Sample records for putative dna-binding response

  1. The DNA Maturation Domain of gpA, the DNA Packaging Motor Protein of Bacteriophage Lambda, Contains an ATPase Site Associated with Endonuclease Activity

    PubMed Central

    Ortega, Marcos E.; Gaussier, Helene; Catalano, Carlos E.

    2007-01-01

    Summary Terminase enzymes are common to double-stranded DNA (dsDNA) viruses and are responsible for packaging viral DNA into the confines of an empty capsid shell. In bacteriophage lambda the catalytic terminase subunit is gpA, which is responsible for maturation of the genome end prior to packaging and subsequent translocation of the matured DNA into the capsid. DNA packaging requires an ATPase catalytic site situated in the N-terminus of the protein. A second ATPase catalytic site associated with the DNA maturation activities of the protein has been proposed; however, direct demonstration of this putative second site is lacking. Here we describe biochemical studies that define protease-resistant peptides of gpA and expression of these putative domains in E. coli. Biochemical characterization of gpA-ΔN179, a construct in which the N-terminal 179 residues of gpA have been deleted, indicates that this protein encompasses the DNA maturation domain of gpA. The construct is folded, soluble and possesses an ATP-dependent nuclease activity. Moreover, the construct binds and hydrolyzes ATP despite the fact that the DNA packaging ATPase site in the N-terminus of gpA has been deleted. Mutation of lysine 497, which alters the conserved lysine in a predicted Walker A “P-loop” sequence, does not affect ATP binding but severely impairs ATP hydrolysis. Further, this mutation abrogates the ATP-dependent nuclease activity of the protein. These studies provide direct evidence for the elusive nucleotide-binding site in gpA that is directly associated with the DNA maturation activity of the protein. The implications of these results with respect to the two roles of the terminase holoenzyme – DNA maturation and DNA packaging – are discussed. PMID:17870092

  2. Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

    PubMed

    Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

    2016-10-24

    DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum

    DOE PAGES

    Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...

    2017-06-24

    In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less

  4. A variable DNA recognition site organization establishes the LiaR-mediated cell envelope stress response of enterococci to daptomycin

    DOE PAGES

    Davlieva, Milya; Shi, Yiwen; Leonard, Paul G.; ...

    2015-04-19

    LiaR is a ‘master regulator’ of the cell envelope stress response in enterococci and many other Gram-positive organisms. Mutations to liaR can lead to antibiotic resistance to a variety of antibiotics including the cyclic lipopeptide daptomycin. LiaR is phosphorylated in response to membrane stress to regulate downstream target operons. Using DNA footprinting of the regions upstream of the liaXYZ and liaFSR operons we show that LiaR binds an extended stretch of DNA that extends beyond the proposed canonical consensus sequence suggesting a more complex level of regulatory control of target operons. We go on to determine the biochemical and structuralmore » basis for increased resistance to daptomycin by the adaptive mutation to LiaR (D191N) first identified from the pathogen Enterococcus faecalis S613. LiaR D191N increases oligomerization of LiaR to form a constitutively activated tetramer that has high affinity for DNA even in the absence of phosphorylation leading to increased resistance. The crystal structures of the LiaR DNA binding domain complexed to the putative consensus sequence as well as an adjoining secondary sequence show that upon binding, LiaR induces DNA bending that is consistent with increased recruitment of RNA polymerase to the transcription start site and upregulation of target operons.« less

  5. BPF-1, a pathogen-induced DNA-binding protein involved in the plant defense response.

    PubMed

    da Costa e Silva, O; Klein, L; Schmelzer, E; Trezzini, G F; Hahlbrock, K

    1993-07-01

    The mechanisms by which plants restrict the growth of pathogens include transient activation of numerous defense-related genes. Box P is a putative cis-acting element of a distinct group of such genes, including those encoding the enzyme phenylalanine ammonialyase (PAL). A DNA-binding activity to Box P was identified in nuclear extracts from cultured parsley cells and a cDNA encoding the protein BPF-1 (Box P-binding Factor) partially characterized. BPF-1 binds to this element with specificity similar to that of the binding activity in nuclear extracts. BPF-1 mRNA accumulates rapidly in elicitor-treated parsley cells and around fungal infection sites on parsley leaves. This accumulation is, at least partly, due to a rapid and transient increase in the transcription rate of BPF-1. Moreover, tight correlation between the relative amounts of BPF-1 and PAL mRNAs was observed in different organs of a parsley plant. These results are consistent with the hypothesis that BPF-1 is involved in disease resistance by modulating plant defense gene expression.

  6. Non-B-DNA structures on the interferon-beta promoter?

    PubMed

    Robbe, K; Bonnefoy, E

    1998-01-01

    The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

  7. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    PubMed

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  8. Characteristics of functional enrichment and gene expression level of human putative transcriptional target genes.

    PubMed

    Osato, Naoki

    2018-01-19

    Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional enrichments were related to the cellular functions. The normalized number of functional enrichments of human putative transcriptional target genes changed according to the criteria of enhancer-promoter assignments and correlated with the median expression level of the target genes. These analyses and characters of human putative transcriptional target genes would be useful to examine the criteria of enhancer-promoter assignments and to predict the novel mechanisms and factors such as DNA binding proteins and DNA sequences of enhancer-promoter interactions.

  9. Regulation of Sulfur Assimilation Pathways in Burkholderia cenocepacia through Control of Genes by the SsuR Transcription Factor▿

    PubMed Central

    Łochowska, Anna; Iwanicka-Nowicka, Roksana; Zielak, Agata; Modelewska, Anna; Thomas, Mark S.; Hryniewicz, Monika M.

    2011-01-01

    The genome of Burkholderia cenocepacia contains two genes encoding closely related LysR-type transcriptional regulators, CysB and SsuR, involved in control of sulfur assimilation processes. In this study we show that the function of SsuR is essential for the utilization of a number of organic sulfur sources of either environmental or human origin. Among the genes upregulated by SsuR identified here are the tauABC operon encoding a predicted taurine transporter, three tauD-type genes encoding putative taurine dioxygenases, and atsA encoding a putative arylsulfatase. The role of SsuR in expression of these genes/operons was characterized through (i) construction of transcriptional reporter fusions to candidate promoter regions and analysis of their expression in the presence/absence of SsuR and (ii) testing the ability of SsuR to bind SsuR-responsive promoter regions. We also demonstrate that expression of SsuR-activated genes is not repressed in the presence of inorganic sulfate. A more detailed analysis of four SsuR-responsive promoter regions indicated that ∼44 bp of the DNA sequence preceding and/or overlapping the predicted −35 element of such promoters is sufficient for SsuR binding. The DNA sequence homology among SsuR “recognition motifs” at different responsive promoters appears to be limited. PMID:21317335

  10. AmrZ Beta-Sheet Residues Are Essential for DNA Binding and Transcriptional Control of Pseudomonas aeruginosa Virulence Genes ▿ †

    PubMed Central

    Waligora, Elizabeth A.; Ramsey, Deborah M.; Pryor, Edward E.; Lu, Haiping; Hollis, Thomas; Sloan, Gina P.; Deora, Rajendar; Wozniak, Daniel J.

    2010-01-01

    AmrZ is a putative ribbon-helix-helix (RHH) transcriptional regulator. RHH proteins utilize residues within the β-sheet for DNA binding, while the α-helices promote oligomerization. AmrZ is of interest due to its dual roles as a transcriptional activator and as a repressor, regulating genes encoding virulence factors associated with both chronic and acute Pseudomonas aeruginosa infection. In this study, cross-linking revealed that AmrZ forms oligomers in solution but that the amino terminus, containing an unordered region and a β-sheet, were not required for oligomerization. The first 12 unordered residues (extended amino terminus) contributed minimally to DNA binding. Mutagenesis of the AmrZ β-sheet demonstrated that residues 18, 20, and 22 were essential for DNA binding at both activation and repressor sites, suggesting that AmrZ utilizes a similar mechanism for binding to these sites. Mice infected with amrZ mutants exhibited reduced bacterial burden, morbidity, and mortality. Direct in vivo competition assays showed a 5-fold competitive advantage for the wild type over an isogenic amrZ mutant. Finally, the reduced infection phenotype of the amrZ-null strain was similar to that of a strain expressing a DNA-binding-deficient AmrZ variant, indicating that DNA binding and transcriptional regulation by AmrZ is responsible for the in vivo virulence defect. These recent infection data, along with previously identified AmrZ-regulated virulence factors, suggest the necessity of AmrZ transcriptional regulation for optimal virulence during acute infection. PMID:20709902

  11. BuD, a helix–loop–helix DNA-binding domain for genome modification

    PubMed Central

    Stella, Stefano; Molina, Rafael; López-Méndez, Blanca; Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza; Campos-Olivas, Ramon; Duchateau, Phillippe; Montoya, Guillermo

    2014-01-01

    DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing. PMID:25004980

  12. A Venom Gland Extracellular Chitin-Binding-Like Protein from Pupal Endoparasitoid Wasps, Pteromalus Puparum, Selectively Binds Chitin

    USDA-ARS?s Scientific Manuscript database

    Chitin-binding proteins (CBPs) existed in various species and involved in different biology processes. In the present study, we cloned a full length cDNA of chitin-binding protein-like (PpCBP-like) from Pteromalus puparum, a pupal endoparasitoid of Pieris rapae. PpCBP-like encoded a 96 putative amin...

  13. A Zn(II)2Cys6 DNA binding protein regulates the sirodesmin PL biosynthetic gene cluster in Leptosphaeria maculans

    PubMed Central

    Fox, Ellen M.; Gardiner, Donald M.; Keller, Nancy P.; Howlett, Barbara J.

    2008-01-01

    A gene, sirZ, encoding a Zn(II)2Cys6 DNA binding protein is present in a cluster of genes responsible for the biosynthesis of the epipolythiodioxopiperazine (ETP) toxin, sirodesmin PL in the ascomycete plant pathogen, Leptosphaeria maculans. RNA-mediated silencing of sirZ gives rise to transformants that produce only residual amounts of sirodesmin PL and display a decrease in the transcription of several sirodesmin PL biosynthetic genes. This indicates that SirZ is a major regulator of this gene cluster. Proteins similar to SirZ are encoded in the gliotoxin biosynthetic gene cluster of Aspergillus fumigatus (gliZ) and in an ETP-like cluster in Penicillium lilacinoechinulatum (PlgliZ). Despite its high level of sequence similarity to gliZ, PlgliZ is unable to complement the gliotoxin-deficiency of a mutant of gliZ in A. fumigatus. Putative binding sites for these regulatory proteins in the promoters of genes in these clusters were predicted using bioinformatic analysis. These sites are similar to those commonly bound by other proteins with Zn(II)2Cys6 DNA binding domains. PMID:18023597

  14. Vitamin D receptor displays DNA binding and transactivation as a heterodimer with the retinoid X receptor, but not with the thyroid hormone receptor.

    PubMed

    Thompson, P D; Hsieh, J C; Whitfield, G K; Haussler, C A; Jurutka, P W; Galligan, M A; Tillman, J B; Spindler, S R; Haussler, M R

    1999-12-01

    The vitamin D receptor (VDR) is a transcription factor believed to function as a heterodimer with the retinoid X receptor (RXR). However, it was reported [Schräder et al., 1994] that, on putative vitamin D response elements (VDREs) within the rat 9k and mouse 28k calcium binding protein genes (rCaBP 9k and mCaBP 28k), VDR and thyroid hormone receptor (TR) form heterodimers that transactivate in response to both 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) and triiodothyronine (T(3)). We, therefore, examined associations of these receptors on the putative rCaBP 9k and mCaBP 28k VDREs, as well as on established VDREs from the rat osteocalcin (rOC) and mouse osteopontin (mOP) genes, plus the thyroid hormone response element (TRE) from the rat myosin heavy chain (rMHC) gene. In gel mobility shift assays, we found no evidence for VDR-TR heterodimer interaction with any tested element. Further, employing these hormone response elements linked to reporter genes in transfected cells, VDR and TR mediated responses to their cognate ligands only from the rOC/mOP and rMHC elements, respectively, while the CaBP elements were unresponsive to any combination of ligand(s). Utilizing the rOC and mOP VDREs, two distinct repressive actions of TR on VDR-mediated signaling were demonstrated: a T(3)-independent action, presumably via direct TR-RXR competition for DNA binding, and a T(3)-dependent repression, likely by diversion of limiting RXR from VDR-RXR toward the formation of TR-RXR heterodimers. The relative importance of these two mechanisms differed in a response element-specific manner. These results may provide a partial explanation for the observed association between hyperthyroidism and bone demineralization/osteoporosis. Copyright 1999 Wiley-Liss, Inc.

  15. Heat Shock Response of Archaeoglobus fulgidus†

    PubMed Central

    Rohlin, Lars; Trent, Jonathan D.; Salmon, Kirsty; Kim, Unmi; Gunsalus, Robert P.; Liao, James C.

    2005-01-01

    The heat shock response of the hyperthermophilic archaeon Archaeoglobus fulgidus strain VC-16 was studied using whole-genome microarrays. On the basis of the resulting expression profiles, approximately 350 of the 2,410 open reading frames (ORFs) (ca. 14%) exhibited increased or decreased transcript abundance. These span a range of cell functions, including energy production, amino acid metabolism, and signal transduction, where the majority are uncharacterized. One ORF called AF1298 was identified that contains a putative helix-turn-helix DNA binding motif. The gene product, HSR1, was expressed and purified from Escherichia coli and was used to characterize specific DNA recognition regions upstream of two A. fulgidus genes, AF1298 and AF1971. The results indicate that AF1298 is autoregulated and is part of an operon with two downstream genes that encode a small heat shock protein, Hsp20, and cdc48, an AAA+ ATPase. The DNase I footprints using HSR1 suggest the presence of a cis-binding motif upstream of AF1298 consisting of CTAAC-N5-GTTAG. Since AF1298 is negatively regulated in response to heat shock and encodes a protein only distantly related to the N-terminal DNA binding domain of Phr of Pyrococcus furiosus, these results suggest that HSR1 and Phr may belong to an evolutionarily diverse protein family involved in heat shock regulation in hyperthermophilic and mesophilic Archaea organisms. PMID:16109946

  16. Leptospira interrogans serovar copenhageni harbors two lexA genes involved in SOS response.

    PubMed

    Fonseca, Luciane S; da Silva, Josefa B; Milanez, Juliana S; Monteiro-Vitorello, Claudia B; Momo, Leonardo; de Morais, Zenaide M; Vasconcellos, Silvio A; Marques, Marilis V; Ho, Paulo L; da Costa, Renata M A

    2013-01-01

    Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2) one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence.

  17. Leptospira interrogans serovar Copenhageni Harbors Two lexA Genes Involved in SOS Response

    PubMed Central

    Fonseca, Luciane S.; da Silva, Josefa B.; Milanez, Juliana S.; Monteiro-Vitorello, Claudia B.; Momo, Leonardo; de Morais, Zenaide M.; Vasconcellos, Silvio A.; Marques, Marilis V.; Ho, Paulo L.; da Costa, Renata M. A.

    2013-01-01

    Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2) one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN 10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence. PMID:24098496

  18. Interactions of the SAP Domain of Human Ku70 with DNA Substrate: A Molecular Dynamics Study

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Carra, Claudio; Huff, Janice; Pluth, Janice M.; Cucinotta, Francis A.

    2007-01-01

    NASA is developing a systems biology approach to improve the assessment of health risks associated with space radiation. The primary toxic and mutagenic lesion following radiation exposure is the DNA double strand break (DSB), thus a model incorporating proteins and pathways important in response and repair of this lesion is critical. One key protein heterodimer for systems models of radiation effects is the Ku70/80 complex. The Ku70/80 complex is important in the initial binding of DSB ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. The SAP domain of Ku70 (residues 556-609), contains an a helix-extended strand-helix motif and similar motifs have been found in other nucleic acid-binding proteins critical for DNA repair. However, the exact mechanism of damage recognition and substrate specificity for the Ku heterodimer remains unclear in part due to the absence of a high-resolution structure of the SAP/DNA complex. We performed a series of molecular dynamics (MD) simulations on a system with the SAP domain of Ku70 and a 10 base pairs DNA duplex. Large-scale conformational changes were observed and some putative binding modes were suggested based on energetic analysis. These modes are consistent with previous experimental investigations. In addition, the results indicate that cooperation of SAP with other domains of Ku70/80 is necessary to explain the high affinity of binding as observed in experiments.

  19. Zuotin, a putative Z-DNA binding protein in Saccharomyces cerevisiae

    NASA Technical Reports Server (NTRS)

    Zhang, S.; Lockshin, C.; Herbert, A.; Winter, E.; Rich, A.

    1992-01-01

    A putative Z-DNA binding protein, named zuotin, was purified from a yeast nuclear extract by means of a Z-DNA binding assay using [32P]poly(dG-m5dC) and [32P]oligo(dG-Br5dC)22 in the presence of B-DNA competitor. Poly(dG-Br5dC) in the Z-form competed well for the binding of a zuotin containing fraction, but salmon sperm DNA, poly(dG-dC) and poly(dA-dT) were not effective. Negatively supercoiled plasmid pUC19 did not compete, whereas an otherwise identical plasmid pUC19(CG), which contained a (dG-dC)7 segment in the Z-form was an excellent competitor. A Southwestern blot using [32P]poly(dG-m5dC) as a probe in the presence of MgCl2 identified a protein having a molecular weight of 51 kDa. The 51 kDa zuotin was partially sequenced at the N-terminal and the gene, ZUO1, was cloned, sequenced and expressed in Escherichia coli; the expressed zuotin showed similar Z-DNA binding activity, but with lower affinity than zuotin that had been partially purified from yeast. Zuotin was deduced to have a number of potential phosphorylation sites including two CDC28 (homologous to the human and Schizosaccharomyces pombe cdc2) phosphorylation sites. The hexapeptide motif KYHPDK was found in zuotin as well as in several yeast proteins, DnaJ of E.coli, csp29 and csp32 proteins of Drosophila and the small t and large T antigens of the polyoma virus. A 60 amino acid segment of zuotin has similarity to several histone H1 sequences. Disruption of ZUO1 in yeast resulted in a slow growth phenotype.

  20. Evidence for hSNM1B/Apollo functioning in the HSP70 mediated DNA damage response.

    PubMed

    Anders, Marco; Mattow, Jens; Digweed, Martin; Demuth, Ilja

    2009-06-01

    The hSNM1B/Apollo protein is involved in the cellular response to DNA-damage as well as in the maintenance of telomeres during S-phase. TRF2 has been shown to interact physically with hSNM1B. As a core component of shelterin, TRF2 functions in organization and protection of telomeres. However, TRF2 was also shown to have a role in the early DNA-damage response, suggesting that hSNM1B and TRF2 cooperate in this dual function. Here we have used Tandem-Affinity-Purification in combination with mass spectrometry to identify additional binding partners of hSNM1B. This revealed HSC70, HSP72, HSP60 and beta-Tubulin to be hSNM1B-interactors. We have confirmed the interaction of hSNM1B and HSP70 in co-immunoprecipitation assays and found that hSNM1B binds to a C-terminal fragment of HSP72, known to contain the substrate binding domain. Depletion of HSP72 in human fibroblasts resulted in a significant reduction of nuclear hSNM1B foci. We also found the phosphorylation of CHK1 at serine 317 to be attenuated in response to UVC irradiation as a consequence of hSNM1B depletion, a result which extends our previous findings on the DNA-damage response function of hSNM1B. HSP70 chaperones have been implicated in the maintenance of genome stability and their expression is often aberrant in cancer. Our results presented here, suggest that the role in genome stability might not be specific to HSP70 but rather can be attributed, at least in part, to hSNM1B. This, together with its stimulating effect on ATM and ATR substrate phosphorylation in response to DNA-damage qualify hSNM1B as a putative target in cancer therapy.

  1. Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes.

    PubMed

    Noh, Ju Young; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Seo, Gi Won; Kim, Dong Hyun; Patnaik, Hongray Howrelia; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Han, Yeon Soo

    2014-01-25

    Apolipophorin III (apoLp-III) is a well-known hemolymph protein having a functional role in lipid transport and immune response of insects. We cloned full-length cDNA encoding putative apoLp-III from larvae of the coleopteran beetle, Tenebrio molitor (TmapoLp-III), by identification of clones corresponding to the partial sequence of TmapoLp-III, subsequently followed with full length sequencing by a clone-by-clone primer walking method. The complete cDNA consists of 890 nucleotides, including an ORF encoding 196 amino acid residues. Excluding a putative signal peptide of the first 20 amino acid residues, the 176-residue mature apoLp-III has a calculated molecular mass of 19,146Da. Genomic sequence analysis with respect to its cDNA showed that TmapoLp-III was organized into four exons interrupted by three introns. Several immune-related transcription factor binding sites were discovered in the putative 5'-flanking region. BLAST and phylogenetic analyses reveal that TmapoLp-III has high sequence identity (88%) with Tribolium castaneum apoLp-III but shares little sequence homologies (<26%) with other apoLp-IIIs. Homology modeling of Tm apoLp-III shows a bundle of five amphipathic alpha helices, including a short helix 3'. The 'helix-short helix-helix' motif was predicted to be implicated in lipid binding interactions, through reversible conformational changes and accommodating the hydrophobic residues to the exterior for stability. Highest level of TmapoLp-III mRNA was detected at late pupal stages, albeit it is expressed in the larval and adult stages at lower levels. The tissue specific expression of the transcripts showed significantly higher numbers in larval fat body and adult integument. In addition, TmapoLp-III mRNA was found to be highly upregulated in late stages of L. monocytogenes or E. coli challenge. These results indicate that TmapoLp-III may play an important role in innate immune responses against bacterial pathogens in T. molitor. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Genome-wide survey of DNA-binding proteins in Arabidopsis thaliana: analysis of distribution and functions.

    PubMed

    Malhotra, Sony; Sowdhamini, Ramanathan

    2013-08-01

    The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.

  3. Mutations in the Putative Zinc-Binding Motif of UL52 Demonstrate a Complex Interdependence between the UL5 and UL52 Subunits of the Human Herpes Simplex Virus Type 1 Helicase/Primase Complex

    PubMed Central

    Chen, Yan; Carrington-Lawrence, Stacy D.; Bai, Ping; Weller, Sandra K.

    2005-01-01

    Herpes simplex virus type 1 (HSV-1) encodes a heterotrimeric helicase-primase (UL5/8/52) complex. UL5 contains seven motifs found in helicase superfamily 1, and UL52 contains conserved motifs found in primases. The contributions of each subunit to the biochemical activities of the complex, however, remain unclear. We have previously demonstrated that a mutation in the putative zinc finger at UL52 C terminus abrogates not only primase but also ATPase, helicase, and DNA-binding activities of a UL5/UL52 subcomplex, indicating a complex interdependence between the two subunits. To test this hypothesis and to further investigate the role of the zinc finger in the enzymatic activities of the helicase-primase, a series of mutations were constructed in this motif. They differed in their ability to complement a UL52 null virus: totally defective, partial complementation, and potentiating. In this study, four of these mutants were studied biochemically after expression and purification from insect cells infected with recombinant baculoviruses. All mutants show greatly reduced primase activity. Complementation-defective mutants exhibited severe defects in ATPase, helicase, and DNA-binding activities. Partially complementing mutants displayed intermediate levels of these activities, except that one showed a wild-type level of helicase activity. These data suggest that the UL52 zinc finger motif plays an important role in the activities of the helicase-primase complex. The observation that mutations in UL52 affected helicase, ATPase, and DNA-binding activities indicates that UL52 binding to DNA via the zinc finger may be necessary for loading UL5. Alternatively, UL5 and UL52 may share a DNA-binding interface. PMID:15994803

  4. Mutations in the putative zinc-binding motif of UL52 demonstrate a complex interdependence between the UL5 and UL52 subunits of the human herpes simplex virus type 1 helicase/primase complex.

    PubMed

    Chen, Yan; Carrington-Lawrence, Stacy D; Bai, Ping; Weller, Sandra K

    2005-07-01

    Herpes simplex virus type 1 (HSV-1) encodes a heterotrimeric helicase-primase (UL5/8/52) complex. UL5 contains seven motifs found in helicase superfamily 1, and UL52 contains conserved motifs found in primases. The contributions of each subunit to the biochemical activities of the complex, however, remain unclear. We have previously demonstrated that a mutation in the putative zinc finger at UL52 C terminus abrogates not only primase but also ATPase, helicase, and DNA-binding activities of a UL5/UL52 subcomplex, indicating a complex interdependence between the two subunits. To test this hypothesis and to further investigate the role of the zinc finger in the enzymatic activities of the helicase-primase, a series of mutations were constructed in this motif. They differed in their ability to complement a UL52 null virus: totally defective, partial complementation, and potentiating. In this study, four of these mutants were studied biochemically after expression and purification from insect cells infected with recombinant baculoviruses. All mutants show greatly reduced primase activity. Complementation-defective mutants exhibited severe defects in ATPase, helicase, and DNA-binding activities. Partially complementing mutants displayed intermediate levels of these activities, except that one showed a wild-type level of helicase activity. These data suggest that the UL52 zinc finger motif plays an important role in the activities of the helicase-primase complex. The observation that mutations in UL52 affected helicase, ATPase, and DNA-binding activities indicates that UL52 binding to DNA via the zinc finger may be necessary for loading UL5. Alternatively, UL5 and UL52 may share a DNA-binding interface.

  5. Diversification, phylogeny and evolution of auxin response factor (ARF) family: insights gained from analyzing maize ARF genes.

    PubMed

    Wang, Yijun; Deng, Dexiang; Shi, Yating; Miao, Nan; Bian, Yunlong; Yin, Zhitong

    2012-03-01

    Auxin response factors (ARFs), member of the plant-specific B3 DNA binding superfamily, target specifically to auxin response elements (AuxREs) in promoters of primary auxin-responsive genes and heterodimerize with Aux/IAA proteins in auxin signaling transduction cascade. In previous research, we have isolated and characterized maize Aux/IAA genes in whole-genome scale. Here, we report the comprehensive analysis of ARF genes in maize. A total of 36 ARF genes were identified and validated from the B73 maize genome through an iterative strategy. Thirty-six maize ARF genes are distributed in all maize chromosomes except chromosome 7. Maize ARF genes expansion is mainly due to recent segmental duplications. Maize ARF proteins share one B3 DNA binding domain which consists of seven-stranded β sheets and two short α helixes. Twelve maize ARFs with glutamine-rich middle regions could be as activators in modulating expression of auxin-responsive genes. Eleven maize ARF proteins are lack of homo- and heterodimerization domains. Putative cis-elements involved in phytohormones and light signaling responses, biotic and abiotic stress adaption locate in promoters of maize ARF genes. Expression patterns vary greatly between clades and sister pairs of maize ARF genes. The B3 DNA binding and auxin response factor domains of maize ARF proteins are primarily subjected to negative selection during selective sweep. The mixed selective forces drive the diversification and evolution of genomic regions outside of B3 and ARF domains. Additionally, the dicot-specific proliferation of ARF genes was detected. Comparative genomics analysis indicated that maize, sorghum and rice duplicate chromosomal blocks containing ARF homologs are highly syntenic. This study provides insights into the distribution, phylogeny and evolution of ARF gene family.

  6. Exercise training alters DNA methylation patterns in genes related to muscle growth and differentiation in mice.

    PubMed

    Kanzleiter, Timo; Jähnert, Markus; Schulze, Gunnar; Selbig, Joachim; Hallahan, Nicole; Schwenk, Robert Wolfgang; Schürmann, Annette

    2015-05-15

    The adaptive response of skeletal muscle to exercise training is tightly controlled and therefore requires transcriptional regulation. DNA methylation is an epigenetic mechanism known to modulate gene expression, but its contribution to exercise-induced adaptations in skeletal muscle is not well studied. Here, we describe a genome-wide analysis of DNA methylation in muscle of trained mice (n = 3). Compared with sedentary controls, 2,762 genes exhibited differentially methylated CpGs (P < 0.05, meth diff >5%, coverage >10) in their putative promoter regions. Alignment with gene expression data (n = 6) revealed 200 genes with a negative correlation between methylation and expression changes in response to exercise training. The majority of these genes were related to muscle growth and differentiation, and a minor fraction involved in metabolic regulation. Among the candidates were genes that regulate the expression of myogenic regulatory factors (Plexin A2) as well as genes that participate in muscle hypertrophy (Igfbp4) and motor neuron innervation (Dok7). Interestingly, a transcription factor binding site enrichment study discovered significantly enriched occurrence of CpG methylation in the binding sites of the myogenic regulatory factors MyoD and myogenin. These findings suggest that DNA methylation is involved in the regulation of muscle adaptation to regular exercise training. Copyright © 2015 the American Physiological Society.

  7. Characterization of the response to zinc deficiency in the cyanobacterium Anabaena sp. strain PCC 7120.

    PubMed

    Napolitano, Mauro; Rubio, Miguel Ángel; Santamaría-Gómez, Javier; Olmedo-Verd, Elvira; Robinson, Nigel J; Luque, Ignacio

    2012-05-01

    Zur regulators control zinc homeostasis by repressing target genes under zinc-sufficient conditions in a wide variety of bacteria. This paper describes how part of a survey of duplicated genes led to the identification of the open reading frame all2473 as the gene encoding the Zur regulator of the cyanobacterium Anabaena sp. strain PCC 7120. All2473 binds to DNA in a zinc-dependent manner, and its DNA-binding sequence was characterized, which allowed us to determine the relative contribution of particular nucleotides to Zur binding. A zur mutant was found to be impaired in the regulation of zinc homeostasis, showing sensitivity to elevated concentrations of zinc but not other metals. In an effort to characterize the Zur regulon in Anabaena, 23 genes containing upstream putative Zur-binding sequences were identified and found to be regulated by Zur. These genes are organized in six single transcriptional units and six operons, some of them containing multiple Zur-regulated promoters. The identities of genes of the Zur regulon indicate that Anabaena adapts to conditions of zinc deficiency by replacing zinc metalloproteins with paralogues that fulfill the same function but presumably with a lower zinc demand, and with inducing putative metallochaperones and membrane transport systems likely being involved in the scavenging of extracellular zinc, including plasma membrane ABC transport systems and outer membrane TonB-dependent receptors. Among the Zur-regulated genes, the ones showing the highest induction level encode proteins of the outer membrane, suggesting a primary role for components of this cell compartment in the capture of zinc cations from the extracellular medium.

  8. Characterization of differential ripening pattern in association with ethylene biosynthesis in the fruits of five naturally occurring banana cultivars and detection of a GCC-box-specific DNA-binding protein.

    PubMed

    Choudhury, Swarup Roy; Roy, Sujit; Saha, Progya Paramita; Singh, Sanjay Kumar; Sengupta, Dibyendu N

    2008-07-01

    MA-ACS1 and MA-ACO1 are the two major ripening genes in banana and play crucial role in the regulation of ethylene production during ripening. Here, we report a comparative ripening pattern in five different naturally occurring banana cultivars namely Cavendish (AAA), Rasthali (AAB), Kanthali (AB), Poovan (AAB) and Monthan (ABB), which have distinct genome composition. We found a distinct variation in the climacteric ethylene production and in-vivo ACC oxidase activity level during the ripening stages in the five cultivars. We identified the cDNAs for MA-ACS1 and MA-ACO1 from the five cultivars and studied the transcript accumulation patterns of the two genes, which correlated well with the differential timing in the expression of these two genes during ripening. The GCC-box is one of the ethylene-responsive elements (EREs) found in the promoters of many ethylene-inducible genes. We have identified a GCC-box motif (putative ERE) in the promoters of MA-ACS1 and MA-ACO1 in banana cultivars. DNA-protein interaction studies revealed the presence of a GCC-box-specific DNA-binding activity in the fruit nuclear extract and such DNA-binding activity was enhanced following ethylene treatment. South-Western blotting revealed a 25-kDa nuclear protein that binds specifically to GCC-box DNA in the climacteric banana fruit. Together, these results indicate the probable involvement of the GCC-box motif as the cis-acting ERE in the regulation of MA-ACS1 and MA-ACO1 during ripening in banana fruits via binding of specific ERE-binding protein.

  9. Structural Insights into the Quadruplex-Duplex 3' Interface Formed from a Telomeric Repeat: A Potential Molecular Target.

    PubMed

    Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N

    2016-02-03

    We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.

  10. The Zur regulon of Corynebacterium glutamicum ATCC 13032

    PubMed Central

    2010-01-01

    Background Zinc is considered as an essential element for all living organisms, but it can be toxic at large concentrations. Bacteria therefore tightly regulate zinc metabolism. The Cg2502 protein of Corynebacterium glutamicum was a candidate to control zinc metabolism in this species, since it was classified as metalloregulator of the zinc uptake regulator (Zur) subgroup of the ferric uptake regulator (Fur) family of DNA-binding transcription regulators. Results The cg2502 (zur) gene was deleted in the chromosome of C. glutamicum ATCC 13032 by an allelic exchange procedure to generate the zur-deficient mutant C. glutamicum JS2502. Whole-genome DNA microarray hybridizations and real-time RT-PCR assays comparing the gene expression in C. glutamicum JS2502 with that of the wild-type strain detected 18 genes with enhanced expression in the zur mutant. The expression data were combined with results from cross-genome comparisons of shared regulatory sites, revealing the presence of candidate Zur-binding sites in the mapped promoter regions of five transcription units encoding components of potential zinc ABC-type transporters (cg0041-cg0042/cg0043; cg2911-cg2912-cg2913), a putative secreted protein (cg0040), a putative oxidoreductase (cg0795), and a putative P-loop GTPase of the COG0523 protein family (cg0794). Enhanced transcript levels of the respective genes in C. glutamicum JS2502 were verified by real-time RT-PCR, and complementation of the mutant with a wild-type zur gene reversed the effect of differential gene expression. The zinc-dependent expression of the putative cg0042 and cg2911 operons was detected in vivo with a gfp reporter system. Moreover, the zinc-dependent binding of purified Zur protein to double-stranded 40-mer oligonucleotides containing candidate Zur-binding sites was demonstrated in vitro by DNA band shift assays. Conclusion Whole-genome expression profiling and DNA band shift assays demonstrated that Zur directly represses in a zinc-dependent manner the expression of nine genes organized in five transcription units. Accordingly, the Zur (Cg2502) protein is the key transcription regulator for genes involved in zinc homeostasis in C. glutamicum. PMID:20055984

  11. Regulation of the Myxococcus xanthus C-Signal-Dependent Ω4400 Promoter by the Essential Developmental Protein FruA

    PubMed Central

    Yoder-Himes, Deborah R.; Kroos, Lee

    2006-01-01

    The bacterium Myxococcus xanthus employs extracellular signals to coordinate aggregation and sporulation during multicellular development. Extracellular, contact-dependent signaling that involves the CsgA protein (called C-signaling) activates FruA, a putative response regulator that governs a branched signaling pathway inside cells. One branch regulates cell movement, leading to aggregation. The other branch regulates gene expression, leading to sporulation. C-signaling is required for full expression of most genes induced after 6 h into development, including the gene identified by Tn5 lac insertion Ω4400. To determine if FruA is a direct regulator of Ω4400 transcription, a combination of in vivo and in vitro experiments was performed. Ω4400 expression was abolished in a fruA mutant. The DNA-binding domain of FruA bound specifically to DNA upstream of the promoter −35 region in vitro. Mutations between bp −86 and −77 greatly reduced binding. One of these mutations had been shown previously to reduce Ω4400 expression in vivo and make it independent of C-signaling. For the first time, chromatin immunoprecipitation (ChIP) experiments were performed on M. xanthus. The ChIP experiments demonstrated that FruA is associated with the Ω4400 promoter region late in development, even in the absence of C-signaling. Based on these results, we propose that FruA directly activates Ω4400 transcription to a moderate level prior to C-signaling and, in response to C-signaling, binds near bp −80 and activates transcription to a higher level. Also, the highly localized effects of mutations between bp −86 and −77 on DNA binding in vitro, together with recently published footprints, allow us to predict a consensus binding site of GTCG/CGA/G for the FruA DNA-binding domain. PMID:16816188

  12. Interrelations of secondary structure stability and DNA-binding affinity in the bacteriophage SPO1-encoded type II DNA-binding protein TF1.

    PubMed

    Andera, L; Spangler, C J; Galeone, A; Mayol, L; Geiduschek, E P

    1994-02-11

    TF1, a homodimeric DNA-binding and -bending protein with a preference for hydroxymethyluracil-containing DNA is the Bacillus subtilis-encoded homolog of the bacterial HU proteins and of the E. coli integration host factor. A temperature-sensitive mutation at amino acid 25 of TF1 (L25-->A) and two intragenic second site revertants at amino acids 15 (E15-->G) and 32 (L32-->I) were previously identified and their effects on virus development were examined. The DNA-binding properties of these proteins and the thermal stability of their secondary structures have now been analyzed. Amino acids 15 and 32 are far removed from the putative DNA-binding domains of TF1 but changes there exert striking effects on DNA affinity that correlate with effects on structure. The double mutant protein TF1-G15I32 binds to a preferred site in hydroxymethyluracil-containing DNA 40 times more tightly, denatures at higher temperature (delta tm = 21 degrees C), and also exchanges subunits much more slowly than does the wild-type protein. The L25-->A mutation makes TF1 secondary structure and DNA-binding highly salt concentration-dependent. The E15-->G mutation partly suppresses this effect: secondary structure of TF1-A25G15 is restored at 21 degrees C by 1 M NaCl or, at low NaCl concentration, by binding to DNA.

  13. New insight into multifunctional role of peroxiredoxin family protein: Determination of DNA protection properties of bacterioferritin comigratory protein under hyperthermal and oxidative stresses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr; Chung, Jeong Min; Yun, Hyung Joong

    Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stressmore » by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.« less

  14. Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.

    2010-11-05

    Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened ormore » eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.« less

  15. Interaction of the putative tyrosine recombinases RipX (UU145), XerC (UU222), and CodV (UU529) of Ureaplasma parvum serovar 3 with specific DNA

    PubMed Central

    Zimmerman, Carl-Ulrich R; Rosengarten, Renate; Spergser, Joachim

    2013-01-01

    Phase variation of two loci (‘mba locus’ and ‘UU172 phase-variable element’) in Ureaplasma parvum serovar 3 has been suggested as result of site-specific DNA inversion occurring at short inverted repeats. Three potential tyrosine recombinases (RipX, XerC, and CodV encoded by the genes UU145, UU222, and UU529) have been annotated in the genome of U. parvum serovar 3, which could be mediators in the proposed recombination event. We document that only orthologs of the gene xerC are present in all strains that show phase variation in the two loci. We demonstrate in vitro binding of recombinant maltose-binding protein fusions of XerC to the inverted repeats of the phase-variable loci, of RipX to a direct repeat that flanks a 20-kbp region, which has been proposed as putative pathogenicity island, and of CodV to a putative dif site. Co-transformation of the model organism Mycoplasma pneumoniae M129 with both the ‘mba locus’ and the recombinase gene xerC behind an active promoter region resulted in DNA inversion in the ‘mba locus’. Results suggest that XerC of U. parvum serovar 3 is a mediator in the proposed DNA inversion event of the two phase-variable loci. PMID:23305333

  16. DNA-binding by Haemophilus influenzae and Escherichia coli YbaB, members of a widely-distributed bacterial protein family.

    PubMed

    Cooley, Anne E; Riley, Sean P; Kral, Keith; Miller, M Clarke; DeMoll, Edward; Fried, Michael G; Stevenson, Brian

    2009-07-13

    Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.

  17. Structure of the SANT domain from the Xenopus chromatin remodeling factor ISWI

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Horton, John R.; Elgar, Stuart J.; Khan, Seema I.

    2008-09-17

    The SANT (Swi3, Ada2, N-Cor, and TFIIIB) module was first described as a putative DNA-binding domain with strong similarity to the helix-turn-helix DNA binding domain of Myb-related proteins. The X-ray structure of the C-terminal one third portion of the ATPase ISWI of Drosophila melangoaster, containing both SANT and SLIDE (SANT-Like ISWI Domain), confirmed the overall helix-turn-helix structural architecture of SANT as well as SLIDE. However, the DNA-contacting residues in Myb are not conserved in SANT and the structurally corresponding residues in the ISWI SANT domain are acidic, and therefore incompatible with DNA interaction. Recent studies suggested that SANT domains mightmore » be a histone-tail-binding module, including the DNA binding SANT domain of c-Myb. Here they present the X-ray structure of Xenopus laevis ISWI SANT domain, derived from limited proteolysis of a C-terminal fragment of ISWI protein.« less

  18. Beyond the binding site: in vivo identification of tbx2, smarca5 and wnt5b as molecular targets of CNBP during embryonic development.

    PubMed

    Armas, Pablo; Margarit, Ezequiel; Mouguelar, Valeria S; Allende, Miguel L; Calcaterra, Nora B

    2013-01-01

    CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates.

  19. Beyond the Binding Site: In Vivo Identification of tbx2, smarca5 and wnt5b as Molecular Targets of CNBP during Embryonic Development

    PubMed Central

    Mouguelar, Valeria S.; Allende, Miguel L.; Calcaterra, Nora B.

    2013-01-01

    CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates. PMID:23667590

  20. Structure and mechanism of the phage T4 recombination mediator protein UvsY

    DOE PAGES

    Gajewski, Stefan; Waddell, Michael Brett; Vaithiyalingam, Sivaraja; ...

    2016-03-07

    The UvsY recombination mediator protein is critical for efficient homologous recombination in bacteriophage T4 and is the functional analog of the eukaryotic Rad52 protein. During T4 homologous recombination, the UvsX recombinase has to compete with the prebound gp32 single-stranded binding protein for DNA-binding sites and UvsY stimulates this filament nucleation event. We report here the crystal structure of UvsY in four similar open-barrel heptameric assemblies and provide structural and biophysical insights into its function. The UvsY heptamer was confirmed in solution by centrifugation and light scattering, and thermodynamic analyses revealed that the UvsY–ssDNA interaction occurs within the assembly via twomore » distinct binding modes. Using surface plasmon resonance, we also examined the binding of UvsY to both ssDNA and the ssDNA–gp32 complex. These analyses confirmed that ssDNA can bind UvsY and gp32 independently and also as a ternary complex. They also showed that residues located on the rim of the heptamer are required for optimal binding to ssDNA, thus identifying the putative ssDNA-binding surface. We propose a model in which UvsY promotes a helical ssDNA conformation that disfavors the binding of gp32 and initiates the assembly of the ssDNA–UvsX filament.« less

  1. Identification and preliminary characterization of a protein motif related to the zinc finger.

    PubMed Central

    Lovering, R; Hanson, I M; Borden, K L; Martin, S; O'Reilly, N J; Evan, G I; Rahman, D; Pappin, D J; Trowsdale, J; Freemont, P S

    1993-01-01

    We have identified a protein motif, related to the zinc finger, which defines a newly discovered family of proteins. The motif was found in the sequence of the human RING1 gene, which is proximal to the major histocompatibility complex region on chromosome six. We propose naming this motif the "RING finger" and it is found in 27 proteins, all of which have putative DNA binding functions. We have synthesized a peptide corresponding to the RING1 motif and examined a number of properties, including metal and DNA binding. We provide evidence to support the suggestion that the RING finger motif is the DNA binding domain of this newly defined family of proteins. Images Fig. 1 Fig. 4 PMID:7681583

  2. The Role of JMY in p53 Regulation.

    PubMed

    Adighibe, Omanma; Pezzella, Francesco

    2018-05-31

    Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.

  3. Functional Domains of the TOL Plasmid Transcription Factor XylS

    PubMed Central

    Kaldalu, Niilo; Toots, Urve; de Lorenzo, Victor; Ustav, Mart

    2000-01-01

    The alkylbenzoate degradation genes of Pseudomonas putida TOL plasmid are positively regulated by XylS, an AraC family protein, in a benzoate-dependent manner. In this study, we used deletion mutants and hybrid proteins to identify which parts of XylS are responsible for the DNA binding, transcriptional activation, and benzoate inducibility. We found that a 112-residue C-terminal fragment of XylS binds specifically to the Pm operator in vitro, protects this sequence from DNase I digestion identically to the wild-type (wt) protein, and activates the Pm promoter in vivo. When overexpressed, that C-terminal fragment could activate transcription as efficiently as wt XylS. All the truncations, which incorporated these 112 C-terminal residues, were able to activate transcription at least to some extent when overproduced. Intactness of the 210-residue N-terminal portion was found to be necessary for benzoate responsiveness of XylS. Deletions in the N-terminal and central regions seriously reduced the activity of XylS and caused the loss of effector control, whereas insertions into the putative interdomain region did not change the basic features of the XylS protein. Our results confirm that XylS consists of two parts which probably interact with each other. The C-terminal domain carries DNA-binding and transcriptional activation abilities, while the N-terminal region carries effector-binding and regulatory functions. PMID:10648539

  4. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    PubMed Central

    Niskanen, Einari A; Hytönen, Vesa P; Grapputo, Alessandro; Nordlund, Henri R; Kulomaa, Markku S; Laitinen, Olli H

    2005-01-01

    Background A chicken egg contains several biotin-binding proteins (BBPs), whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins. PMID:15777476

  5. Construction and analysis of cDNA libraries from the antennae of Batocera horsfieldi and expression pattern of putative odorant binding proteins

    USDA-ARS?s Scientific Manuscript database

    In the natural environment, the longhorned beetle, Batocera horsfieldi (Hope) (Coleoptera: Cerambycidae), finds it’s maturation-feeding and host plants by using chemical cues. In this study, we described the identification and characterization of four new cDNAs that encode Minus-C odorant binding pr...

  6. GBshape: a genome browser database for DNA shape annotations

    PubMed Central

    Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J.; Parker, Stephen C.J.; Nuzhdin, Sergey V.; Tullius, Thomas D.; Rohs, Remo

    2015-01-01

    Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. PMID:25326329

  7. Atomistic Molecular Dynamics Simulations of Mitochondrial DNA Polymerase γ: Novel Mechanisms of Function and Pathogenesis.

    PubMed

    Euro, Liliya; Haapanen, Outi; Róg, Tomasz; Vattulainen, Ilpo; Suomalainen, Anu; Sharma, Vivek

    2017-03-07

    DNA polymerase γ (Pol γ) is a key component of the mitochondrial DNA replisome and an important cause of neurological diseases. Despite the availability of its crystal structures, the molecular mechanism of DNA replication, the switch between polymerase and exonuclease activities, the site of replisomal interactions, and functional effects of patient mutations that do not affect direct catalysis have remained elusive. Here we report the first atomistic classical molecular dynamics simulations of the human Pol γ replicative complex. Our simulation data show that DNA binding triggers remarkable changes in the enzyme structure, including (1) completion of the DNA-binding channel via a dynamic subdomain, which in the apo form blocks the catalytic site, (2) stabilization of the structure through the distal accessory β-subunit, and (3) formation of a putative transient replisome-binding platform in the "intrinsic processivity" subdomain of the enzyme. Our data indicate that noncatalytic mutations may disrupt replisomal interactions, thereby causing Pol γ-associated neurodegenerative disorders.

  8. A novel begomovirus isolated from sida contains putative cis- and trans-acting replication specificity determinants that have evolved independently in several geographical lineages.

    PubMed

    Mauricio-Castillo, J A; Torres-Herrera, S I; Cárdenas-Conejo, Y; Pastor-Palacios, G; Méndez-Lozano, J; Argüello-Astorga, G R

    2014-09-01

    A novel begomovirus isolated from a Sida rhombifolia plant collected in Sinaloa, Mexico, was characterized. The genomic components of sida mosaic Sinaloa virus (SiMSinV) shared highest sequence identity with DNA-A and DNA-B components of chino del tomate virus (CdTV), suggesting a vertical evolutionary relationship between these viruses. However, recombination analysis indicated that a short segment of SiMSinV DNA-A encompassing the plus-strand replication origin and the 5´-proximal 43 codons of the Rep gene was derived from tomato mottle Taino virus (ToMoTV). Accordingly, the putative cis- and trans-acting replication specificity determinants of SiMSinV were identical to those of ToMoTV but differed from those of CdTV. Modeling of the SiMSinV and CdTV Rep proteins revealed significant differences in the region comprising the small β1/β5 sheet element, where five putative DNA-binding specificity determinants (SPDs) of Rep (i.e., amino acid residues 5, 8, 10, 69 and 71) were previously identified. Computer-assisted searches of public databases led to identification of 33 begomoviruses from three continents encoding proteins with SPDs identical to those of the Rep encoded by SiMSinV. Sequence analysis of the replication origins demonstrated that all 33 begomoviruses harbor potential Rep-binding sites identical to those of SiMSinV. These data support the hypothesis that the Rep β1/β5 sheet region determines specificity of this protein for DNA replication origin sequences.

  9. Plant-mediated silencing of the fatty acid- and retinoid-binding Pp-far-1 gene can reduce development of the root lesion nematode, Pratylenchus penetrans

    USDA-ARS?s Scientific Manuscript database

    Pratylenchus penetrans is one of the most important plant-parasitic nematodes and can act as a limiting factor of important agricultural, horticultural and industrial crops. Fatty acid- and retinoid- (FAR) binding proteins are unique to nematodes. The cDNA corresponding to a putative P. penetrans FA...

  10. White collar 2, a partner in blue-light signal transduction, controlling expression of light-regulated genes in Neurospora crassa.

    PubMed Central

    Linden, H; Macino, G

    1997-01-01

    A saturating genetic dissection of 'blind' mutants in Neurospora crassa has identified a total of two non-redundant loci (wc-1 and wc-2) each of which is required for blue-light perception/signal transduction. Previously, we demonstrated that WC1 is a putative zinc finger transcription factor able to bind specifically to a light-regulated promoter. Here, we present the cloning and characterization of the wc-2 gene. We demonstrate using mutation analysis and in vitro DNA-binding assays that WC2, the second partner of this light signal transduction system, encodes a functional zinc finger DNA-binding protein with putative PAS dimerization and transcription activation domains. This molecular genetic dissection of the second of two components of this light signal transduction system has enabled us to devise a model whereby WC1 and WC2 are proposed to interact via homologous PAS domains, bind to promoters of light-regulated genes and activate transcription. As such, this study provides the first insight into two co-operating partners in blue-light signal transduction in any organism and describes the molecular tools with which to dissect this enigmatic process. PMID:9009271

  11. Screening for Protein-DNA Interactions by Automatable DNA-Protein Interaction ELISA

    PubMed Central

    Schüssler, Axel; Kolukisaoglu, H. Üner; Koch, Grit; Wallmeroth, Niklas; Hecker, Andreas; Thurow, Kerstin; Zell, Andreas; Harter, Klaus; Wanke, Dierk

    2013-01-01

    DNA-binding proteins (DBPs), such as transcription factors, constitute about 10% of the protein-coding genes in eukaryotic genomes and play pivotal roles in the regulation of chromatin structure and gene expression by binding to short stretches of DNA. Despite their number and importance, only for a minor portion of DBPs the binding sequence had been disclosed. Methods that allow the de novo identification of DNA-binding motifs of known DBPs, such as protein binding microarray technology or SELEX, are not yet suited for high-throughput and automation. To close this gap, we report an automatable DNA-protein-interaction (DPI)-ELISA screen of an optimized double-stranded DNA (dsDNA) probe library that allows the high-throughput identification of hexanucleotide DNA-binding motifs. In contrast to other methods, this DPI-ELISA screen can be performed manually or with standard laboratory automation. Furthermore, output evaluation does not require extensive computational analysis to derive a binding consensus. We could show that the DPI-ELISA screen disclosed the full spectrum of binding preferences for a given DBP. As an example, AtWRKY11 was used to demonstrate that the automated DPI-ELISA screen revealed the entire range of in vitro binding preferences. In addition, protein extracts of AtbZIP63 and the DNA-binding domain of AtWRKY33 were analyzed, which led to a refinement of their known DNA-binding consensi. Finally, we performed a DPI-ELISA screen to disclose the DNA-binding consensus of a yet uncharacterized putative DBP, AtTIFY1. A palindromic TGATCA-consensus was uncovered and we could show that the GATC-core is compulsory for AtTIFY1 binding. This specific interaction between AtTIFY1 and its DNA-binding motif was confirmed by in vivo plant one-hybrid assays in protoplasts. Thus, the value and applicability of the DPI-ELISA screen for de novo binding site identification of DBPs, also under automatized conditions, is a promising approach for a deeper understanding of gene regulation in any organism of choice. PMID:24146751

  12. Solution structure and interactions of the Escherichia coli cell division activator protein CedA.

    PubMed

    Chen, Ho An; Simpson, Peter; Huyton, Trevor; Roper, David; Matthews, Stephen

    2005-05-10

    CedA is a protein that is postulated to be involved in the regulation of cell division in Escherichia coli and related organisms; however, little biological data about its possible mode of action are available. Here we present a three-dimensional structure of this protein as determined by NMR spectroscopy. The protein is made up of four antiparallel beta-strands, an alpha-helix, and a large unstructured stretch of residues at the N-terminus. It shows structural similarity to a family of DNA-binding proteins which interact with dsDNA via a three-stranded beta-sheet, suggesting that CedA may be a DNA-binding protein. The putative binding surface of CedA is predominantly positively charged with a number of basic residues surrounding a groove largely dominated by aromatic residues. NMR chemical shift perturbations and gel-shift experiments performed with CedA confirm that the protein binds dsDNA, and its interaction is mediated primarily via the beta-sheet.

  13. The interaction of DiaA and DnaA regulates the replication cycle in E. coli by directly promoting ATP–DnaA-specific initiation complexes

    PubMed Central

    Keyamura, Kenji; Fujikawa, Norie; Ishida, Takuma; Ozaki, Shogo; Su’etsugu, Masayuki; Fujimitsu, Kazuyuki; Kagawa, Wataru; Yokoyama, Shigeyuki; Kurumizaka, Hitoshi; Katayama, Tsutomu

    2007-01-01

    Escherichia coli DiaA is a DnaA-binding protein that is required for the timely initiation of chromosomal replication during the cell cycle. In this study, we determined the crystal structure of DiaA at 1.8 Å resolution. DiaA forms a homotetramer consisting of a symmetrical pair of homodimers. Mutational analysis revealed that the DnaA-binding activity and formation of homotetramers are required for the stimulation of initiation by DiaA. DiaA tetramers can bind multiple DnaA molecules simultaneously. DiaA stimulated the assembly of multiple DnaA molecules on oriC, conformational changes in ATP–DnaA-specific initiation complexes, and unwinding of oriC duplex DNA. The mutant DiaA proteins are defective in these stimulations. DiaA associated also with ADP–DnaA, and stimulated the assembly of inactive ADP–DnaA–oriC complexes. Specific residues in the putative phosphosugar-binding motif of DiaA were required for the stimulation of initiation and formation of ATP–DnaA-specific–oriC complexes. Our data indicate that DiaA regulates initiation by a novel mechanism, in which DiaA tetramers most likely bind to multiple DnaA molecules and stimulate the assembly of specific ATP–DnaA–oriC complexes. These results suggest an essential role for DiaA in the promotion of replication initiation in a cell cycle coordinated manner. PMID:17699754

  14. Effects of mutations at amino acid 61 in the arm of TF1 on its DNA-binding properties.

    PubMed

    Sayre, M H; Geiduschek, E P

    1990-12-20

    Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of bacterial DNA-binding proteins that includes Escherichia coli HU and integration host factor (IHF). We have initiated a mutational analysis of the TF1 molecule to understand better its unique DNA-binding properties and to investigate its physiological function. We report here the consequences of mutating the putative DNA-binding "arms" of TF1. At position 61 in its primary sequence, TF1 contains a Phe residue in place of the Arg residue found in all other known members of the HU family. Substituting polar, uncharged residues for Phe61 substantially reduced the DNA-binding affinity and site-selectivity of TF1 in vitro, whereas the substitution of Tyr had no effect. Substituting Trp or Arg for Phe61 had little effect on the affinity of TF1 for SPO1 DNA, but altered the electrophoretic mobilities of protein-DNA complexes in non-denaturing gels. The Arg61 substitution increased the affinity of the protein for non-specific sites on thymine-containing DNA, thus reducing the natural preference of TF1 for (5-hydroxymethyluracil)-containing DNA. The Phe61-to-Arg mutation was also correlated with decreased phage yield and aberrant regulation of viral protein synthesis in vivo.

  15. Identification of novel putative-binding proteins for cellular prion protein and a specific interaction with the STIP1 homology and U-Box-containing protein 1

    PubMed Central

    Gimenez, Ana Paula Lappas; Richter, Larissa Morato Luciani; Atherino, Mariana Campos; Beirão, Breno Castello Branco; Fávaro, Celso; Costa, Michele Dietrich Moura; Zanata, Silvio Marques; Malnic, Bettina; Mercadante, Adriana Frohlich

    2015-01-01

    ABSTRACT Prion diseases involve the conversion of the endogenous cellular prion protein, PrPC, into a misfolded infectious isoform, PrPSc. Several functions have been attributed to PrPC, and its role has also been investigated in the olfactory system. PrPC is expressed in both the olfactory bulb (OB) and olfactory epithelium (OE) and the nasal cavity is an important route of transmission of diseases caused by prions. Moreover, Prnp−/− mice showed impaired behavior in olfactory tests. Given the high PrPC expression in OE and its putative role in olfaction, we screened a mouse OE cDNA library to identify novel PrPC-binding partners. Ten different putative PrPC ligands were identified, which were involved in functions such as cellular proliferation and apoptosis, cytoskeleton and vesicle transport, ubiquitination of proteins, stress response, and other physiological processes. In vitro binding assays confirmed the interaction of PrPC with STIP1 homology and U-Box containing protein 1 (Stub1) and are reported here for the first time. Stub1 is a co-chaperone with ubiquitin E3-ligase activity, which is associated with neurodegenerative diseases characterized by protein misfolding and aggregation. Physiological and pathological implications of PrPC-Stub1 interaction are under investigation. The PrPC-binding proteins identified here are not exclusive to the OE, suggesting that these interactions may occur in other tissues and play general biological roles. These data corroborate the proposal that PrPC is part of a multiprotein complex that modulates several cellular functions and provide a platform for further studies on the physiological and pathological roles of prion protein. PMID:26237451

  16. Phosphorylation of ETS Transcription Factor ER81 in a Complex with Its Coactivators CREB-Binding Protein and p300

    PubMed Central

    Papoutsopoulou, Stamatia; Janknecht, Ralf

    2000-01-01

    The ETS protein ER81 is a DNA-binding factor capable of enhancing gene transcription and is implicated in cellular transformation, but presently the mechanisms of its actions are unclear. In this report, ER81 is shown to coimmunoprecipitate with the transcriptional coactivator CREB-binding protein (CBP) and the related p300 protein (together referred to as CBP/p300). Moreover, confocal laser microscopic studies demonstrated that ER81 and p300 colocalized to nuclear speckles. In vitro and in vivo interaction studies revealed that ER81 amino acids 249 to 429, which encompass the ETS DNA-binding domain, are responsible for binding to CBP/p300. However, mutation of a putative protein-protein interaction motif, LXXLL, in the ETS domain of ER81 did not affect interaction with CBP/p300, whereas DNA binding of ER81 was abolished. Furthermore, two regions within CBP, amino acids 451 to 721 and 1891 to 2175, are capable of binding to ER81. Consistent with the physical interaction between ER81 and the coactivators CBP and p300, ER81 transcriptional activity was potentiated by CBP/p300 overexpression. Moreover, an ER81-associated protein kinase activity was enhanced upon p300 overexpression. This protein kinase phosphorylates ER81 on serines 191 and 216, and mutation of these phosphorylation sites increased ER81 transcriptional activity in Mv1Lu cells but not in HeLa cells. Altogether, our data elucidate the mechanism of how ER81 regulates gene transcription, through interaction with the coactivators CBP and p300 and an associated kinase that may cell type specifically modulate the ability of ER81 to activate gene transcription. PMID:10982847

  17. Dynamic phosphorylation of RelA on Ser42 and Ser45 in response to TNFα stimulation regulates DNA binding and transcription.

    PubMed

    Lanucara, Francesco; Lam, Connie; Mann, Jelena; Monie, Tom P; Colombo, Stefano A P; Holman, Stephen W; Boyd, James; Dange, Manohar C; Mann, Derek A; White, Michael R H; Eyers, Claire E

    2016-07-01

    The NF-κB signalling module controls transcription through a network of protein kinases such as the IKKs, as well as inhibitory proteins (IκBs) and transcription factors including RelA/p65. Phosphorylation of the NF-κB subunits is critical for dictating system dynamics. Using both non-targeted discovery and quantitative selected reaction monitoring-targeted proteomics, we show that the cytokine TNFα induces dynamic multisite phosphorylation of RelA at a number of previously unidentified residues. Putative roles for many of these phosphorylation sites on RelA were predicted by modelling of various crystal structures. Stoichiometry of phosphorylation determination of Ser45 and Ser42 revealed preferential early phosphorylation of Ser45 in response to TNFα. Quantitative analyses subsequently confirmed differential roles for pSer42 and pSer45 in promoter-specific DNA binding and a role for both of these phosphosites in regulating transcription from the IL-6 promoter. These temporal dynamics suggest that RelA-mediated transcription is likely to be controlled by functionally distinct NF-κB proteoforms carrying different combinations of modifications, rather than a simple 'one modification, one effect' system. © 2016 The Authors.

  18. Theory on the mechanism of site-specific DNA-protein interactions in the presence of traps

    NASA Astrophysics Data System (ADS)

    Niranjani, G.; Murugan, R.

    2016-08-01

    The speed of site-specific binding of transcription factor (TFs) proteins with genomic DNA seems to be strongly retarded by the randomly occurring sequence traps. Traps are those DNA sequences sharing significant similarity with the original specific binding sites (SBSs). It is an intriguing question how the naturally occurring TFs and their SBSs are designed to manage the retarding effects of such randomly occurring traps. We develop a simple random walk model on the site-specific binding of TFs with genomic DNA in the presence of sequence traps. Our dynamical model predicts that (a) the retarding effects of traps will be minimum when the traps are arranged around the SBS such that there is a negative correlation between the binding strength of TFs with traps and the distance of traps from the SBS and (b) the retarding effects of sequence traps can be appeased by the condensed conformational state of DNA. Our computational analysis results on the distribution of sequence traps around the putative binding sites of various TFs in mouse and human genome clearly agree well the theoretical predictions. We propose that the distribution of traps can be used as an additional metric to efficiently identify the SBSs of TFs on genomic DNA.

  19. GBshape: a genome browser database for DNA shape annotations.

    PubMed

    Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J; Parker, Stephen C J; Nuzhdin, Sergey V; Tullius, Thomas D; Rohs, Remo

    2015-01-01

    Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Kid-1, a putative renal transcription factor: regulation during ontogeny and in response to ischemia and toxic injury.

    PubMed Central

    Witzgall, R; O'Leary, E; Gessner, R; Ouellette, A J; Bonventre, J V

    1993-01-01

    We have identified a new putative transcription factor from the rat kidney, termed Kid-1 (for kidney, ischemia and developmentally regulated gene 1). Kid-1 belongs to the C2H2 class of zinc finger genes. Its mRNA accumulates with age in postnatal renal development and is detected predominantly in the kidney. Kid-1 mRNA levels decline after renal injury secondary to ischemia or folic acid administration, two insults which result in epithelial cell dedifferentiation, followed by regenerative hyperplasia and differentiation. The low expression of Kid-1 early in postnatal development, and when renal tissue is recovering after injury, suggests that the gene product is involved in establishment of a differentiated phenotype and/or regulation of the proliferative response. The deduced protein contains 13 C2H2 zinc fingers at the COOH end in groups of 4 and 9 separated by a 32-amino-acid spacer. There are consensus sites for phosphorylation in the NH2 terminus non-zinc finger region as well as in the spacer region between zinc fingers 4 and 5. A region of the deduced protein shares extensive homology with a catalytic region of Raf kinases, a feature shared only with TFIIE among transcription factors. To determine whether Kid-1 can modulate transcription, a chimeric construct encoding the Kid-1 non-zinc finger region (sense or antisense) and the DNA-binding region of GAL4 was transfected into COS and LLC-PK1 cells together with a chloramphenicol acetyltransferase (CAT) reporter plasmid containing GAL4 binding sites, driven by either a minimal promoter or a simian virus 40 enhancer. CAT activity was markedly inhibited in cells transfected with the sense construct compared with the activity in cells transfected with the antisense construct. To our knowledge, this pattern of developmental regulation, kidney expression, and regulation of transcription is unique among the C2H2 class of zinc finger-containing DNA-binding proteins. Images PMID:8382778

  1. Human Pif1 helicase unwinds synthetic DNA structures resembling stalled DNA replication forks

    PubMed Central

    George, Tresa; Wen, Qin; Griffiths, Richard; Ganesh, Anil; Meuth, Mark; Sanders, Cyril M.

    2009-01-01

    Pif-1 proteins are 5′→3′ superfamily 1 (SF1) helicases that in yeast have roles in the maintenance of mitochondrial and nuclear genome stability. The functions and activities of the human enzyme (hPif1) are unclear, but here we describe its DNA binding and DNA remodeling activities. We demonstrate that hPif1 specifically recognizes and unwinds DNA structures resembling putative stalled replication forks. Notably, the enzyme requires both arms of the replication fork-like structure to initiate efficient unwinding of the putative leading replication strand of such substrates. This DNA structure-specific mode of initiation of unwinding is intrinsic to the conserved core helicase domain (hPifHD) that also possesses a strand annealing activity as has been demonstrated for the RecQ family of helicases. The result of hPif1 helicase action at stalled DNA replication forks would generate free 3′ ends and ssDNA that could potentially be used to assist replication restart in conjunction with its strand annealing activity. PMID:19700773

  2. NF-Y, a CCAAT box-binding protein, is one of the trans-acting factors necessary for the response of the murine ERp72 gene to protein traffic.

    PubMed

    Marcus, N; Green, M

    1997-09-01

    The accumulation of incompletely assembled immunoglobulin mu heavy chain in transfected COS cells stimulates the cellular response to protein traffic that results in the increased transcription and elevated synthesis of several ER chaperones, including ERP72, a member of the protein disulfide isomerase family of molecular chaperones. The ERp72 promoter contains an 82 bp ER protein traffic response element (ERPTRE) that is sufficient to mediate this response. Previously, it had been shown that the alteration of a putative AP-2 site and a CCAAT and inverted CCAAT site within the ERPTRE significantly decreased the response of ERp72 promoter to mu chain accumulation. We have extended these findings by demonstrating a role for NF-Y and a potentially novel DNA-binding protein in the regulation of transcription from the ERp72 promoter. The fact that NF-Y binding to the ERPTRE is observed in extracts from both control cells and cells in which the response to protein traffic has been activated indicates that the binding of NF-Y, while necessary, is not sufficient to account for the response. Each of the two CCAAT sites in the ERPTRE can bind NF-Y independently, but both sites must be intact for full ERPTRE function. A second protein can bind to the ERPTRE independently of NF-Y and at a site overlapping or close to the 3' end of the reverse CCAAT site. It is possible that interactions between NF-Y, this protein and perhaps other factors are responsible for the regulation of the protein traffic response.

  3. Specific binding of the Xanthomonas campestris pv. vesicatoria AraC-type transcriptional activator HrpX to plant-inducible promoter boxes.

    PubMed

    Koebnik, Ralf; Krüger, Antje; Thieme, Frank; Urban, Alexander; Bonas, Ulla

    2006-11-01

    The pathogenicity of the plant-pathogenic bacterium Xanthomonas campestris pv. vesicatoria depends on a type III secretion system which is encoded by the 23-kb hrp (hypersensitive response and pathogenicity) gene cluster. Expression of the hrp operons is strongly induced in planta and in a special minimal medium and depends on two regulatory proteins, HrpG and HrpX. In this study, DNA affinity enrichment was used to demonstrate that the AraC-type transcriptional activator HrpX binds to a conserved cis-regulatory element, the plant-inducible promoter (PIP) box (TTCGC-N(15)-TTCGC), present in the promoter regions of four hrp operons. No binding of HrpX was observed when DNA fragments lacking a PIP box were used. HrpX also bound to a DNA fragment containing an imperfect PIP box (TTCGC-N(8)-TTCGT). Dinucleotide replacements in each half-site of the PIP box strongly decreased binding of HrpX, while simultaneous dinucleotide replacements in both half-sites completely abolished binding. Based on the complete genome sequence of Xanthomonas campestris pv. vesicatoria, putative plant-inducible promoters consisting of a PIP box and a -10 promoter motif were identified in the promoter regions of almost all HrpX-activated genes. Bioinformatic analyses and reverse transcription-PCR experiments revealed novel HrpX-dependent genes, among them a NUDIX hydrolase gene and several genes with a predicted role in the degradation of the plant cell wall. We conclude that HrpX is the most downstream component of the hrp regulatory cascade, which is proposed to directly activate most genes of the hrpX regulon via binding to corresponding PIP boxes.

  4. Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.

    PubMed

    Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki

    2007-05-01

    The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.

  5. Association of an SNP in a novel DREB2-like gene SiDREB2 with stress tolerance in foxtail millet [Setaria italica (L.)].

    PubMed

    Lata, Charu; Bhutty, Sarita; Bahadur, Ranjit Prasad; Majee, Manoj; Prasad, Manoj

    2011-06-01

    The DREB genes code for important plant transcription factors involved in the abiotic stress response and signal transduction. Characterization of DREB genes and development of functional markers for effective alleles is important for marker-assisted selection in foxtail millet. Here the characterization of a cDNA (SiDREB2) encoding a putative dehydration-responsive element-binding protein 2 from foxtail millet and the development of an allele-specific marker (ASM) for dehydration tolerance is reported. A cDNA clone (GenBank accession no. GT090998) coding for a putative DREB2 protein was isolated as a differentially expressed gene from a 6 h dehydration stress SSH library. A 5' RACE (rapid amplification of cDNA ends) was carried out to obtain the full-length cDNA, and sequence analysis showed that SiDREB2 encoded a polypeptide of 234 amino acids with a predicted mol. wt of 25.72 kDa and a theoretical pI of 5.14. A theoretical model of the tertiary structure shows that it has a highly conserved GCC-box-binding N-terminal domain, and an acidic C-terminus that acts as an activation domain for transcription. Based on its similarity to AP2 domains, SiDREB2 was classified into the A-2 subgroup of the DREB subfamily. Quantitative real-time PCR analysis showed significant up-regulation of SiDREB2 by dehydration (polyethylene glycol) and salinity (NaCl), while its expression was less affected by other stresses. A synonymous single nucleotide polymorphism (SNP) associated with dehydration tolerance was detected at the 558th base pair (an A/G transition) in the SiDREB2 gene in a core set of 45 foxtail millet accessions used. Based on the identified SNP, three primers were designed to develop an ASM for dehydration tolerance. The ASM produced a 261 bp fragment in all the tolerant accessions and produced no amplification in the sensitive accessions. The use of this ASM might be faster, cheaper, and more reproducible than other SNP genotyping methods, and thus will enable marker-aided breeding of foxtail millet for dehydration tolerance.

  6. Molecular cloning and immunochemical characterization of a novel major Japanese cedar pollen allergen belonging to the aspartic protease family.

    PubMed

    Ibrahim, Ahmed Ragaa Nour; Kawamoto, Seiji; Aki, Tsunehiro; Shimada, Yayoi; Rikimaru, Satoshi; Onishi, Nobukazu; Babiker, Elfadil Elfadl; Oiso, Isao; Hashimoto, Kunihiko; Hayashi, Takaharu; Ono, Kazuhisa

    2010-01-01

    Japanese cedar (Cryptomeria japonica) pollen is a major cause of seasonal pollinosis in Japan. Protease activity in the pollen grains may trigger pro-allergic responses but no such proteases have yet been identified as pollen allergens. We report the molecular cloning and immunochemical characterization of a novel C. japonica pollen allergen belonging to the aspartic protease family. We focused on the C. japonica pollen allergen spot No. 63 (CPA63, 47.5% IgE binding frequency) on our 2-dimensional IgE immunoblot map. The internal amino acid sequences were determined using time-of-flight mass spectrometry. Full-length cpa63 cDNA was cloned by rapid amplification of cDNA ends (RACE)-PCR. Recombinant CPA63 (r-CPA63) was expressed using the baculovirus-insect cell culture system and its IgE binding capacity was analyzed by enzyme-linked immunosorbent assay (ELISA). The proteolytic activity of r-CPA63 was also assessed using a putative mature enzyme produced upon autolysis. cpa63 cDNA encoded a 472 amino acid polypeptide showing about 40% sequence identity to members of the plant atypical aspartic protease family. ELISA showed that r-CPA63 was recognized by IgE antibodies in the serum of 58% (18/31) of Japanese cedar pollinosis patients. We also demonstrated an aspartic protease-like enzyme activity of the putative mature r-CPA63. We have identified the first plant aspartic protease allergen from Japanese cedar pollen. The availability of the CPA63 sequence and its recombinant allergen production system are useful not only for pharmaceutical applications but also for further examination of the role of protease activity in the pathogenesis of cedar pollinosis. 2010 S. Karger AG, Basel.

  7. A resource for characterizing genome-wide binding and putative target genes of transcription factors expressed during secondary growth and wood formation in Populus.

    PubMed

    Liu, Lijun; Ramsay, Trevor; Zinkgraf, Matthew; Sundell, David; Street, Nathaniel Robert; Filkov, Vladimir; Groover, Andrew

    2015-06-01

    Identifying transcription factor target genes is essential for modeling the transcriptional networks underlying developmental processes. Here we report a chromatin immunoprecipitation sequencing (ChIP-seq) resource consisting of genome-wide binding regions and associated putative target genes for four Populus homeodomain transcription factors expressed during secondary growth and wood formation. Software code (programs and scripts) for processing the Populus ChIP-seq data are provided within a publically available iPlant image, including tools for ChIP-seq data quality control and evaluation adapted from the human Encyclopedia of DNA Elements (ENCODE) project. Basic information for each transcription factor (including members of Class I KNOX, Class III HD ZIP, BEL1-like families) binding are summarized, including the number and location of binding regions, distribution of binding regions relative to gene features, associated putative target genes, and enriched functional categories of putative target genes. These ChIP-seq data have been integrated within the Populus Genome Integrative Explorer (PopGenIE) where they can be analyzed using a variety of web-based tools. We present an example analysis that shows preferential binding of transcription factor ARBORKNOX1 to the nearest neighbor genes in a pre-calculated co-expression network module, and enrichment for meristem-related genes within this module including multiple orthologs of Arabidopsis KNOTTED-like Arabidopsis 2/6. © 2015 Society for Experimental Biology and John Wiley & Sons Ltd This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  8. Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.

    PubMed

    Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T

    2018-06-01

    To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.

  9. Search for protein partners of mitochondrial single-stranded DNA-binding protein Rim1p using a yeast two-hybrid system.

    PubMed

    Kucejová, B; Foury, F

    2003-01-01

    RIM1 is a nuclear gene of the yeast Saccharomyces cerevisiae coding for a protein with single-stranded DNA-binding activity that is essential for mitochondrial genome maintenance. No protein partners of Rim1p have been described so far in yeast. To better understand the role of this protein in mitochondrial DNA replication and recombination, a search for protein interactors by the yeast two-hybrid system was performed. This approach led to the identification of several candidates, including a putative transcription factor, Azf1p, and Mph1p, a protein with an RNA helicase domain which is known to influence the mutation rate of nuclear and mitochondrial genomes.

  10. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions.

    PubMed

    Hume, Maxwell A; Barrera, Luis A; Gisselbrecht, Stephen S; Bulyk, Martha L

    2015-01-01

    The Universal PBM Resource for Oligonucleotide Binding Evaluation (UniPROBE) serves as a convenient source of information on published data generated using universal protein-binding microarray (PBM) technology, which provides in vitro data about the relative DNA-binding preferences of transcription factors for all possible sequence variants of a length k ('k-mers'). The database displays important information about the proteins and displays their DNA-binding specificity data in terms of k-mers, position weight matrices and graphical sequence logos. This update to the database documents the growth of UniPROBE since the last update 4 years ago, and introduces a variety of new features and tools, including a new streamlined pipeline that facilitates data deposition by universal PBM data generators in the research community, a tool that generates putative nonbinding (i.e. negative control) DNA sequences for one or more proteins and novel motifs obtained by analyzing the PBM data using the BEEML-PBM algorithm for motif inference. The UniPROBE database is available at http://uniprobe.org. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. The protein network surrounding the human telomere repeat binding factors TRF1, TRF2, and POT1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giannone, Richard J; McDonald, W Hayes; Hurst, Gregory

    Telomere integrity (including telomere length and capping) is critical in overall genomic stability. Telomere repeat binding factors and their associated proteins play vital roles in telomere length regulation and end protection. In this study, we explore the protein network surrounding telomere repeat binding factors, TRF1, TRF2, and POT1 using dual-tag affinity purification in combination with multidimensional protein identification technology liquid chromatography - tandem mass spectrometry (MudPIT LC-MS/MS). After control subtraction and data filtering, we found that TRF2 and POT1 co-purified all six members of the telomere protein complex, while TRF1 identified five of six components at frequencies that lend evidencemore » towards the currently accepted telomere architecture. Many of the known TRF1 or TRF2 interacting proteins were also identified. Moreover, putative associating partners identified for each of the three core components fell into functional categories such as DNA damage repair, ubiquitination, chromosome cohesion, chromatin modification/remodeling, DNA replication, cell cycle and transcription regulation, nucleotide metabolism, RNA processing, and nuclear transport. These putative protein-protein associations may participate in different biological processes at telomeres or, intriguingly, outside telomeres.« less

  12. Mapping the Tail Fiber as the Receptor Binding Protein Responsible for Differential Host Specificity of Pseudomonas aeruginosa Bacteriophages PaP1 and JG004

    PubMed Central

    Le, Shuai; He, Xuesong; Tan, Yinling; Huang, Guangtao; Zhang, Lin; Lux, Renate; Shi, Wenyuan; Hu, Fuquan

    2013-01-01

    The first step in bacteriophage infection is recognition and binding to the host receptor, which is mediated by the phage receptor binding protein (RBP). Different RBPs can lead to differential host specificity. In many bacteriophages, such as Escherichia coli and Lactococcal phages, RBPs have been identified as the tail fiber or protruding baseplate proteins. However, the tail fiber-dependent host specificity in Pseudomonas aeruginosa phages has not been well studied. This study aimed to identify and investigate the binding specificity of the RBP of P. aeruginosa phages PaP1 and JG004. These two phages share high DNA sequence homology but exhibit different host specificities. A spontaneous mutant phage was isolated and exhibited broader host range compared with the parental phage JG004. Sequencing of its putative tail fiber and baseplate region indicated a single point mutation in ORF84 (a putative tail fiber gene), which resulted in the replacement of a positively charged lysine (K) by an uncharged asparagine (N). We further demonstrated that the replacement of the tail fiber gene (ORF69) of PaP1 with the corresponding gene from phage JG004 resulted in a recombinant phage that displayed altered host specificity. Our study revealed the tail fiber-dependent host specificity in P. aeruginosa phages and provided an effective tool for its alteration. These contributions may have potential value in phage therapy. PMID:23874674

  13. Mouse Mesenchyme forkhead 2 (Mf2): expression, DNA binding and induction by sonic hedgehog during somitogenesis.

    PubMed

    Wu, S C; Grindley, J; Winnier, G E; Hargett, L; Hogan, B L

    1998-01-01

    Cloning and sequencing of mouse Mf2 (mesoderm/mesenchyme forkhead 2) cDNAs revealed an open reading frame encoding a putative protein of 492 amino acids which, after in vitro translation, binds to a DNA consensus sequence. Mf2 is expressed at high levels in the ventral region of newly formed somites, in sclerotomal derivatives, in lateral plate and cephalic mesoderm and in the first and second branchial arches. Other regions of mesodermal expression include the developing tongue, meninges, nose, whiskers, kidney, genital tubercule and limb joints. In the nervous system Mf2 is transcribed in restricted regions of the mid- and forebrain. In several tissues, including the early somite, Mf2 is expressed in cell populations adjacent to regions expressing sonic hedgehog (Shh) and in explant cultures of presomitic mesoderm Mf2 is induced by Shh secreted by COS cells. These results suggest that Mf2, like other murine forkhead genes, has multiple roles in embryogenesis, possibly mediating the response of cells to signaling molecules such as SHH.

  14. The HhH(2)/NDD Domain of the Drosophila Nod Chromokinesin-like Protein Is Required for Binding to Chromosomes in the Oocyte Nucleus

    PubMed Central

    Cui, Wei; Hawley, R. Scott

    2005-01-01

    Nod is a chromokinesin-like protein that plays a critical role in segregating achiasmate chromosomes during female meiosis. The C-terminal half of the Nod protein contains two putative DNA-binding domains. The first of these domains, known as the HMGN domain, consists of three tandemly repeated high-mobility group N motifs. This domain was previously shown to be both necessary and sufficient for binding of the C-terminal half of Nod to mitotic chromosomes in embryos. The second putative DNA-binding domain, denoted HhH(2)/NDD, is a helix-hairpin-helix(2)/Nod-like DNA-binding domain. Although the HhH(2)/NDD domain is not required or sufficient for chromosome binding in embryos, several well-characterized nod mutations have been mapped in this domain. To characterize the role of the HhH(2)/NDD domain in mediating Nod function, we created a series of UAS-driven transgene constructs capable of expressing either a wild-type Nod-GFP fusion protein or proteins in which the HhH(2)/NDD domain had been altered by site-directed mutagenesis. Although wild-type Nod-GFP localizes to the oocyte chromosomes and rescues the segregation defect in nod mutant oocytes, two of three proteins carrying mutants in the HhH(2)/NDD domain fail to either rescue the nod mutant phenotype or bind to oocyte chromosomes. However, these mutant proteins do bind to the polytene chromosomes in nurse-cell nuclei and enter the oocyte nucleus. Thus, even though the HhH(2)/NDD domain is not essential for chromosome binding in other cell types, it is required for chromosome binding in the oocyte. These HhH(2)/NDD mutants also block the localization of Nod to the posterior pole of stage 9–10A oocytes, a process that is thought to facilitate the interaction of Nod with the plus ends of microtubules (Cui et al. 2005). This observation suggests that the Nod HhH2/NDD domain may play other roles in addition to binding Nod to meiotic chromosomes. PMID:16143607

  15. TPP1 is a homologue of ciliate TEBP-β and interacts with POT1 to recruit telomerase

    NASA Astrophysics Data System (ADS)

    Xin, Huawei; Liu, Dan; Wan, Ma; Safari, Amin; Kim, Hyeung; Sun, Wen; O'Connor, Matthew S.; Songyang, Zhou

    2007-02-01

    Telomere dysfunction may result in chromosomal abnormalities, DNA damage responses, and even cancer. Early studies in lower organisms have helped to establish the crucial role of telomerase and telomeric proteins in maintaining telomere length and protecting telomere ends. In Oxytricha nova, telomere G-overhangs are protected by the TEBP-α/β heterodimer. Human telomeres contain duplex telomeric repeats with 3' single-stranded G-overhangs, and may fold into a t-loop structure that helps to shield them from being recognized as DNA breaks. Additionally, the TEBP-α homologue, POT1, which binds telomeric single-stranded DNA (ssDNA), associates with multiple telomeric proteins (for example, TPP1, TIN2, TRF1, TRF2 and RAP1) to form the six-protein telosome/shelterin and other subcomplexes. These telomeric protein complexes in turn interact with diverse pathways to form the telomere interactome for telomere maintenance. However, the mechanisms by which the POT1-containing telosome communicates with telomerase to regulate telomeres remain to be elucidated. Here we demonstrate that TPP1 is a putative mammalian homologue of TEBP-β and contains a predicted amino-terminal oligonucleotide/oligosaccharide binding (OB) fold. TPP1-POT1 association enhanced POT1 affinity for telomeric ssDNA. In addition, the TPP1 OB fold, as well as POT1-TPP1 binding, seemed critical for POT1-mediated telomere-length control and telomere-end protection in human cells. Disruption of POT1-TPP1 interaction by dominant negative TPP1 expression or RNA interference (RNAi) resulted in telomere-length alteration and DNA damage responses. Furthermore, we offer evidence that TPP1 associates with the telomerase in a TPP1-OB-fold-dependent manner, providing a physical link between telomerase and the telosome/shelterin complex. Our findings highlight the critical role of TPP1 in telomere maintenance, and support a yin-yang model in which TPP1 and POT1 function as a unit to protect human telomeres, by both positively and negatively regulating telomerase access to telomere DNA.

  16. ThrR, a DNA-binding transcription factor involved in controlling threonine biosynthesis in Bacillus subtilis.

    PubMed

    Rosenberg, Jonathan; Müller, Peter; Lentes, Sabine; Thiele, Martin J; Zeigler, Daniel R; Tödter, Dominik; Paulus, Henry; Brantl, Sabine; Stülke, Jörg; Commichau, Fabian M

    2016-09-01

    The threonine dehydratase IlvA is part of the isoleucine biosynthesis pathway in the Gram-positive model bacterium Bacillus subtilis. Consequently, deletion of ilvA causes isoleucine auxotrophy. It has been reported that ilvA pseudo-revertants having a derepressed hom-thrCB operon appear in the presence of threonine. Here we have characterized two classes of ilvA pseudo-revertants. In the first class the hom-thrCB operon was derepressed unmasking the threonine dehydratase activity of the threonine synthase ThrC. In the second class of mutants, threonine biosynthesis was more broadly affected. The first class of ilvA pseudo-revertants had a mutation in the Phom promoter (P*hom ), resulting in constitutive expression of the hom-thrCB operon. In the second class of ilvA pseudo-revertants, the thrR gene encoding a putative DNA-binding protein was inactivated, also resulting in constitutive expression of the hom-thrCB operon. Here we demonstrate that ThrR is indeed a DNA-binding transcription factor that regulates the hom-thrCB operon and the thrD aspartokinase gene. DNA binding assays uncovered the DNA-binding site of ThrR and revealed that the repressor competes with the RNA polymerase for DNA binding. This study also revealed that ThrR orthologs are ubiquitous in genomes from the Gram-positive phylum Firmicutes and in some Gram-negative bacteria. © 2016 John Wiley & Sons Ltd.

  17. Cloning and expression of a nuclear encoded plastid specific 33 kDa ribonucleoprotein gene (33RNP) from pea that is light stimulated.

    PubMed

    Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K

    2001-01-24

    We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.

  18. Lipoxygenase in Caragana jubata responds to low temperature, abscisic acid, methyl jasmonate and salicylic acid.

    PubMed

    Bhardwaj, Pardeep Kumar; Kaur, Jagdeep; Sobti, Ranbir Chander; Ahuja, Paramvir Singh; Kumar, Sanjay

    2011-09-01

    Lipoxygenase (LOX) catalyses oxygenation of free polyunsaturated fatty acids into oxylipins, and is a critical enzyme of the jasmonate signaling pathway. LOX has been shown to be associated with biotic and abiotic stress responses in diverse plant species, though limited data is available with respect to low temperature and the associated cues. Using rapid amplification of cDNA ends, a full-length cDNA (CjLOX) encoding lipoxygenase was cloned from apical buds of Caragana jubata, a temperate plant species that grows under extreme cold. The cDNA obtained was 2952bp long consisting of an open reading frame of 2610bp encoding 869 amino acids protein. Multiple alignment of the deduced amino acid sequence with those of other plants demonstrated putative LH2/ PLAT domain, lipoxygenase iron binding catalytic domain and lipoxygenase_2 signature sequences. CjLOX exhibited up- and down-regulation of gene expression pattern in response to low temperature (LT), abscisic acid (ABA), methyl jasmonate (MJ) and salicylic acid (SA). Among all the treatments, a strong up-regulation was observed in response to MJ. Data suggests an important role of jasmonate signaling pathway in response to LT in C. jubata. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Target gene analysis by microarrays and chromatin immunoprecipitation identifies HEY proteins as highly redundant bHLH repressors.

    PubMed

    Heisig, Julia; Weber, David; Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

    2012-01-01

    HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression.

  20. Target Gene Analysis by Microarrays and Chromatin Immunoprecipitation Identifies HEY Proteins as Highly Redundant bHLH Repressors

    PubMed Central

    Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

    2012-01-01

    HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression. PMID:22615585

  1. Identification and analysis of pig chimeric mRNAs using RNA sequencing data

    PubMed Central

    2012-01-01

    Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

  2. Isolation and expression analysis of cDNAs that are associated with alternate bearing in Olea europaea L. cv. Ayvalık

    PubMed Central

    2013-01-01

    Background Olive cDNA libraries to isolate candidate genes that can help enlightening the molecular mechanism of periodicity and / or fruit production were constructed and analyzed. For this purpose, cDNA libraries from the leaves of trees in “on year” and in “off year” in July (when fruits start to appear) and in November (harvest time) were constructed. Randomly selected 100 positive clones from each library were analyzed with respect to sequence and size. A fruit-flesh cDNA library was also constructed and characterized to confirm the reliability of each library’s temporal and spatial properties. Results Quantitative real-time RT-PCR (qRT-PCR) analyses of the cDNA libraries confirmed cDNA molecules that are associated with different developmental stages (e. g. “on year” leaves in July, “off year” leaves in July, leaves in November) and fruits. Hence, a number of candidate cDNAs associated with “on year” and “off year” were isolated. Comparison of the detected cDNAs to the current EST database of GenBank along with other non - redundant databases of NCBI revealed homologs of previously described genes along with several unknown cDNAs. Of around 500 screened cDNAs, 48 cDNA elements were obtained after eliminating ribosomal RNA sequences. These independent transcripts were analyzed using BLAST searches (cutoff E-value of 1.0E-5) against the KEGG and GenBank nucleotide databases and 37 putative transcripts corresponding to known gene functions were annotated with gene names and Gene Ontology (GO) terms. Transcripts in the biological process were found to be related with metabolic process (27%), cellular process (23%), response to stimulus (17%), localization process (8.5%), multicellular organismal process (6.25%), developmental process (6.25%) and reproduction (4.2%). Conclusions A putative P450 monooxigenase expressed fivefold more in the “on year” than that of “off year” leaves in July. Two putative dehydrins expressed significantly more in “on year” leaves than that of “off year” leaves in November. Homologs of UDP – glucose epimerase, acyl - CoA binding protein, triose phosphate isomerase and a putative nuclear core anchor protein were significant in fruits only, while a homolog of an embryo binding protein / small GTPase regulator was detected in “on year” leaves only. One of the two unknown cDNAs was specific to leaves in July while the other was detected in all of the libraries except fruits. KEGG pathway analyses for the obtained sequences correlated with essential metabolisms such as galactose metabolism, amino sugar and nucleotide sugar metabolisms and photosynthesis. Detailed analysis of the results presents candidate cDNAs that can be used to dissect further the genetic basis of fruit production and / or alternate bearing which causes significant economical loss for olive growers. PMID:23552171

  3. Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

    PubMed

    Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

    2000-12-01

    The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

  4. Scarabaecin, a novel cysteine-containing antifungal peptide from the rhinoceros beetle, Oryctes rhinoceros.

    PubMed

    Tomie, Tetsuya; Ishibashi, Jun; Furukawa, Seiichi; Kobayashi, Satoe; Sawahata, Ryoko; Asaoka, Ai; Tagawa, Michito; Yamakawa, Minoru

    2003-07-25

    A novel antifungal peptide, scarabaecin (4080Da), was isolated from the coconut rhinoceros beetle, Oryctes rhinoceros. Scarabaecin cDNA was cloned by reverse transcriptase-polymerase chain reactions (RT-PCR) using a primer based on the N-terminal amino acid sequence. The amino acid sequence deduced from scarabaecin cDNA showed no significant similarity to those of reported proteins. Chemically synthesized scarabaecin indicated antifungal activity against phytopathogenic fungi such as Pyricularia oryzae, Rhizoctonia solani, and Botrytis cinerea, but not against phytopathogenic bacteria. It showed weak activity against Bauberia bassiana, an insect pathogenic fungus, and Staphylococcus aureus, a pathogenic bacterium. Scarabaecin showed chitin binding property and its K(d) was 1.315 microM. A comparison of putative chitin-binding domains among scarabaecin, invertebrate, and plant chitin-binding proteins suggests that scarabaecin is a new member of chitin-binding antimicrobial proteins.

  5. Analysis of the DNA-Binding Activities of the Arabidopsis R2R3-MYB Transcription Factor Family by One-Hybrid Experiments in Yeast

    PubMed Central

    Kelemen, Zsolt; Sebastian, Alvaro; Xu, Wenjia; Grain, Damaris; Salsac, Fabien; Avon, Alexandra; Berger, Nathalie; Tran, Joseph; Dubreucq, Bertrand; Lurin, Claire; Lepiniec, Loïc; Contreras-Moreira, Bruno; Dubos, Christian

    2015-01-01

    The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs). Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments) with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences. PMID:26484765

  6. Metallated DNA Aptamers for Prostate Cancer Treatment

    DTIC Science & Technology

    2013-03-01

    minor groove while the new 320 nm maxima reflect the binding of N-methyl pyrrole moieties of netropsin in the minor groove of 3’FdU.(Zimmer, Marck...resonance assignment and those consistent with the pyrrole 1 H resonances of netropsin (Fig. 3). NOESY crosspeaks from FdU imino 1 H to putative...computational chemistry data from our laboratory and with netropsin binding in the minor groove based upon NOE data from pyrrole 1 H of netropsin and

  7. A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

    PubMed Central

    Walker, M D; Park, C W; Rosen, A; Aronheim, A

    1990-01-01

    Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

  8. DNA-Binding Properties of African Swine Fever Virus pA104R, a Histone-Like Protein Involved in Viral Replication and Transcription.

    PubMed

    Frouco, Gonçalo; Freitas, Ferdinando B; Coelho, João; Leitão, Alexandre; Martins, Carlos; Ferreira, Fernando

    2017-06-15

    African swine fever virus (ASFV) codes for a putative histone-like protein (pA104R) with extensive sequence homology to bacterial proteins that are implicated in genome replication and packaging. Functional characterization of purified recombinant pA104R revealed that it binds to single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) over a wide range of temperatures, pH values, and salt concentrations and in an ATP-independent manner, with an estimated binding site size of about 14 to 16 nucleotides. Using site-directed mutagenesis, the arginine located in pA104R's DNA-binding domain, at position 69, was found to be relevant for efficient DNA-binding activity. Together, pA104R and ASFV topoisomerase II (pP1192R) display DNA-supercoiling activity, although none of the proteins by themselves do, indicating that the two cooperate in this process. In ASFV-infected cells, A104R transcripts were detected from 2 h postinfection (hpi) onward, reaching a maximum concentration around 16 hpi. pA104R was detected from 12 hpi onward, localizing with viral DNA replication sites and being found exclusively in the Triton-insoluble fraction. Small interfering RNA (siRNA) knockdown experiments revealed that pA104R plays a critical role in viral DNA replication and gene expression, with transfected cells showing lower viral progeny numbers (up to a reduction of 82.0%), lower copy numbers of viral genomes (-78.3%), and reduced transcription of a late viral gene (-47.6%). Taken together, our results strongly suggest that pA104R participates in the modulation of viral DNA topology, probably being involved in viral DNA replication, transcription, and packaging, emphasizing that ASFV mutants lacking the A104R gene could be used as a strategy to develop a vaccine against ASFV. IMPORTANCE Recently reintroduced in Europe, African swine fever virus (ASFV) causes a fatal disease in domestic pigs, causing high economic losses in affected countries, as no vaccine or treatment is currently available. Remarkably, ASFV is the only known mammalian virus that putatively codes for a histone-like protein (pA104R) that shares extensive sequence homology with bacterial histone-like proteins. In this study, we characterized the DNA-binding properties of pA104R, analyzed the functional importance of two conserved residues, and showed that pA104R and ASFV topoisomerase II cooperate and display DNA-supercoiling activity. Moreover, pA104R is expressed during the late phase of infection and accumulates in viral DNA replication sites, and its downregulation revealed that pA104R is required for viral DNA replication and transcription. These results suggest that pA104R participates in the modulation of viral DNA topology and genome packaging, indicating that A104R deletion mutants may be a good strategy for vaccine development against ASFV. Copyright © 2017 American Society for Microbiology.

  9. The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

    Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

  10. Structural Basis for the Interaction of Mutasome Assembly Factor REV1 with Ubiquitin.

    PubMed

    Cui, Gaofeng; Botuyan, Maria Victoria; Mer, Georges

    2018-05-18

    REV1 is an evolutionarily conserved translesion synthesis (TLS) DNA polymerase and an assembly factor key for the recruitment of other TLS polymerases to DNA damage sites. REV1-mediated recognition of ubiquitin in the proliferative cell nuclear antigen is thought to be the trigger for TLS activation. Here we report the solution NMR structure of a 108-residue fragment of human REV1 encompassing the two putative ubiquitin-binding motifs UBM1 and UBM2 in complex with ubiquitin. While in mammals UBM1 and UBM2 are both required for optimal association of REV1 with replication factories after DNA damage, we show that only REV1 UBM2 binds ubiquitin. Structure-guided mutagenesis in Saccharomyces cerevisiae further highlights the importance of UBM2 for REV1-mediated mutagenesis and DNA damage tolerance. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    PubMed

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  12. Quantification of transcription factor-DNA binding affinity in a living cell

    PubMed Central

    Belikov, Sergey; Berg, Otto G.; Wrange, Örjan

    2016-01-01

    The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [3H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. PMID:26657626

  13. Recognition of chromatin by the plant alkaloid, ellipticine as a dual binder

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banerjee, Amrita; Sanyal, Sulagna; Majumder, Parijat

    Recognition of core histone components of chromatin along with chromosomal DNA by a class of small molecule modulators is worth examining to evaluate their intracellular mode of action. A plant alkaloid ellipticine (ELP) which is a putative anticancer agent has so far been reported to function via DNA intercalation, association with topoisomerase II and binding to telomere region. However, its effect upon the potential intracellular target, chromatin is hitherto unreported. Here we have characterized the biomolecular recognition between ELP and different hierarchical levels of chromatin. The significant result is that in addition to DNA, it binds to core histone(s) andmore » can be categorized as a ‘dual binder’. As a sequel to binding with histone(s) and core octamer, it alters post-translational histone acetylation marks. We have further demonstrated that it has the potential to modulate gene expression thereby regulating several key biological processes such as nuclear organization, transcription, translation and histone modifications. - Highlights: • Ellipticine acts a dual binder binding to both DNA and core histone(s). • It induces structural perturbations in chromatin, chromatosome and histone octamer. • It alters histones acetylation and affects global gene expression.« less

  14. iDBPs: a web server for the identification of DNA binding proteins.

    PubMed

    Nimrod, Guy; Schushan, Maya; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir

    2010-03-01

    The iDBPs server uses the three-dimensional (3D) structure of a query protein to predict whether it binds DNA. First, the algorithm predicts the functional region of the protein based on its evolutionary profile; the assumption is that large clusters of conserved residues are good markers of functional regions. Next, various characteristics of the predicted functional region as well as global features of the protein are calculated, such as the average surface electrostatic potential, the dipole moment and cluster-based amino acid conservation patterns. Finally, a random forests classifier is used to predict whether the query protein is likely to bind DNA and to estimate the prediction confidence. We have trained and tested the classifier on various datasets and shown that it outperformed related methods. On a dataset that reflects the fraction of DNA binding proteins (DBPs) in a proteome, the area under the ROC curve was 0.90. The application of the server to an updated version of the N-Func database, which contains proteins of unknown function with solved 3D-structure, suggested new putative DBPs for experimental studies. http://idbps.tau.ac.il/

  15. DNA-Damage Response RNA-Binding Proteins (DDRBPs): Perspectives from a New Class of Proteins and Their RNA Targets.

    PubMed

    Dutertre, Martin; Vagner, Stéphan

    2017-10-27

    Upon DNA damage, cells trigger an early DNA-damage response (DDR) involving DNA repair and cell cycle checkpoints, and late responses involving gene expression regulation that determine cell fate. Screens for genes involved in the DDR have found many RNA-binding proteins (RBPs), while screens for novel RBPs have identified DDR proteins. An increasing number of RBPs are involved in early and/or late DDR. We propose to call this new class of actors of the DDR, which contain an RNA-binding activity, DNA-damage response RNA-binding proteins (DDRBPs). We then discuss how DDRBPs contribute not only to gene expression regulation in the late DDR but also to early DDR signaling, DNA repair, and chromatin modifications at DNA-damage sites through interactions with both long and short noncoding RNAs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Identification of a novel prophage-like gene cluster actively expressed in both virulent and avirulent strains of Leptospira interrogans serovar Lai.

    PubMed

    Qin, Jin-Hong; Zhang, Qing; Zhang, Zhi-Ming; Zhong, Yi; Yang, Yang; Hu, Bao-Yu; Zhao, Guo-Ping; Guo, Xiao-Kui

    2008-06-01

    DNA microarray analysis was used to compare the differential gene expression profiles between Leptospira interrogans serovar Lai type strain 56601 and its corresponding attenuated strain IPAV. A 22-kb genomic island covering a cluster of 34 genes (i.e., genes LA0186 to LA0219) was actively expressed in both strains but concomitantly upregulated in strain 56601 in contrast to that of IPAV. Reverse transcription-PCR assays proved that the gene cluster comprised five transcripts. Gene annotation of this cluster revealed characteristics of a putative prophage-like remnant with at least 8 of 34 sequences encoding prophage-like proteins, of which the LA0195 protein is probably a putative prophage CI-like regulator. The transcription initiation activities of putative promoter-regulatory sequences of transcripts I, II, and III, all proximal to the LA0195 gene, were further analyzed in the Escherichia coli promoter probe vector pKK232-8 by assaying the reporter chloramphenicol acetyltransferase (CAT) activities. The strong promoter activities of both transcripts I and II indicated by the E. coli CAT assay were well correlated with the in vitro sequence-specific binding of the recombinant LA0195 protein to the corresponding promoter probes detected by the electrophoresis mobility shift assay. On the other hand, the promoter activity of transcript III was very low in E. coli and failed to show active binding to the LA0195 protein in vitro. These results suggested that the LA0195 protein is likely involved in the transcription of transcripts I and II. However, the identical complete DNA sequences of this prophage remnant from these two strains strongly suggests that possible regulatory factors or signal transduction systems residing outside of this region within the genome may be responsible for the differential expression profiling in these two strains.

  17. Putative bovine topological association domains and CTCF binding motifs can reduce the search space for causative regulatory variants of complex traits.

    PubMed

    Wang, Min; Hancock, Timothy P; Chamberlain, Amanda J; Vander Jagt, Christy J; Pryce, Jennie E; Cocks, Benjamin G; Goddard, Mike E; Hayes, Benjamin J

    2018-05-24

    Topological association domains (TADs) are chromosomal domains characterised by frequent internal DNA-DNA interactions. The transcription factor CTCF binds to conserved DNA sequence patterns called CTCF binding motifs to either prohibit or facilitate chromosomal interactions. TADs and CTCF binding motifs control gene expression, but they are not yet well defined in the bovine genome. In this paper, we sought to improve the annotation of bovine TADs and CTCF binding motifs, and assess whether the new annotation can reduce the search space for cis-regulatory variants. We used genomic synteny to map TADs and CTCF binding motifs from humans, mice, dogs and macaques to the bovine genome. We found that our mapped TADs exhibited the same hallmark properties of those sourced from experimental data, such as housekeeping genes, transfer RNA genes, CTCF binding motifs, short interspersed elements, H3K4me3 and H3K27ac. We showed that runs of genes with the same pattern of allele-specific expression (ASE) (either favouring paternal or maternal allele) were often located in the same TAD or between the same conserved CTCF binding motifs. Analyses of variance showed that when averaged across all bovine tissues tested, TADs explained 14% of ASE variation (standard deviation, SD: 0.056), while CTCF explained 27% (SD: 0.078). Furthermore, we showed that the quantitative trait loci (QTLs) associated with gene expression variation (eQTLs) or ASE variation (aseQTLs), which were identified from mRNA transcripts from 141 lactating cows' white blood and milk cells, were highly enriched at putative bovine CTCF binding motifs. The linearly-furthermost, and most-significant aseQTL and eQTL for each genic target were located within the same TAD as the gene more often than expected (Chi-Squared test P-value < 0.001). Our results suggest that genomic synteny can be used to functionally annotate conserved transcriptional components, and provides a tool to reduce the search space for causative regulatory variants in the bovine genome.

  18. Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.

    PubMed

    Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P

    2001-08-17

    Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.

  19. Computational modeling on the recognition of the HRE motif by HIF-1: molecular docking and molecular dynamics studies.

    PubMed

    Sokkar, Pandian; Sathis, Vani; Ramachandran, Murugesan

    2012-05-01

    Hypoxia inducible factor-1 (HIF-1) is a bHLH-family transcription factor that controls genes involved in glycolysis, angiogenesis, migration, as well as invasion factors that are important for tumor progression and metastasis. HIF-1, a heterodimer of HIF-1α and HIF-1β, binds to the hypoxia responsive element (HRE) present in the promoter regions of hypoxia responsive genes, such as vascular endothelial growth factor (VEGF). Neither the structure of free HIF-1 nor that of its complex with HRE is available. Computational modeling of the transcription factor-DNA complex has always been challenging due to their inherent flexibility and large conformational space. The present study aims to model the interaction between the DNA-binding domain of HIF-1 and HRE. Experiments showed that rigid macromolecular docking programs (HEX and GRAMM-X) failed to predict the optimal dimerization of individually modeled HIF-1 subunits. Hence, the HIF-1 heterodimer was modeled based on the phosphate system positive regulatory protein (PHO4) homodimer. The duplex VEGF-DNA segment containing HRE with flanking nucleotides was modeled in the B form and equilibrated via molecular dynamics (MD) simulation. A rigid docking approach was used to predict the crude binding mode of HIF-1 dimer with HRE, in which the putative contacts were found to be present. An MD simulation (5 ns) of the HIF-1-HRE complex in explicit water was performed to account for its flexibility and to optimize its interactions. All of the conserved amino acid residues were found to play roles in the recognition of HRE. The present work, which sheds light on the recognition of HRE by HIF-1, could be beneficial in the design of peptide or small molecule therapeutics that can mimic HIF-1 and bind with the HRE sequence.

  20. Neisseria conserved protein DMP19 is a DNA mimic protein that prevents DNA binding to a hypothetical nitrogen-response transcription factor

    PubMed Central

    Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.

    2012-01-01

    DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915

  1. Novel DNA Motif Binding Activity Observed In Vivo With an Estrogen Receptor α Mutant Mouse

    PubMed Central

    Li, Leping; Grimm, Sara A.; Winuthayanon, Wipawee; Hamilton, Katherine J.; Pockette, Brianna; Rubel, Cory A.; Pedersen, Lars C.; Fargo, David; Lanz, Rainer B.; DeMayo, Francesco J.; Schütz, Günther; Korach, Kenneth S.

    2014-01-01

    Estrogen receptor α (ERα) interacts with DNA directly or indirectly via other transcription factors, referred to as “tethering.” Evidence for tethering is based on in vitro studies and a widely used “KIKO” mouse model containing mutations that prevent direct estrogen response element DNA- binding. KIKO mice are infertile, due in part to the inability of estradiol (E2) to induce uterine epithelial proliferation. To elucidate the molecular events that prevent KIKO uterine growth, regulation of the pro-proliferative E2 target gene Klf4 and of Klf15, a progesterone (P4) target gene that opposes the pro-proliferative activity of KLF4, was evaluated. Klf4 induction was impaired in KIKO uteri; however, Klf15 was induced by E2 rather than by P4. Whole uterine chromatin immunoprecipitation-sequencing revealed enrichment of KIKO ERα binding to hormone response elements (HREs) motifs. KIKO binding to HRE motifs was verified using reporter gene and DNA-binding assays. Because the KIKO ERα has HRE DNA-binding activity, we evaluated the “EAAE” ERα, which has more severe DNA-binding domain mutations, and demonstrated a lack of estrogen response element or HRE reporter gene induction or DNA-binding. The EAAE mouse has an ERα null–like phenotype, with impaired uterine growth and transcriptional activity. Our findings demonstrate that the KIKO mouse model, which has been used by numerous investigators, cannot be used to establish biological functions for ERα tethering, because KIKO ERα effectively stimulates transcription using HRE motifs. The EAAE-ERα DNA-binding domain mutant mouse demonstrates that ERα DNA-binding is crucial for biological and transcriptional processes in reproductive tissues and that ERα tethering may not contribute to estrogen responsiveness in vivo. PMID:24713037

  2. Mapping and analysis of Caenorhabditis elegans transcription factor sequence specificities

    PubMed Central

    Narasimhan, Kamesh; Lambert, Samuel A; Yang, Ally WH; Riddell, Jeremy; Mnaimneh, Sanie; Zheng, Hong; Albu, Mihai; Najafabadi, Hamed S; Reece-Hoyes, John S; Fuxman Bass, Juan I; Walhout, Albertha JM; Weirauch, Matthew T; Hughes, Timothy R

    2015-01-01

    Caenorhabditis elegans is a powerful model for studying gene regulation, as it has a compact genome and a wealth of genomic tools. However, identification of regulatory elements has been limited, as DNA-binding motifs are known for only 71 of the estimated 763 sequence-specific transcription factors (TFs). To address this problem, we performed protein binding microarray experiments on representatives of canonical TF families in C. elegans, obtaining motifs for 129 TFs. Additionally, we predict motifs for many TFs that have DNA-binding domains similar to those already characterized, increasing coverage of binding specificities to 292 C. elegans TFs (∼40%). These data highlight the diversification of binding motifs for the nuclear hormone receptor and C2H2 zinc finger families and reveal unexpected diversity of motifs for T-box and DM families. Motif enrichment in promoters of functionally related genes is consistent with known biology and also identifies putative regulatory roles for unstudied TFs. DOI: http://dx.doi.org/10.7554/eLife.06967.001 PMID:25905672

  3. Odorant-binding proteins from a primitive termite.

    PubMed

    Ishida, Yuko; Chiang, Vicky P; Haverty, Michael I; Leal, Walter S

    2002-09-01

    Hitherto, odorant-binding proteins (OBPs) have been identified from insects belonging to more highly evolved insect orders (Lepidoptera, Coleoptera, Diptera, Hymenoptera, and Hemiptera), whereas only chemosensory proteins have been identified from more primitive species, such as orthopteran and phasmid species. Here, we report for the first time the isolation and cloning of odorant-binding proteins from a primitive termite species, the dampwood termite. Zootermopsis nevadensis nevadensis (Isoptera: Termopsidae). A major antennae-specific protein was detected by native PAGE along with four other minor proteins, which were also absent in the extract from control tissues (hindlegs). Multiple cDNA cloning led to the full characterization of the major antennae-specific protein (ZnevOBP1) and to the identification of two other antennae-specific cDNAs, encoding putative odorant-binding proteins (ZnevOBP2 and ZnevOBP3). N-terminal amino acid sequencing of the minor antennal bands and cDNA cloning showed that olfaction in Z. n. nevadensis may involve multiple odorant-binding proteins. Database searches suggest that the OBPs from this primitive termite are homologues of the pheromone-binding proteins from scarab beetles and antennal-binding proteins from moths.

  4. Developmental and Thyroid Hormone Regulation of the DNA Methyltransferase 3a Gene in Xenopus Tadpoles

    PubMed Central

    Kyono, Yasuhiro; Sachs, Laurent M.; Bilesimo, Patrice; Wen, Luan

    2016-01-01

    Thyroid hormone is essential for normal development in vertebrates. In amphibians, T3 controls metamorphosis by inducing tissue-specific gene regulation programs. A hallmark of T3 action is the modification of chromatin structure, which underlies changes in gene transcription. We found that mRNA for the de novo DNA methyltransferase (DNMT) dnmt3a, but not dnmt1, increased in the brain of Xenopus tadpoles during metamorphosis in parallel with plasma [T3]. Addition of T3 to the rearing water caused a time-dependent increase in dnmt3a mRNA in tadpole brain, tail, and hind limb. By analyzing data from a genome-wide analysis of T3 receptor (TR) binding in tadpole tail, we identified several putative T3 response elements (TREs) within the dnmt3a locus. Using in vitro DNA binding, transient transfection-reporter, and chromatin immunoprecipitation assays for TRs, we identified two functional TREs at −7.1 kb and +5.1 kb relative to the dnmt3a transcription start site. Sequence alignment showed that these TREs are conserved between two related frog species, X. laevis and X. tropicalis, but not with amniotes. Our previous findings showed that this gene is directly regulated by liganded TRs in mouse brain, and whereas the two mouse TREs are conserved among Eutherian mammals, they are not conserved in Xenopus species. Thus, although T3 regulation of dnmt3a may be an ancient pathway in vertebrates, the genomic sites responsible for hormone regulation may have diverged or arisen by convergent evolution. We hypothesize that direct T3 regulation of dnmt3a may be an important mechanism for modulating global changes in DNA methylation. PMID:27779916

  5. The putative Agrobacterium transcriptional activator-like virulence protein VirD5 may target T-complex to prevent the degradation of coat proteins in the plant cell nucleus.

    PubMed

    Wang, Yafei; Peng, Wei; Zhou, Xu; Huang, Fei; Shao, Lingyun; Luo, Meizhong

    2014-09-01

    Agrobacterium exports at least five virulence proteins (VirE2, VirE3, VirF, VirD2, VirD5) into host cells and hijacks some host plant factors to facilitate its transformation process. Random DNA binding selection assays (RDSAs), electrophoretic mobility shift assays (EMSAs) and yeast one-hybrid systems were used to identify protein-bound DNA elements. Bimolecular fluorescence complementation, glutathione S-transferase pull-down and yeast two-hybrid assays were used to detect protein interactions. Protoplast transformation, coprecipitation, competitive binding and cell-free degradation assays were used to analyze the relationships among proteins. We found that Agrobacterium VirD5 exhibits transcriptional activation activity in yeast, is located in the plant cell nucleus, and forms homodimers. A specific VirD5-bound DNA element designated D5RE (VirD5 response element) was identified. VirD5 interacted directly with Arabidopsis VirE2 Interacting Protein 1 (AtVIP1). However, the ternary complex of VirD5-AtVIP1-VirE2 could be detected, whereas that of VirD5-AtVIP1-VBF (AtVIP1 Binding F-box protein) could not. We demonstrated that VirD5 competes with VBF for binding to AtVIP1 and stabilizes AtVIP1 and VirE2 in the cell-free degradation system. Our results indicated that VirD5 may act as both a transcriptional activator-like effector to regulate host gene expression and a protector preventing the coat proteins of the T-complex from being quickly degraded by the host's ubiquitin proteasome system (UPS). © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  6. Repeated administration of CGP 46381, a gamma-aminobutyric acidB antagonist, and ethosuximide suppresses seizure-associated cyclic adenosine 3'5' monophosphate response element- and activator protein-1 DNA-binding activities in lethargic (lh/lh) mice.

    PubMed

    Ishige, K; Endo, H; Saito, H; Ito, Y

    2001-01-19

    To characterize seizure-associated increases in cerebral cortical and thalamic cyclic AMP responsive element (CRE)- and activator protein 1 (AP-1) DNA-binding activities in lethargic (lh/lh) mice, a genetic model of absence seizures, we examined the effects of ethosuximide and CGP 46381 on these DNA-binding activities. Repeated administration (twice a day for 5 days) of ethosuximide (200 mg/kg) or CGP 46381 (60 mg/kg) attenuated both seizure behavior and the increased DNA-binding activities, and was more effective than a single administration of these drugs. These treatments did not affect either normal behavior or basal DNA-binding activities in non-epileptic control (+/+) mice. Gel supershift assays revealed that the increased CRE-binding activity was attributable to activation of the binding activity of CREB, and that the c-Fos-c-Jun complex was a component of the increased AP-1 DNA-binding activity.

  7. Dual DNA binding property of ABA insensitive 3 like factors targeted to promoters responsive to ABA and auxin.

    PubMed

    Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee

    2005-11-01

    The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.

  8. Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

    2010-02-19

    Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

  9. Transactivation of a cellular promoter by the NS1 protein of the parvovirus minute virus of mice through a putative hormone-responsive element.

    PubMed Central

    Vanacker, J M; Corbau, R; Adelmant, G; Perros, M; Laudet, V; Rommelaere, J

    1996-01-01

    The promoter of the thyroid hormone receptor alpha gene (c-erbA-1) is activated by the nonstructural protein 1 (NS1) of parvovirus minute virus of mice (prototype strain [MVMp]) in ras-transformed FREJ4 cells that are permissive for lytic MVMp replication. This stimulation may be related to the sensitivity of host cells to MVMp, as it does not take place in parental FR3T3 cells, which are resistant to the parvovirus killing effect. The analysis of a series of deletion and point mutants of the c-erbA-1 promoter led to the identification of an upstream region that is necessary for NS1-driven transactivation. This sequence harbors a putative hormone-responsive element and is sufficient to render a minimal promoter NS1 inducible in FREJ4 but not in FR3T3 cells, and it is involved in distinct interactions with proteins from the respective cell lines. The NS1-responsive element of the c-erbA-1 promoter bears no homology with sequences that were previously reported to be necessary for NS1 DNA binding and transactivation. Altogether, our data point to a novel, cell-specific mechanism of promoter activation by NS1. PMID:8642664

  10. Genome-wide Expression Profiling, In Vivo DNA Binding Analysis, and Probabilistic Motif Prediction Reveal Novel Abf1 Target Genes during Fermentation, Respiration, and Sporulation in Yeast

    PubMed Central

    Schlecht, Ulrich; Erb, Ionas; Demougin, Philippe; Robine, Nicolas; Borde, Valérie; van Nimwegen, Erik; Nicolas, Alain

    2008-01-01

    The autonomously replicating sequence binding factor 1 (Abf1) was initially identified as an essential DNA replication factor and later shown to be a component of the regulatory network controlling mitotic and meiotic cell cycle progression in budding yeast. The protein is thought to exert its functions via specific interaction with its target site as part of distinct protein complexes, but its roles during mitotic growth and meiotic development are only partially understood. Here, we report a comprehensive approach aiming at the identification of direct Abf1-target genes expressed during fermentation, respiration, and sporulation. Computational prediction of the protein's target sites was integrated with a genome-wide DNA binding assay in growing and sporulating cells. The resulting data were combined with the output of expression profiling studies using wild-type versus temperature-sensitive alleles. This work identified 434 protein-coding loci as being transcriptionally dependent on Abf1. More than 60% of their putative promoter regions contained a computationally predicted Abf1 binding site and/or were bound by Abf1 in vivo, identifying them as direct targets. The present study revealed numerous loci previously unknown to be under Abf1 control, and it yielded evidence for the protein's variable DNA binding pattern during mitotic growth and meiotic development. PMID:18305101

  11. Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.

    PubMed

    Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki

    2014-07-01

    Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Evaluation of Impermeant, DNA-Binding Dye Fluorescence as a Real-Time Readout of Eukaryotic Cell Toxicity in a High Throughput Screening Format

    PubMed Central

    Chiaraviglio, Lucius

    2014-01-01

    Abstract Interpretation of high throughput screening (HTS) data in cell-based assays may be confounded by cytotoxic properties of screening compounds. Therefore, assessing cell toxicity in real time during the HTS process itself would be highly advantageous. Here, we investigate the potential of putatively impermeant, fluorescent, DNA-binding dyes to give cell toxicity readout during HTS. Amongst 19 DNA-binding dyes examined, three classes were identified that were (1) permeant, (2) cytotoxic, or (3) neither permeant nor cytotoxic during 3-day incubation with a macrophage cell line. In the last class, four dyes (SYTOX Green, CellTox Green, GelGreen, and EvaGreen) gave highly robust cytotoxicity data in 384-well screening plates. As proof of principle, successful combination with a luminescence-based assay in HTS format was demonstrated. Here, both intracellular growth of Legionella pneumophila (luminescence) and host cell viability (SYTOX Green exclusion) were assayed in the same screening well. Incorporation of membrane-impermeant, DNA-binding, fluorescent dyes in HTS assays should prove useful by allowing evaluation of cytotoxicity in real time, eliminating reagent addition steps and effort associated with endpoint cell viability analysis, and reducing the need for follow-up cytotoxicity screening. PMID:24831788

  13. iDBPs: a web server for the identification of DNA binding proteins

    PubMed Central

    Nimrod, Guy; Schushan, Maya; Szilágyi, András; Leslie, Christina; Ben-Tal, Nir

    2010-01-01

    Summary: The iDBPs server uses the three-dimensional (3D) structure of a query protein to predict whether it binds DNA. First, the algorithm predicts the functional region of the protein based on its evolutionary profile; the assumption is that large clusters of conserved residues are good markers of functional regions. Next, various characteristics of the predicted functional region as well as global features of the protein are calculated, such as the average surface electrostatic potential, the dipole moment and cluster-based amino acid conservation patterns. Finally, a random forests classifier is used to predict whether the query protein is likely to bind DNA and to estimate the prediction confidence. We have trained and tested the classifier on various datasets and shown that it outperformed related methods. On a dataset that reflects the fraction of DNA binding proteins (DBPs) in a proteome, the area under the ROC curve was 0.90. The application of the server to an updated version of the N-Func database, which contains proteins of unknown function with solved 3D-structure, suggested new putative DBPs for experimental studies. Availability: http://idbps.tau.ac.il/ Contact: NirB@tauex.tau.ac.il Supplementary information: Supplementary data are available at Bioinformatics online. PMID:20089514

  14. Microtubule actin cross-linking factor (MACF): a hybrid of dystonin and dystrophin that can interact with the actin and microtubule cytoskeletons.

    PubMed

    Leung, C L; Sun, D; Zheng, M; Knowles, D R; Liem, R K

    1999-12-13

    We cloned and characterized a full-length cDNA of mouse actin cross-linking family 7 (mACF7) by sequential rapid amplification of cDNA ends-PCR. The completed mACF7 cDNA is 17 kb and codes for a 608-kD protein. The closest relative of mACF7 is the Drosophila protein Kakapo, which shares similar architecture with mACF7. mACF7 contains a putative actin-binding domain and a plakin-like domain that are highly homologous to dystonin (BPAG1-n) at its NH(2) terminus. However, unlike dystonin, mACF7 does not contain a coiled-coil rod domain; instead, the rod domain of mACF7 is made up of 23 dystrophin-like spectrin repeats. At its COOH terminus, mACF7 contains two putative EF-hand calcium-binding motifs and a segment homologous to the growth arrest-specific protein, Gas2. In this paper, we demonstrate that the NH(2)-terminal actin-binding domain of mACF7 is functional both in vivo and in vitro. More importantly, we found that the COOH-terminal domain of mACF7 interacts with and stabilizes microtubules. In transfected cells full-length mACF7 can associate not only with actin but also with microtubules. Hence, we suggest a modified name: MACF (microtubule actin cross-linking factor). The properties of MACF are consistent with the observation that mutations in kakapo cause disorganization of microtubules in epidermal muscle attachment cells and some sensory neurons.

  15. Mapping and mutagenesis of the amino-terminal transcriptional repression domain of the Drosophila Krüppel protein.

    PubMed Central

    Licht, J D; Hanna-Rose, W; Reddy, J C; English, M A; Ro, M; Grossel, M; Shaknovich, R; Hansen, U

    1994-01-01

    We previously demonstrated that the Drosophila Krüppel protein is a transcriptional repressor with separable DNA-binding and transcriptional repression activities. In this study, the minimal amino (N)-terminal repression region of the Krüppel protein was defined by transferring regions of the Krüppel protein to a heterologous DNA-binding protein, the lacI protein. Fusion of a predicted alpha-helical region from amino acids 62 to 92 in the N terminus of the Krüppel protein was sufficient to transfer repression activity. This putative alpha-helix has several hydrophobic surfaces, as well as a glutamine-rich surface. Mutants containing multiple amino acid substitutions of the glutamine residues demonstrated that this putative alpha-helical region is essential for repression activity of a Krüppel protein containing the entire N-terminal and DNA-binding regions. Furthermore, one point mutant with only a single glutamine on this surface altered to lysine abolished the ability of the Krüppel protein to repress, indicating the importance of the amino acid at residue 86 for repression. The N terminus also contained an adjacent activation region localized between amino acids 86 and 117. Finally, in accordance with predictions from primary amino acid sequence similarity, a repression region from the Drosophila even-skipped protein, which was six times more potent than that of the Krüppel protein in the mammalian cells, was characterized. This segment included a hydrophobic stretch of 11 consecutive alanine residues and a proline-rich region. Images PMID:8196644

  16. In vitro CpG methylation increases the transformation efficiency of Borrelia burgdorferi strains harboring the endogenous linear plasmid lp56.

    PubMed

    Chen, Qiang; Fischer, Joshua R; Benoit, Vivian M; Dufour, Nicholas P; Youderian, Philip; Leong, John M

    2008-12-01

    Borrelia burgdorferi is the causative agent of Lyme disease, the most common vector-borne illness in the Northern hemisphere. Low-passage-number infectious strains of B. burgdorferi exhibit extremely low transformation efficiencies-so low, in fact, as to hinder the genetic study of putative virulence factors. Two putative restriction-modification (R-M) systems, BBE02 contained on linear plasmid 25 (lp25) and BBQ67 contained on lp56, have been postulated to contribute to this poor transformability. Restriction barriers posed by other bacteria have been overcome by the in vitro methylation of DNA prior to transformation. To test whether a methylation-sensitive restriction system contributes to poor B. burgdorferi transformability, shuttle plasmids were treated with the CpG methylase M.SssI prior to the electroporation of a variety of strains harboring different putative R-M systems. We found that for B. burgdorferi strains that harbor lp56, in vitro methylation increased transformation by at least 1 order of magnitude. These results suggest that in vitro CpG methylation protects exogenous DNA from degradation by an lp56-contained R-M system, presumably BBQ67. The utility of in vitro methylation for the genetic manipulation of B. burgdorferi was exemplified by the ease of plasmid complementation of a B. burgdorferi B31 A3 BBK32 kanamycin-resistant (B31 A3 BBK32::Kan(r)) mutant, deficient in the expression of the fibronectin- and glycosaminoglycan (GAG)-binding adhesin BBK32. Consistent with the observation that several surface proteins may promote GAG binding, the B. burgdorferi B31 A3 BBK32::Kan(r) mutant demonstrated no defect in the ability to bind purified GAGs or GAGs expressed on the surfaces of cultured cells.

  17. Molecular cloning of a C-type lectin with two CRD domains from the banana shrimp Fenneropenaeus merguiensis: early gene up-regulation after Vibrio harveyi infection.

    PubMed

    Rattanaporn, Onnicha; Utarabhand, Prapaporn

    2011-02-01

    A diverse class of pattern-recognition proteins called lectins play important roles in shrimp innate immunity. A novel C-type lectin gene (FmLC) was cloned from the hepatopancreas of banana shrimp Fenneropenaeus merguiensis by means of PCR and 5' and 3' rapid amplification of cDNA ends (RACE). The full-length cDNA consists of 1118 bp with one 1002 bp open reading frame, encoding 333 amino acids. Its deduced amino acid sequence contains a putative signal peptide of 20 amino acids. FmLC contains two carbohydrate recognition domains, CRD1 and CRD2, that share only 30% identity with each other. The first CRD comprises a QPD motif with specificity for binding galactose and a single Ca(2+) binding site, while the second CRD consists of an EPN motif for a mannose-specific binding site. FmLC had a close evolutionary relationship to other dual-CRD lectins of penaeid shrimp. Expression results showed that transcripts of FmLC were detected only in the hepatopancreas, none was found in other tissues. After challenging either whole shrimp or hepatopancreas tissue fragments with Vibrioharveyi, the expression of FmLC was up-regulated. This indicates that FmLC is inducible and may be involved in a shrimp immune response to recognize potential bacterial pathogens. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

    PubMed

    Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

    2017-11-01

    Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. G =  MAT: linking transcription factor expression and DNA binding data.

    PubMed

    Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak

    2011-01-31

    Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/.

  20. G = MAT: Linking Transcription Factor Expression and DNA Binding Data

    PubMed Central

    Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak

    2011-01-01

    Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/. PMID:21297945

  1. NPAS1-ARNT and NPAS3-ARNT crystal structures implicate the bHLH-PAS family as multi-ligand binding transcription factors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Dalei; Su, Xiaoyu; Potluri, Nalini

    Here, the neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the widermore » mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.« less

  2. NPAS1-ARNT and NPAS3-ARNT crystal structures implicate the bHLH-PAS family as multi-ligand binding transcription factors

    DOE PAGES

    Wu, Dalei; Su, Xiaoyu; Potluri, Nalini; ...

    2016-10-26

    Here, the neuronal PAS domain proteins NPAS1 and NPAS3 are members of the basic helix-loop-helix-PER-ARNT-SIM (bHLH-PAS) family, and their genetic deficiencies are linked to a variety of human psychiatric disorders including schizophrenia, autism spectrum disorders and bipolar disease. NPAS1 and NPAS3 must each heterodimerize with the aryl hydrocarbon receptor nuclear translocator (ARNT), to form functional transcription complexes capable of DNA binding and gene regulation. Here we examined the crystal structures of multi-domain NPAS1-ARNT and NPAS3-ARNT-DNA complexes, discovering each to contain four putative ligand-binding pockets. Through expanded architectural comparisons between these complexes and HIF-1α-ARNT, HIF-2α-ARNT and CLOCK-BMAL1, we show the widermore » mammalian bHLH-PAS family is capable of multi-ligand-binding and presents as an ideal class of transcription factors for direct targeting by small-molecule drugs.« less

  3. DNA stabilization at the Bacillus subtilis PolX core—a binding model to coordinate polymerase, AP-endonuclease and 3′-5′ exonuclease activities

    PubMed Central

    Baños, Benito; Villar, Laurentino; Salas, Margarita; de Vega, Miguel

    2012-01-01

    Family X DNA polymerases (PolXs) are involved in DNA repair. Their binding to gapped DNAs relies on two conserved helix-hairpin-helix motifs, one located at the 8-kDa domain and the other at the fingers subdomain. Bacterial/archaeal PolXs have a specifically conserved third helix-hairpin-helix motif (GFGxK) at the fingers subdomain whose putative role in DNA binding had not been established. Here, mutagenesis at the corresponding residues of Bacillus subtilis PolX (PolXBs), Gly130, Gly132 and Lys134 produced enzymes with altered DNA binding properties affecting the three enzymatic activities of the protein: polymerization, located at the PolX core, 3′-5′ exonucleolysis and apurinic/apyrimidinic (AP)-endonucleolysis, placed at the so-called polymerase and histidinol phosphatase domain. Furthermore, we have changed Lys192 of PolXBs, a residue moderately conserved in the palm subdomain of bacterial PolXs and immediately preceding two catalytic aspartates of the polymerization reaction. The results point to a function of residue Lys192 in guaranteeing the right orientation of the DNA substrates at the polymerization and histidinol phosphatase active sites. The results presented here and the recently solved structures of other bacterial PolX ternary complexes lead us to propose a structural model to account for the appropriate coordination of the different catalytic activities of bacterial PolXs. PMID:22844091

  4. Modulation of intracellular protein degradation by SSB1-SIS1 chaperon system in yeast S. cerevisiae.

    PubMed

    Ohba, M

    1997-06-09

    In prokaryotes, DnaK-DnaJ chaperon is involved in the protein degradation catalyzed by proteases La and ClpA/B complex as shown in E. coli. To extend this into eukaryotic cells, we examined the effects of hsp70 genes, SSA1 and SSB1, and DnaJ genes, SIS1 and YDJ1, on the growth of proteasome subunit mutants of the yeast S. cerevisiae. The results identified SSB1 and SIS1 as a pair of chaperon genes specifically involved in efficient protein turnover in the yeast, whose overexpression suppressed the growth defects caused by the proteasome mutations. Moreover, a single amino acid substitution in the putative peptide-binding site of SSB1 protein profoundly enhanced the suppression activity, indicating that the activity is mediated by the peptide-binding activity of this chaperon. Thus SSB1, with its partner DnaJ, SIS1, modulates the efficiency of protein turnover through its chaperon activity.

  5. Non-coding RNA generated following lariat-debranching mediates targeting of AID to DNA

    PubMed Central

    Zheng, Simin; Vuong, Bao Q.; Vaidyanathan, Bharat; Lin, Jia-Yu; Huang, Feng-Ting; Chaudhuri, Jayanta

    2015-01-01

    SUMMARY Transcription through immunoglobulin switch (S) regions is essential for class switch recombination (CSR) but no molecular function of the transcripts has been described. Likewise, recruitment of activation-induced cytidine deaminase (AID) to S regions is critical for CSR; however, the underlying mechanism has not been fully elucidated. Here, we demonstrate that intronic switch RNA acts in trans to target AID to S region DNA. AID binds directly to switch RNA through G-quadruplexes formed by the RNA molecules. Disruption of this interaction by mutation of a key residue in the putative RNA-binding domain of AID impairs recruitment of AID to S region DNA, thereby abolishing CSR. Additionally, inhibition of RNA lariat processing leads to loss of AID localization to S regions and compromises CSR; both defects can be rescued by exogenous expression of switch transcripts in a sequence-specific manner. These studies uncover an RNA-mediated mechanism of targeting AID to DNA. PMID:25957684

  6. Removal of a putative inhibitory element reduces the calcium-dependent calmodulin activation of neuronal nitric-oxide synthase.

    PubMed

    Montgomery, H J; Romanov, V; Guillemette, J G

    2000-02-18

    Neuronal nitric-oxide synthase (NOS) and endothelial NOS are constitutive NOS isoforms that are activated by binding calmodulin in response to elevated intracellular calcium. In contrast, the inducible NOS isoform binds calmodulin at low basal levels of calcium in resting cells. Primary sequence comparisons show that each constitutive NOS isozyme contains a polypeptide segment within its reductase domain, which is absent in the inducible NOS enzyme. To study a possible link between the presence of these additional polypeptide segments in constitutive NOS enzymes and their calcium-dependent calmodulin activation, three deletion mutants were created. The putative inhibitory insert was removed from the FMN binding regions of the neuronal NOS holoenzyme and from two truncated neuronal NOS reductase enzymes in which the calmodulin binding region was either included or deleted. All three mutant enzymes showed reduced incorporation of FMN and required reconstitution with exogenous FMN for activity. The combined removal of both the calmodulin binding domain and the putative inhibitory insert did not result in a calmodulin-independent neuronal NOS reductase. Thus, although the putative inhibitory element has an effect on the calcium-dependent calmodulin activation of neuronal NOS, it does not have the properties of the typical autoinhibitory domain found in calmodulin-activated enzymes.

  7. FmLC5, a putative galactose-binding C-type lectin with two QPD motifs from the hemocytes of Fenneropenaeus merguiensis participates in shrimp immune defense.

    PubMed

    Senghoi, Wilaiwan; Runsaeng, Phanthipha; Utarabhand, Prapaporn

    2017-11-01

    Crustaceans are deficient in adaptive immune system. They depend completely on an innate immunity to protect themselves from invading microorganisms. One kind of pattern recognition receptors that contribute roles in the innate immunity is lectin. A new C-type lectin gene designated as FmLC5 was isolated from Fenneropenaeus merguiensis. Its full-length cDNA is composed of 1526bp and one open reading frame of 852bp encoding a peptide of 284 amino acids. The deduced amino acid sequence of FmLC5 comprises a signal peptide of 20 contiguous amino acids with a molecular mass of 31.47kDa and an isoelectric point of 4.35. The primary structure of FmLC5 consists of two similar carbohydrate recognition domains (CRDs), each CRD contains a Ca 2+ binding site-2 and a QPD motif specific for galactose-binding. The FmLC5 transcripts were detected only in the hemocytes analyzed by RT-PCR and in situ hybridization. The FmLC5 expression was significantly up-regulated after challenge with Vibrio harveyi, white spot syndrome virus (WSSV) or lipopolysaccharide. RNAi-based silencing with co-injection by V. harveyi or WSSV resulted in critical suppression of the FmLC5 expression, increasing in mortality and reduction of the median lethal time. These results conclude that FmLC5 is unique putative galactose-binding C-type lectin in F. merguiensis that may contribute as receptor molecule in the immune response to defend the shrimp from pathogenic bacteria and viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Basal cell adhesion molecule/lutheran protein. The receptor critical for sickle cell adhesion to laminin.

    PubMed Central

    Udani, M; Zen, Q; Cottman, M; Leonard, N; Jefferson, S; Daymont, C; Truskey, G; Telen, M J

    1998-01-01

    Sickle red cells bind significant amounts of soluble laminin, whereas normal red cells do not. Solid phase assays demonstrate that B-CAM/LU binds laminin on intact sickle red cells and that red cell B-CAM/LU binds immobilized laminin, whereas another putative laminin binding protein, CD44, does not. Ligand blots also identify B-CAM/LU as the only erythrocyte membrane protein(s) that binds laminin. Finally, transfection of murine erythroleukemia cells with human B-CAM cDNA induces binding of both soluble and immobilized laminin. Thus, B-CAM/LU appears to be the major laminin-binding protein of sickle red cells. Previously reported overexpression of B-CAM/LU by epithelial cancer cells suggests that this protein may also serve as a laminin receptor in malignant tumors. PMID:9616226

  9. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

  10. The Lipopolysaccharide and β-1,3-Glucan Binding Protein Gene Is Upregulated in White Spot Virus-Infected Shrimp (Penaeus stylirostris)

    PubMed Central

    Roux, Michelle M.; Pain, Arnab; Klimpel, Kurt R.; Dhar, Arun K.

    2002-01-01

    Pattern recognition proteins such as lipopolysaccharide and β-1,3-glucan binding protein (LGBP) play an important role in the innate immune response of crustaceans and insects. Random sequencing of cDNA clones from a hepatopancreas cDNA library of white spot virus (WSV)-infected shrimp provided a partial cDNA (PsEST-289) that showed similarity to the LGBP gene of crayfish and insects. Subsequently full-length cDNA was cloned by the 5′-RACE (rapid amplification of cDNA ends) technique and sequenced. The shrimp LGBP gene is 1,352 bases in length and is capable of encoding a polypeptide of 376 amino acids that showed significant similarity to homologous genes from crayfish, insects, earthworms, and sea urchins. Analysis of the shrimp LGBP deduced amino acid sequence identified conserved features of this gene family including a potential recognition motif for β-(1→3) linkage of polysaccharides and putative RGD cell adhesion sites. It is known that LGBP gene expression is upregulated in bacterial and fungal infection and that the binding of lipopolysaccharide and β-1,3-glucan to LGBP activates the prophenoloxidase (proPO) cascade. The temporal expression of LGBP and proPO genes in healthy and WSV-challenged Penaeus stylirostris shrimp was measured by real-time quantitative reverse transcription-PCR, and we showed that LGBP gene expression in shrimp was upregulated as the WSV infection progressed. Interestingly, the proPO expression was upregulated initially after infection followed by a downregulation as the viral infection progressed. The downward trend in the expression of proPO coincided with the detection of WSV in the infected shrimp. Our data suggest that shrimp LGBP is an inducible acute-phase protein that may play a critical role in shrimp-WSV interaction and that the WSV infection regulates the activation and/or activity of the proPO cascade in a novel way. PMID:12072514

  11. Structural analysis of the receptor binding domain of botulinum neurotoxin serotype D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yanfeng; Buchko, Garry W.; Qin, Lin

    2010-10-28

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65 Å resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences aremore » located at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10 Å relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

  12. Structural Analysis of the Receptor Binding Domain of Botulinum Neurotoxin Serotype D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Y Zhang; G Buchko; L Qin

    2011-12-31

    Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65{angstrom} resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences are locatedmore » at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10{angstrom} relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

  13. Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

    PubMed

    Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

    2018-05-23

    Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stella, Stefano; University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen; Molina, Rafael

    Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-bindingmore » domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing.« less

  15. A site-directed mutagenesis analysis of tNOX functional domains

    NASA Technical Reports Server (NTRS)

    Chueh, Pin-Ju; Morre, Dorothy M.; Morre, D. James

    2002-01-01

    Constitutive NADH oxidase proteins of the mammalian cell surface exhibit two different activities, oxidation of hydroquinones (or NADH) and protein disulfide-thiol interchange which alternate to yield oscillatory patterns with period lengths of 24 min. A drug-responsive tNOX (tumor-associated NADH oxidase) has a period length of about 22 min. The tNOX cDNA has been cloned and expressed. These two proteins are representative of cycling oxidase proteins of the plant and animal cell surface. In this report, we describe a series of eight amino acid replacements in tNOX which, when expressed in Escherichia coli, were analyzed for enzymatic activity, drug response and period length. Replacement sites selected include six cysteines that lie within the processed plasma membrane (34 kDa) form of the protein, and amino acids located in putative drug and adenine nucleotide (NADH) binding domains. The latter, plus two of the cysteine replacements, resulted in a loss of enzymatic activity. The recombinant tNOX with the modified drug binding site retained activity but the activity was no longer drug-responsive. The four remaining cysteine replacements were of interest in that both activity and drug response were retained but the period length for both NADH oxidation and protein disulfide-thiol interchange was increased from 22 min to 36 or 42 min. The findings confirm the correctness of the drug and adenine nucleotide binding motifs within the tNOX protein and imply a potential critical role of cysteine residues in determining the period length.

  16. White collar-1, a central regulator of blue light responses in Neurospora, is a zinc finger protein.

    PubMed Central

    Ballario, P; Vittorioso, P; Magrelli, A; Talora, C; Cabibbo, A; Macino, G

    1996-01-01

    The Neurospora crassa blind mutant white collar-1 (wc-1) is pleiotropically defective in all blue light-induced phenomena, establishing a role for the wc-1 gene product in the signal transduction pathway. We report the cloning of the wc-1 gene isolated by chromosome walking and mutant complementation. The elucidation of the wc-1 gene product provides a key piece of the blue light signal transduction puzzle. The wc-1 gene encodes a 125 kDa protein whose encoded motifs include a single class four, zinc finger DNA binding domain and a glutamine-rich putative transcription activation domain. We demonstrate that the wc-1 zinc finger domain, expressed in Escherichia coli, is able to bind specifically to the promoter of a blue light-regulated gene of Neurospora using an in vitro gel retardation assay. Furthermore, we show that wc-1 gene expression is autoregulated and is transcriptionally induced by blue light irradiation. Images PMID:8612589

  17. MHY1 Encodes a C2H2-Type Zinc Finger Protein That Promotes Dimorphic Transition in the Yeast Yarrowia lipolytica

    PubMed Central

    Hurtado, Cleofe A. R.; Rachubinski, Richard A.

    1999-01-01

    The yeast-to-hypha morphological transition (dimorphism) is typical of many pathogenic fungi. Dimorphism has been attributed to changes in temperature and nutritional status and is believed to constitute a mechanism of response to adverse conditions. We have isolated and characterized a gene, MHY1, whose transcription is dramatically increased during the yeast-to-hypha transition in Yarrowia lipolytica. Deletion of MHY1 is viable and has no effect on mating, but it does result in a complete inability of cells to undergo mycelial growth. MHY1 encodes a C2H2-type zinc finger protein, Mhy1p, which can bind putative cis-acting DNA stress response elements, suggesting that Mhy1p may act as a transcription factor. Interestingly, Mhy1p tagged with a hemagglutinin epitope was concentrated in the nuclei of actively growing cells found at the hyphal tip. PMID:10322005

  18. Structure analysis of FAAP24 reveals single-stranded DNA-binding activity and domain functions in DNA damage response

    PubMed Central

    Wang, Yucai; Han, Xiao; Wu, Fangming; Leung, Justin W; Lowery, Megan G; Do, Huong; Chen, Junjie; Shi, Chaowei; Tian, Changlin; Li, Lei; Gong, Weimin

    2013-01-01

    The FANCM/FAAP24 heterodimer has distinct functions in protecting cells from complex DNA lesions such as interstrand crosslinks. These functions rely on the biochemical activity of FANCM/FAAP24 to recognize and bind to damaged DNA or stalled replication forks. However, the DNA-binding activity of this complex was not clearly defined. We investigated how FAAP24 contributes to the DNA-interacting functions of the FANCM/FAAP24 complex by acquiring the N-terminal and C-terminal solution structures of human FAAP24. Modeling of the FAAP24 structure indicates that FAAP24 may possess a high affinity toward single-stranded DNA (ssDNA). Testing of various FAAP24 mutations in vitro and in vivo validated this prediction derived from structural analyses. We found that the DNA-binding and FANCM-interacting functions of FAAP24, although both require the C-terminal (HhH)2 domain, can be distinguished by segregation-of-function mutations. These results demonstrate dual roles of FAAP24 in DNA damage response against crosslinking lesions, one through the formation of FANCM/FAAP24 heterodimer and the other via its ssDNA-binding activity required in optimized checkpoint activation. PMID:23999858

  19. Purification and DNA-binding properties of the cro-type regulatory repressor protein cng encoded by the Lactobacillus plantarum phage phi g1e.

    PubMed

    Kakikawa, M; Ohkubo, S; Sakate, T; Sayama, M; Taketo, A; Kodaira, K

    2000-05-16

    The putative repressor protein Cng (10kDa on an SDS gel) for the lytic pathway of Lactobacillus plantarum phage φg1e was purified using the Escherichia coli Pt7 system, and its DNA-binding ability for the seven operator-like sequences, the GATAC-boxes (Gb1 to Gb7), was investigated in vitro. In gel-shift assays, Cng selectively bound to the DNA fragments containing the GATAC-box(es). In addition, DNase I footprinting analysis with supercoiled DNA demonstrated that Cng can specifically cover about a 25bp region centered around each of the GATAC-boxes, although two boxes, Gb4 and Gb6, were only partially protected. Moreover, protein crosslinking experiments using glutaraldehyde suggested that Cng most likely functions as a dimer. On the other hand, the binding ability of Cpg for the GATAC-boxes in supercoiled DNA was also examined under the same conditions as in Cng; unlike Cng, Cpg covered Gb4 and Gb6 completely sufficiently as well as the other five boxes. Thus, the present and previous [Kakikawa et al., Gene 215 (1998) 371-379; 242 (2000) 155-166] results indicate a possibility that the two proteins Cng and Cpg selectively bind to the GATAC-boxes that act as operators, and can decide between the lytic or lysogenic pathways through repression of the promoter activity of P(R) as well as P(L).

  20. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    PubMed

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Analysis of cis and trans Requirements for DNA Replication at the Right-End Hairpin of the Human Bocavirus 1 Genome

    PubMed Central

    Shen, Weiran; Deng, Xuefeng; Zou, Wei; Engelhardt, John F.; Yan, Ziying

    2016-01-01

    ABSTRACT Parvoviruses are single-stranded DNA viruses that use the palindromic structures at the ends of the viral genome for their replication. The mechanism of parvovirus replication has been studied mostly in the dependoparvovirus adeno-associated virus 2 (AAV2) and the protoparvovirus minute virus of mice (MVM). Here, we used human bocavirus 1 (HBoV1) to understand the replication mechanism of bocaparvovirus. HBoV1 is pathogenic to humans, causing acute respiratory tract infections, especially in young children under 2 years old. By using the duplex replicative form of the HBoV1 genome in human embryonic kidney 293 (HEK293) cells, we identified the HBoV1 minimal replication origin at the right-end hairpin (OriR). Mutagenesis analyses confirmed the putative NS1 binding and nicking sites within the OriR. Of note, unlike the large nonstructural protein (Rep78/68 or NS1) of other parvoviruses, HBoV1 NS1 did not specifically bind OriR in vitro, indicating that other viral and cellular components or the oligomerization of NS1 is required for NS1 binding to the OriR. In vivo studies demonstrated that residues responsible for NS1 binding and nicking are within the origin-binding domain. Further analysis identified that the small nonstructural protein NP1 is required for HBoV1 DNA replication at OriR. NP1 and other viral nonstructural proteins (NS1 to NS4) colocalized within the viral DNA replication centers in both OriR-transfected cells and virus-infected cells, highlighting a direct involvement of NP1 in viral DNA replication at OriR. Overall, our study revealed the characteristics of HBoV1 DNA replication at OriR, suggesting novel characteristics of autonomous parvovirus DNA replication. IMPORTANCE Human bocavirus 1 (HBoV1) causes acute respiratory tract infections in young children. The duplex HBoV1 genome replicates in HEK293 cells and produces progeny virions that are infectious in well-differentiated airway epithelial cells. A recombinant AAV2 vector pseudotyped with an HBoV1 capsid has been developed to efficiently deliver the cystic fibrosis transmembrane conductance regulator gene to human airway epithelia. Here, we identified both cis-acting elements and trans-acting proteins that are required for HBoV1 DNA replication at the right-end hairpin in HEK293 cells. We localized the minimal replication origin, which contains both NS1 nicking and binding sites, to a 46-nucleotide sequence in the right-end hairpin. The identification of these essential elements of HBoV1 DNA replication acting both in cis and in trans will provide guidance to develop antiviral strategies targeting viral DNA replication at the right-end hairpin and to design next-generation recombinant HBoV1 vectors, a promising tool for gene therapy of lung diseases. PMID:27334591

  3. Analysis of cis and trans Requirements for DNA Replication at the Right-End Hairpin of the Human Bocavirus 1 Genome.

    PubMed

    Shen, Weiran; Deng, Xuefeng; Zou, Wei; Engelhardt, John F; Yan, Ziying; Qiu, Jianming

    2016-09-01

    Parvoviruses are single-stranded DNA viruses that use the palindromic structures at the ends of the viral genome for their replication. The mechanism of parvovirus replication has been studied mostly in the dependoparvovirus adeno-associated virus 2 (AAV2) and the protoparvovirus minute virus of mice (MVM). Here, we used human bocavirus 1 (HBoV1) to understand the replication mechanism of bocaparvovirus. HBoV1 is pathogenic to humans, causing acute respiratory tract infections, especially in young children under 2 years old. By using the duplex replicative form of the HBoV1 genome in human embryonic kidney 293 (HEK293) cells, we identified the HBoV1 minimal replication origin at the right-end hairpin (OriR). Mutagenesis analyses confirmed the putative NS1 binding and nicking sites within the OriR. Of note, unlike the large nonstructural protein (Rep78/68 or NS1) of other parvoviruses, HBoV1 NS1 did not specifically bind OriR in vitro, indicating that other viral and cellular components or the oligomerization of NS1 is required for NS1 binding to the OriR. In vivo studies demonstrated that residues responsible for NS1 binding and nicking are within the origin-binding domain. Further analysis identified that the small nonstructural protein NP1 is required for HBoV1 DNA replication at OriR. NP1 and other viral nonstructural proteins (NS1 to NS4) colocalized within the viral DNA replication centers in both OriR-transfected cells and virus-infected cells, highlighting a direct involvement of NP1 in viral DNA replication at OriR. Overall, our study revealed the characteristics of HBoV1 DNA replication at OriR, suggesting novel characteristics of autonomous parvovirus DNA replication. Human bocavirus 1 (HBoV1) causes acute respiratory tract infections in young children. The duplex HBoV1 genome replicates in HEK293 cells and produces progeny virions that are infectious in well-differentiated airway epithelial cells. A recombinant AAV2 vector pseudotyped with an HBoV1 capsid has been developed to efficiently deliver the cystic fibrosis transmembrane conductance regulator gene to human airway epithelia. Here, we identified both cis-acting elements and trans-acting proteins that are required for HBoV1 DNA replication at the right-end hairpin in HEK293 cells. We localized the minimal replication origin, which contains both NS1 nicking and binding sites, to a 46-nucleotide sequence in the right-end hairpin. The identification of these essential elements of HBoV1 DNA replication acting both in cis and in trans will provide guidance to develop antiviral strategies targeting viral DNA replication at the right-end hairpin and to design next-generation recombinant HBoV1 vectors, a promising tool for gene therapy of lung diseases. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  4. DNA binding of the p21 repressor ZBTB2 is inhibited by cytosine hydroxymethylation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lafaye, Céline; Barbier, Ewa; Miscioscia, Audrey

    2014-03-28

    Highlights: • 5-hmC epigenetic modification is measurable in HeLa, SH-SY5Y and UT7-MPL cell lines. • ZBTB2 binds to DNA probes containing 5-mC but not to sequences containing 5-hmC. • This differential binding is verified with DNA sequences involved in p21 regulation. - Abstract: Recent studies have demonstrated that the modified base 5-hydroxymethylcytosine (5-hmC) is detectable at various rates in DNA extracted from human tissues. This oxidative product of 5-methylcytosine (5-mC) constitutes a new and important actor of epigenetic mechanisms. We designed a DNA pull down assay to trap and identify nuclear proteins bound to 5-hmC and/or 5-mC. We applied thismore » strategy to three cancerous cell lines (HeLa, SH-SY5Y and UT7-MPL) in which we also measured 5-mC and 5-hmC levels by HPLC-MS/MS. We found that the putative oncoprotein Zinc finger and BTB domain-containing protein 2 (ZBTB2) is associated with methylated DNA sequences and that this interaction is inhibited by the presence of 5-hmC replacing 5-mC. As published data mention ZBTB2 recognition of p21 regulating sequences, we verified that this sequence specific binding was also alleviated by 5-hmC. ZBTB2 being considered as a multifunctional cell proliferation activator, notably through p21 repression, this work points out new epigenetic processes potentially involved in carcinogenesis.« less

  5. MGMT DNA repair gene promoter/enhancer haplotypes alter transcription factor binding and gene expression.

    PubMed

    Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z

    2016-10-01

    The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.

  6. The Local Dinucleotide Preference of APOBEC3G Can Be Altered from 5′-CC to 5′-TC by a Single Amino Acid Substitution

    PubMed Central

    Rathore, Anurag; Carpenter, Michael A; Demir, Özlem; Ikeda, Terumasa; Li, Ming; Shaban, Nadine; Law, Emily K.; Anokhin, Dmitry; Brown, William L.; Amaro, Rommie E.; Harris, Reuben S.

    2013-01-01

    APOBEC3A and APOBEC3G are DNA cytosine deaminases with biological functions in foreign DNA and retrovirus restriction, respectively. APOBEC3A has an intrinsic preference for cytosine preceded by thymine (5′-TC) in single-stranded DNA substrates, whereas APOBEC3G prefers the target cytosine to be preceded by another cytosine (5′-CC). To determine the amino acids responsible for these strong dinucleotide preferences, we analyzed a series of chimeras in which putative DNA binding loop regions of APOBEC3G were replaced with the corresponding regions from APOBEC3A. Loop 3 replacement enhanced APOBEC3G catalytic activity but did not alter its intrinsic 5′-CC dinucleotide substrate preference. Loop 7 replacement caused APOBEC3G to become APOBEC3A-like and strongly prefer 5′-TC substrates. Simultaneous loop 3/7 replacement resulted in a hyperactive APOBEC3G variant that also preferred 5′-TC dinucleotides. Single amino acid exchanges revealed D317 as a critical determinant of dinucleotide substrate specificity. Multi-copy explicitly solvated all-atom molecular dynamics simulations suggested a model in which D317 acts as a helix-capping residue by constraining the mobility of loop 7, forming a novel binding pocket that favorably accommodates cytosine. All catalytically active APOBEC3G variants, regardless of dinucleotide preference, retained HIV-1 restriction activity. These data support a model in which the loop 7 region governs the selection of local dinucleotide substrates for deamination but is unlikely to be part of the higher level targeting mechanisms that direct these enzymes to biological substrates such as HIV-1 cDNA. PMID:23938202

  7. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  8. The Strictly Aerobic Yeast Yarrowia lipolytica Tolerates Loss of a Mitochondrial DNA-Packaging Protein

    PubMed Central

    Bakkaiova, Jana; Arata, Kosuke; Matsunobu, Miki; Ono, Bungo; Aoki, Tomoyo; Lajdova, Dana; Nebohacova, Martina; Nosek, Jozef; Miyakawa, Isamu

    2014-01-01

    Mitochondrial DNA (mtDNA) is highly compacted into DNA-protein structures termed mitochondrial nucleoids (mt-nucleoids). The key mt-nucleoid components responsible for mtDNA condensation are HMG box-containing proteins such as mammalian mitochondrial transcription factor A (TFAM) and Abf2p of the yeast Saccharomyces cerevisiae. To gain insight into the function and organization of mt-nucleoids in strictly aerobic organisms, we initiated studies of these DNA-protein structures in Yarrowia lipolytica. We identified a principal component of mt-nucleoids in this yeast and termed it YlMhb1p (Y. lipolytica mitochondrial HMG box-containing protein 1). YlMhb1p contains two putative HMG boxes contributing both to DNA binding and to its ability to compact mtDNA in vitro. Phenotypic analysis of a Δmhb1 strain lacking YlMhb1p resulted in three interesting findings. First, although the mutant exhibits clear differences in mt-nucleoids accompanied by a large decrease in the mtDNA copy number and the number of mtDNA-derived transcripts, its respiratory characteristics and growth under most of the conditions tested are indistinguishable from those of the wild-type strain. Second, our results indicate that a potential imbalance between subunits of the respiratory chain encoded separately by nuclear DNA and mtDNA is prevented at a (post)translational level. Third, we found that mtDNA in the Δmhb1 strain is more prone to mutations, indicating that mtHMG box-containing proteins protect the mitochondrial genome against mutagenic events. PMID:24972935

  9. Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

    PubMed

    Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y

    1996-08-01

    The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

  10. FACT is a sensor of DNA torsional stress in eukaryotic cells

    PubMed Central

    Safina, Alfiya; Cheney, Peter; Pal, Mahadeb; Brodsky, Leonid; Ivanov, Alexander; Kirsanov, Kirill; Lesovaya, Ekaterina; Naberezhnov, Denis; Nesher, Elimelech; Koman, Igor; Wang, Dan; Wang, Jianming; Yakubovskaya, Marianna; Winkler, Duane

    2017-01-01

    Abstract Transitions of B-DNA to alternative DNA structures (ADS) can be triggered by negative torsional strain, which occurs during replication and transcription, and may lead to genomic instability. However, how ADS are recognized in cells is unclear. We found that the binding of candidate anticancer drug, curaxin, to cellular DNA results in uncoiling of nucleosomal DNA, accumulation of negative supercoiling and conversion of multiple regions of genomic DNA into left-handed Z-form. Histone chaperone FACT binds rapidly to the same regions via the SSRP1 subunit in curaxin-treated cells. In vitro binding of purified SSRP1 or its isolated CID domain to a methylated DNA fragment containing alternating purine/pyrimidines, which is prone to Z-DNA transition, is much stronger than to other types of DNA. We propose that FACT can recognize and bind Z-DNA or DNA in transition from a B to Z form. Binding of FACT to these genomic regions triggers a p53 response. Furthermore, FACT has been shown to bind to other types of ADS through a different structural domain, which also leads to p53 activation. Thus, we propose that FACT acts as a sensor of ADS formation in cells. Recognition of ADS by FACT followed by a p53 response may explain the role of FACT in DNA damage prevention. PMID:28082391

  11. Phloem proteomics reveals new lipid-binding proteins with a putative role in lipid-mediated signaling

    DOE PAGES

    Barbaglia, Allison M.; Tamot, Banita; Greve, Veronica; ...

    2016-04-28

    Global climate changes inversely affect our ability to grow the food required for an increasing world population. To combat future crop loss due to abiotic stress, we need to understand the signals responsible for changes in plant development and the resulting adaptations, especially the signaling molecules traveling long-distance through the plant phloem. Using a proteomics approach, we had identified several putative lipid-binding proteins in the phloem exudates. Simultaneously, we identified several complex lipids as well as jasmonates. These findings prompted us to propose that phloem (phospho-) lipids could act as long-distance developmental signals in response to abiotic stress, and thatmore » they are released, sensed, and moved by phloem lipid-binding proteins (Benning et al., 2012). Indeed, the proteins we identified include lipases that could release a signaling lipid into the phloem, putative receptor components, and proteins that could mediate lipid-movement. To test this possible protein-based lipid-signaling pathway, three of the proteins, which could potentially act in a relay, are characterized here: (I) a putative GDSL-motif lipase (II) a PIG-P-like protein, with a possible receptor-like function; (III) and PLAFP (phloem lipid-associated family protein), a predicted lipid-binding protein of unknown function. Here we show that all three proteins bind lipids, in particular phosphatidic acid (PtdOH), which is known to participate in intracellular stress signaling. Genes encoding these proteins are expressed in the vasculature, a prerequisite for phloem transport. Cellular localization studies show that the proteins are not retained in the endoplasmic reticulum but surround the cell in a spotted pattern that has been previously observed with receptors and plasmodesmatal proteins. Abiotic signals that induce the production of PtdOH also regulate the expression of GDSL-lipase and PLAFP, albeit in opposite patterns. Our findings suggest that while all three proteins are indeed lipid-binding and act in the vasculature possibly in a function related to long-distance signaling, the three proteins do not act in the same but rather in distinct pathways. Furthermore, it points toward PLAFP as a prime candidate to investigate long-distance lipid signaling in the plant drought response.« less

  12. Phloem proteomics reveals new lipid-binding proteins with a putative role in lipid-mediated signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Barbaglia, Allison M.; Tamot, Banita; Greve, Veronica

    Global climate changes inversely affect our ability to grow the food required for an increasing world population. To combat future crop loss due to abiotic stress, we need to understand the signals responsible for changes in plant development and the resulting adaptations, especially the signaling molecules traveling long-distance through the plant phloem. Using a proteomics approach, we had identified several putative lipid-binding proteins in the phloem exudates. Simultaneously, we identified several complex lipids as well as jasmonates. These findings prompted us to propose that phloem (phospho-) lipids could act as long-distance developmental signals in response to abiotic stress, and thatmore » they are released, sensed, and moved by phloem lipid-binding proteins (Benning et al., 2012). Indeed, the proteins we identified include lipases that could release a signaling lipid into the phloem, putative receptor components, and proteins that could mediate lipid-movement. To test this possible protein-based lipid-signaling pathway, three of the proteins, which could potentially act in a relay, are characterized here: (I) a putative GDSL-motif lipase (II) a PIG-P-like protein, with a possible receptor-like function; (III) and PLAFP (phloem lipid-associated family protein), a predicted lipid-binding protein of unknown function. Here we show that all three proteins bind lipids, in particular phosphatidic acid (PtdOH), which is known to participate in intracellular stress signaling. Genes encoding these proteins are expressed in the vasculature, a prerequisite for phloem transport. Cellular localization studies show that the proteins are not retained in the endoplasmic reticulum but surround the cell in a spotted pattern that has been previously observed with receptors and plasmodesmatal proteins. Abiotic signals that induce the production of PtdOH also regulate the expression of GDSL-lipase and PLAFP, albeit in opposite patterns. Our findings suggest that while all three proteins are indeed lipid-binding and act in the vasculature possibly in a function related to long-distance signaling, the three proteins do not act in the same but rather in distinct pathways. Furthermore, it points toward PLAFP as a prime candidate to investigate long-distance lipid signaling in the plant drought response.« less

  13. Role of the C-terminal residue of the DNA polymerase of bacteriophage T7.

    PubMed

    Kumar, J K; Tabor, S; Richardson, C C

    2001-09-14

    The crystal structure of the DNA polymerase encoded by gene 5 of bacteriophage T7, in a complex with its processivity factor, Escherichia coli thioredoxin, a primer-template, and an incoming deoxynucleoside triphosphate reveals a putative hydrogen bond between the C-terminal residue, histidine 704 of gene 5 protein, and an oxygen atom on the penultimate phosphate diester of the primer strand. Elimination of this electrostatic interaction by replacing His(704) with alanine renders the phage nonviable, and no DNA synthesis is observed in vivo. Polymerase activity of the genetically altered enzyme on primed M13 DNA is only 12% of the wild-type enzyme, and its processivity is drastically reduced. Kinetic parameters for binding a primer-template (K(D)(app)), nucleotide binding (K(m)), and k(off) for dissociation of the altered polymerase from a primer-template are not significantly different from that of wild-type T7 DNA polymerase. However, the decrease in polymerase activity is concomitant with increased hydrolytic activity, judging from the turnover of nucleoside triphosphate into the corresponding nucleoside monophosphate (percentage of turnover, 65%) during DNA synthesis. Biochemical data along with structural observations imply that the terminal amino acid residue of T7 DNA polymerase plays a critical role in partitioning DNA between the polymerase and exonuclease sites.

  14. Tunable regulation of CREB DNA binding activity couples genotoxic stress response and metabolism

    PubMed Central

    Kim, Sang Hwa; Trinh, Anthony T.; Larsen, Michele Campaigne; Mastrocola, Adam S.; Jefcoate, Colin R.; Bushel, Pierre R.; Tibbetts, Randal S.

    2016-01-01

    cAMP response element binding protein (CREB) is a key regulator of glucose metabolism and synaptic plasticity that is canonically regulated through recruitment of transcriptional coactivators. Here we show that phosphorylation of CREB on a conserved cluster of Ser residues (the ATM/CK cluster) by the DNA damage-activated protein kinase ataxia-telangiectasia-mutated (ATM) and casein kinase1 (CK1) and casein kinase2 (CK2) positively and negatively regulates CREB-mediated transcription in a signal dependent manner. In response to genotoxic stress, phosphorylation of the ATM/CK cluster inhibited CREB-mediated gene expression, DNA binding activity and chromatin occupancy proportional to the number of modified Ser residues. Paradoxically, substoichiometric, ATM-independent, phosphorylation of the ATM/CK cluster potentiated bursts in CREB-mediated transcription by promoting recruitment of the CREB coactivator, cAMP-regulated transcriptional coactivators (CRTC2). Livers from mice expressing a non-phosphorylatable CREB allele failed to attenuate gluconeogenic genes in response to DNA damage or fully activate the same genes in response to glucagon. We propose that phosphorylation-dependent regulation of DNA binding activity evolved as a tunable mechanism to control CREB transcriptional output and promote metabolic homeostasis in response to rapidly changing environmental conditions. PMID:27431323

  15. Exploring DNA-binding Proteins with In Vivo Chemical Cross-linking and Mass Spectrometry

    PubMed Central

    Qiu, Haibo; Wang, Yinsheng

    2009-01-01

    DNA-binding proteins are very important constituents of proteomes of all species and play crucial roles in transcription, DNA replication, recombination, repair and other activities associated with DNA. Although a number of DNA-binding proteins have been identified, many proteins involved in gene regulation and DNA repair are likely still unknown because of their dynamic and/or weak interactions with DNA. In this report, we described an approach for the comprehensive identification of DNA-binding proteins with in vivo formaldehyde cross-linking and LC-MS/MS. DNA-binding proteins could be purified via the isolation of DNA-protein complexes and released from the complexes by reversing the cross-linking. By using this method, we were able to identify more than one hundred DNA-binding proteins, such as proteins involved in transcription, gene regulation, DNA replication and repair, and a large number of proteins which are potentially associated with DNA and DNA-binding proteins. This method should be generally applicable to the investigation of other nucleic acid-binding proteins, and hold great potential in the comprehensive study of gene regulation, DNA damage response and repair, as well as many other critical biological processes at proteomic level. PMID:19714816

  16. Incorporation of deoxyribonucleotides and ribonucleotides by a dNTP-binding cleft mutated reverse transcriptase in hepatitis B virus core particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung

    2008-01-05

    Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate {sup 32}P-ribonucleotides, but not HBV coremore » particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems.« less

  17. Borrelia oxidative stress response regulator, BosR: A distinctive Zn-dependent transcriptional activator

    PubMed Central

    Boylan, Julie A.; Posey, James E.; Gherardini, Frank C.

    2003-01-01

    The ability of a pathogen to cause infection depends on successful colonization of the host, which, in turn, requires adaptation to various challenges presented by that host. For example, host immune cells use a variety of mechanisms to control infection by bacterial pathogens, including the production of bactericidal reactive oxygen species. Prokaryotic and eukaryotic cells have developed ways of protecting themselves against this oxidative damage; for instance, Borrelia burgdorferi alters the expression of oxidative-stress-related proteins, such as a Dps/Dpr homolog NapA (BB0690), in response to increasing levels of oxygen and reactive oxygen species. These stress-related genes appear to be regulated by a putative metal-dependent DNA-binding protein (BB0647) that has 50.7% similarity to the peroxide-specific stress response repressor of Bacillus subtilis, PerR. We overexpressed and purified this protein from Escherichia coli and designated it Borrelia oxidative stress regulator, BosR. BosR bound to a 50-nt region 180 bp upstream of the napA transcriptional start site and required DTT and Zn2+ for optimal binding. Unlike the Bacillus subtilis PerR repressor, BosR did not require Fe2+ and Mn2+ for binding, and oxidizing agents, such as t-butyl peroxide, enhanced, not eliminated, BosR binding to the napA promoter region. Surprisingly, transcriptional fusion analysis indicated that BosR exerted a positive regulatory effect on napA that is inducible with t-butyl peroxide. On the basis of these data, we propose that, despite the similarity to PerR, BosR functions primarily as a transcriptional activator, not a repressor of oxidative stress response, in B. burgdorferi. PMID:12975527

  18. Viral interference with DNA repair by targeting of the single-stranded DNA binding protein RPA.

    PubMed

    Banerjee, Pubali; DeJesus, Rowena; Gjoerup, Ole; Schaffhausen, Brian S

    2013-10-01

    Correct repair of damaged DNA is critical for genomic integrity. Deficiencies in DNA repair are linked with human cancer. Here we report a novel mechanism by which a virus manipulates DNA damage responses. Infection with murine polyomavirus sensitizes cells to DNA damage by UV and etoposide. Polyomavirus large T antigen (LT) alone is sufficient to sensitize cells 100 fold to UV and other kinds of DNA damage. This results in activated stress responses and apoptosis. Genetic analysis shows that LT sensitizes via the binding of its origin-binding domain (OBD) to the single-stranded DNA binding protein replication protein A (RPA). Overexpression of RPA protects cells expressing OBD from damage, and knockdown of RPA mimics the LT phenotype. LT prevents recruitment of RPA to nuclear foci after DNA damage. This leads to failure to recruit repair proteins such as Rad51 or Rad9, explaining why LT prevents repair of double strand DNA breaks by homologous recombination. A targeted intervention directed at RPA based on this viral mechanism could be useful in circumventing the resistance of cancer cells to therapy.

  19. Structure-activity studies of dicationically substituted bis-benzimidazoles against Giardia lamblia: correlation of antigiardial activity with DNA binding affinity and giardial topoisomerase II inhibition.

    PubMed Central

    Bell, C A; Dykstra, C C; Naiman, N A; Cory, M; Fairley, T A; Tidwell, R R

    1993-01-01

    Nine dicationically substituted bis-benzimidazoles were examined for their in vitro activities against Giardia lamblia WB (ATCC 30957). The potential mechanisms of action of these compounds were evaluated by investigating the relationship among in vitro antigiardial activity and the affinity of the molecules for DNA and their ability to inhibit the activity of giardial topoisomerase II. Each compound demonstrated antigiardial activity, as measured by assessing the incorporation of [methyl-3H]thymidine by giardial trophozoites exposed to the test agents. Three compounds exhibited excellent in vitro antigiardial activities, with 50% inhibitory concentrations which compared very favorably with those of two currently used drugs, quinacrine HCl and metronidazole. Putative mechanisms of action for these compounds were suggested by the strong correlation observed among in vitro antigiardial activity and the affinity of the molecules for natural and synthetic DNA and their ability to inhibit the relaxation activity of giardial topoisomerase II. A strong correlation between the DNA binding affinity of these compounds and their inhibition of giardial topoisomerase II activity was also observed. Images PMID:8109934

  20. IFI16 Preferentially Binds to DNA with Quadruplex Structure and Enhances DNA Quadruplex Formation.

    PubMed

    Hároníková, Lucia; Coufal, Jan; Kejnovská, Iva; Jagelská, Eva B; Fojta, Miroslav; Dvořáková, Petra; Muller, Petr; Vojtesek, Borivoj; Brázda, Václav

    2016-01-01

    Interferon-inducible protein 16 (IFI16) is a member of the HIN-200 protein family, containing two HIN domains and one PYRIN domain. IFI16 acts as a sensor of viral and bacterial DNA and is important for innate immune responses. IFI16 binds DNA and binding has been described to be DNA length-dependent, but a preference for supercoiled DNA has also been demonstrated. Here we report a specific preference of IFI16 for binding to quadruplex DNA compared to other DNA structures. IFI16 binds to quadruplex DNA with significantly higher affinity than to the same sequence in double stranded DNA. By circular dichroism (CD) spectroscopy we also demonstrated the ability of IFI16 to stabilize quadruplex structures with quadruplex-forming oligonucleotides derived from human telomere (HTEL) sequences and the MYC promotor. A novel H/D exchange mass spectrometry approach was developed to assess protein interactions with quadruplex DNA. Quadruplex DNA changed the IFI16 deuteration profile in parts of the PYRIN domain (aa 0-80) and in structurally identical parts of both HIN domains (aa 271-302 and aa 586-617) compared to single stranded or double stranded DNAs, supporting the preferential affinity of IFI16 for structured DNA. Our results reveal the importance of quadruplex DNA structure in IFI16 binding and improve our understanding of how IFI16 senses DNA. IFI16 selectivity for quadruplex structure provides a mechanistic framework for IFI16 in immunity and cellular processes including DNA damage responses and cell proliferation.

  1. Cellular nucleic acid binding protein binds G-rich single-stranded nucleic acids and may function as a nucleic acid chaperone.

    PubMed

    Armas, Pablo; Nasif, Sofía; Calcaterra, Nora B

    2008-02-15

    Cellular nucleic acid binding protein (CNBP) is a small single-stranded nucleic acid binding protein made of seven Zn knuckles and an Arg-Gly rich box. CNBP is strikingly conserved among vertebrates and was reported to play broad-spectrum functions in eukaryotic cells biology. Neither its biological function nor its mechanisms of action were elucidated yet. The main goal of this work was to gain further insights into the CNBP biochemical and molecular features. We studied Bufo arenarum CNBP (bCNBP) binding to single-stranded nucleic acid probes representing the main reported CNBP putative targets. We report that, although bCNBP is able to bind RNA and single-stranded DNA (ssDNA) probes in vitro, it binds RNA as a preformed dimer whereas both monomer and dimer are able to bind to ssDNA. A systematic analysis of variant probes shows that the preferred bCNBP targets contain unpaired guanosine-rich stretches. These data expand the knowledge about CNBP binding stoichiometry and begins to dissect the main features of CNBP nucleic acid targets. Besides, we show that bCNBP presents a highly disordered predicted structure and promotes the annealing and melting of nucleic acids in vitro. These features are typical of proteins that function as nucleic acid chaperones. Based on these data, we propose that CNBP may function as a nucleic acid chaperone through binding, remodeling, and stabilizing nucleic acids secondary structures. This novel CNBP biochemical activity broadens the field of study about its biological function and may be the basis to understand the diverse ways in which CNBP controls gene expression. Copyright 2007 Wiley-Liss, Inc.

  2. The LINE-1 DNA sequences in four mammalian orders predict proteins that conserve homologies to retrovirus proteins.

    PubMed Central

    Fanning, T; Singer, M

    1987-01-01

    Recent work suggests that one or more members of the highly repeated LINE-1 (L1) DNA family found in all mammals may encode one or more proteins. Here we report the sequence of a portion of an L1 cloned from the domestic cat (Felis catus). These data permit comparison of the L1 sequences in four mammalian orders (Carnivore, Lagomorph, Rodent and Primate) and the comparison supports the suggested coding potential. In two separate, noncontiguous regions in the carboxy terminal half of the proteins predicted from the DNA sequences, there are several strongly conserved segments. In one region, these share homology with known or suspected reverse transcriptases, as described by others in rodents and primates. In the second region, closer to the carboxy terminus, the strongly conserved segments are over 90% homologous among the four orders. One of the latter segments is cysteine rich and resembles the putative metal binding domains of nucleic acid binding proteins, including those of TFIIIA and retroviruses. PMID:3562227

  3. Agonists and Antagonists of Protease-Activated Receptor 2 Discovered within a DNA-Encoded Chemical Library Using Mutational Stabilization of the Target.

    PubMed

    Brown, Dean G; Brown, Giles A; Centrella, Paolo; Certel, Kaan; Cooke, Robert M; Cuozzo, John W; Dekker, Niek; Dumelin, Christoph E; Ferguson, Andrew; Fiez-Vandal, Cédric; Geschwindner, Stefan; Guié, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Schlenker, Oliver; Sigel, Eric A; Snijder, Arjan; Soutter, Holly T; Sundström, Linda; Troast, Dawn M; Wiggin, Giselle; Zhang, Jing; Zhang, Ying; Clark, Matthew A

    2018-06-01

    The discovery of ligands via affinity-mediated selection of DNA-encoded chemical libraries is driven by the quality and concentration of the protein target. G-protein-coupled receptors (GPCRs) and other membrane-bound targets can be difficult to isolate in their functional state and at high concentrations, and therefore have been challenging for affinity-mediated selection. Here, we report a successful selection campaign against protease-activated receptor 2 (PAR2). Using a thermo-stabilized mutant of PAR2, we conducted affinity selection using our >100-billion-compound DNA-encoded library. We observed a number of putative ligands enriched upon selection, and subsequent cellular profiling revealed these ligands to comprise both agonists and antagonists. The agonist series shared structural similarity with known agonists. The antagonists were shown to bind in a novel allosteric binding site on the PAR2 protein. This report serves to demonstrate that cell-free affinity selection against GPCRs can be achieved with mutant stabilized protein targets.

  4. Comparative genomics of pyridoxal 5′-phosphate-dependent transcription factor regulons in Bacteria

    PubMed Central

    Suvorova, Inna A.

    2016-01-01

    The MocR-subfamily transcription factors (MocR-TFs) characterized by the GntR-family DNA-binding domain and aminotransferase-like sensory domain are broadly distributed among certain lineages of Bacteria. Characterized MocR-TFs bind pyridoxal 5′-phosphate (PLP) and control transcription of genes involved in PLP, gamma aminobutyric acid (GABA) and taurine metabolism via binding specific DNA operator sites. To identify putative target genes and DNA binding motifs of MocR-TFs, we performed comparative genomics analysis of over 250 bacterial genomes. The reconstructed regulons for 825 MocR-TFs comprise structural genes from over 200 protein families involved in diverse biological processes. Using the genome context and metabolic subsystem analysis we tentatively assigned functional roles for 38 out of 86 orthologous groups of studied regulators. Most of these MocR-TF regulons are involved in PLP metabolism, as well as utilization of GABA, taurine and ectoine. The remaining studied MocR-TF regulators presumably control genes encoding enzymes involved in reduction/oxidation processes, various transporters and PLP-dependent enzymes, for example aminotransferases. Predicted DNA binding motifs of MocR-TFs are generally similar in each orthologous group and are characterized by two to four repeated sequences. Identified motifs were classified according to their structures. Motifs with direct and/or inverted repeat symmetry constitute the majority of inferred DNA motifs, suggesting preferable TF dimerization in head-to-tail or head-to-head configuration. The obtained genomic collection of in silico reconstructed MocR-TF motifs and regulons in Bacteria provides a basis for future experimental characterization of molecular mechanisms for various regulators in this family. PMID:28348826

  5. Two residues in the basic region of the yeast transcription factor Yap8 are crucial for its DNA-binding specificity.

    PubMed

    Amaral, Catarina; Pimentel, Catarina; Matos, Rute G; Arraiano, Cecília M; Matzapetakis, Manolis; Rodrigues-Pousada, Claudina

    2013-01-01

    In Saccharomyces cerevisiae, the transcription factor Yap8 is a key determinant in arsenic stress response. Contrary to Yap1, another basic region-leucine zipper (bZIP) yeast regulator, Yap8 has a very restricted DNA-binding specificity and only orchestrates the expression of ACR2 and ACR3 genes. In the DNA-binding basic region, Yap8 has three distinct amino acids residues, Leu26, Ser29 and Asn31, at sites of highly conserved positions in the other Yap family of transcriptional regulators and Pap1 of Schizosaccharomyces pombe. To evaluate whether these residues are relevant to Yap8 specificity, we first built a homology model of the complex Yap8bZIP-DNA based on Pap1-DNA crystal structure. Several Yap8 mutants were then generated in order to confirm the contribution of the residues predicted to interact with DNA. Using bioinformatics analysis together with in vivo and in vitro approaches, we have identified several conserved residues critical for Yap8-DNA binding. Moreover, our data suggest that Leu26 is required for Yap8 binding to DNA and that this residue together with Asn31, hinder Yap1 response element recognition by Yap8, thus narrowing its DNA-binding specificity. Furthermore our results point to a role of these two amino acids in the stability of the Yap8-DNA complex.

  6. Initial Characterization of the Pf-Int Recombinase from the Malaria Parasite Plasmodium falciparum

    PubMed Central

    Ghorbal, Mehdi; Scheidig-Benatar, Christine; Bouizem, Salma; Thomas, Christophe; Paisley, Genevieve; Faltermeier, Claire; Liu, Melanie; Scherf, Artur; Lopez-Rubio, Jose-Juan; Gopaul, Deshmukh N.

    2012-01-01

    Background Genetic variation is an essential means of evolution and adaptation in many organisms in response to environmental change. Certain DNA alterations can be carried out by site-specific recombinases (SSRs) that fall into two families: the serine and the tyrosine recombinases. SSRs are seldom found in eukaryotes. A gene homologous to a tyrosine site-specific recombinase has been identified in the genome of Plasmodium falciparum. The sequence is highly conserved among five other members of Plasmodia. Methodology/Principal Findings The predicted open reading frame encodes for a ∼57 kDa protein containing a C-terminal domain including the putative tyrosine recombinase conserved active site residues R-H-R-(H/W)-Y. The N-terminus has the typical alpha-helical bundle and potentially a mixed alpha-beta domain resembling that of λ-Int. Pf-Int mRNA is expressed differentially during the P. falciparum erythrocytic life stages, peaking in the schizont stage. Recombinant Pf-Int and affinity chromatography of DNA from genomic or synthetic origin were used to identify potential DNA targets after sequencing or micro-array hybridization. Interestingly, the sequences captured also included highly variable subtelomeric genes such as var, rif, and stevor sequences. Electrophoretic mobility shift assays with DNA were carried out to verify Pf-Int/DNA binding. Finally, Pf-Int knock-out parasites were created in order to investigate the biological role of Pf-Int. Conclusions/Significance Our data identify for the first time a malaria parasite gene with structural and functional features of recombinases. Pf-Int may bind to and alter DNA, either in a sequence specific or in a non-specific fashion, and may contribute to programmed or random DNA rearrangements. Pf-Int is the first molecular player identified with a potential role in genome plasticity in this pathogen. Finally, Pf-Int knock-out parasite is viable showing no detectable impact on blood stage development, which is compatible with such function. PMID:23056326

  7. The multi-zinc finger protein ZNF217 contacts DNA through a two-finger domain.

    PubMed

    Nunez, Noelia; Clifton, Molly M K; Funnell, Alister P W; Artuz, Crisbel; Hallal, Samantha; Quinlan, Kate G R; Font, Josep; Vandevenne, Marylène; Setiyaputra, Surya; Pearson, Richard C M; Mackay, Joel P; Crossley, Merlin

    2011-11-04

    Classical C2H2 zinc finger proteins are among the most abundant transcription factors found in eukaryotes, and the mechanisms through which they recognize their target genes have been extensively investigated. In general, a tandem array of three fingers separated by characteristic TGERP links is required for sequence-specific DNA recognition. Nevertheless, a significant number of zinc finger proteins do not contain a hallmark three-finger array of this type, raising the question of whether and how they contact DNA. We have examined the multi-finger protein ZNF217, which contains eight classical zinc fingers. ZNF217 is implicated as an oncogene and in repressing the E-cadherin gene. We show that two of its zinc fingers, 6 and 7, can mediate contacts with DNA. We examine its putative recognition site in the E-cadherin promoter and demonstrate that this is a suboptimal site. NMR analysis and mutagenesis is used to define the DNA binding surface of ZNF217, and we examine the specificity of the DNA binding activity using fluorescence anisotropy titrations. Finally, sequence analysis reveals that a variety of multi-finger proteins also contain two-finger units, and our data support the idea that these may constitute a distinct subclass of DNA recognition motif.

  8. The Multi-zinc Finger Protein ZNF217 Contacts DNA through a Two-finger Domain*

    PubMed Central

    Nunez, Noelia; Clifton, Molly M. K.; Funnell, Alister P. W.; Artuz, Crisbel; Hallal, Samantha; Quinlan, Kate G. R.; Font, Josep; Vandevenne, Marylène; Setiyaputra, Surya; Pearson, Richard C. M.; Mackay, Joel P.; Crossley, Merlin

    2011-01-01

    Classical C2H2 zinc finger proteins are among the most abundant transcription factors found in eukaryotes, and the mechanisms through which they recognize their target genes have been extensively investigated. In general, a tandem array of three fingers separated by characteristic TGERP links is required for sequence-specific DNA recognition. Nevertheless, a significant number of zinc finger proteins do not contain a hallmark three-finger array of this type, raising the question of whether and how they contact DNA. We have examined the multi-finger protein ZNF217, which contains eight classical zinc fingers. ZNF217 is implicated as an oncogene and in repressing the E-cadherin gene. We show that two of its zinc fingers, 6 and 7, can mediate contacts with DNA. We examine its putative recognition site in the E-cadherin promoter and demonstrate that this is a suboptimal site. NMR analysis and mutagenesis is used to define the DNA binding surface of ZNF217, and we examine the specificity of the DNA binding activity using fluorescence anisotropy titrations. Finally, sequence analysis reveals that a variety of multi-finger proteins also contain two-finger units, and our data support the idea that these may constitute a distinct subclass of DNA recognition motif. PMID:21908891

  9. Identification of mutations in regions corresponding to the two putative nucleotide (ATP)-binding folds of the cystic fibrosis gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kerem, B.; Zielenski, J.; Markiewicz, D.

    1990-11-01

    Additional mutations in the cystic fibrosis (CF) gene were identified in the regions corresponding to the two putative nucleotide (ATP)-binding folds (NBFs) of the predicted polypeptide. The patient cohort included 46 Canadian CF families with well-characterized DNA marker haplotypes spanning the disease locus and several other families from Israel. Eleven mutations were found in the first NBF, 2 were found in the second NBF, but none was found in the R-domain. Seven of the mutations were of the missense type affecting some of the highly conserved amino acid residues in the first NBF; 3 were nonsense mutations; 2 would probablymore » affect mRNA splicing; 2 corresponded to small deletions, including another 3-base-pair deletion different from the major mutation ({delta}F508), which could account for 70% of the CF chromosomes in the population. Nine of these mutations accounted for 12 of the 31 non-{delta}F508 CF chromosomes in the Canadian families. The highly heterogeneous nature of the remaining CF mutations provides important insights into the structure and function of the protein, but it also suggests that DNA-based genetic screening for CF carrier status will not be straightforward.« less

  10. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    PubMed

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  11. The Use of Protein-DNA, Chromatin Immunoprecipitation, and Transcriptome Arrays to Describe Transcriptional Circuits in the Dehydrated Male Rat Hypothalamus

    PubMed Central

    Qiu, Jing; Kleineidam, Anna; Gouraud, Sabine; Yao, Song Tieng; Greenwood, Mingkwan; Hoe, See Ziau; Hindmarch, Charles

    2014-01-01

    The supraoptic nucleus (SON) of the hypothalamus is responsible for maintaining osmotic stability in mammals through its elaboration of the antidiuretic hormone arginine vasopressin. Upon dehydration, the SON undergoes a function-related plasticity, which includes remodeling of morphology, electrical properties, and biosynthetic activity. This process occurs alongside alterations in steady state transcript levels, which might be mediated by changes in the activity of transcription factors. In order to identify which transcription factors might be involved in changing patterns of gene expression, an Affymetrix protein-DNA array analysis was carried out. Nuclear extracts of SON from dehydrated and control male rats were analyzed for binding to the 345 consensus DNA transcription factor binding sequences of the array. Statistical analysis revealed significant changes in binding to 26 consensus elements, of which EMSA confirmed increased binding to signal transducer and activator of transcription (Stat) 1/Stat3, cellular Myelocytomatosis virus-like cellular proto-oncogene (c-Myc)-Myc-associated factor X (Max), and pre-B cell leukemia transcription factor 1 sequences after dehydration. Focusing on c-Myc and Max, we used quantitative PCR to confirm previous transcriptomic analysis that had suggested an increase in c-Myc, but not Max, mRNA levels in the SON after dehydration, and we demonstrated c-Myc- and Max-like immunoreactivities in SON arginine vasopressin-expressing cells. Finally, by comparing new data obtained from Roche-NimbleGen chromatin immunoprecipitation arrays with previously published transcriptomic data, we have identified putative c-Myc target genes whose expression changes in the SON after dehydration. These include known c-Myc targets, such as the Slc7a5 gene, which encodes the L-type amino acid transporter 1, ribosomal protein L24, histone deactylase 2, and the Rat sarcoma proto-oncogene (Ras)-related nuclear GTPase. PMID:25144923

  12. Arabidopsis thaliana GYRB3 Does Not Encode a DNA Gyrase Subunit

    PubMed Central

    Evans-Roberts, Katherine M.; Breuer, Christian; Wall, Melisa K.; Sugimoto-Shirasu, Keiko; Maxwell, Anthony

    2010-01-01

    Background DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3. Methodology/Principal Findings We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer. Conclusions/Significance These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen. PMID:20360860

  13. Arabidopsis thaliana GYRB3 does not encode a DNA gyrase subunit.

    PubMed

    Evans-Roberts, Katherine M; Breuer, Christian; Wall, Melisa K; Sugimoto-Shirasu, Keiko; Maxwell, Anthony

    2010-03-26

    DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3. We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer. These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen.

  14. Multivalent DNA-binding properties of the HMG-1 proteins.

    PubMed Central

    Maher, J F; Nathans, D

    1996-01-01

    HMG-I proteins are DNA-binding proteins thought to affect the formation and function of transcription complexes. Each protein contains three DNA-binding motifs, known as AT-hooks, that bind in the minor groove of AT tracts in DNA. Multiple AT-hooks within a polypeptide chain should contact multiple AT tracts, but the rules governing these interactions have not been defined. In this study, we demonstrate that high-affinity binding uses two or three appropriately spaced AT tracts as a single multivalent binding site. These principles have implications for binding to regulatory elements such as the interferon beta enhancer, TATA boxes, and serum response elements. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8692884

  15. Conservation of Matrix Attachment Region-Binding Filament-Like Protein 1 among Higher Plants1

    PubMed Central

    Harder, Patricia A.; Silverstein, Rebecca A.; Meier, Iris

    2000-01-01

    The interaction of chromatin with the nuclear matrix via matrix attachment regions (MARs) on the DNA is considered to be of fundamental importance for higher-order chromatin organization and the regulation of gene expression. We have previously isolated a novel nuclear matrix-localized protein (MFP1) from tomato (Lycopersicon esculentum) that preferentially binds to MAR DNA. Tomato MFP1 has a predicted filament-protein-like structure and is associated with the nuclear envelope via an N-terminal targeting domain. Based on the antigenic relationship, we report here that MFP1 is conserved in a large number of dicot and monocot species. Several cDNAs were cloned from tobacco (Nicotiana tabacum) and shown to correspond to two tobacco MFP1 genes. Comparison of the primary and predicted secondary structures of MFP1 from tomato, tobacco, and Arabidopsis indicates a high degree of conservation of the N-terminal targeting domain, the overall putative coiled-coil structure of the protein, and the C-terminal DNA-binding domain. In addition, we show that tobacco MFP1 is regulated in an organ-specific and developmental fashion, and that this regulation occurs at the level of transcription or RNA stability. PMID:10631266

  16. Identification and characterization of PhbF: a DNA binding protein with regulatory role in the PHB metabolism of Herbaspirillum seropedicae SmR1.

    PubMed

    Kadowaki, Marco A S; Müller-Santos, Marcelo; Rego, Fabiane G M; Souza, Emanuel M; Yates, Marshall G; Monteiro, Rose A; Pedrosa, Fabio O; Chubatsu, Leda S; Steffens, Maria B R

    2011-10-14

    Herbaspirillum seropedicae SmR1 is a nitrogen fixing endophyte associated with important agricultural crops. It produces polyhydroxybutyrate (PHB) which is stored intracellularly as granules. However, PHB metabolism and regulatory control is not yet well studied in this organism. In this work we describe the characterization of the PhbF protein from H. seropedicae SmR1 which was purified and characterized after expression in E. coli. The purified PhbF protein was able to bind to eleven putative promoters of genes involved in PHB metabolism in H. seropedicae SmR1. In silico analyses indicated a probable DNA-binding sequence which was shown to be protected in DNA footprinting assays using purified PhbF. Analyses using lacZ fusions showed that PhbF can act as a repressor protein controlling the expression of PHB metabolism-related genes. Our results indicate that H. seropedicae SmR1 PhbF regulates expression of phb-related genes by acting as a transcriptional repressor. The knowledge of the PHB metabolism of this plant-associated bacterium may contribute to the understanding of the plant-colonizing process and the organism's resistance and survival in planta.

  17. The gene for stinging nettle lectin (Urtica dioica agglutinin) encodes both a lectin and a chitinase.

    PubMed

    Lerner, D R; Raikhel, N V

    1992-06-05

    Chitin-binding proteins are present in a wide range of plant species, including both monocots and dicots, even though these plants contain no chitin. To investigate the relationship between in vitro antifungal and insecticidal activities of chitin-binding proteins and their unknown endogenous functions, the stinging nettle lectin (Urtica dioica agglutinin, UDA) cDNA was cloned using a synthetic gene as the probe. The nettle lectin cDNA clone contained an open reading frame encoding 374 amino acids. Analysis of the deduced amino acid sequence revealed a 21-amino acid putative signal sequence and the 86 amino acids encoding the two chitin-binding domains of nettle lectin. These domains were fused to a 19-amino acid "spacer" domain and a 244-amino acid carboxyl extension with partial identity to a chitinase catalytic domain. The authenticity of the cDNA clone was confirmed by deduced amino acid sequence identity with sequence data obtained from tryptic digests, RNA gel blot, and polymerase chain reaction analyses. RNA gel blot analysis also showed the nettle lectin message was present primarily in rhizomes and inflorescence (with immature seeds) but not in leaves or stems. Chitinase enzymatic activity was found when the chitinase-like domain alone or the chitinase-like domain with the chitin-binding domains were expressed in Escherichia coli. This is the first example of a chitin-binding protein with both a duplication of the 43-amino acid chitin-binding domain and a fusion of the chitin-binding domains to a structurally unrelated domain, the chitinase domain.

  18. The ATPase domain of the large terminase protein, gp17, from bacteriophage T4 binds DNA: implications to the DNA packaging mechanism.

    PubMed

    Alam, Tanfis I; Rao, Venigalla B

    2008-03-07

    Translocation of double-stranded DNA into a preformed capsid by tailed bacteriophages is driven by powerful motors assembled at the special portal vertex. The motor is thought to drive processive cycles of DNA binding, movement, and release to package the viral genome. In phage T4, there is evidence that the large terminase protein, gene product 17 (gp17), assembles into a multisubunit motor and translocates DNA by an inchworm mechanism. gp17 consists of two domains; an N-terminal ATPase domain (amino acids 1-360) that powers translocation of DNA, and a C-terminal nuclease domain (amino acids 361-610) that cuts concatemeric DNA to generate a headful-size viral genome. While the functional motifs of ATPase and nuclease have been well defined and the ATPase atomic structure has been solved, the DNA binding motif(s) responsible for viral DNA recognition, cutting, and translocation are unknown. Here we report the first evidence for the presence of a double-stranded DNA binding activity in the gp17 ATPase domain. Binding to DNA is sensitive to Mg(2+) and salt, but not the type of DNA used. DNA fragments as short as 20 bp can bind to the ATPase but preferential binding was observed to DNA greater than 1 kb. A high molecular weight ATPase-DNA complex was isolated by gel filtration, suggesting oligomerization of ATPase following DNA interaction. DNA binding was not observed with the full-length gp17, or the C-terminal nuclease domain. The small terminase protein, gp16, inhibited DNA binding, which was further accentuated by ATP. The presence of a DNA binding site in the ATPase domain and its binding properties implicate a role in the DNA packaging mechanism.

  19. LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

    PubMed

    Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

    2018-05-17

    Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

  20. Ras-dva Is a Novel Pit-1- and Glucocorticoid-Regulated Gene in the Embryonic Anterior Pituitary Gland

    PubMed Central

    Ellestad, Laura E.

    2013-01-01

    Glucocorticoids play a role in functional differentiation of pituitary somatotrophs and lactotrophs during embryogenesis. Ras-dva was identified as a gene regulated by anterior neural fold protein-1/homeobox expressed in embryonic stem cells-1, a transcription factor known to be critical in pituitary development, and has an expression profile in the chicken embryonic pituitary gland that is consistent with in vivo regulation by glucocorticoids. The objective of this study was to characterize expression and regulation of ras-dva mRNA in the developing chicken anterior pituitary. Pituitary ras-dva mRNA levels increased during embryogenesis to a maximum on embryonic day (e) 18 and then decreased and remained low or undetectable after hatch. Ras-dva expression was highly enriched in the pituitary gland on e18 relative to other tissues examined. Glucocorticoid treatment of pituitary cells from mid- and late-stage embryos rapidly increased ras-dva mRNA, suggesting it may be a direct transcriptional target of glucocorticoids. A reporter construct driven by 4 kb of the chicken ras-dva 5′-flanking region, containing six putative pituitary-specific transcription factor-1 (Pit-1) binding sites and two potential glucocorticoid receptor (GR) binding sites, was highly activated in embryonic pituitary cells and up-regulated by corticosterone. Mutagenesis of the most proximal Pit-1 site decreased promoter activity in chicken e11 pituitary cells, indicating regulation of ras-dva by Pit-1. However, mutating putative GR binding sites did not substantially reduce induction of ras-dva promoter activity by corticosterone, suggesting additional DNA elements within the 5′-flanking region are responsible for glucocorticoid regulation. We have identified ras-dva as a glucocorticoid-regulated gene that is likely expressed in cells of the Pit-1 lineage within the developing anterior pituitary gland. PMID:23161868

  1. Ras-dva is a novel Pit-1- and glucocorticoid-regulated gene in the embryonic anterior pituitary gland.

    PubMed

    Ellestad, Laura E; Porter, Tom E

    2013-01-01

    Glucocorticoids play a role in functional differentiation of pituitary somatotrophs and lactotrophs during embryogenesis. Ras-dva was identified as a gene regulated by anterior neural fold protein-1/homeobox expressed in embryonic stem cells-1, a transcription factor known to be critical in pituitary development, and has an expression profile in the chicken embryonic pituitary gland that is consistent with in vivo regulation by glucocorticoids. The objective of this study was to characterize expression and regulation of ras-dva mRNA in the developing chicken anterior pituitary. Pituitary ras-dva mRNA levels increased during embryogenesis to a maximum on embryonic day (e) 18 and then decreased and remained low or undetectable after hatch. Ras-dva expression was highly enriched in the pituitary gland on e18 relative to other tissues examined. Glucocorticoid treatment of pituitary cells from mid- and late-stage embryos rapidly increased ras-dva mRNA, suggesting it may be a direct transcriptional target of glucocorticoids. A reporter construct driven by 4 kb of the chicken ras-dva 5'-flanking region, containing six putative pituitary-specific transcription factor-1 (Pit-1) binding sites and two potential glucocorticoid receptor (GR) binding sites, was highly activated in embryonic pituitary cells and up-regulated by corticosterone. Mutagenesis of the most proximal Pit-1 site decreased promoter activity in chicken e11 pituitary cells, indicating regulation of ras-dva by Pit-1. However, mutating putative GR binding sites did not substantially reduce induction of ras-dva promoter activity by corticosterone, suggesting additional DNA elements within the 5'-flanking region are responsible for glucocorticoid regulation. We have identified ras-dva as a glucocorticoid-regulated gene that is likely expressed in cells of the Pit-1 lineage within the developing anterior pituitary gland.

  2. Characterization of constitutive and putative differentially expressed mRNAs by means of expressed sequence tags, differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR from the sand fly vector Lutzomyia longipalpis.

    PubMed

    Ramalho-Ortigão, J M; Temporal, P; de Oliveira , S M; Barbosa, A F; Vilela, M L; Rangel, E F; Brazil, R P; Traub-Cseko, Y M

    2001-01-01

    Molecular studies of insect disease vectors are of paramount importance for understanding parasite-vector relationship. Advances in this area have led to important findings regarding changes in vectors' physiology upon blood feeding and parasite infection. Mechanisms for interfering with the vectorial capacity of insects responsible for the transmission of diseases such as malaria, Chagas disease and dengue fever are being devised with the ultimate goal of developing transgenic insects. A primary necessity for this goal is information on gene expression and control in the target insect. Our group is investigating molecular aspects of the interaction between Leishmania parasites and Lutzomyia sand flies. As an initial step in our studies we have used random sequencing of cDNA clones from two expression libraries made from head/thorax and abdomen of sugar fed L. longipalpis for the identification of expressed sequence tags (EST). We applied differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR to characterize differentially expressed mRNA from sugar and blood fed insects, and, in one case, from a L. (V.) braziliensis-infected L. longipalpis. We identified 37 cDNAs that have shown homology to known sequences from GeneBank. Of these, 32 cDNAs code for constitutive proteins such as zinc finger protein, glutamine synthetase, G binding protein, ubiquitin conjugating enzyme. Three are putative differentially expressed cDNAs from blood fed and Leishmania-infected midgut, a chitinase, a V-ATPase and a MAP kinase. Finally, two sequences are homologous to Drosophila melanogaster gene products recently discovered through the Drosophila genome initiative.

  3. Sex change strategy and the aromatase genes.

    PubMed

    Gardner, L; Anderson, T; Place, A R; Dixon, B; Elizur, A

    2005-04-01

    Sequential hermaphroditism is a common reproductive strategy in many teleosts. Steroid production is known to mediate both the natural and induced sex change, yet beyond this the physiology directing this process has received little attention. Cytochrome P450 aromatase is a key enzyme in the hormonal pathway catalysing the conversion of sex steroids, androgens to oestrogens, and thus is highly relevant to the process of sex change. This study reports the isolation of cDNA sequences for aromatase isoforms CYP19A1 and CYP19A2 from teleost species representing three forms of sexual hermaphroditism: Lates calcarifer (protandry), Cromileptes altivelis (protogyny), and Gobiodon histrio (bi-directional). Deduced amino acid analysis of these isoforms with other reported isoforms from gonochoristic (single sex) teleosts revealed 56-95% identity within the same isoform while only 48-65% identity between isoforms irrespective of species and sexual strategy. Phylogenetic analysis supported this result separating sequences into isoform exclusive clades in spite of species apparent evolutionary distance. Furthermore, this study isolates 5' flanking regions of all above genes and describes putative cis-acting elements therein. Elements identified include steroidogenic factor 1 binding site (SF-1), oestrogen response element (ERE), progesterone response element (PRE), androgen response element (ARE), glucocorticoid response elements (GRE), peroxisome proliferator-activated receptor alpha/retinoid X receptor alpha heterodimer responsive element (PPARalpha/RXRalpha), nuclear factor kappabeta (NF-kappabeta), SOX 5, SOX 9, and Wilms tumor suppressor (WTI). A hypothetical in vivo model was constructed for both isoforms highlighting potential roles of these putative cis-acting elements with reference to normal function and sexual hermaphroditism.

  4. Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator

    PubMed Central

    Vassart, Amelia; Wolferen, Marleen; Orell, Alvaro; Hong, Ye; Peeters, Eveline; Albers, Sonja-Verena; Charlier, Daniel

    2013-01-01

    Sa-Lrp is a member of the leucine-responsive regulatory protein (Lrp)-like family of transcriptional regulators in Sulfolobus acidocaldarius. Previously, we demonstrated the binding of Sa-Lrp to the control region of its own gene in vitro. However, the function and cofactor of Sa-Lrp remained an enigma. In this work, we demonstrate that glutamine is the cofactor of Sa-Lrp by inducing the formation of octamers and increasing the DNA-binding affinity and sequence specificity. In vitro protein-DNA interaction assays indicate that Sa-Lrp binds to promoter regions of genes with a variety of functions including ammonia assimilation, transcriptional control, and UV-induced pili synthesis. DNA binding occurs with a specific affinity for AT-rich binding sites, and the protein induces DNA bending and wrapping upon binding, indicating an architectural role of the regulator. Furthermore, by analyzing an Sa-lrp deletion mutant, we demonstrate that the protein affects transcription of some of the genes of which the promoter region is targeted and that it is an important determinant of the cellular aggregation phenotype. Taking all these results into account, we conclude that Sa-Lrp is a glutamine-responsive global transcriptional regulator with an additional architectural role. PMID:23255531

  5. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buchman, A.R.; Kimmerly, W.J.; Rine, J.

    1988-01-01

    Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

  6. Large-scale oscillation of structure-related DNA sequence features in human chromosome 21

    NASA Astrophysics Data System (ADS)

    Li, Wentian; Miramontes, Pedro

    2006-08-01

    Human chromosome 21 is the only chromosome in the human genome that exhibits oscillation of the (G+C) content of a cycle length of hundreds kilobases (kb) ( 500kb near the right telomere). We aim at establishing the existence of a similar periodicity in structure-related sequence features in order to relate this (G+C)% oscillation to other biological phenomena. The following quantities are shown to oscillate with the same 500kb periodicity in human chromosome 21: binding energy calculated by two sets of dinucleotide-based thermodynamic parameters, AA/TT and AAA/TTT bi- and tri-nucleotide density, 5'-TA-3' dinucleotide density, and signal for 10- or 11-base periodicity of AA/TT or AAA/TTT. These intrinsic quantities are related to structural features of the double helix of DNA molecules, such as base-pair binding, untwisting or unwinding, stiffness, and a putative tendency for nucleosome formation.

  7. Cloning, overexpression and interaction of recombinant Fur from the cyanobacterium Anabaena PCC 7119 with isiB and its own promoter.

    PubMed

    Bes, M T; Hernández, J A; Peleato, M L; Fillat, M F

    2001-01-15

    A gene coding for a Fur (ferric uptake regulation) protein from the cyanobacterium Anabaena PCC 7119 has been cloned and overexpressed in Escherichia coli. DNA sequence analysis confirmed the presence of a 151-amino-acid open reading frame that showed homology with the Fur proteins reported for the unicellular cyanobacteria Synechococcus 7942 and Synechocystis PCC 6803. Two putative Fur-binding sites were detected in the promoter regions of the fur gene from Anabaena. Partially purified recombinant Fur binds to the flavodoxin promoter as well as its own promoter. This suggests that the Fur gene is autoregulated in Anabaena.

  8. A novel subviral agent associated with a geminivirus: The first report of a DNA satellite

    PubMed Central

    Dry, Ian B.; Krake, Leslie R.; Rigden, Justin E.; Rezaian, M. Ali

    1997-01-01

    Numerous plant RNA viruses have associated with them satellite (sat) RNAs that have little or no nucleotide sequence similarity to either the viral or host genomes but are completely dependent on the helper virus for replication. We report here on the discovery of a 682-nt circular DNA satellite associated with tomato leaf curl geminivirus (TLCV) infection in northern Australia. This is the first demonstration that satellite molecules are not limited to RNA viral systems. The DNA satellite (TLCV sat-DNA) is strictly dependent for replication on the helper virus replication-associated protein and is encapsidated by TLCV coat protein. It has no significant open reading frames, and it shows no significant sequence similarity to the 2766-nt helper-virus genome except for two short motifs present in separate putative stem–loop structures: TAATATTAC, which is universally conserved in all geminiviruses, and AATCGGTGTC, which is identical to a putative replication-associated protein binding motif in TLCV. Replication of TLCV sat-DNA is also supported by other taxonomically distinct geminiviruses, including tomato yellow leaf curl virus, African cassava mosaic virus, and beet curly top virus. Therefore, this unique DNA satellite does not appear to strictly conform with the requirements that dictate the specificity of interaction of geminiviral replication-associated proteins with their cognate origins as predicted by the current model of geminivirus replication. PMID:9192696

  9. THE ROLE OF THE RETINOBLASTOMA/E2F1 TUMOR SUPPRESSOR PATHWAY IN THE LESION RECOGNITION STEP OF NUCLEOTIDE EXCISION REPAIR

    PubMed Central

    Lin, Patrick S.; McPherson, Lisa A.; Chen, Aubrey Y.; Sage, Julien; Ford, James M.

    2009-01-01

    The retinoblastoma Rb/E2F tumor suppressor pathway plays a major role in the regulation of mammalian cell cycle progression. The pRb protein, along with closely related proteins p107 and p130, exerts its anti-proliferative effects by binding to the E2F family of transcription factors known to regulate essential genes throughout the cell cycle. We sought to investigate the role of the Rb/E2F1 pathway in the lesion recognition step of nucleotide excision repair (NER) in mouse embryonic fibroblasts (MEFs). Rb−/−;p107−/−;p130−/− MEFs repaired both cyclobutane pyrimidine dimers (CPD) and 6-4 photoproducts (6-4PPs) at higher efficiency than did wildtype cells following UV-C irradiation. The expression of damaged DNA binding gene DDB2 involved in the DNA lesion recognition step was elevated in the Rb family-deficient MEFs. To determine if the enhanced DNA repair in the absence of the Rb gene family is due to the derepression of E2F1, we assayed the ability of E2F1-deficient cells to repair damaged DNA and demonstrated that E2F1−/− MEFs are impaired for the removal of both CPDs and 6-4PPs. Furthermore, wildtype cells induced a higher expression of DDB2 and xeroderma pigmentosum gene XPC transcript levels than did E2F1−/− cells following UV-C irradiation. Using an E2F SiteScan algorithm, we uncovered a putative E2F-responsive element in the XPC promoter upstream of the transcription start site. We showed with chromatin immunoprecipitation assays the binding of E2F1 to the XPC promoter in a UV-dependent manner, suggesting that E2F1 is a transcriptional regulator of XPC. Our study identifies a novel E2F1 gene target and further supports the growing body of evidence that the Rb/E2F1 tumor suppressor pathway is involved in the regulation of the DNA lesion recognition step of nucleotide excision repair. PMID:19376752

  10. Identification and analysis of cytochrome P450IID6 antigenic sites recognized by anti-liver-kidney microsome type-1 antibodies (LKM1).

    PubMed

    Yamamoto, A M; Cresteil, D; Boniface, O; Clerc, F F; Alvarez, F

    1993-05-01

    Anti-liver-kidney microsome type-1 antibodies (LKM1), present in sera from a group of patients with autoimmune hepatitis, are directed against P450IID6. Previous work, using cDNA constructions spanning most of the P450IID6 protein defined the main immunogenic site between the amino acids (aa), 254-271 and predicted the presence of other putative immunogenic sites in the molecule. Fusion proteins from new cDNA constructions, spanning so-far-untested regions between aa 1-125 and 431-522, were not recognized by LKM1-positive sera. Synthetic peptides, representing sequences from putative immunogenic regions or previously untested regions, allowed a precise definition of four antigenic sites located between peptides 257-269, 321-351, 373-389 and 410-429, which were recognized, respectively, by 14, 8, 1 and 2 out of 15 LKM1-positive sera tested. The minimal sequence of the main antigenic site (peptide 257-269) recognized by the autoantibody was established to be WDPAQPPRD (peptide 262-270). In addition, deletion and replacement experiments showed that aa 263 (Asp) was essential for the binding of the autoantibody to peptide 262-270. Analysis of the second most frequently recognized peptide between aa 321-351, was performed using peptides 321-339 and 340-351 in competitive inhibition studies. Complete elimination of antibody binding to peptide 321-351 obtained by absorption of both shorter peptides indicated that peptide 321-351 is a discontinuous antigenic site. LKM1-positive sera reacting against peptide 321-351 recognized either both the shorter peptides or just one of them preferentially. Results of the present study suggest that the production of LKM1 antibodies is an antigen-driven, poly- or oligoclonal B cell response. The identification of antigenic sites will allow: (i) the development of specific diagnostic tests and (ii) further studies on the pathogenic value of LKM1 antibodies in autoimmune hepatitis.

  11. Transcriptional activity of the homopurine-homopyrimidine repeat of the c-Ki-ras promoter is independent of its H-forming potential.

    PubMed Central

    Raghu, G; Tevosian, S; Anant, S; Subramanian, K N; George, D L; Mirkin, S M

    1994-01-01

    The mouse c-Ki-ras protooncogene promoter contains an unusual DNA element consisting of a 27 bp-long homopurine-homopyrimidine mirror repeat (H-motif) adjacent to a d(C-G)5 repeat. We have previously shown that in vitro these repeats may adopt H and Z conformations, respectively, causing nuclease and chemical hypersensitivity. Here we have studied the functional role of these DNA stretches using fine deletion analysis of the promoter and a transient transcription assay in vivo. We found that while the H-motif is responsible for approximately half of the promoter activity in both mouse and human cell lines, the Z-forming sequence exhibits little, if any, such activity. Mutational changes introduced within the homopurine-homopyrimidine stretch showed that its sequence integrity, rather than its H-forming potential, is responsible for its effect on transcription. Electrophoretic mobility shift assays revealed that the putative H-motif tightly binds several nuclear proteins, one of which is likely to be transcription factor Sp1, as determined by competition experiments. Southwestern hybridization studies detected two major proteins specifically binding to the H-motif: a 97 kD protein which presumably corresponds to Sp1 and another protein of 60 kD in human and 64 kD in mouse cells. We conclude that the homopurine-homopyrimidine stretch is required for full transcriptional activity of the c-Ki-ras promoter and at least two distinct factors, Sp1 and an unidentified protein, potentially contribute to the positive effect on transcription. Images PMID:8078760

  12. Putative subunits of the rat mesangial KATP: a type 2B sulfonylurea receptor and an inwardly rectifying K+ channel.

    PubMed

    Szamosfalvi, Balázs; Cortes, Pedro; Alviani, Rebecca; Asano, Kenichiro; Riser, Bruce L; Zasuwa, Gary; Yee, Jerry

    2002-05-01

    Sulfonylurea agents exert their physiological effects in many cell types via binding to specific sulfonylurea receptors (SUR). SUR couple to inwardly-rectifying K+ channel (Kir6.x) to form tetradimeric ATP-sensitive K+ channels (KATP). The SUR subunits confer ATP-sensitivity on KATP and also provide the binding sites for sulfonylureas and other pharmacological agents. Our previous work demonstrated that the exposure of mesangial cells (MC) to sulfonylureas generated profound effects on MC glucose uptake and matrix metabolism and induced heightened cell contractility in association with Ca2+ transients. Because these responses likely resulted from the binding of sulfonylurea to a mesangial SUR2, we subsequently documented [3H]-glibenclamide binding to MC and the gene expression of several mesangial SUR2 transcripts. From these data, we inferred that MC expressed the components of a mesangial KATP and sought to establish their presence in primary MC. To obtain mesangial SUR2 cDNA sequences, rapid amplification of cDNA ends (RACE) was utilized. DNA sequences were established by the fluorescent dye termination method. Gene expression of mesangial SUR2 and Kir6.1/2 was examined by reverse transcription polymerase chain reaction (RT-PCR) and Northern analysis. SUR2 proteins were identified by immunoblotting of mesangial proteins from membrane-enriched fractions with polyclonal antiserum directed against SUR2. RACE cloning yielded two mesangial SUR2 cDNAs of 4.8 and 6.7 kbp whose open reading frames translated proteins of 964 and 1535 aa, respectively. Using probes specific to each cDNA, the presence of a unique, 5.5 kbp serum-regulated mesangial SUR2 splice variant was established. The sequence of this mesangial SUR2 (mcSUR2B) shares identity with the recently cloned rat SUR2B (rSUR2B), but, in comparison to rSUR2B, is truncated by 12 exons at the N-terminus where it contains a unique insert of 16 aa. Immunoblotting studies with anti-SUR2 antiserum demonstrated SUR2 proteins of 108 and 170 kD in membrane-enriched fractions of MC protein extracts. Complementary studies showed abundant gene expression of Kir6.1, thereby establishing gene expression of both components of KATP. Based upon analogy to vascular smooth muscle cells (VSMC), there are at least two putative mesangial KATP that most likely represent hetero-octamers, comprised of either rSUR2B or mcSUR2 in complex with Kir6.1. Our results define the mesangial SUR2B as the possible first link in a chain of cellular events that culminates in MC contraction and altered extracellular matrix metabolism following exposure to sulfonylureas. In addition, our results serve as the basis for the future elucidation of the electrophysiologic characteristics of the mesangial KATP and the study of endogenous regulators of mesangial cell contractility.

  13. Porcine bocavirus NP1 negatively regulates interferon signaling pathway by targeting the DNA-binding domain of IRF9

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Ruoxi; The Cooperative Innovation Center for Sustainable Pig Production, Wuhan 430070; Fang, Liurong, E-mail: fanglr@mail.hzau.edu.cn

    2015-11-15

    To subvert host antiviral immune responses, many viruses have evolved countermeasures to inhibit IFN signaling pathway. Porcine bocavirus (PBoV), a newly identified porcine parvovirus, has received attention because it shows clinically high co-infection prevalence with other pathogens in post-weaning multisystemic wasting syndrome (PWMS) and diarrheic piglets. In this study, we screened the structural and non-structural proteins encoded by PBoV and found that the non-structural protein NP1 significantly suppressed IFN-stimulated response element (ISRE) activity and subsequent IFN-stimulated gene (ISG) expression. However, NP1 affected neither the activation and translocation of STAT1/STAT2, nor the formation of the heterotrimeric transcription factor complex ISGF3 (STAT1/STAT2/IRF9).more » Detailed analysis demonstrated that PBoV NP1 blocked the ISGF3 DNA-binding activity by combining with the DNA-binding domain (DBD) of IRF9. In summary, these results indicate that PBoV NP1 interferes with type I IFN signaling pathway by blocking DNA binding of ISGF3 to attenuate innate immune responses. - Highlights: • Porcine bocavirus (PBoV) NP1 interferes with the IFN α/β signaling pathway. • PBoV NP1 does not prevent STAT1/STAT2 phosphorylation and nuclear translocation. • PBoV NP1 inhibits the DNA-binding activity of ISGF3. • PBoV NP1 interacts with the DNA-binding domain of IRF9.« less

  14. Binding and thermodynamics of REV peptide-ctDNA interaction.

    PubMed

    Upadhyay, Santosh Kumar

    2017-03-01

    The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically driven. ITC based analysis of salt dependence of binding constant gave a charge value (Z) = +4.01, as determined for the δlnK/δln[Na + ] parameter, suggesting the participation of only 3-4 Arg out of 11 Arg charge from REV peptide. The stoichiometry observed for the complex was three molar charge of REV peptide binding per molar charge of ctDNA. ITC based analysis further confirmed that the binding between ctDNA and REV peptide is governed by electrostatic interaction. Molecular interactions including H-bonding, van der Waals forces, and solvent molecules rearrangement, underlie the binding of REV peptide to ctDNA. © 2016 Wiley Periodicals, Inc.

  15. Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase

    PubMed Central

    Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.

    2015-01-01

    Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050

  16. Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase.

    PubMed

    Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C

    2015-01-01

    Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.

  17. Structure prediction of Fe(II) 2-oxoglutarate dioxygenase from a psychrophilic yeast Glaciozyma antarctica PI12

    NASA Astrophysics Data System (ADS)

    Yusof, Nik Yusnoraini; Bakar, Farah Diba Abu; Mahadi, Nor Muhammad; Raih, Mohd Firdaus; Murad, Abdul Munir Abdul

    2015-09-01

    A cDNA encoding Fe(II) 2-oxoglutarate (2OG) dependent dioxygenases was isolated from psychrophilic yeast, Glaciozyma antarctica PI12. We have successfully amplified 1,029 bp cDNA sequence that encodes 342 amino acid with predicted molecular weight 38 kDa. The prediction protein was analysed using various bioinformatics tools to explore the properties of the protein. Based on a BLAST search analysis, the Fe2OX amino acid sequence showed 61% identity to the sequence of oxoglutarate/iron-dependent oxygenase from Rhodosporidium toruloides NP11. SignalP prediction showed that the Fe2OX protein contains no putative signal peptide, which suggests that this enzyme most probably localised intracellularly.The structure of Fe2OX was predicted by homology modelling using MODELLER9v11. The model with the lowest objective function was selected from hundred models generated using MODELLER9v11. Analysis of the structure revealed the longer loop at Fe2OX from G.antarctica that might be responsible for the flexibility of the structure, which contributes to its adaptation to low temperatures. Fe2OX hold a highly conserved Fe(II) binding HXD/E…H triad motif. The binding site for 2-oxoglutarate was found conserved for Arg280 among reported studies, however the Phe268 was found to be different in Fe2OX.

  18. Identification and Cloning of Centaurin-α

    PubMed Central

    Hammonds-Odie, Latanya P.; Jackson, Trevor R.; Profit, Adam A.; Blader, Ira J.; Turck, Christoph W.; Prestwich, Glenn D.; Theibert, Anne B.

    2015-01-01

    Using an affinity resin and photoaffinity label based on phospholipid analogs of inositol 1,3,4,5-tetrakisphosphate (InsP4), we have isolated, characterized, and cloned a 46-kDa protein from rat brain, which we have named centaurin-α. Binding specificity was determined using displacement of 1-O-[3H](3-[4-benzoyldihydrocinnamidyl]propyl)-InsP4 photoaffinity labeling. Centaurin-α displayed highest affinity for phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3) (IC50 = 120 nm), whereas InsP4, PtdInsP2, and InsP3 bound with 5-, 12-, and >50-fold lower affinity, respectively. Screening a rat brain cDNA library with a polymerase chain reaction product, generated using partial amino acid sequence from tryptic peptides, yielded a full-length clone. The 2,450-base pair cDNA contained an open reading frame (ORF) encoding a novel protein of 419 amino acids. Northern analysis revealed a 2.5-kilobase transcript that is highly expressed in brain. The deduced sequence contains a novel putative zinc finger motif, 10 ankyrin-like repeats, and shows homology to recently identified yeast and mammalian Arf GTPase-activating proteins. Given the specificity of binding and enrichment in brain, centaurin-α is a candidate PtdInsP3 receptor that may link the activation of phosphoinositide 3-kinase to downstream responses in the brain. PMID:8702546

  19. CalA, a Cyanobacterial AbrB Protein, Interacts with the Upstream Region of hypC and Acts as a Repressor of Its Transcription in the Cyanobacterium Nostoc sp. Strain PCC 7120▿ †

    PubMed Central

    Agervald, Åsa; Zhang, Xiaohui; Stensjö, Karin; Devine, Ellenor; Lindblad, Peter

    2010-01-01

    The filamentous, heterocystous, nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain, depending on growth conditions, up to two hydrogenases directly involved in hydrogen metabolism. HypC is one out of at least seven auxiliary gene products required for synthesis of a functional hydrogenase, specifically involved in the maturation of the large subunit. In this study we present a protein, CalA (Alr0946 in the genome), belonging to the transcription regulator family AbrB, which in protein-DNA assays was found to interact with the upstream region of hypC. Transcriptional investigations showed that calA is cotranscribed with the downstream gene alr0947, which encodes a putative protease from the abortive infection superfamily, Abi. CalA was shown to interact specifically not only with the upstream region of hypC but also with its own upstream region, acting as a repressor on hypC. The bidirectional hydrogenase activity was significantly downregulated when CalA was overexpressed, demonstrating a correlation with the transcription factor, either direct or indirect. In silico studies showed that homologues to both CalA and Alr0947 are highly conserved proteins within cyanobacteria with very similar physical organizations of the corresponding structural genes. Possible functions of the cotranscribed downstream protein Alr0947 are presented. In addition, we present a three-dimensional (3D) model of the DNA binding domain of CalA and putative DNA binding mechanisms are discussed. PMID:20023111

  20. Transcriptome landscape of Lactococcus lactis reveals many novel RNAs including a small regulatory RNA involved in carbon uptake and metabolism.

    PubMed

    van der Meulen, Sjoerd B; de Jong, Anne; Kok, Jan

    2016-01-01

    RNA sequencing has revolutionized genome-wide transcriptome analyses, and the identification of non-coding regulatory RNAs in bacteria has thus increased concurrently. Here we reveal the transcriptome map of the lactic acid bacterial paradigm Lactococcus lactis MG1363 by employing differential RNA sequencing (dRNA-seq) and a combination of manual and automated transcriptome mining. This resulted in a high-resolution genome annotation of L. lactis and the identification of 60 cis-encoded antisense RNAs (asRNAs), 186 trans-encoded putative regulatory RNAs (sRNAs) and 134 novel small ORFs. Based on the putative targets of asRNAs, a novel classification is proposed. Several transcription factor DNA binding motifs were identified in the promoter sequences of (a)sRNAs, providing insight in the interplay between lactococcal regulatory RNAs and transcription factors. The presence and lengths of 14 putative sRNAs were experimentally confirmed by differential Northern hybridization, including the abundant RNA 6S that is differentially expressed depending on the available carbon source. For another sRNA, LLMGnc_147, functional analysis revealed that it is involved in carbon uptake and metabolism. L. lactis contains 13% leaderless mRNAs (lmRNAs) that, from an analysis of overrepresentation in GO classes, seem predominantly involved in nucleotide metabolism and DNA/RNA binding. Moreover, an A-rich sequence motif immediately following the start codon was uncovered, which could provide novel insight in the translation of lmRNAs. Altogether, this first experimental genome-wide assessment of the transcriptome landscape of L. lactis and subsequent sRNA studies provide an extensive basis for the investigation of regulatory RNAs in L. lactis and related lactococcal species.

  1. The crystal structure of the Rv0301-Rv0300 VapBC-3 toxin-antitoxin complex from M. tuberculosis reveals a Mg 2+ ion in the active site and a putative RNA-binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Min, Andrew B; Miallau, Linda; Sawaya, Michael R

    VapBC pairs account for 45 out of 88 identified toxin-antitoxin (TA) pairs in the Mycobacterium tuberculosis (Mtb) H37Rv genome. A working model suggests that under times of stress, antitoxin molecules are degraded, releasing the toxins to slow the metabolism of the cell, which in the case of VapC toxins is via their RNase activity. Otherwise the TA pairs remain bound to their promoters, autoinhibiting transcription. The crystal structure of Rv0301-Rv0300, an Mtb VapBC TA complex determined at 1.49 Å resolution, suggests a mechanism for these three functions: RNase activity, its inhibition by antitoxin, and its ability to bind promoter DNA.more » The Rv0301 toxin consists of a core of five parallel beta strands flanked by alpha helices. Three proximal aspartates coordinate a Mg2+ ion forming the putative RNase active site. The Rv0300 antitoxin monomer is extended in structure, consisting of an N-terminal beta strand followed by four helices. The last two helices wrap around the toxin and terminate near the putative RNase active site, but with different conformations. In one conformation, the C-terminal arginine interferes with Mg2+ ion coordination, suggesting a mechanism by which the antitoxin can inhibit toxin activity. At the N-terminus of the antitoxin, two pairs of Ribbon-Helix-Helix (RHH) motifs are related by crystallographic twofold symmetry. The resulting hetero-octameric complex is similar to the FitAB system, but the two RHH motifs are about 30 Å closer together in the Rv0301-Rv0300 complex, suggesting either a different span of the DNA recognition sequence or a conformational change.« less

  2. Characterization of novel heat-responsive transcription factor (TaHSFA6e) gene involved in regulation of heat shock proteins (HSPs) - A key member of heat stress-tolerance network of wheat.

    PubMed

    Kumar, Ranjeet R; Goswami, Suneha; Singh, Khushboo; Dubey, Kavita; Rai, Gyanendra K; Singh, Bhupinder; Singh, Shivdhar; Grover, Monendra; Mishra, Dwijesh; Kumar, Sanjeev; Bakshi, Suman; Rai, Anil; Pathak, Himanshu; Chinnusamy, Viswanathan; Praveen, Shelly

    2018-08-10

    Heat stress has an adverse effect on the quality and quantity of agriculturally important crops, especially wheat. The tolerance mechanism has not been explored much in wheat and very few genes/ TFs responsive to heat stress is available on public domain. Here, we identified, cloned and characterized a putative TaHSFA6e TF gene of 1.3 kb from wheat cv. HD2985. We observed an ORF of 368 aa with Hsf DNA binding signature domain in the amino acid sequence. Single copy number of TaHSFA6e was observed integrated in the genome of wheat. Expression analysis of TaHSFA6e under differential HS showed maximum transcripts in wheat cv. Halna (thermotolerant) in response to 38 °C for 2 h during pollination and grain-filling stages, as compared to PBW343, HD2329 and HD2985. Putative target genes of TaHSFA6e (HSP17, HSP70 and HSP90) showed upregulation in response to differential HS (30 & 38 °C, 2 h) during pollination and grain-filling stages. Small HSP17 was observed most triggered in Halna under HS. We observed increase in the catalase, guaiacol peroxidase, total antioxidant capacity (TAC), and decrease in the lipid peroxidation in thermotolerant cvs. (Halna, HD2985), as compared to thermosusceptible (PBW343, HD2329) under differential HS. Multiple stresses (heat - 38 °C, 2 h, and drought - 100 mL of 20% polyethylene Glycol 6000) during seedling stage of wheat showed positive correlation between the expression of TaHSFA6e, putative targets (HSP70, HSP90, HSP17) and TAC. Halna (thermotolerant) performed better, as compared to other contrasting cvs. TaHSFA6e TF can be used as promising candidate gene for manipulating the heat stress-tolerance network. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Structure of the Response Regulator PhoP from Mycobacterium tuberculosis Reveals a Dimer Through the Receiver Domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    S Menon; S Wang

    The PhoP protein from Mycobacterium tuberculosis is a response regulator of the OmpR/PhoB subfamily, whose structure consists of an N-terminal receiver domain and a C-terminal DNA-binding domain. How the DNA-binding activities are regulated by phosphorylation of the receiver domain remains unclear due to a lack of structural information on the full-length proteins. Here we report the crystal structure of the full-length PhoP of M. tuberculosis. Unlike other known structures of full-length proteins of the same subfamily, PhoP forms a dimer through its receiver domain with the dimer interface involving {alpha}4-{beta}5-{alpha}5, a common interface for activated receiver domain dimers. However, themore » switch residues, Thr99 and Tyr118, are in a conformation resembling those of nonactivated receiver domains. The Tyr118 side chain is involved in the dimer interface interactions. The receiver domain is tethered to the DNA-binding domain through a flexible linker and does not impose structural constraints on the DNA-binding domain. This structure suggests that phosphorylation likely facilitates/stabilizes receiver domain dimerization, bringing the DNA-binding domains to close proximity, thereby increasing their binding affinity for direct repeat DNA sequences.« less

  4. Transcriptional analysis of the bglP gene from Streptococcus mutans.

    PubMed

    Cote, Christopher K; Honeyman, Allen L

    2006-04-21

    An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.

  5. Transcriptional analysis of the bglP gene from Streptococcus mutans

    PubMed Central

    Cote, Christopher K; Honeyman, Allen L

    2006-01-01

    Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357

  6. Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

    PubMed

    Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

    2002-03-08

    An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

  7. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  8. cDNA encoding a polypeptide including a hev ein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  9. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  10. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  11. NLP-1: a DNA intercalating hypoxic cell radiosensitizer and cytotoxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Panicucci, R.; Heal, R.; Laderoute, K.

    The 2-nitroimidazole linked phenanthridine, NLP-1 (5-(3-(2-nitro-1-imidazoyl)-propyl)-phenanthridinium bromide), was synthesized with the rationale of targeting the nitroimidazole to DNA via the phenanthridine ring. The drug is soluble in aqueous solution (greater than 25 mM) and stable at room temperature. It binds to DNA with a binding constant 1/30 that of ethidium bromide. At a concentration of 0.5 mM, NLP-1 is 8 times more toxic to hypoxic than aerobic cells at 37 degrees C. This concentration is 40 times less than the concentration of misonidazole, a non-intercalating 2-nitroimidazole, required for the same degree of hypoxic cell toxicity. The toxicity of NLP-1 ismore » reduced at least 10-fold at 0 degrees C. Its ability to radiosensitize hypoxic cells is similar to misonidazole at 0 degrees C. Thus the putative targeting of the 2-nitroimidazole, NLP-1, to DNA, via its phenanthridine group, enhances its hypoxic toxicity, but not its radiosensitizing ability under the present test conditions. NLP-1 represents a lead compound for intercalating 2-nitroimidazoles with selective toxicity for hypoxic cells.« less

  12. The three-dimensional structure of TrmB, a transcriptional regulator of dual function in the hyperthermophilic archaeon Pyrococcus furiosus in complex with sucrose

    PubMed Central

    Krug, Michael; Lee, Sung-Jae; Boos, Winfried; Diederichs, Kay; Welte, Wolfram

    2013-01-01

    TrmB is a repressor that binds maltose, maltotriose, and sucrose, as well as other α-glucosides. It recognizes two different operator sequences controlling the TM (Trehalose/Maltose) and the MD (Maltodextrin) operon encoding the respective ABC transporters and sugar-degrading enzymes. Binding of maltose to TrmB abrogates repression of the TM operon but maintains the repression of the MD operon. On the other hand, binding of sucrose abrogates repression of the MD operon but maintains repression of the TM operon. The three-dimensional structure of TrmB in complex with sucrose was solved and refined to a resolution of 3.0 Å. The structure shows the N-terminal DNA binding domain containing a winged-helix-turn-helix (wHTH) domain followed by an amphipathic helix with a coiled-coil motif. The latter promotes dimerization and places the symmetry mates of the putative recognition helix in the wHTH motif about 30 Å apart suggesting a canonical binding to two successive major grooves of duplex palindromic DNA. This suggests that the structure resembles the conformation of TrmB recognizing the pseudopalindromic TM promoter but not the conformation recognizing the nonpalindromic MD promoter. PMID:23576322

  13. Molecular cloning of a putative divalent-cation transporter gene as a new genetic marker for the identification of Lactobacillus brevis strains capable of growing in beer.

    PubMed

    Hayashi, N; Ito, M; Horiike, S; Taguchi, H

    2001-05-01

    Random amplified polymorphic DNA (RAPD) PCR analysis of Lactobacillus brevis isolates from breweries revealed that one of the random primers could distinguish beer-spoilage strains of L. brevis from nonspoilage strains. The 1.1-kb DNA fragment amplified from all beer-spoilers included one open reading frame, termed hitA (hop-inducible cation transporter), which encodes an integral membrane protein with 11 putative trans-membrane domains and a binding protein-dependent transport signature of a non-ATP binding membrane transporter common to several prokaryotic and eukaryotic transporters. The hitA polypeptide is homologous to the natural resistance-associated macrophage protein (Nramp) family characterized as divalent-cation transport proteins in many prokaryotic and eukaryotic organisms. Northern blot analysis indicated that the hitA transcripts are expressed in cells cultivated in MRS broth supplemented with hop bitter compounds, which act as mobile-carrier ionophores, dissipating the trans-membrane pH gradient in bacteria sensitive to the hop bitter compounds by exchanging H+ for cellular divalent cations such as Mn2+. This suggests that the hitA gene products may play an important role in making the bacteria resistant to hop bitter compounds in beer by transporting metal ions such as Mn2+ into cells that no longer maintain the proton gradient.

  14. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    PubMed Central

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  15. The electrostatic role of the Zn-Cys2His2 complex in binding of operator DNA with transcription factors: mouse EGR-1 from the Cys2His2 family.

    PubMed

    Chirgadze, Y N; Boshkova, E A; Polozov, R V; Sivozhelezov, V S; Dzyabchenko, A V; Kuzminsky, M B; Stepanenko, V A; Ivanov, V V

    2018-01-07

    The mouse factor Zif268, known also as early growth response protein EGR-1, is a classical representative for the Cys2His2 transcription factor family. It is required for binding the RNA polymerase with operator dsDNA to initialize the transcription process. We have shown that only in this family of total six Zn-finger protein families the Zn complex plays a significant role in the protein-DNA binding. Electrostatic feature of this complex in the binding of factor Zif268 from Mus musculus with operator DNA has been considered. The factor consists of three similar Zn-finger units which bind with triplets of coding DNA. Essential contacts of the factor with the DNA phosphates are formed by three conservative His residues, one in each finger. We describe here the results of calculations of the electrostatic potentials for the Zn-Cys2His2 complex, Zn-finger unit 1, and the whole transcription factor. The potential of Zif268 has a positive area on the factor surface, and it corresponds exactly to the binding sites of each of Zn-finger units. The main part of these areas is determined by conservative His residues, which form contacts with the DNA phosphate groups. Our result shows that the electrostatic positive potential of this histidine residue is enhanced due to the Zn complex. The other contacts of the Zn-finger with DNA are related to nucleotide bases, and they are responsible for the sequence-specific binding with DNA. This result may be extended to all other members of the Cys2His2 transcription factor family.

  16. Identification and characterization of PhbF: A DNA binding protein with regulatory role in the PHB metabolism of Herbaspirillum seropedicae SmR1

    PubMed Central

    2011-01-01

    Background Herbaspirillum seropedicae SmR1 is a nitrogen fixing endophyte associated with important agricultural crops. It produces polyhydroxybutyrate (PHB) which is stored intracellularly as granules. However, PHB metabolism and regulatory control is not yet well studied in this organism. Results In this work we describe the characterization of the PhbF protein from H. seropedicae SmR1 which was purified and characterized after expression in E. coli. The purified PhbF protein was able to bind to eleven putative promoters of genes involved in PHB metabolism in H. seropedicae SmR1. In silico analyses indicated a probable DNA-binding sequence which was shown to be protected in DNA footprinting assays using purified PhbF. Analyses using lacZ fusions showed that PhbF can act as a repressor protein controlling the expression of PHB metabolism-related genes. Conclusions Our results indicate that H. seropedicae SmR1 PhbF regulates expression of phb-related genes by acting as a transcriptional repressor. The knowledge of the PHB metabolism of this plant-associated bacterium may contribute to the understanding of the plant-colonizing process and the organism's resistance and survival in planta. PMID:21999748

  17. Discrimination against RNA Backbones by a ssDNA Binding Protein.

    PubMed

    Lloyd, Neil R; Wuttke, Deborah S

    2018-05-01

    Pot1 is the shelterin component responsible for the protection of the single-stranded DNA (ssDNA) overhang at telomeres in nearly all eukaryotic organisms. The C-terminal domain of the DNA-binding domain, Pot1pC, exhibits non-specific ssDNA recognition, achieved through thermodynamically equivalent alternative binding conformations. Given this flexibility, it is unclear how specificity for ssDNA over RNA, an activity required for biological function, is achieved. Examination of the ribose-position specificity of Pot1pC shows that ssDNA specificity is additive but not uniformly distributed across the ligand. High-resolution structures of several Pot1pC complexes with RNA-DNA chimeric ligands reveal Pot1pC discriminates against RNA by utilizing non-compensatory binding modes that feature significant rearrangement of the binding interface. These alternative conformations, accessed through both ligand and protein flexibility, recover much, but not all, of the binding energy, leading to the observed reduction in affinities. These findings suggest that intermolecular interfaces are remarkably sophisticated in their tuning of specificity toward flexible ligands. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element.

    PubMed

    Romine, L E; Wood, J R; Lamia, L A; Prendergast, P; Edwards, D P; Nardulli, A M

    1998-05-01

    We have examined the ability of the high-mobility group protein 1 (HMG1) to alter binding of the estrogen receptor DNA-binding domain (DBD) to the estrogen response element (ERE). HMG1 dramatically enhanced binding of purified, bacterially expressed DBD to the consensus vitellogenin A2 ERE in a dose-dependent manner. The ability of HMG1 to stabilize the DBD-ERE complex resulted in part from a decrease in the dissociation rate of the DBD from the ERE. Antibody supershift experiments demonstrated that HMG1 was also capable of forming a ternary complex with the ERE-bound DBD in the presence of HMG1-specific antibody. HMG1 did not substantially affect DBD-ERE contacts as assessed by methylation interference assays, nor did it alter the ability of the DBD to induce distortion in ERE-containing DNA fragments. Because HMG1 dramatically enhanced estrogen receptor DBD binding to the ERE, and the DBD is the most highly conserved region among the nuclear receptor superfamily members, HMG1 may function to enhance binding of other nuclear receptors to their respective response elements and act in concert with coactivator proteins to regulate expression of hormone-responsive genes.

  19. The Electronic Behavior of Zinc-Finger Protein Binding Sites in the Context of the DNA Extended Ladder Model

    NASA Astrophysics Data System (ADS)

    Oiwa, Nestor; Cordeiro, Claudette; Heermann, Dieter

    2016-05-01

    Instead of ATCG letter alignments, typically used in bioinformatics, we propose a new alignment method using the probability distribution function of the bottom of the occupied molecular orbital (BOMO), highest occupied molecular orbital (HOMO) and lowest unoccupied orbital (LUMO). We apply the technique to transcription factors with Cys2His2 zinc fingers. These transcription factors search for binding sites, probing for the electronic patterns at the minor and major DNA groves. The eukaryotic Cys2His2 zinc finger proteins bind to DNA ubiquitously at highly conserved domains. They are responsible for gene regulation and the spatial organization of DNA. To study and understand these zinc finger DNA-protein interactions, we use the extended ladder in the DNA model proposed by Zhu, Rasmussen, Balatsky & Bishop (2007) te{Zhu-2007}. Considering one single spinless electron in each nucleotide π-orbital along a double DNA chain (dDNA), we find a typical pattern for the bottom of BOMO, HOMO and LUMO along the binding sites. We specifically looked at two members of zinc finger protein family: specificity protein 1 (SP1) and early grown response 1 transcription factors (EGR1). When the valence band is filled, we find electrons in the purines along the nucleotide sequence, compatible with the electric charges of the binding amino acids in SP1 and EGR1 zinc finger.

  20. Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

    PubMed Central

    Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

    2011-01-01

    DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

  1. The poly(C)-binding proteins: a multiplicity of functions and a search for mechanisms.

    PubMed Central

    Makeyev, Aleksandr V; Liebhaber, Stephen A

    2002-01-01

    The poly(C) binding proteins (PCBPs) are encoded at five dispersed loci in the mouse and human genomes. These proteins, which can be divided into two groups, hnRNPs K/J and the alphaCPs (alphaCP1-4), are linked by a common evolutionary history, a shared triple KH domain configuration, and by their poly(C) binding specificity. Given these conserved characteristics it is remarkable to find a substantial diversity in PCBP functions. The roles of these proteins in mRNA stabilization, translational activation, and translational silencing suggest a complex and diverse set of post-transcriptional control pathways. Their additional putative functions in transcriptional control and as structural components of important DNA-protein complexes further support their remarkable structural and functional versatility. Clearly the identification of additional binding targets and delineation of corresponding control mechanisms and effector pathways will establish highly informative models for further exploration. PMID:12003487

  2. The poly(C)-binding proteins: a multiplicity of functions and a search for mechanisms.

    PubMed

    Makeyev, Aleksandr V; Liebhaber, Stephen A

    2002-03-01

    The poly(C) binding proteins (PCBPs) are encoded at five dispersed loci in the mouse and human genomes. These proteins, which can be divided into two groups, hnRNPs K/J and the alphaCPs (alphaCP1-4), are linked by a common evolutionary history, a shared triple KH domain configuration, and by their poly(C) binding specificity. Given these conserved characteristics it is remarkable to find a substantial diversity in PCBP functions. The roles of these proteins in mRNA stabilization, translational activation, and translational silencing suggest a complex and diverse set of post-transcriptional control pathways. Their additional putative functions in transcriptional control and as structural components of important DNA-protein complexes further support their remarkable structural and functional versatility. Clearly the identification of additional binding targets and delineation of corresponding control mechanisms and effector pathways will establish highly informative models for further exploration.

  3. Challenging the Metallothionein (MT) Gene of Biomphalaria glabrata: Unexpected Response Patterns Due to Cadmium Exposure and Temperature Stress.

    PubMed

    Niederwanger, Michael; Dvorak, Martin; Schnegg, Raimund; Pedrini-Martha, Veronika; Bacher, Katharina; Bidoli, Massimo; Dallinger, Reinhard

    2017-08-11

    Metallothioneins (MTs) are low-molecular-mass, cysteine-rich, metal binding proteins. In most animal species, they are involved in metal homeostasis and detoxification, and provide protection from oxidative stress. Gastropod MTs are highly diversified, exhibiting unique features and adaptations like metal specificity and multiplications of their metal binding domains. Here, we show that the MT gene of Biomphalaria glabrata , one of the largest MT genes identified so far, is composed in a unique way. The encoding for an MT protein has a three-domain structure and a C-terminal, Cys-rich extension. Using a bioinformatic approach involving structural and in silico analysis of putative transcription factor binding sites (TFBs), we found that this MT gene consists of five exons and four introns. It exhibits a regulatory promoter region containing three metal-responsive elements (MREs) and several TFBs with putative involvement in environmental stress response, and regulation of gene expression. Quantitative real-time polymerase chain reaction (qRT-PCR) data indicate that the MT gene is not inducible by cadmium (Cd) nor by temperature challenges (heat and cold), despite significant Cd uptake within the midgut gland and the high Cd tolerance of metal-exposed snails.

  4. Challenging the Metallothionein (MT) Gene of Biomphalaria glabrata: Unexpected Response Patterns Due to Cadmium Exposure and Temperature Stress

    PubMed Central

    Dvorak, Martin; Schnegg, Raimund; Pedrini-Martha, Veronika; Bacher, Katharina; Bidoli, Massimo; Dallinger, Reinhard

    2017-01-01

    Metallothioneins (MTs) are low-molecular-mass, cysteine-rich, metal binding proteins. In most animal species, they are involved in metal homeostasis and detoxification, and provide protection from oxidative stress. Gastropod MTs are highly diversified, exhibiting unique features and adaptations like metal specificity and multiplications of their metal binding domains. Here, we show that the MT gene of Biomphalaria glabrata, one of the largest MT genes identified so far, is composed in a unique way. The encoding for an MT protein has a three-domain structure and a C-terminal, Cys-rich extension. Using a bioinformatic approach involving structural and in silico analysis of putative transcription factor binding sites (TFBs), we found that this MT gene consists of five exons and four introns. It exhibits a regulatory promoter region containing three metal-responsive elements (MREs) and several TFBs with putative involvement in environmental stress response, and regulation of gene expression. Quantitative real-time polymerase chain reaction (qRT-PCR) data indicate that the MT gene is not inducible by cadmium (Cd) nor by temperature challenges (heat and cold), despite significant Cd uptake within the midgut gland and the high Cd tolerance of metal-exposed snails. PMID:28800079

  5. Functional analysis of the ComK protein of Bacillus coagulans.

    PubMed

    Kovács, Ákos T; Eckhardt, Tom H; van Hartskamp, Mariska; van Kranenburg, Richard; Kuipers, Oscar P

    2013-01-01

    The genes for DNA uptake and recombination in Bacilli are commonly regulated by the transcriptional factor ComK. We have identified a ComK homologue in Bacillus coagulans, an industrial relevant organism that is recalcitrant for transformation. Introduction of B. coagulans comK gene under its own promoter region into Bacillus subtilis comK strain results in low transcriptional induction of the late competence gene comGA, but lacking bistable expression. The promoter regions of B. coagulans comK and the comGA genes are recognized in B. subtilis and expression from these promoters is activated by B. subtilis ComK. Purified ComK protein of B. coagulans showed DNA-binding ability in gel retardation assays with B. subtilis- and B. coagulans-derived probes. These experiments suggest that the function of B. coagulans ComK is similar to that of ComK of B. subtilis. When its own comK is overexpressed in B. coagulans the comGA gene expression increases 40-fold, while the expression of another late competence gene, comC is not elevated and no reproducible DNA-uptake could be observed under these conditions. Our results demonstrate that B. coagulans ComK can recognize several B.subtilis comK-responsive elements, and vice versa, but indicate that the activation of the transcription of complete sets of genes coding for a putative DNA uptake apparatus in B. coagulans might differ from that of B. subtilis.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akabayov, B.; Akabayov, S; Lee , S

    Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

  7. The DnaJ Gene Family in Pepper (Capsicum annuum L.): Comprehensive Identification, Characterization and Expression Profiles.

    PubMed

    Fan, FangFei; Yang, Xian; Cheng, Yuan; Kang, Yunyan; Chai, Xirong

    2017-01-01

    The DnaJ proteins which function as molecular chaperone played critical roles in plant growth and development and response to heat stress (HS) and also called heat shock protein 40 based on molecular weight. However, little was reported on this gene family in pepper. Recently, the release of the whole pepper genome provided an opportunity for identifying putative DnaJ homologous. In this study, a total of 76 putative pepper DnaJ genes (CaDnaJ01 to CaDnaJ76) were identified using bioinformatics methods and classified into five groups by the presence of the complete three domains (J-domain, zinc finger domain, and C-terminal domain). Chromosome mapping suggested that segmental duplication and tandem duplication were occurred in evolution. The multiple stress-related cis -elements were found in the promoter region of these CaDnaJ genes, which indicated that the CaDnaJs might be involved in the process of responding to complex stress conditions. In addition, expression profiles based on RNA-seq showed that the 47 CaDnaJs were expressed in at least one tissue tested. The result implied that they could be involved in the process of pepper growth and development. qRT-PCR analysis found that 80.60% (54/67) CaDnaJs were induced by HS, indicated that they could participated in pepper response to high temperature treatments. In conclusion, all these results would provide a comprehensive basis for further analyzing the function of CaDnaJ members and be also significant for elucidating the evolutionary relationship in pepper.

  8. The DnaJ Gene Family in Pepper (Capsicum annuum L.): Comprehensive Identification, Characterization and Expression Profiles

    PubMed Central

    Fan, FangFei; Yang, Xian; Cheng, Yuan; Kang, Yunyan; Chai, Xirong

    2017-01-01

    The DnaJ proteins which function as molecular chaperone played critical roles in plant growth and development and response to heat stress (HS) and also called heat shock protein 40 based on molecular weight. However, little was reported on this gene family in pepper. Recently, the release of the whole pepper genome provided an opportunity for identifying putative DnaJ homologous. In this study, a total of 76 putative pepper DnaJ genes (CaDnaJ01 to CaDnaJ76) were identified using bioinformatics methods and classified into five groups by the presence of the complete three domains (J-domain, zinc finger domain, and C-terminal domain). Chromosome mapping suggested that segmental duplication and tandem duplication were occurred in evolution. The multiple stress-related cis-elements were found in the promoter region of these CaDnaJ genes, which indicated that the CaDnaJs might be involved in the process of responding to complex stress conditions. In addition, expression profiles based on RNA-seq showed that the 47 CaDnaJs were expressed in at least one tissue tested. The result implied that they could be involved in the process of pepper growth and development. qRT-PCR analysis found that 80.60% (54/67) CaDnaJs were induced by HS, indicated that they could participated in pepper response to high temperature treatments. In conclusion, all these results would provide a comprehensive basis for further analyzing the function of CaDnaJ members and be also significant for elucidating the evolutionary relationship in pepper. PMID:28507559

  9. Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

    PubMed

    Fisher, R P; Topper, J N; Clayton, D A

    1987-07-17

    Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

  10. A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants

    NASA Technical Reports Server (NTRS)

    Yang, Tianbao; Poovaiah, B. W.

    2002-01-01

    We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467-38473). Here we demonstrate that there is one NtER1 homolog as well as five related genes in Arabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H(2)O(2), and salicylic acid. Hence, they were designated as AtSR1-6 (Arabidopsis thaliana signal-responsive genes). Ca(2+)/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic alpha-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants.

  11. Effect of DNA type on response of DNA biosensor for carcinogens

    NASA Astrophysics Data System (ADS)

    Sani, Nor Diyana bt. Md.; Heng, Lee Yook; Surif, Salmijah; Lazim, Azwani Mat

    2013-11-01

    Carcinogens are cancer causing chemicals that can bind to DNA and cause damage to the DNA. These chemicals are available everywhere including in water, air, soil and food. Therefore, a sensor that can detect the presence of these chemicals will be a very useful tool. Since carcinogens bind to DNA, DNA can be used as the biological element in a biosensor. This study has utilized different types of DNA in a biosensor for carcinogen detection. The DNAs include double stranded calf thymus DNA, single stranded calf thymus DNA and guanine rich single stranded DNA. The modified SPE was exposed to a carcinogen followed by interaction with methylene blue which acts as the electroactive indicator. The SPE was then analysed using differential pulse voltammetry (DPV). Optimization studies were conducted for MB concentration and accumulation time, DNA concentration, as well as effect of buffer concentration, buffer pH and ionic strength. The performance of the biosensor was tested on a group 1 carcinogen, formaldehyde. The results indicated that the usage of guanine rich single stranded DNA also gives higher response as carcinogens prefer to bind with guanine compared to other bases.

  12. RING finger and WD repeat domain 3 (RFWD3) associates with replication protein A (RPA) and facilitates RPA-mediated DNA damage response.

    PubMed

    Liu, Shangfeng; Chu, Jessica; Yucer, Nur; Leng, Mei; Wang, Shih-Ya; Chen, Benjamin P C; Hittelman, Walter N; Wang, Yi

    2011-06-24

    DNA damage response is crucial for maintaining genomic integrity and preventing cancer by coordinating the activation of checkpoints and the repair of damaged DNA. Central to DNA damage response are the two checkpoint kinases ATM and ATR that phosphorylate a wide range of substrates. RING finger and WD repeat domain 3 (RFWD3) was initially identified as a substrate of ATM/ATR from a proteomic screen. Subsequent studies showed that RFWD3 is an E3 ubiquitin ligase that ubiquitinates p53 in vitro and positively regulates p53 levels in response to DNA damage. We report here that RFWD3 associates with replication protein A (RPA), a single-stranded DNA-binding protein that plays essential roles in DNA replication, recombination, and repair. Binding of RPA to single-stranded DNA (ssDNA), which is generated by DNA damage and repair, is essential for the recruitment of DNA repair factors to damaged sites and the activation of checkpoint signaling. We show that RFWD3 is physically associated with RPA and rapidly localizes to sites of DNA damage in a RPA-dependent manner. In vitro experiments suggest that the C terminus of RFWD3, which encompass the coiled-coil domain and the WD40 domain, is necessary for binding to RPA. Furthermore, DNA damage-induced phosphorylation of RPA and RFWD3 is dependent upon each other. Consequently, loss of RFWD3 results in the persistent foci of DNA damage marker γH2AX and the repair protein Rad51 in damaged cells. These findings suggest that RFWD3 is recruited to sites of DNA damage and facilitates RPA-mediated DNA damage signaling and repair.

  13. Physical interaction between replication protein A (RPA) and MRN: involvement of RPA2 phosphorylation and the N-terminus of RPA1.

    PubMed

    Oakley, Greg G; Tillison, Kristin; Opiyo, Stephen A; Glanzer, Jason G; Horn, Jeffrey M; Patrick, Steve M

    2009-08-11

    Replication protein A (RPA) is a heterotrimeric protein consisting of RPA1, RPA2, and RPA3 subunits that binds to single-stranded DNA (ssDNA) with high affinity. The response to replication stress requires the recruitment of RPA and the MRE11-RAD50-NBS1 (MRN) complex. RPA bound to ssDNA stabilizes stalled replication forks by recruiting checkpoint proteins involved in fork stabilization. MRN can bind DNA structures encountered at stalled or collapsed replication forks, such as ssDNA-double-stranded DNA (dsDNA) junctions or breaks, and promote the restart of DNA replication. Here, we demonstrate that RPA2 phosphorylation regulates the assembly of DNA damage-induced RPA and MRN foci. Using purified proteins, we observe a direct interaction between RPA with both NBS1 and MRE11. By utilizing RPA bound to ssDNA, we demonstrate that substituting RPA with phosphorylated RPA or a phosphomimetic weakens the interaction with the MRN complex. Also, the N-terminus of RPA1 is a critical component of the RPA-MRN protein-protein interaction. Deletion of the N-terminal oligonucleotide-oligosaccharide binding fold (OB-fold) of RPA1 abrogates interactions of RPA with MRN and individual proteins of the MRN complex. Further identification of residues critical for MRN binding in the N-terminus of RPA1 shows that substitution of Arg31 and Arg41 with alanines disrupts the RPA-MRN interaction and alters cell cycle progression in response to DNA damage. Thus, the N-terminus of RPA1 and phosphorylation of RPA2 regulate RPA-MRN interactions and are important in the response to DNA damage.

  14. Multiple roles of genome-attached bacteriophage terminal proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Redrejo-Rodríguez, Modesto; Salas, Margarita, E-mail: msalas@cbm.csic.es

    2014-11-15

    Protein-primed replication constitutes a generalized mechanism to initiate DNA or RNA synthesis in linear genomes, including viruses, gram-positive bacteria, linear plasmids and mobile elements. By this mechanism a specific amino acid primes replication and becomes covalently linked to the genome ends. Despite the fact that TPs lack sequence homology, they share a similar structural arrangement, with the priming residue in the C-terminal half of the protein and an accumulation of positively charged residues at the N-terminal end. In addition, various bacteriophage TPs have been shown to have DNA-binding capacity that targets TPs and their attached genomes to the host nucleoid.more » Furthermore, a number of bacteriophage TPs from different viral families and with diverse hosts also contain putative nuclear localization signals and localize in the eukaryotic nucleus, which could lead to the transport of the attached DNA. This suggests a possible role of bacteriophage TPs in prokaryote-to-eukaryote horizontal gene transfer. - Highlights: • Protein-primed genome replication constitutes a strategy to initiate DNA or RNA synthesis in linear genomes. • Bacteriophage terminal proteins (TPs) are covalently attached to viral genomes by their primary function priming DNA replication. • TPs are also DNA-binding proteins and target phage genomes to the host nucleoid. • TPs can also localize in the eukaryotic nucleus and may have a role in phage-mediated interkingdom gene transfer.« less

  15. Glucocorticoid Regulation of the Vitamin D Receptor

    PubMed Central

    Hidalgo, Alejandro A.; Trump, Donald L.; Johnson, Candace S.

    2010-01-01

    Many studies indicate calcitriol has potent anti-tumor activity in different types of cancers. However, high levels of vitamin D can produce hypercalcemia in some patients. Glucocorticoids are used to ameliorate hypercalcemia and to enhance calcitriol anti-tumor activity. Calcitriol in combination with the glucocorticoid dexamethasone (Dex) increased vitamin D receptor (VDR) protein levels and ligand binding in squamous cell carcinoma VII (SCC). In this study we found that both calcitriol and Dex induce VDR- and glucocorticoid receptor (GR)-mediated transcription respectively, indicating both hormone receptors are active in SCC. Pre-treatment with Dex increases VDR-mediated transcription at the human CYP24A1 promoter. Whereas, pre-treatment with other steroid hormones, including dihydrotestosterone and R1881, has no effect on VDR-mediated transcription. Real-time PCR indicates treatment with Dex increases Vdr transcripts in a time-dependent manner, suggesting Dex may directly regulate expression of Vdr. Numerous putative glucocorticoid response elements (GREs) were found in the Vdr gene. Chromatin immunoprecipitation (ChIP) assay demonstrated GR binding at several putative GREs located within the mouse Vdr gene. However, none of the putative GREs studied increase GR-mediated transcription in luciferase reporter assays. In an attempt to identify the response element responsible for Vdr transcript regulation, future studies will continue to analyze newly identified GREs more distal from the Vdr gene promoter. PMID:20398752

  16. Role of the DNA Damage Response in Human Papillomavirus RNA Splicing and Polyadenylation.

    PubMed

    Nilsson, Kersti; Wu, Chengjun; Schwartz, Stefan

    2018-06-12

    Human papillomaviruses (HPVs) have evolved to use the DNA repair machinery to replicate its DNA genome in differentiated cells. HPV activates the DNA damage response (DDR) in infected cells. Cellular DDR factors are recruited to the HPV DNA genome and position the cellular DNA polymerase on the HPV DNA and progeny genomes are synthesized. Following HPV DNA replication, HPV late gene expression is activated. Recent research has shown that the DDR factors also interact with RNA binding proteins and affects RNA processing. DDR factors activated by DNA damage and that associate with HPV DNA can recruit splicing factors and RNA binding proteins to the HPV DNA and induce HPV late gene expression. This induction is the result of altered alternative polyadenylation and splicing of HPV messenger RNA (mRNA). HPV uses the DDR machinery to replicate its DNA genome and to activate HPV late gene expression at the level of RNA processing.

  17. Co-regulation analysis of co-expressed modules under cold and pathogen stress conditions in tomato.

    PubMed

    Abedini, Davar; Rashidi Monfared, Sajad

    2018-06-01

    A primary mechanism for controlling the development of multicellular organisms is transcriptional regulation, which carried out by transcription factors (TFs) that recognize and bind to their binding sites on promoter region. The distance from translation start site, order, orientation, and spacing between cis elements are key factors in the concentration of active nuclear TFs and transcriptional regulation of target genes. In this study, overrepresented motifs in cold and pathogenesis responsive genes were scanned via Gibbs sampling method, this method is based on detection of overrepresented motifs by means of a stochastic optimization strategy that searches for all possible sets of short DNA segments. Then, identified motifs were checked by TRANSFAC, PLACE and Soft Berry databases in order to identify putative TFs which, interact to the motifs. Several cis/trans regulatory elements were found using these databases. Moreover, cross-talk between cold and pathogenesis responsive genes were confirmed. Statistical analysis was used to determine distribution of identified motifs on promoter region. In addition, co-regulation analysis results, illustrated genes in pathogenesis responsive module are divided into two main groups. Also, promoter region was crunched to six subareas in order to draw the pattern of distribution of motifs in promoter subareas. The result showed the majority of motifs are concentrated on 700 nucleotides upstream of the translational start site (ATG). In contrast, this result isn't true in another group. In other words, there was no difference between total and compartmentalized regions in cold responsive genes.

  18. Determining the folding and binding free energy of DNA-based nanodevices and nanoswitches using urea titration curves

    PubMed Central

    Idili, Andrea

    2017-01-01

    Abstract DNA nanotechnology takes advantage of the predictability of DNA interactions to build complex DNA-based functional nanoscale structures. However, when DNA functional and responsive units that are based on non-canonical DNA interactions are employed it becomes quite challenging to predict, understand and control their thermodynamics. In response to this limitation, here we demonstrate the use of isothermal urea titration experiments to estimate the free energy involved in a set of DNA-based systems ranging from unimolecular DNA-based nanoswitches to more complex DNA folds (e.g. aptamers) and nanodevices. We propose here a set of fitting equations that allow to analyze the urea titration curves of these DNA responsive units based on Watson–Crick and non-canonical interactions (stem-loop, G-quadruplex, triplex structures) and to correctly estimate their relative folding and binding free energy values under different experimental conditions. The results described herein will pave the way toward the use of urea titration experiments in the field of DNA nanotechnology to achieve easier and more reliable thermodynamic characterization of DNA-based functional responsive units. More generally, our results will be of general utility to characterize other complex supramolecular systems based on different biopolymers. PMID:28605461

  19. Genetic heterogeneity of the dnaK gene locus including transcription terminator region (TTR) in Campylobacter lari.

    PubMed

    Shitara, M; Tsuboi, Y; Sekizuka, T; Tazumi, A; Moorei, J E; Millar, B C; Taneike, I; Matsuda, M

    2008-01-01

    Nucleotide sequences of approximately 3.1 kbp consisting of the full-length open reading frame (ORF) for grpE, a non-coding (NC) region and a putative ORF for the full-length dnaK gene (1860 bp) were identified from a urease-positive thermophilic Campylobacter (UPTC) CF89-12 isolate. Then, following the construction of a new degenerate polymerase chain reaction (PCR) primer pair for amplification of the dnaK structural gene, including the transcription terminator region of C. lari isolates, the dnaK region was amplified successfully, TA-cloned and sequenced in nine C. lari isolates. The dnaK gene sequences commenced with an ATG and terminated with a TAA in all 10 isolates, including CF89-12. In addition, the putative ORFs for the dnaK gene locus from seven UPTC isolates consisted of 1860 bases, and the four urease-negative (UN) C. lari isolates included C. lari RM2100 reference strain 1866. Interestingly, different probable ribosome binding sites and hypothetically intrinsic p-independent terminator structures were identified between the seven UPTC and four UN C. lari isolates, respectively. Moreover, it is interesting to note that 20 out of a total of 28 polymorphic sites occurred among amino acid sequences of the dnaK ORF from 11 C. lari isolates, identified to be alternatively UPTC-specific or UN C. lari-specific. In the neighbour-joining tree based on the nucleotide sequence information of the dnaK gene, C. lari forms two major distinct clusters consisting of UPTC and UN C. lari isolates, respectively, with UN C. lari being more closely related to other thermophilic campylobacters than to UPTC.

  20. Na+/K+-ATPase α-subunit in swimming crab Portunus trituberculatus: molecular cloning, characterization, and expression under low salinity stress

    NASA Astrophysics Data System (ADS)

    Han, Xiaolin; Liu, Ping; Gao, Baoquan; Wang, Haofeng; Duan, Yafei; Xu, Wenfei; Chen, Ping

    2015-07-01

    Na+/K+-ATPases are membrane-associated enzymes responsible for the active transport of Na+ and K+ ions across cell membranes, generating chemical and electrical gradients. These enzymes' α-subunit provides catalytic function, binding and hydrolyzing ATP, and itself becoming phosphorylated during the transport cycle. In this study, Na+/K+-ATPase α-subunit cDNA was cloned from gill tissue of the swimming crab Portunus trituberculatus by reverse-transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end methods. Analysis of the nucleotide sequence revealed that the cDNA had a full-length of 3 833 base pairs (bp), with an open reading frame of 3 120 bp, 5' untranslated region (UTR) of 317 bp, and 3' UTR of 396 bp. The sequence encoded a 1 039 amino acid protein with a predicted molecular weight of 115.57 kDa and with estimated pI of 5.21. It was predicted here to possess all expected features of Na+/K+-ATPase members, including eight transmembrane domains, putative ATP-binding site, and phosphorylation site. Comparison of amino acid sequences showed that the P. trituberculatus α-subunit possessed an overall identity of 75%-99% to that of other organisms. Phylogenetic analysis revealed that this α-subunit was in the same category as those of crustaceans. Quantitative real-time RT-PCR analysis indicated that this α-subunit's transcript were most highly expressed in gill and lowest in muscle. RT-PCR analysis also revealed that α-subunit expression in crab gill decreased after 2 and 6 h, but increased after 12, 24, 48, and 72 h. In addition, α-subunit expression in hepatopancreas of crab decreased after 2-72 h. These facts indicated that the crab's Na+/K+-ATPase α-subunit was potentially involved in the observed acute response to low salinity stress.

  1. The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans.

    PubMed

    Biggar, Kyle K; Storey, Kenneth B

    2018-01-01

    In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans . Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G 1 arrest for the duration of stress survival.

  2. The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans

    PubMed Central

    Biggar, Kyle K.

    2018-01-01

    In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans. Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G1 arrest for the duration of stress survival. PMID:29770276

  3. Novel structural features drive DNA binding properties of Cmr, a CRP family protein in TB complex mycobacteria.

    PubMed

    Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A

    2018-01-09

    Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Recurrent nonsense mutations in the growth hormone receptor from patients with Laron dwarfism.

    PubMed Central

    Amselem, S; Sobrier, M L; Duquesnoy, P; Rappaport, R; Postel-Vinay, M C; Gourmelen, M; Dallapiccola, B; Goossens, M

    1991-01-01

    In addition to its classical effects on growth, growth hormone (GH) has been shown to have a number of other actions, all of which are initiated by an interaction with specific high affinity receptors present in a variety of tissues. Purification of a rabbit liver protein via its ability to bind GH has allowed the isolation of a cDNA encoding a putative human growth hormone receptor that belongs to a new class of transmembrane receptors. We have previously shown that this putative growth hormone receptor gene is genetically linked to Laron dwarfism, a rare autosomal recessive syndrome caused by target resistance to GH. Nevertheless, the inability to express the corresponding full-length coding sequence and the lack of a test for growth-promoting function have hampered a direct confirmation of its role in growth. We have now identified three nonsense mutations within this growth hormone receptor gene, lying at positions corresponding to the amino terminal extremity and causing a truncation of the molecule, thereby deleting a large portion of both the GH binding domain and the full transmembrane and intracellular domains. Three independent patients with Laron dwarfism born of consanguineous parents were homozygous for these defects. Two defects were identical and consisted of a CG to TG transition. Not only do these results confirm the growth-promoting activity of this receptor but they also suggest that CpG doublets may represent hot spots for mutations in the growth hormone receptor gene that are responsible for hereditary dwarfism. Images PMID:1999489

  5. An in silico algorithm for identifying stabilizing pockets in proteins: test case, the Y220C mutant of the p53 tumor suppressor protein

    PubMed Central

    Bromley, Dennis; Bauer, Matthias R.; Fersht, Alan R.; Daggett, Valerie

    2016-01-01

    The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be ‘rescued’ and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant. PMID:27503952

  6. Evolution of the nuclear receptor gene superfamily.

    PubMed Central

    Laudet, V; Hänni, C; Coll, J; Catzeflis, F; Stéhelin, D

    1992-01-01

    Nuclear receptor genes represent a large family of genes encoding receptors for various hydrophobic ligands such as steroids, vitamin D, retinoic acid and thyroid hormones. This family also contains genes encoding putative receptors for unknown ligands. Nuclear receptor gene products are composed of several domains important for transcriptional activation, DNA binding (C domain), hormone binding and dimerization (E domain). It is not known whether these genes have evolved through gene duplication from a common ancestor or if their different domains came from different independent sources. To test these possibilities we have constructed and compared the phylogenetic trees derived from two different domains of 30 nuclear receptor genes. The tree built from the DNA binding C domain clearly shows a common progeny of all nuclear receptors, which can be grouped into three subfamilies: (i) thyroid hormone and retinoic acid receptors, (ii) orphan receptors and (iii) steroid hormone receptors. The tree constructed from the central part of the E domain which is implicated in transcriptional regulation and dimerization shows the same distribution in three subfamilies but two groups of receptors are in a different position from that in the C domain tree: (i) the Drosophila knirps family genes have acquired very different E domains during evolution, and (ii) the vitamin D and ecdysone receptors, as well as the FTZ-F1 and the NGF1B genes, seem to have DNA binding and hormone binding domains belonging to different classes. These data suggest a complex evolutionary history for nuclear receptor genes in which gene duplication events and swapping between domains of different origins took place. PMID:1312460

  7. Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.

    2013-11-20

    Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less

  8. SNM1B/Apollo in the DNA damage response and telomere maintenance

    PubMed Central

    Schmiester, Maren; Demuth, Ilja

    2017-01-01

    hSNM1B/Apollo is a member of the highly conserved β-CASP subgroup within the MBL superfamily of proteins. It interacts with several DNA repair proteins and functions within the Fanconi anemia pathway in response to DNA interstrand crosslinks. As a shelterin accessory protein, hSNM1B/Apollo is also vital for the generation and maintenance of telomeric overhangs. In this review, we will summarize studies on hSNM1B/Apollo's function, including its contribution to DNA damage signaling, replication fork maintenance, control of topological stress and telomere protection. Furthermore, we will highlight recent studies illustrating hSNM1B/Apollo's putative role in human disease. PMID:28430596

  9. SNM1B/Apollo in the DNA damage response and telomere maintenance.

    PubMed

    Schmiester, Maren; Demuth, Ilja

    2017-07-18

    hSNM1B/Apollo is a member of the highly conserved β-CASP subgroup within the MBL superfamily of proteins. It interacts with several DNA repair proteins and functions within the Fanconi anemia pathway in response to DNA interstrand crosslinks. As a shelterin accessory protein, hSNM1B/Apollo is also vital for the generation and maintenance of telomeric overhangs. In this review, we will summarize studies on hSNM1B/Apollo's function, including its contribution to DNA damage signaling, replication fork maintenance, control of topological stress and telomere protection. Furthermore, we will highlight recent studies illustrating hSNM1B/Apollo's putative role in human disease.

  10. Nectinepsin: a new extracellular matrix protein of the pexin family. Characterization of a novel cDNA encoding a protein with an RGD cell binding motif.

    PubMed

    Blancher, C; Omri, B; Bidou, L; Pessac, B; Crisanti, P

    1996-10-18

    We report the isolation and characterization of a novel cDNA from quail neuroretina encoding a putative protein named nectinepsin. The nectinepsin cDNA identifies a major 2.2-kilobase mRNA that is detected from ED 5 in neuroretina and is increasingly abundant during embryonic development. A nectinepsin mRNA is also found in quail liver, brain, and intestine and in mouse retina. The deduced nectinepsin amino acid sequence contains the RGD cell binding motif of integrin ligands. Furthermore, nectinepsin shares substantial homologies with vitronectin and structural protein similarities with most of the matricial metalloproteases. However, the presence of a specific sequence and the lack of heparin and collagen binding domains of the vitronectin indicate that nectinepsin is a new extracellular matrix protein. Furthermore, genomic Southern blot studies suggest that nectinepsin and vitronectin are encoded by different genes. Western blot analysis with an anti-human vitronectin antiserum revealed, in addition to the 65- and 70-kDa vitronectin bands, an immunoreactive protein of about 54 kDa in all tissues containing nectinepsin mRNA. It seems likely that the form of vitronectin found in chick egg yolk plasma by Nagano et al. ((1992) J. Biol. Chem. 267, 24863-24870) is the protein that corresponds to the nectinepsin cDNA. This new protein could be an important molecule involved in the early steps of the development.

  11. Conserved ABC Transport System Regulated by the General Stress Response Pathways of Alpha- and Gammaproteobacteria.

    PubMed

    Herrou, Julien; Willett, Jonathan W; Czyż, Daniel M; Babnigg, Gyorgy; Kim, Youngchang; Crosson, Sean

    2017-03-01

    Brucella abortus σ E1 is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon, bab1_0223-bab1_0226 , is among the most highly activated gene sets in the σ E1 regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription of yehZYXW is activated by the general stress sigma factor σ S in Enterobacteriaceae , which suggests a functional role for this transport system in bacterial stress response across the classes Alphaproteobacteria and Gammaproteobacteria We present evidence that B. abortus YehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σ E1 -null strain. The sole in vitro phenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li + ion concentrations. A crystal structure of B. abortus YehZ revealed a class II periplasmic binding protein fold with significant structural homology to Archaeoglobus fulgidus ProX, which binds glycine betaine. However, the structure of the YehZ ligand-binding pocket is incompatible with high-affinity binding to glycine betaine. This is consistent with weak measured binding of YehZ to glycine betaine and related compatible solutes. We conclude that YehZYXW is a conserved, stress-regulated transport system that is phylogenetically and functionally distinct from quaternary ammonium-compatible solute importers. IMPORTANCE Brucella abortus σ E1 regulates transcription in response to stressors encountered in its mammalian host and is necessary for maintenance of chronic infection in a mouse model. The functions of the majority of genes regulated by σ E1 remain undefined. We present a functional/structural analysis of a conserved putative membrane transport system (YehZYXW) whose expression is strongly activated by σ E1 Though annotated as a quaternary ammonium osmolyte uptake system, experimental physiological studies and measured ligand-binding properties of the periplasmic binding protein (PBP), YehZ, are inconsistent with this function. A crystal structure of B. abortus YehZ provides molecular insight into differences between bona fide quaternary ammonium osmolyte importers and YehZ-related proteins, which form a distinct phylogenetic and functional group of PBPs. Copyright © 2017 American Society for Microbiology.

  12. Conserved ABC Transport System Regulated by the General Stress Response Pathways of Alpha- and Gammaproteobacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herrou, Julien; Willett, Jonathan W.; Czyż, Daniel M.

    ABSTRACT Brucella abortusσ E1is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon,bab1_0223-bab1_0226, is among the most highly activated gene sets in the σ E1regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription ofyehZYXWis activated by the general stress sigma factor σ SinEnterobacteriaceae, which suggests a functional role for this transport systemmore » in bacterial stress response across the classesAlphaproteobacteriaandGammaproteobacteria. We present evidence thatB. abortusYehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σ E1-null strain. The solein vitrophenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li +ion concentrations. A crystal structure ofB. abortusYehZ revealed a class II periplasmic binding protein fold with significant structural homology toArchaeoglobus fulgidusProX, which binds glycine betaine. However, the structure of the YehZ ligand-binding pocket is incompatible with high-affinity binding to glycine betaine. This is consistent with weak measured binding of YehZ to glycine betaine and related compatible solutes. We conclude that YehZYXW is a conserved, stress-regulated transport system that is phylogenetically and functionally distinct from quaternary ammonium-compatible solute importers. IMPORTANCEBrucella abortusσ E1regulates transcription in response to stressors encountered in its mammalian host and is necessary for maintenance of chronic infection in a mouse model. The functions of the majority of genes regulated by σ E1remain undefined. We present a functional/structural analysis of a conserved putative membrane transport system (YehZYXW) whose expression is strongly activated by σ E1. Though annotated as a quaternary ammonium osmolyte uptake system, experimental physiological studies and measured ligand-binding properties of the periplasmic binding protein (PBP), YehZ, are inconsistent with this function. A crystal structure ofB. abortusYehZ provides molecular insight into differences between bona fide quaternary ammonium osmolyte importers and YehZ-related proteins, which form a distinct phylogenetic and functional group of PBPs.« less

  13. Identification of aluminum-regulated genes by cDNA-AFLP analysis of roots in two contrasting genotypes of highbush blueberry (Vaccinium corymbosum L.).

    PubMed

    Inostroza-Blancheteau, Claudio; Aquea, Felipe; Reyes-Díaz, Marjorie; Alberdi, Miren; Arce-Johnson, Patricio

    2011-09-01

    To investigate the molecular mechanisms of Al(3+)-stress in blueberry, a cDNA-amplified fragment length polymorphism (cDNA-AFLP) analysis was employed to identify Al-regulated genes in roots of contrasting genotypes of highbush blueberry (Brigitta, Al(3+)-resistant and Bluegold, Al(3+)-sensitive). Plants grown in hydroponic culture were treated with 0 and 100 μM Al(3+) and collected at different times over 48 h. Seventy transcript-derived fragments (TDFs) were identified as being Al(3+) responsive, 31 of which showed significant homology to genes with known or putative functions. Twelve TDFs were homologous to uncharacterized genes and 27 did not have significant matches. The expression pattern of several of the genes with known functions in other species was confirmed by quantitative relative real-time RT-PCR. Twelve genes of known or putative function were related to cellular metabolism, nine associated to stress responses and other transcription and transport facilitation processes. Genes involved in signal transduction, photosynthetic and energy processes were also identified, suggesting that a multitude of processes are implicated in the Al(3+)-stress response as reported previously for other species. The Al(3+)-stress response genes identified in this study could be involved in Al(3+)-resistance in woody plants.

  14. The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

    PubMed Central

    Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

    2010-01-01

    The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

  15. Identification and expression analysis of a putative fatty acidbinding protein gene in the Asian honeybee, Apis cerana cerana.

    PubMed

    Yu, Xiaoli; Kang, Mingjiang; Liu, Li; Guo, Xingqi; Xu, Baohua

    2013-01-01

    Fatty acid-binding proteins (FABPs) play pivotal roles in cellular signaling, gene transcription, and lipid metabolism in vertebrates and invertebrates. In this study, a putative FABP gene, referred to as AccFABP, was isolated from the Asian honeybee, Apis cerana cerana Fabricius (Hymenoptera: Apidae). The full-length cDNA consisted of 725 bp, and encoded a protein of 204 amino acids. Homology and phylogenetic analysis indicated that AccFABP was a member of the FABP multifamily. The genomic structure of this gene, which was common among FABP multifamily members, spanned 1,900 bp, and included four exons and three introns. Gene expression analysis revealed that AccFABP was highly expressed in the dark-pigmented phase of pupal development, with peak expression observed in the fat bodies of the dark-pigmented phase pupae. The AccFABP transcripts in the fat body were upregulated by exposure to dietary fatty acids such as conjugated linoleic acid, docosahexaenoic acid, and arachidonic acid. Transcription factor binding sites for Caudal-Related Homeobox and functional CCAAT/enhancer binding site, which were respectively associated with tissue expression and lipid metabolism, were detected in the 5' promoter sequence. The evidence provided in the present study suggests that AccFABP may regulate insect growth and development, and lipid metabolism.

  16. The Verrucomicrobia LexA-Binding Motif: Insights into the Evolutionary Dynamics of the SOS Response.

    PubMed

    Erill, Ivan; Campoy, Susana; Kılıç, Sefa; Barbé, Jordi

    2016-01-01

    The SOS response is the primary bacterial mechanism to address DNA damage, coordinating multiple cellular processes that include DNA repair, cell division, and translesion synthesis. In contrast to other regulatory systems, the composition of the SOS genetic network and the binding motif of its transcriptional repressor, LexA, have been shown to vary greatly across bacterial clades, making it an ideal system to study the co-evolution of transcription factors and their regulons. Leveraging comparative genomics approaches and prior knowledge on the core SOS regulon, here we define the binding motif of the Verrucomicrobia, a recently described phylum of emerging interest due to its association with eukaryotic hosts. Site directed mutagenesis of the Verrucomicrobium spinosum recA promoter confirms that LexA binds a 14 bp palindromic motif with consensus sequence TGTTC-N4-GAACA. Computational analyses suggest that recognition of this novel motif is determined primarily by changes in base-contacting residues of the third alpha helix of the LexA helix-turn-helix DNA binding motif. In conjunction with comparative genomics analysis of the LexA regulon in the Verrucomicrobia phylum, electrophoretic shift assays reveal that LexA binds to operators in the promoter region of DNA repair genes and a mutagenesis cassette in this organism, and identify previously unreported components of the SOS response. The identification of tandem LexA-binding sites generating instances of other LexA-binding motifs in the lexA gene promoter of Verrucomicrobia species leads us to postulate a novel mechanism for LexA-binding motif evolution. This model, based on gene duplication, successfully addresses outstanding questions in the intricate co-evolution of the LexA protein, its binding motif and the regulatory network it controls.

  17. Genome-Wide Analysis of the RAV Family in Soybean and Functional Identification of GmRAV-03 Involvement in Salt and Drought Stresses and Exogenous ABA Treatment

    PubMed Central

    Zhao, Shu-Ping; Xu, Zhao-Shi; Zheng, Wei-Jun; Zhao, Wan; Wang, Yan-Xia; Yu, Tai-Fei; Chen, Ming; Zhou, Yong-Bin; Min, Dong-Hong; Ma, You-Zhi; Chai, Shou-Cheng; Zhang, Xiao-Hong

    2017-01-01

    Transcription factors play vital roles in plant growth and in plant responses to abiotic stresses. The RAV transcription factors contain a B3 DNA binding domain and/or an APETALA2 (AP2) DNA binding domain. Although genome-wide analyses of RAV family genes have been performed in several species, little is known about the family in soybean (Glycine max L.). In this study, a total of 13 RAV genes, named as GmRAVs, were identified in the soybean genome. We predicted and analyzed the amino acid compositions, phylogenetic relationships, and folding states of conserved domain sequences of soybean RAV transcription factors. These soybean RAV transcription factors were phylogenetically clustered into three classes based on their amino acid sequences. Subcellular localization analysis revealed that the soybean RAV proteins were located in the nucleus. The expression patterns of 13 RAV genes were analyzed by quantitative real-time PCR. Under drought stresses, the RAV genes expressed diversely, up- or down-regulated. Following NaCl treatments, all RAV genes were down-regulated excepting GmRAV-03 which was up-regulated. Under abscisic acid (ABA) treatment, the expression of all of the soybean RAV genes increased dramatically. These results suggested that the soybean RAV genes may be involved in diverse signaling pathways and may be responsive to abiotic stresses and exogenous ABA. Further analysis indicated that GmRAV-03 could increase the transgenic lines resistance to high salt and drought and result in the transgenic plants insensitive to exogenous ABA. This present study provides valuable information for understanding the classification and putative functions of the RAV transcription factors in soybean. PMID:28634481

  18. The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

    PubMed Central

    Oliviero, S; Cortese, R

    1989-01-01

    Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

  19. Replication of damaged DNA in vitro is blocked by p53

    PubMed Central

    Zhou, Jianmin; Prives, Carol

    2003-01-01

    The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

  20. Treacher Collins syndrome TCOF1 protein cooperates with NBS1 in the DNA damage response.

    PubMed

    Ciccia, Alberto; Huang, Jen-Wei; Izhar, Lior; Sowa, Mathew E; Harper, J Wade; Elledge, Stephen J

    2014-12-30

    The signal transduction pathway of the DNA damage response (DDR) is activated to maintain genomic integrity following DNA damage. The DDR promotes genomic integrity by regulating a large network of cellular activities that range from DNA replication and repair to transcription, RNA splicing, and metabolism. In this study we define an interaction between the DDR factor NBS1 and TCOF1, a nucleolar protein that regulates ribosomal DNA (rDNA) transcription and is mutated in Treacher Collins syndrome. We show that NBS1 relocalizes to nucleoli after DNA damage in a manner dependent on TCOF1 and on casein kinase II and ATM, which are known to modify TCOF1 by phosphorylation. Moreover, we identify a putative ATM phosphorylation site that is required for NBS1 relocalization to nucleoli in response to DNA damage. Last, we report that TCOF1 promotes cellular resistance to DNA damaging agents. Collectively, our findings identify TCOF1 as a DDR factor that could cooperate with ATM and NBS1 to suppress inappropriate rDNA transcription and maintain genomic integrity after DNA damage.

  1. Treacher Collins syndrome TCOF1 protein cooperates with NBS1 in the DNA damage response

    PubMed Central

    Ciccia, Alberto; Huang, Jen-Wei; Izhar, Lior; Sowa, Mathew E.; Harper, J. Wade; Elledge, Stephen J.

    2014-01-01

    The signal transduction pathway of the DNA damage response (DDR) is activated to maintain genomic integrity following DNA damage. The DDR promotes genomic integrity by regulating a large network of cellular activities that range from DNA replication and repair to transcription, RNA splicing, and metabolism. In this study we define an interaction between the DDR factor NBS1 and TCOF1, a nucleolar protein that regulates ribosomal DNA (rDNA) transcription and is mutated in Treacher Collins syndrome. We show that NBS1 relocalizes to nucleoli after DNA damage in a manner dependent on TCOF1 and on casein kinase II and ATM, which are known to modify TCOF1 by phosphorylation. Moreover, we identify a putative ATM phosphorylation site that is required for NBS1 relocalization to nucleoli in response to DNA damage. Last, we report that TCOF1 promotes cellular resistance to DNA damaging agents. Collectively, our findings identify TCOF1 as a DDR factor that could cooperate with ATM and NBS1 to suppress inappropriate rDNA transcription and maintain genomic integrity after DNA damage. PMID:25512513

  2. Tsetse Salivary Gland Proteins 1 and 2 Are High Affinity Nucleic Acid Binding Proteins with Residual Nuclease Activity

    PubMed Central

    Caljon, Guy; Ridder, Karin De; Stijlemans, Benoît; Coosemans, Marc; Magez, Stefan; De Baetselier, Patrick; Van Den Abbeele, Jan

    2012-01-01

    Analysis of the tsetse fly salivary gland EST database revealed the presence of a highly enriched cluster of putative endonuclease genes, including tsal1 and tsal2. Tsal proteins are the major components of tsetse fly (G. morsitans morsitans) saliva where they are present as monomers as well as high molecular weight complexes with other saliva proteins. We demonstrate that the recombinant tsetse salivary gland proteins 1&2 (Tsal1&2) display DNA/RNA non-specific, high affinity nucleic acid binding with KD values in the low nanomolar range and a non-exclusive preference for duplex. These Tsal proteins exert only a residual nuclease activity with a preference for dsDNA in a broad pH range. Knockdown of Tsal expression by in vivo RNA interference in the tsetse fly revealed a partially impaired blood digestion phenotype as evidenced by higher gut nucleic acid, hematin and protein contents. PMID:23110062

  3. The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

    PubMed

    Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

    2017-09-12

    The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

  4. Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions that Inhibit DNA Binding

    PubMed Central

    Leonard, Paul G.; Bezar, Ian F.; Sidote, David J.; Stock, Ann M.

    2012-01-01

    The AgrA transcription factor regulates the quorum-sensing response in Staphylococcus aureus, controlling the production of hemolysins and other virulence factors. AgrA binds to DNA via its C-terminal LytTR domain, a domain not found in humans but common in many pathogenic bacteria, making it a potential target for antimicrobial development. We have determined the crystal structure of the apo AgrA LytTR domain and screened a library of 500 fragment compounds to find inhibitors of AgrA DNA-binding activity. Using NMR, the binding site for five compounds has been mapped to a common locus at the C-terminal end of the LytTR domain, a site known to be important for DNA-binding activity. Three of these compounds inhibit AgrA DNA binding. These results provide the first evidence that LytTR domains can be targeted by small organic compounds. PMID:23181972

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cordeiro, André M.; Figueiredo, Duarte D.; Tepperman, James

    DREB1/CBF genes, known as major regulators of plant stress responses, are rapidly and transiently induced by low temperatures. Using a yeast one-hybrid screening, we identified a putative Phytochrome-Interacting bHLH Factor (OsPIF14), as binding to the OsDREB1B promoter. bHLH proteins are able to bind to hexameric E-box (CANNTG) or N-box (CACG(A/C)G) motifs, depending on transcriptional activity. We have shown that OsPIF14 binds to the OsDREB1B promoter through two N-boxes and that the flanking regions of the hexameric core are essential for protein–DNA interaction and stability. We also showed that OsPIF14 down-regulates OsDREB1B gene expression in rice protoplasts, corroborating the OsPIF14 repressormore » activity observed in the transactivation assays using Arabidopsis protoplasts. Additionally, we showed that OsPIF14 is indeed a phytochrome interacting factor, which preferentially binds to the active form (Pfr) of rice phytochrome B. This raises the possibility that OsPIF14 activity might be modulated by light. However, we did not observe any regulation of the OsDREB1B gene expression by light under control conditions. Moreover, OsPIF14 gene expression was shown to be modulated by different treatments, such as drought, salt, cold and ABA. Interestingly, OsPIF14 showed also a specific cold-induced alternative splicing. Our results suggest the possibility that OsPIF14 is involved in cross-talk between light and stress signaling through interaction with the OsDREB1B promoter. Finally, although in the absence of stress, OsDREB1B gene expression was not regulated by light, given previous reports, it remains possible that OsPIF14 has a role in light modulation of stress responses.« less

  6. Isolation and characterization of a novel calmodulin-binding protein from potato

    NASA Technical Reports Server (NTRS)

    Reddy, Anireddy S N.; Day, Irene S.; Narasimhulu, S. B.; Safadi, Farida; Reddy, Vaka S.; Golovkin, Maxim; Harnly, Melissa J.

    2002-01-01

    Tuberization in potato is controlled by hormonal and environmental signals. Ca(2+), an important intracellular messenger, and calmodulin (CaM), one of the primary Ca(2+) sensors, have been implicated in controlling diverse cellular processes in plants including tuberization. The regulation of cellular processes by CaM involves its interaction with other proteins. To understand the role of Ca(2+)/CaM in tuberization, we have screened an expression library prepared from developing tubers with biotinylated CaM. This screening resulted in isolation of a cDNA encoding a novel CaM-binding protein (potato calmodulin-binding protein (PCBP)). Ca(2+)-dependent binding of the cDNA-encoded protein to CaM is confirmed by (35)S-labeled CaM. The full-length cDNA is 5 kb long and encodes a protein of 1309 amino acids. The deduced amino acid sequence showed significant similarity with a hypothetical protein from another plant, Arabidopsis. However, no homologs of PCBP are found in nonplant systems, suggesting that it is likely to be specific to plants. Using truncated versions of the protein and a synthetic peptide in CaM binding assays we mapped the CaM-binding region to a 20-amino acid stretch (residues 1216-1237). The bacterially expressed protein containing the CaM-binding domain interacted with three CaM isoforms (CaM2, CaM4, and CaM6). PCBP is encoded by a single gene and is expressed differentially in the tissues tested. The expression of CaM, PCBP, and another CaM-binding protein is similar in different tissues and organs. The predicted protein contained seven putative nuclear localization signals and several strong PEST motifs. Fusion of the N-terminal region of the protein containing six of the seven nuclear localization signals to the reporter gene beta-glucuronidase targeted the reporter gene to the nucleus, suggesting a nuclear role for PCBP.

  7. Pathogen-regulated genes in wheat isogenic lines differing in resistance to brown rust Puccinia triticina.

    PubMed

    Dmochowska-Boguta, Marta; Alaba, Sylwia; Yanushevska, Yuliya; Piechota, Urszula; Lasota, Elzbieta; Nadolska-Orczyk, Anna; Karlowski, Wojciech M; Orczyk, Waclaw

    2015-10-05

    Inoculation of wheat plants with Puccinia triticina (Pt) spores activates a wide range of host responses. Compatible Pt interaction with susceptible Thatcher plants supports all stages of the pathogen life cycle. Incompatible interaction with TcLr9 activates defense responses including oxidative burst and micronecrotic reactions associated with the pathogen's infection structures and leads to complete termination of pathogen development. These two contrasting host-pathogen interactions were a foundation for transcriptome analysis of incompatible wheat-Pt interaction. A suppression subtractive hybridization (SSH) library was constructed using cDNA from pathogen-inoculated susceptible Thatcher and resistant TcLr9 isogenic lines. cDNA represented steps of wheat-brown rust interactions: spore germination, haustorium mother cell (HMC) formation and micronecrotic reactions. All ESTs were clustered and validated by similarity search to wheat genome using BLASTn and sim4db tools. qRT-PCR was used to determine transcript levels of selected ESTs after inoculation in both lines. Out of 793 isolated cDNA clones, 183 were classified into 152 contigs. 89 cDNA clones and encoded proteins were functionally annotated and assigned to 5 Gene Ontology categories: catalytic activity 48 clones (54 %), binding 32 clones (36 %), transporter activity 6 clones (7 %), structural molecule activity 2 clones (2 %) and molecular transducer activity 1 clone (1 %). Detailed expression profiles of 8 selected clones were analyzed using the same plant-pathogen system. The strongest induction after pathogen infection and the biggest differences between resistant and susceptible interactions were detected for clones encoding wall-associated kinase (GenBank accession number JG969003), receptor with leucine-rich repeat domain (JG968955), putative serine/threonine protein kinase (JG968944), calcium-mediated signaling protein (JG968925) and 14-3-3 protein (JG968969). The SSH library represents transcripts regulated by pathogen infection during compatible and incompatible interactions of wheat with P. triticina. Annotation of selected clones confirms their putative roles in successive steps of plant-pathogen interactions. The transcripts can be categorized as defense-related due to their involvement in either basal defense or resistance through an R-gene mediated reaction. The possible involvement of selected clones in pathogen recognition and pathogen-induced signaling as well as resistance mechanisms such as cell wall enforcement, oxidative burst and micronecrotic reactions is discussed.

  8. Trigger Factor and DnaK possess overlapping substrate pools and binding specificities.

    PubMed

    Deuerling, Elke; Patzelt, Holger; Vorderwülbecke, Sonja; Rauch, Thomas; Kramer, Günter; Schaffitzel, Elke; Mogk, Axel; Schulze-Specking, Agnes; Langen, Hanno; Bukau, Bernd

    2003-03-01

    Ribosome-associated Trigger Factor (TF) and the DnaK chaperone system assist the folding of newly synthesized proteins in Escherichia coli. Here, we show that DnaK and TF share a common substrate pool in vivo. In TF-deficient cells, deltatig, depleted for DnaK and DnaJ the amount of aggregated proteins increases with increasing temperature, amounting to 10% of total soluble protein (approximately 340 protein species) at 37 degrees C. A similar population of proteins aggregated in DnaK depleted tig+ cells, albeit to a much lower extent. Ninety-four aggregated proteins isolated from DnaK- and DnaJ-depleted deltatig cells were identified by mass spectrometry and found to include essential cytosolic proteins. Four potential in vivo substrates were screened for chaperone binding sites using peptide libraries. Although TF and DnaK recognize different binding motifs, 77% of TF binding peptides also associated with DnaK. In the case of the nascent polypeptides TF and DnaK competed for binding, however, with competitive advantage for TF. In vivo, the loss of TF is compensated by the induction of the heat shock response and thus enhanced levels of DnaK. In summary, our results demonstrate that the co-operation of the two mechanistically distinct chaperones in protein folding is based on their overlap in substrate specificities.

  9. HTLV-1 Tax Oncoprotein Subverts the Cellular DNA Damage Response via Binding to DNA-dependent Protein Kinase*S⃞

    PubMed Central

    Durkin, Sarah S.; Guo, Xin; Fryrear, Kimberly A.; Mihaylova, Valia T.; Gupta, Saurabh K.; Belgnaoui, S. Mehdi; Haoudi, Abdelali; Kupfer, Gary M.; Semmes, O. John

    2008-01-01

    Human T-cell leukemia virus type-1 is the causative agent for adult T-cell leukemia. Previous research has established that the viral oncoprotein Tax mediates the transformation process by impairing cell cycle control and cellular response to DNA damage. We showed previously that Tax sequesters huChk2 within chromatin and impairs the response to ionizing radiation. Here we demonstrate that DNA-dependent protein kinase (DNA-PK) is a member of the Tax·Chk2 nuclear complex. The catalytic subunit, DNA-PKcs, and the regulatory subunit, Ku70, were present. Tax-containing nuclear extracts showed increased DNA-PK activity, and specific inhibition of DNA-PK prevented Tax-induced activation of Chk2 kinase activity. Expression of Tax induced foci formation and phosphorylation of H2AX. However, Tax-induced constitutive signaling of the DNA-PK pathway impaired cellular response to new damage, as reflected in suppression of ionizing radiation-induced DNA-PK phosphorylation and γH2AX stabilization. Tax co-localized with phospho-DNA-PK into nuclear speckles and a nuclear excluded Tax mutant sequestered endogenous phospho-DNA-PK into the cytoplasm, suggesting that Tax interaction with DNA-PK is an initiating event. We also describe a novel interaction between DNA-PK and Chk2 that requires Tax. We propose that Tax binds to and stabilizes a protein complex with DNA-PK and Chk2, resulting in a saturation of DNA-PK-mediated damage repair response. PMID:18957425

  10. Insights into the nature of DNA binding of AbrB-like transcription factors

    PubMed Central

    Sullivan, Daniel M.; Bobay, Benjamin G.; Kojetin, Douglas J.; Thompson, Richele J.; Rance, Mark; Strauch, Mark A.; Cavanagh, John

    2008-01-01

    Summary Understanding the DNA recognition and binding by the AbrB-like family of transcriptional regulators is of significant interest since these proteins enable bacteria to elicit the appropriate response to diverse environmental stimuli. Although these ‘transition-state regulator’ proteins have been well characterized at the genetic level, the general and specific mechanisms of DNA binding remain elusive. We present RDC-refined NMR solution structures and dynamic properties of the DNA-binding domains of three Bacillus subtilis transition-state regulators AbrB, Abh, and SpoVT. We combined previously investigated DNase I footprinting, DNA methylation, gel shift assays, mutagenic and NMR studies to generate a structural model of the complex between AbrBN55 and its cognate promoter, abrB8. These investigations have enabled us to generate the first model for the specific nature of the transition-state regulator-DNA interaction. PMID:19000822

  11. Expression, purification, and DNA-binding activity of the Herbaspirillum seropedicae RecX protein.

    PubMed

    Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

    2004-06-01

    The Herbaspirillum seropedicae RecX protein participates in the SOS response: a process in which the RecA protein plays a central role. The RecX protein of the H. seropedicae, fused to a His-tag sequence (RecX His-tagged), was over-expressed in Escherichia coli and purified by metal-affinity chromatography to yield a highly purified and active protein. DNA band-shift assays showed that the RecX His-tagged protein bound to both circular and linear double-stranded DNA and also to circular single-stranded DNA. The apparent affinity of RecX for DNA decreased in the presence of Mg(2+) ions. The ability of RecX to bind DNA may be relevant to its function in the SOS response.

  12. Optimization of Polyplex Formation between DNA Oligonucleotide and Poly(ʟ-Lysine): Experimental Study and Modeling Approach.

    PubMed

    Vasiliu, Tudor; Cojocaru, Corneliu; Rotaru, Alexandru; Pricope, Gabriela; Pinteala, Mariana; Clima, Lilia

    2017-06-17

    The polyplexes formed by nucleic acids and polycations have received a great attention owing to their potential application in gene therapy. In our study, we report experimental results and modeling outcomes regarding the optimization of polyplex formation between the double-stranded DNA (dsDNA) and poly(ʟ-Lysine) (PLL). The quantification of the binding efficiency during polyplex formation was performed by processing of the images captured from the gel electrophoresis assays. The design of experiments (DoE) and response surface methodology (RSM) were employed to investigate the coupling effect of key factors (pH and N/P ratio) affecting the binding efficiency. According to the experimental observations and response surface analysis, the N/P ratio showed a major influence on binding efficiency compared to pH. Model-based optimization calculations along with the experimental confirmation runs unveiled the maximal binding efficiency (99.4%) achieved at pH 5.4 and N/P ratio 125. To support the experimental data and reveal insights of molecular mechanism responsible for the polyplex formation between dsDNA and PLL, molecular dynamics simulations were performed at pH 5.4 and 7.4.

  13. Optimization of Polyplex Formation between DNA Oligonucleotide and Poly(l-Lysine): Experimental Study and Modeling Approach

    PubMed Central

    Vasiliu, Tudor; Cojocaru, Corneliu; Rotaru, Alexandru; Pricope, Gabriela; Pinteala, Mariana; Clima, Lilia

    2017-01-01

    The polyplexes formed by nucleic acids and polycations have received a great attention owing to their potential application in gene therapy. In our study, we report experimental results and modeling outcomes regarding the optimization of polyplex formation between the double-stranded DNA (dsDNA) and poly(l-Lysine) (PLL). The quantification of the binding efficiency during polyplex formation was performed by processing of the images captured from the gel electrophoresis assays. The design of experiments (DoE) and response surface methodology (RSM) were employed to investigate the coupling effect of key factors (pH and N/P ratio) affecting the binding efficiency. According to the experimental observations and response surface analysis, the N/P ratio showed a major influence on binding efficiency compared to pH. Model-based optimization calculations along with the experimental confirmation runs unveiled the maximal binding efficiency (99.4%) achieved at pH 5.4 and N/P ratio 125. To support the experimental data and reveal insights of molecular mechanism responsible for the polyplex formation between dsDNA and PLL, molecular dynamics simulations were performed at pH 5.4 and 7.4. PMID:28629130

  14. Generation of mice deficient in RNA-binding motif protein 3 (RBM3) and characterization of its role in innate immune responses and cell growth

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matsuda, Atsushi; Core Research for Evolution Science and Technology, Japan Science and Technology Agency, Chiyoda-ku, Tokyo 102-0075; Ogawa, Masahiro

    Highlights: {yields} We identified RNA-binding motif protein 3 (RBM3) as CpG-B DNA-binding protein. {yields} RBM3 translocates from the nucleus to the cytoplasm and co-localized with CpG-B DNA. {yields} We newly generated Rbm3-deficient (Rbm3{sup -/-}) mice. {yields} DNA-mediated cytokine gene induction was normally occured in Rbm3{sup -/-} cells. {yields}Rbm3{sup -/-} MEFs showed poorer proliferation rate and increased number of G2-phase cells. -- Abstract: The activation of innate immune responses is critical to host defense against microbial infections, wherein nucleic acid-sensing pattern recognition receptors recognize DNA or RNA from viruses or bacteria and activate downstream signaling pathways. In a search for newmore » DNA-sensing molecules that regulate innate immune responses, we identified RNA-binding motif protein 3 (RBM3), whose role has been implicated in the regulation of cell growth. In this study, we generated Rbm3-deficient (Rbm3{sup -/-}) mice to study the role of RBM3 in immune responses and cell growth. Despite evidence for its interaction with immunogenic DNA in a cell, no overt phenotypic abnormalities were found in cells from Rbm3{sup -/-} mice for the DNA-mediated induction of cytokine genes. Interestingly, however, Rbm3{sup -/-} mouse embryonic fibroblasts (MEFs) showed poorer proliferation rates as compared to control MEFs. Further cell cycle analysis revealed that Rbm3{sup -/-} MEFs have markedly increased number of G2-phase cells, suggesting a hitherto unknown role of RBM3 in the G2-phase control. Thus, these mutant mice and cells may provide new tools with which to study the mechanisms underlying the regulation of cell cycle and oncogenesis.« less

  15. Molecular structure of EmbR, a response element of Ser/Thr kinase signaling in Mycobacterium tuberculosis

    PubMed Central

    Alderwick, Luke J.; Molle, Virginie; Kremer, Laurent; Cozzone, Alain J.; Dafforn, Timothy R.; Besra, Gurdyal S.; Fütterer, Klaus

    2006-01-01

    Ser/Thr phosphorylation has emerged as a critical regulatory mechanism in a number of bacteria, including Mycobacterium tuberculosis. This problematic pathogen encodes 11 eukaryotic-like Ser/Thr kinases, yet few substrates or signaling targets have been characterized. Here, we report the structure of EmbR (2.0 Å), a putative transcriptional regulator of key arabinosyltransferases (EmbC, -A, and -B), and an endogenous substrate of the Ser/Thr-kinase PknH. EmbR presents a unique domain architecture: the N-terminal winged-helix DNA-binding domain forms an extensive interface with the all-helical central bacterial transcriptional activation domain and is positioned adjacent to the regulatory C-terminal forkhead-associated (FHA) domain, which mediates binding to a Thr-phosphorylated site in PknH. The structure in complex with a phospho-peptide (1.9 Å) reveals a conserved mode of phospho-threonine recognition by the FHA domain and evidence for specific recognition of the cognate kinase. The present structures suggest hypotheses as to how EmbR might propagate the phospho-relay signal from its cognate kinase, while serving as a template for the structurally uncharacterized Streptomyces antibiotic regulatory protein family of transcription factors. PMID:16477027

  16. Dipeptidyl peptidase III is a zinc metallo-exopeptidase. Molecular cloning and expression.

    PubMed Central

    Fukasawa, K; Fukasawa, K M; Kanai, M; Fujii, S; Hirose, J; Harada, M

    1998-01-01

    We have purified dipeptidyl peptidase III (EC 3.4.14.4) from human placenta. It had a pH optimum of 8.8 and readily hydrolysed Arg-Arg-beta-naphthylamide. Monoamino acid-, Gly-Phe-, Gly-Pro- and Bz-Arg-beta-naphthylamides were not hydrolysed at all. The enzyme was inhibited by p-chloromercuriphenylsulphonic acid, metal chelators and 3,4-dichloroisocoumarin and contained 1 mol of zinc per mol of enzyme. The zinc dissociation constant was 250 fM at pH 7. 4 as determined by the zinc binding study. We isolated, by immunological screening of a Uni-ZAP XR cDNA library constructed from rat liver mRNA species, a cDNA clone with 2633 bp encoding the rat enzyme. The longest open reading frame encodes a 827-residue protein with a theoretical molecular mass of 92790 Da. Escherichia coli SOLR cells were infected with the pBluescript phagemid containing the cloned cDNA and established the overexpression of a protein that hydrolysed Arg-Arg-beta-naphthylamide. The recombinant protein was purified and the amino acid sequence of the protein was confirmed. We presumed that the putative zinc-binding domain involved in catalysis was present in the recombinant enzyme. It was a novel zinc-binding motif in that one amino acid residue was inserted into the conserved HEXXH motif characteristic of the metalloproteinases. PMID:9425109

  17. A novel paired domain DNA recognition motif can mediate Pax2 repression of gene transcription.

    PubMed

    Håvik, B; Ragnhildstveit, E; Lorens, J B; Saelemyr, K; Fauske, O; Knudsen, L K; Fjose, A

    1999-12-20

    The paired domain (PD) is an evolutionarily conserved DNA-binding domain encoded by the Pax gene family of developmental regulators. The Pax proteins are transcription factors and are involved in a variety of processes such as brain development, patterning of the central nervous system (CNS), and B-cell development. In this report we demonstrate that the zebrafish Pax2 PD can interact with a novel type of DNA sequences in vitro, the triple-A motif, consisting of a heptameric nucleotide sequence G/CAAACA/TC with an invariant core of three adjacent adenosines. This recognition sequence was found to be conserved in known natural Pax5 repressor elements involved in controlling the expression of the p53 and J-chain genes. By identifying similar high affinity binding sites in potential target genes of the Pax2 protein, including the pax2 gene itself, we obtained further evidence that the triple-A sites are biologically significant. The putative natural target sites also provide a basis for defining an extended consensus recognition sequence. In addition, we observed in transformation assays a direct correlation between Pax2 repressor activity and the presence of triple-A sites. The results suggest that a transcriptional regulatory function of Pax proteins can be modulated by PD binding to different categories of target sequences. Copyright 1999 Academic Press.

  18. Proliferation of group II introns in the chloroplast genome of the green alga Oedocladium carolinianum (Chlorophyceae).

    PubMed

    Brouard, Jean-Simon; Turmel, Monique; Otis, Christian; Lemieux, Claude

    2016-01-01

    The chloroplast genome sustained extensive changes in architecture during the evolution of the Chlorophyceae, a morphologically and ecologically diverse class of green algae belonging to the Chlorophyta; however, the forces driving these changes are poorly understood. The five orders recognized in the Chlorophyceae form two major clades: the CS clade consisting of the Chlamydomonadales and Sphaeropleales, and the OCC clade consisting of the Oedogoniales, Chaetophorales, and Chaetopeltidales. In the OCC clade, considerable variations in chloroplast DNA (cpDNA) structure, size, gene order, and intron content have been observed. The large inverted repeat (IR), an ancestral feature characteristic of most green plants, is present in Oedogonium cardiacum (Oedogoniales) but is lacking in the examined members of the Chaetophorales and Chaetopeltidales. Remarkably, the Oedogonium 35.5-kb IR houses genes that were putatively acquired through horizontal DNA transfer. To better understand the dynamics of chloroplast genome evolution in the Oedogoniales, we analyzed the cpDNA of a second representative of this order, Oedocladium carolinianum . The Oedocladium cpDNA was sequenced and annotated. The evolutionary distances separating Oedocladium and Oedogonium cpDNAs and two other pairs of chlorophycean cpDNAs were estimated using a 61-gene data set. Phylogenetic analysis of an alignment of group IIA introns from members of the OCC clade was performed. Secondary structures and insertion sites of oedogonialean group IIA introns were analyzed. The 204,438-bp Oedocladium genome is 7.9 kb larger than the Oedogonium genome, but its repertoire of conserved genes is remarkably similar and gene order differs by only one reversal. Although the 23.7-kb IR is missing the putative foreign genes found in Oedogonium , it contains sequences coding for a putative phage or bacterial DNA primase and a hypothetical protein. Intergenic sequences are 1.5-fold longer and dispersed repeats are more abundant, but a smaller fraction of the Oedocladium genome is occupied by introns. Six additional group II introns are present, five of which lack ORFs and carry highly similar sequences to that of the ORF-less IIA intron shared with Oedogonium . Secondary structure analysis of the group IIA introns disclosed marked differences in the exon-binding sites; however, each intron showed perfect or nearly perfect base pairing interactions with its target site. Our results suggest that chloroplast genes rearrange more slowly in the Oedogoniales than in the Chaetophorales and raise questions as to what was the nature of the foreign coding sequences in the IR of the common ancestor of the Oedogoniales. They provide the first evidence for intragenomic proliferation of group IIA introns in the Viridiplantae, revealing that intron spread in the Oedocladium lineage likely occurred by retrohoming after sequence divergence of the exon-binding sites.

  19. Structural and Functional Analysis of DDX41: a bispecific immune receptor for DNA and cyclic dinucleotide

    PubMed Central

    Omura, Hiroki; Oikawa, Daisuke; Nakane, Takanori; Kato, Megumi; Ishii, Ryohei; Ishitani, Ryuichiro; Tokunaga, Fuminori; Nureki, Osamu

    2016-01-01

    In the innate immune system, pattern recognition receptors (PRRs) specifically recognize ligands derived from bacteria or viruses, to trigger the responsible downstream pathways. DEAD box protein 41 (DDX41) is an intracellular PRR that triggers the downstream pathway involving the adapter STING, the kinase TBK1, and the transcription factor IRF3, to activate the type I interferon response. DDX41 is unique in that it recognizes two different ligands; i.e., double-stranded DNA (dsDNA) and cyclic dinucleotides (CDN), via its DEAD domain. However, the structural basis for the ligand recognition by the DDX41 DEAD domain has remained elusive. Here, we report two crystal structures of the DDX41 DEAD domain in apo forms, at 1.5 and 2.2 Å resolutions. A comparison of the two crystal structures revealed the flexibility in the ATP binding site, suggesting its formation upon ATP binding. Structure-guided functional analyses in vitro and in vivo demonstrated the overlapped binding surface for dsDNA and CDN, which is distinct from the ATP-binding site. We propose that the structural rearrangement of the ATP binding site is crucial for the release of ADP, enabling the fast turnover of DDX41 for the dsDNA/CDN-induced STING activation pathway. PMID:27721487

  20. CDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  1. Reduced DNA repair in mouse satellite DNA after treatment with methylmethanesulfonate, and N-methyl-N-nitrosourea.

    PubMed Central

    Bodell, W J; Banerjee, M R

    1976-01-01

    We have measured DNA repair in mouse satellite and main band DNA as resolved by Ag+-Cs2SO4 centrifugation in response to treatment with the alkylating agents, methyl methanesulfonate, and N-methyl-N-nitrosourea. We find that there is a statistically significant lower incorporation of 3H-Tdr into the satellite DNA as compared to the main band at varying periods after treatment with the alkylating agents. This suggests a reduced repair activity in the satellite DNA. We have measured the extent of binding of 14C-methyl methanesulfonate to the satellite, and main band DNA, and no difference in binding was observed, indicating that the reduced repair activity of satellite DNA is not due to a difference in binding of alkylating agents. We believe that the reduced incorporation of 3H-Tdr into satellite DNA may be due to its location in the condensed chromatin fraction. PMID:184436

  2. Specificity determinants for the abscisic acid response element.

    PubMed

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  3. Two copies of mthmg1, encoding a novel mitochondrial HMG-like protein, delay accumulation of mitochondrial DNA deletions in Podospora anserina.

    PubMed

    Dequard-Chablat, Michelle; Allandt, Cynthia

    2002-08-01

    In the filamentous fungus Podospora anserina, two degenerative processes which result in growth arrest are associated with mitochondrial genome (mitochondrial DNA [mtDNA]) instability. Senescence is correlated with mtDNA rearrangements and amplification of specific regions (senDNAs). Premature death syndrome is characterized by the accumulation of specific mtDNA deletions. This accumulation is due to indirect effects of the AS1-4 mutation, which alters a cytosolic ribosomal protein gene. The mthmg1 gene has been identified as a double-copy suppressor of premature death. It greatly delays premature death and the accumulation of deletions when it is present in two copies in an ASI-4 context. The duplication of mthmg1 has no significant effect on the wild-type life span or on senDNA patterns. In anAS1+ context, deletion of the mthmg1 gene alters germination, growth, and fertility and reduces the life span. The deltamthmg1 senescent strains display a particular senDNA pattern. This deletion is lethal in an AS1-4 context. According to its physical properties (very basic protein with putative mitochondrial targeting sequence and HMG-type DNA-binding domains) and the cellular localization of an mtHMG1-green fluorescent protein fusion, mtHMG1 appears to be a mitochondrial protein possibly associated with mtDNA. It is noteworthy that it is the first example of a protein combining the two DNA-binding domains, AT-hook motif and HMG-1 boxes. It may be involved in the stability and/or transmission of the mitochondrial genome. To date, no structural homologues have been found in other organisms. However, mtHMG1 displays functional similarities with the Saccharomyces cerevisiae mitochondrial HMG-box protein Abf2.

  4. Distinct structural features of the peroxide response regulator from group A Streptococcus drive DNA binding.

    PubMed

    Lin, Chang Sheng-Huei; Chao, Shi-Yu; Hammel, Michal; Nix, Jay C; Tseng, Hsiao-Ling; Tsou, Chih-Cheng; Fei, Chun-Hsien; Chiou, Huo-Sheng; Jeng, U-Ser; Lin, Yee-Shin; Chuang, Woei-Jer; Wu, Jiunn-Jong; Wang, Shuying

    2014-01-01

    Group A streptococcus (GAS, Streptococcus pyogenes) is a strict human pathogen that causes severe, invasive diseases. GAS does not produce catalase, but has an ability to resist killing by reactive oxygen species (ROS) through novel mechanisms. The peroxide response regulator (PerR), a member of ferric uptake regulator (Fur) family, plays a key role for GAS to cope with oxidative stress by regulating the expression of multiple genes. Our previous studies have found that expression of an iron-binding protein, Dpr, is under the direct control of PerR. To elucidate the molecular interactions of PerR with its cognate promoter, we have carried out structural studies on PerR and PerR-DNA complex. By combining crystallography and small-angle X-ray scattering (SAXS), we confirmed that the determined PerR crystal structure reflects its conformation in solution. Through mutagenesis and biochemical analysis, we have identified DNA-binding residues suggesting that PerR binds to the dpr promoter at the per box through a winged-helix motif. Furthermore, we have performed SAXS analysis and resolved the molecular architecture of PerR-DNA complex, in which two 30 bp DNA fragments wrap around two PerR homodimers by interacting with the adjacent positively-charged winged-helix motifs. Overall, we provide structural insights into molecular recognition of DNA by PerR and define the hollow structural arrangement of PerR-30bpDNA complex, which displays a unique topology distinct from currently proposed DNA-binding models for Fur family regulators.

  5. Mechanism of the CO-sensing heme protein CooA: new insights from the truncated heme domain and UVRR spectroscopy

    PubMed Central

    Ibrahim, Mohammed; Kuchinskas, Michael; Youn, Hwan; Kerby, Robert L.; Roberts, Gary P.; Poulos, Thomas L.; Spiro, Thomas G.

    2007-01-01

    The bacterial CO-sensing heme protein CooA activates expression of genes whose products perform CO-metabolism by binding its target DNA in response to CO binding. The required conformational change has been proposed to result from CO-induced displacement of the heme and of the adjacent C-helix, which connects the sensory and DNA-binding domains. Support for this proposal comes from UV Resonance Raman (UVRR) spectroscopy, which reveals a more hydrophobic environment for the C-helix residue Trp110 when CO binds. In addition, we find a tyrosine UVRR response, which is attributable to weakening of a Tyr55-Glu83 H-bond that anchors the proximal side of the heme. Both Trp and Tyr responses are augmented in the heme domain when the DNA-binding domain has been removed, apparently reflecting loss of the inter-domain restraint. This augmentation is abolished by a Glu83Gln substitution, which weakens the anchoring H-bond. The CO recombination rate following photolysis of the CO adduct is similar for truncated and full-length protein, though truncation does increase the rate of CO association in the absence of photolysis; together these data indicate that truncation causes a faster dissociation of the endogenous Pro2 ligand. These findings are discussed in the light of structural evidence that the N-terminal tail, once released from the heme, selects the proper orientation of the DNA-binding domain, via docking interactions. PMID:17720248

  6. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  7. Transcript profiles of mitochondrial and cytoplasmic manganese superoxide dismutases in Exopalaemon carinicauda under ammonia stress

    NASA Astrophysics Data System (ADS)

    Ren, Hai; Li, Jian; Li, Jitao; Liu, Ping; Liang, Zhongxiu; Wu, Jianhua

    2015-05-01

    Superoxide dismutase (SOD) is one of the most important antioxidant defense enzymes, and is considered as the first line against oxidative stress. In this study, we cloned a mitochondrial manganese (Mn) SOD ( mMnSOD) cDNA from the ridgetail white prawn Exopalaemon carinicauda by using rapid amplification of cDNA ends (RACE) methods. The full-length cDNA for mMnSOD was 1 014-bp long, containing a 5'-untranslated region (UTR) of 37-bp, a 3'-UTR of 321-bp with a poly (A) tail, and included a 657-bp open reading frame encoding a protein of 218 amino acids with a 16-amino-acid signal peptide. The protein had a calculated molecular weight of 23.87 kDa and a theoretical isoelectric point of 6.75. The mMnSOD sequence included two putative N-glycosylation sites (NHT and NLS), the MnSOD signature sequence 180DVWEHAYY187, and four putative Mn binding sites (H48, H96, D180, and H184). Sequence comparison showed that the mMnSOD deduced amino acid sequence of E. carinicauda shared 97%, 95%, 89%, 84%, 82%, 72%, and 69% identity with that of Macrobrachium rosenbergii, Macrobrachium nipponense, Fenneropeneaus chinensis, Callinectes sapidus, Perisesarma bidens, Danio rerio, and Homo sapiens, resectively. Quantitative real-time RT-PCR analysis showed that mMnSOD transcripts were present in all E. carinicauda tissues examined, with the highest levels in the hepatopancreas. During an ammonia stress treatment, the transcript levels of mMnSOD and cMnSOD were up-regulated at 12 h in hemocytes and at 24 h in the hepatopancreas. As the duration of the ammonia stress treatment extended to 72 h, the transcript levels of mMnSOD and cMnSOD significantly decreased both in hemocytes and hepatopancreas. These findings indicate that the SOD system is induced to respond to acute ammonia stress, and may be involved in environmental stress responses in E. carinicauda.

  8. Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism

    PubMed Central

    Maguire, S. M.; Phelps, S. M.

    2017-01-01

    DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564

  9. Functional Analysis of the ComK Protein of Bacillus coagulans

    PubMed Central

    Kovács, Ákos T.; Eckhardt, Tom H.; van Kranenburg, Richard; Kuipers, Oscar P.

    2013-01-01

    The genes for DNA uptake and recombination in Bacilli are commonly regulated by the transcriptional factor ComK. We have identified a ComK homologue in Bacillus coagulans, an industrial relevant organism that is recalcitrant for transformation. Introduction of B. coagulans comK gene under its own promoter region into Bacillus subtilis comK strain results in low transcriptional induction of the late competence gene comGA, but lacking bistable expression. The promoter regions of B. coagulans comK and the comGA genes are recognized in B. subtilis and expression from these promoters is activated by B. subtilis ComK. Purified ComK protein of B. coagulans showed DNA-binding ability in gel retardation assays with B. subtilis- and B. coagulans-derived probes. These experiments suggest that the function of B. coagulans ComK is similar to that of ComK of B. subtilis. When its own comK is overexpressed in B. coagulans the comGA gene expression increases 40-fold, while the expression of another late competence gene, comC is not elevated and no reproducible DNA-uptake could be observed under these conditions. Our results demonstrate that B. coagulans ComK can recognize several B. subtilis comK-responsive elements, and vice versa, but indicate that the activation of the transcription of complete sets of genes coding for a putative DNA uptake apparatus in B. coagulans might differ from that of B. subtilis. PMID:23301076

  10. Identification of Novel Gene Targets and Putative Regulators of Arsenic-Associated DNA Methylation in Human Urothelial Cells and Bladder Cancer

    PubMed Central

    Rager, Julia E.; Miller, Sloane; Tulenko, Samantha E.; Smeester, Lisa; Ray, Paul D.; Yosim, Andrew; Currier, Jenna M.; Ishida, María C.; González-Horta, Maria del Carmen; Sánchez-Ramírez, Blanca; Ballinas-Casarrubias, Lourdes; Gutiérrez-Torres, Daniela S.; Drobná, Zuzana; Del Razo, Luz M.; García-Vargas, Gonzalo G.; Kim, William Y.; Zhou, Yi-Hui; Wright, Fred A.; Stýblo, Miroslav; Fry, Rebecca C.

    2016-01-01

    There is strong epidemiologic evidence linking chronic exposure to inorganic arsenic (iAs) to a myriad of adverse health effects, including cancer of the bladder. The present study set out to identify DNA methylation patterns associated with iAs and its metabolites in exfoliated urothelial cells (EUCs) that originate primarily from the urinary bladder, one of the targets of arsenic (As)-induced carcinogenesis. Genome-wide, gene-specific promoter DNA methylation levels were assessed in EUCs from 46 residents of Chihuahua, Mexico, and the relationship was examined between promoter methylation profiles and the intracellular concentrations of total As (tAs) and As species. A set of 49 differentially methylated genes was identified with increased promoter methylation associated with EUC tAs, iAs, and/or monomethylated As (MMAs) enriched for their roles in metabolic disease and cancer. Notably, no genes had differential methylation associated with EUC dimethylated As (DMAs), suggesting that DMAs may influence DNA methylation-mediated urothelial cell responses to a lesser extent than iAs or MMAs. Further analysis showed that 22 of the 49 As-associated genes (45%) are also differentially methylated in bladder cancer tissue identified using The Cancer Genome Atlas repository. Both the As- and cancer-associated genes are enriched for the binding sites of common transcription factors known to play roles in carcinogenesis, demonstrating a novel potential mechanistic link between iAs exposure and bladder cancer. PMID:26039340

  11. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  12. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

    PubMed

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-05-11

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

  13. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma

    PubMed Central

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-01-01

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mϕ) direct trauma-induced inflammation, and Mϕ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mϕ and the subsequent regulation of Mϕ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)–TLR4–MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mϕ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mϕ. However, autophagy activation also suppressed Mϕ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mϕ homeostasis in response to trauma. PMID:28492546

  14. Identification, characterization and leucocyte expression of Siglec-10, a novel human sialic acid-binding receptor.

    PubMed Central

    Munday, J; Kerr, S; Ni, J; Cornish, A L; Zhang, J Q; Nicoll, G; Floyd, H; Mattei, M G; Moore, P; Liu, D; Crocker, P R

    2001-01-01

    Here we characterize Siglec-10 as a new member of the Siglec family of sialic acid-binding Ig-like lectins. A full-length cDNA was isolated from a human spleen library and the corresponding gene identified. Siglec-10 is predicted to contain five extracellular Ig-like domains and a cytoplasmic tail containing three putative tyrosine-based signalling motifs. Siglec-10 exhibited a high degree of sequence similarity to CD33-related Siglecs and mapped to the same region, on chromosome 19q13.3. The expressed protein was able to mediate sialic acid-dependent binding to human erythrocytes and soluble sialoglycoconjugates. Using specific antibodies, Siglec-10 was detected on subsets of human leucocytes including eosinophils, monocytes and a minor population of natural killer-like cells. The molecular properties and expression pattern suggest that Siglec-10 may function as an inhibitory receptor within the innate immune system. PMID:11284738

  15. The amplification effect of functionalized gold nanoparticles on the binding of anticancer drug dacarbazine to DNA and DNA bases

    NASA Astrophysics Data System (ADS)

    Shen, Qin; Wang, Xuemei; Fu, Degang

    2008-11-01

    The promising application of functionalized gold nanoparticles to amplify the performance of biosensors and relevant biomolecular recognition processes has been explored in this paper. Our observations illustrate the apparent enhancement effect of the gold nanoparticles on the electrochemical response of the anticancer drug dacarbazine (DTIC) binding to DNA and DNA bases, indicating that these functionalized gold nanoparticles could readily facilitate the specific interactions between DTIC and DNA/DNA bases. This raises the potential valuable applications of these biocompatible nanoparticles in the promising biosensors and biomedical engineering.

  16. Solution structure of the DNA-binding domain of RPA from Saccharomyces cerevisiae and its interaction with single-stranded DNA and SV40 T antigen

    PubMed Central

    Park, Chin-Ju; Lee, Joon-Hwa; Choi, Byong-Seok

    2005-01-01

    Replication protein A (RPA) is a three-subunit complex with multiple roles in DNA metabolism. DNA-binding domain A in the large subunit of human RPA (hRPA70A) binds to single-stranded DNA (ssDNA) and is responsible for the species-specific RPA–T antigen (T-ag) interaction required for Simian virus 40 replication. Although Saccharomyces cerevisiae RPA70A (scRPA70A) shares high sequence homology with hRPA70A, the two are not functionally equivalent. To elucidate the similarities and differences between these two homologous proteins, we determined the solution structure of scRPA70A, which closely resembled the structure of hRPA70A. The structure of ssDNA-bound scRPA70A, as simulated by residual dipolar coupling-based homology modeling, suggested that the positioning of the ssDNA is the same for scRPA70A and hRPA70A, although the conformational changes that occur in the two proteins upon ssDNA binding are not identical. NMR titrations of hRPA70A with T-ag showed that the T-ag binding surface is separate from the ssDNA-binding region and is more neutral than the corresponding part of scRPA70A. These differences might account for the species-specific nature of the hRPA70A–T-ag interaction. Our results provide insight into how these two homologous RPA proteins can exhibit functional differences, but still both retain their ability to bind ssDNA. PMID:16043636

  17. Proteomic characterization of the acid tolerance response in Lactobacillus delbrueckii subsp. bulgaricus CAUH1 and functional identification of a novel acid stress-related transcriptional regulator Ldb0677.

    PubMed

    Zhai, Zhengyuan; Douillard, François P; An, Haoran; Wang, Guohong; Guo, Xinghua; Luo, Yunbo; Hao, Yanling

    2014-06-01

    To overcome the deleterious effects of acid stress, Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) elicits an adaptive response to acid stress. In this study, proteomics approach complemented by transcriptional analysis revealed some cellular changes in L. bulgaricus CAUH1 during acid adaptation. We observed an increase of glycolysis-associated proteins, promoting an optimal utilization of carbohydrates. Also, rerouting of the pyruvate metabolism to fatty acid biosynthesis was observed, indicating a possible modification of the cell membrane rigidity and impermeability. In addition, expression of ribosomal protein S1 (RpsA) was repressed; however, the expression of EF-Tu, EF-G and TypA was up-regulated at both protein and transcript levels. This suggests a reduction of protein synthesis in response to acid stress along with possible enhancement of the translational accuracy and protein folding. It is noteworthy that the putative transcriptional regulator Ldb0677 was 1.84-fold up-regulated. Heterologous expression of Ldb0677 was shown to significantly enhance acid resistance in host strain Lactococcus lactis. To clarify its role in transcriptional regulation network, the DNA-binding specificity of Ldb0677 was determined using bacterial one-hybrid and electrophoretic mobility shift assay. The identification of a binding motif (SSTAGACR) present in the promoter regions of 22 genes indicates that it might function as a major regulator in acid stress response in L. bulgaricus. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  18. Solution structure of CEH-37 homeodomain of the nematode Caenorhabditis elegans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moon, Sunjin; Lee, Yong Woo; Kim, Woo Taek

    Highlights: •We have determined solution structures of CEH-37 homedomain. •CEH-37 HD has a compact α-helical structure with HTH DNA binding motif. •Solution structure of CEH-37 HD shares its molecular topology with that of the homeodomain proteins. •Residues in the N-terminal region and HTH motif are important in binding to Caenorhabditis elegans telomeric DNA. •CEH-37 could play an important role in telomere function via DNA binding. -- Abstract: The nematode Caenorhabditis elegans protein CEH-37 belongs to the paired OTD/OTX family of homeobox-containing homeodomain proteins. CEH-37 shares sequence similarity with homeodomain proteins, although it specifically binds to double-stranded C. elegans telomeric DNA,more » which is unusual to homeodomain proteins. Here, we report the solution structure of CEH-37 homeodomain and molecular interaction with double-stranded C. elegans telomeric DNA using nuclear magnetic resonance (NMR) spectroscopy. NMR structure shows that CEH-37 homeodomain is composed of a flexible N-terminal region and three α-helices with a helix-turn-helix (HTH) DNA binding motif. Data from size-exclusion chromatography and fluorescence spectroscopy reveal that CEH-37 homeodomain interacts strongly with double-stranded C. elegans telomeric DNA. NMR titration experiments identified residues responsible for specific binding to nematode double-stranded telomeric DNA. These results suggest that C. elegans homeodomain protein, CEH-37 could play an important role in telomere function via DNA binding.« less

  19. Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

    PubMed Central

    Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.

    2012-01-01

    The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

  20. SNF1-related protein kinases 2 are negatively regulated by a plant-specific calcium sensor.

    PubMed

    Bucholc, Maria; Ciesielski, Arkadiusz; Goch, Grażyna; Anielska-Mazur, Anna; Kulik, Anna; Krzywińska, Ewa; Dobrowolska, Grażyna

    2011-02-04

    SNF1-related protein kinases 2 (SnRK2s) are plant-specific enzymes involved in environmental stress signaling and abscisic acid-regulated plant development. Here, we report that SnRK2s interact with and are regulated by a plant-specific calcium-binding protein. We screened a Nicotiana plumbaginifolia Matchmaker cDNA library for proteins interacting with Nicotiana tabacum osmotic stress-activated protein kinase (NtOSAK), a member of the SnRK2 family. A putative EF-hand calcium-binding protein was identified as a molecular partner of NtOSAK. To determine whether the identified protein interacts only with NtOSAK or with other SnRK2s as well, we studied the interaction of an Arabidopsis thaliana orthologue of the calcium-binding protein with selected Arabidopsis SnRK2s using a two-hybrid system. All kinases studied interacted with the protein. The interactions were confirmed by bimolecular fluorescence complementation assay, indicating that the binding occurs in planta, exclusively in the cytoplasm. Calcium binding properties of the protein were analyzed by fluorescence spectroscopy using Tb(3+) as a spectroscopic probe. The calcium binding constant, determined by the protein fluorescence titration, was 2.5 ± 0.9 × 10(5) M(-1). The CD spectrum indicated that the secondary structure of the protein changes significantly in the presence of calcium, suggesting its possible function as a calcium sensor in plant cells. In vitro studies revealed that the activity of SnRK2 kinases analyzed is inhibited in a calcium-dependent manner by the identified calcium sensor, which we named SCS (SnRK2-interacting calcium sensor). Our results suggest that SCS is involved in response to abscisic acid during seed germination most probably by negative regulation of SnRK2s activity.

  1. The Saccharomyces cerevisiae Mlh1-Mlh3 Heterodimer Is an Endonuclease That Preferentially Binds to Holliday Junctions*

    PubMed Central

    Ranjha, Lepakshi; Anand, Roopesh; Cejka, Petr

    2014-01-01

    MutLγ, a heterodimer of the MutL homologues Mlh1 and Mlh3, plays a critical role during meiotic homologous recombination. The meiotic function of Mlh3 is fully dependent on the integrity of a putative nuclease motif DQHAX2EX4E, inferring that the anticipated nuclease activity of Mlh1-Mlh3 is involved in the processing of joint molecules to generate crossover recombination products. Although a vast body of genetic and cell biological data regarding Mlh1-Mlh3 is available, mechanistic insights into its function have been lacking due to the unavailability of the recombinant protein complex. Here we expressed the yeast Mlh1-Mlh3 heterodimer and purified it into near homogeneity. We show that recombinant MutLγ is a nuclease that nicks double-stranded DNA. We demonstrate that MutLγ binds DNA with a high affinity and shows a marked preference for Holliday junctions. We also expressed the human MLH1-MLH3 complex and show that preferential binding to Holliday junctions is a conserved capacity of eukaryotic MutLγ complexes. Specific DNA recognition has never been observed with any other eukaryotic MutL homologue. MutLγ thus represents a new paradigm for the function of the eukaryotic MutL protein family. We provide insights into the mode of Holliday junction recognition and show that Mlh1-Mlh3 prefers to bind the open unstacked Holliday junction form. This further supports the model where MutLγ is part of a complex acting on joint molecules to generate crossovers in meiosis. PMID:24443562

  2. The Saccharomyces cerevisiae Mlh1-Mlh3 heterodimer is an endonuclease that preferentially binds to Holliday junctions.

    PubMed

    Ranjha, Lepakshi; Anand, Roopesh; Cejka, Petr

    2014-02-28

    MutLγ, a heterodimer of the MutL homologues Mlh1 and Mlh3, plays a critical role during meiotic homologous recombination. The meiotic function of Mlh3 is fully dependent on the integrity of a putative nuclease motif DQHAX2EX4E, inferring that the anticipated nuclease activity of Mlh1-Mlh3 is involved in the processing of joint molecules to generate crossover recombination products. Although a vast body of genetic and cell biological data regarding Mlh1-Mlh3 is available, mechanistic insights into its function have been lacking due to the unavailability of the recombinant protein complex. Here we expressed the yeast Mlh1-Mlh3 heterodimer and purified it into near homogeneity. We show that recombinant MutLγ is a nuclease that nicks double-stranded DNA. We demonstrate that MutLγ binds DNA with a high affinity and shows a marked preference for Holliday junctions. We also expressed the human MLH1-MLH3 complex and show that preferential binding to Holliday junctions is a conserved capacity of eukaryotic MutLγ complexes. Specific DNA recognition has never been observed with any other eukaryotic MutL homologue. MutLγ thus represents a new paradigm for the function of the eukaryotic MutL protein family. We provide insights into the mode of Holliday junction recognition and show that Mlh1-Mlh3 prefers to bind the open unstacked Holliday junction form. This further supports the model where MutLγ is part of a complex acting on joint molecules to generate crossovers in meiosis.

  3. Surface reengineering of RPA70N enables cocrystallization with an inhibitor of the replication protein A interaction motif of ATR interacting protein.

    PubMed

    Feldkamp, Michael D; Frank, Andreas O; Kennedy, J Phillip; Patrone, James D; Vangamudi, Bhavatarini; Waterson, Alex G; Fesik, Stephen W; Chazin, Walter J

    2013-09-17

    Replication protein A (RPA) is the primary single-stranded DNA (ssDNA) binding protein in eukaryotes. The N-terminal domain of the RPA70 subunit (RPA70N) interacts via a basic cleft with a wide range of DNA processing proteins, including several that regulate DNA damage response and repair. Small molecule inhibitors that disrupt these protein-protein interactions are therefore of interest as chemical probes of these critical DNA processing pathways and as inhibitors to counter the upregulation of DNA damage response and repair associated with treatment of cancer patients with radiation or DNA-damaging agents. Determination of three-dimensional structures of protein-ligand complexes is an important step for elaboration of small molecule inhibitors. However, although crystal structures of free RPA70N and an RPA70N-peptide fusion construct have been reported, RPA70N-inhibitor complexes have been recalcitrant to crystallization. Analysis of the P61 lattice of RPA70N crystals led us to hypothesize that the ligand-binding surface was occluded. Surface reengineering to alter key crystal lattice contacts led to the design of RPA70N E7R, E100R, and E7R/E100R mutants. These mutants crystallized in a P212121 lattice that clearly had significant solvent channels open to the critical basic cleft. Analysis of X-ray crystal structures, target peptide binding affinities, and (15)N-(1)H heteronuclear single-quantum coherence nuclear magnetic resonance spectra showed that the mutations do not result in perturbations of the RPA70N ligand-binding surface. The success of the design was demonstrated by determining the structure of RPA70N E7R soaked with a ligand discovered in a previously reported molecular fragment screen. A fluorescence anisotropy competition binding assay revealed this compound can inhibit the interaction of RPA70N with the peptide binding motif from the DNA damage response protein ATRIP. The implications of the results are discussed in the context of ongoing efforts to design RPA70N inhibitors.

  4. The presence of an insulin-like androgenic gland factor (IAG) and insulin-like peptide binding protein (ILPBP) in the ovary of the blue crab, Callinectes sapidus and their roles in ovarian development.

    PubMed

    Huang, Xiaoshuai; Ye, Haihui; Chung, J Sook

    2017-08-01

    Insulin-like androgenic gland factor (IAG) that is produced by the male androgenic gland (AG), plays a role in sexual differentiation and maintenance of male secondary sex characteristics in decapod crustaceans. With an earlier finding of IAG expression in a female Callinectes sapidus ovary, we aimed to examine a putative role of IAG during the ovarian development of this species. To this end, the full-length cDNA sequence of the ovarian CasIAG (termed CasIAG-ova) has been isolated. The predicted mature peptide sequence of CasIAG-ova is identical to that of the IAG from the AG, except in their signal peptide regions. The CasIAG-ova contains an alternative initiation codon (UUG) as the start codon, which suggests that the translational regulation of CasIAG-ova may differ from that of the IAG from AG. To define the function of CasIAG-ova, the expressions of CasIAG-ova as well as its putative binding protein, insulin-like peptide binding protein (ILPBP), are measured in the ovaries at various developmental stages obtained from different seasons. Season affects both CasIAG and ILPBP expression in the ovary. Overall, summer females at earlier ovarian stages contain high levels of CasIAG and ILPBP than spring or fall females. These findings indicate that CasIAG-ova and CasILPBP may be involved in the ovarian development. When comparing the levels of CasIAG and CasILPBP in the ovary, the latter are much higher (∼10-10000 fold) than the former. Expression patterns of CasILPBP differ from those of CasIAG-ova during ovarian development and by season, suggesting that ILPBP may have an additional role in ovarian development rather than a function of a putative binding protein of IAG. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Massive Gene Transfer and Extensive RNA Editing of a Symbiotic Dinoflagellate Plastid Genome

    PubMed Central

    Mungpakdee, Sutada; Shinzato, Chuya; Takeuchi, Takeshi; Kawashima, Takeshi; Koyanagi, Ryo; Hisata, Kanako; Tanaka, Makiko; Goto, Hiroki; Fujie, Manabu; Lin, Senjie; Satoh, Nori; Shoguchi, Eiichi

    2014-01-01

    Genome sequencing of Symbiodinium minutum revealed that 95 of 109 plastid-associated genes have been transferred to the nuclear genome and subsequently expanded by gene duplication. Only 14 genes remain in plastids and occur as DNA minicircles. Each minicircle (1.8–3.3 kb) contains one gene and a conserved noncoding region containing putative promoters and RNA-binding sites. Nine types of RNA editing, including a novel G/U type, were discovered in minicircle transcripts but not in genes transferred to the nucleus. In contrast to DNA editing sites in dinoflagellate mitochondria, which tend to be highly conserved across all taxa, editing sites employed in DNA minicircles are highly variable from species to species. Editing is crucial for core photosystem protein function. It restores evolutionarily conserved amino acids and increases peptidyl hydropathy. It also increases protein plasticity necessary to initiate photosystem complex assembly. PMID:24881086

  6. Aptamer-Binding Directed DNA Origami Pattern for Logic Gates.

    PubMed

    Yang, Jing; Jiang, Shuoxing; Liu, Xiangrong; Pan, Linqiang; Zhang, Cheng

    2016-12-14

    In this study, an aptamer-substrate strategy is introduced to control programmable DNA origami pattern. Combined with DNA aptamer-substrate binding and DNAzyme-cutting, small DNA tiles were specifically controlled to fill into the predesigned DNA origami frame. Here, a set of DNA logic gates (OR, YES, and AND) are performed in response to the stimuli of adenosine triphosphate (ATP) and cocaine. The experimental results are confirmed by AFM imaging and time-dependent fluorescence changes, demonstrating that the geometric patterns are regulated in a controllable and programmable manner. Our approach provides a new platform for engineering programmable origami nanopatterns and constructing complex DNA nanodevices.

  7. Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

    PubMed

    Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

    2005-06-03

    We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

  8. High-Mobility Group Chromatin Proteins 1 and 2 Functionally Interact with Steroid Hormone Receptors To Enhance Their DNA Binding In Vitro and Transcriptional Activity in Mammalian Cells

    PubMed Central

    Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.

    1998-01-01

    We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors. PMID:9671457

  9. Specialized nucleoprotein structures at the origin of replication of bacteriophage lambda: localized unwinding of duplex DNA by a six-protein reaction.

    PubMed Central

    Dodson, M; Echols, H; Wickner, S; Alfano, C; Mensa-Wilmot, K; Gomes, B; LeBowitz, J; Roberts, J D; McMacken, R

    1986-01-01

    The O protein of bacteriophage lambda localizes the initiation of DNA replication to a unique site on the lambda genome, ori lambda. By means of electron microscopy, we infer that the binding of O to ori lambda initiates a series of protein addition and transfer reactions that culminate in localized unwinding of the origin DNA, generating a prepriming structure for the initiation of DNA replication. We can define three stages of this prepriming reaction, the first two of which we have characterized previously. First, dimeric O protein binds to multiple DNA binding sites and self-associates to form a nucleoprotein structure, the O-some. Second, lambda P and host DnaB proteins interact with the O-some to generate a larger complex that includes additional DNA from an A + T-rich region adjacent to the O binding sites. Third, the addition of the DnaJ, DnaK, and Ssb proteins and ATP results in an origin-specific unwinding reaction, probably catalyzed by the helicase activity of DnaB. The unwinding reaction is unidirectional, proceeding "rightward" from the origin. The minimal DNA sequence competent for unwinding consists of two O binding sites and the adjacent A + T-rich region to the right of the binding sites. We conclude that the lambda O protein localizes and initiates a six-protein sequential reaction responsible for but preceding the precise initiation of DNA replication. Specialized nucleoprotein structures similar to the O-some may be a general feature of DNA transactions requiring extraordinary precision in localization and control. Images PMID:3020552

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herrou, Julien; Willett, Jonathan W.; Czyż, Daniel M.

    ABSTRACT Brucella abortusσ E1is an EcfG family sigma factor that regulates the transcription of dozens of genes in response to diverse stress conditions and is required for maintenance of chronic infection in a mouse model. A putative ATP-binding cassette transporter operon,bab1_0223-bab1_0226, is among the most highly activated gene sets in the σ E1regulon. The proteins encoded by the operon resemble quaternary ammonium-compatible solute importers but are most similar in sequence to the broadly conserved YehZYXW system, which remains largely uncharacterized. Transcription ofyehZYXWis activated by the general stress sigma factor σ SinEnterobacteriaceae, which suggests a functional role for this transport systemmore » in bacterial stress response across the classesAlphaproteobacteriaandGammaproteobacteria. We present evidence thatB. abortusYehZYXW does not function as an importer of known compatible solutes under physiological conditions and does not contribute to the virulence defect of a σ E1-null strain. The solein vitrophenotype associated with genetic disruption of this putative transport system is reduced growth in the presence of high Li +ion concentrations. A crystal structure ofB. abortusYehZ revealed a class II periplasmic binding protein fold with significant structural homology toArchaeoglobus fulgidusProX, which binds glycine betaine. However, the structure of the YehZ ligand-binding pocket is incompatible with high-affinity binding to glycine betaine. This is consistent with weak measured binding of YehZ to glycine betaine and related compatible solutes. We conclude that YehZYXW is a conserved, stress-regulated transport system that is phylogenetically and functionally distinct from quaternary ammonium-compatible solute importers. IMPORTANCEBrucella abortusσ E1regulates transcription in response to stressors encountered in its mammalian host and is necessary for maintenance of chronic infection in a mouse model. The functions of the majority of genes regulated by σ E1remain undefined. We present a functional/structural analysis of a conserved putative membrane transport system (YehZYXW) whose expression is strongly activated by σ E1. Though annotated as a quaternary ammonium osmolyte uptake system, experimental physiological studies and measured ligand-binding properties of the periplasmic binding protein (PBP), YehZ, are inconsistent with this function. A crystal structure ofB. abortusYehZ provides molecular insight into differences between bona fide quaternary ammonium osmolyte importers and YehZ-related proteins, which form a distinct phylogenetic and functional group of PBPs.« less

  11. Genome-wide DNA methylation reprogramming in response to inorganic arsenic links inhibition of CTCF binding, DNMT expression and cellular transformation

    NASA Astrophysics Data System (ADS)

    Rea, Matthew; Eckstein, Meredith; Eleazer, Rebekah; Smith, Caroline; Fondufe-Mittendorf, Yvonne N.

    2017-02-01

    Chronic low dose inorganic arsenic (iAs) exposure leads to changes in gene expression and epithelial-to-mesenchymal transformation. During this transformation, cells adopt a fibroblast-like phenotype accompanied by profound gene expression changes. While many mechanisms have been implicated in this transformation, studies that focus on the role of epigenetic alterations in this process are just emerging. DNA methylation controls gene expression in physiologic and pathologic states. Several studies show alterations in DNA methylation patterns in iAs-mediated pathogenesis, but these studies focused on single genes. We present a comprehensive genome-wide DNA methylation analysis using methyl-sequencing to measure changes between normal and iAs-transformed cells. Additionally, these differential methylation changes correlated positively with changes in gene expression and alternative splicing. Interestingly, most of these differentially methylated genes function in cell adhesion and communication pathways. To gain insight into how genomic DNA methylation patterns are regulated during iAs-mediated carcinogenesis, we show that iAs probably targets CTCF binding at the promoter of DNA methyltransferases, regulating their expression. These findings reveal how CTCF binding regulates DNA methyltransferase to reprogram the methylome in response to an environmental toxin.

  12. Genome-wide DNA methylation reprogramming in response to inorganic arsenic links inhibition of CTCF binding, DNMT expression and cellular transformation

    PubMed Central

    Rea, Matthew; Eckstein, Meredith; Eleazer, Rebekah; Smith, Caroline; Fondufe-Mittendorf , Yvonne N.

    2017-01-01

    Chronic low dose inorganic arsenic (iAs) exposure leads to changes in gene expression and epithelial-to-mesenchymal transformation. During this transformation, cells adopt a fibroblast-like phenotype accompanied by profound gene expression changes. While many mechanisms have been implicated in this transformation, studies that focus on the role of epigenetic alterations in this process are just emerging. DNA methylation controls gene expression in physiologic and pathologic states. Several studies show alterations in DNA methylation patterns in iAs-mediated pathogenesis, but these studies focused on single genes. We present a comprehensive genome-wide DNA methylation analysis using methyl-sequencing to measure changes between normal and iAs-transformed cells. Additionally, these differential methylation changes correlated positively with changes in gene expression and alternative splicing. Interestingly, most of these differentially methylated genes function in cell adhesion and communication pathways. To gain insight into how genomic DNA methylation patterns are regulated during iAs-mediated carcinogenesis, we show that iAs probably targets CTCF binding at the promoter of DNA methyltransferases, regulating their expression. These findings reveal how CTCF binding regulates DNA methyltransferase to reprogram the methylome in response to an environmental toxin. PMID:28150704

  13. Identification of putative TAL effector targets of the citrus canker pathogens shows functional convergence underlying disease development and defense response

    PubMed Central

    2014-01-01

    Background Transcriptional activator-like (TAL) effectors, formerly known as the AvrBs3/PthA protein family, are DNA-binding effectors broadly found in Xanthomonas spp. that transactivate host genes upon injection via the bacterial type three-secretion system. Biologically relevant targets of TAL effectors, i.e. host genes whose induction is vital to establish a compatible interaction, have been reported for xanthomonads that colonize rice and pepper; however, citrus genes modulated by the TAL effectors PthA“s” and PthC“s” of the citrus canker bacteria Xanthomonas citri (Xc) and Xanthomonas aurantifolii pathotype C (XaC), respectively, are poorly characterized. Of particular interest, XaC causes canker disease in its host lemon (Citrus aurantifolia), but triggers a defense response in sweet orange. Results Based on, 1) the TAL effector-DNA binding code, 2) gene expression data of Xc and XaC-infiltrated sweet orange leaves, and 3) citrus hypocotyls transformed with PthA2, PthA4 or PthC1, we have identified a collection of Citrus sinensis genes potentially targeted by Xc and XaC TAL effectors. Our results suggest that similar with other strains of Xanthomonas TAL effectors, PthA2 and PthA4, and PthC1 to some extent, functionally converge. In particular, towards induction of genes involved in the auxin and gibberellin synthesis and response, cell division, and defense response. We also present evidence indicating that the TAL effectors act as transcriptional repressors and that the best scoring predicted DNA targets of PthA“s” and PthC“s” in citrus promoters predominantly overlap with or localize near to TATA boxes of core promoters, supporting the idea that TAL effectors interact with the host basal transcriptional machinery to recruit the RNA pol II and start transcription. Conclusions The identification of PthA“s” and PthC“s” targets, such as the LOB (LATERAL ORGAN BOUNDARY) and CCNBS genes that we report here, is key for the understanding of the canker symptoms development during host susceptibility, or the defenses of sweet orange against the canker bacteria. We have narrowed down candidate targets to a few, which pointed out the host metabolic pathways explored by the pathogens. PMID:24564253

  14. Identification of putative TAL effector targets of the citrus canker pathogens shows functional convergence underlying disease development and defense response.

    PubMed

    Pereira, Andre L A; Carazzolle, Marcelo F; Abe, Valeria Y; de Oliveira, Maria L P; Domingues, Mariane N; Silva, Jaqueline C; Cernadas, Raul A; Benedetti, Celso E

    2014-02-25

    Transcriptional activator-like (TAL) effectors, formerly known as the AvrBs3/PthA protein family, are DNA-binding effectors broadly found in Xanthomonas spp. that transactivate host genes upon injection via the bacterial type three-secretion system. Biologically relevant targets of TAL effectors, i.e. host genes whose induction is vital to establish a compatible interaction, have been reported for xanthomonads that colonize rice and pepper; however, citrus genes modulated by the TAL effectors PthA"s" and PthC"s" of the citrus canker bacteria Xanthomonas citri (Xc) and Xanthomonas aurantifolii pathotype C (XaC), respectively, are poorly characterized. Of particular interest, XaC causes canker disease in its host lemon (Citrus aurantifolia), but triggers a defense response in sweet orange. Based on, 1) the TAL effector-DNA binding code, 2) gene expression data of Xc and XaC-infiltrated sweet orange leaves, and 3) citrus hypocotyls transformed with PthA2, PthA4 or PthC1, we have identified a collection of Citrus sinensis genes potentially targeted by Xc and XaC TAL effectors. Our results suggest that similar with other strains of Xanthomonas TAL effectors, PthA2 and PthA4, and PthC1 to some extent, functionally converge. In particular, towards induction of genes involved in the auxin and gibberellin synthesis and response, cell division, and defense response. We also present evidence indicating that the TAL effectors act as transcriptional repressors and that the best scoring predicted DNA targets of PthA"s" and PthC"s" in citrus promoters predominantly overlap with or localize near to TATA boxes of core promoters, supporting the idea that TAL effectors interact with the host basal transcriptional machinery to recruit the RNA pol II and start transcription. The identification of PthA"s" and PthC"s" targets, such as the LOB (lateral organ boundary) and CCNBS genes that we report here, is key for the understanding of the canker symptoms development during host susceptibility, or the defenses of sweet orange against the canker bacteria. We have narrowed down candidate targets to a few, which pointed out the host metabolic pathways explored by the pathogens.

  15. Genomic organization of the Neurospora crassa gsn gene: possible involvement of the STRE and HSE elements in the modulation of transcription during heat shock.

    PubMed

    Freitas, F Zanolli; Bertolini, M C

    2004-12-01

    Glycogen synthase, an enzyme involved in glycogen biosynthesis, is regulated by phosphorylation and by the allosteric ligand glucose-6-phosphate (G6P). In addition, enzyme levels can be regulated by changes in gene expression. We recently cloned a cDNA for glycogen synthase ( gsn) from Neurospora crassa, and showed that gsn transcription decreased when cells were exposed to heat shock (shifted from 30 degrees C to 45 degrees C). In order to understand the mechanisms that control gsn expression, we isolated the gene, including its 5' and 3' flanking regions, from the genome of N. crassa. An ORF of approximately 2.4 kb was identified, which is interrupted by four small introns (II-V). Intron I (482 bp) is located in the 5'UTR region. Three putative Transcription Initiation Sites (TISs) were mapped, one of which lies downstream of a canonical TATA-box sequence (5'-TGTATAAA-3'). Analysis of the 5'-flanking region revealed the presence of putative transcription factor-binding sites, including Heat Shock Elements (HSEs) and STress Responsive Elements (STREs). The possible involvement of these motifs in the negative regulation of gsn transcription was investigated using Electrophoretic Mobility Shift Assays (EMSA) with nuclear extracts of N. crassa mycelium obtained before and after heat shock, and DNA fragments encompassing HSE and STRE elements from the 5'-flanking region. While elements within the promoter region are involved in transcription under heat shock, elements in the 5'UTR intron may participate in transcription during vegetative growth. The results thus suggest that N. crassa possesses trans -acting elements that interact with the 5'-flanking region to regulate gsn transcription during heat shock and vegetative growth.

  16. Cytosolic sensing of immuno-stimulatory DNA, the enemy within.

    PubMed

    Dhanwani, Rekha; Takahashi, Mariko; Sharma, Sonia

    2018-02-01

    In the cytoplasm, DNA is sensed as a universal danger signal by the innate immune system. Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor/enzyme that catalyzes formation of 2'-5'-cGAMP, an atypical cyclic di-nucleotide second messenger that binds and activates the Stimulator of Interferon Genes (STING), resulting in recruitment of Tank Binding Kinase 1 (TBK1), activation of the transcription factor Interferon Regulatory Factor 3 (IRF3), and trans-activation of innate immune response genes, including type I Interferon cytokines (IFN-I). Activation of the pro-inflammatory cGAS-STING-IRF3 response is triggered by direct recognition of the DNA genomes of bacteria and viruses, but also during RNA virus infection, neoplastic transformation, tumor immunotherapy and systemic auto-inflammatory diseases. In these circumstances, the source of immuno-stimulatory DNA has often represented a fundamental yet poorly understood aspect of the response. This review focuses on recent findings related to cGAS activation by an array of self-derived DNA substrates, including endogenous retroviral elements, mitochondrial DNA (mtDNA) and micronuclei generated as a result of genotoxic stress and DNA damage. These findings emphasize the role of the cGAS axis as a cell-intrinsic innate immune response to a wide variety of genomic insults. Copyright © 2017. Published by Elsevier Ltd.

  17. The DNA-recognition mode shared by archaeal feast/famine-regulatory proteins revealed by the DNA-binding specificities of TvFL3, FL10, FL11 and Ss-LrpB

    PubMed Central

    Yokoyama, Katsushi; Nogami, Hideki; Kabasawa, Mamiko; Ebihara, Sonomi; Shimowasa, Ai; Hashimoto, Keiko; Kawashima, Tsuyoshi; Ishijima, Sanae A.; Suzuki, Masashi

    2009-01-01

    The DNA-binding mode of archaeal feast/famine-regulatory proteins (FFRPs), i.e. paralogs of the Esherichia coli leucine-responsive regulatory protein (Lrp), was studied. Using the method of systematic evolution of ligands by exponential enrichment (SELEX), optimal DNA duplexes for interacting with TvFL3, FL10, FL11 and Ss-LrpB were identified as TACGA[AAT/ATT]TCGTA, GTTCGA[AAT/ATT]TCGAAC, CCGAAA[AAT/ATT]TTTCGG and TTGCAA[AAT/ATT]TTGCAA, respectively, all fitting into the form abcdeWWWedcba. Here W is A or T, and e.g. a and a are bases complementary to each other. Apparent equilibrium binding constants of the FFRPs and various DNA duplexes were determined, thereby confirming the DNA-binding specificities of the FFRPs. It is likely that these FFRPs recognize DNA in essentially the same way, since their DNA-binding specificities were all explained by the same pattern of relationship between amino-acid positions and base positions to form chemical interactions. As predicted from this relationship, when Gly36 of TvFL3 was replaced by Thr, the b base in the optimal DNA duplex changed from A to T, and, when Thr36 of FL10 was replaced by Ser, the b base changed from T to G/A. DNA-binding characteristics of other archaeal FFRPs, Ptr1, Ptr2, Ss-Lrp and LysM, are also consistent with the relationship. PMID:19468044

  18. The Replication Focus Targeting Sequence (RFTS) Domain Is a DNA-competitive Inhibitor of Dnmt1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Syeda, Farisa; Fagan, Rebecca L.; Wean, Matthew

    Dnmt1 (DNA methyltransferase 1) is the principal enzyme responsible for maintenance of cytosine methylation at CpG dinucleotides in the mammalian genome. The N-terminal replication focus targeting sequence (RFTS) domain of Dnmt1 has been implicated in subcellular localization, protein association, and catalytic function. However, progress in understanding its function has been limited by the lack of assays for and a structure of this domain. Here, we show that the naked DNA- and polynucleosome-binding activities of Dnmt1 are inhibited by the RFTS domain, which functions by virtue of binding the catalytic domain to the exclusion of DNA. Kinetic analysis with a fluorogenicmore » DNA substrate established the RFTS domain as a 600-fold inhibitor of Dnmt1 enzymatic activity. The crystal structure of the RFTS domain reveals a novel fold and supports a mechanism in which an RFTS-targeted Dnmt1-binding protein, such as Uhrf1, may activate Dnmt1 for DNA binding.« less

  19. Function and horizontal transfer of the small terminase subunit of the tailed bacteriophage Sf6 DNA packaging nanomotor

    PubMed Central

    Leavitt, Justin C.; Gilcrease, Eddie B.; Wilson, Kassandra; Casjens, Sherwood R.

    2013-01-01

    Bacteriophage Sf6 DNA packaging series initiate at many locations across a 2 kbp region. Our in vivo studies that show that Sf6 small terminase subunit (TerS) protein recognizes a specific packaging (pac) site near the center of this region, that this site lies within the portion of the Sf6 gene that encodes the DNA-binding domain of TerS protein, that this domain of the TerS protein is responsible for the imprecision in Sf6 packaging initiation, and that the DNA-binding domain of TerS must be covalently attached to the domain that interacts with the rest of the packaging motor. The TerS DNA-binding domain is self-contained in that it apparently does not interact closely with the rest of the motor and it binds to a recognition site that lies within the DNA that encodes the domain. This arrangement has allowed the horizontal exchange of terS genes among phages to be very successful. PMID:23562538

  20. Altered Gene Expression in Three Plant Species in Response to Treatment with Nep1, a Fungal Protein That Causes Necrosis

    PubMed Central

    Keates, Sarah E.; Kostman, Todd A.; Anderson, James D.; Bailey, Bryan A.

    2003-01-01

    Nep1 is an extracellular fungal protein that causes necrosis when applied to many dicotyledonous plants, including invasive weed species. Using transmission electron microscopy, it was determined that application of Nep1 (1.0 μg mL–1, 0.1% [v/v] Silwet-L77) to Arabidopsis and two invasive weed species, spotted knapweed (Centaurea maculosa) and dandelion (Taraxacum officinale), caused a reduction in the thickness of the cuticle and a breakdown of chloroplasts 1 to 4 h after treatment. Membrane breakdown was most severe in cells closest to the surface of application. Differential display was used to isolate cDNA clones from the three species showing differential expression in response to Nep1 treatment. Differential gene expression was observed for a putative serpin (CmSER-1) and a calmodulin-like (CmCAL-1) protein from spotted knapweed, and a putative protein phosphatase 2C (ToPP2C-1) and cytochrome P-450 (ToCYP-1) protein from dandelion. In addition, differential expression was observed for genes coding for a putative protein kinase (AtPK-1), a homolog (AtWI-12) of wound-induced WI12, a homolog (AtLEA-1) of late embryogenesis abundant LEA-5, a WRKY-18 DNA-binding protein (AtWRKY-18), and a phospholipase D (AtPLD-1) from Arabidopsis. Genes showing elevated mRNA levels in Nep1-treated (5 μg mL–1, 0.1% [v/v] Silwet-L77) leaves 15 min after Nep1 treatment included CmSER-1 and CmCAL-1 for spotted knapweed, ToCYP-1 and CmCAL-1 for dandelion, and AtPK-1, AtWRKY-18, AtWI-12, and AtLEA-1 for Arabidopsis. Levels of mRNA for AtPLD-1 (Arabidopsis) and ToPP2C-1 (dandelion) decreased rapidly in Silwet-l77-treated plants between 15 min and 4 h of treatment, but were maintained or decreased more slowly over time in Nep1-treated (5 μg mL–1, 0.1% [v/v] Silwet-L77) leaves. In general, increases in mRNA band intensities were in the range of two to five times, with only ToCYP-1 in dandelion exceeding an increase of 10 times. The identified genes have been shown to be involved or are related to gene families that are involved in plant stress responses, including wounding, drought, senescence, and disease resistance. PMID:12857840

  1. Localization of a putative transcriptional regulator (ATRX) at pericentromeric heterochromatin and the short arms of acrocentric chromosomes.

    PubMed

    McDowell, T L; Gibbons, R J; Sutherland, H; O'Rourke, D M; Bickmore, W A; Pombo, A; Turley, H; Gatter, K; Picketts, D J; Buckle, V J; Chapman, L; Rhodes, D; Higgs, D R

    1999-11-23

    ATRX is a member of the SNF2 family of helicase/ATPases that is thought to regulate gene expression via an effect on chromatin structure and/or function. Mutations in the hATRX gene cause severe syndromal mental retardation associated with alpha-thalassemia. Using indirect immunofluorescence and confocal microscopy we have shown that ATRX protein is associated with pericentromeric heterochromatin during interphase and mitosis. By coimmunofluorescence, ATRX localizes with a mouse homologue of the Drosophila heterochromatic protein HP1 in vivo, consistent with a previous two-hybrid screen identifying this interaction. From the analysis of a trap assay for nuclear proteins, we have shown that the localization of ATRX to heterochromatin is encoded by its N-terminal region, which contains a conserved plant homeodomain-like finger and a coiled-coil domain. In addition to its association with heterochromatin, at metaphase ATRX clearly binds to the short arms of human acrocentric chromosomes, where the arrays of ribosomal DNA are located. The unexpected association of a putative transcriptional regulator with highly repetitive DNA provides a potential explanation for the variability in phenotype of patients with identical mutations in the ATRX gene.

  2. Epigenetic Control of Gonadal Aromatase (cyp19a1) in Temperature-Dependent Sex Determination of Red-Eared Slider Turtles

    PubMed Central

    Matsumoto, Yuiko; Buemio, Alvin; Chu, Randy; Vafaee, Mozhgon; Crews, David

    2013-01-01

    In the red-eared slider turtle (Trachemys scripta), a species with temperature-dependent sex determination (TSD), the expression of the aromatase gene during gonad development is strictly limited to the female-producing temperature. The underlying mechanism remains unknown. In this study, we identified the upstream 5′-flanking region of the aromatase gene, gonad-specific promoter, and the temperature-dependent DNA methylation signatures during gonad development in the red-eared slider turtle. The 5′-flanking region of the slider aromatase exhibited sequence similarities to the aromatase genes of the American alligator, chicken, quail, and zebra finch. A putative TATA box was located 31 bp upstream of the gonad-specific transcription start site. DNA methylation at the CpG sites between the putative binding sites of the fork head domain factor (FOX) and vertebrate steroidogenic factor 1 (SF1) and adjacent TATA box in the promoter region were significantly lower in embryonic gonads at the female-producing temperature compared the male-producing temperature. A shift from male- to female-, but not from female- to male-, producing temperature changed the level of DNA methylation in gonads. Taken together these results indicate that the temperature, particularly female-producing temperature, allows demethylation at the specific CpG sites of the promoter region which leads the temperature-specific expression of aromatase during gonad development. PMID:23762231

  3. Enhancing the response rate of strand displacement-based electrochemical aptamer sensors using bivalent binding aptamer-cDNA probes.

    PubMed

    Zhang, Ziping; Tao, Cancan; Yin, Jungang; Wang, Yunhui; Li, Yanshen

    2018-04-30

    Electrochemical aptamer (EA) sensors based on aptamer-cDNA duplex probes (cDNA: complementary DNA) and target induced strand displacement (TISD) recognition are sensitive, selective and capable of detecting a wide variety of target analytes. While substantial research efforts have focused on engineering of new signaling mechanisms for the improvement of sensor sensitivity, little attention was paid to the enhancement of sensor response rate. Typically, the previous TISD based EA sensors exhibited relatively long response times larger than 30min, which mainly resulted from the suboptimal aptamer-cDNA probe structure in which most of aptamer bases were paired to the cDNA bases. In an effort to improve the response rate of this type of sensors, we report here the rational engineering of a quickly responsive and sensitive aptamer-cDNA probe by employing the conception of bivalent interaction in supramolecular chemistry. We design a bivalent cDNA strand through linking two short monovalent cDNA sequences, and it is simultaneously hybridized to two electrode-immobilized aptamer probes to form a bivalent binding (BB) aptamer-cDNA probe. This class of BB probe possesses the advantages of less aptamer bases paired to the cDNA bases for quick response rate and good structural stability for high sensor sensitivity. By use of the rationally designed BB aptamer-cDNA probe, a TISD based EA sensor against ATP with significantly enhanced response rate (with a displacement equilibrium time of 4min) and high sensitivity was successfully constructed. We believe that our BB probe conception will help guide future designs and applications of TISD based EA sensors. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. NMR and computational methods applied to the 3- dimensional structure determination of DNA and ligand-DNA complexes in solution

    NASA Astrophysics Data System (ADS)

    Smith, Jarrod Anson

    2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.

  5. Analytical methods to determine the comparative DNA binding studies of curcumin-Cu(II) complexes

    NASA Astrophysics Data System (ADS)

    Rajesh, Jegathalaprathaban; Rajasekaran, Marichamy; Rajagopal, Gurusamy; Athappan, Periakaruppan

    2012-11-01

    DNA interaction studies of two mononuclear [1:1(1); 1:2(2)] copper(II) complexes of curcumin have been studied. The interaction of these complexes with CT-DNA has been explored by physical methods to propose modes of DNA binding of the complexes. Absorption spectral titrations of complex 1 with CT-DNA shows a red-shift of 3 nm with the DNA binding affinity of Kb, 5.21 × 104 M-1 that are higher than that obtained for 2 (red-shift, 2 nm; Kb, 1.73 × 104 M-1) reveal that the binding occurs in grooves as a result of the interaction is via exterior phosphates. The CD spectra of these Cu(II) complexes show a red shift of 3-10 nm in the positive band with increase in intensities. This spectral change of induced CD due to the hydrophobic interaction of copper complexes with DNA is the characteristic of B to A conformational change. The EB displacement assay also reveals the same trend as observed in UV-Vis spectral titration. The addition of complexes 1 and 2 to the DNA bound ethidium bromide (EB) solutions causes an obvious reduction in emission intensities indicating that these complexes competitively bind to DNA with EB. The positive shift of both the Epc and E0' accompanied by reduction of peak currents in differential pulse voltammogram (DPV), upon adding different concentrations of DNA to the metal complexes, are obviously in favor of strong binding to DNA. The super coiled plasmid pUC18 DNA cleavage ability of Cu(II) complexes in the presence of reducing agent reveals the single strand DNA cleavage (ssDNA) is observed. The hydroxyl radical (HOrad ) and the singlet oxygen are believed to be the reactive species responsible for the cleavage.

  6. Two CGTCA motifs and a GHF1/Pit1 binding site mediate cAMP-dependent protein kinase A regulation of human growth hormone gene expression in rat anterior pituitary GC cells.

    PubMed

    Shepard, A R; Zhang, W; Eberhardt, N L

    1994-01-21

    We established the cis-acting elements which mediate cAMP responsiveness of the human growth hormone (hGH) gene in transiently transfected rat anterior pituitary tumor GC cells. Analysis of the intact hGH gene or hGH 5'-flanking DNA (5'-FR) coupled to the hGh cDNA or chloramphenicol acetyltransferase or luciferase genes, indicated that cAMP primarily stimulated hGH promoter activity. Cotransfection of a protein kinase A inhibitory protein cDNA demonstrated that the cAMP response was mediated by protein kinase A. Mutational analysis of the hGH promoter identified two core cAMP response element motifs (CGTCA) located at nucleotides -187/-183 (distal cAMP response element; dCRE) and -99/-95 (proximal cAMP response element; pCRE) and a pituitary-specific transcription factor (GHF1/Pit1) binding site at nucleotides -123/-112 (dGHF1) which were required for cAMP responsiveness. GHF1 was not a limiting factor, since overexpression of GHF1 in cotransfections increased basal but not forskolin induction levels. Gel shift analyses indicated that similar, ubiquitous, thermostable protein(s) specifically bound the pCRE and dCRE motifs. The CGTCA motif-binding factors were cAMP response element binding protein (CREB)/activating transcription factor-1 (ATF-1)-related, since the DNA-protein complex was competed by unlabeled CREB consensus oligonucleotide, specifically supershifted by antisera to CREB and ATF-1 but not ATF-2, and was bound by purified CREB with the same relative binding affinity (pCRE < dCRE < CREB) and mobility as the GC nuclear extract. UV cross-linking and Southwestern blot analyses revealed multiple DNA-protein interactions of which approximately 100- and approximately 45-kDa proteins were predominant; the approximately 45-kDa protein may represent CREB. These results indicate that CREB/ATF-1-related factors act coordinately with the cell-specific factor GHF1 to mediate cAMP-dependent regulation of hGH-1 gene transcription in anterior pituitary somatotrophs.

  7. Nitrogen metabolism and nitrogen control in corynebacteria: variations of a common theme.

    PubMed

    Walter, Britta; Hänssler, Eva; Kalinowski, Jörn; Burkovski, Andreas

    2007-01-01

    The published genome sequences of Corynebacterium diphtheriae, Corynebacterium efficiens, Corynebacterium glutamicum and Corynebacterium jeikeium were screened for genes encoding central components of nitrogen source uptake, nitrogen assimilation and nitrogen control systems. Interestingly, the soil-living species C. efficiens and C. glutamicum exhibit a broader spectrum of genes for nitrogen transport and metabolism than the pathogenic species C. diphtheriae and C. jeikeium. The latter are characterized by gene decay and loss of functions like urea metabolism and nitrogen-dependent transcription control. The global regulator of nitrogen regulation AmtR and its DNA-binding motif are conserved in C. diphtheriae, C. efficiens and C. glutamicum, while in C. jeikeium, an AmtR-encoding gene as well as putative AmtR-binding motifs are missing. Copyright (c) 2007 S. Karger AG, Basel.

  8. Isolation of a gene (pbsC) required for siderophore biosynthesis in fluorescent Pseudomonas sp. strain M114.

    PubMed

    Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F

    1994-06-03

    An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.

  9. PRP19 Transforms into a Sensor of RPA-ssDNA after DNA Damage and Drives ATR Activation via a Ubiquitin-Mediated Circuitry

    PubMed Central

    Maréchal, Alexandre; Wu, Ching-Shyi; Yazinski, Stephanie A.; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E.; Jin, Jianping; Zou, Lee

    2014-01-01

    Summary PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). While the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 binds RPA directly and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ATR kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, the recovery of stalled replication forks, and the progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. PMID:24332808

  10. Modular structural elements in the replication origin region of Tetrahymena rDNA.

    PubMed Central

    Du, C; Sanzgiri, R P; Shaiu, W L; Choi, J K; Hou, Z; Benbow, R M; Dobbs, D L

    1995-01-01

    Computer analyses of the DNA replication origin region in the amplified rRNA genes of Tetrahymena thermophila identified a potential initiation zone in the 5'NTS [Dobbs, Shaiu and Benbow (1994), Nucleic Acids Res. 22, 2479-2489]. This region consists of a putative DNA unwinding element (DUE) aligned with predicted bent DNA segments, nuclear matrix or scaffold associated region (MAR/SAR) consensus sequences, and other common modular sequence elements previously shown to be clustered in eukaryotic chromosomal origin regions. In this study, two mung bean nuclease-hypersensitive sites in super-coiled plasmid DNA were localized within the major DUE-like element predicted by thermodynamic analyses. Three restriction fragments of the 5'NTS region predicted to contain bent DNA segments exhibited anomalous migration characteristic of bent DNA during electrophoresis on polyacrylamide gels. Restriction fragments containing the 5'NTS region bound Tetrahymena nuclear matrices in an in vitro binding assay, consistent with an association of the replication origin region with the nuclear matrix in vivo. The direct demonstration in a protozoan origin region of elements previously identified in Drosophila, chick and mammalian origin regions suggests that clusters of modular structural elements may be a conserved feature of eukaryotic chromosomal origins of replication. Images PMID:7784181

  11. The Drosophila telomere-capping protein Verrocchio binds single-stranded DNA and protects telomeres from DNA damage response

    PubMed Central

    Cicconi, Alessandro; Micheli, Emanuela; Vernì, Fiammetta; Jackson, Alison; Gradilla, Ana Citlali; Cipressa, Francesca; Raimondo, Domenico; Bosso, Giuseppe; Wakefield, James G.; Ciapponi, Laura; Cenci, Giovanni; Gatti, Maurizio

    2017-01-01

    Abstract Drosophila telomeres are sequence-independent structures maintained by transposition to chromosome ends of three specialized retroelements rather than by telomerase activity. Fly telomeres are protected by the terminin complex that includes the HOAP, HipHop, Moi and Ver proteins. These are fast evolving, non-conserved proteins that localize and function exclusively at telomeres, protecting them from fusion events. We have previously suggested that terminin is the functional analogue of shelterin, the multi-protein complex that protects human telomeres. Here, we use electrophoretic mobility shift assay (EMSA) and atomic force microscopy (AFM) to show that Ver preferentially binds single-stranded DNA (ssDNA) with no sequence specificity. We also show that Moi and Ver form a complex in vivo. Although these two proteins are mutually dependent for their localization at telomeres, Moi neither binds ssDNA nor facilitates Ver binding to ssDNA. Consistent with these results, we found that Ver-depleted telomeres form RPA and γH2AX foci, like the human telomeres lacking the ssDNA-binding POT1 protein. Collectively, our findings suggest that Drosophila telomeres possess a ssDNA overhang like the other eukaryotes, and that the terminin complex is architecturally and functionally similar to shelterin. PMID:27940556

  12. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    PubMed

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  13. Crystallization and preliminary X-ray diffraction analysis of a high-affinity phosphate-binding protein endowed with phosphatase activity from Pseudomonas aeruginosa PAO1

    PubMed Central

    Djeghader, Ahmed; Gotthard, Guillaume; Suh, Andrew; Gonzalez, Daniel; Scott, Ken; Chabriere, Eric; Elias, Mikael

    2013-01-01

    In prokaryotes, phosphate starvation induces the expression of numerous phosphate-responsive genes, such as the pst operon including the high-affinity phosphate-binding protein (PBP or pstS) and alkaline phosphatases such as PhoA. This response increases the cellular inorganic phosphate import efficiency. Notably, some Pseudomonas species secrete, via a type-2 secretion system, a phosphate-binding protein dubbed LapA endowed with phosphatase activity. Here, the expression, purification, crystallization and X-ray data collection at 0.87 Å resolution of LapA are described. Combined with biochemical and enzymatic characterization, the structure of this intriguing phosphate-binding protein will help to elucidate the molecular origin of its phosphatase activity and to decipher its putative role in phosphate uptake. PMID:24100568

  14. Structural and functional characterization of the LldR from Corynebacterium glutamicum: a transcriptional repressor involved in l-lactate and sugar utilization

    PubMed Central

    Gao, Yong-Gui; Suzuki, Hiroaki; Itou, Hiroshi; Zhou, Yong; Tanaka, Yoshikazu; Wachi, Masaaki; Watanabe, Nobuhisa; Tanaka, Isao; Yao, Min

    2008-01-01

    LldR (CGL2915) from Corynebacterium glutamicum is a transcription factor belonging to the GntR family, which is typically involved in the regulation of oxidized substrates associated with amino acid metabolism. In the present study, the crystal structure of LldR was determined at 2.05-Å resolution. The structure consists of N- and C-domains similar to those of FadR, but with distinct domain orientations. LldR and FadR dimers achieve similar structures by domain swapping, which was first observed in dimeric assembly of transcription factors. A structural feature of Zn2+ binding in the regulatory domain was also observed, as a difference from the FadR subfamily. DNA microarray and DNase I footprint analyses suggested that LldR acts as a repressor regulating cgl2917-lldD and cgl1934-fruK-ptsF operons, which are indispensable for l-lactate and fructose/sucrose utilization, respectively. Furthermore, the stoichiometries and affinities of LldR and DNAs were determined by isothermal titration calorimetry measurements. The transcriptional start site and repression of LldR on the cgl2917-lldD operon were analysed by primer extension assay. Mutation experiments showed that residues Lys4, Arg32, Arg42 and Gly63 are crucial for DNA binding. The location of the putative ligand binding cavity and the regulatory mechanism of LldR on its affinity for DNA were proposed. PMID:18988622

  15. pH modulates the binding of early growth response protein 1 transcription factor to DNA.

    PubMed

    Mikles, David C; Bhat, Vikas; Schuchardt, Brett J; Deegan, Brian J; Seldeen, Kenneth L; McDonald, Caleb B; Farooq, Amjad

    2013-08-01

    The transcription factor early growth response protein (EGR)1 orchestrates a plethora of signaling cascades involved in cellular homeostasis, and its downregulation has been implicated in the development of prostate cancer. Herein, using a battery of biophysical tools, we show that the binding of EGR1 to DNA is tightly regulated by solution pH. Importantly, the binding affinity undergoes an enhancement of more than an order of magnitude with an increase in pH from 5 to 8, implying that the deprotonation of an ionizable residue accounts for such behavior. This ionizable residue is identified as His382 by virtue of the fact that its replacement by nonionizable residues abolishes the pH dependence of the binding of EGR1 to DNA. Notably, His382 inserts into the major groove of DNA, and stabilizes the EGR1-DNA interaction via both hydrogen bonding and van der Waals contacts. Remarkably, His382 is mainly conserved across other members of the EGR family, implying that histidine protonation-deprotonation may serve as a molecular switch for modulating the protein-DNA interactions that are central to this family of transcription factors. Collectively, our findings reveal an unexpected but a key step in the molecular recognition of the EGR family of transcription factors, and suggest that they may act as sensors of pH within the intracellular environment. © 2013 FEBS.

  16. Elucidating the evolutionary conserved DNA-binding specificities of WRKY transcription factors by molecular dynamics and in vitro binding assays

    PubMed Central

    Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk

    2013-01-01

    WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197

  17. E2fl1 is a meiosis-specific transcription factor in the protist Tetrahymena thermophila

    PubMed Central

    Zhang, Jing; Tian, Miao; Miao, Wei

    2017-01-01

    ABSTRACT Members of the E2F family of transcription factors have been reported to regulate the expression of genes involved in cell cycle control, DNA replication, and DNA repair in multicellular eukaryotes. Here, E2FL1, a meiosis-specific E2F transcription factor gene, was identified in the model ciliate Tetrahymena thermophila. Loss of this gene resulted in meiotic arrest prior to anaphase I. The cytological experiments revealed that the meiotic homologous pairing was not affected in the absence of E2FL1, but the paired homologous chromosomes did not separate and assumed a peculiar tandem arrangement. This is the first time that an E2F family member has been shown to regulate meiotic events. Moreover, BrdU incorporation showed that DSB processing during meiosis was abnormal upon the deletion of E2FL1. Transcriptome sequencing analysis revealed that E2FL1 knockout decreased the expression of genes involved in DNA replication and DNA repair in T. thermophila, suggesting that the function of E2F is highly conserved in eukaryotes. In addition, E2FL1 deletion inhibited the expression of related homologous chromosome segregation genes in T. thermophila. The result may explain the meiotic arrest phenotype at anaphase I. Finally, by searching for E2F DNA-binding motifs in the entire T. thermophila genome, we identified 714 genes containing at least one E2F DNA-binding motif; of these, 235 downregulated represent putative E2FL1 target genes. PMID:27892792

  18. Haloperidol induces pharmacoepigenetic response by modulating miRNA expression, global DNA methylation and expression profiles of methylation maintenance genes and genes involved in neurotransmission in neuronal cells.

    PubMed

    Swathy, Babu; Banerjee, Moinak

    2017-01-01

    Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects. SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study. Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes involved in neurotransmission were observed to be upregulated while CHRM2 gene expression was down regulated. Haloperidol can influence methylation traits thereby inducing a pharmacoepigenomic response, which seems to be regulated by DNMTs and their putative miRNA expression. Increased methylation seems to influence CHRM2 gene expression while microRNA could influence neurotransmission, pharmacogene expression and methylation events. Altered expression of various therapeutically relevant genes and miRNA expression, could account for their role in therapeutic response or side effects.

  19. Haloperidol induces pharmacoepigenetic response by modulating miRNA expression, global DNA methylation and expression profiles of methylation maintenance genes and genes involved in neurotransmission in neuronal cells

    PubMed Central

    Swathy, Babu

    2017-01-01

    Introduction Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects. Methods SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study. Results Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes involved in neurotransmission were observed to be upregulated while CHRM2 gene expression was down regulated. Conclusions Haloperidol can influence methylation traits thereby inducing a pharmacoepigenomic response, which seems to be regulated by DNMTs and their putative miRNA expression. Increased methylation seems to influence CHRM2 gene expression while microRNA could influence neurotransmission, pharmacogene expression and methylation events. Altered expression of various therapeutically relevant genes and miRNA expression, could account for their role in therapeutic response or side effects. PMID:28886082

  20. PrPC has nucleic acid chaperoning properties similar to the nucleocapsid protein of HIV-1.

    PubMed

    Derrington, Edmund; Gabus, Caroline; Leblanc, Pascal; Chnaidermann, Jonas; Grave, Linda; Dormont, Dominique; Swietnicki, Wieslaw; Morillas, Manuel; Marck, Daniel; Nandi, Pradip; Darlix, Jean-Luc

    2002-01-01

    The function of the cellular prion protein (PrPC) remains obscure. Studies suggest that PrPC functions in several processes including signal transduction and Cu2+ metabolism. PrPC has also been established to bind nucleic acids. Therefore we investigated the properties of PrPC as a putative nucleic acid chaperone. Surprisingly, PrPC possesses all the nucleic acid chaperoning properties previously specific to retroviral nucleocapsid proteins. PrPC appears to be a molecular mimic of NCP7, the nucleocapsid protein of HIV-1. Thus PrPC, like NCP7, chaperones the annealing of tRNA(Lys) to the HIV-1 primer binding site, the initial step of retrovirus replication. PrPC also chaperones the two DNA strand transfers required for production of a complete proviral DNA with LTRs. Concerning the functions of NCP7 during budding, PrPC also mimices NCP7 by dimerizing the HIV-1 genomic RNA. These data are unprecedented because, although many cellular proteins have been identified as nucleic acid chaperones, none have the properties of retroviral nucleocapsid proteins.

  1. DNA sequences, recombinant DNA molecules and processes for producing the A and B subunits of cholera toxin and preparations containing so-obtained subunit or subunits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harford, N.; De Wilde, M.

    1987-05-19

    A recombinant DNA molecule is described comprising at least a portion coding for subunits A and B of cholera toxin, or a fragment or derivative of the portion wherein the fragment or derivative codes for a polypeptide have an activity which can induce an immune response to subunit A; can induce an immune response to subunit A and cause epithelial cell penetration and the enzymatic effect leading to net loss of fluid into the gut lumen; can bind to the membrane receptor for the B subunit of cholera toxin; can induce an immune response to subunit B; can induce anmore » immune response to subunit B and bind to the membrane receptor; or has a combination of the activities.« less

  2. Absence of specific binding of several putative neuro-transmitters to human fibroblasts.

    PubMed

    Berrettini, W H; Nadi, N S; Gershon, E S

    1983-01-01

    Fibroblasts were examined for specific binding sites of ten putative neurotransmitters to determine whether this tissue could be used in receptor studies of neurologic and psychiatric disorders. Stereospecific saturable binding was not found for any of the ligands: arginine vasopressin, neurotensin, somatostatin, angiotensin II, thyrotropin-releasing hormone (TRH), alpha-bungarotoxin, LSD, dihydromorphine, muscimol and spiperone.

  3. RPA-coated single-stranded DNA as a platform for post-translational modifications in the DNA damage response

    PubMed Central

    Maréchal, Alexandre; Zou, Lee

    2015-01-01

    The Replication Protein A (RPA) complex is an essential regulator of eukaryotic DNA metabolism. RPA avidly binds to single-stranded DNA (ssDNA) through multiple oligonucleotide/oligosaccharide-binding folds and coordinates the recruitment and exchange of genome maintenance factors to regulate DNA replication, recombination and repair. The RPA-ssDNA platform also constitutes a key physiological signal which activates the master ATR kinase to protect and repair stalled or collapsed replication forks during replication stress. In recent years, the RPA complex has emerged as a key target and an important regulator of post-translational modifications in response to DNA damage, which is critical for its genome guardian functions. Phosphorylation and SUMOylation of the RPA complex, and more recently RPA-regulated ubiquitination, have all been shown to control specific aspects of DNA damage signaling and repair by modulating the interactions between RPA and its partners. Here, we review our current understanding of the critical functions of the RPA-ssDNA platform in the maintenance of genome stability and its regulation through an elaborate network of covalent modifications. PMID:25403473

  4. RPA-coated single-stranded DNA as a platform for post-translational modifications in the DNA damage response.

    PubMed

    Maréchal, Alexandre; Zou, Lee

    2015-01-01

    The Replication Protein A (RPA) complex is an essential regulator of eukaryotic DNA metabolism. RPA avidly binds to single-stranded DNA (ssDNA) through multiple oligonucleotide/oligosaccharide-binding folds and coordinates the recruitment and exchange of genome maintenance factors to regulate DNA replication, recombination and repair. The RPA-ssDNA platform also constitutes a key physiological signal which activates the master ATR kinase to protect and repair stalled or collapsed replication forks during replication stress. In recent years, the RPA complex has emerged as a key target and an important regulator of post-translational modifications in response to DNA damage, which is critical for its genome guardian functions. Phosphorylation and SUMOylation of the RPA complex, and more recently RPA-regulated ubiquitination, have all been shown to control specific aspects of DNA damage signaling and repair by modulating the interactions between RPA and its partners. Here, we review our current understanding of the critical functions of the RPA-ssDNA platform in the maintenance of genome stability and its regulation through an elaborate network of covalent modifications.

  5. Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yun, Ji-Hye; Lee, Won Kyung; Kim, Heeyoun

    Highlights: • We have determined solution structure of Myb domain of AtTRB2. • The Myb domain of AtTRB2 is located in the N-terminal region. • The Myb domain of AtTRB2 binds to plant telomeric DNA without fourth helix. • Helix 2 and 3 of the Myb domain of AtTRB2 are involved in DNA recognition. • AtTRB2 is a novel protein distinguished from other known plant TBP. - Abstract: Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminalmore » Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2{sub 1–64}) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2{sub 1–64} and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences.« less

  6. SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics

    PubMed Central

    Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron

    2016-01-01

    Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression. PMID:27628341

  7. Light-up fluorescent probes utilizing binding behavior of perylenediimide derivatives to a hydrophobic pocket within DNA.

    PubMed

    Takada, Tadao; Yamaguchi, Kosato; Tsukamoto, Suguru; Nakamura, Mitsunobu; Yamana, Kazushige

    2014-08-21

    Here we study the binding behavior of perylenediimide () derivatives to a hydrophobic pocket created inside DNA and their photochemical properties capable of designing a light-up fluorescent sensor for short single-stranded DNA or RNA. The perylenediimide derivative with alkoxy groups () suppressing electron transfer quenching was examined. The bound randomly to DNA showed negligible fluorescence due to the aggregation-induced quenching, whereas the bound to the pocket as a monomeric form showed more than 100-fold fluorescence enhancement. Switching the binding states of the corresponded to a change in the fluorescence response for the hybridization event, which allowed us to design a fluorescent sensor of nucleic acids with a nanomolar detection limit.

  8. Differential sensitivities of cellular XPA and PARP-1 to arsenite inhibition and zinc rescue.

    PubMed

    Ding, Xiaofeng; Zhou, Xixi; Cooper, Karen L; Huestis, Juliana; Hudson, Laurie G; Liu, Ke Jian

    2017-09-15

    Arsenite directly binds to the zinc finger domains of the DNA repair protein poly (ADP ribose) polymerase (PARP)-1, and inhibits PARP-1 activity in the base excision repair (BER) pathway. PARP inhibition by arsenite enhances ultraviolet radiation (UVR)-induced DNA damage in keratinocytes, and the increase in DNA damage is reduced by zinc supplementation. However, little is known about the effects of arsenite and zinc on the zinc finger nucleotide excision repair (NER) protein xeroderma pigmentosum group A (XPA). In this study, we investigated the difference in response to arsenite exposure between XPA and PARP-1, and the differential effectiveness of zinc supplementation in restoring protein DNA binding and DNA damage repair. Arsenite targeted both XPA and PARP-1 in human keratinocytes, resulting in zinc loss from each protein and a pronounced decrease in XPA and PARP-1 binding to chromatin as demonstrated by Chip-on-Western assays. Zinc effectively restored DNA binding of PARP-1 and XPA to chromatin when zinc concentrations were equal to those of arsenite. In contrast, zinc was more effective in rescuing arsenite-augmented direct UVR-induced DNA damage than oxidative DNA damage. Taken together, our findings indicate that arsenite interferes with PARP-1 and XPA binding to chromatin, and that zinc supplementation fully restores DNA binding activity to both proteins in the cellular context. Interestingly, rescue of arsenite-inhibited DNA damage repair by supplemental zinc was more sensitive for DNA damage repaired by the XPA-associated NER pathway than for the PARP-1-dependent BER pathway. This study expands our understanding of arsenite's role in DNA repair inhibition and co-carcinogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. The Myb-domain protein ULTRAPETALA1 INTERACTING FACTOR 1 controls floral meristem activities in Arabidopsis.

    PubMed

    Moreau, Fanny; Thévenon, Emmanuel; Blanvillain, Robert; Lopez-Vidriero, Irene; Franco-Zorrilla, Jose Manuel; Dumas, Renaud; Parcy, François; Morel, Patrice; Trehin, Christophe; Carles, Cristel C

    2016-04-01

    Higher plants continuously and iteratively produce new above-ground organs in the form of leaves, stems and flowers. These organs arise from shoot apical meristems whose homeostasis depends on coordination between self-renewal of stem cells and their differentiation into organ founder cells. This coordination is stringently controlled by the central transcription factor WUSCHEL (WUS), which is both necessary and sufficient for stem cell specification in Arabidopsis thaliana ULTRAPETALA1 (ULT1) was previously identified as a plant-specific, negative regulator of WUS expression. However, molecular mechanisms underlying this regulation remain unknown. ULT1 protein contains a SAND putative DNA-binding domain and a B-box, previously proposed as a protein interaction domain in eukaryotes. Here, we characterise a novel partner of ULT1, named ULT1 INTERACTING FACTOR 1 (UIF1), which contains a Myb domain and an EAR motif. UIF1 and ULT1 function in the same pathway for regulation of organ number in the flower. Moreover, UIF1 displays DNA-binding activity and specifically binds to WUS regulatory elements. We thus provide genetic and molecular evidence that UIF1 and ULT1 work together in floral meristem homeostasis, probably by direct repression of WUS expression. © 2016. Published by The Company of Biologists Ltd.

  10. Identification of transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) as a novel factor for TNF-α expression upon lipopolysaccharide stimulation in human monocytes.

    PubMed

    Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T

    2015-08-01

    Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Structure of the E2 DNA-binding domain from human papillomavirus serotype 31 at 2.4 A.

    PubMed

    Bussiere, D E; Kong, X; Egan, D A; Walter, K; Holzman, T F; Lindh, F; Robins, T; Giranda, V L

    1998-11-01

    The papillomaviruses are a family of small double-stranded DNA viruses which exclusively infect epithelial cells and stimulate the proliferation of those cells. A key protein within the papillomavirus life-cycle is known as the E2 (Early 2) protein and is responsible for regulating viral transcription from all viral promoters as well as for replication of the papillomavirus genome in tandem with another protein known as E1. The E2 protein itself consists of three functional domains: an N-terminal trans-activation domain, a proline-rich linker, and a C-terminal DNA-binding domain. The first crystal structure of the human papillomavirus, serotype 31 (HPV-31), E2 DNA-binding domain has been determined at 2.4 A resolution. The HPV DNA-binding domain monomer consists of two beta-alpha-beta repeats of approximately equal length and is arranged as to have an anti-parallel beta-sheet flanked by the two alpha-helices. The monomers form the functional in vivo dimer by association of the beta-sheets of each monomer so as to form an eight-stranded anti-parallel beta-barrel at the center of the dimer, with the alpha-helices lining the outside of the barrel. The overall structure of HVP-31 E2 DNA-binding domain is similar to both the bovine papillomavirus E2-binding domain and the Epstein-Barr nuclear antigen-1 DNA-binding domain.

  12. Mapping the Structural and Dynamical Features of Multiple p53 DNA Binding Domains: Insights into Loop 1 Intrinsic Dynamics

    PubMed Central

    Lukman, Suryani; Lane, David P.; Verma, Chandra S.

    2013-01-01

    The transcription factor p53 regulates cellular integrity in response to stress. p53 is mutated in more than half of cancerous cells, with a majority of the mutations localized to the DNA binding domain (DBD). In order to map the structural and dynamical features of the DBD, we carried out multiple copy molecular dynamics simulations (totaling 0.8 μs). Simulations show the loop 1 to be the most dynamic element among the DNA-contacting loops (loops 1-3). Loop 1 occupies two major conformational states: extended and recessed; the former but not the latter displays correlations in atomic fluctuations with those of loop 2 (~24 Å apart). Since loop 1 binds to the major groove whereas loop 2 binds to the minor groove of DNA, our results begin to provide some insight into the possible mechanism underpinning the cooperative nature of DBD binding to DNA. We propose (1) a novel mechanism underlying the dynamics of loop 1 and the possible tread-milling of p53 on DNA and (2) possible mutations on loop 1 residues to restore the transcriptional activity of an oncogenic mutation at a distant site. PMID:24324553

  13. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

  14. Trichomonas vaginalis Repair of Iron Centres Proteins: The Different Role of Two Paralogs.

    PubMed

    Nobre, Lígia S; Meloni, Dionigia; Teixeira, Miguel; Viscogliosi, Eric; Saraiva, Lígia M

    2016-06-01

    Trichomonas vaginalis, the causative parasite of one of the most prevalent sexually transmitted diseases is, so far, the only protozoan encoding two putative Repair of Iron Centres (RIC) proteins. Homologs of these proteins have been shown to protect bacteria from the chemical stress imposed by mammalian immunity. In this work, the biochemical and functional characterisation of the T. vaginalis RICs revealed that the two proteins have different properties. Expression of ric1 is induced by nitrosative stress but not by hydrogen peroxide, while ric2 transcription remained unaltered under similar conditions. T. vaginalis RIC1 contains a di-iron centre, but RIC2 apparently does not. Only RIC1 resembles bacterial RICs on spectroscopic profiling and repairing ability of oxidatively-damaged iron-sulfur clusters. Unexpectedly, RIC2 was found to bind DNA plasmid and T. vaginalis genomic DNA, a function proposed to be related with its leucine zipper domain. The two proteins also differ in their cellular localization: RIC1 is expressed in the cytoplasm only, and RIC2 occurs both in the nucleus and cytoplasm. Therefore, we concluded that the two RIC paralogs have different roles in T. vaginalis, with RIC2 showing an unprecedented DNA binding ability when compared with all other until now studied RICs. Copyright © 2016 Elsevier GmbH. All rights reserved.

  15. Engineering synthetic TAL effectors with orthogonal target sites

    PubMed Central

    Garg, Abhishek; Lohmueller, Jason J.; Silver, Pamela A.; Armel, Thomas Z.

    2012-01-01

    The ability to engineer biological circuits that process and respond to complex cellular signals has the potential to impact many areas of biology and medicine. Transcriptional activator-like effectors (TALEs) have emerged as an attractive component for engineering these circuits, as TALEs can be designed de novo to target a given DNA sequence. Currently, however, the use of TALEs is limited by degeneracy in the site-specific manner by which they recognize DNA. Here, we propose an algorithm to computationally address this problem. We apply our algorithm to design 180 TALEs targeting 20 bp cognate binding sites that are at least 3 nt mismatches away from all 20 bp sequences in putative 2 kb human promoter regions. We generated eight of these synthetic TALE activators and showed that each is able to activate transcription from a targeted reporter. Importantly, we show that these proteins do not activate synthetic reporters containing mismatches similar to those present in the genome nor a set of endogenous genes predicted to be the most likely targets in vivo. Finally, we generated and characterized TALE repressors comprised of our orthogonal DNA binding domains and further combined them with shRNAs to accomplish near complete repression of target gene expression. PMID:22581776

  16. A scallop C-type lectin from Argopecten irradians (AiCTL5) with activities of lipopolysaccharide binding and Gram-negative bacteria agglutination.

    PubMed

    Mu, Changkao; Song, Xiaoyan; Zhao, Jianmin; Wang, Lingling; Qiu, Limei; Zhang, Huan; Zhou, Zhi; Wang, Mengqiang; Song, Linsheng; Wang, Chunlin

    2012-05-01

    C-type lectins are a family of calcium-dependent carbohydrate-binding proteins. In the present study, a C-type lectin (designated as AiCTL5) was identified and characterized from Argopecten irradians. The full-length cDNA of AiCTL5 was of 673 bp, containing a 5' untranslated region (UTR) of 24 bp, a 3' UTR of 130 bp with a poly (A) tail, and an open reading frame (ORF) of 519 bp encoding a polypeptide of 172 amino acids with a putative signal peptide of 17 amino acids. A C-type lectin-like domain (CRD) containing 6 conserved cysteines and a putative glycosylation sites were identified in the deduced amino acid sequence of AiCTL5. AiCTL5 shared 11%-27.5% identity with the previous reported C-type lectin from A. irradians. The cDNA fragment encoding the mature peptide of AiCTL5 was recombined into pET-21a (+) with a C-terminal hexa-histidine tag fused in-frame, and expressed in Escherichia coli Origami (DE3). The recombinant AiCTL5 (rAiCTL5) agglutinated Gram-negative E. coli TOP10F' and Listonella anguillarum, but did not agglutinate Gram-positive bacteria Bacillus thuringiensis and Micrococcus luteus, and the agglutination could be inhibited by EDTA, indicating that AiCTL5 was a Ca(2+)-dependent lectin. rAiCTL5 exhibited a significantly strong activity to bind LPS from E. coli, which conformed to the agglutinating activity toward Gram-negative bacteria. Moreover, rAiCTL5 also agglutinated rabbit erythrocytes. These results indicated that AiCTL5 could function as a pattern recognition receptor to protect bay scallop from Gram-negative bacterial infection, and also provide evidence to understand the structural and functional diverse of lectin. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Development of novel metabolite-responsive transcription factors via transposon-mediated protein fusion.

    PubMed

    Younger, Andrew K D; Su, Peter Y; Shepard, Andrea J; Udani, Shreya V; Cybulski, Thaddeus R; Tyo, Keith E J; Leonard, Joshua N

    2018-02-01

    Naturally evolved metabolite-responsive biosensors enable applications in metabolic engineering, ranging from screening large genetic libraries to dynamically regulating biosynthetic pathways. However, there are many metabolites for which a natural biosensor does not exist. To address this need, we developed a general method for converting metabolite-binding proteins into metabolite-responsive transcription factors-Biosensor Engineering by Random Domain Insertion (BERDI). This approach takes advantage of an in vitro transposon insertion reaction to generate all possible insertions of a DNA-binding domain into a metabolite-binding protein, followed by fluorescence activated cell sorting to isolate functional biosensors. To develop and evaluate the BERDI method, we generated a library of candidate biosensors in which a zinc finger DNA-binding domain was inserted into maltose binding protein, which served as a model well-studied metabolite-binding protein. Library diversity was characterized by several methods, a selection scheme was deployed, and ultimately several distinct and functional maltose-responsive transcriptional biosensors were identified. We hypothesize that the BERDI method comprises a generalizable strategy that may ultimately be applied to convert a wide range of metabolite-binding proteins into novel biosensors for applications in metabolic engineering and synthetic biology. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Molecular cloning, characterization and expression analysis of a putative C-type lectin (Fclectin) gene in Chinese shrimp Fenneropenaeus chinensis.

    PubMed

    Liu, Yi-Chen; Li, Fu-Hua; Dong, Bo; Wang, Bing; Luan, Wei; Zhang, Xiao-Jun; Zhang, Liu-Suo; Xiang, Jian-Hai

    2007-01-01

    Lectin is regarded as a potential molecule involved in immune recognition and phagocytosis through opsonization in crustacean. Knowledge on lectin at molecular level would help us to understand its regulation mechanism in crustacean immune system. A novel C-type lectin gene (Fclectin) was cloned from hemocytes of Chinese shrimp Fenneropenaeus chinensis by 3' and 5' rapid amplification of cDNA ends (RACE) PCR. The full-length cDNA consists of 1482 bp with an 861 bp open reading frame, encoding 287 amino acids. The deduced amino acid sequence contains a putative signal peptide of 19 amino acids. It also contains two carbohydrate recognition domains/C-type lectin-like domains (CRD1 and CRD2), which share 78% identity with each other. CRD1 and CRD2 showed 34% and 30% identity with that of mannose-binding lectin from Japanese lamprey (Lethenteron japonicum), respectively. Both CRD1 and CRD2 of Fclectin have 11 amino acids residues, which are relatively invariant in animals' C-type lectin CRDs. Five residues at Ca2+ binding site 1 are conserved in Fclectin. The potential Ca2+/carbohydrate-binding (site 2) motif QPD, E, NP (Gln-Pro-Asp, Glu, Asn-Pro) presented in the two CRDs of Fclectin may support its ability to bind galactose-type sugars. It could be deduced that Fclectin is a member of C-type lectin superfamily. Transcripts of Fclectin were found only in hemocytes by Northern blotting and RNA in situ hybridization. The variation of mRNA transcription level in hemocytes during artificial infection with bacteria and white spot syndrome virus (WSSV) was quantitated by capillary electrophoresis after RT-PCR. An exploration of mRNA expression variation after LPS stimulation was carried out in primarily cultured hemocytes in vitro. Expression profiles of Fclectin gene were greatly modified after bacteria, LPS or WSSV challenge. The above-stated data can provide us clues to understand the probable role of C-type lectin in innate immunity of shrimp and would be helpful to shrimp disease control.

  19. The prokaryotic enhancer binding protein NTRC has an ATPase activity which is phosphorylation and DNA dependent.

    PubMed Central

    Austin, S; Dixon, R

    1992-01-01

    The prokaryotic activator protein NTRC binds to enhancer-like elements and activates transcription in response to nitrogen limitation by catalysing open complex formation by sigma 54 RNA polymerase holoenzyme. Formation of open complexes requires the phosphorylated form of NTRC and the reaction is ATP dependent. We find that NTRC has an ATPase activity which is activated by phosphorylation and is strongly stimulated by the presence of DNA containing specific NTRC binding sites. Images PMID:1534752

  20. Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2 hindbrain enhancer activity.

    PubMed

    Jacobs, Y; Schnabel, C A; Cleary, M L

    1999-07-01

    Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element.

  1. Nitric oxide sensitizes tumor cells to TRAIL-induced apoptosis via inhibition of the DR5 transcription repressor Yin Yang 1.

    PubMed

    Huerta-Yepez, Sara; Vega, Mario; Escoto-Chavez, Saul E; Murdock, Benjamin; Sakai, Toshiyuki; Baritaki, Stavroula; Bonavida, Benjamin

    2009-02-01

    Treatment of TRAIL-resistant tumor cells with the nitric oxide donor DETANONOate sensitizes the tumor cells to TRAIL-induced apoptosis concomitantly with DR5 upregulation. The mechanism of sensitization was examined based on the hypothesis that DETANONOate inhibits a transcription repressor Yin Yang 1 (YY1) that negatively regulates DR5 transcription. Treatment of the prostate carcinoma cell lines with DETANONOate inhibited both NF-kappaB and YY1 DNA-binding activities concomitantly with upregulation of DR5 expression. The direct role of YY1 in the regulation of TRAIL resistance was demonstrated in cells treated with YY1 siRNA resulting in TRAIL-induced apoptosis. The role of YY1 in the transcriptional regulation of DR5 was examined in cells treated with a DR5 luciferase reporter system (pDR5) and two constructs, namely, the pDR5/-605 construct with a deletion of the putative YY1 DNA-binding region (-1224 to -605) and a construct pDR5-YY1 with a mutation of the YY1 DNA-binding site. A significant (3-fold) augmentation of luciferase activity over baseline transfection with pDR5 was observed in cells transfected with the modified constructs. ChIP analysis corroborated the YY1 binding to the DR5 promoter. In vivo, tissues from nude mice bearing the PC-3 xenograft and treated with DETANONOate showed inhibition of YY1 and upregulation of DR5. The present findings demonstrate that YY1 negatively regulates DR5 transcription and expression and these correlated with resistance to TRAIL-induced apoptosis. DETANONOate inhibits both NF-kappaB and YY1 and in combination with TRAIL reverses tumor cell resistance to TRAIL apoptosis.

  2. Listeria monocytogenes DNA glycosylase AdiP affects flagellar motility, biofilm formation, virulence, and stress responses

    USDA-ARS?s Scientific Manuscript database

    The temperature-dependent alteration of flagellar motility gene expression is critical for the foodborne pathogen Listeria monocytogenes to respond to a changing environment. In this study, a genetic determinant, L. monocytogenes f2365_0220 (lmof2365_0220), encoding a putative protein that is struct...

  3. An electrochemical sensing platform based on local repression of electrolyte diffusion for single-step, reagentless, sensitive detection of a sequence-specific DNA-binding protein.

    PubMed

    Zhang, Yun; Liu, Fang; Nie, Jinfang; Jiang, Fuyang; Zhou, Caibin; Yang, Jiani; Fan, Jinlong; Li, Jianping

    2014-05-07

    In this paper, we report for the first time an electrochemical biosensor for single-step, reagentless, and picomolar detection of a sequence-specific DNA-binding protein using a double-stranded, electrode-bound DNA probe terminally modified with a redox active label close to the electrode surface. This new methodology is based upon local repression of electrolyte diffusion associated with protein-DNA binding that leads to reduction of the electrochemical response of the label. In the proof-of-concept study, the resulting electrochemical biosensor was quantitatively sensitive to the concentrations of the TATA binding protein (TBP, a model analyte) ranging from 40 pM to 25.4 nM with an estimated detection limit of ∼10.6 pM (∼80 to 400-fold improvement on the detection limit over previous electrochemical analytical systems).

  4. SOS response in bacteria: Inhibitory activity of lichen secondary metabolites against Escherichia coli RecA protein.

    PubMed

    Bellio, Pierangelo; Di Pietro, Letizia; Mancini, Alisia; Piovano, Marisa; Nicoletti, Marcello; Brisdelli, Fabrizia; Tondi, Donatella; Cendron, Laura; Franceschini, Nicola; Amicosante, Gianfranco; Perilli, Mariagrazia; Celenza, Giuseppe

    2017-06-15

    RecA is a bacterial multifunctional protein essential to genetic recombination, error-prone replicative bypass of DNA damages and regulation of SOS response. The activation of bacterial SOS response is directly related to the development of intrinsic and/or acquired resistance to antimicrobials. Although recent studies directed towards RecA inactivation via ATP binding inhibition described a variety of micromolar affinity ligands, inhibitors of the DNA binding site are still unknown. Twenty-seven secondary metabolites classified as anthraquinones, depsides, depsidones, dibenzofurans, diphenyl-butenolides, paraconic acids, pseudo-depsidones, triterpenes and xanthones, were investigated for their ability to inhibit RecA from Escherichia coli. They were isolated in various Chilean regions from 14 families and 19 genera of lichens. The ATP hydrolytic activity of RecA was quantified detecting the generation of free phosphate in solution. The percentage of inhibition was calculated fixing at 100µM the concentration of the compounds. Deeper investigations were reserved to those compounds showing an inhibition higher than 80%. To clarify the mechanism of inhibition, the semi-log plot of the percentage of inhibition vs. ATP and vs. ssDNA, was evaluated. Only nine compounds showed a percentage of RecA inhibition higher than 80% (divaricatic, perlatolic, alpha-collatolic, lobaric, lichesterinic, protolichesterinic, epiphorellic acids, sphaerophorin and tumidulin). The half-inhibitory concentrations (IC 50 ) calculated for these compounds were ranging from 14.2µM for protolichesterinic acid to 42.6µM for sphaerophorin. Investigations on the mechanism of inhibition showed that all compounds behaved as uncompetitive inhibitors for ATP binding site, with the exception of epiphorellic acid which clearly acted as non-competitive inhibitor of the ATP site. Further investigations demonstrated that epiphorellic acid competitively binds the ssDNA binding site. Kinetic data were confirmed by molecular modelling binding predictions which shows that epiphorellic acid is expected to bind the ssDNA site into the L2 loop of RecA protein. In this paper the first RecA ssDNA binding site ligand is described. Our study sets epiphorellic acid as a promising hit for the development of more effective RecA inhibitors. In our drug discovery approach, natural products in general and lichen in particular, represent a successful source of active ligands and structural diversity. Copyright © 2017 Elsevier GmbH. All rights reserved.

  5. Xenopus origin recognition complex (ORC) initiates DNA replication preferentially at sequences targeted by Schizosaccharomyces pombe ORC

    PubMed Central

    Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.

    2003-01-01

    Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006

  6. Downstream promoter interactions of TFIID TAFs facilitate transcription reinitiation

    PubMed Central

    Joo, Yoo Jin; Ficarro, Scott B.; Soares, Luis M.; Chun, Yujin; Marto, Jarrod A.; Buratowski, Stephen

    2017-01-01

    TFIID binds promoter DNA to recruit RNA polymerase II and other basal factors for transcription. Although the TATA-binding protein (TBP) subunit of TFIID is necessary and sufficient for in vitro transcription, the TBP-associated factor (TAF) subunits recognize downstream promoter elements, act as coactivators, and interact with nucleosomes. In yeast nuclear extracts, transcription induces stable TAF binding to downstream promoter DNA, promoting subsequent activator-independent transcription reinitiation. In vivo, promoter responses to TAF mutations correlate with the level of downstream, rather than overall, Taf1 cross-linking. We propose a new model in which TAFs function as reinitiation factors, accounting for the differential responses of promoters to various transcription factor mutations. PMID:29203645

  7. Early growth response 1 (EGR-1) is a transcriptional regulator of mitochondrial carrier homolog 1 (MTCH 1)/presenilin 1-associated protein (PSAP).

    PubMed

    Nelo-Bazán, María Alejandra; Latorre, Pedro; Bolado-Carrancio, Alfonso; Pérez-Campo, Flor M; Echenique-Robba, Pablo; Rodríguez-Rey, José Carlos; Carrodeguas, José Alberto

    2016-03-01

    Attempts to elucidate the cellular function of MTCH1 (mitochondrial carrier homolog 1) have not yet rendered a clear insight into the function of this outer mitochondrial membrane protein. Classical biochemical and cell biology approaches have not produced the expected outcome. In vitro experiments have indicated a likely role in the regulation of cell death by apoptosis, and its reported interaction with presenilin 1 suggests a role in the cellular pathways in which this membrane protease participates, nevertheless in vivo data are missing. In an attempt to identify cellular pathways in which this protein might participate, we have studied its promoter looking for transcriptional regulators. We have identified several putative binding sites for EGR-1 (Early growth response 1; a protein involved in growth, proliferation and differentiation), in the proximal region of the MTCH1 promoter. Chromatin immunoprecipitation showed an enrichment of these sequences in genomic DNA bound to EGR-1 and transient overexpression of EGR-1 in cultured HEK293T cells induces an increase of endogenous MTCH1 levels. We also show that MTCH1 levels increase in response to treatment of cells with doxorubicin, an apoptosis inducer through DNA damage. The endogenous levels of MTCH1 decrease when EGR-1 levels are lowered by RNA interference. Our results indicate that EGR-1 is a transcriptional regulator of MTCH1 and give some clues about the cellular processes in which MTCH1 might participate. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. In Vivo Validation of Predicted and Conserved T Cell Epitopes in a Swine Influenza Model

    PubMed Central

    Gutiérrez, Andres H.; Loving, Crystal; Moise, Leonard; Terry, Frances E.; Brockmeier, Susan L.; Hughes, Holly R.; Martin, William D.; De Groot, Anne S.

    2016-01-01

    Swine influenza is a highly contagious respiratory viral infection in pigs that is responsible for significant financial losses to pig farmers annually. Current measures to protect herds from infection include: inactivated whole-virus vaccines, subunit vaccines, and alpha replicon-based vaccines. As is true for influenza vaccines for humans, these strategies do not provide broad protection against the diverse strains of influenza A virus (IAV) currently circulating in U.S. swine. Improved approaches to developing swine influenza vaccines are needed. Here, we used immunoinformatics tools to identify class I and II T cell epitopes highly conserved in seven representative strains of IAV in U.S. swine and predicted to bind to Swine Leukocyte Antigen (SLA) alleles prevalent in commercial swine. Epitope-specific interferon-gamma (IFNγ) recall responses to pooled peptides and whole virus were detected in pigs immunized with multi-epitope plasmid DNA vaccines encoding strings of class I and II putative epitopes. In a retrospective analysis of the IFNγ responses to individual peptides compared to predictions specific to the SLA alleles of cohort pigs, we evaluated the predictive performance of PigMatrix and demonstrated its ability to distinguish non-immunogenic from immunogenic peptides and to identify promiscuous class II epitopes. Overall, this study confirms the capacity of PigMatrix to predict immunogenic T cell epitopes and demonstrate its potential for use in the design of epitope-driven vaccines for swine. Additional studies that match the SLA haplotype of animals with the study epitopes will be required to evaluate the degree of immune protection conferred by epitope-driven DNA vaccines in pigs. PMID:27411061

  9. Using host-pathogen protein interactions to identify and characterize Francisella tularensis virulence factors.

    PubMed

    Wallqvist, Anders; Memišević, Vesna; Zavaljevski, Nela; Pieper, Rembert; Rajagopala, Seesandra V; Kwon, Keehwan; Yu, Chenggang; Hoover, Timothy A; Reifman, Jaques

    2015-12-29

    Francisella tularensis is a select bio-threat agent and one of the most virulent intracellular pathogens known, requiring just a few organisms to establish an infection. Although several virulence factors are known, we lack an understanding of virulence factors that act through host-pathogen protein interactions to promote infection. To address these issues in the highly infectious F. tularensis subsp. tularensis Schu S4 strain, we deployed a combined in silico, in vitro, and in vivo analysis to identify virulence factors and their interactions with host proteins to characterize bacterial infection mechanisms. We initially used comparative genomics and literature to identify and select a set of 49 putative and known virulence factors for analysis. Each protein was then subjected to proteome-scale yeast two-hybrid (Y2H) screens with human and murine cDNA libraries to identify potential host-pathogen protein-protein interactions. Based on the bacterial protein interaction profile with both hosts, we selected seven novel putative virulence factors for mutant construction and animal validation experiments. We were able to create five transposon insertion mutants and used them in an intranasal BALB/c mouse challenge model to establish 50 % lethal dose estimates. Three of these, ΔFTT0482c, ΔFTT1538c, and ΔFTT1597, showed attenuation in lethality and can thus be considered novel F. tularensis virulence factors. The analysis of the accompanying Y2H data identified intracellular protein trafficking between the early endosome to the late endosome as an important component in virulence attenuation for these virulence factors. Furthermore, we also used the Y2H data to investigate host protein binding of two known virulence factors, showing that direct protein binding was a component in the modulation of the inflammatory response via activation of mitogen-activated protein kinases and in the oxidative stress response. Direct interactions with specific host proteins and the ability to influence interactions among host proteins are important components for F. tularensis to avoid host-cell defense mechanisms and successfully establish an infection. Although direct host-pathogen protein-protein binding is only one aspect of Francisella virulence, it is a critical component in directly manipulating and interfering with cellular processes in the host cell.

  10. Use of a Phosphorylation Site Mutant To Identify Distinct Modes of Gene Repression by the Control of Virulence Regulator (CovR) in Streptococcus pyogenes.

    PubMed

    Horstmann, Nicola; Sahasrabhojane, Pranoti; Yao, Hui; Su, Xiaoping; Shelburne, Samuel A

    2017-09-15

    Control of the virulence regulator/sensor kinase (CovRS) two-component system (TCS) serves as a model for investigating the impact of signaling pathways on the pathogenesis of Gram-positive bacteria. However, the molecular mechanisms by which CovR, an OmpR/PhoB family response regulator, controls virulence gene expression are poorly defined, partly due to the labile nature of its aspartate phosphorylation site. To better understand the regulatory effect of phosphorylated CovR, we generated the phosphorylation site mutant strain 10870-CovR-D53E, which we predicted to have a constitutive CovR phosphorylation phenotype. Interestingly, this strain showed CovR activity only for a subset of the CovR regulon, which allowed for classification of CovR-influenced genes into D53E-regulated and D53E-nonregulated groups. Inspection of the promoter sequences of genes belonging to each group revealed distinct promoter architectures with respect to the location and number of putative CovR-binding sites. Electrophoretic mobility shift analysis demonstrated that recombinant CovR-D53E protein retains its ability to bind promoter DNA from both CovR-D53E-regulated and -nonregulated groups, implying that factors other than mere DNA binding are crucial for gene regulation. In fact, we found that CovR-D53E is incapable of dimerization, a process thought to be critical to OmpR/PhoB family regulator function. Thus, our global analysis of CovR-D53E indicates dimerization-dependent and dimerization-independent modes of CovR-mediated repression, thereby establishing distinct mechanisms by which this critical regulator coordinates virulence gene expression. IMPORTANCE Streptococcus pyogenes causes a wide variety of diseases, ranging from superficial skin and throat infections to life-threatening invasive infections. To establish these various disease manifestations, Streptococcus pyogenes requires tightly coordinated production of its virulence factor repertoire. Here, the response regulator CovR plays a crucial role. As an OmpR/PhoB family member, CovR is activated by phosphorylation on a conserved aspartate residue, leading to protein dimerization and subsequent binding to operator sites. Our transcriptome analysis using the monomeric phosphorylation mimic mutant CovR-D53E broadens this general notion by revealing dimerization-independent repression of a subset of CovR-regulated genes. Combined with promoter analyses, these data suggest distinct mechanisms of CovR transcriptional control, which allow for differential expression of virulence genes in response to environmental cues. Copyright © 2017 American Society for Microbiology.

  11. Crystal structure of the DNA-binding domain of the LysR-type transcriptional regulator CbnR in complex with a DNA fragment of the recognition-binding site in the promoter region.

    PubMed

    Koentjoro, Maharani Pertiwi; Adachi, Naruhiko; Senda, Miki; Ogawa, Naoto; Senda, Toshiya

    2018-03-01

    LysR-type transcriptional regulators (LTTRs) are among the most abundant transcriptional regulators in bacteria. CbnR is an LTTR derived from Cupriavidus necator (formerly Alcaligenes eutrophus or Ralstonia eutropha) NH9 and is involved in transcriptional activation of the cbnABCD genes encoding chlorocatechol degradative enzymes. CbnR interacts with a cbnA promoter region of approximately 60 bp in length that contains the recognition-binding site (RBS) and activation-binding site (ABS). Upon inducer binding, CbnR seems to undergo conformational changes, leading to the activation of the transcription. Since the interaction of an LTTR with RBS is considered to be the first step of the transcriptional activation, the CbnR-RBS interaction is responsible for the selectivity of the promoter to be activated. To understand the sequence selectivity of CbnR, we determined the crystal structure of the DNA-binding domain of CbnR in complex with RBS of the cbnA promoter at 2.55 Å resolution. The crystal structure revealed details of the interactions between the DNA-binding domain and the promoter DNA. A comparison with the previously reported crystal structure of the DNA-binding domain of BenM in complex with its cognate RBS showed several differences in the DNA interactions, despite the structural similarity between CbnR and BenM. These differences explain the observed promoter sequence selectivity between CbnR and BenM. Particularly, the difference between Thr33 in CbnR and Ser33 in BenM appears to affect the conformations of neighboring residues, leading to the selective interactions with DNA. Atomic coordinates and structure factors for the DNA-binding domain of Cupriavidus necatorNH9 CbnR in complex with RBS are available in the Protein Data Bank under the accession code 5XXP. © 2018 Federation of European Biochemical Societies.

  12. pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.

    PubMed

    Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

    2016-07-15

    Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.

  13. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

    PubMed

    Lenzmeier, B A; Giebler, H A; Nyborg, J K

    1998-02-01

    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

  14. Structural and Mechanistic Basis of Zinc Regulation Across the E. coli Zur Regulon

    PubMed Central

    Gilston, Benjamin A.; Wang, Suning; Marcus, Mason D.; Canalizo-Hernández, Mónica A.; Swindell, Elden P.; Xue, Yi; Mondragón, Alfonso; O'Halloran, Thomas V.

    2014-01-01

    Commensal microbes, whether they are beneficial or pathogenic, are sensitive to host processes that starve or swamp the prokaryote with large fluctuations in local zinc concentration. To understand how microorganisms coordinate a dynamic response to changes in zinc availability at the molecular level, we evaluated the molecular mechanism of the zinc-sensing zinc uptake regulator (Zur) protein at each of the known Zur-regulated genes in Escherichia coli. We solved the structure of zinc-loaded Zur bound to the PznuABC promoter and show that this metalloregulatory protein represses gene expression by a highly cooperative binding of two adjacent dimers to essentially encircle the core element of each of the Zur-regulated promoters. Cooperativity in these protein-DNA interactions requires a pair of asymmetric salt bridges between Arg52 and Asp49′ that connect otherwise independent dimers. Analysis of the protein-DNA interface led to the discovery of a new member of the Zur-regulon: pliG. We demonstrate this gene is directly regulated by Zur in a zinc responsive manner. The pliG promoter forms stable complexes with either one or two Zur dimers with significantly less protein-DNA cooperativity than observed at other Zur regulon promoters. Comparison of the in vitro Zur-DNA binding affinity at each of four Zur-regulon promoters reveals ca. 10,000-fold variation Zur-DNA binding constants. The degree of Zur repression observed in vivo by comparison of transcript copy number in wild-type and Δzur strains parallels this trend spanning a 100-fold difference. We conclude that the number of ferric uptake regulator (Fur)-family dimers that bind within any given promoter varies significantly and that the thermodynamic profile of the Zur-DNA interactions directly correlates with the physiological response at different promoters. PMID:25369000

  15. Nuclear factor of activated T cells (NFAT) in pearl oyster Pinctada fucata: molecular cloning and functional characterization.

    PubMed

    Huang, Xian-De; Wei, Guo-jian; Zhang, Hua; He, Mao-Xian

    2015-01-01

    Nuclear factor of activated T cells (NFAT) plays an important role in nonimmune cells and also in T cells and many other cells of the immune system, by regulating the expression of a variety of genes involved in the immune response, organ development, developmental apoptosis and angiogenesis. In the present study, the NFAT homology gene, PfNFAT, from the pearl oyster Pinctada fucata was cloned and its genomic structure and promoter were analyzed. PfNFAT encodes a putative protein of 1226 amino acids, and contains a highly conserved Rel homology region (RHR) with DNA-binding specificity, and a regulatory domain (NFAT homology region, NHR) containing a potent transactivation domain (TAD). The PfNFAT gene consists of 12 exons and 11 introns, and its promoter contains potential binding sites for transcription factors such as NF-κB (Nuclear factor κB), STATx (signal transducer and activator of transcription), AP-1 (activator protein-1) and Sox-5/9 (SRY type HMG box-5/9), MyoD (Myogenic Differentiation Antigen) and IRF (Interferon regulatory factor). Comparison and phylogenetic analysis revealed that PfNFAT shows high identity with other invertebrate NFAT, and clusters with the NFAT5 subgroup. Furthermore, gene expression analysis revealed that PfNFAT is involved in the immune response to lipopolysaccharide (LPS) and Polyinosinic-polycytidylic acid (poly I:C) stimulation and in the nucleus inserting operation. The study of PfNFAT may increase understanding of molluscan innate immunity. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Chemical methodology as a source of small-molecule checkpoint inhibitors and heat shock protein 70 (Hsp70) modulators.

    PubMed

    Huryn, Donna M; Brodsky, Jeffrey L; Brummond, Kay M; Chambers, Peter G; Eyer, Benjamin; Ireland, Alex W; Kawasumi, Masaoki; Laporte, Matthew G; Lloyd, Kayla; Manteau, Baptiste; Nghiem, Paul; Quade, Bettina; Seguin, Sandlin P; Wipf, Peter

    2011-04-26

    Unique chemical methodology enables the synthesis of innovative and diverse scaffolds and chemotypes and allows access to previously unexplored "chemical space." Compound collections based on such new synthetic methods can provide small-molecule probes of proteins and/or pathways whose functions are not fully understood. We describe the identification, characterization, and evolution of two such probes. In one example, a pathway-based screen for DNA damage checkpoint inhibitors identified a compound, MARPIN (ATM and ATR pathway inhibitor) that sensitizes p53-deficient cells to DNA-damaging agents. Modification of the small molecule and generation of an immobilized probe were used to selectively bind putative protein target(s) responsible for the observed activity. The second example describes a focused library approach that relied on tandem multicomponent reaction methodologies to afford a series of modulators of the heat shock protein 70 (Hsp70) molecular chaperone. The synthesis of libraries based on the structure of MAL3-101 generated a collection of chemotypes, each modulating Hsp70 function, but exhibiting divergent pharmacological activities. For example, probes that compromise the replication of a disease-associated polyomavirus were identified. These projects highlight the importance of chemical methodology development as a source of small-molecule probes and as a drug discovery starting point.

  17. Chemical methodology as a source of small-molecule checkpoint inhibitors and heat shock protein 70 (Hsp70) modulators

    PubMed Central

    Huryn, Donna M.; Brodsky, Jeffrey L.; Brummond, Kay M.; Chambers, Peter G.; Eyer, Benjamin; Ireland, Alex W.; Kawasumi, Masaoki; LaPorte, Matthew G.; Lloyd, Kayla; Manteau, Baptiste; Nghiem, Paul; Quade, Bettina; Seguin, Sandlin P.; Wipf, Peter

    2011-01-01

    Unique chemical methodology enables the synthesis of innovative and diverse scaffolds and chemotypes and allows access to previously unexplored “chemical space.” Compound collections based on such new synthetic methods can provide small-molecule probes of proteins and/or pathways whose functions are not fully understood. We describe the identification, characterization, and evolution of two such probes. In one example, a pathway-based screen for DNA damage checkpoint inhibitors identified a compound, MARPIN (ATM and ATR pathway inhibitor) that sensitizes p53-deficient cells to DNA-damaging agents. Modification of the small molecule and generation of an immobilized probe were used to selectively bind putative protein target(s) responsible for the observed activity. The second example describes a focused library approach that relied on tandem multicomponent reaction methodologies to afford a series of modulators of the heat shock protein 70 (Hsp70) molecular chaperone. The synthesis of libraries based on the structure of MAL3-101 generated a collection of chemotypes, each modulating Hsp70 function, but exhibiting divergent pharmacological activities. For example, probes that compromise the replication of a disease-associated polyomavirus were identified. These projects highlight the importance of chemical methodology development as a source of small-molecule probes and as a drug discovery starting point. PMID:21502524

  18. DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

    DTIC Science & Technology

    2001-05-01

    We are interested in the molecular mechanisms involved in DNA replication arrest by the S phase DNA damage checkpoints. Using in vitro simian virus...40 DNA replication assays, we have found three factors that directly contribute to DNA damage-induced DNA replication arrest: Replication Protein A...trans-acting inhibitors. RPA is the major eukaryotic single-stranded DNA binding protein required for DNA replication , repair and recombination. Upon DNA

  19. Cloning and characterization of a novel stress-responsive WRKY transcription factor gene (MusaWRKY71) from Musa spp. cv. Karibale Monthan (ABB group) using transformed banana cells.

    PubMed

    Shekhawat, Upendra K Singh; Ganapathi, Thumballi R; Srinivas, Lingam

    2011-08-01

    WRKY transcription factor proteins play significant roles in plant stress responses. Here, we report the cloning and characterization of a novel WRKY gene, MusaWRKY71 isolated from an edible banana cultivar Musa spp. Karibale Monthan (ABB group). MusaWRKY71, initially identified using in silico approaches from an abiotic stress-related EST library, was later extended towards the 3' end using rapid amplification of cDNA ends technique. The 1299-bp long cDNA of MusaWRKY71 encodes a protein with 280 amino acids and contains a characteristic WRKY domain in the C-terminal half. Although MusaWRKY71 shares good similarity with other monocot WRKY proteins the substantial size difference makes it a unique member of the WRKY family in higher plants. The 918-bp long 5' proximal region determined using thermal asymmetric interlaced-polymerase chain reaction has many putative cis-acting elements and transcription factor binding motifs. Subcellular localization assay of MusaWRKY71 performed using a GFP-fusion platform confirmed its nuclear targeting in transformed banana suspension cells. Importantly, MusaWRKY71 expression in banana plantlets was up-regulated manifold by cold, dehydration, salt, ABA, H2O2, ethylene, salicylic acid and methyl jasmonate treatment indicating its involvement in response to a variety of stress conditions in banana. Further, transient overexpression of MusaWRKY71 in transformed banana cells led to the induction of several genes, homologues of which have been proven to be involved in diverse stress responses in other important plants. The present study is the first report on characterization of a banana stress-related transcription factor using transformed banana cells.

  20. Whole-genome de novo sequencing reveals unique genes that contributed to the adaptive evolution of the Mikado pheasant.

    PubMed

    Lee, Chien-Yueh; Hsieh, Ping-Han; Chiang, Li-Mei; Chattopadhyay, Amrita; Li, Kuan-Yi; Lee, Yi-Fang; Lu, Tzu-Pin; Lai, Liang-Chuan; Lin, En-Chung; Lee, Hsinyu; Ding, Shih-Torng; Tsai, Mong-Hsun; Chen, Chien-Yu; Chuang, Eric Y

    2018-05-01

    The Mikado pheasant (Syrmaticus mikado) is a nearly endangered species indigenous to high-altitude regions of Taiwan. This pheasant provides an opportunity to investigate evolutionary processes following geographic isolation. Currently, the genetic background and adaptive evolution of the Mikado pheasant remain unclear. We present the draft genome of the Mikado pheasant, which consists of 1.04 Gb of DNA and 15,972 annotated protein-coding genes. The Mikado pheasant displays expansion and positive selection of genes related to features that contribute to its adaptive evolution, such as energy metabolism, oxygen transport, hemoglobin binding, radiation response, immune response, and DNA repair. To investigate the molecular evolution of the major histocompatibility complex (MHC) across several avian species, 39 putative genes spanning 227 kb on a contiguous region were annotated and manually curated. The MHC loci of the pheasant revealed a high level of synteny, several rapidly evolving genes, and inverse regions compared to the same loci in the chicken. The complete mitochondrial genome was also sequenced, assembled, and compared against four long-tailed pheasants. The results from molecular clock analysis suggest that ancestors of the Mikado pheasant migrated from the north to Taiwan about 3.47 million years ago. This study provides a valuable genomic resource for the Mikado pheasant, insights into its adaptation to high altitude, and the evolutionary history of the genus Syrmaticus, which could potentially be useful for future studies that investigate molecular evolution, genomics, ecology, and immunogenetics.

  1. PRP19 transforms into a sensor of RPA-ssDNA after DNA damage and drives ATR activation via a ubiquitin-mediated circuitry.

    PubMed

    Maréchal, Alexandre; Li, Ju-Mei; Ji, Xiao Ye; Wu, Ching-Shyi; Yazinski, Stephanie A; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E; Jin, Jianping; Zou, Lee

    2014-01-23

    PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). Although the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 directly binds RPA and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA-damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ataxia telangiectasia mutated and Rad3-related (ATR) kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, recovery of stalled replication forks, and progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. C/EBPα Expression is Partially Regulated by C/EBPβ in Response to DNA Damage and C/EBPα Deficient Fibroblasts Display an Impaired G1 Checkpoint

    PubMed Central

    Ranjan, Rakesh; Thompson, Elizabeth A.; Yoon, Kyungsil; Smart, Robert C.

    2009-01-01

    We observed that C/EBPα is highly inducible in primary fibroblasts by DNA damaging agents that induce strand breaks, alkylate and crosslink DNA as well as those that produce bulky DNA lesions. Fibroblasts deficient in C/EBPα (C/EBPα-/-) display an impaired G1 checkpoint as evidenced by inappropriate entry into S-phase in response to DNA damage and these cells also display an enhanced G1 to S transition in response to mitogens. The induction of C/EBPα by DNA damage in fibroblasts does not require p53. EMSA analysis of nuclear extracts prepared from UVB- and MNNG-treated fibroblasts revealed increased binding of C/EBPβ to a C/EBP consensus sequence and ChIP analysis revealed increased C/EBPβ binding to the C/EBPα promoter. To determine whether C/EBPβ has a role in the regulation of C/EBPα we treated C/EBPβ-/- fibroblasts with UVB or MNNG. We observed C/EBPα induction was impaired in both UVB- and MNNG- treated C/EBPβ-/- fibroblasts. Our study reveals a novel role for C/EBPβ in the regulation of C/EBPα in response to DNA damage and provides definitive genetic evidence that C/EBPα has a critical role in the DNA damage G1 checkpoint. PMID:19581927

  3. Chk1 Promotes DNA Damage Response Bypass following Oxidative Stress in a Model of Hydrogen Peroxide-Associated Ulcerative Colitis through JNK Inactivation and Chromatin Binding.

    PubMed

    Reissig, Kathrin; Silver, Andrew; Hartig, Roland; Schinlauer, Antje; Walluscheck, Diana; Guenther, Thomas; Siedentopf, Sandra; Ross, Jochen; Vo, Diep-Khanh; Roessner, Albert; Poehlmann-Nitsche, Angela

    2017-01-01

    Dysregulation of c-Jun N -terminal kinase (JNK) activation promoted DNA damage response bypass and tumorigenesis in our model of hydrogen peroxide-associated ulcerative colitis (UC) and in patients with quiescent UC (QUC), UC-related dysplasia, and UC-related carcinoma (UC-CRC), thereby adapting to oxidative stress. In the UC model, we have observed features of oncogenic transformation: increased proliferation, undetected DNA damage, and apoptosis resistance. Here, we show that Chk1 was downregulated but activated in the acute and quiescent chronic phases. In both phases, Chk1 was linked to DNA damage response bypass by suppressing JNK activation following oxidative stress, promoting cell cycle progression despite DNA damage. Simultaneously, activated Chk1 was bound to chromatin. This triggered histone acetylation and the binding of histone acetyltransferases and transcription factors to chromatin. Thus, chromatin-immobilized activated Chk1 executed a dual function by suppressing DNA damage response and simultaneously inducing chromatin modulation. This caused undetected DNA damage and increased cellular proliferation through failure to transmit the appropriate DNA damage signal. Findings in vitro were corroborated by chromatin accumulation of activated Chk1, Ac-H3, Ac-H4, and c-Jun in active UC (AUC) in vivo. Targeting chromatin-bound Chk1, GCN5, PCAF, and p300/CBP could be a novel therapeutic strategy to prevent UC-related tumor progression.

  4. Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

    PubMed

    Wang, Yaru; Ma, Na; Wang, Yan; Chen, Guangju

    2012-01-01

    It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR) for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD) dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

  5. Putative Prostate Cancer Risk SNP in an Androgen Receptor‐Binding Site of the Melanophilin Gene Illustrates Enrichment of Risk SNPs in Androgen Receptor Target Sites

    PubMed Central

    Bu, Huajie; Narisu, Narisu; Schlick, Bettina; Rainer, Johannes; Manke, Thomas; Schäfer, Georg; Pasqualini, Lorenza; Chines, Peter; Schweiger, Michal R.; Fuchsberger, Christian

    2015-01-01

    ABSTRACT Genome‐wide association studies have identified genomic loci, whose single‐nucleotide polymorphisms (SNPs) predispose to prostate cancer (PCa). However, the mechanisms of most of these variants are largely unknown. We integrated chromatin‐immunoprecipitation‐coupled sequencing and microarray expression profiling in TMPRSS2‐ERG gene rearrangement positive DUCaP cells with the GWAS PCa risk SNPs catalog to identify disease susceptibility SNPs localized within functional androgen receptor‐binding sites (ARBSs). Among the 48 GWAS index risk SNPs and 3,917 linked SNPs, 80 were found located in ARBSs. Of these, rs11891426:T>G in an intron of the melanophilin gene (MLPH) was within a novel putative auxiliary AR‐binding motif, which is enriched in the neighborhood of canonical androgen‐responsive elements. T→G exchange attenuated the transcriptional activity of the ARBS in an AR reporter gene assay. The expression of MLPH in primary prostate tumors was significantly lower in those with the G compared with the T allele and correlated significantly with AR protein. Higher melanophilin level in prostate tissue of patients with a favorable PCa risk profile points out a tumor‐suppressive effect. These results unravel a hidden link between AR and a functional putative PCa risk SNP, whose allele alteration affects androgen regulation of its host gene MLPH. PMID:26411452

  6. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

    2016-01-01

    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  7. Molecular Insights into the Impact of Oxidative Stress on the Quorum-Sensing Regulator Protein LasR*

    PubMed Central

    Kafle, Prapti; Amoh, Amanda N.; Reaves, Jocelyn M.; Suneby, Emma G.; Tutunjian, Kathryn A.; Tyson, Reed L.; Schneider, Tanya L.

    2016-01-01

    The LasR regulator protein functions at the top of the Pseudomonas aeruginosa quorum-sensing hierarchy and is implicated in promoting bacterial virulence. Of note is recent evidence that this transcription factor may also respond to oxidative stress. Here, all cysteines in LasR were inspected to deduce their redox sensitivity and to probe the connection between stress response and LasR activity using purified LasR and individual LasR domains. Cys79 in the ligand binding domain of LasR appears to be important for ligand recognition and folding of this domain to potentiate DNA binding but does not seem to be sensitive to oxidative stress when bound to its native ligand. Two cysteines in the DNA binding domain of LasR do form a disulfide bond when treated with hydrogen peroxide, and formation of this Cys201-Cys203 disulfide bond appears to disrupt the DNA binding activity of the transcription factor. Mutagenesis of either of these cysteines leads to expression of a protein that no longer binds DNA. A cell-based reporter assay linking LasR function with β-galactosidase activity gave results consistent with those obtained with purified LasR. This work provides a possible mechanism for oxidative stress response by LasR and indicates that multiple cysteines within the protein may prove to be useful targets for disabling its activity. PMID:27053110

  8. Search for Partner Proteins of A. thaliana Immunophilins Involved in the Control of Plant Immunity.

    PubMed

    Abdeeva, Inna A; Pogorelko, Gennady V; Maloshenok, Liliya G; Mokrykova, Maria V; Fursova, Oksana V; Bruskin, Sergey A

    2018-04-19

    The involvement of plant immunophilins in multiple essential processes such as development, various ways of adapting to biotic and abiotic stresses, and photosynthesis has already been established. Previously, research has demonstrated the involvement of three immunophilin genes ( AtCYP19-1/ROC3 , AtFKBP65/ROF2 , and AtCYP57 ) in the control of plant response to invasion by various pathogens. Current research attempts to identify host target proteins for each of the selected immunophilins. As a result, candidate interactors have been determined and confirmed using a yeast 2-hybrid (Y2H) system for protein⁻protein interaction assays. The generation of mutant isoforms of ROC3 and AtCYP57 harboring substituted amino acids in the in silico-predicted active sites became essential to achieving significant binding to its target partners. This data shows that ROF2 targets calcium-dependent lipid-binding domain-containing protein (At1g70790; AT1) and putative protein phosphatase (At2g30020; АТ2), whereas ROC3 interacts with GTP-binding protein (At1g30580; ENGD-1) and RmlC-like cupin (At5g39120). The immunophilin AtCYP57 binds to putative pyruvate decarboxylase-1 (Pdc1) and clathrin adaptor complex-related protein (At5g05010). Identified interactors confirm our previous findings that immunophilins ROC3 , ROF2 , and AtCYP57 are directly involved with stress response control. Further, these findings extend our understanding of the molecular functional pathways of these immunophilins.

  9. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

    PubMed Central

    Glinsky, Gennadi V.

    2015-01-01

    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions such as cancer, diseases of cardiovascular and reproductive systems, metabolic diseases, multiple neurological and psychological disorders. A proximity placement model is proposed explaining how a 33–47% excess of NANOG, CTCF, and POU5F1 proteins immobilized on a DNA scaffold may play a functional role at distal regulatory elements. PMID:25956794

  10. NOTCH1 Inhibits Activation of ATM by Impairing the Formation of an ATM-FOXO3a-KAT5/Tip60 Complex.

    PubMed

    Adamowicz, Marek; Vermezovic, Jelena; d'Adda di Fagagna, Fabrizio

    2016-08-23

    The DNA damage response (DDR) signal transduction pathway is responsible for sensing DNA damage and further relaying this signal into the cell. ATM is an apical DDR kinase that orchestrates the activation and the recruitment of downstream DDR factors to induce cell-cycle arrest and repair. We have previously shown that NOTCH1 inhibits ATM activation upon DNA damage, but the underlying mechanism remains unclear. Here, we show that NOTCH1 does not impair ATM recruitment to DNA double-strand breaks (DSBs). Rather, NOTCH1 prevents binding of FOXO3a and KAT5/Tip60 to ATM through a mechanism in which NOTCH1 competes with FOXO3a for ATM binding. Lack of FOXO3a binding to ATM leads to the loss of KAT5/Tip60 association with ATM. Moreover, expression of NOTCH1 or depletion of ATM impairs the formation of the FOXO3a-KAT5/Tip60 protein complex. Finally, we show that pharmacological induction of FOXO3a nuclear localization sensitizes NOTCH1-driven cancers to DNA-damage-induced cell death. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Analysis of URI nuclear interaction with RPB5 and components of the R2TP/prefoldin-like complex.

    PubMed

    Mita, Paolo; Savas, Jeffrey N; Ha, Susan; Djouder, Nabil; Yates, John R; Logan, Susan K

    2013-01-01

    Unconventional prefoldin RPB5 Interactor (URI) was identified as a transcriptional repressor that binds RNA polymerase II (pol II) through interaction with the RPB5/POLR2E subunit. Despite the fact that many other proteins involved in transcription regulation have been shown to interact with URI, its nuclear function still remains elusive. Previous mass spectrometry analyses reported that URI is part of a novel protein complex called R2TP/prefoldin-like complex responsible for the cytoplasmic assembly of RNA polymerase II. We performed a mass spectrometry (MS)-based proteomic analysis to identify nuclear proteins interacting with URI in prostate cells. We identified all the components of the R2TP/prefoldin-like complex as nuclear URI interactors and we showed that URI binds and regulates RPB5 protein stability and transcription. Moreover, we validated the interaction of URI to the P53 and DNA damage-Regulated Gene 1 (PDRG1) and show that PDRG1 protein is also stabilized by URI binding. We present data demonstrating that URI nuclear/cytoplasmic shuttling is affected by compounds that stall pol II on the DNA (α-amanitin and actinomycin-D) and by leptomycin B, an inhibitor of the CRM1 exportin that mediates the nuclear export of pol II subunits. These data suggest that URI, and probably the entire R2TP/prefoldin-like complex is exported from the nucleus through CRM1. Finally we identified putative URI sites of phosphorylation and acetylation and confirmed URI sites of post-transcriptional modification identified in previous large-scale analyses the importance of which is largely unknown. However URI post-transcriptional modification was shown to be essential for URI function and therefore characterization of novel sites of URI modification will be important to the understanding of URI function.

  12. Analysis of URI Nuclear Interaction with RPB5 and Components of the R2TP/Prefoldin-Like Complex

    PubMed Central

    Mita, Paolo; Savas, Jeffrey N.; Ha, Susan; Djouder, Nabil; Yates, John R.; Logan, Susan K.

    2013-01-01

    Unconventional prefoldin RPB5 Interactor (URI) was identified as a transcriptional repressor that binds RNA polymerase II (pol II) through interaction with the RPB5/POLR2E subunit. Despite the fact that many other proteins involved in transcription regulation have been shown to interact with URI, its nuclear function still remains elusive. Previous mass spectrometry analyses reported that URI is part of a novel protein complex called R2TP/prefoldin-like complex responsible for the cytoplasmic assembly of RNA polymerase II. We performed a mass spectrometry (MS)-based proteomic analysis to identify nuclear proteins interacting with URI in prostate cells. We identified all the components of the R2TP/prefoldin-like complex as nuclear URI interactors and we showed that URI binds and regulates RPB5 protein stability and transcription. Moreover, we validated the interaction of URI to the P53 and DNA damage-Regulated Gene 1 (PDRG1) and show that PDRG1 protein is also stabilized by URI binding. We present data demonstrating that URI nuclear/cytoplasmic shuttling is affected by compounds that stall pol II on the DNA (α-amanitin and actinomycin-D) and by leptomycin B, an inhibitor of the CRM1 exportin that mediates the nuclear export of pol II subunits. These data suggest that URI, and probably the entire R2TP/prefoldin-like complex is exported from the nucleus through CRM1. Finally we identified putative URI sites of phosphorylation and acetylation and confirmed URI sites of post-transcriptional modification identified in previous large-scale analyses the importance of which is largely unknown. However URI post-transcriptional modification was shown to be essential for URI function and therefore characterization of novel sites of URI modification will be important to the understanding of URI function. PMID:23667685

  13. Structural and Thermodynamic Consequences of the Replacement of Zinc with Environmental Metals on ERα-DNA Interactions

    PubMed Central

    Deegan, Brian J.; Bona, Anna M.; Bhat, Vikas; Mikles, David C.; McDonald, Caleb B.; Seldeen, Kenneth L.; Farooq, Amjad

    2011-01-01

    Estrogen receptor α (ERα) acts as a transcription factor by virtue of the ability of its DNA-binding (DB) domain, comprised of a tandem pair of zinc fingers, to recognize the estrogen response element (ERE) within the promoters of target genes. Herein, using an array of biophysical methods, we probe structural consequences of the replacement of zinc within the DB domain of ERα with various environmental metals and their effects on the thermodynamics of binding to DNA. Our data reveal that while the DB domain reconstituted with divalent ions of zinc, cadmium, mercury and cobalt binds to DNA with affinities in the nanomolar range, divalent ions of barium, copper, iron, lead, manganese, nickel and tin are unable to regenerate DB domain with DNA-binding potential though they can compete with zinc for coordinating the cysteine ligands within the zinc fingers. We also show that the metal-free DB domain is a homodimer in solution and that the binding of various metals only results in subtle secondary and tertiary structural changes, implying that metal-coordination may only be essential for DNA-binding. Collectively, our findings provide mechanistic insights into how environmental metals may modulate the physiological function of a key nuclear receptor involved in mediating a plethora of cellular functions central to human health and disease. PMID:22038807

  14. Non-equilibrium repressor binding kinetics link DNA damage dose to transcriptional timing within the SOS gene network.

    PubMed

    Culyba, Matthew J; Kubiak, Jeffrey M; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2018-06-01

    Biochemical pathways are often genetically encoded as simple transcription regulation networks, where one transcription factor regulates the expression of multiple genes in a pathway. The relative timing of each promoter's activation and shut-off within the network can impact physiology. In the DNA damage repair pathway (known as the SOS response) of Escherichia coli, approximately 40 genes are regulated by the LexA repressor. After a DNA damaging event, LexA degradation triggers SOS gene transcription, which is temporally separated into subsets of 'early', 'middle', and 'late' genes. Although this feature plays an important role in regulating the SOS response, both the range of this separation and its underlying mechanism are not experimentally defined. Here we show that, at low doses of DNA damage, the timing of promoter activities is not separated. Instead, timing differences only emerge at higher levels of DNA damage and increase as a function of DNA damage dose. To understand mechanism, we derived a series of synthetic SOS gene promoters which vary in LexA-operator binding kinetics, but are otherwise identical, and then studied their activity over a large dose-range of DNA damage. In distinction to established models based on rapid equilibrium assumptions, the data best fit a kinetic model of repressor occupancy at promoters, where the drop in cellular LexA levels associated with higher doses of DNA damage leads to non-equilibrium binding kinetics of LexA at operators. Operators with slow LexA binding kinetics achieve their minimal occupancy state at later times than operators with fast binding kinetics, resulting in a time separation of peak promoter activity between genes. These data provide insight into this remarkable feature of the SOS pathway by demonstrating how a single transcription factor can be employed to control the relative timing of each gene's transcription as a function of stimulus dose.

  15. Alternative Use of DNA Binding Domains by the Neurospora White Collar Complex Dictates Circadian Regulation and Light Responses

    PubMed Central

    Wang, Bin; Zhou, Xiaoying; Loros, Jennifer J.

    2015-01-01

    In the Neurospora circadian system, the White Collar complex (WCC) of WC-1 and WC-2 drives transcription of the circadian pacemaker gene frequency (frq), whose gene product, FRQ, as a part of the FRQ-FRH complex (FFC), inhibits its own expression. The WCC is also the principal Neurospora photoreceptor; WCC-mediated light induction of frq resets the clock, and all acute light induction is triggered by WCC binding to promoters of light-induced genes. However, not all acutely light-induced genes are also clock regulated, and conversely, not all clock-regulated direct targets of WCC are light induced; the structural determinants governing the shift from WCC's dark circadian role to its light activation role are poorly described. We report that the DBD region (named for being defective in binding DNA), a basic region in WC-1 proximal to the DNA-binding zinc finger (ZnF) whose function was previously ascribed to nuclear localization, instead plays multiple essential roles assisting in DNA binding and mediating interactions with the FFC. DNA binding for light induction by the WCC requires only WC-2, whereas DNA binding for circadian functions requires WC-2 as well as the ZnF and DBD motif of WC-1. The data suggest a means by which alterations in the tertiary and quaternary structures of the WCC can lead to its distinct functions in the dark and in the light. PMID:26711258

  16. Cross-talk between the ligand- and DNA-binding domains of estrogen receptor.

    PubMed

    Huang, Wei; Greene, Geoffrey L; Ravikumar, Krishnakumar M; Yang, Sichun

    2013-11-01

    Estrogen receptor alpha (ERα) is a hormone-responsive transcription factor that contains several discrete functional domains, including a ligand-binding domain (LBD) and a DNA-binding domain (DBD). Despite a wealth of knowledge about the behaviors of individual domains, the molecular mechanisms of cross-talk between LBD and DBD during signal transduction from hormone to DNA-binding of ERα remain elusive. Here, we apply a multiscale approach combining coarse-grained (CG) and atomistically detailed simulations to characterize this cross-talk mechanism via an investigation of the ERα conformational landscape. First, a CG model of ERα is built based on crystal structures of individual LBDs and DBDs, with more emphasis on their interdomain interactions. Second, molecular dynamics simulations are implemented and enhanced sampling is achieved via the "push-pull-release" strategy in the search for different LBD-DBD orientations. Third, multiple energetically stable ERα conformations are identified on the landscape. A key finding is that estradiol-bound LBDs utilize the well-described activation helix H12 to pack and stabilize LBD-DBD interactions. Our results suggest that the estradiol-bound LBDs can serve as a scaffold to position and stabilize the DBD-DNA complex, consistent with experimental observations of enhanced DNA binding with the LBD. Final assessment using atomic-level simulations shows that these CG-predicted models are significantly stable within a 15-ns simulation window and that specific pairs of lysine residues in close proximity at the domain interfaces could serve as candidate sites for chemical cross-linking studies. Together, these simulation results provide a molecular view of the role of ERα domain interactions in response to hormone binding. Copyright © 2013 Wiley Periodicals, Inc.

  17. Effect of DNA Binding on Geminate CO Recombination Kinetics in CO-sensing Transcription Factor CooA*

    PubMed Central

    Benabbas, Abdelkrim; Karunakaran, Venugopal; Youn, Hwan; Poulos, Thomas L.; Champion, Paul M.

    2012-01-01

    Carbon monoxide oxidation activator (CooA) proteins are heme-based CO-sensing transcription factors. Here we study the ultrafast dynamics of geminate CO rebinding in two CooA homologues, Rhodospirillum rubrum (RrCooA) and Carboxydothermus hydrogenoformans (ChCooA). The effects of DNA binding and the truncation of the DNA-binding domain on the CO geminate recombination kinetics were specifically investigated. The CO rebinding kinetics in these CooA complexes take place on ultrafast time scales but remain non-exponential over many decades in time. We show that this non-exponential kinetic response is due to a quenched enthalpic barrier distribution resulting from a distribution of heme geometries that is frozen or slowly evolving on the time scale of CO rebinding. We also show that, upon CO binding, the distal pocket of the heme in the CooA proteins relaxes to form a very efficient hydrophobic trap for CO. DNA binding further tightens the narrow distal pocket and slightly weakens the iron-proximal histidine bond. Comparison of the CO rebinding kinetics of RrCooA, truncated RrCooA, and DNA-bound RrCooA proteins reveals that the uncomplexed and inherently flexible DNA-binding domain adds additional structural heterogeneity to the heme doming coordinate. When CooA forms a complex with DNA, the flexibility of the DNA-binding domain decreases, and the distribution of the conformations available in the heme domain becomes restricted. The kinetic studies also offer insights into how the architecture of the heme environment can tune entropic barriers in order to control the geminate recombination of CO in heme proteins, whereas spin selection rules play a minor or non-existent role. PMID:22544803

  18. Effect of DNA binding on geminate CO recombination kinetics in CO-sensing transcription factor CooA.

    PubMed

    Benabbas, Abdelkrim; Karunakaran, Venugopal; Youn, Hwan; Poulos, Thomas L; Champion, Paul M

    2012-06-22

    Carbon monoxide oxidation activator (CooA) proteins are heme-based CO-sensing transcription factors. Here we study the ultrafast dynamics of geminate CO rebinding in two CooA homologues, Rhodospirillum rubrum (RrCooA) and Carboxydothermus hydrogenoformans (ChCooA). The effects of DNA binding and the truncation of the DNA-binding domain on the CO geminate recombination kinetics were specifically investigated. The CO rebinding kinetics in these CooA complexes take place on ultrafast time scales but remain non-exponential over many decades in time. We show that this non-exponential kinetic response is due to a quenched enthalpic barrier distribution resulting from a distribution of heme geometries that is frozen or slowly evolving on the time scale of CO rebinding. We also show that, upon CO binding, the distal pocket of the heme in the CooA proteins relaxes to form a very efficient hydrophobic trap for CO. DNA binding further tightens the narrow distal pocket and slightly weakens the iron-proximal histidine bond. Comparison of the CO rebinding kinetics of RrCooA, truncated RrCooA, and DNA-bound RrCooA proteins reveals that the uncomplexed and inherently flexible DNA-binding domain adds additional structural heterogeneity to the heme doming coordinate. When CooA forms a complex with DNA, the flexibility of the DNA-binding domain decreases, and the distribution of the conformations available in the heme domain becomes restricted. The kinetic studies also offer insights into how the architecture of the heme environment can tune entropic barriers in order to control the geminate recombination of CO in heme proteins, whereas spin selection rules play a minor or non-existent role.

  19. Concentration-Dependent Exchange of Replication Protein A on Single-Stranded DNA Revealed by Single-Molecule Imaging

    PubMed Central

    Gibb, Bryan; Ye, Ling F.; Gergoudis, Stephanie C.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein necessary for all aspects of DNA metabolism involving an ssDNA intermediate, including DNA replication, repair, recombination, DNA damage response and checkpoint activation, and telomere maintenance [1], [2], [3]. The role of RPA in most of these reactions is to protect the ssDNA until it can be delivered to downstream enzymes. Therefore a crucial feature of RPA is that it must bind very tightly to ssDNA, but must also be easily displaced from ssDNA to allow other proteins to gain access to the substrate. Here we use total internal reflection fluorescence microscopy and nanofabricated DNA curtains to visualize the behavior of Saccharomyces cerevisiae RPA on individual strands of ssDNA in real-time. Our results show that RPA remains bound to ssDNA for long periods of time when free protein is absent from solution. In contrast, RPA rapidly dissociates from ssDNA when free RPA is present in solution allowing rapid exchange between the free and bound states. In addition, the S. cerevisiae DNA recombinase Rad51 and E. coli single-stranded binding protein (SSB) also promote removal of RPA from ssDNA. These results reveal an unanticipated exchange between bound and free RPA suggesting a binding mechanism that can confer exceptionally slow off rates, yet also enables rapid displacement through a direct exchange mechanism that is reliant upon the presence of free ssDNA-binding proteins in solution. Our results indicate that RPA undergoes constant microscopic dissociation under all conditions, but this is only manifested as macroscopic dissociation (i.e. exchange) when free proteins are present in solution, and this effect is due to mass action. We propose that the dissociation of RPA from ssDNA involves a partially dissociated intermediate, which exposes a small section of ssDNA allowing other proteins to access to the DNA. PMID:24498402

  20. CisMiner: Genome-Wide In-Silico Cis-Regulatory Module Prediction by Fuzzy Itemset Mining

    PubMed Central

    Navarro, Carmen; Lopez, Francisco J.; Cano, Carlos; Garcia-Alcalde, Fernando; Blanco, Armando

    2014-01-01

    Eukaryotic gene control regions are known to be spread throughout non-coding DNA sequences which may appear distant from the gene promoter. Transcription factors are proteins that coordinately bind to these regions at transcription factor binding sites to regulate gene expression. Several tools allow to detect significant co-occurrences of closely located binding sites (cis-regulatory modules, CRMs). However, these tools present at least one of the following limitations: 1) scope limited to promoter or conserved regions of the genome; 2) do not allow to identify combinations involving more than two motifs; 3) require prior information about target motifs. In this work we present CisMiner, a novel methodology to detect putative CRMs by means of a fuzzy itemset mining approach able to operate at genome-wide scale. CisMiner allows to perform a blind search of CRMs without any prior information about target CRMs nor limitation in the number of motifs. CisMiner tackles the combinatorial complexity of genome-wide cis-regulatory module extraction using a natural representation of motif combinations as itemsets and applying the Top-Down Fuzzy Frequent- Pattern Tree algorithm to identify significant itemsets. Fuzzy technology allows CisMiner to better handle the imprecision and noise inherent to regulatory processes. Results obtained for a set of well-known binding sites in the S. cerevisiae genome show that our method yields highly reliable predictions. Furthermore, CisMiner was also applied to putative in-silico predicted transcription factor binding sites to identify significant combinations in S. cerevisiae and D. melanogaster, proving that our approach can be further applied genome-wide to more complex genomes. CisMiner is freely accesible at: http://genome2.ugr.es/cisminer. CisMiner can be queried for the results presented in this work and can also perform a customized cis-regulatory module prediction on a query set of transcription factor binding sites provided by the user. PMID:25268582

  1. Rice phytochrome-interacting factor protein OsPIF14 represses OsDREB1B gene expression through an extended N-box and interacts preferentially with the active form of phytochrome B

    DOE PAGES

    Cordeiro, André M.; Figueiredo, Duarte D.; Tepperman, James; ...

    2015-12-28

    DREB1/CBF genes, known as major regulators of plant stress responses, are rapidly and transiently induced by low temperatures. Using a yeast one-hybrid screening, we identified a putative Phytochrome-Interacting bHLH Factor (OsPIF14), as binding to the OsDREB1B promoter. bHLH proteins are able to bind to hexameric E-box (CANNTG) or N-box (CACG(A/C)G) motifs, depending on transcriptional activity. We have shown that OsPIF14 binds to the OsDREB1B promoter through two N-boxes and that the flanking regions of the hexameric core are essential for protein–DNA interaction and stability. We also showed that OsPIF14 down-regulates OsDREB1B gene expression in rice protoplasts, corroborating the OsPIF14 repressormore » activity observed in the transactivation assays using Arabidopsis protoplasts. Additionally, we showed that OsPIF14 is indeed a phytochrome interacting factor, which preferentially binds to the active form (Pfr) of rice phytochrome B. This raises the possibility that OsPIF14 activity might be modulated by light. However, we did not observe any regulation of the OsDREB1B gene expression by light under control conditions. Moreover, OsPIF14 gene expression was shown to be modulated by different treatments, such as drought, salt, cold and ABA. Interestingly, OsPIF14 showed also a specific cold-induced alternative splicing. Our results suggest the possibility that OsPIF14 is involved in cross-talk between light and stress signaling through interaction with the OsDREB1B promoter. Finally, although in the absence of stress, OsDREB1B gene expression was not regulated by light, given previous reports, it remains possible that OsPIF14 has a role in light modulation of stress responses.« less

  2. Rice phytochrome-interacting factor protein OsPIF14 represses OsDREB1B gene expression through an extended N-box and interacts preferentially with the active form of Phytochrome B

    PubMed Central

    Cordeiro, André M.; Figueiredo, Duarte D.; Tepperman, James; Borba, Ana Rita; Lourenço, Tiago; Abreu, Isabel A.; Ouwerkerk, Pieter B.F.; Quail, Peter H.; Oliveira, M. Margarida; Saibo, Nelson J. M.

    2016-01-01

    DREB1/CBF genes, known as major regulators of plant stress responses, are rapidly and transiently induced by low temperatures. Using a Yeast one Hybrid screening, we identified a putative Phytochrome-Interacting bHLH Factor (OsPIF14), as binding to the OsDREB1B promoter. bHLH proteins are able to bind to hexameric E-box (CANNTG) or N-box (CACG(A/C)G) motifs, depending on transcriptional activity. We have shown that OsPIF14 binds to the OsDREB1B promoter through two N-boxes and that the flanking regions of the hexameric core are essential for protein-DNA interaction and stability. We also showed that OsPIF14 down-regulates OsDREB1B gene expression in rice protoplasts, corroborating the OsPIF14 repressor activity observed in the transactivation assays using Arabidopsis protoplasts. In addition, we showed that OsPIF14 is indeed a Phytochrome Interacting Factor, which preferentially binds to the active form (Pfr) of rice phytochrome B. This raises the possibility that OsPIF14 activity might be modulated by light. However, we did not observe any regulation of the OsDREB1B gene expression by light under control conditions. Moreover, OsPIF14 gene expression was shown to be modulated by different treatments, such as drought, salt, cold and ABA. Interestingly, OsPIF14 showed also a specific cold-induced alternative splicing. All together, these results suggest the possibility that OsPIF14 is involved in cross-talk between light and stress signaling through interaction with the OsDREB1B promoter. Although in the absence of stress, OsDREB1B gene expression was not regulated by light, given previous reports, it remains possible that OsPIF14 has a role in light modulation of stress responses. PMID:26732823

  3. High-Molecular-Mass Multi-c-Heme Cytochromes from Methylococcus capsulatus Bath†

    PubMed Central

    Bergmann, David J.; Zahn, James A.; DiSpirito, Alan A.

    1999-01-01

    The polypeptide and structural gene for a high-molecular-mass c-type cytochrome, cytochrome c553O, was isolated from the methanotroph Methylococcus capsulatus Bath. Cytochrome c553O is a homodimer with a subunit molecular mass of 124,350 Da and an isoelectric point of 6.0. The heme c concentration was estimated to be 8.2 ± 0.4 mol of heme c per subunit. The electron paramagnetic resonance spectrum showed the presence of multiple low spin, S = 1/2, hemes. A degenerate oligonucleotide probe synthesized based on the N-terminal amino acid sequence of cytochrome c553O was used to identify a DNA fragment from M. capsulatus Bath that contains occ, the gene encoding cytochrome c553O. occ is part of a gene cluster which contains three other open reading frames (ORFs). ORF1 encodes a putative periplasmic c-type cytochrome with a molecular mass of 118,620 Da that shows approximately 40% amino acid sequence identity with occ and contains nine c-heme-binding motifs. ORF3 encodes a putative periplasmic c-type cytochrome with a molecular mass of 94,000 Da and contains seven c-heme-binding motifs but shows no sequence homology to occ or ORF1. ORF4 encodes a putative 11,100-Da protein. The four ORFs have no apparent similarity to any proteins in the GenBank database. The subunit molecular masses, arrangement and number of hemes, and amino acid sequences demonstrate that cytochrome c553O and the gene products of ORF1 and ORF3 constitute a new class of c-type cytochrome. PMID:9922265

  4. Massive gene transfer and extensive RNA editing of a symbiotic dinoflagellate plastid genome.

    PubMed

    Mungpakdee, Sutada; Shinzato, Chuya; Takeuchi, Takeshi; Kawashima, Takeshi; Koyanagi, Ryo; Hisata, Kanako; Tanaka, Makiko; Goto, Hiroki; Fujie, Manabu; Lin, Senjie; Satoh, Nori; Shoguchi, Eiichi

    2014-05-31

    Genome sequencing of Symbiodinium minutum revealed that 95 of 109 plastid-associated genes have been transferred to the nuclear genome and subsequently expanded by gene duplication. Only 14 genes remain in plastids and occur as DNA minicircles. Each minicircle (1.8-3.3 kb) contains one gene and a conserved noncoding region containing putative promoters and RNA-binding sites. Nine types of RNA editing, including a novel G/U type, were discovered in minicircle transcripts but not in genes transferred to the nucleus. In contrast to DNA editing sites in dinoflagellate mitochondria, which tend to be highly conserved across all taxa, editing sites employed in DNA minicircles are highly variable from species to species. Editing is crucial for core photosystem protein function. It restores evolutionarily conserved amino acids and increases peptidyl hydropathy. It also increases protein plasticity necessary to initiate photosystem complex assembly. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    NASA Technical Reports Server (NTRS)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  6. In vitro selection of shape-changing DNA nanostructures capable of binding-induced cargo release.

    PubMed

    Oh, Seung Soo; Plakos, Kory; Xiao, Yi; Eisenstein, Michael; Soh, H Tom

    2013-11-26

    Many biological systems employ allosteric regulatory mechanisms, which offer a powerful means of directly linking a specific binding event to a wide spectrum of molecular functionalities. There is considerable interest in generating synthetic allosteric regulators that can perform useful molecular functions for applications in diagnostics, imaging and targeted therapies, but generating such molecules through either rational design or directed evolution has proven exceptionally challenging. To address this need, we present an in vitro selection strategy for generating conformation-switching DNA nanostructures that selectively release a small-molecule payload in response to binding of a specific trigger molecule. As an exemplar, we have generated a DNA nanostructure that hybridizes with a separate 'cargo strand' containing an abasic site. This abasic site stably sequesters a fluorescent cargo molecule in an inactive state until the DNA nanostructure encounters an ATP trigger molecule. This ATP trigger causes the nanostructure to release the cargo strand, thereby liberating the fluorescent payload and generating a detectable fluorescent readout. Our DNA nanostructure is highly sensitive, with an EC50 of 30 μM, and highly specific, releasing its payload in response to ATP but not to other chemically similar nucleotide triphosphates. We believe that this selection approach could be generalized to generate synthetic nanostructures capable of selective and controlled release of other small-molecule cargos in response to a variety of triggers, for both research and clinical applications.

  7. Characterization of two mosquito STATs, AaSTAT and CtSTAT. Differential regulation of tyrosine phosphorylation and DNA binding activity by lipopolysaccharide treatment and by Japanese encephalitis virus infection.

    PubMed

    Lin, Chang-Chi; Chou, Chih-Ming; Hsu, Ya-Li; Lien, Jih-Ching; Wang, Yu-Ming; Chen, Shui-Tsung; Tsai, Shu-Chuan; Hsiao, Pei-Wen; Huang, Chang-Jen

    2004-01-30

    Two mosquito STATs, AaSTAT and CtSTAT, have been cloned from Aedes albopictus and Culex tritaeniorhynchus mosquitoes, respectively. These two STATs are more similar to those of Drosophila, Anopheles, and mammalian STAT5 in the DNA binding and Src homology 2 domains. The mRNA transcripts are expressed at all developmental stages, and the proteins are present predominantly at the pupal and adult stages in both mosquitoes. Stimulation with lipopolysaccharide resulted in an increase of tyrosine phosphorylation and DNA binding activity of AaSTAT and CtSTAT as well as an increase of luciferase activity of a reporter gene containing Drosophila STAT binding motif in mosquito C6/36 cells. After being infected with Japanese encephalitis virus, nuclear extracts of C6/36 cells revealed a decrease of tyrosine phosphorylation and DNA binding activity of AaSTAT which could be restored by sodium orthovanadate treatment. Taking all of the data together, this is the first report to clone and characterize two mosquito STATs with 81% identity and to demonstrate a different response of tyrosine phosphorylation and DNA binding of these two STATs by lipopolysaccharide treatment and by Japanese encephalitis virus infection.

  8. Regulation of SNM1, an inducible Saccharomyces cerevisiae gene required for repair of DNA cross-links.

    PubMed

    Wolter, R; Siede, W; Brendel, M

    1996-02-05

    The interstrand cross-link repair gene SNM1 of Saccharomyces cerevisiae was examined for regulation in response to DNA-damaging agents. Induction of SNM1-lacZ fusions was detected in response to nitrogen mustard, cis-platinum (II) diamine dichloride, UV light, and 8-methoxypsoralen + UVA, but not after heat-shock treatment or incubation with 2-dimethylaminoethylchloride, methylmethane sulfonate or 4-nitroquinoline-N-oxide. The promoter of SNM1 contains a 15 bp motif, which shows homology to the DRE2 box of the RAD2 promoter. Similar motifs have been found in promoter regions of other damage-inducible DNA repair genes. Deletion of this motif results in loss of inducibility of SNM1. Also, a putative negative upstream regulation sequence was found to be responsible for repression of constitutive transcription of SNM1. Surprisingly, no inducibility of SNM1 was found after treatment with DNA-damaging agents in strains without an intact DUN1 gene, while regulation seems unchanged in sad1 mutants.

  9. Putative melatonin receptors in a human biological clock

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reppert, S.M.; Weaver, D.R.; Rivkees, S.A.

    In vitro autoradiography with /sup 125/I-labeled melatonin was used to examine melatonin binding sites in human hypothalamus. Specific /sup 125/I-labeled melatonin binding was localized to the suprachiasmatic nuclei, the site of a putative biological clock, and was not apparent in other hypothalamic regions. Specific /sup 125/I-labeled melatonin binding was consistently found in the suprachiasmatic nuclei of hypothalami from adults and fetuses. Densitometric analysis of competition experiments with varying concentrations of melatonin showed monophasic competition curves, with comparable half-maximal inhibition values for the suprachiasmatic nuclei of adults (150 picomolar) and fetuses (110 picomolar). Micromolar concentrations of the melatonin agonist 6-chloromelatonin completelymore » inhibited specific /sup 125/I-labeled melatonin binding, whereas the same concentrations of serotonin and norepinephrine caused only a partial reduction in specific binding. The results suggest that putative melatonin receptors are located in a human biological clock.« less

  10. The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development.

    PubMed

    Hou, Hongmin; Yan, Xiaoxiao; Sha, Ting; Yan, Qin; Wang, Xiping

    2017-07-13

    Flowering occurs in angiosperms during a major developmental transition from vegetative growth to the reproductive phase. Squamosa promoter binding protein (SBP)-box genes have been found to play critical roles in regulating flower and fruit development, but their roles in grapevine have remained unclear. To better understand the functions of the grape SBP-box genes in both vegetative and reproductive growth phases, a full-length complementary DNA (cDNA) sequence of the putative SBP-box transcription factor gene, VpSBP11 , was obtained from Chinese wild grapevine Vitis pseudoreticulata Wen Tsai Wang (W. T. Wang) clone 'Baihe-35-1'. VpSBP11 encoded a putative polypeptide of 170 amino acids with a highly conserved SBP-domain with two zinc-binding sites of the Cx2C-x3-H-x11-C-x6-H (C2HCH) type and a nuclear localization signal. We confirmed that the VpSBP11 protein was targeted to the nucleus and possessed transcriptional activation activity by subcellular localization and trans -activation assay. Over-expression of VpSBP11 in Arabidopsis thaliana was shown to activate the FUL gene, and subsequently the AP1 and LFY genes, all of which were floral meristem identity genes, and to cause earlier flowering than in wild type (WT) plants. The pattern of vegetative growth was also different between the transgenic and WT plants. For example, in the VpSBP11 over-expressing transgenic plants, the number of rosette leaves was less than that of WT; the petiole was significantly elongated; and the rosette and cauline leaves curled upwards or downwards. These results were consistent with VpSBP11 acting as a transcription factor during the transition from the vegetative stage to the reproductive stage.

  11. Characterization of Five Novel Brevibacillus Bacteriophages and Genomic Comparison of Brevibacillus Phages

    PubMed Central

    Berg, Jordan A.; Merrill, Bryan D.; Crockett, Justin T.; Esplin, Kyle P.; Evans, Marlee R.; Heaton, Karli E.; Hilton, Jared A.; Hyde, Jonathan R.; McBride, Morgan S.; Schouten, Jordan T.; Simister, Austin R.; Thurgood, Trever L.; Ward, Andrew T.; Breakwell, Donald P.; Hope, Sandra; Grose, Julianne H.

    2016-01-01

    Brevibacillus laterosporus is a spore-forming bacterium that causes a secondary infection in beehives following European Foulbrood disease. To better understand the contributions of Brevibacillus bacteriophages to the evolution of their hosts, five novel phages (Jenst, Osiris, Powder, SecTim467, and Sundance) were isolated and characterized. When compared with the five Brevibacillus phages currently in NCBI, these phages were assigned to clusters based on whole genome and proteome synteny. Powder and Osiris, both myoviruses, were assigned to the previously described Jimmer-like cluster. SecTim467 and Jenst, both siphoviruses, formed a novel phage cluster. Sundance, a siphovirus, was assigned as a singleton phage along with the previously isolated singleton, Emery. In addition to characterizing the basic relationships between these phages, several genomic features were observed. A motif repeated throughout phages Jenst and SecTim467 was frequently upstream of genes predicted to function in DNA replication, nucleotide metabolism, and transcription, suggesting transcriptional co-regulation. In addition, paralogous gene pairs that encode a putative transcriptional regulator were identified in four Brevibacillus phages. These paralogs likely evolved to bind different DNA sequences due to variation at amino acid residues predicted to bind specific nucleotides. Finally, a putative transposable element was identified in SecTim467 and Sundance that carries genes homologous to those found in Brevibacillus chromosomes. Remnants of this transposable element were also identified in phage Jenst. These discoveries provide a greater understanding of the diversity of phages, their behavior, and their evolutionary relationships to one another and to their host. In addition, they provide a foundation with which further Brevibacillus phages can be compared. PMID:27304881

  12. The adnAB Locus, Encoding a Putative Helicase-Nuclease Activity, Is Essential in Streptomyces

    PubMed Central

    Zhang, Lingli; Nguyen, Hoang Chuong; Chipot, Ludovic; Piotrowski, Emilie; Bertrand, Claire

    2014-01-01

    Homologous recombination is a crucial mechanism that repairs a wide range of DNA lesions, including the most deleterious ones, double-strand breaks (DSBs). This multistep process is initiated by the resection of the broken DNA ends by a multisubunit helicase-nuclease complex exemplified by Escherichia coli RecBCD, Bacillus subtilis AddAB, and newly discovered Mycobacterium tuberculosis AdnAB. Here we show that in Streptomyces, neither recBCD nor addAB homologues could be detected. The only putative helicase-nuclease-encoding genes identified were homologous to M. tuberculosis adnAB genes. These genes are conserved as a single copy in all sequenced genomes of Streptomyces. The disruption of adnAB in Streptomyces ambofaciens and Streptomyces coelicolor could not be achieved unless an ectopic copy was provided, indicating that adnAB is essential for growth. Both adnA and adnB genes were shown to be inducible in response to DNA damage (mitomycin C) and to be independently transcribed. Introduction of S. ambofaciens adnAB genes in an E. coli recB mutant restored viability and resistance to UV light, suggesting that Streptomyces AdnAB could be a functional homologue of RecBCD and be involved in DNA damage resistance. PMID:24837284

  13. Divalent cations and molecular crowding buffers stabilize G-triplex at physiologically relevant temperatures

    PubMed Central

    Jiang, Hong-Xin; Cui, Yunxi; Zhao, Ting; Fu, Hai-Wei; Koirala, Deepak; Punnoose, Jibin Abraham; Kong, De-Ming; Mao, Hanbin

    2015-01-01

    G-triplexes are non-canonical DNA structures formed by G-rich sequences with three G-tracts. Putative G-triplex-forming sequences are expected to be more prevalent than putative G-quadruplex-forming sequences. However, the research on G-triplexes is rare. In this work, the effects of molecular crowding and several physiologically important metal ions on the formation and stability of G-triplexes were examined using a combination of circular dichroism, thermodynamics, optical tweezers and calorimetry techniques. We determined that molecular crowding conditions and cations, such as Na+, K+, Mg2+ and Ca2+, promote the formation of G-triplexes and stabilize these structures. Of these four metal cations, Ca2+ has the strongest stabilizing effect, followed by K+, Mg2+, and Na+ in a decreasing order. The binding of K+ to G-triplexes is accompanied by exothermic heats, and the binding of Ca2+ with G-triplexes is characterized by endothermic heats. G-triplexes formed from two G-triad layers are not stable at physiological temperatures; however, G-triplexes formed from three G-triads exhibit melting temperatures higher than 37°C, especially under the molecular crowding conditions and in the presence of K+ or Ca2+. These observations imply that stable G-triplexes may be formed under physiological conditions. PMID:25787838

  14. The structures of non-CG-repeat Z-DNAs co-crystallized with the Z-DNA-binding domain, hZ alpha(ADAR1).

    PubMed

    Ha, Sung Chul; Choi, Jongkeun; Hwang, Hye-Yeon; Rich, Alexander; Kim, Yang-Gyun; Kim, Kyeong Kyu

    2009-02-01

    The Z-DNA conformation preferentially occurs at alternating purine-pyrimidine repeats, and is specifically recognized by Z alpha domains identified in several Z-DNA-binding proteins. The binding of Z alpha to foreign or chromosomal DNA in various sequence contexts is known to influence various biological functions, including the DNA-mediated innate immune response and transcriptional modulation of gene expression. For these reasons, understanding its binding mode and the conformational diversity of Z alpha bound Z-DNAs is of considerable importance. However, structural studies of Z alpha bound Z-DNA have been mostly limited to standard CG-repeat DNAs. Here, we have solved the crystal structures of three representative non-CG repeat DNAs, d(CACGTG)(2), d(CGTACG)(2) and d(CGGCCG)(2) complexed to hZ alpha(ADAR1) and compared those structures with that of hZ alpha(ADAR1)/d(CGCGCG)(2) and the Z alpha-free Z-DNAs. hZ alpha(ADAR1) bound to each of the three Z-DNAs showed a well conserved binding mode with very limited structural deviation irrespective of the DNA sequence, although varying numbers of residues were in contact with Z-DNA. Z-DNAs display less structural alterations in the Z alpha-bound state than in their free form, thereby suggesting that conformational diversities of Z-DNAs are restrained by the binding pocket of Z alpha. These data suggest that Z-DNAs are recognized by Z alpha through common conformational features regardless of the sequence and structural alterations.

  15. Reactivation of mutant p53: Constraints on mechanism highlighted by principal component analysis of the DNA binding domain.

    PubMed

    Ouaray, Zahra; ElSawy, Karim M; Lane, David P; Essex, Jonathan W; Verma, Chandra

    2016-10-01

    Most p53 mutations associated with cancer are located in its DNA binding domain (DBD). Many structures (X-ray and NMR) of this domain are available in the protein data bank (PDB) and a vast conformational heterogeneity characterizes the various free and complexed states. The major difference between the apo and the holo-complexed states appears to lie in the L1 loop. In particular, the conformations of this loop appear to depend intimately on the sequence of DNA to which it binds. This conclusion builds upon recent observations that implicate the tetramerization and the C-terminal domains (respectively TD and Cter) in DNA binding specificity. Detailed PCA analysis of the most recent collection of DBD structures from the PDB have been carried out. In contrast to recommendations that small molecules/drugs stabilize the flexible L1 loop to rescue mutant p53, our study highlights a need to retain the flexibility of the p53 DNA binding surface (DBS). It is the adaptability of this region that enables p53 to engage in the diverse interactions responsible for its functionality. Proteins 2016; 84:1443-1461. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. In Silico Prediction and Validation of Novel RNA Binding Proteins and Residues in the Human Proteome.

    PubMed

    Chowdhury, Shomeek; Zhang, Jian; Kurgan, Lukasz

    2018-05-28

    Deciphering a complete landscape of protein-RNA interactions in the human proteome remains an elusive challenge. We computationally elucidate RNA binding proteins (RBPs) using an approach that complements previous efforts. We employ two modern complementary sequence-based methods that provide accurate predictions from the structured and the intrinsically disordered sequences, even in the absence of sequence similarity to the known RBPs. We generate and analyze putative RNA binding residues on the whole proteome scale. Using a conservative setting that ensures low, 5% false positive rate, we identify 1511 putative RBPs that include 281 known RBPs and 166 RBPs that were previously predicted. We empirically demonstrate that these overlaps are statistically significant. We also validate the putative RBPs based on two major hallmarks of their RNA binding residues: high levels of evolutionary conservation and enrichment in charged amino acids. Moreover, we show that the novel RBPs are significantly under-annotated functionally which coincides with the fact that they were not yet found to interact with RNAs. We provide two examples of our novel putative RBPs for which there is recent evidence of their interactions with RNAs. The dataset of novel putative RBPs and RNA binding residues for the future hypothesis generation is provided in the Supporting Information. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Role of sequence encoded κB DNA geometry in gene regulation by Dorsal

    PubMed Central

    Mrinal, Nirotpal; Tomar, Archana; Nagaraju, Javaregowda

    2011-01-01

    Many proteins of the Rel family can act as both transcriptional activators and repressors. However, mechanism that discerns the ‘activator/repressor’ functions of Rel-proteins such as Dorsal (Drosophila homologue of mammalian NFκB) is not understood. Using genomic, biophysical and biochemical approaches, we demonstrate that the underlying principle of this functional specificity lies in the ‘sequence-encoded structure’ of the κB-DNA. We show that Dorsal-binding motifs exist in distinct activator and repressor conformations. Molecular dynamics of DNA-Dorsal complexes revealed that repressor κB-motifs typically have A-tract and flexible conformation that facilitates interaction with co-repressors. Deformable structure of repressor motifs, is due to changes in the hydrogen bonding in A:T pair in the ‘A-tract’ core. The sixth nucleotide in the nonameric κB-motif, ‘A’ (A6) in the repressor motifs and ‘T’ (T6) in the activator motifs, is critical to confer this functional specificity as A6 → T6 mutation transformed flexible repressor conformation into a rigid activator conformation. These results highlight that ‘sequence encoded κB DNA-geometry’ regulates gene expression by exerting allosteric effect on binding of Rel proteins which in turn regulates interaction with co-regulators. Further, we identified and characterized putative repressor motifs in Dl-target genes, which can potentially aid in functional annotation of Dorsal gene regulatory network. PMID:21890896

  18. Nanopore sensing of individual transcription factors bound to DNA

    PubMed Central

    Squires, Allison; Atas, Evrim; Meller, Amit

    2015-01-01

    Transcription factor (TF)-DNA interactions are the primary control point in regulation of gene expression. Characterization of these interactions is essential for understanding genetic regulation of biological systems and developing novel therapies to treat cellular malfunctions. Solid-state nanopores are a highly versatile class of single-molecule sensors that can provide rich information about local properties of long charged biopolymers using the current blockage patterns generated during analyte translocation, and provide a novel platform for characterization of TF-DNA interactions. The DNA-binding domain of the TF Early Growth Response Protein 1 (EGR1), a prototypical zinc finger protein known as zif268, is used as a model system for this study. zif268 adopts two distinct bound conformations corresponding to specific and nonspecific binding, according to the local DNA sequence. Here we implement a solid-state nanopore platform for direct, label- and tether-free single-molecule detection of zif268 bound to DNA. We demonstrate detection of single zif268 TFs bound to DNA according to current blockage sublevels and duration of translocation through the nanopore. We further show that the nanopore can detect and discriminate both specific and nonspecific binding conformations of zif268 on DNA via the distinct current blockage patterns corresponding to each of these two known binding modes. PMID:26109509

  19. Nanopore sensing of individual transcription factors bound to DNA

    NASA Astrophysics Data System (ADS)

    Squires, Allison; Atas, Evrim; Meller, Amit

    2015-06-01

    Transcription factor (TF)-DNA interactions are the primary control point in regulation of gene expression. Characterization of these interactions is essential for understanding genetic regulation of biological systems and developing novel therapies to treat cellular malfunctions. Solid-state nanopores are a highly versatile class of single-molecule sensors that can provide rich information about local properties of long charged biopolymers using the current blockage patterns generated during analyte translocation, and provide a novel platform for characterization of TF-DNA interactions. The DNA-binding domain of the TF Early Growth Response Protein 1 (EGR1), a prototypical zinc finger protein known as zif268, is used as a model system for this study. zif268 adopts two distinct bound conformations corresponding to specific and nonspecific binding, according to the local DNA sequence. Here we implement a solid-state nanopore platform for direct, label- and tether-free single-molecule detection of zif268 bound to DNA. We demonstrate detection of single zif268 TFs bound to DNA according to current blockage sublevels and duration of translocation through the nanopore. We further show that the nanopore can detect and discriminate both specific and nonspecific binding conformations of zif268 on DNA via the distinct current blockage patterns corresponding to each of these two known binding modes.

  20. Optical tweezers reveal how proteins alter replication

    NASA Astrophysics Data System (ADS)

    Chaurasiya, Kathy

    Single molecule force spectroscopy is a powerful method that explores the DNA interaction properties of proteins involved in a wide range of fundamental biological processes such as DNA replication, transcription, and repair. We use optical tweezers to capture and stretch a single DNA molecule in the presence of proteins that bind DNA and alter its mechanical properties. We quantitatively characterize the DNA binding mechanisms of proteins in order to provide a detailed understanding of their function. In this work, we focus on proteins involved in replication of Escherichia coli (E. coli ), endogenous eukaryotic retrotransposons Ty3 and LINE-1, and human immunodeficiency virus (HIV). DNA polymerases replicate the entire genome of the cell, and bind both double-stranded DNA (dsDNA) and single-stranded DNA (ssDNA) during DNA replication. The replicative DNA polymerase in the widely-studied model system E. coli is the DNA polymerase III subunit alpha (DNA pol III alpha). We use optical tweezers to determine that UmuD, a protein that regulates bacterial mutagenesis through its interactions with DNA polymerases, specifically disrupts alpha binding to ssDNA. This suggests that UmuD removes alpha from its ssDNA template to allow DNA repair proteins access to the damaged DNA, and to facilitate exchange of the replicative polymerase for an error-prone translesion synthesis (TLS) polymerase that inserts nucleotides opposite the lesions, so that bacterial DNA replication may proceed. This work demonstrates a biophysical mechanism by which E. coli cells tolerate DNA damage. Retroviruses and retrotransposons reproduce by copying their RNA genome into the nuclear DNA of their eukaryotic hosts. Retroelements encode proteins called nucleic acid chaperones, which rearrange nucleic acid secondary structure and are therefore required for successful replication. The chaperone activity of these proteins requires strong binding affinity for both single- and double-stranded nucleic acids. We use single molecule DNA stretching to show that the nucleocapsid protein (NC) of the yeast retrotransposon Ty3, which is likely to be an ancestor of HIV NC, has optimal nucleic acid chaperone activity with only a single zinc finger. We also show that the chaperone activity of the ORF1 protein is responsible for successful replication of the mouse LINE-1 retrotransposon. LINE-1 is also 17% of the human genome, where it generates insertion mutations and alters gene expression. Retrotransposons such as LINE-1 and Ty3 are likely to be ancestors of retroviruses such as HIV. Human APOBEC3G (A3G) inhibits HIV-1 replication via cytidine deamination of the viral ssDNA genome, as well as via a distinct deamination-independent mechanism. Efficient deamination requires rapid on-off binding kinetics, but a slow dissociation rate is required for the proposed deaminase-independent mechanism. We resolve this apparent contradiction with a new quantitative single molecule method, which shows that A3G initially binds ssDNA with fast on-off rates and subsequently converts to a slow binding mode. This suggests that oligomerization transforms A3G from a fast enzyme to a slow binding protein, which is the biophysical mechanism that allows A3G to inhibit HIV replication. A complete understanding of the mechanism of A3G-mediated antiviral activity is required to design drugs that disrupt the viral response to A3G, enhance A3G packaging inside the viral core, and other potential strategies for long-term treatment of HIV infection. We use single molecule biophysics to explore the function of proteins involved in bacterial DNA replication, endogenous retrotransposition of retroelements in eukaryotic hosts such yeast and mice, and HIV replication in human cells. Our quantitative results provide insight into protein function in a range of complex biological systems and have wide-ranging implications for human health.

  1. Selective DNA demethylation by fusion of TDG with a sequence-specific DNA-binding domain

    PubMed Central

    Gregory, David J.; Mikhaylova, Lyudmila; Fedulov, Alexey V.

    2012-01-01

    Our ability to selectively manipulate gene expression by epigenetic means is limited, as there is no approach for targeted reactivation of epigenetically silenced genes, in contrast to what is available for selective gene silencing. We aimed to develop a tool for selective transcriptional activation by DNA demethylation. Here we present evidence that direct targeting of thymine-DNA-glycosylase (TDG) to specific sequences in the DNA can result in local DNA demethylation at potential regulatory sequences and lead to enhanced gene induction. When TDG was fused to a well-characterized DNA-binding domain [the Rel-homology domain (RHD) of NFκB], we observed decreased DNA methylation and increased transcriptional response to unrelated stimulus of inducible nitric oxide synthase (NOS2). The effect was not seen for control genes lacking either RHD-binding sites or high levels of methylation, nor in control mock-transduced cells. Specific reactivation of epigenetically silenced genes may thus be achievable by this approach, which provides a broadly useful strategy to further our exploration of biological mechanisms and to improve control over the epigenome. PMID:22419066

  2. Sequence variability of Campylobacter temperate bacteriophages

    PubMed Central

    Clark, Clifford G; Ng, Lai-King

    2008-01-01

    Background Prophages integrated within the chromosomes of Campylobacter jejuni isolates have been demonstrated very recently. Prior work with Campylobacter temperate bacteriophages, as well as evidence from prophages in other enteric bacteria, suggests these prophages might have a role in the biology and virulence of the organism. However, very little is known about the genetic variability of Campylobacter prophages which, if present, could lead to differential phenotypes in isolates carrying the phages versus those that do not. As a first step in the characterization of C. jejuni prophages, we investigated the distribution of prophage DNA within a C. jejuni population assessed the DNA and protein sequence variability within a subset of the putative prophages found. Results Southern blotting of C. jejuni DNA using probes from genes within the three putative prophages of the C. jejuni sequenced strain RM 1221 demonstrated the presence of at least one prophage gene in a large proportion (27/35) of isolates tested. Of these, 15 were positive for 5 or more of the 7 Campylobacter Mu-like phage 1 (CMLP 1, also designated Campylobacter jejuni integrated element 1, or CJIE 1) genes tested. Twelve of these putative prophages were chosen for further analysis. DNA sequencing of a 9,000 to 11,000 nucleotide region of each prophage demonstrated a close homology with CMLP 1 in both gene order and nucleotide sequence. Structural and sequence variability, including short insertions, deletions, and allele replacements, were found within the prophage genomes, some of which would alter the protein products of the ORFs involved. No insertions of novel genes were detected within the sequenced regions. The 12 prophages and RM 1221 had a % G+C very similar to C. jejuni sequenced strains, as well as promoter regions characteristic of C. jejuni. None of the putative prophages were successfully induced and propagated, so it is not known if they were functional or if they represented remnant prophage DNA in the bacterial chromosomes. Conclusion These putative prophages form a family of phages with conserved sequences, and appear to be adapted to Campylobacter. There was evidence for recombination among groups of prophages, suggesting that the prophages had a mosaic structure. In many of these properties, the Mu-like CMLP 1 homologs characterized in this study resemble temperate bacteriophages of enteric bacteria that are responsible for contributions to virulence and host adaptation. PMID:18366706

  3. Regulation of chromatin organization and inducible gene expression by a Drosophila insulator

    PubMed Central

    Wood, Ashley M.; Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Rohrbaugh, Margaret; Jones, Brian C.; Jones, Keith C.; Corces, Victor G.

    2011-01-01

    SUMMARY Insulators are multi-protein-DNA complexes thought to affect gene expression by mediating inter- and intra-chromosomal interactions. Drosophila insulators contain specific DNA binding proteins plus common components, such as CP190, that facilitate these interactions. Here we examine changes in the distribution of Drosophila insulator proteins during the heat-shock and ecdysone responses. We find that CP190 recruitment to insulator sites is the main regulatable step in controlling insulator function during heat shock. In contrast, both CP190 and DNA binding protein recruitment are regulated during the ecdysone response. CP190 is necessary to stabilize specific chromatin loops and for proper activation of transcription of genes regulated by this hormone. These findings suggest that cells may regulate recruitment of insulator proteins to the DNA in order to activate insulator activity at specific sites and create distinct patterns of nuclear organization that are necessary to achieve proper gene expression in response to different stimuli. PMID:21981916

  4. Regulation of chromatin organization and inducible gene expression by a Drosophila insulator.

    PubMed

    Wood, Ashley M; Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Rohrbaugh, Margaret; Jones, Brian C; Jones, Keith C; Corces, Victor G

    2011-10-07

    Insulators are multiprotein-DNA complexes thought to affect gene expression by mediating inter- and intrachromosomal interactions. Drosophila insulators contain specific DNA-binding proteins plus common components, such as CP190, that facilitate these interactions. Here, we examine changes in the distribution of Drosophila insulator proteins during the heat-shock and ecdysone responses. We find that CP190 recruitment to insulator sites is the main regulatable step in controlling insulator function during heat shock. In contrast, both CP190 and DNA-binding protein recruitment are regulated during the ecdysone response. CP190 is necessary to stabilize specific chromatin loops and for proper activation of transcription of genes regulated by this hormone. These findings suggest that cells may regulate recruitment of insulator proteins to DNA to activate insulator activity at specific sites and create distinct patterns of nuclear organization that are necessary to achieve proper gene expression in response to different stimuli. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. A novel bifunctional histone protein in Streptomyces: a candidate for structural coupling between DNA conformation and transcription during development and stress?

    PubMed Central

    Aldridge, Matthew; Facey, Paul; Francis, Lewis; Bayliss, Sion; Del Sol, Ricardo; Dyson, Paul

    2013-01-01

    Antibiotic-producing Streptomyces are complex bacteria that remodel global transcription patterns and their nucleoids during development. Here, we describe a novel developmentally regulated nucleoid-associated protein, DdbA, of the genus that consists of an N-terminal DNA-binding histone H1-like domain and a C-terminal DksA-like domain that can potentially modulate RNA polymerase activity in conjunction with ppGpp. Owing to its N-terminal domain, the protein can efficiently bind and condense DNA in vitro. Loss of function of this DNA-binding protein results in changes in both DNA condensation during development and the ability to adjust DNA supercoiling in response to osmotic stress. Initial analysis of the DksA-like activity of DdbA indicates that overexpression of the protein suppresses a conditional deficiency in antibiotic production of relA mutants that are unable to synthesise ppGpp, just as DksA overexpression in Escherichia coli can suppress ppGpp0 phenotypes. The null mutant is also sensitive to oxidative stress owing to impaired upregulation of transcription of sigR, encoding an alternative sigma factor. Consequently, we propose this bifunctional histone-like protein as a candidate that could structurally couple changes in DNA conformation and transcription during the streptomycete life-cycle and in response to stress. PMID:23525459

  6. Two phenylalanines in the C-terminus of Epstein-Barr virus Rta protein reciprocally modulate its DNA binding and transactivation function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, L.-W.; Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, New Haven, CT 06520; Raghavan, Vineetha

    The Rta (R transactivator) protein plays an essential role in the Epstein-Barr viral (EBV) lytic cascade. Rta activates viral gene expression by several mechanisms including direct and indirect binding to target viral promoters, synergy with EBV ZEBRA protein, and stimulation of cellular signaling pathways. We previously found that Rta proteins with C-terminal truncations of 30 aa were markedly enhanced in their capacity to bind DNA (Chen, L.W., Chang, P.J., Delecluse, H.J., and Miller, G., (2005). Marked variation in response of consensus binding elements for the Rta protein of Epstein-Barr virus. J. Virol. 79(15), 9635-9650.). Here we show that two phenylalaninesmore » (F600 and F605) in the C-terminus of Rta play a crucial role in mediating this DNA binding inhibitory function. Amino acids 555 to 605 of Rta constitute a functional DNA binding inhibitory sequence (DBIS) that markedly decreased DNA binding when transferred to a minimal DNA binding domain of Rta (aa 1-350). Alanine substitution mutants, F600A/F605A, abolished activity of the DBIS. F600 and F605 are located in the transcriptional activation domain of Rta. Alanine substitutions, F600A/F605A, decreased transcriptional activation by Rta protein, whereas aromatic substitutions, such as F600Y/F605Y or F600W/F605W, partially restored transcriptional activation. Full-length Rta protein with F600A/F605A mutations were enhanced in DNA binding compared to wild-type, whereas Rta proteins with F600Y/F605Y or F600W/F605W substitutions were, like wild-type Rta, relatively poor DNA binders. GAL4 (1-147)/Rta (416-605) fusion proteins with F600A/F605A mutations were diminished in transcriptional activation, relative to GAL4/Rta chimeras without such mutations. The results suggest that, in the context of a larger DBIS, F600 and F605 play a role in the reciprocal regulation of DNA binding and transcriptional activation by Rta. Regulation of DNA binding by Rta is likely to be important in controlling its different modes of action.« less

  7. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involvedmore » in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.« less

  8. Cerium chloride stimulated controlled conversion of B-to-Z DNA in self-assembled nanostructures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhanjadeo, Madhabi M.; Academy of Scientific & Innovative Research; Nayak, Ashok K.

    DNA adopts different conformation not only because of novel base pairs but also while interacting with inorganic or organic compounds. Self-assembled branched DNA (bDNA) structures or DNA origami that change conformation in response to environmental cues hold great promises in sensing and actuation at the nanoscale. Recently, the B-Z transition in DNA is being explored to design various nanomechanical devices. In this communication we have demonstrated that Cerium chloride binds to the phosphate backbone of self-assembled bDNA structure and induce B-to-Z transition at physiological concentration. The mechanism of controlled conversion from right-handed to left-handed has been assayed by various dyemore » binding studies using CD and fluorescence spectroscopy. Three different bDNA structures have been identified to display B-Z transition. This approach provides a rapid and reversible means to change bDNA conformation, which can be used for dynamic and progressive control at the nanoscale. - Highlights: • Cerium-induced B-to-Z DNA transition in self-assembled nanostructures. • Lower melting temperature of Z-DNA than B-DNA confirmed by CD spectroscopy. • Binding mechanism of cerium chloride is explained using fluorescence spectroscopy. • Right-handed to left-handed DNA conformation is also noticed in modified bDNA structure.« less

  9. Functionalization of DNA Nanostructures for Cell Signaling Applications

    NASA Astrophysics Data System (ADS)

    Pedersen, Ronnie O.

    Transforming growth factor beta (TGF-beta) is an important cytokine responsible for a wide range of different cellular functions including extracellular matrix formation, angiogenesis and epithelial-mesenchymal transition. We have sought to use self-assembling DNA nanostructures to influence TGF-beta signaling. The predictable Watson Crick base pairing allows for designing self-assembling nanoscale structures using oligonucleotides. We have used the method of DNA origami to assemble structures functionalized with multiple peptides that bind TGF-beta receptors outside the ligand binding domain. This allows the nanostructures to cluster TGF-beta receptors and lower the energy barrier of ligand binding thus sensitizing the cells to TGF-beta stimulation. To prove efficacy of our nanostructures we have utilized immunofluorescent staining of Smad2/4 in order to monitor TGF-beta mediated translocation of Smad2/4 to the cell nucleus. We have also utilized Smad2/4 responsive luminescence constructs that allows us to quantify TGF-beta stimulation with and without nanostructures. To functionalize our nanostructures we relied on biotin-streptavidin linkages. This introduces a multivalency that is not necessarily desirable in all designs. Therefore we have investigated alternative means of functionalization. The first approach is based on targeting DNA nanostructure by using zinc finger binding proteins. Efficacy of zinc finger binding proteins was assayed by the use of enzyme-linked immunosorbent (ELISA) assay and atomic force microscopy (AFM). While ELISA indicated a relative specificity of zinc finger proteins for target DNA sequences AFM showed a high degree of non-specific binding and insufficient affinity. The second approach is based on using peptide nucleic acid (PNA) incorporated in the nanostructure through base pairing. PNA is a synthetic DNA analog consisting of a backbone of repeating N-(2-aminoethyl)-glycine units to which purine and pyrimidine bases are linked by amide bonds. The solid phase synthesis of PNA allows for convenient extension of the backbone into a peptide segment enabling peptide functionalization of DNA nanostructures. We have investigated how the neutral character of PNA alters the incorporation in DNA based nanostructures compared to a DNA control using biotinylation and AFM. Results indicate that PNA can successfully be used as a way of functionalizing DNA nanostructures. Additionally we have shown that functionalized nanostructures are capable of sensitizing cells to TGF-beta stimulation.

  10. Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription.

    PubMed

    Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C

    2017-09-12

    Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  11. DNA Binding Hydroxyl Radical Probes.

    PubMed

    Tang, Vicky J; Konigsfeld, Katie M; Aguilera, Joe A; Milligan, Jamie R

    2012-01-01

    The hydroxyl radical is the primary mediator of DNA damage by the indirect effect of ionizing radiation. It is a powerful oxidizing agent produced by the radiolysis of water and is responsible for a significant fraction of the DNA damage associated with ionizing radiation. There is therefore an interest in the development of sensitive assays for its detection. The hydroxylation of aromatic groups to produce fluorescent products has been used for this purpose. We have examined four different chromophores which produce fluorescent products when hydroxylated. Of these, the coumarin system suffers from the fewest disadvantages. We have therefore examined its behavior when linked to a cationic peptide ligand designed to bind strongly to DNA.

  12. Oligomerization transforms human APOBEC3G from an efficient enzyme to a slowly dissociating nucleic acid-binding protein

    NASA Astrophysics Data System (ADS)

    Chaurasiya, Kathy R.; McCauley, Micah J.; Wang, Wei; Qualley, Dominic F.; Wu, Tiyun; Kitamura, Shingo; Geertsema, Hylkje; Chan, Denise S. B.; Hertz, Amber; Iwatani, Yasumasa; Levin, Judith G.; Musier-Forsyth, Karin; Rouzina, Ioulia; Williams, Mark C.

    2014-01-01

    The human APOBEC3 proteins are a family of DNA-editing enzymes that play an important role in the innate immune response against retroviruses and retrotransposons. APOBEC3G is a member of this family that inhibits HIV-1 replication in the absence of the viral infectivity factor Vif. Inhibition of HIV replication occurs by both deamination of viral single-stranded DNA and a deamination-independent mechanism. Efficient deamination requires rapid binding to and dissociation from ssDNA. However, a relatively slow dissociation rate is required for the proposed deaminase-independent roadblock mechanism in which APOBEC3G binds the viral template strand and blocks reverse transcriptase-catalysed DNA elongation. Here, we show that APOBEC3G initially binds ssDNA with rapid on-off rates and subsequently converts to a slowly dissociating mode. In contrast, an oligomerization-deficient APOBEC3G mutant did not exhibit a slow off rate. We propose that catalytically active monomers or dimers slowly oligomerize on the viral genome and inhibit reverse transcription.

  13. Deregulation of DNA-dependent protein kinase catalytic subunit contributes to human hepatocarcinogenesis development and has a putative prognostic value.

    PubMed

    Evert, M; Frau, M; Tomasi, M L; Latte, G; Simile, M M; Seddaiu, M A; Zimmermann, A; Ladu, S; Staniscia, T; Brozzetti, S; Solinas, G; Dombrowski, F; Feo, F; Pascale, R M; Calvisi, D F

    2013-11-12

    The DNA-repair gene DNA-dependent kinase catalytic subunit (DNA-PKcs) favours or inhibits carcinogenesis, depending on the cancer type. Its role in human hepatocellular carcinoma (HCC) is unknown. DNA-dependent protein kinase catalytic subunit, H2A histone family member X (H2AFX) and heat shock transcription factor-1 (HSF1) levels were assessed by immunohistochemistry and/or immunoblotting and qRT-PCR in a collection of human HCC. Rates of proliferation, apoptosis, microvessel density and genomic instability were also determined. Heat shock factor-1 cDNA or DNA-PKcs-specific siRNA were used to explore the role of both genes in HCC. Activator protein 1 (AP-1) binding to DNA-PKcs promoter was evaluated by chromatin immunoprecipitation. Kaplan-Meier curves and multivariate Cox model were used to study the impact on clinical outcome. Total and phosphorylated DNA-PKcs and H2AFX were upregulated in HCC. Activated DNA-PKcs positively correlated with HCC proliferation, genomic instability and microvessel density, and negatively with apoptosis and patient's survival. Proliferation decline and massive apoptosis followed DNA-PKcs silencing in HCC cell lines. Total and phosphorylated HSF1 protein, mRNA and activity were upregulated in HCC. Mechanistically, we demonstrated that HSF1 induces DNA-PKcs upregulation through the activation of the MAPK/JNK/AP-1 axis. DNA-dependent protein kinase catalytic subunit transduces HSF1 effects in HCC cells, and might represent a novel target and prognostic factor in human HCC.

  14. Structure of a DNA glycosylase that unhooks interstrand cross-links

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mullins, Elwood A.; Warren, Garrett M.; Bradley, Noah P.

    DNA glycosylases are important editing enzymes that protect genomic stability by excising chemically modified nucleobases that alter normal DNA metabolism. These enzymes have been known only to initiate base excision repair of small adducts by extrusion from the DNA helix. However, recent reports have described both vertebrate and microbial DNA glycosylases capable of unhooking highly toxic interstrand cross-links (ICLs) and bulky minor groove adducts normally recognized by Fanconi anemia and nucleotide excision repair machinery, although the mechanisms of these activities are unknown. Here we report the crystal structure of Streptomyces sahachiroi AlkZ (previously Orf1), a bacterial DNA glycosylase that protectsmore » its host by excising ICLs derived from azinomycin B (AZB), a potent antimicrobial and antitumor genotoxin. AlkZ adopts a unique fold in which three tandem winged helix-turn-helix motifs scaffold a positively charged concave surface perfectly shaped for duplex DNA. Through mutational analysis, we identified two glutamine residues and a β-hairpin within this putative DNA-binding cleft that are essential for catalytic activity. Additionally, we present a molecular docking model for how this active site can unhook either or both sides of an AZB ICL, providing a basis for understanding the mechanisms of base excision repair of ICLs. Given the prevalence of this protein fold in pathogenic bacteria, this work also lays the foundation for an emerging role of DNA repair in bacteria-host pathogenesis.« less

  15. Glutathionylation of the Bacterial Hsp70 Chaperone DnaK Provides a Link between Oxidative Stress and the Heat Shock Response.

    PubMed

    Zhang, Hong; Yang, Jie; Wu, Si; Gong, Weibin; Chen, Chang; Perrett, Sarah

    2016-03-25

    DnaK is the major bacterial Hsp70, participating in DNA replication, protein folding, and the stress response. DnaK cooperates with the Hsp40 co-chaperone DnaJ and the nucleotide exchange factor GrpE. Under non-stress conditions, DnaK binds to the heat shock transcription factor σ(32)and facilitates its degradation. Oxidative stress results in temporary inactivation of DnaK due to depletion of cellular ATP and thiol modifications such as glutathionylation until normal cellular ATP levels and a reducing environment are restored. However, the biological significance of DnaK glutathionylation remains unknown, and the mechanisms by which glutathionylation may regulate the activity of DnaK are also unclear. We investigated the conditions under which Escherichia coli DnaK undergoesS-glutathionylation. We observed glutathionylation of DnaK in lysates of E. coli cells that had been subjected to oxidative stress. We also obtained homogeneously glutathionylated DnaK using purified DnaK in the apo state. We found that glutathionylation of DnaK reversibly changes the secondary structure and tertiary conformation, leading to reduced nucleotide and peptide binding ability. The chaperone activity of DnaK was reversibly down-regulated by glutathionylation, accompanying the structural changes. We found that interaction of DnaK with DnaJ, GrpE, or σ(32)becomes weaker when DnaK is glutathionylated, and the interaction is restored upon deglutathionylation. This study confirms that glutathionylation down-regulates the functions of DnaK under oxidizing conditions, and this down-regulation may facilitate release of σ(32)from its interaction with DnaK, thus triggering the heat shock response. Such a mechanism provides a link between oxidative stress and the heat shock response in bacteria. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Trimeric Association of Hox and TALE Homeodomain Proteins Mediates Hoxb2 Hindbrain Enhancer Activity

    PubMed Central

    Jacobs, Yakop; Schnabel, Catherine A.; Cleary, Michael L.

    1999-01-01

    Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element. PMID:10373562

  17. Formononetin, a phyto-oestrogen, and its metabolites up-regulate interleukin-4 production in activated T cells via increased AP-1 DNA binding activity

    PubMed Central

    Park, Jin; Kim, Seung H; Cho, Daeho; Kim, Tae S

    2005-01-01

    Phyto-oestrogens are polyphenolic non-steroidal plant compounds with oestrogen-like biological activity. Phyto-oestrogens have many biological effects including oestrogen agonist/antagonist properties. However, the effect of phyto-oestrogens on allergic responses remains unclear. In this study we investigated whether formononetin, a phyto-oestrogen, and its metabolites, daidzein and equol, affect production of interleukin-4 (IL-4), a pro-inflammatory cytokine closely associated with allergic immune response, in primary CD4+ T cells and EL4 T lymphoma cells. Formononetin, daidzein and equol significantly enhanced IL-4 production from both CD4+ T cells and EL4 cells in a dose-dependent manner. Formononetin, daidzein and equol also enhanced IL-4 gene promoter activity in EL4 cells transiently transfected with IL-4 gene promoter constructs, but this effect was impaired in EL4 cells transfected with an IL-4 promoter construct deleted of P4 site carrying nuclear factor of activated T cells (NF-AT) and activator protein-1 (AP-1) binding sites. In addition, formononetin, daidzein and equol increased AP-1 DNA binding activities while did not affect NF-AT DNA binding activities. The enhancing effects on IL-4 production and AP-1 DNA binding activities were abrogated by specific inhibitors for phosphatidylinositol-3-kinase (PI3K), protein kinase C (PKC) and p38 mitogen-activated protein kinase (MAPK), indicating that formononetin, daidzein and equol might enhance IL-4 production by increased activation of AP-1 through the PI3-K/PKC/p38 MAPK signalling pathway. These results suggest that phyto-oestrogens and some of their metabolites may increase allergic responses via the enhancement of IL-4 production in T cells. PMID:16108819

  18. Chk1 Promotes DNA Damage Response Bypass following Oxidative Stress in a Model of Hydrogen Peroxide-Associated Ulcerative Colitis through JNK Inactivation and Chromatin Binding

    PubMed Central

    Silver, Andrew; Guenther, Thomas; Siedentopf, Sandra; Ross, Jochen; Vo, Diep-Khanh; Roessner, Albert

    2017-01-01

    Dysregulation of c-Jun N-terminal kinase (JNK) activation promoted DNA damage response bypass and tumorigenesis in our model of hydrogen peroxide-associated ulcerative colitis (UC) and in patients with quiescent UC (QUC), UC-related dysplasia, and UC-related carcinoma (UC-CRC), thereby adapting to oxidative stress. In the UC model, we have observed features of oncogenic transformation: increased proliferation, undetected DNA damage, and apoptosis resistance. Here, we show that Chk1 was downregulated but activated in the acute and quiescent chronic phases. In both phases, Chk1 was linked to DNA damage response bypass by suppressing JNK activation following oxidative stress, promoting cell cycle progression despite DNA damage. Simultaneously, activated Chk1 was bound to chromatin. This triggered histone acetylation and the binding of histone acetyltransferases and transcription factors to chromatin. Thus, chromatin-immobilized activated Chk1 executed a dual function by suppressing DNA damage response and simultaneously inducing chromatin modulation. This caused undetected DNA damage and increased cellular proliferation through failure to transmit the appropriate DNA damage signal. Findings in vitro were corroborated by chromatin accumulation of activated Chk1, Ac-H3, Ac-H4, and c-Jun in active UC (AUC) in vivo. Targeting chromatin-bound Chk1, GCN5, PCAF, and p300/CBP could be a novel therapeutic strategy to prevent UC-related tumor progression. PMID:28751935

  19. The Two-Component System ChtRS Contributes to Chlorhexidine Tolerance in Enterococcus faecium.

    PubMed

    Guzmán Prieto, Ana M; Wijngaarden, Jessica; Braat, Johanna C; Rogers, Malbert R C; Majoor, Eline; Brouwer, Ellen C; Zhang, Xinglin; Bayjanov, Jumamurat R; Bonten, Marc J M; Willems, Rob J L; van Schaik, Willem

    2017-05-01

    Enterococcus faecium is one of the primary causes of nosocomial infections. Disinfectants are commonly used to prevent infections with multidrug-resistant E. faecium in hospitals. Worryingly, E. faecium strains that exhibit tolerance to disinfectants have already been described. We aimed to identify and characterize E. faecium genes that contribute to tolerance to the disinfectant chlorhexidine (CHX). We used a transposon mutant library, constructed in a multidrug-resistant E. faecium bloodstream isolate, to perform a genome-wide screen to identify genetic determinants involved in tolerance to CHX. We identified a putative two-component system (2CS), composed of a putative sensor histidine kinase (ChtS) and a cognate DNA-binding response regulator (ChtR), which contributed to CHX tolerance in E. faecium Targeted chtR and chtS deletion mutants exhibited compromised growth in the presence of CHX. Growth of the chtR and chtS mutants was also affected in the presence of the antibiotic bacitracin. The CHX- and bacitracin-tolerant phenotype of E. faecium E1162 was linked to a unique, nonsynonymous single nucleotide polymorphism in chtR Transmission electron microscopy showed that upon challenge with CHX, the Δ chtR and Δ chtS mutants failed to divide properly and formed long chains. Normal growth and cell morphology were restored when the mutations were complemented in trans Morphological abnormalities were also observed upon exposure of the Δ chtR and Δ chtS mutants to bacitracin. The tolerance to both chlorhexidine and bacitracin provided by ChtRS in E. faecium highlights the overlap between responses to disinfectants and antibiotics and the potential for the development of cross-tolerance for these classes of antimicrobials. Copyright © 2017 American Society for Microbiology.

  20. Asymmetric binding of histone H1 stabilizes MMTV nucleosomes and the interaction of progesterone receptor with the exposed HRE.

    PubMed

    Vicent, Guillermo P; Meliá, María J; Beato, Miguel

    2002-11-29

    Packaging of mouse mammary tumor virus (MMTV) promoter sequences in nucleosomes modulates access of DNA binding proteins and influences the interaction among DNA bound transcription factors. Here we analyze the binding of histone H1 to MMTV mononucleosomes assembled with recombinant histones and study its influence on nucleosome structure and stability as well as on progesterone receptor (PR) binding to the hormone responsive elements (HREs). The MMTV nucleosomes can be separated into three main populations, two of which exhibited precise translational positioning. Histone H1 bound preferentially to the 5' distal nucleosomal DNA protecting additional 27-28 nt from digestion by micrococcal nuclease. Binding of histone H1 was unaffected by prior crosslinking of protein and DNA in nucleosomes with formaldehyde. Neither the translational nor the rotational nucleosome positioning was altered by histone H1 binding, but the nucleosomes were stabilized as judged by the kinetics of nuclease cleavage. Unexpectedly, binding of recombinant PR to the exposed distal HRE-I in nucleosomes was enhanced in the presence of histone H1, as demonstrated by band shift and footprinting experiments. This enhanced PR affinity may contribute to the reported positive effect of histone H1 on the hormonal activation of MMTV reporter genes.

  1. ATM activation and its recruitment to damaged DNA require binding to the C terminus of Nbs1.

    PubMed

    You, Zhongsheng; Chahwan, Charly; Bailis, Julie; Hunter, Tony; Russell, Paul

    2005-07-01

    ATM has a central role in controlling the cellular responses to DNA damage. It and other phosphoinositide 3-kinase-related kinases (PIKKs) have giant helical HEAT repeat domains in their amino-terminal regions. The functions of these domains in PIKKs are not well understood. ATM activation in response to DNA damage appears to be regulated by the Mre11-Rad50-Nbs1 (MRN) complex, although the exact functional relationship between the MRN complex and ATM is uncertain. Here we show that two pairs of HEAT repeats in fission yeast ATM (Tel1) interact with an FXF/Y motif at the C terminus of Nbs1. This interaction resembles nucleoporin FXFG motif binding to HEAT repeats in importin-beta. Budding yeast Nbs1 (Xrs2) appears to have two FXF/Y motifs that interact with Tel1 (ATM). In Xenopus egg extracts, the C terminus of Nbs1 recruits ATM to damaged DNA, where it is subsequently autophosphorylated. This interaction is essential for ATM activation. A C-terminal 147-amino-acid fragment of Nbs1 that has the Mre11- and ATM-binding domains can restore ATM activation in an Nbs1-depleted extract. We conclude that an interaction between specific HEAT repeats in ATM and the C-terminal FXF/Y domain of Nbs1 is essential for ATM activation. We propose that conformational changes in the MRN complex that occur upon binding to damaged DNA are transmitted through the FXF/Y-HEAT interface to activate ATM. This interaction also retains active ATM at sites of DNA damage.

  2. The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

    PubMed Central

    Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

    1980-01-01

    Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

  3. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    PubMed

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  4. RPA and POT1: friends or foes at telomeres?

    PubMed

    Flynn, Rachel Litman; Chang, Sandy; Zou, Lee

    2012-02-15

    Telomere maintenance in cycling cells relies on both DNA replication and capping by the protein complex shelterin. Two single-stranded DNA (ssDNA)-binding proteins, replication protein A (RPA) and protection of telomere 1 (POT1) play critical roles in DNA replication and telomere capping, respectively. While RPA binds to ssDNA in a non-sequence-specific manner, POT1 specifically recognizes singlestranded TTAGGG telomeric repeats. Loss of POT1 leads to aberrant accumulation of RPA at telomeres and activation of the ataxia telangiectasia and Rad3-related kinase (ATR)-mediated checkpoint response, suggesting that POT1 antagonizes RPA binding to telomeric ssDNA. The requirement for both POT1 and RPA in telomere maintenance and the antagonism between the two proteins raises the important question of how they function in concert on telomeric ssDNA. Two interesting models were proposed by recent studies to explain the regulation of POT1 and RPA at telomeres. Here, we discuss how these models help unravel the coordination, and also the antagonism, between POT1 and RPA during the cell cycle.

  5. Novel mechanism of gene regulation: the protein Rv1222 of Mycobacterium tuberculosis inhibits transcription by anchoring the RNA polymerase onto DNA.

    PubMed

    Rudra, Paulami; Prajapati, Ranjit Kumar; Banerjee, Rajdeep; Sengupta, Shreya; Mukhopadhyay, Jayanta

    2015-07-13

    We propose a novel mechanism of gene regulation in Mycobacterium tuberculosis where the protein Rv1222 inhibits transcription by anchoring RNA polymerase (RNAP) onto DNA. In contrast to our existing knowledge that transcriptional repressors function either by binding to DNA at specific sequences or by binding to RNAP, we show that Rv1222-mediated transcription inhibition requires simultaneous binding of the protein to both RNAP and DNA. We demonstrate that the positively charged C-terminus tail of Rv1222 is responsible for anchoring RNAP on DNA, hence the protein slows down the movement of RNAP along the DNA during transcription elongation. The interaction between Rv1222 and DNA is electrostatic, thus the protein could inhibit transcription from any gene. As Rv1222 slows down the RNA synthesis, upon expression of the protein in Mycobacterium smegmatis or Escherichia coli, the growth rate of the bacteria is severely impaired. The protein does not possess any significant affinity for DNA polymerase, thus, is unable to inhibit DNA synthesis. The proposed mechanism by which Rv1222 inhibits transcription reveals a new repertoire of prokaryotic gene regulation. © Crown copyright 2015.

  6. Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

    PubMed Central

    Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

    2014-01-01

    The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

  7. Synthesis, molecular docking and Brugia malayi thymidylate kinase (BmTMK) enzyme inhibition study of novel derivatives of [6]-shogaol.

    PubMed

    Singh, Vinay Kr; Doharey, Pawan K; Kumar, Vikash; Saxena, J K; Siddiqi, M I; Rathaur, Sushma; Narender, Tadigoppula

    2015-03-26

    [6]-Shogaol (1) was isolated from Zingiber officinale. Twelve novel compounds have been synthesized and evaluated for their Brugia malayi thymidylate kinase (BmTMK) inhibition activity, which plays important role for the DNA synthesis in parasite. [6]-Shogaol (1) and shogaol with thymine head group (2), 5-bromouracil head group (3), adenine head group (4) and 2-amino-3-methylpyridine head group (5) showed potential inhibitory effect on BmTMK activity. Further molecular docking studies were carried out to explore the putative binding mode of compounds 1-5. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  8. Regulation of the Salmonella enterica std fimbrial operon by DNA adenine methylation, SeqA, and HdfR.

    PubMed

    Jakomin, Marcello; Chessa, Daniela; Bäumler, Andreas J; Casadesús, Josep

    2008-11-01

    DNA adenine methylase (dam) mutants of Salmonella enterica serovar Typhimurium grown under laboratory conditions express the std fimbrial operon, which is tightly repressed in the wild type. Here, we show that uncontrolled production of Std fimbriae in S. enterica serovar Typhimurium dam mutants contributes to attenuation in mice, as indicated by the observation that an stdA dam strain is more competitive than a dam strain upon oral infection. Dam methylation appears to regulate std transcription, rather than std mRNA stability or turnover. A genetic screen for std regulators showed that the GATC-binding protein SeqA directly or indirectly represses std expression, while the poorly characterized yifA gene product serves as an std activator. YifA encodes a putative LysR-like protein and has been renamed HdfR, like its Escherichia coli homolog. Activation of std expression by HdfR is observed only in dam and seqA backgrounds. These data suggest that HdfR directly or indirectly activates std transcription. Since SeqA is unable to bind nonmethylated DNA, it is possible that std operon derepression in dam and seqA mutants may result from unconstrained HdfR-mediated activation of std transcription. Derepression of std in dam and seqA mutants of S. enterica occurs in only a fraction of the bacterial population, suggesting the occurrence of either bistable expression or phase variation.

  9. Azadirachtin interacts with retinoic acid receptors and inhibits retinoic acid-mediated biological responses.

    PubMed

    Thoh, Maikho; Babajan, Banaganapalli; Raghavendra, Pongali B; Sureshkumar, Chitta; Manna, Sunil K

    2011-02-11

    Considering the role of retinoids in regulation of more than 500 genes involved in cell cycle and growth arrest, a detailed understanding of the mechanism and its regulation is useful for therapy. The extract of the medicinal plant Neem (Azadirachta indica) is used against several ailments especially for anti-inflammatory, anti-itching, spermicidal, anticancer, and insecticidal activities. In this report we prove the detailed mechanism on the regulation of retinoic acid-mediated cell signaling by azadirachtin, active components of neem extract. Azadirachtin repressed all trans-retinoic acid (ATRA)-mediated nuclear transcription factor κB (NF-κB) activation, not the DNA binding but the NF-κB-dependent gene expression. It did not inhibit IκBα degradation, IκBα kinase activity, or p65 phosphorylation and its nuclear translocation but inhibited NF-κB-dependent reporter gene expression. Azadirachtin inhibited TRAF6-mediated, but not TRAF2-mediated NF-κB activation. It inhibited ATRA-induced Sp1 and CREB (cAMP-response element-binding protein) DNA binding. Azadirachtin inhibited ATRA binding with retinoid receptors, which is supported by biochemical and in silico evidences. Azadirachtin showed strong interaction with retinoid receptors. It suppressed ATRA-mediated removal of retinoid receptors, bound with DNA by inhibiting ATRA binding to its receptors. Overall, our data suggest that azadirachtin interacts with retinoic acid receptors and suppresses ATRA binding, inhibits falling off the receptors, and activates transcription factors like CREB, Sp1, NF-κB, etc. Thus, azadirachtin exerts anti-inflammatory and anti-metastatic responses by a novel pathway that would be beneficial for further anti-inflammatory and anti-cancer therapies.

  10. A transferrin gene associated with development and 2-tridecanone tolerance in Helicoverpa armigera

    PubMed Central

    Zhang, L; Shang, Q; Lu, Y; Zhao, Q; Gao, X

    2015-01-01

    The full-length cDNA (2320 bp) encoding a putative iron-binding transferrin protein from Helicoverpa armigera was cloned and named HaTrf. The putative HaTrf sequence included 670 amino acids with a molecular mass of approximately 76 kDa. Quantitative PCR results demonstrated that the transcriptional level of HaTrf was significantly higher in the sixth instar and pupa stages as compared with other developmental stages. HaTrf transcripts were more abundant in fat bodies and in the epidermis than in malpighian tubules. Compared with the control, the expression of HaTrf increased dramatically 24 h after treatment with 2-tridecanone. Apparent growth inhibition with a dramatic body weight decrease was observed in larvae fed with HaTrf double-stranded RNA (dsRNA), as compared with those fed with green fluorescent protein dsRNA. RNA interference of HaTrf also significantly increased the susceptibility of larvae to 2-tridecanone. These results indicate the possible involvement of HaTrf in tolerance to plant secondary chemicals. PMID:25430818

  11. The oxidative DNA glycosylases of Mycobacterium tuberculosis exhibit different substrate preferences from their Escherichia coli counterparts

    PubMed Central

    Guo, Yin; Bandaru, Viswanath; Jaruga, Pawel; Zhao, Xiaobei; Burrows, Cynthia J.; Iwai, Shigenori; Dizdaroglu, Miral; Bond, Jeffrey P.; Wallace, Susan S.

    2010-01-01

    The DNA glycosylases that remove oxidized DNA bases fall into two general families: the Fpg/Nei family and the Nth superfamily. Based on protein sequence alignments, we identified four putative Fpg/Nei family members, as well as a putative Nth protein in Mycobacterium tuberculosis H37Rv. All four Fpg/Nei proteins were successfully overexpressed using a bicistronic vector created in our laboratory. The MtuNth protein was also overexpressed in soluble form. The substrate specificities of the purified enzymes were characterized in vitro with oligodeoxynucleotide substrates containing single lesions. Some were further characterized by gas chromatography/mass spectrometry (GC/MS) analysis of products released from γ-irradiated DNA. MtuFpg1 has a substrate specificity similar to that of EcoFpg. Both EcoFpg and MtuFpg1 are more efficient at removing spiroiminodihydantoin (Sp) than 7,8-dihydro-8-oxoguanine (8-oxoG). However, MtuFpg1 shows a substantially increased opposite base discrimination compared to EcoFpg. MtuFpg2 contains only the C-terminal domain of an Fpg protein and has no detectable DNA binding activity or DNA glycosylase/lyase activity and thus appears to be a pseudogene. MtuNei1 recognizes oxidized pyrimidines on both double-stranded and single-stranded DNA and exhibits uracil DNA glycosylase activity. MtuNth recognizes a variety of oxidized bases, including urea, 5,6-dihydrouracil (DHU), 5-hydroxyuracil (5-OHU), 5-hydroxycytosine (5-OHC) and methylhydantoin (MeHyd). Both MtuNei1 and MtuNth excise thymine glycol (Tg); however, MtuNei1 strongly prefers the (5R) isomers, whereas MtuNth recognizes only the (5S) isomers. MtuNei2 did not demonstrate activity in vitro as a recombinant protein, but like MtuNei1 when expressed in Escherichia coli, it decreased the spontaneous mutation frequency of both the fpg mutY nei triple and nei nth double mutants, suggesting that MtuNei2 is functionally active in vivo recognizing both guanine and cytosine oxidation products. The kinetic parameters of the MtuFpg1, MtuNei1 and MtuNth proteins on selected substrates were also determined and compared to those of their E. coli homologs. PMID:20031487

  12. Thermodynamic and structural insights into CSL-DNA complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Friedmann, David R.; Kovall, Rhett A.

    The Notch pathway is an intercellular signaling mechanism that plays important roles in cell fates decisions throughout the developing and adult organism. Extracellular complexation of Notch receptors with ligands ultimately results in changes in gene expression, which is regulated by the nuclear effector of the pathway, CSL (C-promoter binding factor 1 (CBF-1), suppressor of hairless (Su(H)), lin-12 and glp-1 (Lag-1)). CSL is a DNA binding protein that is involved in both repression and activation of transcription from genes that are responsive to Notch signaling. One well-characterized Notch target gene is hairy and enhancer of split-1 (HES-1), which is regulated bymore » a promoter element consisting of two CSL binding sites oriented in a head-to-head arrangement. Although previous studies have identified in vivo and consensus binding sites for CSL, and crystal structures of these complexes have been determined, to date, a quantitative description of the energetics that underlie CSL-DNA binding is unknown. Here, we provide a thermodynamic and structural analysis of the interaction between CSL and the two individual sites that comprise the HES-1 promoter element. Our comprehensive studies that analyze binding as a function of temperature, salt, and pH reveal moderate, but distinct, differences in the affinities of CSL for the two HES-1 binding sites. Similarly, our structural results indicate that overall CSL binds both DNA sites in a similar manner; however, minor changes are observed in both the conformation of CSL and DNA. Taken together, our results provide a quantitative and biophysical basis for understanding how CSL interacts with DNA sites in vivo.« less

  13. In-silico analysis of putative HCV epitopes against Pakistani human leukocyte antigen background: An approach towards development of future vaccines for Pakistani population.

    PubMed

    Ashraf, Naeem Mahmood; Bilal, Muhammad; Mahmood, Malik Siddique; Hussain, Aadil; Mehboob, Muhammad Zubair

    2016-09-01

    Mounting burden of HCV-infected individuals and soaring cost of treatment is a serious source of unease for developing countries. Numbers of various approaches have been anticipated to develop a vaccine against HCV but the majority of them proved ineffective. Development of vaccine by considering geographical distribution of HCV genotypes and host genetics shows potential. In this research article, we have tried to predict most putative HCV epitopes which are efficiently restricted by most common HLA alleles in Pakistani population through different computational algorithms. Thirteen selected, experimentally identified epitopes sequences were used to derived consensus sequences in all genotypes of HCV. Obtained consensus sequences were used to predict their binding affinities with most prevalent HLA alleles in Pakistani population. Two Class-I epitopes from NS4B region, one from Class-I epitope from NS5A and one Class-II epitope from NS3 region showed effective binding and proved to be highly putative to boost immune response. A cocktail of these four have been checked for population coverage and they gave 75.53% for Pakistani Asian and 70.77% for Pakistani Mixed populations with no allergenic response. Computational algorithms are robust way to shortlist potential candidate epitopes for vaccine development but further, in vivo and in-vitro studies are required to confirm their immunogenic properties. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. High-throughput transcriptome analysis of barley (Hordeum vulgare) exposed to excessive boron.

    PubMed

    Tombuloglu, Guzin; Tombuloglu, Huseyin; Sakcali, M Serdal; Unver, Turgay

    2015-02-15

    Boron (B) is an essential micronutrient for optimum plant growth. However, above certain threshold B is toxic and causes yield loss in agricultural lands. While a number of studies were conducted to understand B tolerance mechanism, a transcriptome-wide approach for B tolerant barley is performed here for the first time. A high-throughput RNA-Seq (cDNA) sequencing technology (Illumina) was used with barley (Hordeum vulgare), yielding 208 million clean reads. In total, 256,874 unigenes were generated and assigned to known peptide databases: Gene Ontology (GO) (99,043), Swiss-Prot (38,266), Clusters of Orthologous Groups (COG) (26,250), and the Kyoto Encyclopedia of Genes and Genomes (KEGG) (36,860), as determined by BLASTx search. According to the digital gene expression (DGE) analyses, 16% and 17% of the transcripts were found to be differentially regulated in root and leaf tissues, respectively. Most of them were involved in cell wall, stress response, membrane, protein kinase and transporter mechanisms. Some of the genes detected as highly expressed in root tissue are phospholipases, predicted divalent heavy-metal cation transporters, formin-like proteins and calmodulin/Ca(2+)-binding proteins. In addition, chitin-binding lectin precursor, ubiquitin carboxyl-terminal hydrolase, and serine/threonine-protein kinase AFC2 genes were indicated to be highly regulated in leaf tissue upon excess B treatment. Some pathways, such as the Ca(2+)-calmodulin system, are activated in response to B toxicity. The differential regulation of 10 transcripts was confirmed by qRT-PCR, revealing the tissue-specific responses against B toxicity and their putative function in B-tolerance mechanisms. Copyright © 2014. Published by Elsevier B.V.

  15. Stage-specific excretory/secretory small heat shock proteins from the parasitic nematode Strongyloides ratti: putative links to host’s intestinal mucosal defense system

    PubMed Central

    Younis, Abuelhassan Elshazly; Geisinger, Frank; Ajonina-Ekoti, Irene; Soblik, Hanns; Steen, Hanno; Mitreva, Makedonka; Erttmann, Klaus D.; Perbandt, Markus; Liebau, Eva; Brattig, Norbert W.

    2013-01-01

    SUMMARY In search of molecules involved in the interaction of intestinal nematodes and mammalian mucosal host cells, we performed mass spectrometry to identify excretory/secretory proteins (ESP) from Strongyloides ratti. In addition to other peptides, we detected in the ESP of parasitic female stage peptides homologous to the Caenorhabditis elegans heat shock protein-17, named Sra-HSP-17.1 (~19 kDa) and Sra-HSP-17.2 (~ 18 kDa) with 49% amino acid identity. The full-length cDNAs (483 bp and 474 bp, respectively) were identified and the genomic organization analyzed. To allow further characterization, the proteins were recombinantly expressed and purified. Profiling of transcription by qRT-PCR and of protein by ELISA in various developmental stages revealed parasitic female-specific expression. The sequence analysis of both DNA and amino acid sequence showed two genes share a conserved alpha-crystallin domain and variable N-terminals. The Sra-HSP-17 proteins showed the highest homology to the deduced small heat-shock protein sequence of the human pathogen S. stercoralis. We observed strong immunogenicity of both proteins, leading to high IgG responses following infection of rats. Flow cytometric analysis indicated the binding of Sra-HSP-17s to the monocytes/macrophage lineage but not to peripheral lymphocytes or neutrophils. A rat intestinal epithelial cell line showed dose dependent binding to Sra-HSP-17.1, but not to Sra-HSP-17.2. Exposed monocytes released IL-10 but not TNF-alpha in response to Sra-HSP-17s, suggesting a possible involvement of secreted female proteins in host immune responses. PMID:21762402

  16. DNA Replication Arrest and DNA Damage Responses Induced by Alkylating Minor Groove Binders

    DTIC Science & Technology

    2003-05-01

    Alkylating minor groove DNA binder adozelesin is capable of inhibiting DNA replication in treated cells through a trans-acting mechanism. The trans... replication in vitro. Using purified proteins in DNA replication initiation assays, we found that RPA purified from cells treated with adozelesin in not...adozelesin has the same single-stranded DNA binding activity and support nucleotide excision repair as normal RPA, but is not able to support SV40 DNA

  17. Identification of functional domains in Arabidopsis thaliana mRNA decapping enzyme (AtDcp2)

    PubMed Central

    Gunawardana, Dilantha; Cheng, Heung-Chin; Gayler, Kenwyn R.

    2008-01-01

    The Arabidopsis thaliana decapping enzyme (AtDcp2) was characterized by bioinformatics analysis and by biochemical studies of the enzyme and mutants produced by recombinant expression. Three functionally significant regions were detected: (i) a highly disordered C-terminal region with a putative PSD-95, Discs-large, ZO-1 (PDZ) domain-binding motif, (ii) a conserved Nudix box constituting the putative active site and (iii) a putative RNA binding domain consisting of the conserved Box B and a preceding loop region. Mutation of the putative PDZ domain-binding motif improved the stability of recombinant AtDcp2 and secondary mutants expressed in Escherichia coli. Such recombinant AtDcp2 specifically hydrolysed capped mRNA to produce 7-methyl GDP and decapped RNA. AtDcp2 activity was Mn2+- or Mg2+-dependent and was inhibited by the product 7-methyl GDP. Mutation of the conserved glutamate-154 and glutamate-158 in the Nudix box reduced AtDcp2 activity up to 400-fold and showed that AtDcp2 employs the catalytic mechanism conserved amongst Nudix hydrolases. Unlike many Nudix hydrolases, AtDcp2 is refractory to inhibition by fluoride ions. Decapping was dependent on binding to the mRNA moiety rather than to the 7-methyl diguanosine triphosphate cap of the substrate. Mutational analysis of the putative RNA-binding domain confirmed the functional significance of an 11-residue loop region and the conserved Box B. PMID:18025047

  18. /sup 3/H)pirenzepine and (-)-(/sup 3/H)quinuclidinyl benzilate binding to rat cerebral cortical and cardiac muscarinic cholinergic sites. I. Characterization and regulation of agonist binding to putative muscarinic subtypes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watson, M.; Yamamura, H.I.; Roeske, W.R.

    The binding and regulation of selected muscarinic agonists to putative subtypes in rat cerebral cortex and heart were studied. Parallel inhibition studies of (/sup 3/H)pirenzepine ((/sup 3/H)PZ) and (-)-(/sup 3/H)quinuclidinylbenzilate ((-)-(/sup 3/H)QNB)-labeled membranes were done with and without 30 microM guanyl-5'-yl imidodiphosphate (Gpp(NH)p) at 25 degrees C in 10 mM Na-K-phosphate buffer which enhances PZ binding affinity and in modified Krebs-phosphate buffer, which mimics physiological conditions. Classical agonists such as carbachol, oxotremorine and acetylcholine inhibited (-)-(/sup 3/H)QNB binding to membranes with shallow Hill values (nH less than 1), were better fit to a 2-state model, were Gpp(NH)p-regulated and showed lowermore » affinity in modified Krebs-phosphate buffer than in 10 mM Na-K-phosphate buffer. Some agonists were not significantly better fit to a 2-state model in (/sup 3/H)PZ-labeled cortical membranes, especially in 10 mM Na-K-phosphate buffer. Whereas putative M1 and M2 binding sites distinguished by PZ possessed multiple agonist affinity states, as judged by carbachol, and agonist binding to (/sup 3/H)PZ-labeled sites were Gpp(NH)p modulated, the partial agonist pilocarpine and nonclassical agonist McN-A-343 (3-(m-chlorophenylcarbamoyloxy)-2-butynyl trimethylammonium chloride) showed little Gpp(NH)p-induced shift in (/sup 3/H)PZ-labeled cortical membranes in physiological conditions. Agonist binding to (-)-(/sup 3/H)QNB-labeled putative M2 cardiac sites was more sensitive to Gpp(NH)p than (-)-(/sup 3/H)QNB-labeled cortical sites. Carbachol and acetylcholine showed significant selectivity for putative M2 sites.« less

  19. Urate is a ligand for the transcriptional regulator PecS.

    PubMed

    Perera, Inoka C; Grove, Anne

    2010-09-24

    PecS is a member of the MarR (multiple antibiotic resistance regulator) family, which has been shown in Erwinia to regulate the expression of virulence genes. MarR homologs typically bind a small molecule ligand, resulting in attenuated DNA binding. For PecS, the natural ligand has not been identified. We have previously shown that urate is a ligand for the Deinococcus radiodurans-encoded MarR homolog HucR (hypothetical uricase regulator) and identified residues responsible for ligand binding. We show here that all four residues involved in urate binding and propagation of conformational changes to DNA recognition helices are conserved in PecS homologs, suggesting that urate is the ligand for PecS. Consistent with this prediction, Agrobacterium tumefaciens PecS specifically binds urate, and urate attenuates DNA binding in vitro. PecS binds two operator sites in the intergenic region between the divergent pecS gene and pecM genes, one of which features two partially overlapping repeats to which PecS binds as a dimer on opposite faces of the duplex. Notably, urate dissociates PecS from cognate DNA, allowing transcription of both genes in vivo. Taken together, our data show that urate is a ligand for PecS and suggest that urate serves a novel function in signaling the colonization of a host plant. Copyright © 2010 Elsevier Ltd. All rights reserved.

  20. Mechanistic Characterization and Molecular Modeling of Hepatitis B Virus Polymerase Resistance to Entecavir

    PubMed Central

    Walsh, Ann W.; Langley, David R.; Colonno, Richard J.; Tenney, Daniel J.

    2010-01-01

    Background Entecavir (ETV) is a deoxyguanosine analog competitive inhibitor of hepatitis B virus (HBV) polymerase that exhibits delayed chain termination of HBV DNA. A high barrier to entecavir-resistance (ETVr) is observed clinically, likely due to its potency and a requirement for multiple resistance changes to overcome suppression. Changes in the HBV polymerase reverse-transcriptase (RT) domain involve lamivudine-resistance (LVDr) substitutions in the conserved YMDD motif (M204V/I ± L180M), plus an additional ETV-specific change at residues T184, S202 or M250. These substitutions surround the putative dNTP binding site or primer grip regions of the HBV RT. Methods/Principal Findings To determine the mechanistic basis for ETVr, wildtype, lamivudine-resistant (M204V, L180M) and ETVr HBVs were studied using in vitro RT enzyme and cell culture assays, as well as molecular modeling. Resistance substitutions significantly reduced ETV incorporation and chain termination in HBV DNA and increased the ETV-TP inhibition constant (Ki) for HBV RT. Resistant HBVs exhibited impaired replication in culture and reduced enzyme activity (kcat) in vitro. Molecular modeling of the HBV RT suggested that ETVr residue T184 was adjacent to and stabilized S202 within the LVDr YMDD loop. ETVr arose through steric changes at T184 or S202 or by disruption of hydrogen-bonding between the two, both of which repositioned the loop and reduced the ETV-triphosphate (ETV-TP) binding pocket. In contrast to T184 and S202 changes, ETVr at primer grip residue M250 was observed during RNA-directed DNA synthesis only. Experimentally, M250 changes also impacted the dNTP-binding site. Modeling suggested a novel mechanism for M250 resistance, whereby repositioning of the primer-template component of the dNTP-binding site shifted the ETV-TP binding pocket. No structural data are available to confirm the HBV RT modeling, however, results were consistent with phenotypic analysis of comprehensive substitutions of each ETVr position. Conclusions Altogether, ETVr occurred through exclusion of ETV-TP from the dNTP-binding site, through different, novel mechanisms that involved lamivudine-resistance, ETV-specific substitutions, and the primer-template. PMID:20169198

  1. Mechanistic characterization and molecular modeling of hepatitis B virus polymerase resistance to entecavir.

    PubMed

    Walsh, Ann W; Langley, David R; Colonno, Richard J; Tenney, Daniel J

    2010-02-12

    Entecavir (ETV) is a deoxyguanosine analog competitive inhibitor of hepatitis B virus (HBV) polymerase that exhibits delayed chain termination of HBV DNA. A high barrier to entecavir-resistance (ETVr) is observed clinically, likely due to its potency and a requirement for multiple resistance changes to overcome suppression. Changes in the HBV polymerase reverse-transcriptase (RT) domain involve lamivudine-resistance (LVDr) substitutions in the conserved YMDD motif (M204V/I +/- L180M), plus an additional ETV-specific change at residues T184, S202 or M250. These substitutions surround the putative dNTP binding site or primer grip regions of the HBV RT. To determine the mechanistic basis for ETVr, wildtype, lamivudine-resistant (M204V, L180M) and ETVr HBVs were studied using in vitro RT enzyme and cell culture assays, as well as molecular modeling. Resistance substitutions significantly reduced ETV incorporation and chain termination in HBV DNA and increased the ETV-TP inhibition constant (K(i)) for HBV RT. Resistant HBVs exhibited impaired replication in culture and reduced enzyme activity (k(cat)) in vitro. Molecular modeling of the HBV RT suggested that ETVr residue T184 was adjacent to and stabilized S202 within the LVDr YMDD loop. ETVr arose through steric changes at T184 or S202 or by disruption of hydrogen-bonding between the two, both of which repositioned the loop and reduced the ETV-triphosphate (ETV-TP) binding pocket. In contrast to T184 and S202 changes, ETVr at primer grip residue M250 was observed during RNA-directed DNA synthesis only. Experimentally, M250 changes also impacted the dNTP-binding site. Modeling suggested a novel mechanism for M250 resistance, whereby repositioning of the primer-template component of the dNTP-binding site shifted the ETV-TP binding pocket. No structural data are available to confirm the HBV RT modeling, however, results were consistent with phenotypic analysis of comprehensive substitutions of each ETVr position. Altogether, ETVr occurred through exclusion of ETV-TP from the dNTP-binding site, through different, novel mechanisms that involved lamivudine-resistance, ETV-specific substitutions, and the primer-template.

  2. Comprehensive analysis of genome-wide DNA methylation across human polycystic ovary syndrome ovary granulosa cell.

    PubMed

    Xu, Jiawei; Bao, Xiao; Peng, Zhaofeng; Wang, Linlin; Du, Linqing; Niu, Wenbin; Sun, Yingpu

    2016-05-10

    Polycystic ovary syndrome (PCOS) affects approximately 7% of the reproductive-age women. A growing body of evidence indicated that epigenetic mechanisms contributed to the development of PCOS. The role of DNA modification in human PCOS ovary granulosa cell is still unknown in PCOS progression. Global DNA methylation and hydroxymethylation were detected between PCOS' and controls' granulosa cell. Genome-wide DNA methylation was profiled to investigate the putative function of DNA methylaiton. Selected genes expressions were analyzed between PCOS' and controls' granulosa cell. Our results showed that the granulosa cell global DNA methylation of PCOS patients was significant higher than the controls'. The global DNA hydroxymethylation showed low level and no statistical difference between PCOS and control. 6936 differentially methylated CpG sites were identified between control and PCOS-obesity. 12245 differential methylated CpG sites were detected between control and PCOS-nonobesity group. 5202 methylated CpG sites were significantly differential between PCOS-obesity and PCOS-nonobesity group. Our results showed that DNA methylation not hydroxymethylation altered genome-wide in PCOS granulosa cell. The different methylation genes were enriched in development protein, transcription factor activity, alternative splicing, sequence-specific DNA binding and embryonic morphogenesis. YWHAQ, NCF2, DHRS9 and SCNA were up-regulation in PCOS-obesity patients with no significance different between control and PCOS-nonobesity patients, which may be activated by lower DNA methylaiton. Global and genome-wide DNA methylation alteration may contribute to different genes expression and PCOS clinical pathology.

  3. Epigenetics, chromatin and genome organization: recent advances from the ENCODE project.

    PubMed

    Siggens, L; Ekwall, K

    2014-09-01

    The organization of the genome into functional units, such as enhancers and active or repressed promoters, is associated with distinct patterns of DNA and histone modifications. The Encyclopedia of DNA Elements (ENCODE) project has advanced our understanding of the principles of genome, epigenome and chromatin organization, identifying hundreds of thousands of potential regulatory regions and transcription factor binding sites. Part of the ENCODE consortium, GENCODE, has annotated the human genome with novel transcripts including new noncoding RNAs and pseudogenes, highlighting transcriptional complexity. Many disease variants identified in genome-wide association studies are located within putative enhancer regions defined by the ENCODE project. Understanding the principles of chromatin and epigenome organization will help to identify new disease mechanisms, biomarkers and drug targets, particularly as ongoing epigenome mapping projects generate data for primary human cell types that play important roles in disease. © 2014 The Association for the Publication of the Journal of Internal Medicine.

  4. Cloning and characterization of a novel zinc finger gene in Xp11.2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Derry, J.M.J.; Jess, U.; Francke, U.

    1995-11-20

    During a systematic search for open reading frames in chromosome band Xp11.2, a novel gene (ZNF157) that encodes a putative 506-amino-acid protein with the sequence characteristics of a zinc-finger-containing transcription factor was isolated. ZNF157 is encoded by four exons distributed over >20 kb of genomic DNA. The second and third exons contain sequences similar to those of the previously described KRAB-A and KRAB-B domains, motifs that have been shown to mediate transcriptional repression in other members of the protein family. A fourth exon contains 12 zinc finger DNA binding motifs and finger linking regions characteristic of ZNF proteins of themore » Krueppel family. ZNF157 maps to the telomeric end of a cluster of ZNF genes that includes ZNF21, ZNF41, and ZNF81. 19 refs., 2 figs.« less

  5. Differences in the Mechanism of the Allosteric L-Rhamnose Responses of the AraC/XylS Family Transcription Activators RhaS and RhaR

    PubMed Central

    Kolin, Ana; Balasubramaniam, Vinitha; Skredenske, Jeff; Wickstrum, Jason; Egan, Susan M.

    2008-01-01

    SUMMARY Proteins in the largest subset of AraC/XylS family transcription activators, including RhaS and RhaR, have C-terminal domains (CTDs) that mediate DNA-binding and transcription activation, and N-terminal domains (NTDs) that mediate dimerization and effector binding. The mechanism of the allosteric effector response in this family has been identified only for AraC. Here, we investigated the mechanism by which RhaS and RhaR respond to their effector, L-rhamnose. Unlike AraC, N-terminal truncations suggested that RhaS and RhaR don’t use an N-terminal arm to inhibit activity in the absence of effector. We used random mutagenesis to isolate RhaS and RhaR variants with enhanced activation in the absence of L-rhamnose. NTD substitutions largely clustered around the predicted L-rhamnose-binding pockets, suggesting that they mimic the structural outcome of effector binding to the wild-type proteins. RhaS-CTD substitutions clustered in the first HTH motif, and suggested that L-rhamnose induces improved DNA binding. In contrast, RhaR-CTD substitutions clustered at a single residue in the second HTH motif, at a position consistent with improved RNAP contacts. We propose separate allosteric mechanisms for the two proteins: Without L-rhamnose, RhaS doesn’t effectively bind DNA while RhaR doesn’t effectively contact RNAP. Upon L-rhamnose binding, both proteins undergo structural changes that enable transcription activation. PMID:18366439

  6. The natural absence of RPA1N domain did not impair Leishmania amazonensis RPA-1 participation in DNA damage response and telomere protection.

    PubMed

    Da Silveira, Rita De Cássia Viveiros; Da Silva, Marcelo Santos; Nunes, Vinícius Santana; Perez, Arina Marina; Cano, Maria Isabel Nogueira

    2013-04-01

    We have previously shown that the subunit 1 of Leishmania amazonensis RPA (LaRPA-1) alone binds the G-rich telomeric strand and is structurally different from other RPA-1. It is analogous to telomere end-binding proteins described in model eukaryotes whose homologues were not identified in the protozoan´s genome. Here we show that LaRPA-1 is involved with damage response and telomere protection although it lacks the RPA1N domain involved with the binding with multiple checkpoint proteins. We induced DNA double-strand breaks (DSBs) in Leishmania using phleomycin. Damage was confirmed by TUNEL-positive nuclei and triggered a G1/S cell cycle arrest that was accompanied by nuclear accumulation of LaRPA-1 and RAD51 in the S phase of hydroxyurea-synchronized parasites. DSBs also increased the levels of RAD51 in non-synchronized parasites and of LaRPA-1 and RAD51 in the S phase of synchronized cells. More LaRPA-1 appeared immunoprecipitating telomeres in vivo and associated in a complex containing RAD51, although this interaction needs more investigation. RAD51 apparently co-localized with few telomeric clusters but it did not immunoprecipitate telomeric DNA. These findings suggest that LaRPA-1 and RAD51 work together in response to DNA DSBs and at telomeres, upon damage, LaRPA-1 works probably to prevent loss of single-stranded DNA and to assume a capping function.

  7. NLRC3, a member of the NLR family of proteins, is a negative regulator of innate immune signaling induced by the DNA sensor STING

    PubMed Central

    Zhang, Lu; Mo, Jinyao; Swanson, Karen V.; Wen, Haitao; Petrucelli, Alex; Gregory, Sean M.; Zhang, Zhigang; Schneider, Monika; Jiang, Yan; Fitzgerald, Katherine A.; Ouyang, Songying; Liu, Zhi-Jie; Damania, Blossom A; Shu, Hong-Bing; Duncan, Joseph A.; Ting, Jenny P-Y.

    2014-01-01

    SUMMARY Stimulator of interferon genes (STING, also named MITA, MYPS or ERIS) is an intracellular DNA sensor that induces type I interferon through its interaction with TANK-binding kinase 1 (TBK1). Here we found that the nucleotide-binding, leucine-rich repeat containing protein, NLRC3, reduced STING-dependent innate immune activation in response to cytosolic DNA, cyclic di-GMP (c-di-GMP) and DNA viruses. NLRC3 associated with both STING and TBK1, and impeded STING-TBK1 interaction and downstream type I interferon production. Using purified recombinant proteins NLRC3 was found to interact directly with STING. Furthermore, NLRC3 prevented proper trafficking of STING to perinuclear and punctated region, known to be important for its activation. In animals, herpes simplex virus 1 (HSV-1)-infected Nlrc3−/− mice exhibited enhanced innate immunity, reduced morbidity and viral load. This demonstrates the intersection of two key pathways of innate immune regulation, NLR and STING, to fine tune host response to intracellular DNA, DNA virus and c-di-GMP PMID:24560620

  8. Experimental design, modeling and optimization of polyplex formation between DNA oligonucleotides and branched polyethylenimine.

    PubMed

    Clima, Lilia; Ursu, Elena L; Cojocaru, Corneliu; Rotaru, Alexandru; Barboiu, Mihail; Pinteala, Mariana

    2015-09-28

    The complexes formed by DNA and polycations have received great attention owing to their potential application in gene therapy. In this study, the binding efficiency between double-stranded oligonucleotides (dsDNA) and branched polyethylenimine (B-PEI) has been quantified by processing of the images captured from the gel electrophoresis assays. The central composite experimental design has been employed to investigate the effects of controllable factors on the binding efficiency. On the basis of experimental data and the response surface methodology, a multivariate regression model has been constructed and statistically validated. The model has enabled us to predict the binding efficiency depending on experimental factors, such as concentrations of dsDNA and B-PEI as well as the initial pH of solution. The optimization of the binding process has been performed using simplex and gradient methods. The optimal conditions determined for polyplex formation have yielded a maximal binding efficiency close to 100%. In order to reveal the mechanism of complex formation at the atomic-scale, a molecular dynamic simulation has been carried out. According to the computation results, B-PEI amine hydrogen atoms have interacted with oxygen atoms from dsDNA phosphate groups. These interactions have led to the formation of hydrogen bonds between macromolecules, stabilizing the polyplex structure.

  9. Loci under selection and markers associated with host plant and host-related strains shape the genetic structure of Brazilian populations of Spodoptera frugiperda (Lepidoptera, Noctuidae).

    PubMed

    Silva-Brandão, Karina Lucas; Peruchi, Aline; Seraphim, Noemy; Murad, Natália Faraj; Carvalho, Renato Assis; Farias, Juliano Ricardo; Omoto, Celso; Cônsoli, Fernando Luis; Figueira, Antonio; Brandão, Marcelo Mendes

    2018-01-01

    We applied the ddRAD genotyping-by-sequencing technique to investigate the genetic distinctiveness of Brazilian populations of the noctuid moth Spodoptera frugiperda, the fall armyworm (FAW), and the role of host-plant association as a source of genetic diversification. By strain-genotyping all field-collected individuals we found that populations collected from corn were composed primarily of corn-strain individuals, while the population collected from rice was composed almost entirely of rice-strain individuals. Outlier analyses indicated 1,184 loci putatively under selection (ca. 15% of the total) related to 194 different Gene Ontologies (GOs); the most numerous GOs were nucleotide binding, ATP binding, metal-ion binding and nucleic-acid binding. The association analyses indicated 326 loci associated with the host plant, and 216 loci associated with the individual strain, including functions related to Bacillus thuringiensis and insecticide resistance. The genetic-structure analyses indicated a moderate level of differentiation among all populations, and lower genetic structure among populations collected exclusively from corn, which suggests that the population collected from rice has a strong influence on the overall genetic structure. Populations of S. frugiperda are structured partially due to the host plant, and pairs of populations using the same host plant are more genetically similar than pairs using different hosts. Loci putatively under selection are the main factors responsible for the genetic structure of these populations, which indicates that adaptive selection on important traits, including the response to control tactics, is acting in the genetic differentiation of FAW populations in Brazil.

  10. Loci under selection and markers associated with host plant and host-related strains shape the genetic structure of Brazilian populations of Spodoptera frugiperda (Lepidoptera, Noctuidae)

    PubMed Central

    Peruchi, Aline; Seraphim, Noemy; Murad, Natália Faraj; Carvalho, Renato Assis; Farias, Juliano Ricardo; Omoto, Celso; Cônsoli, Fernando Luis; Figueira, Antonio; Brandão, Marcelo Mendes

    2018-01-01

    We applied the ddRAD genotyping-by-sequencing technique to investigate the genetic distinctiveness of Brazilian populations of the noctuid moth Spodoptera frugiperda, the fall armyworm (FAW), and the role of host-plant association as a source of genetic diversification. By strain-genotyping all field-collected individuals we found that populations collected from corn were composed primarily of corn-strain individuals, while the population collected from rice was composed almost entirely of rice-strain individuals. Outlier analyses indicated 1,184 loci putatively under selection (ca. 15% of the total) related to 194 different Gene Ontologies (GOs); the most numerous GOs were nucleotide binding, ATP binding, metal-ion binding and nucleic-acid binding. The association analyses indicated 326 loci associated with the host plant, and 216 loci associated with the individual strain, including functions related to Bacillus thuringiensis and insecticide resistance. The genetic-structure analyses indicated a moderate level of differentiation among all populations, and lower genetic structure among populations collected exclusively from corn, which suggests that the population collected from rice has a strong influence on the overall genetic structure. Populations of S. frugiperda are structured partially due to the host plant, and pairs of populations using the same host plant are more genetically similar than pairs using different hosts. Loci putatively under selection are the main factors responsible for the genetic structure of these populations, which indicates that adaptive selection on important traits, including the response to control tactics, is acting in the genetic differentiation of FAW populations in Brazil. PMID:29787608

  11. The increasing diversity of functions attributed to the SAFB family of RNA-/DNA-binding proteins.

    PubMed

    Norman, Michael; Rivers, Caroline; Lee, Youn-Bok; Idris, Jalilah; Uney, James

    2016-12-01

    RNA-binding proteins play a central role in cellular metabolism by orchestrating the complex interactions of coding, structural and regulatory RNA species. The SAFB (scaffold attachment factor B) proteins (SAFB1, SAFB2 and SAFB-like transcriptional modulator, SLTM), which are highly conserved evolutionarily, were first identified on the basis of their ability to bind scaffold attachment region DNA elements, but attention has subsequently shifted to their RNA-binding and protein-protein interactions. Initial studies identified the involvement of these proteins in the cellular stress response and other aspects of gene regulation. More recently, the multifunctional capabilities of SAFB proteins have shown that they play crucial roles in DNA repair, processing of mRNA and regulatory RNA, as well as in interaction with chromatin-modifying complexes. With the advent of new techniques for identifying RNA-binding sites, enumeration of individual RNA targets has now begun. This review aims to summarise what is currently known about the functions of SAFB proteins. © 2016 The Author(s).

  12. Mapping the membrane proteome of anaerobic gut fungi identifies a wealth of carbohydrate binding proteins and transporters

    DOE PAGES

    Seppala, Susanna; Solomon, Kevin V.; Gilmore, Sean P.; ...

    2016-12-20

    Here, engineered cell factories that convert biomass into value-added compounds are emerging as a timely alternative to petroleum-based industries. Although often overlooked, integral membrane proteins such as solute transporters are pivotal for engineering efficient microbial chassis. Anaerobic gut fungi, adapted to degrade raw plant biomass in the intestines of herbivores, are a potential source of valuable transporters for biotechnology, yet very little is known about the membrane constituents of these non-conventional organisms. Here, we mined the transcriptome of three recently isolated strains of anaerobic fungi to identify membrane proteins responsible for sensing and transporting biomass hydrolysates within a competitive andmore » rather extreme environment. Using sequence analyses and homology, we identified membrane protein-coding sequences from assembled transcriptomes from three strains of anaerobic gut fungi: Neocallimastix californiae, Anaeromyces robustus, and Piromyces finnis. We identified nearly 2000 transporter components: about half of these are involved in the general secretory pathway and intracellular sorting of proteins; the rest are predicted to be small-solute transporters. Unexpectedly, we found a number of putative sugar binding proteins that are associated with prokaryotic uptake systems; and approximately 100 class C G-protein coupled receptors (GPCRs) with non-canonical putative sugar binding domains. In conclusion, we report the first comprehensive characterization of the membrane protein machinery of biotechnologically relevant anaerobic gut fungi. Apart from identifying conserved machinery for protein sorting and secretion, we identify a large number of putative solute transporters that are of interest for biotechnological applications. Notably, our data suggests that the fungi display a plethora of carbohydrate binding domains at their surface, perhaps as a means to sense and sequester some of the sugars that their biomass degrading, extracellular enzymes produce.« less

  13. Mapping the membrane proteome of anaerobic gut fungi identifies a wealth of carbohydrate binding proteins and transporters.

    PubMed

    Seppälä, Susanna; Solomon, Kevin V; Gilmore, Sean P; Henske, John K; O'Malley, Michelle A

    2016-12-20

    Engineered cell factories that convert biomass into value-added compounds are emerging as a timely alternative to petroleum-based industries. Although often overlooked, integral membrane proteins such as solute transporters are pivotal for engineering efficient microbial chassis. Anaerobic gut fungi, adapted to degrade raw plant biomass in the intestines of herbivores, are a potential source of valuable transporters for biotechnology, yet very little is known about the membrane constituents of these non-conventional organisms. Here, we mined the transcriptome of three recently isolated strains of anaerobic fungi to identify membrane proteins responsible for sensing and transporting biomass hydrolysates within a competitive and rather extreme environment. Using sequence analyses and homology, we identified membrane protein-coding sequences from assembled transcriptomes from three strains of anaerobic gut fungi: Neocallimastix californiae, Anaeromyces robustus, and Piromyces finnis. We identified nearly 2000 transporter components: about half of these are involved in the general secretory pathway and intracellular sorting of proteins; the rest are predicted to be small-solute transporters. Unexpectedly, we found a number of putative sugar binding proteins that are associated with prokaryotic uptake systems; and approximately 100 class C G-protein coupled receptors (GPCRs) with non-canonical putative sugar binding domains. We report the first comprehensive characterization of the membrane protein machinery of biotechnologically relevant anaerobic gut fungi. Apart from identifying conserved machinery for protein sorting and secretion, we identify a large number of putative solute transporters that are of interest for biotechnological applications. Notably, our data suggests that the fungi display a plethora of carbohydrate binding domains at their surface, perhaps as a means to sense and sequester some of the sugars that their biomass degrading, extracellular enzymes produce.

  14. Estrogen receptor accessory proteins augment receptor-DNA interaction and DNA bending.

    PubMed

    Landel, C C; Potthoff, S J; Nardulli, A M; Kushner, P J; Greene, G L

    1997-01-01

    Increasing evidence suggests that accessory proteins play an important role in the ability of the estrogen receptor (ER) and other nuclear hormone receptors to modulate transcription when bound to cis-acting hormone response elements in target genes. We have previously shown that four proteins, hsp70, protein disulfide isomerase (PDI) and two unknown proteins (p48 and p45), copurify with ER that has been isolated by site-specific DNA chromatography (BERE) and influence the interaction of ER with DNA in vitro. To better define the nature of these effects, we used filter binding and electrophoretic mobility shift assays to study the ability of these proteins to alter the kinetics of ER-DNA interaction and to influence the ability of ER to bend DNA when bound to an estrogen response element (ERE). The results of both assays indicate that ERE-purified ER, with its four associated proteins (hsp70, PDI, p48, p45), has a greater ability to bind to the vitellogenin A2 ERE than ER purified by estradiol-Sepharose chromatography in the absence (ESeph) or presence (EATP) of ATP, in which p48, p45 (ESeph) and hsp70 (EATP) are removed. Surprisingly, the rates of association and dissociation of ER and ERE were essentially the same for all three mixtures, suggesting that one or more ER-associated proteins, especially p45 and p48, may be required for ER to attain maximum DNA binding activity. In addition, circular permutation and phasing analyses demonstrated that the same ER-associated proteins produced higher order ER-DNA complexes that significantly increased the magnitude of DNA distortion, but did not alter the direction of the ER-induced bend of ERE-containing DNA fragments, which was toward the major groove of the DNA helix. These results suggest that p45 and/or p48 and possibly hsp70, play an important role both in the specific DNA binding and bending activities of ER and thus contribute to the overall stimulation of transcription in target genes that contain cis-acting EREs.

  15. Chemical Screens Against A Reconstituted Multi-Protein Complex: Myricetin Blocks DnaJ Regulation of DnaK through an Allosteric Mechanism

    PubMed Central

    Chang, Lyra; Miyata, Yoshinari; Ung, Peter M. U.; Bertelsen, Eric B.; McQuade, Thomas J.; Carlson, Heather A.; Zuiderweg, Erik R. P.; Gestwicki, Jason E.

    2011-01-01

    SUMMARY DnaK is a molecular chaperone responsible for multiple aspects of proteostasis. The intrinsically slow ATPase activity of DnaK is stimulated by its co-chaperone, DnaJ, and these proteins often work in concert. To identify inhibitors, we screened plant-derived extracts against a re-constituted mixture of DnaK and DnaJ. This approach resulted in the identification of flavonoids, including myricetin, which inhibited activity by up to 75%. Interestingly, myricetin prevented DnaJ-mediated stimulation of ATPase activity, with minimal impact on either DnaK’s intrinsic turnover rate or its stimulation by another co-chaperone, GrpE. Using NMR, we found that myricetin binds DnaK at an unanticipated site between the IB and IIB subdomains and that it allosterically blocked binding of DnaJ. Together, these results highlight a “gray box” screening approach, which approximates a limited amount of the complexity expected in physiological, multi-protein systems. PMID:21338918

  16. Transcription and DNA Damage: Holding Hands or Crossing Swords?

    PubMed

    D'Alessandro, Giuseppina; d'Adda di Fagagna, Fabrizio

    2017-10-27

    Transcription has classically been considered a potential threat to genome integrity. Collision between transcription and DNA replication machinery, and retention of DNA:RNA hybrids, may result in genome instability. On the other hand, it has been proposed that active genes repair faster and preferentially via homologous recombination. Moreover, while canonical transcription is inhibited in the proximity of DNA double-strand breaks, a growing body of evidence supports active non-canonical transcription at DNA damage sites. Small non-coding RNAs accumulate at DNA double-strand break sites in mammals and other organisms, and are involved in DNA damage signaling and repair. Furthermore, RNA binding proteins are recruited to DNA damage sites and participate in the DNA damage response. Here, we discuss the impact of transcription on genome stability, the role of RNA binding proteins at DNA damage sites, and the function of small non-coding RNAs generated upon damage in the signaling and repair of DNA lesions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Glucagon-Like Peptide-1 Receptor Ligand Interactions: Structural Cross Talk between Ligands and the Extracellular Domain

    PubMed Central

    West, Graham M.; Willard, Francis S.; Sloop, Kyle W.; Showalter, Aaron D.; Pascal, Bruce D.; Griffin, Patrick R.

    2014-01-01

    Activation of the glucagon-like peptide-1 receptor (GLP-1R) in pancreatic β-cells potentiates insulin production and is a current therapeutic target for the treatment of type 2 diabetes mellitus (T2DM). Like other class B G protein-coupled receptors (GPCRs), the GLP-1R contains an N-terminal extracellular ligand binding domain. N-terminal truncations on the peptide agonist generate antagonists capable of binding to the extracellular domain, but not capable of activating full length receptor. The main objective of this study was to use Hydrogen/deuterium exchange (HDX) to identify how the amide hydrogen bonding network of peptide ligands and the extracellular domain of GLP-1R (nGLP-1R) were altered by binding interactions and to then use this platform to validate direct binding events for putative GLP-1R small molecule ligands. The HDX studies presented here for two glucagon-like peptide-1 receptor (GLP-1R) peptide ligands indicates that the antagonist exendin-4[9-39] is significantly destabilized in the presence of nonionic detergents as compared to the agonist exendin-4. Furthermore, HDX can detect stabilization of exendin-4 and exendin-4[9-39] hydrogen bonding networks at the N-terminal helix [Val19 to Lys27] upon binding to the N-terminal extracellular domain of GLP-1R (nGLP-1R). In addition we show hydrogen bonding network stabilization on nGLP-1R in response to ligand binding, and validate direct binding events with the extracellular domain of the receptor for putative GLP-1R small molecule ligands. PMID:25180755

  18. A systematic analysis of factors localized to damaged chromatin reveals PARP-dependent recruitment of transcription factors

    PubMed Central

    Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C.; Westbrook, Thomas F.; Harper, J. Wade; Elledge, Stephen J.

    2015-01-01

    Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify new DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the ALS candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a PARP-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors and >70% of randomly tested transcription factors localized to sites of DNA damage and approximately 90% were PARP-dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding domain-dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP-dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. PMID:26004182

  19. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    NASA Astrophysics Data System (ADS)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  20. Transforming properties of Felis catus papillomavirus type 2 E6 and E7 putative oncogenes in vitro and their transcriptional activity in feline squamous cell carcinoma in vivo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Altamura, Gennaro, E-mail: gennaro.altamura@unina.it; Corteggio, Annunziata, E-mail: ancorteg@unina.it; Pacini, Laura, E-mail: PaciniL@students.iarc.fr

    Felis catus papillomavirus type 2 (FcaPV2) DNA is found in feline cutaneous squamous cell carcinomas (SCCs); however, its biological properties are still uncharacterized. In this study, we successfully expressed FcaPV2 E6 and E7 putative oncogenes in feline epithelial cells and demonstrated that FcaPV2 E6 binds to p53, impairing its protein level. In addition, E6 and E7 inhibited ultraviolet B (UVB)-triggered accumulation of p53, p21 and pro-apoptotic markers such as Cleaved Caspase3, Bax and Bak, suggesting a synergistic action of the virus with UV exposure in tumour pathogenesis. Furthermore, FcaPV2 E7 bound to feline pRb and impaired pRb levels, resulting inmore » upregulation of the downstream pro-proliferative genes Cyclin A and Cdc2. Importantly, we demonstrated mRNA expression of FcaPV2 E2, E6 and E7 in feline SCC samples, strengthening the hypothesis of a causative role in the development of feline SCC. - Highlights: • FcaPV2 E6 binds to and deregulates feline p53 protein. • FcaPV2 E7 binds to and deregulates feline pRb protein. • FcaPV2 oncogenes inhibit UVB-induced apoptosis. • FcaPV2 E6E7 and E7 increase the lifespan of primary cells. • FcaPV2 E2, E6 and E7 are expressed at the mRNA level in feline SCC in vivo.« less

  1. A resource for characterizing genome-wide binding and putative target genes of transcription factors expressed during secondary growth and wood formation in Populus

    Treesearch

    Lijun Liu; Trevor Ramsay; Matthew S. Zinkgraf; David Sundell; Nathaniel Robert Street; Vladimir Filkov; Andrew Groover

    2015-01-01

    Identifying transcription factor target genes is essential for modeling the transcriptional networks underlying developmental processes. Here we report a chromatin immunoprecipitation sequencing (ChIP-seq) resource consisting of genome-wide binding regions and associated putative target genes for four Populus homeodomain transcription factors...

  2. Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

    PubMed

    Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng

    2014-10-07

    We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.

  3. Structure of Rot, a global regulator of virulence genes in Staphylococcus aureus.

    PubMed

    Zhu, Yuwei; Fan, Xiaojiao; Zhang, Xu; Jiang, Xuguang; Niu, Liwen; Teng, Maikun; Li, Xu

    2014-09-01

    Staphylococcus aureus is a highly versatile pathogen that can infect human tissue by producing a large arsenal of virulence factors that are tightly regulated by a complex regulatory network. Rot, which shares sequence similarity with SarA homologues, is a global regulator that regulates numerous virulence genes. However, the recognition model of Rot for the promoter region of target genes and the putative regulation mechanism remain elusive. In this study, the 1.77 Å resolution X-ray crystal structure of Rot is reported. The structure reveals that two Rot molecules form a compact homodimer, each of which contains a typical helix-turn-helix module and a β-hairpin motif connected by a flexible loop. Fluorescence polarization results indicate that Rot preferentially recognizes AT-rich dsDNA with ~30-base-pair nucleotides and that the conserved positively charged residues on the winged-helix motif are vital for binding to the AT-rich dsDNA. It is proposed that the DNA-recognition model of Rot may be similar to that of SarA, SarR and SarS, in which the helix-turn-helix motifs of each monomer interact with the major grooves of target dsDNA and the winged motifs contact the minor grooves. Interestingly, the structure shows that Rot adopts a novel dimerization model that differs from that of other SarA homologues. As expected, perturbation of the dimer interface abolishes the dsDNA-binding ability of Rot, suggesting that Rot functions as a dimer. In addition, the results have been further confirmed in vivo by measuring the transcriptional regulation of α-toxin, a major virulence factor produced by most S. aureus strains.

  4. ATM Protein Physically and Functionally Interacts with Proliferating Cell Nuclear Antigen to Regulate DNA Synthesis*

    PubMed Central

    Gamper, Armin M.; Choi, Serah; Matsumoto, Yoshihiro; Banerjee, Dibyendu; Tomkinson, Alan E.; Bakkenist, Christopher J.

    2012-01-01

    Ataxia telangiectasia (A-T) is a pleiotropic disease, with a characteristic hypersensitivity to ionizing radiation that is caused by biallelic mutations in A-T mutated (ATM), a gene encoding a protein kinase critical for the induction of cellular responses to DNA damage, particularly to DNA double strand breaks. A long known characteristic of A-T cells is their ability to synthesize DNA even in the presence of ionizing radiation-induced DNA damage, a phenomenon termed radioresistant DNA synthesis. We previously reported that ATM kinase inhibition, but not ATM protein disruption, blocks sister chromatid exchange following DNA damage. We now show that ATM kinase inhibition, but not ATM protein disruption, also inhibits DNA synthesis. Investigating a potential physical interaction of ATM with the DNA replication machinery, we found that ATM co-precipitates with proliferating cell nuclear antigen (PCNA) from cellular extracts. Using bacterially purified ATM truncation mutants and in vitro translated PCNA, we showed that the interaction is direct and mediated by the C terminus of ATM. Indeed, a 20-amino acid region close to the kinase domain is sufficient for strong binding to PCNA. This binding is specific to ATM, because the homologous regions of other PIKK members, including the closely related kinase A-T and Rad3-related (ATR), did not bind PCNA. ATM was found to bind two regions in PCNA. To examine the functional significance of the interaction between ATM and PCNA, we tested the ability of ATM to stimulate DNA synthesis by DNA polymerase δ, which is implicated in both DNA replication and DNA repair processes. ATM was observed to stimulate DNA polymerase activity in a PCNA-dependent manner. PMID:22362778

  5. Surface display of metal binding domain derived from PbrR on Escherichia coli specifically increases lead(II) adsorption.

    PubMed

    Hui, Chang-Ye; Guo, Yan; Yang, Xue-Qin; Zhang, Wen; Huang, Xian-Qing

    2018-05-01

    To improve the Pb 2+ biosorption capacity of the potential E. coli biosorbent, a putative Pb 2+ binding domain (PbBD) derived from PbrR was efficiently displayed on to the E. coli cell surface. The PbBD was obtained by truncating the N-terminal DNA-binding domain and C-terminal redundant amino acid residues of the Pb 2+ -sensing transcriptional factor PbrR. Whole-cell sorbents were constructed with the full-length PbrR and PbBD of PbrR genetically engineered onto the surface of E. coli cells using Lpp-OmpA as the anchor. Followed by a 1.71-fold higher display of PbBD than PbrR, the presence of PbBD on the surface of E. coli cells enabled a 1.92-fold higher Pb 2+ biosorption than that found in PbrR-displayed cells. Specific Pb 2+ binding via PbBD was the same as Pb 2+ binding via the full-length PbrR, with no observable decline even in the presence of Zn 2+ and Cd 2+ . Since surface-engineered E. coli cells with PbBD increased the Pb 2+ binding capacity and did not affect the adsorption selectivity, this suggests that surface display of the metal binding domain derived from MerR-like proteins may be used for the bioremediation of specific toxic heavy metals.

  6. Bombyx mori E26 transformation-specific 2 (BmEts2), an Ets family protein, represses Bombyx mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in the silkworm Bombyx mori.

    PubMed

    Tanaka, H; Sagisaka, A; Suzuki, N; Yamakawa, M

    2016-10-01

    E26 transformation-specific (Ets) family transcription factors are known to play roles in various biological phenomena, including immunity, in vertebrates. However, the mechanisms by which Ets proteins contribute to immunity in invertebrates remain poorly understood. In this study, we identified a cDNA encoding BmEts2, which is a putative orthologue of Drosophila Yan and human translocation-ets-leukemia/Ets-variant gene 6, from the silkworm Bombyx mori. Expression of the BmEts2 gene was significantly increased in the fat bodies of silkworm larvae in response to injection with Escherichia coli and Staphylococcus aureus. BmEts2 overexpression dramatically repressed B. mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in silkworm cells. Conversely, gene knockdown of BmEts2 significantly enhanced BmRels activity. In addition, two κB sites located on the 5' upstream region of cecropin B1 were found to be involved in the repression of BmRels-mediated promoter activation. Protein-competition analysis further demonstrated that BmEts2 competitively inhibited binding of BmRels to κB sites. Overall, BmEts2 acts as a repressor of BmRels-mediated transactivation of antimicrobial protein genes by inhibiting the binding of BmRels to κB sites. © 2016 The Royal Entomological Society.

  7. Controlling the response to DNA damage by the APC/C-Cdh1.

    PubMed

    de Boer, H Rudolf; Guerrero Llobet, S; van Vugt, Marcel A T M

    2016-03-01

    Proper cell cycle progression is safeguarded by the oscillating activities of cyclin/cyclin-dependent kinase complexes. An important player in the regulation of mitotic cyclins is the anaphase-promoting complex/cyclosome (APC/C), a multi-subunit E3 ubiquitin ligase. Prior to entry into mitosis, the APC/C remains inactive, which allows the accumulation of mitotic regulators. APC/C activation requires binding to either the Cdc20 or Cdh1 adaptor protein, which sequentially bind the APC/C and facilitate targeting of multiple mitotic regulators for proteasomal destruction, including Securin and Cyclin B, to ensure proper chromosome segregation and mitotic exit. Emerging data have indicated that the APC/C, particularly in association with Cdh1, also functions prior to mitotic entry. Specifically, the APC/C-Cdh1 is activated in response to DNA damage in G2 phase cells. These observations are in line with in vitro and in vivo genetic studies, in which cells lacking Cdh1 expression display various defects, including impaired DNA repair and aberrant cell cycle checkpoints. In this review, we summarize the current literature on APC/C regulation in response to DNA damage, the functions of APC/C-Cdh1 activation upon DNA damage, and speculate how APC/C-Cdh1 can control cell fate in the context of persistent DNA damage.

  8. Cell cycle-regulated oscillator coordinates core histone gene transcription through histone acetylation

    PubMed Central

    Kurat, Christoph F.; Lambert, Jean-Philippe; Petschnigg, Julia; Friesen, Helena; Pawson, Tony; Rosebrock, Adam; Gingras, Anne-Claude; Fillingham, Jeffrey; Andrews, Brenda

    2014-01-01

    DNA replication occurs during the synthetic (S) phase of the eukaryotic cell cycle and features a dramatic induction of histone gene expression for concomitant chromatin assembly. Ectopic production of core histones outside of S phase is toxic, underscoring the critical importance of regulatory pathways that ensure proper expression of histone genes. Several regulators of histone gene expression in the budding yeast Saccharomyces cerevisiae are known, yet the key oscillator responsible for restricting gene expression to S phase has remained elusive. Here, we show that suppressor of Ty (Spt)10, a putative histone acetyltransferase, and its binding partner Spt21 are key determinants of S-phase–specific histone gene expression. We show that Spt21 abundance is restricted to S phase in part by anaphase promoting complex Cdc20-homologue 1 (APCCdh1) and that it is recruited to histone gene promoters in S phase by Spt10. There, Spt21-Spt10 enables the recruitment of a cascade of regulators, including histone chaperones and the histone-acetyltransferase general control nonderepressible (Gcn) 5, which we hypothesize lead to histone acetylation and consequent transcription activation. PMID:25228766

  9. Identification of a differentially-expressed gene in fatty liver of overfeeding geese.

    PubMed

    Zhao, Ayong; Tang, Huachun; Lu, Sufang; He, Ruiguo

    2007-09-01

    In response to overfeeding, geese develop fatty liver. To understand the fattening mechanism, mRNA differential display reverse transcription PCR was used to study the gene expression differences between French Landes grey geese and Xupu white geese in conditions of overfeeding and normal feeding. One gene was found to be up-regulated in the fatty liver in both breeds, and it has a 1797 bp cDNA with 83% identity to chicken SELENBP1. The sequence analysis revealed that its open reading frame of 1413 bp encodes a protein of 471 amino acids, which contains a putative conserved domain of 56 kDa selenium binding protein with high homology to its homologues of chicken (95%), rat (86%), mouse (84%), human (86%), monkey (86%), dog (86%), and cattle (86%). The function of this protein has been briefly reviewed based on published information. In tissue expression analysis, the expression of geese SELENBP1 mRNA was found to be higher in liver or kidney than in other tested tissues. The results showed that overfeeding could increase the mRNA expression level of geese SELENBP1.

  10. Characterization of Plasmids in a Human Clinical Strain of Lactococcus garvieae

    PubMed Central

    Blanco, M. Mar; López-Campos, Guillermo H.; Cutuli, M. Teresa; Fernández-Garayzábal, José F.

    2012-01-01

    The present work describes the molecular characterization of five circular plasmids found in the human clinical strain Lactococcus garvieae 21881. The plasmids were designated pGL1-pGL5, with molecular sizes of 4,536 bp, 4,572 bp, 12,948 bp, 14,006 bp and 68,798 bp, respectively. Based on detailed sequence analysis, some of these plasmids appear to be mosaics composed of DNA obtained by modular exchange between different species of lactic acid bacteria. Based on sequence data and the derived presence of certain genes and proteins, the plasmid pGL2 appears to replicate via a rolling-circle mechanism, while the other four plasmids appear to belong to the group of lactococcal theta-type replicons. The plasmids pGL1, pGL2 and pGL5 encode putative proteins related with bacteriocin synthesis and bacteriocin secretion and immunity. The plasmid pGL5 harbors genes (txn, orf5 and orf25) encoding proteins that could be considered putative virulence factors. The gene txn encodes a protein with an enzymatic domain corresponding to the family actin-ADP-ribosyltransferases toxins, which are known to play a key role in pathogenesis of a variety of bacterial pathogens. The genes orf5 and orf25 encode two putative surface proteins containing the cell wall-sorting motif LPXTG, with mucin-binding and collagen-binding protein domains, respectively. These proteins could be involved in the adherence of L. garvieae to mucus from the intestine, facilitating further interaction with intestinal epithelial cells and to collagenous tissues such as the collagen-rich heart valves. To our knowledge, this is the first report on the characterization of plasmids in a human clinical strain of this pathogen. PMID:22768237

  11. The RNA-binding proteins Zfp36l1 and Zfp36l2 enforce the thymic β-selection checkpoint by limiting DNA damage response signaling and cell cycle progression

    PubMed Central

    Galloway, Alison; Ahlfors, Helena; Turner, Martin

    2016-01-01

    The RNA binding proteins Zfp36l1 and Zfp36l2 act redundantly to enforce the β-selection checkpoint during thymopoiesis, yet their molecular targets remain largely unknown. Here, we identify these targets on a genome wide scale in primary mouse thymocytes and show that Zfp36l1/l2 regulate DNA damage response and cell cycle transcripts to ensure proper β-selection. DN3 thymocytes lacking Zfp36l1/l2 share a gene expression profile with post-selected DN3b cells despite the absence of intracellular TCRβ and reduced IL-7 signaling. Our findings show that in addition to controlling the timing of proliferation at β-selection post-transcriptional control by Zfp36l1/l2 limits DNA damage responses which are known to promote thymocyte differentiation. Zfp36l1/l2 therefore act as post-transcriptional safeguards against chromosomal instability and replication stress by integrating pre-TCR and IL-7 signaling with DNA damage and cell cycle control. PMID:27566829

  12. Rhodium metalloinsertor binding generates a lesion with selective cytotoxicity for mismatch repair-deficient cells.

    PubMed

    Bailis, Julie M; Weidmann, Alyson G; Mariano, Natalie F; Barton, Jacqueline K

    2017-07-03

    The DNA mismatch repair (MMR) pathway recognizes and repairs errors in base pairing and acts to maintain genome stability. Cancers that have lost MMR function are common and comprise an important clinical subtype that is resistant to many standard of care chemotherapeutics such as cisplatin. We have identified a family of rhodium metalloinsertors that bind DNA mismatches with high specificity and are preferentially cytotoxic to MMR-deficient cells. Here, we characterize the cellular mechanism of action of the most potent and selective complex in this family, [Rh(chrysi)(phen)(PPO)] 2+ (Rh-PPO). We find that Rh-PPO binding induces a lesion that triggers the DNA damage response (DDR). DDR activation results in cell-cycle blockade and inhibition of DNA replication and transcription. Significantly, the lesion induced by Rh-PPO is not repaired in MMR-deficient cells, resulting in selective cytotoxicity. The Rh-PPO mechanism is reminiscent of DNA repair enzymes that displace mismatched bases, and is differentiated from other DNA-targeted chemotherapeutics such as cisplatin by its potency, cellular mechanism, and selectivity for MMR-deficient cells.

  13. SOX9 is targeted for proteasomal degradation by the E3 ligase FBW7 in response to DNA damage

    PubMed Central

    Hong, Xuehui; Liu, Wenyu; Song, Ruipeng; Shah, Jamie J.; Feng, Xing; Tsang, Chi Kwan; Morgan, Katherine M.; Bunting, Samuel F.; Inuzuka, Hiroyuki; Zheng, X. F. Steven; Shen, Zhiyuan; Sabaawy, Hatem E.; Liu, LianXin; Pine, Sharon R.

    2016-01-01

    SOX9 encodes a transcription factor that governs cell fate specification throughout development and tissue homeostasis. Elevated SOX9 is implicated in the genesis and progression of human tumors by increasing cell proliferation and epithelial-mesenchymal transition. We found that in response to UV irradiation or genotoxic chemotherapeutics, SOX9 is actively degraded in various cancer types and in normal epithelial cells, through a pathway independent of p53, ATM, ATR and DNA-PK. SOX9 is phosphorylated by GSK3β, facilitating the binding of SOX9 to the F-box protein FBW7α, an E3 ligase that functions in the DNA damage response pathway. The binding of FBW7α to the SOX9 K2 domain at T236-T240 targets SOX9 for subsequent ubiquitination and proteasomal destruction. Exogenous overexpression of SOX9 after genotoxic stress increases cell survival. Our findings reveal a novel regulatory mechanism for SOX9 stability and uncover a unique function of SOX9 in the cellular response to DNA damage. This new mechanism underlying a FBW7-SOX9 axis in cancer could have implications in therapy resistance. PMID:27566146

  14. Investigations of vibrational spectra and bioactivity of novel anticancer drug N-(6-ferrocenyl-2-naphthoyl)-gamma-amino butyric acid ethyl ester

    NASA Astrophysics Data System (ADS)

    Sudhi, Geethu; Rajina, S. R.; Praveen, S. G.; Xavier, T. S.; Kenny, Peter T. M.; Jaiswal-Nagar, D.; Binoy, J.

    2017-10-01

    The bioactivity of compounds is mainly dependent on molecular structure and the present work aims to explore the bonding features responsible for biological activity of novel anticancer drug N-(6-ferrocenyl-2-naphthoyl)-gamma-amino butyric acid ethyl ester (FNGABEE). In the present study, we investigate the molecular structural properties of newly synthesized title compound through experimental and quantum chemical studies. The detailed vibrational analysis has been performed using FT IR and FT Raman spectrum, aided by DFT computed geometry, vibrational spectrum, Eigen vector distribution and PED, at B3LYP/6-311 ++G(d,p) level. The resonance structure of naphthalene, different from that of benzene, revealed by molecular structure has been investigated using Csbnd C and Cdbnd C stretching modes. The proton transfer in amide has been analyzed to obtain spectral distinction between different carbonyl and Csbnd N groups which point to the reactive sites responsible for binding with DNA and bovine serum albumin (BSA). The spectral distinction between eclipsed and staggered form of ferrocene has been analyzed. The molecular docking of FNGABEE with BSA and DNA has been performed to find the strength of binding and the moieties responsible for the interactions. The experimental binding studies of FNGABEE with BSA and DNA has been performed using UV absorption spectroscopy and fluorometric assay, to find the nature and strength of binding.

  15. Functional Analysis of the Citrate Activator CitO from Enterococcus faecalis Implicates a Divalent Metal in Ligand Binding

    PubMed Central

    Blancato, Víctor S.; Pagliai, Fernando A.; Magni, Christian; Gonzalez, Claudio F.; Lorca, Graciela L.

    2016-01-01

    The regulator of citrate metabolism, CitO, from Enterococcus faecalis belongs to the FCD family within the GntR superfamily. In the presence of citrate, CitO binds to cis-acting sequences located upstream of the cit promoters inducing the expression of genes involved in citrate utilization. The quantification of the molecular binding affinities, performed by isothermal titration calorimetry (ITC), indicated that CitO has a high affinity for citrate (KD = 1.2 ± 0.2 μM), while it did not recognize other metabolic intermediates. Based on a structural model of CitO where a putative small molecule and a metal binding site were identified, it was hypothesized that the metal ion is required for citrate binding. In agreement with this model, citrate binding to CitO sharply decreased when the protein was incubated with EDTA. This effect was reverted by the addition of Ni2+, and Zn2+ to a lesser extent. Structure-based site-directed mutagenesis was conducted and it was found that changes to alanine in residues Arg97 and His191 resulted in decreased binding affinities for citrate, as determined by EMSA and ITC. Further assays using lacZ fusions confirmed that these residues in CitO are involved in sensing citrate in vivo. These results indicate that the molecular modifications induced by a ligand and a metal binding in the C-terminal domain of CitO are required for optimal DNA binding activity, and consequently, transcriptional activation. PMID:26903980

  16. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  17. Investigating DNA Binding and Conformational Variation in Temperature Sensitive p53 Cancer Mutants Using QM-MM Simulations

    PubMed Central

    Koulgi, Shruti; Achalere, Archana; Sonavane, Uddhavesh; Joshi, Rajendra

    2015-01-01

    The tp53 gene is found to be mutated in 50% of all the cancers. The p53 protein, a product of tp53 gene, is a multi-domain protein. It consists of a core DNA binding domain (DBD) which is responsible for its binding and transcription of downstream target genes. The mutations in p53 protein are responsible for creating cancerous conditions and are found to be occurring at a high frequency in the DBD region of p53. Some of these mutations are also known to be temperature sensitive (ts) in nature. They are known to exhibit partial or strong binding with DNA in the temperature range (298–306 K). Whereas, at 310 K and above they show complete loss in binding. We have analyzed the changes in binding and conformational behavior at 300 K and 310 K for three of the ts-mutants viz., V143A, R249S and R175H. QM-MM simulations have been performed on the wild type and the above mentioned ts-mutants for 30 ns each. The optimal estimate of free energy of binding for a particular number of interface hydrogen bonds was calculated using the maximum likelihood method as described by Chodera et. al (2007). This parameter has been observed to be able to mimic the binding affinity of the p53 ts-mutants at 300 K and 310 K. Thus the correlation between MM-GBSA free energy of binding and hydrogen bonds formed by the interface residues between p53 and DNA has revealed the temperature dependent nature of these mutants. The role of main chain dihedrals was obtained by performing dihedral principal component analysis (PCA). This analysis, suggests that the conformational variations in the main chain dihedrals (ϕ and ψ) of the p53 ts-mutants may have caused reduction in the overall stability of the protein. The solvent exposure of the side chains of the interface residues were found to hamper the binding of the p53 to the DNA. Solvent Accessible Surface Area (SASA) also proved to be a crucial property in distinguishing the conformers obtained at 300 K and 310 K for the three ts-mutants from the wild type at 300 K. PMID:26579714

  18. Xeroderma pigmentosum complementation group E and UV-damaged DNA-binding protein

    PubMed Central

    Tang, Jean; Chu, Gilbert

    2010-01-01

    UV-damaged DNA-binding protein (UV-DDB) is composed of two subunits, DDB1 (p127) and DDB2 (p48). Mutations in the DDB2 gene inactivate UV-DDB in individuals from complementation group E of xeroderma pigmentosum (XP-E), an autosomal recessive disease characterized by sun sensitivity, severe risk for skin cancer and defective nucleotide excision repair. UV-DDB is also deficient in many rodent tissues, exposing a shortcoming in rodent models for cancer. In vitro, UV-DDB binds to cyclobutane pyrimidine dimers (CPDs), 6–4 photoproducts and other DNA lesions, stimulating the excision of CPDs, and to a lesser extent, of 6–4 photoproducts. In vivo, UV-DDB plays an important role in the p53-dependent response of mammalian cells to DNA damage. When cells are exposed to UV, the resulting accumulation of p53 activates DDB2 transcription, which leads to increased levels of UV-DDB. Binding of UV-DDB to CPDs targets these lesions for global genomic repair, suppressing mutations without affecting UV survival. Apparently, cells are able to survive with unrepaired CPDs because of the activity of bypass DNA polymerases. Finally, there is evidence that UV-DDB may have roles in the cell that are distinct from DNA repair. PMID:12509284

  19. Elastin receptor (S-gal) occupancy by elastin peptides modulates T-cell response during murine emphysema.

    PubMed

    Meghraoui-Kheddar, Aïda; Pierre, Alexandre; Sellami, Mehdi; Audonnet, Sandra; Lemaire, Flora; Le Naour, Richard

    2017-09-01

    Chronic obstructive pulmonary disease and emphysema are associated with increased elastin peptides (EP) production because of excessive breakdown of lung connective tissue. We recently reported that exposure of mice to EP elicited hallmark features of emphysema. EP effects are largely mediated through a receptor complex that includes the elastin-binding protein spliced-galactosidase (S-gal). In previous studies, we established a correlation between cytokine production and S-gal protein expression in EP-treated immune cells. In this study, we investigated the S-gal-dependent EP effects on T-helper (Th) and T-cytotoxic (Tc) responses during murine EP-triggered pulmonary inflammation. C57BL/6J mice were endotracheally instilled with the valine-glycine-valine-alanine-proline-glycine (VGVAPG) elastin peptide, and, 21 days after treatment, local and systemic T-lymphocyte phenotypes were analyzed at cytokine and transcription factor expression levels by multicolor flow cytometry. Exposure of mice to the VGVAPG peptide resulted in a significant increase in the proportion of the CD4 + and CD8 + T cells expressing the cytokines IFN-γ or IL-17a and the transcription factors T-box expressed in T cells or retinoic acid-related orphan receptor-γt (RORγt) without effects on IL-4 and Gata-binding protein 3 to DNA sequence [A/T]GATA[A/G] expression. These effects were maximized when each T-cell subpopulation was challenged ex vivo with EP, and they were inhibited in vivo when an analogous peptide antagonizing the EP/S-gal interactions was instilled together with the VGVAPG peptide. This study demonstrates that, during murine emphysema, EP-S-gal interactions contribute to a Th-1 and Th-17 proinflammatory T-cell response combined with a Tc-1 response. Our study also highlights the S-gal receptor as a putative pharmacological target to modulate such an immune response. Copyright © 2017 the American Physiological Society.

  20. DIRECT BINDING OF GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE TO TELOMERIC DNA PROTECTS TELOMERES AGAINST CHEMOTHERAPY-INDUCED RAPID DEGRADATION

    PubMed Central

    Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher

    2009-01-01

    GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890

Top