Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease

PubMed Central

Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John

2012-01-01

Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703

RNA Interference for improving the Outcome of Islet Transplantation

PubMed Central

Li, Feng; Mahato, Ram I

2010-01-01

Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190

Ethical Perspectives on RNA Interference Therapeutics

PubMed Central

Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou

2008-01-01

RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370

siRNA and innate immunity.

PubMed

Robbins, Marjorie; Judge, Adam; MacLachlan, Ian

2009-06-01

Canonical small interfering RNA (siRNA) duplexes are potent activators of the mammalian innate immune system. The induction of innate immunity by siRNA is dependent on siRNA structure and sequence, method of delivery, and cell type. Synthetic siRNA in delivery vehicles that facilitate cellular uptake can induce high levels of inflammatory cytokines and interferons after systemic administration in mammals and in primary human blood cell cultures. This activation is predominantly mediated by immune cells, normally via a Toll-like receptor (TLR) pathway. The siRNA sequence dependency of these pathways varies with the type and location of the TLR involved. Alternatively nonimmune cell activation may also occur, typically resulting from siRNA interaction with cytoplasmic RNA sensors such as RIG1. As immune activation by siRNA-based drugs represents an undesirable side effect due to the considerable toxicities associated with excessive cytokine release in humans, understanding and abrogating this activity will be a critical component in the development of safe and effective therapeutics. This review describes the intracellular mechanisms of innate immune activation by siRNA, the design of appropriate sequences and chemical modification approaches, and suitable experimental methods for studying their effects, with a view toward reducing siRNA-mediated off-target effects.

Misinterpreting the therapeutic effects of small interfering RNA caused by immune stimulation.

PubMed

Robbins, Marjorie; Judge, Adam; Ambegia, Ellen; Choi, Catherine; Yaworski, Ed; Palmer, Lorne; McClintock, Kevin; MacLachlan, Ian

2008-10-01

Activation of innate immunity has direct effects in modulating viral replication, tumor growth, angiogenesis, and inflammatory and other immunological processes. It is now established that unmodified siRNA can activate this innate immune response and therefore there is real potential for siRNA to elicit nonspecific therapeutic effects in a wide range of disease models. Here we demonstrate that in a murine model of influenza infection, the antiviral activity of siRNA is due primarily to immune stimulation elicited by the active siRNA duplexes and is not the result of therapeutic RNA interference (RNAi) as previously reported. We show that the misinterpretation stems from the use of a particular control green fluorescent protein (GFP) siRNA that we identify as having unusually low immunostimulatory activity compared with the active anti-influenza siRNA. Curiously, this GFP siRNA has served as a negative control for a surprising number of groups reporting therapeutic effects of siRNA. The inert immunologic profile of the GFP sequence was unique among a broad panel of published siRNAs, all of which could elicit significant interferon induction from primary immune cells. This panel included eight active siRNAs against viral, angiogenic, and oncologic targets, the reported therapeutic efficacy of which was based on comparison with the nonimmunostimulatory GFP siRNA. These results emphasize the need for researchers to anticipate, monitor, and adequately control for siRNA-mediated immune stimulation and calls into question the interpretation of numerous published reports of therapeutic RNAi in vivo. The use of chemically modified siRNA with minimal immunostimulatory capacity will help to delineate more accurately the mechanism of action underlying such studies.

RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

PubMed Central

Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

2016-01-01

Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

Flavivirus RNAi suppression: decoding non-coding RNA.

PubMed

Pijlman, Gorben P

2014-08-01

Flaviviruses are important human pathogens that are transmitted by invertebrate vectors, mostly mosquitoes and ticks. During replication in their vector, flaviviruses are subject to a potent innate immune response known as antiviral RNA interference (RNAi). This defense mechanism is associated with the production of small interfering (si)RNA that lead to degradation of viral RNA. To what extent flaviviruses would benefit from counteracting antiviral RNAi is subject of debate. Here, the experimental evidence to suggest the existence of flavivirus RNAi suppressors is discussed. I will highlight the putative role of non-coding, subgenomic flavivirus RNA in suppression of RNAi in insect and mammalian cells. Novel insights from ongoing research will reveal how arthropod-borne viruses modulate innate immunity including antiviral RNAi. Copyright © 2014 Elsevier B.V. All rights reserved.

A simple and robust vector-based shRNA expression system used for RNA interference.

PubMed

Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

2013-01-01

RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

RNA interference for performance enhancement and detection in doping control.

PubMed

Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

2011-10-01

RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.

Ebolavirus proteins suppress the effects of small interfering RNA by direct interaction with the mammalian RNA interference pathway.

PubMed

Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J

2011-03-01

Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.

RNA interference-based nanosystems for inflammatory bowel disease therapy

PubMed Central

Guo, Jian; Jiang, Xiaojing; Gui, Shuangying

2016-01-01

Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943

A yeast-based assay identifies drugs that interfere with immune evasion of the Epstein-Barr virus.

PubMed

Voisset, Cécile; Daskalogianni, Chrysoula; Contesse, Marie-Astrid; Mazars, Anne; Arbach, Hratch; Le Cann, Marie; Soubigou, Flavie; Apcher, Sébastien; Fåhraeus, Robin; Blondel, Marc

2014-04-01

Epstein-Barr virus (EBV) is tightly associated with certain human cancers, but there is as yet no specific treatment against EBV-related diseases. The EBV-encoded EBNA1 protein is essential to maintain viral episomes and for viral persistence. As such, EBNA1 is expressed in all EBV-infected cells, and is highly antigenic. All infected individuals, including individuals with cancer, have CD8(+) T cells directed towards EBNA1 epitopes, yet the immune system fails to detect and destroy cells harboring the virus. EBV immune evasion depends on the capacity of the Gly-Ala repeat (GAr) domain of EBNA1 to inhibit the translation of its own mRNA in cis, thereby limiting the production of EBNA1-derived antigenic peptides presented by the major histocompatibility complex (MHC) class I pathway. Here we establish a yeast-based assay for monitoring GAr-dependent inhibition of translation. Using this assay we identify doxorubicin (DXR) as a compound that specifically interferes with the GAr effect on translation in yeast. DXR targets the topoisomerase-II-DNA complexes and thereby causes genomic damage. We show, however, that the genotoxic effect of DXR and various analogs thereof is uncoupled from the effect on GAr-mediated translation control. This is further supported by the observation that etoposide and teniposide, representing another class of topoisomerase-II-DNA targeting drugs, have no effect on GAr-mediated translation control. DXR and active analogs stimulate, in a GAr-dependent manner, EBNA1 expression in mammalian cells and overcome GAr-dependent restriction of MHC class I antigen presentation. These results validate our approach as an effective high-throughput screening assay to identify drugs that interfere with EBV immune evasion and, thus, constitute candidates for treating EBV-related diseases, in particular EBV-associated cancers.

A yeast model for the mechanism of the Epstein-Barr virus immune evasion identifies a new therapeutic target to interfere with the virus stealthiness.

PubMed

Lista, María José; Martins, Rodrigo Prado; Angrand, Gaelle; Quillévéré, Alicia; Daskalogianni, Chrysoula; Voisset, Cécile; Teulade-Fichou, Marie-Paule; Fåhraeus, Robin; Blondel, Marc

2017-08-31

The oncogenic Epstein-Barr virus (EBV) evades the immune system but has an Achilles heel: its genome maintenance protein EBNA1. Indeed, EBNA1 is essential for viral genome replication and maintenance but also highly antigenic. Hence, EBV evolved a system in which the glycine-alanine repeat (GAr) of EBNA1 limits the translation of its own mRNA at a minimal level to ensure its essential function thereby, at the same time, minimizing immune recognition. Defining intervention points where to interfere with EBNA1 immune evasion is an important step to trigger an immune response against EBV-carrying cancers. Thanks to a yeast-based assay that recapitulates all the aspects of EBNA1 self-limitation of expression, a recent study by Lista et al. [Nature Communications (2017) 7, 435-444] has uncovered the role of the host cell nucleolin (NCL) in this process via a direct interaction of this protein with G-quadruplexes (G4) formed in GAr-encoding sequence of EBNA1 mRNA. In addition, the G4 ligand PhenDC3 prevents NCL binding on EBNA1 mRNA and reverses GAr-mediated repression of translation and antigen presentation. This shows that the NCL-EBNA1 mRNA interaction is a relevant therapeutic target to unveil EBV-carrying cancers to the immune system and that the yeast model can be successfully used for uncovering drugs and host factors that interfere with EBV stealthiness.

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences.

PubMed

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.

Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

PubMed Central

Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

2018-01-01

RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

Modeling RNA interference in mammalian cells

PubMed Central

2011-01-01

Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of

Symbiont-mediated RNA interference in insects

PubMed Central

Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.

2016-01-01

RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963

Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.

PubMed Central

Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K

1995-01-01

We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978

Generation of siRNA Nanosheets for Efficient RNA Interference

NASA Astrophysics Data System (ADS)

Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum

2016-04-01

After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.

An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

PubMed

Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

2015-02-13

The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

An Active Immune Defense with a Minimal CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA and without the Cas6 Protein*

PubMed Central

Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita

2015-01-01

The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

Potential applications of RNA interference-based therapeutics in the treatment of cardiovascular disease.

PubMed

Hassan, Ali

2006-06-01

RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.

Prokaryotic Argonautes - variations on the RNA interference theme.

PubMed

van der Oost, John; Swarts, Daan C; Jore, Matthijs M

2014-04-15

The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.

Prokaryotic Argonautes - variations on the RNA interference theme

PubMed Central

van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.

2014-01-01

The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239

Prediction of effective RNA interference targets and pathway-related genes in lepidopteran insects by RNA sequencing analysis.

PubMed

Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia

2018-06-01

When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.

RNA interference-based therapeutics for inherited long QT syndrome.

PubMed

Li, Guoliang; Ma, Shuting; Sun, Chaofeng

2015-08-01

Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.

RNA interference-based therapeutics for inherited long QT syndrome

PubMed Central

LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG

2015-01-01

Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327

Advance of RNA interference technique in Hemipteran insects.

PubMed

Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia

2012-07-24

RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

RNA Interference in Infectious Tropical Diseases

PubMed Central

Hong, Young S.

2008-01-01

Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671

The RNA-Editing Enzyme ADAR1 Controls Innate Immune Responses to RNA

PubMed Central

Mannion, Niamh M.; Greenwood, Sam M.; Young, Robert; Cox, Sarah; Brindle, James; Read, David; Nellåker, Christoffer; Vesely, Cornelia; Ponting, Chris P.; McLaughlin, Paul J.; Jantsch, Michael F.; Dorin, Julia; Adams, Ian R.; Scadden, A.D.J.; Öhman, Marie; Keegan, Liam P.; O’Connell, Mary A.

2014-01-01

Summary The ADAR RNA-editing enzymes deaminate adenosine bases to inosines in cellular RNAs. Aberrant interferon expression occurs in patients in whom ADAR1 mutations cause Aicardi-Goutières syndrome (AGS) or dystonia arising from striatal neurodegeneration. Adar1 mutant mouse embryos show aberrant interferon induction and die by embryonic day E12.5. We demonstrate that Adar1 embryonic lethality is rescued to live birth in Adar1; Mavs double mutants in which the antiviral interferon induction response to cytoplasmic double-stranded RNA (dsRNA) is prevented. Aberrant immune responses in Adar1 mutant mouse embryo fibroblasts are dramatically reduced by restoring the expression of editing-active cytoplasmic ADARs. We propose that inosine in cellular RNA inhibits antiviral inflammatory and interferon responses by altering RLR interactions. Transfecting dsRNA oligonucleotides containing inosine-uracil base pairs into Adar1 mutant mouse embryo fibroblasts reduces the aberrant innate immune response. ADAR1 mutations causing AGS affect the activity of the interferon-inducible cytoplasmic isoform more severely than the nuclear isoform. PMID:25456137

The RNA-editing enzyme ADAR1 controls innate immune responses to RNA.

PubMed

Mannion, Niamh M; Greenwood, Sam M; Young, Robert; Cox, Sarah; Brindle, James; Read, David; Nellåker, Christoffer; Vesely, Cornelia; Ponting, Chris P; McLaughlin, Paul J; Jantsch, Michael F; Dorin, Julia; Adams, Ian R; Scadden, A D J; Ohman, Marie; Keegan, Liam P; O'Connell, Mary A

2014-11-20

The ADAR RNA-editing enzymes deaminate adenosine bases to inosines in cellular RNAs. Aberrant interferon expression occurs in patients in whom ADAR1 mutations cause Aicardi-Goutières syndrome (AGS) or dystonia arising from striatal neurodegeneration. Adar1 mutant mouse embryos show aberrant interferon induction and die by embryonic day E12.5. We demonstrate that Adar1 embryonic lethality is rescued to live birth in Adar1; Mavs double mutants in which the antiviral interferon induction response to cytoplasmic double-stranded RNA (dsRNA) is prevented. Aberrant immune responses in Adar1 mutant mouse embryo fibroblasts are dramatically reduced by restoring the expression of editing-active cytoplasmic ADARs. We propose that inosine in cellular RNA inhibits antiviral inflammatory and interferon responses by altering RLR interactions. Transfecting dsRNA oligonucleotides containing inosine-uracil base pairs into Adar1 mutant mouse embryo fibroblasts reduces the aberrant innate immune response. ADAR1 mutations causing AGS affect the activity of the interferon-inducible cytoplasmic isoform more severely than the nuclear isoform. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Vector-based RNA interference against vascular endothelial growth factor-A significantly limits vascularization and growth of prostate cancer in vivo.

PubMed

Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia

2005-12-01

RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.

RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.

PubMed

Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F

2005-01-01

In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.

RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans

PubMed Central

Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.

2005-01-01

In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635

Chemical modification: the key to clinical application of RNA interference?

PubMed Central

Corey, David R.

2007-01-01

RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019

Self-adjuvanted mRNA vaccines induce local innate immune responses that lead to a potent and boostable adaptive immunity.

PubMed

Kowalczyk, Aleksandra; Doener, Fatma; Zanzinger, Kai; Noth, Janine; Baumhof, Patrick; Fotin-Mleczek, Mariola; Heidenreich, Regina

2016-07-19

mRNA represents a new platform for the development of therapeutic and prophylactic vaccines with high flexibility with respect to production and application. We have previously shown that our two component self-adjuvanted mRNA-based vaccines (termed RNActive® vaccines) induce balanced immune responses comprising both humoral and cellular effector as well as memory responses. Here, we evaluated the early events upon intradermal application to gain more detailed insights into the underlying mode of action of our mRNA-based vaccine. We showed that the vaccine is taken up in the skin by both non-leukocytic and leukocytic cells, the latter being mostly represented by antigen presenting cells (APCs). mRNA was then transported to the draining lymph nodes (dLNs) by migratory dendritic cells. Moreover, the encoded protein was expressed and efficiently presented by APCs within the dLNs as shown by T cell proliferation and immune cell activation, followed by the induction of the adaptive immunity. Importantly, the immunostimulation was limited to the injection site and lymphoid organs as no proinflammatory cytokines were detected in the sera of the immunized mice indicating a favorable safety profile of the mRNA-based vaccines. Notably, a substantial boostability of the immune responses was observed, indicating that mRNA can be used effectively in repetitive immunization schedules. The evaluation of the immunostimulation following prime and boost vaccination revealed no signs of exhaustion as demonstrated by comparable levels of cytokine production at the injection site and immune cell activation within dLNs. In summary, our data provide mechanistic insight into the mode of action and a rational for the use of mRNA-based vaccines as a promising immunization platform. Copyright © 2016 Elsevier Ltd. All rights reserved.

RNA Interference Therapies for an HIV-1 Functional Cure.

PubMed

Scarborough, Robert J; Gatignol, Anne

2017-12-27

HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.

Photoinduced RNA interference.

PubMed

Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi

2012-07-17

Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of

Cardiovascular RNA interference therapy: the broadening tool and target spectrum.

PubMed

Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina

2013-08-16

Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.

RNA interference of GGTA1 physiological and immune functions in immortalized porcine aortic endothelial cells.

PubMed

Han, Wei; Zhou, Jingshi; Li, Xiao; Wang, Jianfeng; Li, Junjie; Zhang, Zhuochao; Yang, Zhaoxu; Wang, Desheng; Tao, Kaishan; Dou, Kefeng

2013-11-01

Pig organs are commonly used in xenotransplantation, and α-1,3-galactose has been shown to be the main cause of hyperacute rejection. The development of transgenic pigs that lack α-1,3-galactosyltransferase (GGTA1) has overcome this problem to a certain extent, but transgenic pigs are difficult to maintain, making their usefulness in basic research limited. For this reason, we propose to establish a cell model to study hyperacute rejection. Immortalized primary porcine aortic endothelial cells were transfected with a short hairpin RNA targeted to GGTA1. Cell proliferation, apoptosis, complement C3 activation, and the binding of human immunoglobulins and components of the complement system, including IgM, IgG, C3, and C5b-9, were examined. After RNA interference, GGTA1 was found to be reduced at both the transcript and protein level as assessed by quantitative polymerase chain reaction and flow cytometry, respectively. When cultured in the presence of human serum, the proliferation rate of the transfected cells was higher than that of untransfected cells, and the apoptosis rate was lower. Additionally, activation of C3 and the binding of human immunoglobulins IgM and IgG and complement component C3 and C5b-9 to the transfected cells were lower than in the immortalized group but higher than in untransfected cells. RNA interference of GGTA1 in cultured porcine endothelial cells reduces the reaction of immunoglobulin and complement system with the cells. Therefore, this in vitro cell model could be useful for further study of xenotransplantation. Copyright © 2013 Elsevier Inc. All rights reserved.

Multimodality Imaging of RNA Interference

PubMed Central

Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo

2013-01-01

The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567

Delivery of RNA interference therapeutics using polycation-based nanoparticles.

PubMed

Howard, Kenneth Alan

2009-07-25

RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.

Abasic pivot substitution harnesses target specificity of RNA interference

PubMed Central

Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook

2015-01-01

Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372

RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon.

PubMed Central

Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M

1999-01-01

In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456

RNA interference: from biology to drugs and therapeutics.

PubMed

Appasani, Krishnarao

2004-07-01

RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.

Exploiting CRISPR/Cas: Interference Mechanisms and Applications

PubMed Central

Richter, Hagen; Randau, Lennart; Plagens, André

2013-01-01

The discovery of biological concepts can often provide a framework for the development of novel molecular tools, which can help us to further understand and manipulate life. One recent example is the elucidation of the prokaryotic adaptive immune system, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) that protects bacteria and archaea against viruses or conjugative plasmids. The immunity is based on small RNA molecules that are incorporated into versatile multi-domain proteins or protein complexes and specifically target viral nucleic acids via base complementarity. CRISPR/Cas interference machines are utilized to develop novel genome editing tools for different organisms. Here, we will review the latest progress in the elucidation and application of prokaryotic CRISPR/Cas systems and discuss possible future approaches to exploit the potential of these interference machineries. PMID:23857052

Exploiting CRISPR/Cas: interference mechanisms and applications.

PubMed

Richter, Hagen; Randau, Lennart; Plagens, André

2013-07-12

The discovery of biological concepts can often provide a framework for the development of novel molecular tools, which can help us to further understand and manipulate life. One recent example is the elucidation of the prokaryotic adaptive immune system, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) that protects bacteria and archaea against viruses or conjugative plasmids. The immunity is based on small RNA molecules that are incorporated into versatile multi-domain proteins or protein complexes and specifically target viral nucleic acids via base complementarity. CRISPR/Cas interference machines are utilized to develop novel genome editing tools for different organisms. Here, we will review the latest progress in the elucidation and application of prokaryotic CRISPR/Cas systems and discuss possible future approaches to exploit the potential of these interference machineries.

Deletion of Cytoplasmic Double-Stranded RNA Sensors Does Not Uncover Viral Small Interfering RNA Production in Human Cells.

PubMed

Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M; van Rij, Ronald P

2017-01-01

Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in mammals is the subject of debate. In vertebrates, recognition of viral RNA induces a sophisticated type I interferon (IFN)-based immune response, and it has been proposed that this response masks or inhibits antiviral RNAi. To test this hypothesis, we analyzed viral small RNA production in differentiated cells deficient in the cytoplasmic RNA sensors RIG-I and MDA5. We did not detect 22-nucleotide (nt) viral siRNAs upon infection with three different positive-sense RNA viruses. Our data suggest that the depletion of cytoplasmic RIG-I-like sensors is not sufficient to uncover viral siRNAs in differentiated cells. IMPORTANCE The contribution of the RNA interference (RNAi) pathway in antiviral immunity in vertebrates has been widely debated. It has been proposed that RNAi possesses antiviral activity in mammalian systems but that its antiviral effect is masked by the potent antiviral interferon response in differentiated mammalian cells. In this study, we show that inactivation of the interferon response is not sufficient to uncover antiviral activity of RNAi in human epithelial cells infected with three wild-type positive-sense RNA viruses.

Enhanced susceptibility of cancer cells to oncolytic rhabdo-virotherapy by expression of Nodamura virus protein B2 as a suppressor of RNA interference.

PubMed

Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S

2018-06-19

Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.

RNA sensor LGP2 inhibits TRAF ubiquitin ligase to negatively regulate innate immune signaling.

PubMed

Parisien, Jean-Patrick; Lenoir, Jessica J; Mandhana, Roli; Rodriguez, Kenny R; Qian, Kenin; Bruns, Annie M; Horvath, Curt M

2018-06-01

The production of type I interferon (IFN) is essential for cellular barrier functions and innate and adaptive antiviral immunity. In response to virus infections, RNA receptors RIG-I and MDA5 stimulate a mitochondria-localized signaling apparatus that uses TRAF family ubiquitin ligase proteins to activate master transcription regulators IRF3 and NFκB, driving IFN and antiviral target gene expression. Data indicate that a third RNA receptor, LGP2, acts as a negative regulator of antiviral signaling by interfering with TRAF family proteins. Disruption of LGP2 expression in cells results in earlier and overactive transcriptional responses to virus or dsRNA LGP2 associates with the C-terminus of TRAF2, TRAF3, TRAF5, and TRAF6 and interferes with TRAF ubiquitin ligase activity. TRAF interference is independent of LGP2 ATP hydrolysis, RNA binding, or its C-terminal domain, and LGP2 can regulate TRAF-mediated signaling pathways in trans , including IL-1β, TNFα, and cGAMP These findings provide a unique mechanism for LGP2 negative regulation through TRAF suppression and extend the potential impact of LGP2 negative regulation beyond the IFN antiviral response. © 2018 The Authors.

Long noncoding RNA in hematopoiesis and immunity.

PubMed

Satpathy, Ansuman T; Chang, Howard Y

2015-05-19

Dynamic gene expression during cellular differentiation is tightly coordinated by transcriptional and post-transcriptional mechanisms. An emerging theme is the central role of long noncoding RNAs (lncRNAs) in the regulation of this specificity. Recent advances demonstrate that lncRNAs are expressed in a lineage-specific manner and control the development of several cell types in the hematopoietic system. Moreover, specific lncRNAs are induced to modulate innate and adaptive immune responses. lncRNAs can function via RNA-DNA, RNA-RNA, and RNA-protein target interactions. As a result, they affect several stages of gene regulation, including chromatin modification, mRNA biogenesis, and protein signaling. We discuss recent advances, future prospects, and challenges in understanding the roles of lncRNAs in immunity and immune-mediated diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

[Innate immune response to RNA virus infection].

PubMed

Oshiumi, Hiroyuki; Matsumoto, Misako; Seya, Tsukasa

2011-12-01

Viral RNA is recognized by RIG-I-like receptors and Toll-like receptors. RIG-I is a cytoplasmic viral RNA sensor. High Mobility Group Box (HMGB) proteins and DExD/H box RNA helicases, such as DDX3 and 60, associate with viral RNA. Those proteins promotes the RIG-I binding to viral RNA. RIG-I triggers the signal via IPS-1 adaptor molecule to induce type I IFN. RIG-I harbors Lys63-linked polyubiquitination by Riplet and TRIM25 ubiquitin ligases. The polyubiquitination is essential for RIG-I-mediated signaling. Toll-like receptors are located in endosome. TLR3 recognizes viral double-stranded RNA, and TLR7 and 8 recognize single-strand RNA. Virus has the ability to suppress these innate immune response. For example, to inhibit RIG-I-mediated signaling, HCV core protein suppresses the function of DDX3. In addition, HCV NS3-4A protein cleaves IPS-1 to inhibit the signal. Molecular mechanism of how viral RNA is recognized by innate immune system will make great progress on our understanding of how virus escapes from host immune system.

EGFP-EGF1-Conjugated PLGA Nanoparticles for Targeted Delivery of siRNA into Injured Brain Microvascular Endothelial Cells for Efficient RNA Interference

PubMed Central

Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu

2013-01-01

Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330

Induction of protective immunity against toxoplasmosis in mice by immunization with Toxoplasma gondii RNA.

PubMed

Dimier-Poisson, Isabelle; Aline, Fleur; Bout, Daniel; Mévélec, Marie-Noëlle

2006-03-06

Toxoplasma gondii enters the mucosal surfaces of the host, and so immunity at these sites is of major interest. Due to the compartmentalization of the immune response, systemic immunization does not induce high levels of immunity at mucosal surfaces. Intranasal immunization has been shown to be very effective in inducing both systemic and mucosal immune responses. Immunization with mRNA can induce both humoral and cell-mediated immune responses, both of which are important in conferring immunity to T. gondii. The efficacy of RNA vaccination by the nasal route with T. gondii RNA was evaluated. We assessed the percentage of cumulative survival after an oral challenge with a lethal dose of T. gondii cysts (40 cysts), and the number of brain cysts following a challenge with a sublethal dose of T. gondii 76 K cysts (15 cysts). Vaccinated mice were found to be significantly better protected than non-immunized mice after a challenge with a lethal dose of cysts; and a challenge with a sublethal dose also resulted in fewer brain cysts than in non-immunized mice. Sera and intestinal secretions of immunized mice recognized T. gondii antigens, suggesting that a specific humoral immune response may occur. Moreover, a specific lymphoproliferative response observed in cervical lymph nodes may confer protection. These preliminary findings suggest that RNA vaccination by a mucosal route could be feasible.

Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.

PubMed

Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M

2018-05-01

Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.

Cas5d Protein Processes Pre-crRNA and Assembles into a Cascade-like Interference Complex in Subtype I-C/Dvulg CRISPR-Cas System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nam, Ki Hyun; Haitjema, Charles; Liu, Xueqi

Clustered regularly interspaced short palindromic repeats (CRISPRs), together with an operon of CRISPR-associated (Cas) proteins, form an RNA-based prokaryotic immune system against exogenous genetic elements. Cas5 family proteins are found in several type I CRISPR-Cas systems. Here, we report the molecular function of subtype I-C/Dvulg Cas5d from Bacillus halodurans. We show that Cas5d cleaves pre-crRNA into unit length by recognizing both the hairpin structure and the 3 single stranded sequence in the CRISPR repeat region. Cas5d structure reveals a ferredoxin domain-based architecture and a catalytic triad formed by Y46, K116, and H117 residues. We further show that after pre-crRNA processing,more » Cas5d assembles with crRNA, Csd1, and Csd2 proteins to form a multi-sub-unit interference complex similar to Escherichia coli Cascade (CRISPR-associated complex for antiviral defense) in architecture. Our results suggest that formation of a crRNA-presenting Cascade-like complex is likely a common theme among type I CRISPR subtypes.« less

Engineering intranasal mRNA vaccines to enhance lymph node trafficking and immune responses.

PubMed

Li, Man; Li, You; Peng, Ke; Wang, Ying; Gong, Tao; Zhang, Zhirong; He, Qin; Sun, Xun

2017-12-01

Intranasal mRNA vaccination provides immediate immune protection against pandemic diseases. Recent studies have shown that diverse forms of polyethyleneimine (PEI) have potent mucosal adjuvant activity, which could significantly facilitate the delivery of intranasal mRNA vaccines. Nevertheless, optimizing the chemical structure of PEI to maximize its adjuvanticity and decrease its toxicity remains a challenge. Here we show that the chemical structure of PEI strongly influences how well nanocomplexes of PEI and mRNA migrate to the lymph nodes and elicit immune responses. Conjugating cyclodextrin (CD) with PEI600 or PEI2k yielded CP (CD-PEI) polymers with different CD/PEI ratios. We analyzed the delivery efficacy of CP600, CP2k, and PEI25k as intranasal mRNA vaccine carriers by evaluating the lymph nodes migration and immune responses. Among these polymers, CP2k/mRNA showed significantly higher in vitro transfection efficiency, stronger abilities to migrate to lymph nodes and stimulate dendritic cells maturation in vivo, which further led to potent humoral and cellular immune responses, and showed lower local and systemic toxicity than PEI25k/mRNA. These results demonstrate the potential of CD-PEI2k/mRNA nanocomplex as a self-adjuvanting vaccine delivery vehicle that traffics to lymph nodes with high efficiency. As we face outbreaks of pandemic diseases such as Zika virus, intranasal mRNA vaccination provides instant massive protection against highly variant viruses. Various polymer-based delivery systems have been successfully applied in intranasal vaccine delivery. However, the influence of molecular structure of the polymeric carriers on the lymph node trafficking and dendritic cell maturation is seldom studied for intranasal vaccination. Therefore, engineering polymer-based vaccine delivery system and elucidating the relationship between molecular structure and the intranasal delivery efficiency are essential for maximizing the immune responses. We hereby

Modulating the tumor microenvironment with RNA interference as a cancer treatment strategy.

PubMed

Zins, Karin; Sioud, Mouldy; Aharinejad, Seyedhossein; Lucas, Trevor; Abraham, Dietmar

2015-01-01

The tumor microenvironment is composed of accessory cells and immune cells in addition to extracellular matrix (ECM) components. The stromal compartment interacts with cancer cells in a complex crosstalk to support tumor development. Growth factors and cytokines produced by stromal cells support the growth of tumor cells and promote interaction with the vasculature to enhance tumor progression and invasion. The activation of autocrine and paracrine oncogenic signaling pathways by growth factors, cytokines, and proteases derived from both tumor cells and the stromal compartment is thought to play a major role in assisting tumor cells during metastasis. Consequently, targeting tumor-stroma interactions by RNA interference (RNAi)-based approaches is a promising strategy in the search for novel treatment modalities in human cancer. Recent advances in packaging technology including the use of polymers, peptides, liposomes, and nanoparticles to deliver small interfering RNAs (siRNAs) into target cells may overcome limitations associated with potential RNAi-based therapeutics. Newly developed nonviral gene delivery approaches have shown improved anticancer efficacy suggesting that RNAi-based therapeutics provide novel opportunities to elicit significant gene silencing and induce regression of tumor growth. This chapter summarizes our current understanding of the tumor microenvironment and highlights some potential targets for therapeutic intervention with RNAi-based cancer therapeutics.

RNA interference-based therapeutics: new strategies to fight infectious disease.

PubMed

López-Fraga, M; Wright, N; Jiménez, A

2008-12-01

For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise "undruggable" with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAi-therapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.

Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.

PubMed

Hernández, Armando R; Peterson, Larryn W; Kool, Eric T

2012-08-17

Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.

Silence of the transcripts: RNA interference in medicine.

PubMed

Barik, Sailen

2005-10-01

Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.

RNA interference: ready to silence cancer?

PubMed

Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

2006-01-01

RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro

PubMed Central

Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.

2013-01-01

Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792

Bringing RNA Interference (RNAi) into the High School Classroom

ERIC Educational Resources Information Center

Sengupta, Sibani

2013-01-01

RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…

Respiratory viral diseases: access to RNA interference therapy

PubMed Central

Bitko, Vira; Barik, Sailen

2008-01-01

This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824

Noncoding RNA danger motifs bridge innate and adaptive immunity and are potent adjuvants for vaccination

PubMed Central

Wang, Lilin; Smith, Dan; Bot, Simona; Dellamary, Luis; Bloom, Amy; Bot, Adrian

2002-01-01

The adaptive immune response is triggered by recognition of T and B cell epitopes and is influenced by “danger” motifs that act via innate immune receptors. This study shows that motifs associated with noncoding RNA are essential features in the immune response reminiscent of viral infection, mediating rapid induction of proinflammatory chemokine expression, recruitment and activation of antigen-presenting cells, modulation of regulatory cytokines, subsequent differentiation of Th1 cells, isotype switching, and stimulation of cross-priming. The heterogeneity of RNA-associated motifs results in differential binding to cellular receptors, and specifically impacts the immune profile. Naturally occurring double-stranded RNA (dsRNA) triggered activation of dendritic cells and enhancement of specific immunity, similar to selected synthetic dsRNA motifs. Based on the ability of specific RNA motifs to block tolerance induction and effectively organize the immune defense during viral infection, we conclude that such RNA species are potent danger motifs. We also demonstrate the feasibility of using selected RNA motifs as adjuvants in the context of novel aerosol carriers for optimizing the immune response to subunit vaccines. In conclusion, RNA-associated motifs produced during viral infection bridge the early response with the late adaptive phase, regulating the activation and differentiation of antigen-specific B and T cells, in addition to a short-term impact on innate immunity. PMID:12393853

Dynamic miRNA-mRNA regulations are essential for maintaining Drosophila immune homeostasis during Micrococcus luteus infection.

PubMed

Wei, Guanyun; Sun, Lianjie; Li, Ruimin; Li, Lei; Xu, Jiao; Ma, Fei

2018-04-01

Pathogen bacteria infections can lead to dynamic changes of microRNA (miRNA) and mRNA expression profiles, which may control synergistically the outcome of immune responses. To reveal the role of dynamic miRNA-mRNA regulation in Drosophila innate immune responses, we have detailedly analyzed the paired miRNA and mRNA expression profiles at three time points during Drosophila adult males with Micrococcus luteus (M. luteus) infection using RNA- and small RNA-seq data. Our results demonstrate that differentially expressed miRNAs and mRNAs represent extensively dynamic changes over three time points during Drosophila with M. luteus infection. The pathway enrichment analysis indicates that differentially expressed genes are involved in diverse signaling pathways, including Toll and Imd as well as orther signaling pathways at three time points during Drosophila with M. luteus infection. Remarkably, the dynamic change of miRNA expression is delayed by compared to mRNA expression change over three time points, implying that the "time" parameter should be considered when the function of miRNA/mRNA is further studied. In particular, the dynamic miRNA-mRNA regulatory networks have shown that miRNAs may synergistically regulate gene expressions of different signaling pathways to promote or inhibit innate immune responses and maintain homeostasis in Drosophila, and some new regulators involved in Drosophila innate immune response have been identified. Our findings strongly suggest that miRNA regulation is a key mechanism involved in fine-tuning cooperatively gene expressions of diverse signaling pathways to maintain innate immune response and homeostasis in Drosophila. Taken together, the present study reveals a novel role of dynamic miRNA-mRNA regulation in immune response to bacteria infection, and provides a new insight into the underlying molecular regulatory mechanism of Drosophila innate immune responses. Copyright © 2017 Elsevier Ltd. All rights reserved.

Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases

PubMed Central

Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.

2012-01-01

Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660

Structural basis of RNA recognition and activation by innate immune receptor RIG-I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, Fuguo; Ramanathan, Anand; Miller, Matthew T.

Retinoic-acid-inducible gene-I (RIG-I; also known as DDX58) is a cytoplasmic pathogen recognition receptor that recognizes pathogen-associated molecular pattern (PAMP) motifs to differentiate between viral and cellular RNAs. RIG-I is activated by blunt-ended double-stranded (ds)RNA with or without a 5'-triphosphate (ppp), by single-stranded RNA marked by a 5'-ppp and by polyuridine sequences. Upon binding to such PAMP motifs, RIG-I initiates a signalling cascade that induces innate immune defences and inflammatory cytokines to establish an antiviral state. The RIG-I pathway is highly regulated and aberrant signalling leads to apoptosis, altered cell differentiation, inflammation, autoimmune diseases and cancer. The helicase and repressor domainsmore » (RD) of RIG-I recognize dsRNA and 5'-ppp RNA to activate the two amino-terminal caspase recruitment domains (CARDs) for signalling. Here, to understand the synergy between the helicase and the RD for RNA binding, and the contribution of ATP hydrolysis to RIG-I activation, we determined the structure of human RIG-I helicase-RD in complex with dsRNA and an ATP analogue. The helicase-RD organizes into a ring around dsRNA, capping one end, while contacting both strands using previously uncharacterized motifs to recognize dsRNA. Small-angle X-ray scattering, limited proteolysis and differential scanning fluorimetry indicate that RIG-I is in an extended and flexible conformation that compacts upon binding RNA. These results provide a detailed view of the role of helicase in dsRNA recognition, the synergy between the RD and the helicase for RNA binding and the organization of full-length RIG-I bound to dsRNA, and provide evidence of a conformational change upon RNA binding. The RIG-I helicase-RD structure is consistent with dsRNA translocation without unwinding and cooperative binding to RNA. The structure yields unprecedented insight into innate immunity and has a broader impact on other areas of biology, including RNA

Gene silencing efficiency and INF-β induction effects of splicing miRNA 155-based artificial miRNA with pre-miRNA stem-loop structures.

PubMed

Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin

2012-02-01

Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.

RNA interference in the clinic: challenges and future directions

PubMed Central

Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.

2011-01-01

Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526

Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing

PubMed Central

Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom

2015-01-01

Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842

Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.

PubMed

Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom

2015-05-14

Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.

Domain motions of Argonaute, the catalytic engine of RNA interference

PubMed Central

Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

2007-01-01

Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142

Domain motions of Argonaute, the catalytic engine of RNA interference.

PubMed

Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y

2007-11-30

The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.

ImmunemiR - A Database of Prioritized Immune miRNA Disease Associations and its Interactome.

PubMed

Prabahar, Archana; Natarajan, Jeyakumar

2017-01-01

MicroRNAs are the key regulators of gene expression and their abnormal expression in the immune system may be associated with several human diseases such as inflammation, cancer and autoimmune diseases. Elucidation of miRNA disease association through the interactome will deepen the understanding of its disease mechanisms. A specialized database for immune miRNAs is highly desirable to demonstrate the immune miRNA disease associations in the interactome. miRNAs specific to immune related diseases were retrieved from curated databases such as HMDD, miR2disease and PubMed literature based on MeSH classification of immune system diseases. The additional data such as miRNA target genes, genes coding protein-protein interaction information were compiled from related resources. Further, miRNAs were prioritized to specific immune diseases using random walk ranking algorithm. In total 245 immune miRNAs associated with 92 OMIM disease categories were identified from external databases. The resultant data were compiled as ImmunemiR, a database of prioritized immune miRNA disease associations. This database provides both text based annotation information and network visualization of its interactome. To our knowledge, ImmunemiR is the first available database to provide a comprehensive repository of human immune disease associated miRNAs with network visualization options of its target genes, protein-protein interactions (PPI) and its disease associations. It is freely available at http://www.biominingbu.org/immunemir/. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

De Novo Assembly of the Japanese Flounder (Paralichthys olivaceus) Spleen Transcriptome to Identify Putative Genes Involved in Immunity

PubMed Central

Huang, Lin; Li, Guiyang; Mo, Zhaolan; Xiao, Peng; Li, Jie; Huang, Jie

2015-01-01

Background Japanese flounder (Paralichthys olivaceus) is an economically important marine fish in Asia and has suffered from disease outbreaks caused by various pathogens, which requires more information for immune relevant genes on genome background. However, genomic and transcriptomic data for Japanese flounder remain scarce, which limits studies on the immune system of this species. In this study, we characterized the Japanese flounder spleen transcriptome using an Illumina paired-end sequencing platform to identify putative genes involved in immunity. Methodology/Principal Findings A cDNA library from the spleen of P. olivaceus was constructed and randomly sequenced using an Illumina technique. The removal of low quality reads generated 12,196,968 trimmed reads, which assembled into 96,627 unigenes. A total of 21,391 unigenes (22.14%) were annotated in the NCBI Nr database, and only 1.1% of the BLASTx top-hits matched P. olivaceus protein sequences. Approximately 12,503 (58.45%) unigenes were categorized into three Gene Ontology groups, 19,547 (91.38%) were classified into 26 Cluster of Orthologous Groups, and 10,649 (49.78%) were assigned to six Kyoto Encyclopedia of Genes and Genomes pathways. Furthermore, 40,928 putative simple sequence repeats and 47, 362 putative single nucleotide polymorphisms were identified. Importantly, we identified 1,563 putative immune-associated unigenes that mapped to 15 immune signaling pathways. Conclusions/Significance The P. olivaceus transciptome data provides a rich source to discover and identify new genes, and the immune-relevant sequences identified here will facilitate our understanding of the mechanisms involved in the immune response. Furthermore, the plentiful potential SSRs and SNPs found in this study are important resources with respect to future development of a linkage map or marker assisted breeding programs for the flounder. PMID:25723398

Double strand RNA-mediated RNA interference through feeding in larval gypsy moth, Lymantria dispar (Lepidoptera: Erebidae)

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...

Interference of Aspergillus fumigatus with the immune response.

PubMed

Heinekamp, Thorsten; Schmidt, Hella; Lapp, Katrin; Pähtz, Vera; Shopova, Iordana; Köster-Eiserfunke, Nora; Krüger, Thomas; Kniemeyer, Olaf; Brakhage, Axel A

2015-03-01

Aspergillus fumigatus is a saprotrophic filamentous fungus and also the most prevalent airborne fungal pathogen of humans. Depending on the host's immune status, the variety of diseases caused by A. fumigatus ranges from allergies in immunocompetent hosts to life-threatening invasive infections in patients with impaired immunity. In contrast to the majority of other Aspergillus species, which are in most cases nonpathogenic, A. fumigatus features an armory of virulence determinants to establish an infection. For example, A. fumigatus is able to evade the human complement system by binding or degrading complement regulators. Furthermore, the fungus interferes with lung epithelial cells, alveolar macrophages, and neutrophil granulocytes to prevent killing by these immune cells. This chapter summarizes the different strategies of A. fumigatus to manipulate the immune response. We also discuss the potential impact of recent advances in immunoproteomics to improve diagnosis and therapy of an A. fumigatus infection.

RNA interference targets arbovirus replication in Culicoides cells.

PubMed

Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain

2013-03-01

Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.

Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference

PubMed Central

Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant

2015-01-01

The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748

Therapeutic potentials of gene silencing by RNA interference: principles, challenges, and new strategies.

PubMed

Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao

2014-04-01

During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.

RNA Editing, ADAR1, and the Innate Immune Response.

PubMed

Wang, Qingde; Li, Xiaoni; Qi, Ruofan; Billiar, Timothy

2017-01-18

RNA editing, particularly A-to-I RNA editing, has been shown to play an essential role in mammalian embryonic development and tissue homeostasis, and is implicated in the pathogenesis of many diseases including skin pigmentation disorder, autoimmune and inflammatory tissue injury, neuron degeneration, and various malignancies. A-to-I RNA editing is carried out by a small group of enzymes, the adenosine deaminase acting on RNAs (ADARs). Only three members of this protein family, ADAR1-3, exist in mammalian cells. ADAR3 is a catalytically null enzyme and the most significant function of ADAR2 was found to be in editing on the neuron receptor GluR-B mRNA. ADAR1, however, has been shown to play more significant roles in biological and pathological conditions. Although there remains much that is not known about how ADAR1 regulates cellular function, recent findings point to regulation of the innate immune response as an important function of ADAR1. Without appropriate RNA editing by ADAR1, endogenous RNA transcripts stimulate cytosolic RNA sensing receptors and therefore activate the IFN-inducing signaling pathways. Overactivation of innate immune pathways can lead to tissue injury and dysfunction. However, obvious gaps in our knowledge persist as to how ADAR1 regulates innate immune responses through RNA editing. Here, we review critical findings from ADAR1 mechanistic studies focusing on its regulatory function in innate immune responses and identify some of the important unanswered questions in the field.

Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

PubMed Central

Tomoyasu, Yoshinori

2014-01-01

The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485

Efficacy of a Novel Class of RNA Interference Therapeutic Agents

PubMed Central

Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki

2012-01-01

RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145

RNA Interference: Biology, Mechanism, and Applications

PubMed Central

Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.

2003-01-01

Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679

Immunity to Rice black streaked dwarf virus, a plant reovirus, can be achieved in rice plants by RNA silencing against the gene for the viroplasm component protein.

PubMed

Shimizu, Takumi; Nakazono-Nagaoka, Eiko; Akita, Fusamichi; Uehara-Ichiki, Tamaki; Omura, Toshihiro; Sasaya, Takahide

2011-09-01

The nonstructural protein P9-1 of Rice black streaked dwarf virus has been confirmed to accumulate in viroplasms, the putative sites of viral replication, in infected plants and insects. We transformed rice plants by introducing an RNA interference construct against the P9-1-encoding gene. The resultant transgenic plants accumulated short interfering RNAs specific to the construct. All progenies produced by self-fertilization of these transgenic plants with induced RNA interference against the gene for P9-1 were resistant to infection by the virus. Our results demonstrated that interfering with the expression of a viroplasm component protein of plant reoviruses, which plays an important role in viral proliferation, might be a practical and effective way to control plant reovirus infection in crop plants. Copyright © 2011 Elsevier B.V. All rights reserved.

Molecular Mechanisms of RNA-Targeting by Cas13-containing Type VI CRISPR-Cas Systems.

PubMed

O'Connell, Mitchell

2018-06-22

Prokaryotic adaptive immune systems use CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR associated (Cas) proteins for RNA-guided cleavage of foreign genetic elements. The focus of this review, Type VI CRISPR-Cas systems, include a single protein known as Cas13 (formerly C2c2), that when assembled with a crRNA forms a crRNA-guided RNA-targeting effector complex. Type VI CRISPR-Cas systems can be divided into four subtypes (A-D) based on Cas13 phylogeny. All Cas13 proteins studied to date possess two enzymatically distinct ribonuclease activities that are required for optimal interference. One RNase is responsible for pre-crRNA processing to form mature Type VI interference complexes, while the other RNase activity provided by the two HEPN (Higher Eukaryotes and Prokaryotes Nucleotide-binding) domains, is required for degradation of target RNA during viral interference. In this review, I will compare and contrast what is known about the molecular architecture and behavior of Type VI (A-D) CRISPR-Cas13 interference complexes, how this allows them to carry out their RNA-targeting function, how Type VI accessory proteins are able to modulate Cas13 activity, and how together all of these features have led to the rapid development of a range of RNA-targeting applications. Throughout I will also discuss some of the outstanding questions regarding Cas13's molecular behavior, and its role in bacterial adaptive immunity and RNA-targeting applications. Copyright © 2018. Published by Elsevier Ltd.

Expression of putative immune response genes during early ontogeny in the coral Acropora millepora.

PubMed

Puill-Stephan, Eneour; Seneca, François O; Miller, David J; van Oppen, Madeleine J H; Willis, Bette L

2012-01-01

Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals. Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes) were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR). Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A. millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria) during winnowing processes as symbioses are fine-tuned. Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of these genes in alloimmune-challenged corals are needed to further

Exploring Fusarium head blight disease control by RNA interference

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...

Immunity to proactive interference is not a property of the focus of attention in working memory.

PubMed

Ralph, Alicia; Walters, Jade N; Stevens, Alison; Fitzgerald, Kirra J; Tehan, Gerald; Surprenant, Aimee M; Neath, Ian; Turcotte, Josée

2011-02-01

The Focus of Attention (FOA) is the latest incarnation of a limited capacity store in which a small number of items, in this case four, are deemed to be readily accessible and do not need to be retrieved. Thus a corollary of these ideas is that those items in the FOA are always immune to proactive interference. While there is empirical support for instances of immunity to PI in short-term retention tasks that involve memory for four-item lists, there are also many instances in which PI is observed with four-item lists as well as instances where PI and immunity to PI can be shown in the same experiment. In contrast to the FOA assumptions, an alternative cue-based account predicts both the presence of PI and immunity to PI as a function of the relation between the cues available and the particular test. Three experiments contrasted the FOA assumptions and the cue-based approach in a short-term cued recall task in which PI is manipulated by testing whether the presentation of previous, similar items would interfere with immediate recall of three list items. The results indicated that even with very short lists, both PI and immunity to PI could be observed. The PI effects observed in our experiment are at odds with the FOA approach and are more readily explained using the cueing account.

[RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].

PubMed

Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente

2010-01-01

RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.

Contribution of murine innate serum inhibitors toward interference within influenza virus immune assays

PubMed Central

Cwach, Kevin T.; Sandbulte, Heather R.; Klonoski, Joshua M.; Huber, Victor C.

2011-01-01

Please cite this paper as: Cwach et al. (2011) Contribution of murine innate serum inhibitors toward interference within influenza virus immune assays. Influenza and Other Respiratory Viruses DOI: 10.1111/j.1750‐2659.2011.00283.x. Background  Prior to detection of an antibody response toward influenza viruses using the hemagglutination inhibition assay (HAI), sera are routinely treated to inactivate innate inhibitors using both heat inactivation (56°C) and recombinant neuraminidase [receptor‐destroying enzyme (RDE)]. Objectives  We revisited the contributions of innate serum inhibitors toward interference with influenza viruses in immune assays, using murine sera, with emphasis on the interactions with influenza A viruses of the H3N2 subtype. Methods  We used individual serum treatments: 56°C alone, RDE alone, or RDE + 56°C, to treat sera prior to evaluation within HAI, microneutralization, and macrophage uptake assays. Results  Our data demonstrate that inhibitors present within untreated murine sera interfere with the HAI assay in a manner that is different from that seen for the microneutralization assay. Specifically, the γ class inhibitor α2‐Macroglobulin (A2‐M) can inhibit H3N2 viruses within the HAI assay, but not in the microneutralization assay. Based on these findings, we used a macrophage uptake assay to demonstrate that these inhibitors can increase uptake by macrophages when the influenza viruses express an HA from a 1968 H3N2 virus isolate, but not a 1997 H3N2 isolate. Conclusions  The practice of treating sera to inactivate innate inhibitors of influenza viruses prior to evaluation within immune assays has allowed us to effectively detect influenza virus‐specific antibodies for decades. However, this practice has yielded an under‐appreciation for the contribution of innate serum inhibitors toward host immune responses against these viruses, including contributions toward neutralization and macrophage uptake. PMID

RNA interference of tubulin genes has lethal effects in Mythimna separate.

PubMed

Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

2018-05-23

RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

TLR4, NOD1 and NOD2 mediate immune recognition of putative newly identified periodontal pathogens.

PubMed

Marchesan, Julie; Jiao, Yizu; Schaff, Riley A; Hao, Jie; Morelli, Thiago; Kinney, Janet S; Gerow, Elizabeth; Sheridan, Rachel; Rodrigues, Vinicius; Paster, Bruce J; Inohara, Naohiro; Giannobile, William V

2016-06-01

Periodontitis is a polymicrobial inflammatory disease that results from the interaction between the oral microbiota and the host immunity. Although the innate immune response is important for disease initiation and progression, the innate immune receptors that recognize both classical and putative periodontal pathogens that elicit an immune response have not been elucidated. By using the Human Oral Microbe Identification Microarray (HOMIM), we identified multiple predominant oral bacterial species in human plaque biofilm that strongly associate with severe periodontitis. Ten of the identified species were evaluated in greater depth, six being classical pathogens and four putative novel pathogens. Using human peripheral blood monocytes (HPBM) and murine bone-marrow-derived macrophages (BMDM) from wild-type (WT) and Toll-like receptor (TLR)-specific and MyD88 knockouts (KOs), we demonstrated that heat-killed Campylobacter concisus, Campylobacter rectus, Selenomonas infelix, Porphyromonas endodontalis, Porphyromonas gingivalis, and Tannerella forsythia mediate high immunostimulatory activity. Campylobacter concisus, C. rectus, and S. infelix exhibited robust TLR4 stimulatory activity. Studies using mesothelial cells from WT and NOD1-specific KOs and NOD2-expressing human embryonic kidney cells demonstrated that Eubacterium saphenum, Eubacterium nodatum and Filifactor alocis exhibit robust NOD1 stimulatory activity, and that Porphyromonas endodontalis and Parvimonas micra have the highest NOD2 stimulatory activity. These studies allowed us to provide important evidence on newly identified putative pathogens in periodontal disease pathogenesis showing that these bacteria exhibit different immunostimulatory activity via TLR4, NOD1, and NOD2 (Clinicaltrials.gov NCT01154855). © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

TLR4, NOD1 and NOD2 Mediate Immune Recognition of Putative Newly-Identified Periodontal Pathogens

PubMed Central

Schaff, Riley A.; Hao, Jie; Morelli, Thiago; Kinney, Janet S.; Gerow, Elizabeth; Sheridan, Rachel; Rodrigues, Vinicius; Paster, Bruce J.; Inohara, Naohiro; Giannobile, William V.

2015-01-01

SUMMARY Periodontitis is a polymicrobial inflammatory disease that results from the interaction between the oral microbiota and the host immunity. While the innate immune response is important for disease initiation and progression, the innate immune receptors that recognize both classical and putative periodontal pathogens that elicit an immune response have not been elucidated. By using the Human Oral Microbe Identification Microarray (HOMIM), we identified multiple predominant oral bacterial species in human plaque biofilm that strongly associate with severe periodontitis. Ten of the identified species were evaluated in greater depth, 6 being classical pathogens and 4 putative novel pathogens. Using human peripheral blood monocytes (HPBM) and murine bone marrow–derived macrophages (BMDM) from wild-type (WT) and toll-like receptor (TLR)-specific and MyD88 knockouts (KOs), we demonstrated that heat-killed Campylobacter concisus, Campylobacter rectus, Selenomonas infelix, Porphyromonas endodontalis, Porphyromonas gingivalis, and Tannerella forsythia mediate high immunostimulatory activity. C. concisus, C. rectus, and S. infelix exhibited robust TLR4 stimulatory activity. Studies using mesothelial cells from WT and NOD1-specific KOs and NOD2-expressing human embryonic kidney (HEK) cells demonstrated that Eubacterium saphenum, Eubacterium nodatum and Filifactor alocis exhibit robust NOD1 stimulatory activity, and that Porphyromonas endodontalis and Parvimonas micra have the highest NOD2-stimulatory activity. These studies allowed us to provide important evidence on newly-identified putative pathogens in periodontal disease pathogenesis showing that these bacteria exhibit different immunostimulatory activity via TLR4, NOD1, and NOD2 (Clinicaltrials.gov NCT01154855). PMID:26177212

Inhibition of HBV replication in vivo using helper-dependent adenovirus vectors to deliver antiviral RNA interference expression cassettes.

PubMed

Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B

2014-01-01

HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.

Transcriptome Analysis Based on RNA-Seq in Understanding Pathogenic Mechanisms of Diseases and the Immune System of Fish: A Comprehensive Review

PubMed Central

Sudhagar, Arun; El-Matbouli, Mansour

2018-01-01

In recent years, with the advent of next-generation sequencing along with the development of various bioinformatics tools, RNA sequencing (RNA-Seq)-based transcriptome analysis has become much more affordable in the field of biological research. This technique has even opened up avenues to explore the transcriptome of non-model organisms for which a reference genome is not available. This has made fish health researchers march towards this technology to understand pathogenic processes and immune reactions in fish during the event of infection. Recent studies using this technology have altered and updated the previous understanding of many diseases in fish. RNA-Seq has been employed in the understanding of fish pathogens like bacteria, virus, parasites, and oomycetes. Also, it has been helpful in unraveling the immune mechanisms in fish. Additionally, RNA-Seq technology has made its way for future works, such as genetic linkage mapping, quantitative trait analysis, disease-resistant strain or broodstock selection, and the development of effective vaccines and therapies. Until now, there are no reviews that comprehensively summarize the studies which made use of RNA-Seq to explore the mechanisms of infection of pathogens and the defense strategies of fish hosts. This review aims to summarize the contemporary understanding and findings with regard to infectious pathogens and the immune system of fish that have been achieved through RNA-Seq technology. PMID:29342931

Generation of Constructs for DNA-Directed RNA Interference of Venezuelan Equine Encephalitis Virus Genes

DTIC Science & Technology

2006-12-01

Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential

The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

PubMed

Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

1999-10-15

Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

Evaluation and control of miRNA-like off-target repression for RNA interference.

PubMed

Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook

2018-03-01

RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.

HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.

PubMed

Vongrad, Valentina; Imig, Jochen; Mohammadi, Pejman; Kishore, Shivendra; Jaskiewicz, Lukasz; Hall, Jonathan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J

2015-01-01

MiRNAs and other small noncoding RNAs (sncRNAs) are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs) have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi) pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM). The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM) were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs. PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.

[RNA interference library research progress and its application in cancer research].

PubMed

Zhao, Ning; Cai, Li

2013-02-01

RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

PubMed

Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy

2017-11-01

RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.

ZFP36 RNA-binding proteins restrain T-cell activation and anti-viral immunity.

PubMed

Moore, Michael J; Blachere, Nathalie E; Fak, John J; Park, Christopher Y; Sawicka, Kirsty; Parveen, Salina; Zucker-Scharff, Ilana; Moltedo, Bruno; Rudensky, Alexander Y; Darnell, Robert B

2018-05-31

Dynamic post-transcriptional control of RNA expression by RNA-binding proteins (RBPs) is critical during immune response. ZFP36 RBPs are prominent inflammatory regulators linked to autoimmunity and cancer, but functions in adaptive immunity are less clear. We used HITS-CLIP to define ZFP36 targets in mouse T cells, revealing unanticipated actions in regulating T cell activation, proliferation, and effector functions. Transcriptome and ribosome profiling showed that ZFP36 represses mRNA target abundance and translation, notably through novel AU-rich sites in coding sequence. Functional studies revealed that ZFP36 regulates early T cell activation kinetics cell autonomously, by attenuating activation marker expression, limiting T cell expansion, and promoting apoptosis. Strikingly, loss of ZFP36 in vivo accelerated T cell responses to acute viral infection and enhanced anti-viral immunity. These findings uncover a critical role for ZFP36 RBPs in restraining T cell expansion and effector functions, and suggest ZFP36 inhibition as a strategy to enhance immune-based therapies. © 2018, Moore et al.

Expression of Putative Immune Response Genes during Early Ontogeny in the Coral Acropora millepora

PubMed Central

Puill-Stephan, Eneour; Seneca, François O.; Miller, David J.; van Oppen, Madeleine J. H.; Willis, Bette L.

2012-01-01

Background Corals, like many other marine invertebrates, lack a mature allorecognition system in early life history stages. Indeed, in early ontogeny, when corals acquire and establish associations with various surface microbiota and dinoflagellate endosymbionts, they do not efficiently distinguish between closely and distantly related individuals from the same population. However, very little is known about the molecular components that underpin allorecognition and immunity responses or how they change through early ontogeny in corals. Methodology/Principal Findings Patterns in the expression of four putative immune response genes (apextrin, complement C3, and two CELIII type lectin genes) were examined in juvenile colonies of Acropora millepora throughout a six-month post-settlement period using quantitative real-time PCR (qPCR). Expression of a CELIII type lectin gene peaked in the fourth month for most of the coral juveniles sampled and was significantly higher at this time than at any other sampling time during the six months following settlement. The timing of this increase in expression levels of putative immune response genes may be linked to allorecognition maturation which occurs around this time in A.millepora. Alternatively, the increase may represent a response to immune challenges, such as would be involved in the recognition of symbionts (such as Symbiodinium spp. or bacteria) during winnowing processes as symbioses are fine-tuned. Conclusions/Significance Our data, although preliminary, are consistent with the hypothesis that lectins may play an important role in the maturation of allorecognition responses in corals. The co-expression of lectins with apextrin during development of coral juveniles also raises the possibility that these proteins, which are components of innate immunity in other invertebrates, may influence the innate immune systems of corals through a common pathway or system. However, further studies investigating the expression of

RNA interference of argininosuccinate synthetase restores sensitivity to recombinant arginine deiminase (rADI) in resistant cancer cells

PubMed Central

2011-01-01

Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546

Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes.

PubMed

Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P

2016-11-15

Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission

Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes

PubMed Central

Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.

2016-01-01

ABSTRACT Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5′-3′ exoribonuclease XRN1/Pacman on conserved RNA structures in the 3′ untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo. Two reproducible small-RNA hot spots within the 3′ UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3′ SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. IMPORTANCE Understanding

Knockdown of genes in the Toll pathway reveals new lethal RNA interference targets for insect pest control.

PubMed

Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A

2017-02-01

RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.

Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection.

PubMed

East-Seletsky, Alexandra; O'Connell, Mitchell R; Knight, Spencer C; Burstein, David; Cate, Jamie H D; Tjian, Robert; Doudna, Jennifer A

2016-10-13

Bacterial adaptive immune systems use CRISPRs (clustered regularly interspaced short palindromic repeats) and CRISPR-associated (Cas) proteins for RNA-guided nucleic acid cleavage. Although most prokaryotic adaptive immune systems generally target DNA substrates, type III and VI CRISPR systems direct interference complexes against single-stranded RNA substrates. In type VI systems, the single-subunit C2c2 protein functions as an RNA-guided RNA endonuclease (RNase). How this enzyme acquires mature CRISPR RNAs (crRNAs) that are essential for immune surveillance and how it carries out crRNA-mediated RNA cleavage remain unclear. Here we show that bacterial C2c2 possesses a unique RNase activity responsible for CRISPR RNA maturation that is distinct from its RNA-activated single-stranded RNA degradation activity. These dual RNase functions are chemically and mechanistically different from each other and from the crRNA-processing behaviour of the evolutionarily unrelated CRISPR enzyme Cpf1 (ref. 11). The two RNase activities of C2c2 enable multiplexed processing and loading of guide RNAs that in turn allow sensitive detection of cellular transcripts.

RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design.

PubMed

Terenius, Olle; Papanicolaou, Alexie; Garbutt, Jennie S; Eleftherianos, Ioannis; Huvenne, Hanneke; Kanginakudru, Sriramana; Albrechtsen, Merete; An, Chunju; Aymeric, Jean-Luc; Barthel, Andrea; Bebas, Piotr; Bitra, Kavita; Bravo, Alejandra; Chevalier, François; Collinge, Derek P; Crava, Cristina M; de Maagd, Ruud A; Duvic, Bernard; Erlandson, Martin; Faye, Ingrid; Felföldi, Gabriella; Fujiwara, Haruhiko; Futahashi, Ryo; Gandhe, Archana S; Gatehouse, Heather S; Gatehouse, Laurence N; Giebultowicz, Jadwiga M; Gómez, Isabel; Grimmelikhuijzen, Cornelis J P; Groot, Astrid T; Hauser, Frank; Heckel, David G; Hegedus, Dwayne D; Hrycaj, Steven; Huang, Lihua; Hull, J Joe; Iatrou, Kostas; Iga, Masatoshi; Kanost, Michael R; Kotwica, Joanna; Li, Changyou; Li, Jianghong; Liu, Jisheng; Lundmark, Magnus; Matsumoto, Shogo; Meyering-Vos, Martina; Millichap, Peter J; Monteiro, Antónia; Mrinal, Nirotpal; Niimi, Teruyuki; Nowara, Daniela; Ohnishi, Atsushi; Oostra, Vicencio; Ozaki, Katsuhisa; Papakonstantinou, Maria; Popadic, Aleksandar; Rajam, Manchikatla V; Saenko, Suzanne; Simpson, Robert M; Soberón, Mario; Strand, Michael R; Tomita, Shuichiro; Toprak, Umut; Wang, Ping; Wee, Choon Wei; Whyard, Steven; Zhang, Wenqing; Nagaraju, Javaregowda; Ffrench-Constant, Richard H; Herrero, Salvador; Gordon, Karl; Swevers, Luc; Smagghe, Guy

2011-02-01

Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our public database at http://insectacentral.org/RNAi will continue to gather information on RNAi experiments. Copyright © 2010 Elsevier Ltd. All rights reserved.

Usefulness of multiple chalk-based food colorings for inducing better gene silencing by feeding RNA interference in planarians.

PubMed

Hattori, Miki; Miyamoto, Mai; Hosoda, Kazutaka; Umesono, Yoshihiko

2018-01-01

Planarians have become widely recognized as one of the major animal models for regeneration studies in invertebrates. To induce RNA interference (RNAi) by feeding in planarians, the widely accepted protocol is one in which animals undergo two or three feedings of food containing double-stranded RNA (dsRNA) plus visible food coloring (e.g., blood) for confirmation of feeding by individual animals. However, one possible problem is that incorporated food coloring is often retained within the gut for several days, which makes it difficult to confirm the success of each round of dsRNA feeding based on the difference of the color density within the gut before and after feeding. As a consequence, the difference of appetite levels among individuals undergoing dsRNA feeding leads to phenotypic variability among them due to insufficient knockdown. In our attempts to overcome this problem, we have developed a novel method for achieving robust confirmation of the success of dsRNA feeding in individuals fed multiple times by means of including a combination of three different colored chalks (pink, yellow and blue) as food coloring. Notably, we found that this method is superior to the conventional method for positively marking individuals that actively consumed the dsRNA-containing food during four times of once-daily feeding. Using these selected animals, we obtained stable and sufficiently strong RNAi-induced phenotypes. We termed this improved multi-colored chalk-spiked method of feeding RNAi "Candi" and propose its benefits for gene function analysis in planarians. © 2017 Japanese Society of Developmental Biologists.

Putative SF2 helicases of the early-branching eukaryote Giardia lamblia are involved in antigenic variation and parasite differentiation into cysts

PubMed Central

2012-01-01

Background Regulation of surface antigenic variation in Giardia lamblia is controlled post-transcriptionally by an RNA-interference (RNAi) pathway that includes a Dicer-like bidentate RNase III (gDicer). This enzyme, however, lacks the RNA helicase domain present in Dicer enzymes from higher eukaryotes. The participation of several RNA helicases in practically all organisms in which RNAi was studied suggests that RNA helicases are potentially involved in antigenic variation, as well as during Giardia differentiation into cysts. Results An extensive in silico analysis of the Giardia genome identified 32 putative Super Family 2 RNA helicases that contain almost all the conserved RNA helicase motifs. Phylogenetic studies and sequence analysis separated them into 22 DEAD-box, 6 DEAH-box and 4 Ski2p-box RNA helicases, some of which are homologs of well-characterized helicases from higher organisms. No Giardia putative helicase was found to have significant homology to the RNA helicase domain of Dicer enzymes. Additionally a series of up- and down-regulated putative RNA helicases were found during encystation and antigenic variation by qPCR experiments. Finally, we were able to recognize 14 additional putative helicases from three different families (RecQ family, Swi2/Snf2 and Rad3 family) that could be considered DNA helicases. Conclusions This is the first comprehensive analysis of the Super Family 2 helicases from the human intestinal parasite G. lamblia. The relative and variable expression of particular RNA helicases during both antigenic variation and encystation agrees with the proposed participation of these enzymes during both adaptive processes. The putatives RNA and DNA helicases identified in this early-branching eukaryote provide initial information regarding the biological role of these enzymes in cell adaptation and differentiation. PMID:23190735

Ontology-oriented retrieval of putative microRNAs in Vitis vinifera via GrapeMiRNA: a web database of de novo predicted grape microRNAs.

PubMed

Lazzari, Barbara; Caprera, Andrea; Cestaro, Alessandro; Merelli, Ivan; Del Corvo, Marcello; Fontana, Paolo; Milanesi, Luciano; Velasco, Riccardo; Stella, Alessandra

2009-06-29

Two complete genome sequences are available for Vitis vinifera Pinot noir. Based on the sequence and gene predictions produced by the IASMA, we performed an in silico detection of putative microRNA genes and of their targets, and collected the most reliable microRNA predictions in a web database. The application is available at http://www.itb.cnr.it/ptp/grapemirna/. The program FindMiRNA was used to detect putative microRNA genes in the grape genome. A very high number of predictions was retrieved, calling for validation. Nine parameters were calculated and, based on the grape microRNAs dataset available at miRBase, thresholds were defined and applied to FindMiRNA predictions having targets in gene exons. In the resulting subset, predictions were ranked according to precursor positions and sequence similarity, and to target identity. To further validate FindMiRNA predictions, comparisons to the Arabidopsis genome, to the grape Genoscope genome, and to the grape EST collection were performed. Results were stored in a MySQL database and a web interface was prepared to query the database and retrieve predictions of interest. The GrapeMiRNA database encompasses 5,778 microRNA predictions spanning the whole grape genome. Predictions are integrated with information that can be of use in selection procedures. Tools added in the web interface also allow to inspect predictions according to gene ontology classes and metabolic pathways of targets. The GrapeMiRNA database can be of help in selecting candidate microRNA genes to be validated.

Using RNA interference to knock down the adhesion protein TES.

PubMed

Griffith, Elen

2007-01-01

RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.

PsOr1, a potential target for RNA interference-based pest management.

PubMed

Zhao, Y Y; Liu, F; Yang, G; You, M S

2011-02-01

Insect pests cause billions of dollars in agricultural losses, and attempts to kill them have resulted in growing threats from insecticide resistance, dietary pesticide pollution and environmental destruction. New approaches to control refractory insect pests are therefore needed. The host-plant preferences of insect pests rely on olfaction and are mediated via a seven transmembrane-domain odorant receptor (Or) family. The present study reports the cloning and characterization of PsOr1, the first candidate member of the Or gene family from Phyllotreta striolata, a devastating beetle pest that causes damage worldwide. PsOr1 is remarkably well conserved with respect to other insect orthologues, including DmOr83b from Drosophila melanogaster. These insect orthologues form an essential non-conventional Or sub-family and may play an important and generalized role in insect olfaction. We designed double-stranded (ds) RNA directly against the PsOr1 gene and exploited RNA interference (RNAi) to control P. striolata. The chemotactic behavioural measurements showed that adult beetles were unable to sense the attractant or repellent odour stimulus after microinjection of dsRNA against PsOr1. Reverse Transcription (RT)-PCR analysis showed specific down-regulation of mRNA transcript levels for this gene. Furthermore, host-plant preference experiments confirmed that silencing PsOr1 by RNAi treatment impaired the host-plant preferences of P. striolata for cruciferous vegetables. These results demonstrate that this insect control approach of using RNAi to target PsOr1 and its orthologues might be effective in blocking host-plant-seeking behaviours in diverse insect pests. The results also support the theory that this unique receptor type plays an essential general role in insect olfaction. © 2010 Fujian Agriculture and Forestry University. Insect Molecular Biology © 2010 The Royal Entomological Society.

The RNA silencing enzyme RNA polymerase v is required for plant immunity.

PubMed

López, Ana; Ramírez, Vicente; García-Andrade, Javier; Flors, Victor; Vera, Pablo

2011-12-01

RNA-directed DNA methylation (RdDM) is an epigenetic control mechanism driven by small interfering RNAs (siRNAs) that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1). NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V), which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA)-mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA)-mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA-related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence, but whether

RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes

PubMed Central

Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.

2011-01-01

Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430

Nanoparticle-based delivery of small interfering RNA: challenges for cancer therapy

PubMed Central

Miele, Evelina; Spinelli, Gian Paolo; Miele, Ermanno; Di Fabrizio, Enzo; Ferretti, Elisabetta; Tomao, Silverio; Gulino, Alberto

2012-01-01

During recent decades there have been remarkable advances and profound changes in cancer therapy. Many therapeutic strategies learned at the bench, including monoclonal antibodies and small molecule inhibitors, have been used at the bedside, leading to important successes. One of the most important advances in biology has been the discovery that small interfering RNA (siRNA) is able to regulate the expression of genes, by a phenomenon known as RNA interference (RNAi). RNAi is one of the most rapidly growing fields of research in biology and therapeutics. Much research effort has gone into the application of this new discovery in the treatment of various diseases, including cancer. However, even though these molecules may have potential and strong utility, some limitations make their clinical application difficult, including delivery problems, side effects due to off-target actions, disturbance of physiological functions of the cellular machinery involved in gene silencing, and induction of the innate immune response. Many researchers have attempted to overcome these limitations and to improve the safety of potential RNAi-based therapeutics. Nanoparticles, which are nanostructured entities with tunable size, shape, and surface, as well as biological behavior, provide an ideal opportunity to modify current treatment regimens in a substantial way. These nanoparticles could be designed to surmount one or more of the barriers encountered by siRNA. Nanoparticle drug formulations afford the chance to improve drug bioavailability, exploiting superior tissue permeability, payload protection, and the “stealth” features of these entities. The main aims of this review are: to explain the siRNA mechanism with regard to potential applications in siRNA-based cancer therapy; to discuss the possible usefulness of nanoparticle-based delivery of certain molecules for overcoming present therapeutic limitations; to review the ongoing relevant clinical research with its pitfalls and

Virus-Derived Gene Expression and RNA Interference Vector for Grapevine

PubMed Central

Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.

2012-01-01

The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553

Suppression of RNA Interference by Adenovirus Virus-Associated RNA†

PubMed Central

Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran

2005-01-01

We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917

RNA interference by feeding in vitro synthesized double-stranded RNA to planarians: methodology and dynamics

PubMed Central

Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.

2013-01-01

Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014

Gene silencing in non-model insects: Overcoming hurdles using symbiotic bacteria for trauma-free sustainable delivery of RNA interference: Sustained RNA interference in insects mediated by symbiotic bacteria: Applications as a genetic tool and as a biocide.

PubMed

Whitten, Miranda; Dyson, Paul

2017-03-01

Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.

JingleBells: A Repository of Immune-Related Single-Cell RNA-Sequencing Datasets.

PubMed

Ner-Gaon, Hadas; Melchior, Ariel; Golan, Nili; Ben-Haim, Yael; Shay, Tal

2017-05-01

Recent advances in single-cell RNA-sequencing (scRNA-seq) technology increase the understanding of immune differentiation and activation processes, as well as the heterogeneity of immune cell types. Although the number of available immune-related scRNA-seq datasets increases rapidly, their large size and various formats render them hard for the wider immunology community to use, and read-level data are practically inaccessible to the non-computational immunologist. To facilitate datasets reuse, we created the JingleBells repository for immune-related scRNA-seq datasets ready for analysis and visualization of reads at the single-cell level (http://jinglebells.bgu.ac.il/). To this end, we collected the raw data of publicly available immune-related scRNA-seq datasets, aligned the reads to the relevant genome, and saved aligned reads in a uniform format, annotated for cell of origin. We also added scripts and a step-by-step tutorial for visualizing each dataset at the single-cell level, through the commonly used Integrated Genome Viewer (www.broadinstitute.org/igv/). The uniform scRNA-seq format used in JingleBells can facilitate reuse of scRNA-seq data by computational biologists. It also enables immunologists who are interested in a specific gene to visualize the reads aligned to this gene to estimate cell-specific preferences for splicing, mutation load, or alleles. Thus JingleBells is a resource that will extend the usefulness of scRNA-seq datasets outside the programming aficionado realm. Copyright © 2017 by The American Association of Immunologists, Inc.

RNA Interference of the Muscle Actin Gene in Bed Bugs: Exploring Injection Versus Topical Application for dsRNA Delivery.

PubMed

Basnet, Sanjay; Kamble, Shripat T

2018-05-01

Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.

Profile of microRNA in Giant Panda Blood: A Resource for Immune-Related and Novel microRNAs.

PubMed

Yang, Mingyu; Du, Lianming; Li, Wujiao; Shen, Fujun; Fan, Zhenxin; Jian, Zuoyi; Hou, Rong; Shen, Yongmei; Yue, Bisong; Zhang, Xiuyue

2015-01-01

The giant panda (Ailuropoda melanoleuca) is one of the world's most beloved endangered mammals. Although the draft genome of this species had been assembled, little was known about the composition of its microRNAs (miRNAs) or their functional profiles. Recent studies demonstrated that changes in the expression of miRNAs are associated with immunity. In this study, miRNAs were extracted from the blood of four healthy giant pandas and sequenced by Illumina next generation sequencing technology. As determined by miRNA screening, a total of 276 conserved miRNAs and 51 novel putative miRNAs candidates were detected. After differential expression analysis, we noticed that the expressions of 7 miRNAs were significantly up-regulated in young giant pandas compared with that of adults. Moreover, 2 miRNAs were up-regulated in female giant pandas and 1 in the male individuals. Target gene prediction suggested that the miRNAs of giant panda might be relevant to the expressions of 4,602 downstream genes. Subseuqently, the predicted target genes were conducted to KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis and we found that these genes were mainly involved in host immunity, including the Ras signaling pathway, the PI3K-Akt signaling pathway, and the MAPK signaling pathway. In conclusion, our results provide the first miRNA profiles of giant panda blood, and the predicted functional analyses may open an avenue for further study of giant panda immunity.

Profile of microRNA in Giant Panda Blood: A Resource for Immune-Related and Novel microRNAs

PubMed Central

Yang, Mingyu; Du, Lianming; Li, Wujiao; Shen, Fujun; Fan, Zhenxin; Jian, Zuoyi; Hou, Rong; Shen, Yongmei; Yue, Bisong; Zhang, Xiuyue

2015-01-01

The giant panda (Ailuropoda melanoleuca) is one of the world’s most beloved endangered mammals. Although the draft genome of this species had been assembled, little was known about the composition of its microRNAs (miRNAs) or their functional profiles. Recent studies demonstrated that changes in the expression of miRNAs are associated with immunity. In this study, miRNAs were extracted from the blood of four healthy giant pandas and sequenced by Illumina next generation sequencing technology. As determined by miRNA screening, a total of 276 conserved miRNAs and 51 novel putative miRNAs candidates were detected. After differential expression analysis, we noticed that the expressions of 7 miRNAs were significantly up-regulated in young giant pandas compared with that of adults. Moreover, 2 miRNAs were up-regulated in female giant pandas and 1 in the male individuals. Target gene prediction suggested that the miRNAs of giant panda might be relevant to the expressions of 4,602 downstream genes. Subseuqently, the predicted target genes were conducted to KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis and we found that these genes were mainly involved in host immunity, including the Ras signaling pathway, the PI3K-Akt signaling pathway, and the MAPK signaling pathway. In conclusion, our results provide the first miRNA profiles of giant panda blood, and the predicted functional analyses may open an avenue for further study of giant panda immunity. PMID:26599861

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens

PubMed Central

Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun

2011-01-01

Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219

Real-time monitoring of immune responses under pathogen invasion and drug interference by integrated microfluidic device coupled with worm-based biosensor.

PubMed

Hu, Liang; Ge, Anle; Wang, Xixian; Wang, Shanshan; Yue, Xinpei; Wang, Jie; Feng, Xiaojun; Du, Wei; Liu, Bi-Feng

2018-07-01

Immune response to environmental pathogen invasion is a complex process to prevent host from further damage. For quantitatively understanding immune responses and revealing the pathogenic environmental information, real-time monitoring of such a whole dynamic process with single-animal resolution in well-defined environments is highly desired. In this work, an integrated microfluidic device coupled with worm-based biosensor was proposed for in vivo studies of dynamic immune responses and antibiotics interference in infected C. elegans. Individual worms housed in chambers were exposed to the various pathogens and discontinuously manipulated for imaging with limited influence on physiological activities. The expression of immune responses gene (irg-1) was time-lapse measured in intact worms during pathogen infection. Results demonstrated that irg-1 gene could be induced in the presence of P. aeruginosa strain PA14 in a dose-dependent manner, and the survival of infected worm could be rescued under gentamicin or erythromycin treatments. We expect it to be a versatile platform to facilitate future studies on pathogenesis researches and rapid drug screen using C. elegans disease model. Copyright © 2018 Elsevier B.V. All rights reserved.

Loss of a Conserved tRNA Anticodon Modification Perturbs Plant Immunity

PubMed Central

López, Ana; Castelló, María José; Gil, María José; Zheng, Bo; Chen, Peng; Vera, Pablo

2015-01-01

tRNA is the most highly modified class of RNA species, and modifications are found in tRNAs from all organisms that have been examined. Despite their vastly different chemical structures and their presence in different tRNAs, occurring in different locations in tRNA, the biosynthetic pathways of the majority of tRNA modifications include a methylation step(s). Recent discoveries have revealed unprecedented complexity in the modification patterns of tRNA, their regulation and function, suggesting that each modified nucleoside in tRNA may have its own specific function. However, in plants, our knowledge on the role of individual tRNA modifications and how they are regulated is very limited. In a genetic screen designed to identify factors regulating disease resistance and activation of defenses in Arabidopsis, we identified SUPPRESSOR OF CSB3 9 (SCS9). Our results reveal SCS9 encodes a tRNA methyltransferase that mediates the 2´-O-ribose methylation of selected tRNA species in the anticodon loop. These SCS9-mediated tRNA modifications enhance during the course of infection with the bacterial pathogen Pseudomonas syringae DC3000, and lack of such tRNA modification, as observed in scs9 mutants, severely compromise plant immunity against the same pathogen without affecting the salicylic acid (SA) signaling pathway which regulates plant immune responses. Our results support a model that gives importance to the control of certain tRNA modifications for mounting an effective immune response in Arabidopsis, and therefore expands the repertoire of molecular components essential for an efficient disease resistance response. PMID:26492405

Fluorescence Reporter-Based Genome-Wide RNA Interference Screening to Identify Alternative Splicing Regulators.

PubMed

Misra, Ashish; Green, Michael R

2017-01-01

Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.

Silicon Carbide Mixers Demonstrated to Improve the Interference Immunity of Radio-Based Aircraft Avionics

NASA Technical Reports Server (NTRS)

Neudeck, Philip G.

1998-01-01

Concern over the interference of stray radiofrequency (RF) emissions with key aircraft avionics is evident during takeoff and landing of every commercial flight when the flight attendant requests that all portable electronics be switched off. The operation of key radio-based avionics (such as glide-slope and localizer approach instruments) depends on the ability of front-end RF receivers to detect and amplify desired information signals while rejecting interference from undesired RF sources both inside and outside the aircraft. Incidents where key navigation and approach avionics malfunction because of RF interference clearly represent an increasing threat to flight safety as the radio spectrum becomes more crowded. In an initial feasibility experiment, the U.S. Army Research Laboratory and the NASA Lewis Research Center recently demonstrated the strategic use of silicon carbide (SiC) semiconductor components to significantly reduce the susceptibility of an RF receiver circuit to undesired RF interference. A pair of silicon carbide mixer diodes successfully reduced RF interference (intermodulation distortion) in a prototype receiver circuit by a factor of 10 (20 dB) in comparison to a pair of commercial silicon-based mixer diodes.

RNA Interference Based Approach to Down Regulate Osmoregulators of Whitefly (Bemisia tabaci): Potential Technology for the Control of Whitefly

USDA-ARS?s Scientific Manuscript database

Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...

Molecular requirements for RNA-induced silencing complex assembly in the Drosophila RNA interference pathway.

PubMed

Pham, John W; Sontheimer, Erik J

2005-11-25

Complexes in the Drosophila RNA-induced silencing complex (RISC) assembly pathway can be resolved using native gel electrophoresis, revealing an initiator called R1, an intermediate called R2, and an effector called R3 (now referred to as holo-RISC). Here we show that R1 forms when the Dicer-2/R2D2 heterodimer binds short interfering RNA (siRNA) duplexes. The heterodimer alone can initiate RISC assembly, indicating that other factors are dispensable for initiation. During assembly, R2 requires Argonaute 2 to convert into holo-RISC. This requirement is reminiscent of the RISC-loading complex, which also requires Argonaute 2 for assembly into RISC. We have compared R2 to the RISC-loading complex and show that the two complexes are similar in their sensitivities to ATP and to chemical modifications on siRNA duplexes, indicating that they are likely to be identical. We have examined the requirements for RISC formation and show that the siRNA 5'-termini are repeatedly monitored during RISC assembly, first by the Dcr-2/R2D2 heterodimer and again after R2 formation, before siRNA unwinding. The 2'-position of the 5'-terminal nucleotide also affects RISC assembly, because an siRNA strand bearing a 2'-deoxyribose at this position can inhibit the cognate strand from entering holo-RISC; in contrast, the 2'-deoxyribose-modified strand has enhanced activity in the RNA interference pathway.

Geometric Distribution-Based Readers Scheduling Optimization Algorithm Using Artificial Immune System.

PubMed

Duan, Litian; Wang, Zizhong John; Duan, Fu

2016-11-16

In the multiple-reader environment (MRE) of radio frequency identification (RFID) system, multiple readers are often scheduled to interrogate the randomized tags via operating at different time slots or frequency channels to decrease the signal interferences. Based on this, a Geometric Distribution-based Multiple-reader Scheduling Optimization Algorithm using Artificial Immune System (GD-MRSOA-AIS) is proposed to fairly and optimally schedule the readers operating from the viewpoint of resource allocations. GD-MRSOA-AIS is composed of two parts, where a geometric distribution function combined with the fairness consideration is first introduced to generate the feasible scheduling schemes for reader operation. After that, artificial immune system (including immune clone, immune mutation and immune suppression) quickly optimize these feasible ones as the optimal scheduling scheme to ensure that readers are fairly operating with larger effective interrogation range and lower interferences. Compared with the state-of-the-art algorithm, the simulation results indicate that GD-MRSOA-AIS could efficiently schedules the multiple readers operating with a fairer resource allocation scheme, performing in larger effective interrogation range.

Geometric Distribution-Based Readers Scheduling Optimization Algorithm Using Artificial Immune System

PubMed Central

Duan, Litian; Wang, Zizhong John; Duan, Fu

2016-01-01

In the multiple-reader environment (MRE) of radio frequency identification (RFID) system, multiple readers are often scheduled to interrogate the randomized tags via operating at different time slots or frequency channels to decrease the signal interferences. Based on this, a Geometric Distribution-based Multiple-reader Scheduling Optimization Algorithm using Artificial Immune System (GD-MRSOA-AIS) is proposed to fairly and optimally schedule the readers operating from the viewpoint of resource allocations. GD-MRSOA-AIS is composed of two parts, where a geometric distribution function combined with the fairness consideration is first introduced to generate the feasible scheduling schemes for reader operation. After that, artificial immune system (including immune clone, immune mutation and immune suppression) quickly optimize these feasible ones as the optimal scheduling scheme to ensure that readers are fairly operating with larger effective interrogation range and lower interferences. Compared with the state-of-the-art algorithm, the simulation results indicate that GD-MRSOA-AIS could efficiently schedules the multiple readers operating with a fairer resource allocation scheme, performing in larger effective interrogation range. PMID:27854342

RNA interference for functional genomics and improvement of cotton (Gossypium species)

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...

The role of Cas8 in type I CRISPR interference.

PubMed

Cass, Simon D B; Haas, Karina A; Stoll, Britta; Alkhnbashi, Omer S; Sharma, Kundan; Urlaub, Henning; Backofen, Rolf; Marchfelder, Anita; Bolt, Edward L

2015-05-05

CRISPR (clustered regularly interspaced short palindromic repeat) systems provide bacteria and archaea with adaptive immunity to repel invasive genetic elements. Type I systems use 'cascade' [CRISPR-associated (Cas) complex for antiviral defence] ribonucleoprotein complexes to target invader DNA, by base pairing CRISPR RNA (crRNA) to protospacers. Cascade identifies PAMs (protospacer adjacent motifs) on invader DNA, triggering R-loop formation and subsequent DNA degradation by Cas3. Cas8 is a candidate PAM recognition factor in some cascades. We analysed Cas8 homologues from type IB CRISPR systems in archaea Haloferax volcanii (Hvo) and Methanothermobacter thermautotrophicus (Mth). Cas8 was essential for CRISPR interference in Hvo and purified Mth Cas8 protein responded to PAM sequence when binding to nucleic acids. Cas8 interacted physically with Cas5-Cas7-crRNA complex, stimulating binding to PAM containing substrates. Mutation of conserved Cas8 amino acid residues abolished interference in vivo and altered catalytic activity of Cas8 protein in vitro. This is experimental evidence that Cas8 is important for targeting Cascade to invader DNA. © 2015 Authors.

Harnessing RNA interference to develop neonatal therapies: from Nobel Prize winning discovery to proof of concept clinical trials.

PubMed

DeVincenzo, John P

2009-10-01

A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral

New Kids on the Block: RNA-Based Influenza Virus Vaccines.

PubMed

Scorza, Francesco Berlanda; Pardi, Norbert

2018-04-01

RNA-based immunization strategies have emerged as promising alternatives to conventional vaccine approaches. A substantial body of published work demonstrates that RNA vaccines can elicit potent, protective immune responses against various pathogens. Consonant with its huge impact on public health, influenza virus is one of the best studied targets of RNA vaccine research. Currently licensed influenza vaccines show variable levels of protection against seasonal influenza virus strains but are inadequate against drifted and pandemic viruses. In recent years, several types of RNA vaccines demonstrated efficacy against influenza virus infections in preclinical models. Additionally, comparative studies demonstrated the superiority of some RNA vaccines over the currently used inactivated influenza virus vaccines in animal models. Based on these promising preclinical results, clinical trials have been initiated and should provide valuable information about the translatability of the impressive preclinical data to humans. This review briefly describes RNA-based vaccination strategies, summarizes published preclinical and clinical data, highlights the roadblocks that need to be overcome for clinical applications, discusses the landscape of industrial development, and shares the authors' personal perspectives about the future of RNA-based influenza virus vaccines.

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System.

PubMed

Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T

2018-04-17

In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA

Regulatory functions of trehalose-6-phosphate synthase in the chitin biosynthesis pathway in Tribolium castaneum (Coleoptera: Tenebrionidae) revealed by RNA interference.

PubMed

Chen, Q W; Jin, S; Zhang, L; Shen, Q D; Wei, P; Wei, Z M; Wang, S G; Tang, B

2018-06-01

RNA interference (RNAi) is a very effective technique for studying gene function and may be an efficient method for controlling pests. Trehalose-6-phosphate synthase (TPS), which plays a key role in the synthesis of trehalose and insect development, was cloned in Tribolium castaneum (Herbst) (TcTPS) and the putative functions were studied using RNAi via the injection of double-stranded RNA (dsRNA) corresponding to conserved TPS and trehalose-6-phosphate phosphatase domains. Expression analyses show that TcTPS is expressed higher in the fat body, while quantitative real-time polymerase chain reaction results show that the expression of four trehalase isoforms was significantly suppressed by dsTPS injection. Additionally, the expression of six chitin synthesis-related genes, such as hexokinase 2 and glutamine-fructose-6-phosphate aminotransferase, was suppressed at 48 and 72 h post-dsTPS-1 and dsTPS-2 RNA injection, which were two dsTPS fragments that had been designed for two different locations in TcTPS open reading frame, and that trehalose content and trehalase 1 activity decreased significantly at 72 h post-dsRNA injection. Furthermore, T. castaneum injected with dsTPS-1 and dsTPS-2 RNA displayed significantly lower levels of chitin and could not complete the molting process from larvae to pupae, revealing abnormal molting phenotypes. These results demonstrate that silencing TPS gene leads to molting deformities and high mortality rates via regulation of gene expression in the chitin biosynthetic pathway, and may be a promising approach for pest control in the future.

Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.

PubMed

Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G

2018-05-18

Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.

Mechanisms of innate immune evasion in re-emerging RNA viruses.

PubMed

Ma, Daphne Y; Suthar, Mehul S

2015-06-01

Recent outbreaks of Ebola, West Nile, Chikungunya, Middle Eastern Respiratory and other emerging/re-emerging RNA viruses continue to highlight the need to further understand the virus-host interactions that govern disease severity and infection outcome. As part of the early host antiviral defense, the innate immune system mediates pathogen recognition and initiation of potent antiviral programs that serve to limit virus replication, limit virus spread and activate adaptive immune responses. Concordantly, viral pathogens have evolved several strategies to counteract pathogen recognition and cell-intrinsic antiviral responses. In this review, we highlight the major mechanisms of innate immune evasion by emerging and re-emerging RNA viruses, focusing on pathogens that pose significant risk to public health. Copyright © 2015 Elsevier B.V. All rights reserved.

MicroRNA-mediated networks underlie immune response regulation in papillary thyroid carcinoma

NASA Astrophysics Data System (ADS)

Huang, Chen-Tsung; Oyang, Yen-Jen; Huang, Hsuan-Cheng; Juan, Hsueh-Fen

2014-09-01

Papillary thyroid carcinoma (PTC) is a common endocrine malignancy with low death rate but increased incidence and recurrence in recent years. MicroRNAs (miRNAs) are small non-coding RNAs with diverse regulatory capacities in eukaryotes and have been frequently implied in human cancer. Despite current progress, however, a panoramic overview concerning miRNA regulatory networks in PTC is still lacking. Here, we analyzed the expression datasets of PTC from The Cancer Genome Atlas (TCGA) Data Portal and demonstrate for the first time that immune responses are significantly enriched and under specific regulation in the direct miRNA-target network among distinctive PTC variants to different extents. Additionally, considering the unconventional properties of miRNAs, we explore the protein-coding competing endogenous RNA (ceRNA) and the modulatory networks in PTC and unexpectedly disclose concerted regulation of immune responses from these networks. Interestingly, miRNAs from these conventional and unconventional networks share general similarities and differences but tend to be disparate as regulatory activities increase, coordinately tuning the immune responses that in part account for PTC tumor biology. Together, our systematic results uncover the intensive regulation of immune responses underlain by miRNA-mediated networks in PTC, opening up new avenues in the management of thyroid cancer.

Terminal Duplex Stability and Nucleotide Identity Differentially Control siRNA Loading and Activity in RNA Interference

PubMed Central

Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi

2016-01-01

Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870

RNA interference tools for the western flower thrips, Frankliniella occidentalis.

PubMed

Badillo-Vargas, Ismael E; Rotenberg, Dorith; Schneweis, Brandi A; Whitfield, Anna E

2015-05-01

The insect order Thysanoptera is exclusively comprised of small insects commonly known as thrips. The western flower thrips, Frankliniella occidentalis, is an economically important pest amongst thysanopterans due to extensive feeding damage and tospovirus transmission to hundreds of plant species worldwide. Geographically-distinct populations of F. occidentalis have developed resistance against many types of traditional chemical insecticides, and as such, management of thrips and tospoviruses are a persistent challenge in agriculture. Molecular methods for defining the role(s) of specific genes in thrips-tospovirus interactions and for assessing their potential as gene targets in thrips management strategies is currently lacking. The goal of this work was to develop an RNA interference (RNAi) tool that enables functional genomic assays and to evaluate RNAi for its potential as a biologically-based approach for controlling F. occidentalis. Using a microinjection system, we delivered double-stranded RNA (dsRNA) directly to the hemocoel of female thrips to target the vacuolar ATP synthase subunit B (V-ATPase-B) gene of F. occidentalis. Gene expression analysis using real-time quantitative reverse transcriptase-PCR (qRT-PCR) revealed significant reductions of V-ATPase-B transcripts at 2 and 3 days post-injection (dpi) with dsRNA of V-ATPase-B compared to injection with dsRNA of GFP. Furthermore, the effect of knockdown of the V-ATPase-B gene in females at these two time points was mirrored by the decreased abundance of V-ATPase-B protein as determined by quantitative analysis of Western blots. Reduction in V-ATPase-B expression in thrips resulted in increased female mortality and reduced fertility, i.e., number of viable offspring produced. Survivorship decreased significantly by six dpi compared to the dsRNA-GFP control group, which continued decreasing significantly until the end of the bioassay. Surviving female thrips injected with dsRNA-V-ATPase-B produced

Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

PubMed

Parrish, S; Fire, A

2001-10-01

RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.

Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

PubMed Central

Parrish, S; Fire, A

2001-01-01

RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844

Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference

PubMed Central

Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

2015-01-01

RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667

Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.

PubMed

Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

2015-03-03

RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.

Role of RNA interference (RNAi) in the Moss Physcomitrella patens.

PubMed

Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel

2013-01-14

RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.

New basic approach to treat non-small cell lung cancer based on RNA-interference.

PubMed

Makowiecki, Christina; Nolte, Andrea; Sutaj, Besmire; Keller, Timea; Avci-Adali, Meltem; Stoll, Heidi; Schlensak, Christian; Wendel, Hans Peter; Walker, Tobias

2014-03-01

To date the therapy for non-small cell lung cancer (NSCLC) is associated with severe side effects, frustrating outcomes, and does not consider different tumor characteristics. The RNA-interference (RNAi) pathway represents a potential new approach to treat NSCLC. With small interfering ribonucleic acids (siRNAs), it is possible to reduce the expression of proliferation-dependent proteins in tumor cells, leading to their apoptosis. We propose that siRNAs could be adapted to the tumor type and may cause fewer side effects than current therapy. Four NSCLC cell lines were cultured under standard conditions and transfected with three different concentrations of siRNAs targeted against the hypoxia-inducible factors 1α and 2α (HIF1α and HIF2α) and signal transducer and activator of transcription 3 (STAT3). The expression was observed by quantitative real-time polymerase chain reaction and western blots. For the analysis of cell growth three days after transfection, the cell number was detected using a CASY cell counter system. The results of the silencing of the analyzed factors differ in each cell line. Cell growth was significantly reduced in all cell lines after transfection with HIF1α- and STAT3-siRNA. The silencing of HIF2α resulted in a significant effect on cell growth in squamous, and large-cell lung cancer. This study shows that the knockdown and viability to siRNA transfection differ in each tumor type according to the used siRNA. This implies that the tumor types differ among themselves and should be treated differently. Therefore, the authors suggest a possible approach to a more personalized treatment of NSCLC.

Contribution of murine innate serum inhibitors toward interference within influenza virus immune assays.

PubMed

Cwach, Kevin T; Sandbulte, Heather R; Klonoski, Joshua M; Huber, Victor C

2012-03-01

Prior to detection of an antibody response toward influenza viruses using the hemagglutination inhibition assay (HAI), sera are routinely treated to inactivate innate inhibitors using both heat inactivation (56°C) and recombinant neuraminidase [receptor-destroying enzyme (RDE)]. We revisited the contributions of innate serum inhibitors toward interference with influenza viruses in immune assays, using murine sera, with emphasis on the interactions with influenza A viruses of the H3N2 subtype. We used individual serum treatments: 56°C alone, RDE alone, or RDE + 56°C, to treat sera prior to evaluation within HAI, microneutralization, and macrophage uptake assays. Our data demonstrate that inhibitors present within untreated murine sera interfere with the HAI assay in a manner that is different from that seen for the microneutralization assay. Specifically, the γ class inhibitor α(2) -Macroglobulin (A2-M) can inhibit H3N2 viruses within the HAI assay, but not in the microneutralization assay. Based on these findings, we used a macrophage uptake assay to demonstrate that these inhibitors can increase uptake by macrophages when the influenza viruses express an HA from a 1968 H3N2 virus isolate, but not a 1997 H3N2 isolate. The practice of treating sera to inactivate innate inhibitors of influenza viruses prior to evaluation within immune assays has allowed us to effectively detect influenza virus-specific antibodies for decades. However, this practice has yielded an under-appreciation for the contribution of innate serum inhibitors toward host immune responses against these viruses, including contributions toward neutralization and macrophage uptake. © 2011 Blackwell Publishing Ltd.

RNA Interference in Moths: Mechanisms, Applications, and Progress

PubMed Central

Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He

2016-01-01

The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569

A bacterial Argonaute with noncanonical guide RNA specificity

PubMed Central

Kaya, Emine; Doxzen, Kevin W.; Knoll, Kilian R.; Wilson, Ross C.; Strutt, Steven C.; Kranzusch, Philip J.; Doudna, Jennifer A.

2016-01-01

Eukaryotic Argonaute proteins induce gene silencing by small RNA-guided recognition and cleavage of mRNA targets. Although structural similarities between human and prokaryotic Argonautes are consistent with shared mechanistic properties, sequence and structure-based alignments suggested that Argonautes encoded within CRISPR-cas [clustered regularly interspaced short palindromic repeats (CRISPR)-associated] bacterial immunity operons have divergent activities. We show here that the CRISPR-associated Marinitoga piezophila Argonaute (MpAgo) protein cleaves single-stranded target sequences using 5′-hydroxylated guide RNAs rather than the 5′-phosphorylated guides used by all known Argonautes. The 2.0-Å resolution crystal structure of an MpAgo–RNA complex reveals a guide strand binding site comprising residues that block 5′ phosphate interactions. Using structure-based sequence alignment, we were able to identify other putative MpAgo-like proteins, all of which are encoded within CRISPR-cas loci. Taken together, our data suggest the evolution of an Argonaute subclass with noncanonical specificity for a 5′-hydroxylated guide. PMID:27035975

Intergenic Transcriptional Interference Is Blocked by RNA Polymerase III Transcription Factor TFIIIB in Saccharomyces cerevisiae

PubMed Central

Korde, Asawari; Rosselot, Jessica M.; Donze, David

2014-01-01

The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System

PubMed Central

Cooper, Lauren A.; Stringer, Anne M.

2018-01-01

ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291

EGO-1, a Putative RNA-Directed RNA Polymerase, Promotes Germline Proliferation in Parallel With GLP-1/Notch Signaling and Regulates the Spatial Organization of Nuclear Pore Complexes and Germline P Granules in Caenorhabditis elegans

PubMed Central

Vought, Valarie E.; Ohmachi, Mitsue; Lee, Min-Ho; Maine, Eleanor M.

2005-01-01

Caenorhabditis elegans EGO-1, a putative cellular RNA-directed RNA polymerase, promotes several aspects of germline development, including proliferation, meiosis, and gametogenesis, and ensures a robust response to RNA interference. In C. elegans, GLP-1/Notch signaling from the somatic gonad maintains a population of proliferating germ cells, while entry of germ cells into meiosis is triggered by the GLD-1 and GLD-2 pathways. GLP-1 signaling prevents germ cells from entering meiosis by inhibiting GLD-1 and GLD-2 activity. We originally identified the ego-1 gene on the basis of a genetic interaction with glp-1. Here, we investigate the role of ego-1 in germline proliferation. Our data indicate that EGO-1 does not positively regulate GLP-1 protein levels or GLP-1 signaling activity. Moreover, GLP-1 signaling does not positively regulate EGO-1 activity. EGO-1 does not inhibit expression of GLD-1 protein in the distal germline. Instead, EGO-1 acts in parallel with GLP-1 signaling to influence the proliferation vs. meiosis fate choice. Moreover, EGO-1 and GLD-1 act in parallel to ensure germline health. Finally, the size and distribution of nuclear pore complexes and perinuclear P granules are altered in the absence of EGO-1, effects that disrupt germ cell biology per se and probably limit germline growth. PMID:15911573

RNA Interference in Insect Vectors for Plant Viruses.

PubMed

Kanakala, Surapathrudu; Ghanim, Murad

2016-12-12

Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.

RNA Interference in Insect Vectors for Plant Viruses

PubMed Central

Kanakala, Surapathrudu; Ghanim, Murad

2016-01-01

Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446

RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.

PubMed

Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil

2017-01-01

Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.

Novel Semi-Parametric Algorithm for Interference-Immune Tunable Absorption Spectroscopy Gas Sensing

PubMed Central

Michelucci, Umberto; Venturini, Francesca

2017-01-01

One of the most common limits to gas sensor performance is the presence of unwanted interference fringes arising, for example, from multiple reflections between surfaces in the optical path. Additionally, since the amplitude and the frequency of these interferences depend on the distance and alignment of the optical elements, they are affected by temperature changes and mechanical disturbances, giving rise to a drift of the signal. In this work, we present a novel semi-parametric algorithm that allows the extraction of a signal, like the spectroscopic absorption line of a gas molecule, from a background containing arbitrary disturbances, without having to make any assumption on the functional form of these disturbances. The algorithm is applied first to simulated data and then to oxygen absorption measurements in the presence of strong fringes.To the best of the authors’ knowledge, the algorithm enables an unprecedented accuracy particularly if the fringes have a free spectral range and amplitude comparable to those of the signal to be detected. The described method presents the advantage of being based purely on post processing, and to be of extremely straightforward implementation if the functional form of the Fourier transform of the signal is known. Therefore, it has the potential to enable interference-immune absorption spectroscopy. Finally, its relevance goes beyond absorption spectroscopy for gas sensing, since it can be applied to any kind of spectroscopic data. PMID:28991161

Induction of RNA interference in dendritic cells.

PubMed

Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping

2004-01-01

Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.

Two Distinct RNase Activities of CRISPR-C2c2 Enable Guide RNA Processing and RNA Detection

PubMed Central

East-Seletsky, Alexandra; O’Connell, Mitchell R.; Knight, Spencer C.; Burstein, David; Cate, Jamie H. D.; Tjian, Robert; Doudna, Jennifer A.

2017-01-01

Bacterial adaptive immune systems employ CRISPRs (clustered regularly interspaced short palindromic repeats) and CRISPR-associated (Cas) proteins for RNA-guided nucleic acid cleavage1,2. Although generally targeted to DNA substrates3–5, the Type III and Type VI CRISPR systems direct interference complexes against single-stranded RNA (ssRNA) substrates6–9. In Type VI systems, the single-subunit C2c2 protein functions as an RNA-guided RNA endonuclease9,10. How this enzyme acquires mature CRISPR RNAs (crRNAs) essential for immune surveillance and its mechanism of crRNA-mediated RNA cleavage remain unclear. Here we show that C2c2 possesses a unique ribonuclease activity responsible for CRISPR RNA maturation that is distinct from its RNA-activated ssRNA-degradation activity. These dual ribonuclease functions are chemically and mechanistically different from each other and from the crRNA-processing behavior of the evolutionarily unrelated CRISPR enzyme Cpf111. We show that the two ribonuclease activities of C2c2 enable multiplexed processing and loading of guide RNAs that in turn allow for sensitive cellular transcript detection. PMID:27669025

Disruption of Specific RNA-RNA Interactions in a Double-Stranded RNA Virus Inhibits Genome Packaging and Virus Infectivity

PubMed Central

Fajardo, Teodoro; Sung, Po-Yu; Roy, Polly

2015-01-01

Bluetongue virus (BTV) causes hemorrhagic disease in economically important livestock. The BTV genome is organized into ten discrete double-stranded RNA molecules (S1-S10) which have been suggested to follow a sequential packaging pathway from smallest to largest segment during virus capsid assembly. To substantiate and extend these studies, we have investigated the RNA sorting and packaging mechanisms with a new experimental approach using inhibitory oligonucleotides. Putative packaging signals present in the 3’untranslated regions of BTV segments were targeted by a number of nuclease resistant oligoribonucleotides (ORNs) and their effects on virus replication in cell culture were assessed. ORNs complementary to the 3’ UTR of BTV RNAs significantly inhibited virus replication without affecting protein synthesis. Same ORNs were found to inhibit complex formation when added to a novel RNA-RNA interaction assay which measured the formation of supramolecular complexes between and among different RNA segments. ORNs targeting the 3’UTR of BTV segment 10, the smallest RNA segment, were shown to be the most potent and deletions or substitution mutations of the targeted sequences diminished the RNA complexes and abolished the recovery of viable viruses using reverse genetics. Cell-free capsid assembly/RNA packaging assay also confirmed that the inhibitory ORNs could interfere with RNA packaging and further substitution mutations within the putative RNA packaging sequence have identified the recognition sequence concerned. Exchange of 3’UTR between segments have further demonstrated that RNA recognition was segment specific, most likely acting as part of the secondary structure of the entire genomic segment. Our data confirm that genome packaging in this segmented dsRNA virus occurs via the formation of supramolecular complexes formed by the interaction of specific sequences located in the 3’ UTRs. Additionally, the inhibition of packaging in-trans with inhibitory

Disruption of Specific RNA-RNA Interactions in a Double-Stranded RNA Virus Inhibits Genome Packaging and Virus Infectivity.

PubMed

Fajardo, Teodoro; Sung, Po-Yu; Roy, Polly

2015-12-01

Bluetongue virus (BTV) causes hemorrhagic disease in economically important livestock. The BTV genome is organized into ten discrete double-stranded RNA molecules (S1-S10) which have been suggested to follow a sequential packaging pathway from smallest to largest segment during virus capsid assembly. To substantiate and extend these studies, we have investigated the RNA sorting and packaging mechanisms with a new experimental approach using inhibitory oligonucleotides. Putative packaging signals present in the 3'untranslated regions of BTV segments were targeted by a number of nuclease resistant oligoribonucleotides (ORNs) and their effects on virus replication in cell culture were assessed. ORNs complementary to the 3' UTR of BTV RNAs significantly inhibited virus replication without affecting protein synthesis. Same ORNs were found to inhibit complex formation when added to a novel RNA-RNA interaction assay which measured the formation of supramolecular complexes between and among different RNA segments. ORNs targeting the 3'UTR of BTV segment 10, the smallest RNA segment, were shown to be the most potent and deletions or substitution mutations of the targeted sequences diminished the RNA complexes and abolished the recovery of viable viruses using reverse genetics. Cell-free capsid assembly/RNA packaging assay also confirmed that the inhibitory ORNs could interfere with RNA packaging and further substitution mutations within the putative RNA packaging sequence have identified the recognition sequence concerned. Exchange of 3'UTR between segments have further demonstrated that RNA recognition was segment specific, most likely acting as part of the secondary structure of the entire genomic segment. Our data confirm that genome packaging in this segmented dsRNA virus occurs via the formation of supramolecular complexes formed by the interaction of specific sequences located in the 3' UTRs. Additionally, the inhibition of packaging in-trans with inhibitory ORNs

Interference of hepatitis C virus RNA replication by short interfering RNAs

NASA Astrophysics Data System (ADS)

Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.

2003-02-01

Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.

Antiviral Effects of Small Interfering RNA Simultaneously Inducing RNA Interference and Type 1 Interferon in Coxsackievirus Myocarditis

PubMed Central

Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon

2012-01-01

Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300

RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.

PubMed

Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy

2018-06-01

Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Comparison of the Functional microRNA Expression in Immune Cell Subsets of Neonates and Adults

PubMed Central

Yu, Hong-Ren; Hsu, Te-Yao; Huang, Hsin-Chun; Kuo, Ho-Chang; Li, Sung-Chou; Yang, Kuender D.; Hsieh, Kai-Sheng

2016-01-01

Diversity of biological molecules in newborn and adult immune cells contributes to differences in cell function and atopic properties. Micro RNAs (miRNAs) are reported to involve in the regulation of immune system. Therefore, determining the miRNA expression profile of leukocyte subpopulations is important for understanding immune system regulation. In order to explore the unique miRNA profiling that contribute to altered immune in neonates, we comprehensively analyzed the functional miRNA signatures of eight leukocyte subsets (polymorphonuclear cells, monocytes, CD4+ T cells, CD8+ T cells, natural killer cells, B cells, plasmacytoid dendritic cells, and myeloid dendritic cells) from both neonatal and adult umbilical cord and peripheral blood samples, respectively. We observed distinct miRNA profiles between adult and neonatal blood leukocyte subsets, including unique miRNA signatures for each cell lineage. Leukocyte miRNA signatures were altered after stimulation. Adult peripheral leukocytes had higher let-7b-5p expression levels compared to neonatal cord leukocytes across multiple subsets, irrespective of stimulation. Transfecting neonatal monocytes with a let-7b-5p mimic resulted in a reduction of LPS-induced interleukin (IL)-6 and TNF-α production, while transfection of a let-7b-5p inhibitor into adult monocytes enhanced IL-6 and TNF-α production. With this functional approach, we provide intact differential miRNA expression profiling of specific immune cell subsets between neonates and adults. These studies serve as a basis to further understand the altered immune response observed in neonates and advance the development of therapeutic strategies. PMID:28066425

Secondary RNA structure and its role in RNA interference to silence the respiratory syncytial virus fusion protein gene.

PubMed

Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R

2009-11-01

RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.

A whole genome screening and RNA interference identify a juvenile hormone esterase-like gene of the diamondback moth, Plutella xylostella.

PubMed

Gu, Xiaojun; Kumar, Sunil; Kim, Eunjin; Kim, Yonggyun

2015-09-01

Juvenile hormone (JH) plays a crucial role in preventing precocious metamorphosis and stimulating reproduction. Thus, its hemolymph titer should be under a tight control. As a negative controller, juvenile hormone esterase (JHE) performs a rapid breakdown of residual JH in the hemolymph during last instar to induce a larval-to-pupal metamorphosis. A whole genome of the diamondback moth (DBM), Plutella xylostella, has been annotated and proposed 11 JHE candidates. Sequence analysis using conserved motifs commonly found in other JHEs proposed a putative JHE (Px004817). Px004817 (64.61 kDa, pI=5.28) exhibited a characteristic JHE expression pattern by showing high peak at the early last instar, at which JHE enzyme activity was also at a maximal level. RNA interference of Px004817 reduced JHE activity and interrupted pupal development with a significant increase of larval period. This study identifies Px004817 as a JHE-like gene of P. xylostella. Copyright © 2015 Elsevier Ltd. All rights reserved.

Special Issue: Gene Therapy with Emphasis on RNA Interference

PubMed Central

Lundstrom, Kenneth

2015-01-01

Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255

RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

PubMed

Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

2014-06-19

The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?

PubMed Central

Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N.

2016-01-01

The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term. PMID:26927085

RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?

PubMed

Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N

2016-02-26

The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.

Functional analysis of two polygalacturonase genes in Apolygus lucorum associated with eliciting plant injury using RNA interference.

PubMed

Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei

2017-04-01

Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.

The cytomegalovirus promoter-driven short hairpin RNA constructs mediate effective RNA interference in zebrafish in vivo.

PubMed

Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun

2008-01-01

The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.

Deep sequencing and in silico analysis of small RNA library reveals novel miRNA from leaf Persicaria minor transcriptome.

PubMed

Samad, Abdul Fatah A; Nazaruddin, Nazaruddin; Murad, Abdul Munir Abdul; Jani, Jaeyres; Zainal, Zamri; Ismail, Ismanizan

2018-03-01

In current era, majority of microRNA (miRNA) are being discovered through computational approaches which are more confined towards model plants. Here, for the first time, we have described the identification and characterization of novel miRNA in a non-model plant, Persicaria minor ( P . minor ) using computational approach. Unannotated sequences from deep sequencing were analyzed based on previous well-established parameters. Around 24 putative novel miRNAs were identified from 6,417,780 reads of the unannotated sequence which represented 11 unique putative miRNA sequences. PsRobot target prediction tool was deployed to identify the target transcripts of putative novel miRNAs. Most of the predicted target transcripts (mRNAs) were known to be involved in plant development and stress responses. Gene ontology showed that majority of the putative novel miRNA targets involved in cellular component (69.07%), followed by molecular function (30.08%) and biological process (0.85%). Out of 11 unique putative miRNAs, 7 miRNAs were validated through semi-quantitative PCR. These novel miRNAs discoveries in P . minor may develop and update the current public miRNA database.

Scavenger receptor mediates systemic RNA interference in ticks.

PubMed

Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo

2011-01-01

RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.

Scavenger Receptor Mediates Systemic RNA Interference in Ticks

PubMed Central

Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo

2011-01-01

RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043

CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

PubMed

Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

2014-05-06

In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.

PubMed

Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna

2014-01-01

Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

PubMed Central

Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara

2011-01-01

RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198

Global analysis of gene expression reveals mRNA superinduction is required for the inducible immune response to a bacterial pathogen

PubMed Central

Barry, Kevin C; Ingolia, Nicholas T; Vance, Russell E

2017-01-01

The inducible innate immune response to infection requires a concerted process of gene expression that is regulated at multiple levels. Most global analyses of the innate immune response have focused on transcription induced by defined immunostimulatory ligands, such as lipopolysaccharide. However, the response to pathogens involves additional complexity, as pathogens interfere with virtually every step of gene expression. How cells respond to pathogen-mediated disruption of gene expression to nevertheless initiate protective responses remains unclear. We previously discovered that a pathogen-mediated blockade of host protein synthesis provokes the production of specific pro-inflammatory cytokines. It remains unclear how these cytokines are produced despite the global pathogen-induced block of translation. We addressed this question by using parallel RNAseq and ribosome profiling to characterize the response of macrophages to infection with the intracellular bacterial pathogen Legionella pneumophila. Our results reveal that mRNA superinduction is required for the inducible immune response to a bacterial pathogen. DOI: http://dx.doi.org/10.7554/eLife.22707.001 PMID:28383283

Role of RNA interference in plant improvement

NASA Astrophysics Data System (ADS)

Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant

2011-06-01

Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.

Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

PubMed

Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

2012-07-01

A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

Supradural inflammatory soup in awake and freely moving rats induces facial allodynia that is blocked by putative immune modulators.

PubMed

Wieseler, Julie; Ellis, Amanda; McFadden, Andrew; Stone, Kendra; Brown, Kimberley; Cady, Sara; Bastos, Leandro F; Sprunger, David; Rezvani, Niloofar; Johnson, Kirk; Rice, Kenner C; Maier, Steven F; Watkins, Linda R

2017-06-01

Facial allodynia is a migraine symptom that is generally considered to represent a pivotal point in migraine progression. Treatment before development of facial allodynia tends to be more successful than treatment afterwards. As such, understanding the underlying mechanisms of facial allodynia may lead to a better understanding of the mechanisms underlying migraine. Migraine facial allodynia is modeled by applying inflammatory soup (histamine, bradykinin, serotonin, prostaglandin E2) over the dura. Whether glial and/or immune activation contributes to such pain is unknown. Here we tested if trigeminal nucleus caudalis (Sp5C) glial and/or immune cells are activated following supradural inflammatory soup, and if putative glial/immune inhibitors suppress the consequent facial allodynia. Inflammatory soup was administered via bilateral indwelling supradural catheters in freely moving rats, inducing robust and reliable facial allodynia. Gene expression for microglial/macrophage activation markers, interleukin-1β, and tumor necrosis factor-α increased following inflammatory soup along with robust expression of facial allodynia. This provided the basis for pursuing studies of the behavioral effects of 3 diverse immunomodulatory drugs on facial allodynia. Pretreatment with either of two compounds broadly used as putative glial/immune inhibitors (minocycline, ibudilast) prevented the development of facial allodynia, as did treatment after supradural inflammatory soup but prior to the expression of facial allodynia. Lastly, the toll-like receptor 4 (TLR4) antagonist (+)-naltrexone likewise blocked development of facial allodynia after supradural inflammatory soup. Taken together, these exploratory data support that activated glia and/or immune cells may drive the development of facial allodynia in response to supradural inflammatory soup in unanesthetized male rats. Copyright © 2017 Elsevier B.V. All rights reserved.

Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

DOE PAGES

Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...

2016-10-13

The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

Altered stoichiometry Escherichia coli Cascade complexes with shortened CRISPR RNA spacers are capable of interference and primed adaptation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia

The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less

Engineering Molecular Immunity Against Plant Viruses.

PubMed

Zaidi, Syed Shan-E-Ali; Tashkandi, Manal; Mahfouz, Magdy M

2017-01-01

Genomic engineering has been used to precisely alter eukaryotic genomes at the single-base level for targeted gene editing, replacement, fusion, and mutagenesis, and plant viruses such as Tobacco rattle virus have been developed into efficient vectors for delivering genome-engineering reagents. In addition to altering the host genome, these methods can target pathogens to engineer molecular immunity. Indeed, recent studies have shown that clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) systems that target the genomes of DNA viruses can interfere with viral activity and limit viral symptoms in planta, demonstrating the utility of this system for engineering molecular immunity in plants. CRISPR/Cas9 can efficiently target single and multiple viral infections and confer plant immunity. Here, we discuss the use of site-specific nucleases to engineer molecular immunity against DNA and RNA viruses in plants. We also explore how to address the potential challenges encountered when producing plants with engineered resistance to single and mixed viral infections. © 2017 Elsevier Inc. All rights reserved.

Complete Genome Sequence of Diaphorina citri-associated C virus, a Novel Putative RNA Virus of the Asian Citrus Psyllid, Diaphorina citri.

PubMed

Nouri, Shahideh; Salem, Nidà; Falk, Bryce W

2016-07-21

We present here the complete nucleotide sequence and genome organization of a novel putative RNA virus identified in field populations of the Asian citrus psyllid, Diaphorina citri, through sequencing of the transcriptome followed by reverse transcription-PCR (RT-PCR). We tentatively named this virus Diaphorina citri-associated C virus (DcACV). DcACV is an unclassified positive-sense RNA virus. Copyright © 2016 Nouri et al.

Ran Involved in the Development and Reproduction Is a Potential Target for RNA-Interference-Based Pest Management in Nilaparvata lugens

PubMed Central

Wang, Wei-Xia; Lai, Feng-Xiang; Fu, Qiang

2015-01-01

Ran (RanGTPase) in insects participates in the 20-hydroxyecdysone signal transduction pathway in which downstream genes, FTZ-F1, Krüppel-homolog 1 (Kr-h1) and vitellogenin, are involved. A putative Ran gene (NlRan) was cloned from Nilaparvata lugens, a destructive phloem-feeding pest of rice. NlRan has the typical Ran primary structure features that are conserved in insects. NlRan showed higher mRNA abundance immediately after molting and peaked in newly emerged female adults. Among the examined tissues ovary had the highest transcript level, followed by fat body, midgut and integument, and legs. Three days after dsNlRan injection the NlRan mRNA abundance in the third-, fourth-, and fifth-instar nymphs was decreased by 94.3%, 98.4% and 97.0%, respectively. NlFTZ-F1 expression levels in treated third- and fourth-instar nymphs were reduced by 89.3% and 23.8%, respectively. In contrast, NlKr-h1 mRNA levels were up-regulated by 67.5 and 1.5 folds, respectively. NlRan knockdown significantly decreased the body weights, delayed development, and killed >85% of the nymphs at day seven. Two apparent phenotypic defects were observed: (1) Extended body form, and failed to molt; (2) The cuticle at the notum was split open but cannot completely shed off. The newly emerged female adults from dsNlRan injected fifth-instar nymphs showed lower levels of NlRan and vitellogenin, lower weight gain and honeydew excretion comparing with the blank control, and no offspring. Those results suggest that NlRan encodes a functional protein that was involved in development and reproduction. The study established proof of concept that NlRan could serve as a target for dsRNA-based pesticides for N. lugens control. PMID:26554926

Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells

DTIC Science & Technology

2005-07-01

pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23󈧜. My initial studies

The RNA Silencing Enzyme RNA Polymerase V Is Required for Plant Immunity

PubMed Central

López, Ana; Ramírez, Vicente; García-Andrade, Javier; Flors, Victor; Vera, Pablo

2011-01-01

RNA–directed DNA methylation (RdDM) is an epigenetic control mechanism driven by small interfering RNAs (siRNAs) that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1). NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V), which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA)–mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA)–mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA–related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence, but

In silico molecular docking analysis of the human Argonaute 2 PAZ domain reveals insights into RNA interference.

PubMed

Kandeel, Mahmoud; Kitade, Yukio

2013-07-01

RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.

Antiviral Immunity and Circular RNA: No End in Sight.

PubMed

Cadena, Cristhian; Hur, Sun

2017-07-20

In this issue of Molecular Cell, two papers by Chen et al. (2017) and Li et al. (2017) describe new insights into circRNA biogenesis and function, connecting circRNAs to innate immune pathways. Copyright © 2017 Elsevier Inc. All rights reserved.

Enhancing immunomodulation on innate immunity by shape transition among RNA triangle, square and pentagon nanovehicles

PubMed Central

Khisamutdinov, Emil F.; Li, Hui; Jasinski, Daniel L.; Chen, Jiao; Fu, Jian; Guo, Peixuan

2014-01-01

Modulation of immune response is important in cancer immunotherapy, vaccine adjuvant development and inflammatory or immune disease therapy. Here we report the development of new immunomodulators via control of shape transition among RNA triangle, square and pentagon. Changing one RNA strand in polygons automatically induced the stretching of the interior angle from 60° to 90° or 108°, resulting in self-assembly of elegant RNA triangles, squares and pentagons. When immunological adjuvants were incorporated, their immunomodulation effect for cytokine TNF-α and IL-6 induction was greatly enhanced in vitro and in animals up to 100-fold, while RNA polygon controls induced unnoticeable effect. The RNA nanoparticles were delivered to macrophages specifically. The degree of immunostimulation greatly depended on the size, shape and number of the payload per nanoparticles. Stronger immune response was observed when the number of adjuvants per polygon was increased, demonstrating the advantage of shape transition from triangle to pentagon. PMID:25092921

How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference

ERIC Educational Resources Information Center

Kuldell, Natalie H.

2006-01-01

It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…

Uncovering the Role of RNA-Binding Proteins in Gene Expression in the Immune System

PubMed Central

Díaz-Muñoz, Manuel D.; Turner, Martin

2018-01-01

Fighting external pathogens requires an ever-changing immune system that relies on tight regulation of gene expression. Transcriptional control is the first step to build efficient responses while preventing immunodeficiencies and autoimmunity. Post-transcriptional regulation of RNA editing, location, stability, and translation are the other key steps for final gene expression, and they are all controlled by RNA-binding proteins (RBPs). Nowadays we have a deep understanding of how transcription factors control the immune system but recent evidences suggest that post-transcriptional regulation by RBPs is equally important for both development and activation of immune responses. Here, we review current knowledge about how post-transcriptional control by RBPs shapes our immune system and discuss the perspective of RBPs being the key players of a hidden immune cell epitranscriptome. PMID:29875770

Uncovering the Role of RNA-Binding Proteins in Gene Expression in the Immune System.

PubMed

Díaz-Muñoz, Manuel D; Turner, Martin

2018-01-01

Fighting external pathogens requires an ever-changing immune system that relies on tight regulation of gene expression. Transcriptional control is the first step to build efficient responses while preventing immunodeficiencies and autoimmunity. Post-transcriptional regulation of RNA editing, location, stability, and translation are the other key steps for final gene expression, and they are all controlled by RNA-binding proteins (RBPs). Nowadays we have a deep understanding of how transcription factors control the immune system but recent evidences suggest that post-transcriptional regulation by RBPs is equally important for both development and activation of immune responses. Here, we review current knowledge about how post-transcriptional control by RBPs shapes our immune system and discuss the perspective of RBPs being the key players of a hidden immune cell epitranscriptome.

A role for small RNA in regulating innate immunity during plant growth

PubMed Central

Deng, Yingtian; Wang, Jubin; Tung, Jeffrey; Liu, Dan; Zhou, Yingjia; He, Shuang; Baker, Barbara

2018-01-01

Plant genomes encode large numbers of nucleotide-binding (NB) leucine-rich repeat (LRR) immune receptors (NLR) that mediate effector triggered immunity (ETI) and play key roles in protecting crops from diseases caused by devastating pathogens. Fitness costs are associated with plant NLR genes and regulation of NLR genes by micro(mi)RNAs and phased small interfering RNAs (phasiRNA) is proposed as a mechanism for reducing these fitness costs. However, whether NLR expression and NLR-mediated immunity are regulated during plant growth is unclear. We conducted genome-wide transcriptome analysis and showed that NLR expression gradually increased while expression of their regulatory small RNAs (sRNA) gradually decreased as plants matured, indicating that sRNAs could play a role in regulating NLR expression during plant growth. We further tested the role of miRNA in the growth regulation of NLRs using the tobacco mosaic virus (TMV) resistance gene N, which was targeted by miR6019 and miR6020. We showed that N-mediated resistance to TMV effectively restricted this virus to the infected leaves of 6-week old plants, whereas TMV infection was lethal in 1- and 3-week old seedlings due to virus-induced systemic necrosis. We further found that N transcript levels gradually increased while miR6019 levels gradually decreased during seedling maturation that occurs in the weeks after germination. Analyses of reporter genes in transgenic plants showed that growth regulation of N expression was post-transcriptionally mediated by MIR6019/6020 whereas MIR6019/6020 was regulated at the transcriptional level during plant growth. TMV infection of MIR6019/6020 transgenic plants indicated a key role for miR6019-triggered phasiRNA production for regulation of N-mediated immunity. Together our results demonstrate a mechanistic role for miRNAs in regulating innate immunity during plant growth. PMID:29293695

Double-stranded RNA innate immune response activation from long-term adeno-associated virus vector transduction.

PubMed

Shao, Wenwei; Earley, Lauriel F; Chai, Zheng; Chen, Xiaojing; Sun, Junjiang; He, Ting; Deng, Meng; Hirsch, Matthew L; Ting, Jenny; Samulski, R Jude; Li, Chengwen

2018-06-21

Data from clinical trials for hemophilia B using adeno-associated virus (AAV) vectors have demonstrated decreased transgenic coagulation factor IX (hFIX) expression 6-10 weeks after administration of a high vector dose. While it is likely that capsid-specific cytotoxic T lymphocytes eliminate vector-transduced hepatocytes, thereby resulting in decreased hFIX, this observation is not intuitively consistent with restored hFIX levels following prednisone application. Although the innate immune response is immediately activated following AAV vector infection via TLR pathways, no studies exist regarding the role of the innate immune response at later time points after AAV vector transduction. Herein, activation of the innate immune response in cell lines, primary human hepatocytes, and hepatocytes in a human chimeric mouse model was observed at later time points following AAV vector transduction. Mechanistic analysis demonstrated that the double-stranded RNA (dsRNA) sensor MDA5 was necessary for innate immune response activation and that transient knockdown of MDA5, or MAVS, decreased IFN-β expression while increasing transgene production in AAV-transduced cells. These results both highlight the role of the dsRNA-triggered innate immune response in therapeutic transgene expression at later time points following AAV transduction and facilitate the execution of effective strategies to block the dsRNA innate immune response in future clinical trials.

The relative immunity of high-frequency transposed stimuli to low-frequency binaural interference

NASA Astrophysics Data System (ADS)

Bernstein, Leslie R.; Trahiotis, Constantine

2004-05-01

We have recently demonstrated that high-frequency transposed stimuli, having envelopes designed to provide high-frequency channels with information similar to that normally available in only low-frequency channels, yield threshold-ITDs and extents of laterality comparable to those obtained with conventional low-frequency stimuli. This enhanced potency of ITDs conveyed by high-frequency transposed stimuli, as compared to conventional high-frequency stimuli, suggested to us that ITDs conveyed by transposed stimuli might be relatively immune to the presence of low-frequency binaural interferers. To investigate this issue, threshold-ITDs and extents of laterality were measured with a variety of conventional and transposed targets centered at 4 kHz. The targets were presented either in the presence or absence of a simultaneously gated diotic noise centered at 500 Hz, the interferer. As expected, the presence of the low-frequency interferer resulted in substantially elevated threshold-ITDs and reduced extents of laterality for the conventional high-frequency stimuli. In contrast, these interference effects were either greatly attenuated or absent for ITDs conveyed by the high-frequency transposed targets. The results will be discussed in the context of current models of binaural interference. [Work supported by NIH DC 04147, NIH DC04073, NIH DC 002304.

RNA interference: learning gene knock-down from cell physiology

PubMed Central

Mocellin, Simone; Provenzano, Maurizio

2004-01-01

Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

Small-interfering RNA (siRNA)-based functional micro- and nanostructures for efficient and selective gene silencing.

PubMed

Lee, Soo Hyeon; Chung, Bong Hyun; Park, Tae Gwan; Nam, Yoon Sung; Mok, Hyejung

2012-07-17

Because of RNA's ability to encode structure and functional information, researchers have fabricated diverse geometric structures from this polymer at the micro- and nanoscale. With their tunable structures, rigidity, and biocompatibility, novel two-dimensional and three-dimensional RNA structures can serve as a fundamental platform for biomedical applications, including engineered tissues, biosensors, and drug delivery vehicles. The discovery of the potential of small-interfering RNA (siRNA) has underscored the applications of RNA-based micro- and nanostructures in medicine. Small-interfering RNA (siRNA), synthetic double-stranded RNA consisting of approximately 21 base pairs, suppresses problematic target genes in a sequence-specific manner via inherent RNA interference (RNAi) processing. As a result, siRNA offers a potential strategy for treatment of many human diseases. However, due to inefficient delivery to cells and off-target effects, the clinical application of therapeutic siRNA has been very challenging. To address these issues, researchers have studied a variety of nanocarrier systems for siRNA delivery. In this Account, we describe several strategies for efficient siRNA delivery and selective gene silencing. We took advantage of facile chemical conjugation and complementary hybridization to design novel siRNA-based micro- and nanostructures. Using chemical crosslinkers and hydrophobic/hydrophilic polymers at the end of siRNA, we produced various RNA-based structures, including siRNA block copolymers, micelles, linear siRNA homopolymers, and microhydrogels. Because of their increased charge density and flexibility compared with conventional siRNA, these micro- and nanostructures can form polyelectrolyte complexes with poorly charged and biocompatible cationic carriers that are both more condensed and more homogenous than the complexes formed in other carrier systems. In addition, the fabricated siRNA-based structures are linked by cleavable disulfide

Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

PubMed

Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

2014-05-16

Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

Image-based RNA interference screening reveals an individual dependence of acute lymphoblastic leukemia on stromal cysteine support

PubMed Central

Marovca, Blerim; Vonderheit, Andreas; Grotzer, Michael A.; Eckert, Cornelia; Cario, Gunnar; Wollscheid, Bernd; Horvath, Peter

2014-01-01

Interactions with the bone marrow microenvironment are essential for leukemia survival and disease progression. We developed an imaging-based RNAi platform to identify protective cues from bone marrow derived mesenchymal stromal cells (MSC) that promote survival of primary acute lymphoblastic leukemia (ALL) cells. Using a candidate gene approach, we detected distinct responses of individual ALL cases to RNA interference with stromal targets. The strongest effects were observed when interfering with solute carrier family 3 member 2 (SLC3A2) expression, which forms the cystine transporter xc− when associated with SLC7A11. Import of cystine and metabolism to cysteine by stromal cells provides the limiting substrate to generate and maintain glutathione in ALL. This metabolic interaction reduces oxidative stress in ALL cells that depend on stromal xc−. Indeed, cysteine depletion using cysteine dioxygenase resulted in leukemia cell death. Thus, functional evaluation of intercellular interactions between leukemia cells and their microenvironment identifies a selective dependency of ALL cells on stromal metabolism for a relevant subgroup of cases, providing new opportunities to develop more personalized approaches to leukemia treatment. PMID:25415224

Interference activity of a minimal Type I CRISPR–Cas system from Shewanella putrefaciens

PubMed Central

Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

2015-01-01

Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. PMID:26350210

RNA interference-based resistance in transgenic tomato plants against Tomato yellow leaf curl virus-Oman (TYLCV-OM) and its associated betasatellite.

PubMed

Ammara, Um e; Mansoor, Shahid; Saeed, Muhammad; Amin, Imran; Briddon, Rob W; Al-Sadi, Abdullah Mohammed

2015-03-04

Tomato yellow leaf curl virus (TYLCV), a monopartite begomovirus (family Geminiviridae) is responsible for heavy yield losses for tomato production around the globe. In Oman at least five distinct begomoviruses cause disease in tomato, including TYLCV. Unusually, TYLCV infections in Oman are sometimes associated with a betasatellite (Tomato leaf curl betasatellite [ToLCB]; a symptom modulating satellite). RNA interference (RNAi) can be used to develop resistance against begomoviruses at either the transcriptional or post-transcriptional levels. A hairpin RNAi (hpRNAi) construct to express double-stranded RNA homologous to sequences of the intergenic region, coat protein gene, V2 gene and replication-associated gene of Tomato yellow leaf curl virus-Oman (TYLCV-OM) was produced. Initially, transient expression of the hpRNAi construct at the site of virus inoculation was shown to reduce the number of plants developing symptoms when inoculated with either TYLCV-OM or TYLCV-OM with ToLCB-OM to Nicotiana benthamiana or tomato. Solanum lycopersicum L. cv. Pusa Ruby was transformed with the hpRNAi construct and nine confirmed transgenic lines were obtained and challenged with TYLCV-OM and ToLCB-OM by Agrobacterium-mediated inoculation. For all but one line, for which all plants remained symptomless, inoculation with TYLCV-OM led to a proportion (≤25%) of tomato plants developing symptoms of infection. For inoculation with TYLCV-OM and ToLCB-OM all lines showed a proportion of plants (≤45%) symptomatic. However, for all infected transgenic plants the symptoms were milder and virus titre in plants was lower than in infected non-transgenic tomato plants. These results show that RNAi can be used to develop resistance against geminiviruses in tomato. The resistance in this case is not immunity but does reduce the severity of infections and virus titer. Also, the betasatellite may compromise resistance, increasing the proportion of plants which ultimately show symptoms.

On future's doorstep: RNA interference and the pharmacopeia of tomorrow.

PubMed

Gewirtz, Alan M

2007-12-01

Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.

How short RNAs impact the human ribonuclease Dicer activity: putative regulatory feedback-loops and other RNA-mediated mechanisms controlling microRNA processing.

PubMed

Koralewska, Natalia; Hoffmann, Weronika; Pokornowska, Maria; Milewski, Marek; Lipinska, Andrea; Bienkowska-Szewczyk, Krystyna; Figlerowicz, Marek; Kurzynska-Kokorniak, Anna

2016-01-01

Ribonuclease Dicer plays a pivotal role in RNA interference pathways by processing long double-stranded RNAs and single-stranded hairpin RNA precursors into small interfering RNAs (siRNAs) and microRNAs (miRNAs), respectively. While details of Dicer regulation by a variety of proteins are being elucidated, less is known about non-protein factors, e.g. RNA molecules, that may influence this enzyme's activity. Therefore, we decided to investigate the question of whether the RNA molecules can function not only as Dicer substrates but also as its regulators. Our previous in vitro studies indicated that the activity of human Dicer can be influenced by short RNA molecules that either bind to Dicer or interact with its substrates, or both. Those studies were carried out with commercial Dicer preparations. Nevertheless, such preparations are usually not homogeneous enough to carry out more detailed RNA-binding studies. Therefore, we have established our own system for the production of human Dicer in insect cells. In this manuscript, we characterize the RNA-binding and RNA-cleavage properties of the obtained preparation. We demonstrate that Dicer can efficiently bind single-stranded RNAs that are longer than ~20-nucleotides. Consequently, we revisit possible scenarios of Dicer regulation by single-stranded RNA species ranging from ~10- to ~60-nucleotides, in the context of their binding to this enzyme. Finally, we show that siRNA/miRNA-sized RNAs may affect miRNA production either by binding to Dicer or by participating in regulatory feedback-loops. Altogether, our studies suggest a broad regulatory role of short RNAs in Dicer functioning.

Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.

PubMed

Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla

2014-04-01

Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.

Strigolactone-Induced Putative Secreted Protein 1 Is Required for the Establishment of Symbiosis by the Arbuscular Mycorrhizal Fungus Rhizophagus irregularis.

PubMed

Tsuzuki, Syusaku; Handa, Yoshihiro; Takeda, Naoya; Kawaguchi, Masayoshi

2016-04-01

Arbuscular mycorrhizal (AM) symbiosis is the most widespread association between plants and fungi. To provide novel insights into the molecular mechanisms of AM symbiosis, we screened and investigated genes of the AM fungus Rhizophagus irregularis that contribute to the infection of host plants. R. irregularis genes involved in the infection were explored by RNA-sequencing (RNA-seq) analysis. One of the identified genes was then characterized by a reverse genetic approach using host-induced gene silencing (HIGS), which causes RNA interference in the fungus via the host plant. The RNA-seq analysis revealed that 19 genes are up-regulated by both treatment with strigolactone (SL) (a plant symbiotic signal) and symbiosis. Eleven of the 19 genes were predicted to encode secreted proteins and, of these, SL-induced putative secreted protein 1 (SIS1) showed the largest induction under both conditions. In hairy roots of Medicago truncatula, SIS1 expression is knocked down by HIGS, resulting in significant suppression of colonization and formation of stunted arbuscules. These results suggest that SIS1 is a putative secreted protein that is induced in a wide spatiotemporal range including both the presymbiotic and symbiotic stages and that SIS1 positively regulates colonization of host plants by R. irregularis.

Preparation and Evaluation of Ribonuclease-Resistant Viral HIV RNA Standards Based on Armored RNA Technology

PubMed

Gholami, Mohammad; Ravanshad, Mehrdad; Baesi, Kazem; Samiee, Siamak M.; Hosseini Rozbahani, Negin; Mohraz, Minoo

2018-05-19

The human immunodeficiency virus type 1 (HIV-1) is an infectious viral agent that gradually extinguishes the immune system, resulting in acquired immune deficiency syndrome (AIDS). The aim of this study was to construct an RNA-positive control based on armored (AR) RNA technology, using HIV-1 RNA as a model. The MS2 maturase, a coat protein gene (at positions 1765 to 1787) and HIV-1 pol gene were cloned into pET-32a plasmid. The prepared plasmid was transformed into Escherichia coli strain BL2 (DE3), and the expression of the construct was induced by 1 mM of isopropyl-L-thio-D-galactopyranoside (IPTG) at 37 °C for 16 h to obtain the fabricated AR RNA. The AR RNA was precipitated and purified using polyethylene glycol and Sephacryl S-200 chromatography. The stability of AR RNA was evaluated by treatment with DNase I and RNase A and confirmed by transmission electron microscopy and gel agarose electrophoresis. Tenfold serial dilution of AR RNA from 101 to 105 was prepared; real-time PCR assays had a range of detection between 101 and 105, R2 value was 0.998, and the slope of the standard curve was -3.33. Prepared AR RNA, as a positive control, could be used as a basis for launching an in-house HIV-1 virus assay and other infectious agents. It can be readily available to laboratories and HIV research centers. The AR RNA is non-infectious and highly resistant to ribonuclease enzyme and can reduce the risk of infection in the clinical laboratory.

RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)

PubMed Central

Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.

2016-01-01

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765

RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).

PubMed

Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E

2016-01-01

RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.

TmSR-C, scavenger receptor class C, plays a pivotal role in antifungal and antibacterial immunity in the coleopteran insect Tenebrio molitor.

PubMed

Kim, Soo Gon; Jo, Yong Hun; Seong, Jeong Hwan; Park, Ki Beom; Noh, Mi Young; Cho, Jun Ho; Ko, Hye Jin; Kim, Chang Eun; Tindwa, Hamisi; Patnaik, Bharat Bhusan; Bang, In Seok; Lee, Yong Seok; Han, Yeon Soo

2017-10-01

Scavenger receptors (SRs) constitute a family of membrane-bound receptors that bind to multiple ligands. The SR family of proteins is involved in removing cellular debris, oxidized low-density lipoproteins, and pathogens. Specifically, class C scavenger receptors (SR-C) have also been reported to be involved in phagocytosis of gram-positive and -negative bacteria in Drosophila and viruses in shrimp. However, reports are unavailable regarding the role of SR-C in antifungal immune mechanisms in insects. In this study, a full-length Tenebrio molitor SR-C (TmSR-C) sequence was obtained by 5'- and 3'-Rapid amplification of cDNA ends-polymerase chain reaction (RACE-PCR). The TmSR-C full-length cDNA comprised 1671 bp with 5'- and 3'-untranslated regions of 23- and 107-bp, respectively. TmSR-C encodes a putative protein of 556 amino acid residues that is constitutively expressed in all tissues of late instar larvae and 2-day-old adults, with the highest transcript levels observed in hemocytes of larvae and adults. TmSR-C mRNA showed a 2.5-fold and 3-fold increase at 24 and 6 h after infection with Candida albicans and β-glucan, respectively. Immunoassay with TmSR-C polyclonal antibody showed induction of the putative protein in the cytosols of hemocytes at 3 h after inoculation of C. albicans. RNA interference (RNAi)-based gene silencing and phagocytosis assays were used to understand the role of TmSR-C in antifungal immunity. Silencing of TmSR-C transcripts reduced the survivability of late instar larvae at 2 days post-inoculation of C. albicans, Escherichia coli, or Staphylococcus aureus. Furthermore, in TmSR-C-silenced larvae, there was a decline in the rate of microorganism phagocytosis. Taken together, results of this study suggest that TmSR-C plays a pivotal role in phagocytosing not only fungi but also gram-negative and -positive bacteria in T. molitor. Copyright © 2017. Published by Elsevier Ltd.

Single-target RNA interference for the blockade of multiple interacting proinflammatory and profibrotic pathways in cardiac fibroblasts.

PubMed

Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang

2014-01-01

Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.

Homo sapiens Systemic RNA Interference-defective-1 Transmembrane Family Member 1 (SIDT1) Protein Mediates Contact-dependent Small RNA Transfer and MicroRNA-21-driven Chemoresistance*

PubMed Central

Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.

2012-01-01

Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421

Mechanism of action of mRNA-based vaccines.

PubMed

Iavarone, Carlo; O'hagan, Derek T; Yu, Dong; Delahaye, Nicolas F; Ulmer, Jeffrey B

2017-09-01

The present review summarizes the growing body of work defining the mechanisms of action of this exciting new vaccine technology that should allow rational approaches in the design of next generation mRNA vaccines. Areas covered: Bio-distribution of mRNA, localization of antigen production, role of the innate immunity, priming of the adaptive immune response, route of administration and effects of mRNA delivery systems. Expert commentary: In the last few years, the development of RNA vaccines had a fast growth, the rising number of proof will enable rational approaches to improving the effectiveness and safety of this modern class of medicine.

Short hairpin RNA interference therapy for ischemic heart disease.

PubMed

Huang, Mei; Chan, Denise A; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C; Chen, Xiaoyuan; Giaccia, Amato J; Wu, Joseph C

2008-09-30

During hypoxia, upregulation of hypoxia inducible factor-1 alpha transcriptional factor can activate several downstream angiogenic genes. However, hypoxia inducible factor-1 alpha is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. PHD2 was cloned from mouse embryonic stem cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter followed by a separate hypoxia response element-incorporated promoter driving a firefly luciferase reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared with the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of hypoxia inducible factor-1 alpha protein and several downstream angiogenic genes by >30% (P<0.01). Afterward, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending artery in mice. Animals were randomized into shPHD2 experimental group (n=25) versus shScramble control group (n=20). Bioluminescence imaging detected plasmid-mediated transgene expression for 4 to 5 weeks. Echocardiography showed the shPHD2 group had improved fractional shortening compared with the shScramble group at Week 4 (33.7%+/-1.9% versus 28.4%+/-2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot analysis of explanted hearts also confirmed that animals treated with shPHD2 had significantly higher levels of hypoxia inducible factor-1 alpha protein. This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by

Innate and intrinsic antiviral immunity in Drosophila.

PubMed

Mussabekova, Assel; Daeffler, Laurent; Imler, Jean-Luc

2017-06-01

The fruit fly Drosophila melanogaster has been a valuable model to investigate the genetic mechanisms of innate immunity. Initially focused on the resistance to bacteria and fungi, these studies have been extended to include antiviral immunity over the last decade. Like all living organisms, insects are continually exposed to viruses and have developed efficient defense mechanisms. We review here our current understanding on antiviral host defense in fruit flies. A major antiviral defense in Drosophila is RNA interference, in particular the small interfering (si) RNA pathway. In addition, complex inducible responses and restriction factors contribute to the control of infections. Some of the genes involved in these pathways have been conserved through evolution, highlighting loci that may account for susceptibility to viral infections in humans. Other genes are not conserved and represent species-specific innovations.

A Simple Laboratory Practical to Illustrate RNA Mediated Gene Interference Using Drosophila Cell Culture

ERIC Educational Resources Information Center

Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak

2010-01-01

RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…

RNA interference inhibits yellow fever virus replication in vitro and in vivo.

PubMed

Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L

2009-04-01

RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.

RNA-sequencing analysis reveals abundant developmental stage-specific and immunity-related genes in the pollen beetle Meligethes aeneus.

PubMed

Vogel, H; Badapanda, C; Knorr, E; Vilcinskas, A

2014-02-01

The pollen beetle (Meligethes aeneus) is a major pest of oilseed rape (Brassica napus) and other cruciferous crops in Europe. Pesticide-resistant pollen beetle populations are emerging, increasing the economic impact of this species. We isolated total RNA from the larval and adult stages, the latter either naïve or immunized by injection with bacteria and yeast. High-throughput RNA sequencing (RNA-Seq) was carried out to establish a comprehensive transcriptome catalogue and to screen for developmental stage-specific and immunity-related transcripts. We assembled the transcriptome de novo by combining sequence tags from all developmental stages and treatments. Gene expression data based on normalized read counts revealed several functional gene categories that were differentially expressed between larvae and adults, particularly genes associated with digestion and detoxification that were induced in larvae, and genes associated with reproduction and environmental signalling that were induced in adults. We also identified many genes associated with microbe recognition, immunity-related signalling and defence effectors, such as antimicrobial peptides (AMPs) and lysozymes. Digital gene expression analysis revealed significant differences in the profile of AMPs expressed in larvae, naïve adults and immune-challenged adults, providing insight into the steady-state differences between developmental stages and the complex transcriptional remodelling that occurs following the induction of immunity. Our data provide insight into the adaptive mechanisms used by phytophagous insects and could lead to the development of more effective control strategies for insect pests. © 2013 The Royal Entomological Society.

Nonenzymatic microorganism identification based on ribosomal RNA

NASA Astrophysics Data System (ADS)

Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

1999-11-01

Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.

PubMed

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.

RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding

PubMed Central

Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

2014-01-01

RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689

Integration of Immune Cell Populations, mRNA-Seq, and CpG Methylation to Better Predict Humoral Immunity to Influenza Vaccination: Dependence of mRNA-Seq/CpG Methylation on Immune Cell Populations

PubMed Central

Zimmermann, Michael T.; Kennedy, Richard B.; Grill, Diane E.; Oberg, Ann L.; Goergen, Krista M.; Ovsyannikova, Inna G.; Haralambieva, Iana H.; Poland, Gregory A.

2017-01-01

performance (AUC = 0.67), but highlighted well-known mechanisms. Our analysis demonstrated that each of the three data sets (cell composition, mRNA-Seq, and DNA methylation) may provide distinct information for the prediction of humoral immune response outcomes. We believe that these findings are important for the interpretation of current omics-based studies and set the stage for a more thorough understanding of interindividual immune responses to influenza vaccination. PMID:28484452

Dengue subgenomic flaviviral RNA disrupts immunity in mosquito salivary glands to increase virus transmission

PubMed Central

Manuel, Menchie; Shan, Chao; Manokaran, Gayathri; Bradrick, Shelton S.; Missé, Dorothée; Shi, Pei-Yong

2017-01-01

Globally re-emerging dengue viruses are transmitted from human-to-human by Aedes mosquitoes. While viral determinants of human pathogenicity have been defined, there is a lack of knowledge of how dengue viruses influence mosquito transmission. Identification of viral determinants of transmission can help identify isolates with high epidemiological potential. Additionally, mechanistic understanding of transmission will lead to better understanding of how dengue viruses harness evolution to cycle between the two hosts. Here, we identified viral determinants of transmission and characterized mechanisms that enhance production of infectious saliva by inhibiting immunity specifically in salivary glands. Combining oral infection of Aedes aegypti mosquitoes and reverse genetics, we identified two 3’ UTR substitutions in epidemic isolates that increased subgenomic flaviviral RNA (sfRNA) quantity, infectious particles in salivary glands and infection rate of saliva, which represents a measure of transmission. We also demonstrated that various 3’UTR modifications similarly affect sfRNA quantity in both whole mosquitoes and human cells, suggesting a shared determinism of sfRNA quantity. Furthermore, higher relative quantity of sfRNA in salivary glands compared to midgut and carcass pointed to sfRNA function in salivary glands. We showed that the Toll innate immune response was preferentially inhibited in salivary glands by viruses with the 3’UTR substitutions associated to high epidemiological fitness and high sfRNA quantity, pointing to a mechanism for higher saliva infection rate. By determining that sfRNA is an immune suppressor in a tissue relevant to mosquito transmission, we propose that 3’UTR/sfRNA sequence evolution shapes dengue epidemiology not only by influencing human pathogenicity but also by increasing mosquito transmission, thereby revealing a viral determinant of epidemiological fitness that is shared between the two hosts. PMID:28753642

Interference activity of a minimal Type I CRISPR-Cas system from Shewanella putrefaciens.

PubMed

Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart

2015-10-15

Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects.

PubMed

Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E

2018-05-04

Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for

Effect of North Bicyclo[3.1.0]hexane 2'-Deoxypseudosugars on RNA Interference: A Novel Class of siRNA Modification | Center for Cancer Research

Cancer.gov

The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.

Messenger RNA (mRNA) nanoparticle tumour vaccination

NASA Astrophysics Data System (ADS)

Phua, Kyle K. L.; Nair, Smita K.; Leong, Kam W.

2014-06-01

Use of mRNA-based vaccines for tumour immunotherapy has gained increasing attention in recent years. A growing number of studies applying nanomedicine concepts to mRNA tumour vaccination show that the mRNA delivered in nanoparticle format can generate a more robust immune response. Advances in the past decade have deepened our understanding of gene delivery barriers, mRNA's biological stability and immunological properties, and support the notion for engineering innovations tailored towards a more efficient mRNA nanoparticle vaccine delivery system. In this review we will first examine the suitability of mRNA for engineering manipulations, followed by discussion of a model framework that highlights the barriers to a robust anti-tumour immunity mediated by mRNA encapsulated in nanoparticles. Finally, by consolidating existing literature on mRNA nanoparticle tumour vaccination within the context of this framework, we aim to identify bottlenecks that can be addressed by future nanoengineering research.

Effect of the nanoformulation of siRNA-lipid assemblies on their cellular uptake and immune stimulation.

PubMed

Kubota, Kohei; Onishi, Kohei; Sawaki, Kazuaki; Li, Tianshu; Mitsuoka, Kaoru; Sato, Takaaki; Takeoka, Shinji

2017-01-01

Two lipid-based nanoformulations have been used to date in clinical studies: lipoplexes and lipid nanoparticles (LNPs). In this study, we prepared small interfering RNA (siRNA)-loaded carriers using lipid components of the same composition to form molecular assemblies of differing structures, and evaluated the impact of structure on cellular uptake and immune stimulation. Lipoplexes are electrostatic complexes formed by mixing preformed cationic lipid liposomes with anionic siRNA in an aqueous environment, whereas LNPs are nanoparticles embedding siRNA prepared by mixing an alcoholic lipid solution with an aqueous siRNA solution in one step. Although the physicochemical properties of lipoplexes and LNPs were similar except for small increases in apparent size of lipoplexes and zeta potential of LNPs, siRNA uptake efficiency of LNPs was significantly higher than that of lipoplexes. Furthermore, in the case of LNPs, both siRNA and lipid were effectively incorporated into cells in a co-assembled state; however, in the case of lipoplexes, the amount of siRNA internalized into cells was small in comparison with lipid. siRNAs in lipoplexes were thought to be more likely to localize on the particle surface and thereby undergo dissociation into the medium. Inflammatory cytokine responses also appeared to differ between lipoplexes and LNPs. For tumor necrosis factor-α, release was mainly caused by siRNA. On the other hand, the release of interleukin-1β was mainly due to the cationic nature of particles. LNPs released lower amounts of tumor necrosis factor-α and interleukin-1β than lipoplexes and were thus considered to be better tolerated with respect to cytokine release. In conclusion, siRNA-loaded nanoformulations effect their cellular uptake and immune stimulation in a manner that depends on the structure of the molecular assembly; therefore, nanoformulations should be optimized before extending studies into the in vivo environment.

Effect of the nanoformulation of siRNA-lipid assemblies on their cellular uptake and immune stimulation

PubMed Central

Kubota, Kohei; Onishi, Kohei; Sawaki, Kazuaki; Li, Tianshu; Mitsuoka, Kaoru; Sato, Takaaki; Takeoka, Shinji

2017-01-01

Two lipid-based nanoformulations have been used to date in clinical studies: lipoplexes and lipid nanoparticles (LNPs). In this study, we prepared small interfering RNA (siRNA)-loaded carriers using lipid components of the same composition to form molecular assemblies of differing structures, and evaluated the impact of structure on cellular uptake and immune stimulation. Lipoplexes are electrostatic complexes formed by mixing preformed cationic lipid liposomes with anionic siRNA in an aqueous environment, whereas LNPs are nanoparticles embedding siRNA prepared by mixing an alcoholic lipid solution with an aqueous siRNA solution in one step. Although the physicochemical properties of lipoplexes and LNPs were similar except for small increases in apparent size of lipoplexes and zeta potential of LNPs, siRNA uptake efficiency of LNPs was significantly higher than that of lipoplexes. Furthermore, in the case of LNPs, both siRNA and lipid were effectively incorporated into cells in a co-assembled state; however, in the case of lipoplexes, the amount of siRNA internalized into cells was small in comparison with lipid. siRNAs in lipoplexes were thought to be more likely to localize on the particle surface and thereby undergo dissociation into the medium. Inflammatory cytokine responses also appeared to differ between lipoplexes and LNPs. For tumor necrosis factor-α, release was mainly caused by siRNA. On the other hand, the release of interleukin-1β was mainly due to the cationic nature of particles. LNPs released lower amounts of tumor necrosis factor-α and interleukin-1β than lipoplexes and were thus considered to be better tolerated with respect to cytokine release. In conclusion, siRNA-loaded nanoformulations effect their cellular uptake and immune stimulation in a manner that depends on the structure of the molecular assembly; therefore, nanoformulations should be optimized before extending studies into the in vivo environment. PMID:28790820

A potential role for RNA interference in controlling the activity of the human LINE-1 retrotransposon.

PubMed

Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J

2005-01-01

Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.

RNA interference can be used to disrupt gene function in tardigrades.

PubMed

Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob

2013-05-01

How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.

Short hairpin RNA interference therapy for ischemic heart disease

PubMed Central

Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.

2013-01-01

Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to

Defective RNA particles derived from Tomato black ring virus genome interfere with the replication of parental virus.

PubMed

Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F

2018-05-02

Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.

Innate and intrinsic antiviral immunity in Drosophila

PubMed Central

Mussabekova, Assel; Daeffler, Laurent; Imler, Jean-Luc

2017-01-01

The fruitfly Drosophila melanogaster has been a valuable model to investigate the genetic mechanisms of innate immunity. Initially focused on the resistance to bacteria and fungi, these studies have been extended to include antiviral immunity over the last decade. Like all living organisms, insects are continually exposed to viruses and have developed efficient defense mechanisms. We review here our current understanding on antiviral host-defense in fruit flies. A major antiviral defense in Drosophila is RNA interference, in particular the small interfering (si) RNA pathway. In addition, complex inducible responses and restriction factors contribute to the control of infections. Some of the genes involved in these pathways have been conserved through evolution, highlighting loci that may account for susceptibility to viral infections in humans. Other genes are not conserved and represent species-specific innovations. PMID:28102430

RNA-Seq of the Caribbean reef-building coral Orbicella faveolata (Scleractinia-Merulinidae) under bleaching and disease stress expands models of coral innate immunity.

PubMed

Anderson, David A; Walz, Marcus E; Weil, Ernesto; Tonellato, Peter; Smith, Matthew C

2016-01-01

Climate change-driven coral disease outbreaks have led to widespread declines in coral populations. Early work on coral genomics established that corals have a complex innate immune system, and whole-transcriptome gene expression studies have revealed mechanisms by which the coral immune system responds to stress and disease. The present investigation expands bioinformatic data available to study coral molecular physiology through the assembly and annotation of a reference transcriptome of the Caribbean reef-building coral, Orbicella faveolata. Samples were collected during a warm water thermal anomaly, coral bleaching event and Caribbean yellow band disease outbreak in 2010 in Puerto Rico. Multiplex sequencing of RNA on the Illumina GAIIx platform and de novo transcriptome assembly by Trinity produced 70,745,177 raw short-sequence reads and 32,463 O. faveolata transcripts, respectively. The reference transcriptome was annotated with gene ontologies, mapped to KEGG pathways, and a predicted proteome of 20,488 sequences was generated. Protein families and signaling pathways that are essential in the regulation of innate immunity across Phyla were investigated in-depth. Results were used to develop models of evolutionarily conserved Wnt, Notch, Rig-like receptor, Nod-like receptor, and Dicer signaling. O. faveolata is a coral species that has been studied widely under climate-driven stress and disease, and the present investigation provides new data on the genes that putatively regulate its immune system.

RNA-Seq of the Caribbean reef-building coral Orbicella faveolata (Scleractinia-Merulinidae) under bleaching and disease stress expands models of coral innate immunity

PubMed Central

Walz, Marcus E.; Weil, Ernesto; Smith, Matthew C.

2016-01-01

Climate change-driven coral disease outbreaks have led to widespread declines in coral populations. Early work on coral genomics established that corals have a complex innate immune system, and whole-transcriptome gene expression studies have revealed mechanisms by which the coral immune system responds to stress and disease. The present investigation expands bioinformatic data available to study coral molecular physiology through the assembly and annotation of a reference transcriptome of the Caribbean reef-building coral, Orbicella faveolata. Samples were collected during a warm water thermal anomaly, coral bleaching event and Caribbean yellow band disease outbreak in 2010 in Puerto Rico. Multiplex sequencing of RNA on the Illumina GAIIx platform and de novo transcriptome assembly by Trinity produced 70,745,177 raw short-sequence reads and 32,463 O. faveolata transcripts, respectively. The reference transcriptome was annotated with gene ontologies, mapped to KEGG pathways, and a predicted proteome of 20,488 sequences was generated. Protein families and signaling pathways that are essential in the regulation of innate immunity across Phyla were investigated in-depth. Results were used to develop models of evolutionarily conserved Wnt, Notch, Rig-like receptor, Nod-like receptor, and Dicer signaling. O. faveolata is a coral species that has been studied widely under climate-driven stress and disease, and the present investigation provides new data on the genes that putatively regulate its immune system. PMID:26925311

RNA interference therapy: a new solution for intracranial atherosclerosis?

PubMed Central

Tang, Tao; Wong, Ka-Sing

2014-01-01

Intracranial atherosclerotic stenosis (ICAS) of a major intracranial artery, especially middle cerebral artery (MCA), is reported to be one leading cause of ischemic stroke throughout the world. Compared with other stroke subtypes, ICAS is associated with a higher risk of recurrent stroke despite aggressive medical therapy. Increased understanding of the pathophysiology of ICAS has highlighted several possible targets for therapeutic interventions. Both luminal stenosis and plaque components of ICAS have been found to be associated with ischemic stroke based a post-mortem study. Recent application of high-resolution magnetic resonance imaging (HRMRI) in evaluating ICAS provides new insight into the vascular biology of plaque morphology and component. High signal on T1-weighted fat-suppressed images (HST1) within MCA plaque of HRMRI, highly suggested of fresh or recent intraplaque hemorrhage, has been found to be associated with ipsilateral brain infarction. Thus, the higher prevalence of intraplaque hemorrhage and neovasculature in symptomatic patients with MCA stenosis may provide a potential target for plaque stabilization. We hypothesize that RNA interference (RNAi) therapy delivered by modified nanoparticles may achieve in vivo biomedical imaging and targeted therapy. With the rapid developments in studies about therapeutic and diagnostic nanomaterials, future studies further exploring the molecular biology of atherosclerosis may provide more drug targets for plaque stabilization. PMID:25333054

Sensitivity of Small RNA-Based Detection of Plant Viruses.

PubMed

Santala, Johanna; Valkonen, Jari P T

2018-01-01

Plants recognize unrelated viruses by the antiviral defense system called RNA interference (RNAi). RNAi processes double-stranded viral RNA into small RNAs (sRNAs) of 21-24 nucleotides, the reassembly of which into longer strands in silico allows virus identification by comparison with the sequences available in databases. The aim of this study was to compare the virus detection sensitivity of sRNA-based virus diagnosis with the established virus species-specific polymerase chain reaction (PCR) approach. Viruses propagated in tobacco plants included three engineered, infectious clones of Potato virus A (PVA), each carrying a different marker gene, and an infectious clone of Potato virus Y (PVY). Total RNA (containing sRNA) was isolated and subjected to reverse-transcription real-time PCR (RT-RT-PCR) and sRNA deep-sequencing at different concentrations. RNA extracted from various crop plants was included in the reactions to normalize RNA concentrations. Targeted detection of selected viruses showed a similar threshold for the sRNA and reverse-transcription quantitative PCR (RT-qPCR) analyses. The detection limit for PVY and PVA by RT-qPCR in this study was 3 and 1.5 fg of viral RNA, respectively, in 50 ng of total RNA per PCR reaction. When knowledge was available about the viruses likely present in the samples, sRNA-based virus detection was 10 times more sensitive than RT-RT-PCR. The advantage of sRNA analysis is the detection of all tested viruses without the need for virus-specific primers or probes.

Toll immune signal activates cellular immune response via eicosanoids.

PubMed

Shafeeq, Tahir; Ahmed, Shabbir; Kim, Yonggyun

2018-07-01

Upon immune challenge, insects recognize nonself. The recognition signal will propagate to nearby immune effectors. It is well-known that Toll signal pathway induces antimicrobial peptide (AMP) gene expression. Eicosanoids play crucial roles in mediating the recognition signal to immune effectors by enhancing humoral immune response through activation of AMP synthesis as well as cellular immune responses, suggesting a functional cross-talk between Toll and eicosanoid signals. This study tested a cross-talk between these two signals. Two signal transducing factors (MyD88 and Pelle) of Toll immune pathway were identified in Spodoptera exigua. RNA interference (RNAi) of either SeMyD88 or SePelle expression interfered with the expression of AMP genes under Toll signal pathway. Bacterial challenge induced PLA 2 enzyme activity. However, RNAi of these two immune factors significantly suppressed the induction of PLA 2 enzyme activity. Furthermore, RNAi treatment prevented gene expression of cellular PLA 2 . Inhibition of PLA 2 activity reduced phenoloxidase activity and subsequent suppression in cellular immune response measured by hemocyte nodule formation. However, immunosuppression induced by RNAi of Toll signal molecules was significantly reversed by addition of arachidonic acid (AA), a catalytic product of PLA 2 . The addition also significantly reduced the enhanced fungal susceptibility of S. exigua treated by RNAi against two Toll signal molecules. These results indicate that there is a cross-talk between Toll and eicosanoid signals in insect immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.

LncRNA uc.48+ is involved in the diabetic immune and inflammatory responses mediated by P2X7 receptor in RAW264.7 macrophages.

PubMed

Wu, Hong; Wen, Fang; Jiang, Mei; Liu, Qiang; Nie, Yijun

2018-08-01

High glucose combined with high FFAs can contribute to the unfavorable development of type 2 diabetes mellitus (T2DM) and monocytes/macrophages are important in the occurrence and development of T2DM, which is regarded as a type of low‑grade inflammation. Although our previous study demonstrated that increased expression of P2X7 receptor (P2X7R) in peripheral blood monocytes may alter the innate immune system and that long non‑coding (lnc)RNA uc.48+ was involved in diabetic neuropathic pain, the involvement of uc.48+ mediated by the P2X7R in monocyte/macrophages during T2DM has not been reported. In the present study, the effectsof uc.48+ small interference RNA (siRNA) on factors, including the mRNA and protein expression of P2X7R, apoptosis and proliferation, levels of reactive oxygen species (ROS), cytokine levels, and expression of phosphorylated (p‑) extracellular signal‑regulated kinase (ERK)1/2, were examined in RAW264.7 macrophages following exposure to high glucose and high plasma free fatty acids (FFAs). After RAW264.7 cells were transfected with uc.48+ siRNA under high glucose conditions and FFAs treatment, the mRNA expression levels of uc.48+ and P2X7 receptor were detected by reverse transcription‑polymerase chain reaction. The protein mass of P2X7 receptor and ERK signaling pathway were assessed by western blotting. ROS and calcium concentrations, and culture supernatant cytokine content [tumor necrosis factor‑α, interleukin (IL)‑10, IL‑1β] were detected by fluorescent probes and ELISA respectively. Cell viability and apoptosis were determined by MTS test and flow cytometry, respectively. It was found that treatment of RAW264.7 cells with high glucose and FFAs, which exhibited increased expression of uc.48+, evoked P2X7R‑mediated immune and inflammatory responses through several means, including cytokine secretion, ROS formation, and activation of the ERK signaling pathway. The uc.48+ siRNA regulated these factors and thus

The protective effect of Hif3a RNA interference and HIF-prolyl hydroxylase inhibition on cardiomyocytes under anoxia-reoxygenation.

PubMed

Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V

2018-06-01

The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.

Trivalent Human Papillomavirus (HPV) VLP vaccine covering HPV type 58 can elicit high level of humoral immunity but also induce immune interference among component types.

PubMed

Zhang, Ting; Xu, Yufei; Qiao, Liang; Wang, Youchun; Wu, Xueling; Fan, Dongsheng; Peng, Qinglin; Xu, Xuemei

2010-04-26

Both Human Papillomavirus (HPV) type 16/18 bivalent vaccine and type 16/18/6/11 quadrivalent vaccine have been proved to be safe and effective, and licensed for public use. However, these two vaccines do not quite match the distribution of HPV types in China, Southeast Asia and Latin America, where HPV 58 is highly prevalent. Here we produced three types of virus-like particles (VLPs) in baculovirus expression system, formulated a trivalent vaccine containing HPV 16, 18, and 58 L1 VLPs and examined its in vitro neutralizing titers. This vaccine could induce high level and long-term humoral immunity against the component types. But immune interference was observed when comparing type specific neutralizing antibody levels induced by trivalent vaccine to those by corresponding monovalent vaccines. This kind of interference would become more obvious when formulating more types of VLPs into multivalent vaccines, but could be greatly overcome by decreasing the antigen dosage and adding a proper adjuvant. Copyright 2010 Elsevier Ltd. All rights reserved.

Ingestion of genetically modified yeast symbiont reduces fitness of an insect pest via RNA interference

PubMed Central

Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.

2016-01-01

RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800

Listeria monocytogenes Induces a Virulence-Dependent microRNA Signature That Regulates the Immune Response in Galleria mellonella

PubMed Central

Mannala, Gopala K.; Izar, Benjamin; Rupp, Oliver; Schultze, Tilman; Goesmann, Alexander; Chakraborty, Trinad; Hain, Torsten

2017-01-01

microRNAs (miRNAs) coordinate several physiological and pathological processes by regulating the fate of mRNAs. Studies conducted in vitro indicate a role of microRNAs in the control of host-microbe interactions. However, there is limited understanding of miRNA functions in in vivo models of bacterial infections. In this study, we systematically explored changes in miRNA expression levels of Galleria mellonella larvae (greater-wax moth), a model system that recapitulates the vertebrate innate immunity, following infection with L. monocytogenes. Using an insect-specific miRNA microarray with more than 2000 probes, we found differential expression of 90 miRNAs (39 upregulated and 51 downregulated) in response to infection with L. monocytogenes. We validated the expression of a subset of miRNAs which have mammalian homologs of known or predicted function. In contrast, non-pathogenic L. innocua failed to induce these miRNAs, indicating a virulence-dependent miRNA deregulation. To predict miRNA targets using established algorithms, we generated a publically available G. mellonella transcriptome database. We identified miRNA targets involved in innate immunity, signal transduction and autophagy, including spätzle, MAP kinase, and optineurin, respectively, which exhibited a virulence-specific differential expression. Finally, in silico estimation of minimum free energy of miRNA-mRNA duplexes of validated microRNAs and target transcripts revealed a regulatory network of the host immune response to L. monocytogenes. In conclusion, this study provides evidence for a role of miRNAs in the regulation of the innate immune response following bacterial infection in a simple, rapid and scalable in vivo model that may predict host-microbe interactions in higher vertebrates. PMID:29312175

MicroRNA regulation of immune events at conception.

PubMed

Robertson, Sarah A; Zhang, Bihong; Chan, Honyueng; Sharkey, David J; Barry, Simon C; Fullston, Tod; Schjenken, John E

2017-09-01

The reproductive tract environment at conception programs the developmental trajectory of the embryo, sets the course of pregnancy, and impacts offspring phenotype and health. Despite the fundamental importance of this stage of reproduction, the rate-limiting regulatory mechanisms operating locally to control fertility and fecundity are incompletely understood. Emerging studies highlight roles for microRNAs (miRNAs) in regulating reproductive and developmental processes and in modulating the quality and strength of the female immune response. Since endometrial receptivity and robust placentation require specific adaptation of the immune response, we hypothesize that miRNAs participate in establishing pregnancy through effects on key gene networks in immune cells. Our recent studies investigated miRNAs that are induced in the peri-conception environment, focusing on miRNAs that have immune-regulatory roles-particularly miR-223, miR-155, and miR-146a. Genetic mouse models deficient in individual miRNAs are proving informative in defining roles for these miRNAs in the generation and stabilization of regulatory T cells (Treg cells) that confer adaptive immune tolerance. Overlapping and redundant functions between miRNAs that target multiple genes, combined with multiple miRNAs targeting individual genes, indicate complex and sensitive regulatory networks. Although to date most data on miRNA regulation of reproductive events are from mice, conserved functions of miRNAs across species imply similar biological pathways operate in all mammals. Understanding the regulation and roles of miRNAs in the peri-conception immune response will advance our knowledge of how environmental determinants act at conception, and could have practical applications for animal breeding as well as human fertility. © 2017 Wiley Periodicals, Inc.

Evolution of RNA- and DNA-guided antivirus defense systems in prokaryotes and eukaryotes: common ancestry vs convergence.

PubMed

Koonin, Eugene V

2017-02-10

Complementarity between nucleic acid molecules is central to biological information transfer processes. Apart from the basal processes of replication, transcription and translation, complementarity is also employed by multiple defense and regulatory systems. All cellular life forms possess defense systems against viruses and mobile genetic elements, and in most of them some of the defense mechanisms involve small guide RNAs or DNAs that recognize parasite genomes and trigger their inactivation. The nucleic acid-guided defense systems include prokaryotic Argonaute (pAgo)-centered innate immunity and CRISPR-Cas adaptive immunity as well as diverse branches of RNA interference (RNAi) in eukaryotes. The archaeal pAgo machinery is the direct ancestor of eukaryotic RNAi that, however, acquired additional components, such as Dicer, and enormously diversified through multiple duplications. In contrast, eukaryotes lack any heritage of the CRISPR-Cas systems, conceivably, due to the cellular toxicity of some Cas proteins that would get activated as a result of operon disruption in eukaryotes. The adaptive immunity function in eukaryotes is taken over partly by the PIWI RNA branch of RNAi and partly by protein-based immunity. In this review, I briefly discuss the interplay between homology and analogy in the evolution of RNA- and DNA-guided immunity, and attempt to formulate some general evolutionary principles for this ancient class of defense systems. This article was reviewed by Mikhail Gelfand and Bojan Zagrovic.

Identification and characterization of a putative lipopolysaccharide-induced TNF-α factor (LITAF) gene from Amphioxus (Branchiostoma belcheri): an insight into the innate immunity of Amphioxus and the evolution of LITAF.

PubMed

Jin, Ping; Hu, Jing; Qian, Jinjun; Chen, Liming; Xu, Xiaofeng; Ma, Fei

2012-06-01

Innate immunity defenses against infectious agent in all multicultural organisms. TNF-α is an important cytokine that can be stimulated by Lipopolysaccharide (LPS) to regulate the innate immunity. The lipopolysaccharide-induced TNF-α factor (LITAF) functions as a transcription factor for regulating the expression of TNF-α as well as various inflammatory cytokines in response to LPS stimulation. The physiological significance of LITAF gene in the innate immunity of various animals has recently been reported. However, no LITAF gene has yet been identified in amphioxus, which is the best available stand-in for the proximate invertebrate ancestor of the vertebrates. In this study, we identified and characterized an amphioxus LITAF gene (designated as AmphiLITAF). First, we identified the AmphiLITAF from the amphioxus and found that AmphiLITAF gene with ~1.6 kb in length has a 827bp cDNA transcription product which encodes a putative protein with 127 amino acids containing conserved LITAF-domain, and the deduced amino acid of AmphiLITAF shared 37-60% similarity with the LITAFs from other species; second, we uncovered the spatial distribution of the LITAF in different tissues, the expression level of AmphiLITAF mRNA was the highest in hepatic cecum and intestine, moderate in muscles, gills and gonad, and the lowest in notochord. Our findings provide an insight into the innate immune response in the amphioxus and the evolution of the LITAF family. Copyright © 2012 Elsevier Ltd. All rights reserved.

RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design

USDA-ARS?s Scientific Manuscript database

Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...

Improvement of In Vivo Expression of Genes Delivered by Self-Amplifying RNA Using Vaccinia Virus Immune Evasion Proteins.

PubMed

Beissert, Tim; Koste, Lars; Perkovic, Mario; Walzer, Kerstin C; Erbar, Stephanie; Selmi, Abderraouf; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

2017-12-01

Among nucleic acid-based delivery platforms, self-amplifying RNA (saRNA) vectors are of increasing interest for applications such as transient expression of recombinant proteins and vaccination. saRNA is safe and, due to its capability to amplify intracellularly, high protein levels can be produced from even minute amounts of transfected templates. However, it is an obstacle to full exploitation of this platform that saRNA induces a strong innate host immune response. In transfected cells, pattern recognition receptors sense double-stranded RNA intermediates and via activation of protein kinase R (PKR) and interferon signaling initiate host defense measures including a translational shutdown. To reduce pattern recognition receptor stimulation and unleash suppressed saRNA translation, this study co-delivered non-replicating mRNA encoding vaccinia virus immune evasion proteins E3, K3, and B18. It was shown that E3 is far superior to K3 or B18 as a highly potent blocker of PKR activation and of interferon (IFN)-β upregulation. B18, in contrast, is superior in controlling OAS1, a key IFN-inducible gene involved in viral RNA degradation. By combining all three vaccinia proteins, the study achieved significant suppression of PKR and IFN pathway activation in vitro and enhanced expression of saRNA-encoded genes of interest both in vitro and in vivo. This approach promises to overcome key hurdles of saRNA gene delivery. Its application may improve the bioavailability of the encoded protein, and reduce the effective dose and correspondingly the cost of goods of manufacture in the various fields where saRNA utilization is envisioned.

Improvement of In Vivo Expression of Genes Delivered by Self-Amplifying RNA Using Vaccinia Virus Immune Evasion Proteins

PubMed Central

Beissert, Tim; Koste, Lars; Perkovic, Mario; Walzer, Kerstin C.; Erbar, Stephanie; Selmi, Abderraouf; Diken, Mustafa; Kreiter, Sebastian; Türeci, Özlem; Sahin, Ugur

2017-01-01

Among nucleic acid–based delivery platforms, self-amplifying RNA (saRNA) vectors are of increasing interest for applications such as transient expression of recombinant proteins and vaccination. saRNA is safe and, due to its capability to amplify intracellularly, high protein levels can be produced from even minute amounts of transfected templates. However, it is an obstacle to full exploitation of this platform that saRNA induces a strong innate host immune response. In transfected cells, pattern recognition receptors sense double-stranded RNA intermediates and via activation of protein kinase R (PKR) and interferon signaling initiate host defense measures including a translational shutdown. To reduce pattern recognition receptor stimulation and unleash suppressed saRNA translation, this study co-delivered non-replicating mRNA encoding vaccinia virus immune evasion proteins E3, K3, and B18. It was shown that E3 is far superior to K3 or B18 as a highly potent blocker of PKR activation and of interferon (IFN)-β upregulation. B18, in contrast, is superior in controlling OAS1, a key IFN-inducible gene involved in viral RNA degradation. By combining all three vaccinia proteins, the study achieved significant suppression of PKR and IFN pathway activation in vitro and enhanced expression of saRNA-encoded genes of interest both in vitro and in vivo. This approach promises to overcome key hurdles of saRNA gene delivery. Its application may improve the bioavailability of the encoded protein, and reduce the effective dose and correspondingly the cost of goods of manufacture in the various fields where saRNA utilization is envisioned. PMID:28877647

RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.

PubMed

Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana

2018-01-01

Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.

Pre-microRNA and Mature microRNA in Human Mitochondria

PubMed Central

Barrey, Eric; Saint-Auret, Gaelle; Bonnamy, Blandine; Damas, Dominique; Boyer, Orane; Gidrol, Xavier

2011-01-01

Background Because of the central functions of the mitochondria in providing metabolic energy and initiating apoptosis on one hand and the role that microRNA (miRNA) play in gene expression, we hypothesized that some miRNA could be present in the mitochondria for post-transcriptomic regulation by RNA interference. We intend to identify miRNA localized in the mitochondria isolated from human skeletal primary muscular cells. Methodology/Principal Findings To investigate the potential origin of mitochondrial miRNA, we in-silico searched for microRNA candidates in the mtDNA. Twenty five human pre-miRNA and 33 miRNA aligments (E-value<0.1) were found in the reference mitochondrial sequence and some of the best candidates were chosen for a co-localization test. In situ hybridization of pre-mir-302a, pre-let-7b and mir-365, using specific labelled locked nucleic acids and confocal microscopy, demonstrated that these miRNA were localized in mitochondria of human myoblasts. Total RNA was extracted from enriched mitochondria isolated by an immunomagnetic method from a culture of human myotubes. The detection of 742 human miRNA (miRBase) were monitored by RT-qPCR at three increasing mtRNA inputs. Forty six miRNA were significantly expressed (2nd derivative method Cp>35) for the smallest RNA input concentration and 204 miRNA for the maximum RNA input concentration. In silico analysis predicted 80 putative miRNA target sites in the mitochondrial genome (E-value<0.05). Conclusions/Significance The present study experimentally demonstrated for the first time the presence of pre-miRNA and miRNA in the human mitochondria isolated from skeletal muscular cells. A set of miRNA were significantly detected in mitochondria fraction. The origin of these pre-miRNA and miRNA should be further investigate to determine if they are imported from the cytosol and/or if they are partially processed in the mitochondria. PMID:21637849

RNA interference inhibits herpes simplex virus type 1 isolated from saliva samples and mucocutaneous lesions.

PubMed

Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de

2014-01-01

The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.

RNA interference can be used to disrupt gene function in tardigrades

PubMed Central

Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob

2012-01-01

How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800

An Evolutionarily Conserved Innate Immunity Protein Interaction Network*

PubMed Central

De Arras, Lesly; Seng, Amara; Lackford, Brad; Keikhaee, Mohammad R.; Bowerman, Bruce; Freedman, Jonathan H.; Schwartz, David A.; Alper, Scott

2013-01-01

The innate immune response plays a critical role in fighting infection; however, innate immunity also can affect the pathogenesis of a variety of diseases, including sepsis, asthma, cancer, and atherosclerosis. To identify novel regulators of innate immunity, we performed comparative genomics RNA interference screens in the nematode Caenorhabditis elegans and mouse macrophages. These screens have uncovered many candidate regulators of the response to lipopolysaccharide (LPS), several of which interact physically in multiple species to form an innate immunity protein interaction network. This protein interaction network contains several proteins in the canonical LPS-responsive TLR4 pathway as well as many novel interacting proteins. Using RNAi and overexpression studies, we show that almost every gene in this network can modulate the innate immune response in mouse cell lines. We validate the importance of this network in innate immunity regulation in vivo using available mutants in C. elegans and mice. PMID:23209288

MicroRNA-466l inhibits antiviral innate immune response by targeting interferon-alpha

PubMed Central

Li, Yingke; Fan, Xiaohua; He, Xingying; Sun, Haijing; Zou, Zui; Yuan, Hongbin; Xu, Haitao; Wang, Chengcai; Shi, Xueyin

2012-01-01

Effective recognition of viral infections and subsequent triggering of antiviral innate immune responses are essential for the host antiviral defense, which is tightly regulated by multiple regulators, including microRNAs (miRNAs). A previous study showed that miR-466l upregulates IL-10 expression in macrophages by antagonizing RNA-binding protein tristetraprolin-mediated IL-10 mRNA degradation. However, the ability of miR-466l to regulate antiviral immune responses remains unknown. Here, we found that interferon-alpha (IFN-α) expression was repressed in Sendai virus (SeV)- and vesicular stomatitis virus (VSV)-infected macrophages and in dendritic cells transfected with miR-466l expression. Moreover, multiple IFN-α species can be directly targeted by miR-466l through their 3′ untranslated region (3′UTR). This study has demonstrated that miR-466l could directly target IFN-α expression to inhibit host antiviral innate immune response. PMID:23042536

Putative members of the Arabidopsis Nup107-160 nuclear pore sub-complex contribute to pathogen defense.

PubMed

Wiermer, Marcel; Cheng, Yu Ti; Imkampe, Julia; Li, Meilan; Wang, Dongmei; Lipka, Volker; Li, Xin

2012-06-01

In eukaryotic cells, transduction of external stimuli into the nucleus to induce transcription and export of mRNAs for translation in the cytoplasm is mediated by nuclear pore complexes (NPCs) composed of nucleoporin proteins (Nups). We previously reported that Arabidopsis MOS3, encoding the homolog of vertebrate Nup96, is required for plant immunity and constitutive resistance mediated by the de-regulated Toll interleukin 1 receptor/nucleotide-binding/leucine-rich repeat (TNL)-type R gene snc1. In vertebrates, Nup96 is a component of the conserved Nup107-160 nuclear pore sub-complex, and implicated in immunity-related mRNA export. Here, we used a reverse genetics approach to examine the requirement for additional subunits of the predicted Arabidopsis Nup107-160 complex in plant immunity. We show that, among eight putative complex members, beside MOS3, only plants with defects in Nup160 or Seh1 are impaired in basal resistance. Constitutive resistance in the snc1 mutant and immunity mediated by TNL-type R genes also depend on functional Nup160 and have a partial requirement for Seh1. Conversely, resistance conferred by coiled coil-type immune receptors operates largely independently of both genes, demonstrating specific contributions to plant defense signaling. Our functional analysis further revealed that defects in nup160 and seh1 result in nuclear accumulation of poly(A) mRNA, and, in the case of nup160, considerable depletion of EDS1, a key positive regulator of basal and TNL-triggered resistance. These findings suggest that Nup160 is required for nuclear mRNA export and full expression of EDS1-conditioned resistance pathways in Arabidopsis. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

The rough endoplasmatic reticulum is a central nucleation site of siRNA-mediated RNA silencing

PubMed Central

Stalder, Lukas; Heusermann, Wolf; Sokol, Lena; Trojer, Dominic; Wirz, Joel; Hean, Justin; Fritzsche, Anja; Aeschimann, Florian; Pfanzagl, Vera; Basselet, Pascal; Weiler, Jan; Hintersteiner, Martin; Morrissey, David V; Meisner-Kober, Nicole C

2013-01-01

Despite progress in mechanistic understanding of the RNA interference (RNAi) pathways, the subcellular sites of RNA silencing remain under debate. Here we show that loading of lipid-transfected siRNAs and endogenous microRNAs (miRNA) into RISC (RNA-induced silencing complexes), encounter of the target mRNA, and Ago2-mediated mRNA slicing in mammalian cells are nucleated at the rough endoplasmic reticulum (rER). Although the major RNAi pathway proteins are found in most subcellular compartments, the miRNA- and siRNA-loaded Ago2 populations co-sediment almost exclusively with the rER membranes, together with the RISC loading complex (RLC) factors Dicer, TAR RNA binding protein (TRBP) and protein activator of the interferon-induced protein kinase (PACT). Fractionation and membrane co-immune precipitations further confirm that siRNA-loaded Ago2 physically associates with the cytosolic side of the rER membrane. Additionally, RLC-associated double-stranded siRNA, diagnostic of RISC loading, and RISC-mediated mRNA cleavage products exclusively co-sediment with rER. Finally, we identify TRBP and PACT as key factors anchoring RISC to ER membranes in an RNA-independent manner. Together, our findings demonstrate that the outer rER membrane is a central nucleation site of siRNA-mediated RNA silencing. PMID:23511973

Delivery of dsRNA through topical feeding for RNA interference in the citrus sap piercing-sucking hemipteran, Diaphorina citri.

PubMed

Killiny, Nabil; Kishk, Abdelaziz

2017-06-01

RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.

Small self-RNA generated by RNase L amplifies antiviral innate immunity

PubMed Central

Malathi, Krishnamurthy; Dong, Beihua; Gale, Michael; Silverman, Robert H.

2013-01-01

Antiviral innate immunity is initiated in response to RNA molecules that are produced in virus-infected cells1. These RNAs activate signalling cascades that activate the genes that encode α- and β-interferon (IFN). Signalling occurs through the interaction of the RNAs with either of two pathogen recognition receptors, retinoic acid-inducible gene-I (RIG-I, also known as DDX58) and melanoma differentiation associated gene-5 (MDA5, also known as IFIH1), which contain amino-terminal caspase activation and recruitment domains (CARD) and carboxy-terminal DExD/H Box RNA helicase motifs2-5. RIG-I and MDA5 interact with another CARD protein, interferon-β promotor stimulator protein-1 (IPS-1, also known as MAVS, VISA and Cardif), in the mitochondrial membrane, which relays the signal through the transcription factors interferon regulatory factor 3 (IRF-3) and nuclear factor (NF)-κB to the IFN-β gene6-10. Although the signalling pathway is well understood, the origin of the RNA molecules that initiate these processes is not. Here we show that activation of the antiviral endoribonuclease, RNase L11, by 2′,5′-linked oligoadenylate (2-5A)12 produces small RNA cleavage products from self-RNA that initiate IFN production. Accordingly, mouse embryonic fibroblasts lacking RNase L were resistant to the induction of IFN-β expression in response to 2-5A, dsRNA or viral infection. Single-stranded regions of RNA are cleaved 3′ of UpUp and UpAp sequences by RNase L during viral infections, resulting in small, often duplex, RNAs13,14. We show that small self-RNAs produced by the action of RNase L on cellular RNA induce IFN-β expression and that the signalling involves RIG-I, MDA5 and IPS-1. Mice lacking RNase L produce significantly less IFN-β during viral infections than infected wild-type mice. Furthermore, activation of RNase L with 2-5A in vivo induced the expression of IFN-β in wild-type but not RNase L-deficient mice. Our results indicate that RNase L has an essential

Infection-specific phosphorylation of glutamyl-prolyl tRNA synthetase induces antiviral immunity

PubMed Central

Lee, Eun-Young; Lee, Hyun-Cheol; Kim, Hyun-Kwan; Jang, Song Yee; Park, Seong-Jun; Kim, Yong-Hoon; Kim, Jong Hwan; Hwang, Jungwon; Kim, Jae-Hoon; Kim, Tae-Hwan; Arif, Abul; Kim, Seon-Young; Choi, Young-Ki; Lee, Cheolju; Lee, Chul-Ho; Jung, Jae U; Fox, Paul L; Kim, Sunghoon; Lee, Jong-Soo; Kim, Myung Hee

2016-01-01

The mammalian cytoplasmic multi-tRNA synthetase complex (MSC) is a depot system that regulates non-translational cellular functions. Here we found that the MSC component glutamyl-prolyl-tRNA synthetase (EPRS) switched its function following viral infection and exhibited potent antiviral activity. Infection-specific phosphorylation of EPRS at Ser990 induced its dissociation from the MSC, after which it was guided to the antiviral signaling pathway, where it interacted with PCBP2, a negative regulator of mitochondrial antiviral signaling protein (MAVS) that is critical for antiviral immunity. This interaction blocked PCBP2-mediated ubiquitination of MAVS and ultimately suppressed viral replication. EPRS-haploid (Eprs+/−) mice showed enhanced viremia and inflammation and delayed viral clearance. This stimulus-inducible activation of MAVS by EPRS suggests an unexpected role for the MSC as a regulator of immune responses to viral infection. PMID:27595231

RNA viruses can hijack vertebrate microRNAs to suppress innate immunity

NASA Astrophysics Data System (ADS)

Trobaugh, Derek W.; Gardner, Christina L.; Sun, Chengqun; Haddow, Andrew D.; Wang, Eryu; Chapnik, Elik; Mildner, Alexander; Weaver, Scott C.; Ryman, Kate D.; Klimstra, William B.

2014-02-01

Currently, there is little evidence for a notable role of the vertebrate microRNA (miRNA) system in the pathogenesis of RNA viruses. This is primarily attributed to the ease with which these viruses mutate to disrupt recognition and growth suppression by host miRNAs. Here we report that the haematopoietic-cell-specific miRNA miR-142-3p potently restricts the replication of the mosquito-borne North American eastern equine encephalitis virus in myeloid-lineage cells by binding to sites in the 3' non-translated region of its RNA genome. However, by limiting myeloid cell tropism and consequent innate immunity induction, this restriction directly promotes neurologic disease manifestations characteristic of eastern equine encephalitis virus infection in humans. Furthermore, the region containing the miR-142-3p binding sites is essential for efficient virus infection of mosquito vectors. We propose that RNA viruses can adapt to use antiviral properties of vertebrate miRNAs to limit replication in particular cell types and that this restriction can lead to exacerbation of disease severity.

RNA viruses and microRNAs: challenging discoveries for the 21st century

PubMed Central

Swaminathan, Gokul; Martin-Garcia, Julio

2013-01-01

RNA viruses represent the predominant cause of many clinically relevant viral diseases in humans. Among several evolutionary advantages acquired by RNA viruses, the ability to usurp host cellular machinery and evade antiviral immune responses is imperative. During the past decade, RNA interference mechanisms, especially microRNA (miRNA)-mediated regulation of cellular protein expression, have revolutionized our understanding of host-viral interactions. Although it is well established that several DNA viruses express miRNAs that play crucial roles in their pathogenesis, expression of miRNAs by RNA viruses remains controversial. However, modulation of the miRNA machinery by RNA viruses may confer multiple benefits for enhanced viral replication and survival in host cells. In this review, we discuss the current literature on RNA viruses that may encode miRNAs and the varied advantages of engineering RNA viruses to express miRNAs as potential vectors for gene therapy. In addition, we review how different families of RNA viruses can alter miRNA machinery for productive replication, evasion of antiviral immune responses, and prolonged survival. We underscore the need to further explore the complex interactions of RNA viruses with host miRNAs to augment our understanding of host-virus interplay. PMID:24046280

A new putative deltapartitivirus recovered from Dianthus amurensis.

PubMed

An, Hongliu; Tan, Guanlin; Xiong, Guihong; Li, Meirong; Fang, Shouguo; Islam, Saif Ul; Zhang, Songbai; Li, Fan

2017-09-01

Two double stranded RNAs (dsRNA), likely representing the genome of a novel deltapartitivirus, provisionally named carnation cryptic virus 3 (CCV3), were recovered from Dianthus amurensis. The two dsRNAs were 1,573 (dsRNA1) and 1,561 (dsRNA2) bp in size, each containing a single open reading frame (ORF) encoding a 475- and 411-aa protein, respectively. The 475-aa protein contains a conserved RNA dependent RNA polymerase (RdRp) domain which shows significant homology to RdRps of established or putative partitiviruses, particularly those belonging to the genus Deltapartitivirus. However, it shares an amino acid identity of 75% with its closest relative, the RdRp of the deltapartitivirus beet cryptic virus 2 (BCV2), and is <62% identical to the RdRps of other partitiviruses. In a phylogenetic tree constructed with RdRps of selected partitiviruses, CCV3 clustered with BCV2 and formed a well-supported monophyletic clade with known or putative deltapartitiviruses.

Identification of giant Mimivirus protein functions using RNA interference

PubMed Central

Sobhy, Haitham; Scola, Bernard La; Pagnier, Isabelle; Raoult, Didier; Colson, Philippe

2015-01-01

Genomic analysis of giant viruses, such as Mimivirus, has revealed that more than half of the putative genes have no known functions (ORFans). We knocked down Mimivirus genes using short interfering RNA as a proof of concept to determine the functions of giant virus ORFans. As fibers are easy to observe, we targeted a gene encoding a protein absent in a Mimivirus mutant devoid of fibers as well as three genes encoding products identified in a protein concentrate of fibers, including one ORFan and one gene of unknown function. We found that knocking down these four genes was associated with depletion or modification of the fibers. Our strategy of silencing ORFan genes in giant viruses opens a way to identify its complete gene repertoire and may clarify the role of these genes, differentiating between junk DNA and truly used genes. Using this strategy, we were able to annotate four proteins in Mimivirus and 30 homologous proteins in other giant viruses. In addition, we were able to annotate >500 proteins from cellular organisms and 100 from metagenomic databases. PMID:25972846

DLEU2 encodes an antisense RNA for the putative bicistronic RFP2/LEU5 gene in humans and mouse.

PubMed

Corcoran, Martin M; Hammarsund, Marianne; Zhu, Chaoyong; Lerner, Mikael; Kapanadze, Bagrat; Wilson, Bill; Larsson, Catharina; Forsberg, Lars; Ibbotson, Rachel E; Einhorn, Stefan; Oscier, David G; Grandér, Dan; Sangfelt, Olle

2004-08-01

Our group previously identified two novel genes, RFP2/LEU5 and DLEU2, within a 13q14.3 genomic region of loss seen in various malignancies. However, no specific inactivating mutations were found in these or other genes in the vicinity of the deletion, suggesting that a nonclassical tumor-suppressor mechanism may be involved. Here, we present data showing that the DLEU2 gene encodes a putative noncoding antisense RNA, with one exon directly overlapping the first exon of the RFP2/LEU5 gene in the opposite orientation. In addition, the RFP2/LEU5 transcript can be alternatively spliced to produce either several monocistronic transcripts or a putative bicistronic transcript encoding two separate open-reading frames, adding to the complexity of the locus. The finding that these gene structures are conserved in the mouse, including the putative bicistronic RFP2/LEU5 transcript as well as the antisense relationship with DLEU2, further underlines the significance of this unusual organization and suggests a biological function for DLEU2 in the regulation of RFP2/LEU5. Copyright 2004 Wiley-Liss, Inc.

Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.

PubMed

Wang, Leo L; Burdick, Jason A

2017-01-01

It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Entomopathogenic Fungi Isaria fumosorosea Plays a Vital Role in Suppressing the Immune System of Plutella xylostella: RNA-Seq and DGE Analysis of Immunity-Related Genes.

PubMed

Xu, Jin; Xu, Xiaoxia; Shakeel, Muhammad; Li, Shuzhong; Wang, Shuang; Zhou, Xianqiang; Yu, Jialin; Xu, Xiaojing; Yu, Xiaoqiang; Jin, Fengliang

2017-01-01

Most, if not all, entomopathogenic fungi have been used as alternative control agents to decrease the insect resistance and harmful effects of the insecticides on the environment. Among them, Isaria fumosorosea has also shown great potential to control different insect pests. In the present study, we explored the immune response of P. xylostella to the infection of I. fumosorosea at different time points by using RNA-Sequencing and differential gene expression technology at the genomic level. To gain insight into the host-pathogen interaction at the genomic level, five libraries of P. xylostella larvae at 12, 18, 24, and 36 h post-infection and a control were constructed. In total, 161 immunity-related genes were identified and grouped into four categories; immune recognition families, toll and Imd pathway, melanization, and antimicrobial peptides (AMPs). The results of differentially expressed immunity-related genes depicted that 15, 13, 53, and 14 up-regulated and 38, 51, 56, and 49 were down-regulated in P. xylostella at 12, 18, 24, and 36 h post-treatment, respectively. RNA-Seq results of immunity-related genes revealed that the expression of AMPs was reduced after treatment with I. fumosorosea . To validate RNA-Seq results by RT-qPCR, 22 immunity-related genes were randomly selected. In conclusion, our results demonstrate that I. fumosorosea has the potential to suppress the immune response of P. xylostella and can become a potential biopesticide for controlling P. xylostella .

The siRNA Non-seed Region and Its Target Sequences Are Auxiliary Determinants of Off-Target Effects.

PubMed

Kamola, Piotr J; Nakano, Yuko; Takahashi, Tomoko; Wilson, Paul A; Ui-Tei, Kumiko

2015-12-01

RNA interference (RNAi) is a powerful tool for post-transcriptional gene silencing. However, the siRNA guide strand may bind unintended off-target transcripts via partial sequence complementarity by a mechanism closely mirroring micro RNA (miRNA) silencing. To better understand these off-target effects, we investigated the correlation between sequence features within various subsections of siRNA guide strands, and its corresponding target sequences, with off-target activities. Our results confirm previous reports that strength of base-pairing in the siRNA seed region is the primary factor determining the efficiency of off-target silencing. However, the degree of downregulation of off-target transcripts with shared seed sequence is not necessarily similar, suggesting that there are additional auxiliary factors that influence the silencing potential. Here, we demonstrate that both the melting temperature (Tm) in a subsection of siRNA non-seed region, and the GC contents of its corresponding target sequences, are negatively correlated with the efficiency of off-target effect. Analysis of experimentally validated miRNA targets demonstrated a similar trend, indicating a putative conserved mechanistic feature of seed region-dependent targeting mechanism. These observations may prove useful as parameters for off-target prediction algorithms and improve siRNA 'specificity' design rules.

Double-stranded RNA interferes in a sequence-specific manner with the infection of representative members of the two viroid families

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo

2008-02-05

Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less

Event-Based Prospective Memory Is Resistant but Not Immune to Proactive Interference.

PubMed

Oates, Joyce M; Peynircioglu, Zehra F

2016-01-01

Recent evidence suggests that proactive interference (PI) does not hurt event-based prospective memory (ProM) the way it does retrospective memory (RetroM) (Oates, Peynircioglu, & Bates, 2015). We investigated this apparent resistance further. Introduction of a distractor task to ensure we were testing ProM rather than vigilance in Experiment 1 and tripling the number of lists to provide more opportunity for PI buildup in Experiment 2 still did not produce performance decrements. However, when the ProM task was combined with a RetroM task in Experiment 3, a comparable buildup and release was observed also in the ProM task. It appears that event based ProM is indeed somewhat resistant to PI, but this resistance can break down when the ProM task comprises the same stimuli as in an embedded RetroM task. We discuss the results using the ideas of cue overload and distinctiveness as well as shared attentional and working memory resources.

Transplacental rotavirus IgG interferes with immune response to live oral rotavirus vaccine ORV-116E in Indian infants.

PubMed

Appaiahgari, Mohan Babu; Glass, Roger; Singh, Shakti; Taneja, Sunita; Rongsen-Chandola, Temsunaro; Bhandari, Nita; Mishra, Sukhdev; Vrati, Sudhanshu

2014-02-03

The lower immune response and efficacy of live oral rotavirus (RV) vaccines tested in developing countries may be due in part to high levels of pre-existing RV antibodies transferred to the infant from mother via the placenta. The candidate RV vaccine strain 116E was isolated from a newborn indicating that it might grow well even in the presence of this transplacental rotavirus antibody. Since the immune response to this vaccine among infants in the Indian subcontinent has been greater than that of the commercially licensed vaccines, we questioned whether this might be due to the ability of RV 116E to grow well in infants despite the presence of maternal RV antibody. To this end, we tested pre-immunization sera from Indian infants enrolled in a phase Ia/IIb trial of candidate RV vaccine ORV-116E for transplacental RV IgG to see whether it affected the immune responses and seroconversion to the vaccine. We found that the high titers of transplacental RV IgG diminished the immune responses of infants to ORV-116E vaccine. However, the vaccine was able to overcome the inhibitory effect of this RV IgG in a dose-dependent manner. This report clearly demonstrates the interference of maternal antibody on RV vaccine immunogenicity in infants in a field study as well as the ability of ORV-116E to overcome this interference when used at a higher dose. Copyright © 2013. Published by Elsevier Ltd.

RNA interference technology to control pest sea lampreys--a proof-of-concept.

PubMed

Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven

2014-01-01

The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.

RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept

PubMed Central

Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven

2014-01-01

The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485

Structural and functional insights into 5'-ppp RNA pattern recognition by the innate immune receptor RIG-I.

PubMed

Wang, Yanli; Ludwig, Janos; Schuberth, Christine; Goldeck, Marion; Schlee, Martin; Li, Haitao; Juranek, Stefan; Sheng, Gang; Micura, Ronald; Tuschl, Thomas; Hartmann, Gunther; Patel, Dinshaw J

2010-07-01

RIG-I is a cytosolic helicase that senses 5'-ppp RNA contained in negative-strand RNA viruses and triggers innate antiviral immune responses. Calorimetric binding studies established that the RIG-I C-terminal regulatory domain (CTD) binds to blunt-end double-stranded 5'-ppp RNA a factor of 17 more tightly than to its single-stranded counterpart. Here we report on the crystal structure of RIG-I CTD bound to both blunt ends of a self-complementary 5'-ppp dsRNA 12-mer, with interactions involving 5'-pp clearly visible in the complex. The structure, supported by mutation studies, defines how a lysine-rich basic cleft within the RIG-I CTD sequesters the observable 5'-pp of the bound RNA, with a stacked phenylalanine capping the terminal base pair. Key intermolecular interactions observed in the crystalline state are retained in the complex of 5'-ppp dsRNA 24-mer and full-length RIG-I under in vivo conditions, as evaluated from the impact of binding pocket RIG-I mutations and 2'-OCH(3) RNA modifications on the interferon response.

Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.

PubMed

Huang, Mei; Wu, Joseph C

2011-01-01

Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.

Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia

PubMed Central

Huang, Mei; Wu, Joseph C.

2011-01-01

Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030

Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes.

PubMed

Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris

2014-04-01

Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.

Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes

PubMed Central

Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris

2014-01-01

Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493

[Expression of Jagged1 mRNA in human epithelial ovarian carcinoma tissues and effect of RNA interference of Jagged1 on growth of xenograft in nude mice].

PubMed

Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G

2016-06-25

To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were

Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis

PubMed Central

Barnwal, Ravi Pratap; Loh, Edmund; Godin, Katherine S.; Yip, Jordan; Lavender, Hayley; Tang, Christoph M.; Varani, Gabriele

2016-01-01

Neisseria meningitidis causes bacterial meningitis and septicemia. It evades the host complement system by upregulating expression of immune evasion factors in response to changes in temperature. RNA thermometers within mRNAs control expression of bacterial immune evasion factors, including CssA, in the 5′-untranslated region of the operon for capsule biosynthesis. We dissect the molecular mechanisms of thermoregulation and report the structure of the CssA thermometer. We show that the RNA thermometer acts as a rheostat, whose stability is optimized to respond in a small temperature range around 37°C as occur within the upper airways during infection. Small increases in temperature gradually open up the structure to allow progressively increased access to the ribosome binding site. Even small changes in stability induced by mutations of imperfect base pairs, as in naturally occurring polymorphisms, shift the thermometer response outside of the desired temperature range, suggesting that its activity could be modulated by pharmacological intervention. PMID:27369378

Extraordinary GU-rich single-strand RNA identified from SARS coronavirus contributes an excessive innate immune response.

PubMed

Li, Yan; Chen, Ming; Cao, Hongwei; Zhu, Yuanfeng; Zheng, Jiang; Zhou, Hong

2013-02-01

A dangerous cytokine storm occurs in the SARS involving in immune disorder, but many aspects of the pathogenetic mechanism remain obscure since its outbreak. To deeply reveal the interaction of host and SARS-CoV, based on the basic structural feature of pathogen-associated molecular pattern, we created a new bioinformatics method for searching potential pathogenic molecules and identified a set of SARS-CoV specific GU-rich ssRNA fragments with a high-density distribution in the genome. In vitro experiments, the result showed the representative SARS-CoV ssRNAs had powerful immunostimulatory activities to induce considerable level of pro-inflammatory cytokine TNF-a, IL-6 and IL-12 release via the TLR7 and TLR8, almost 2-fold higher than the strong stimulatory ssRNA40 that was found previously from other virus. Moreover, SARS-CoV ssRNA was able to cause acute lung injury in mice with a high mortality rate in vivo experiment. It suggests that SARS-CoV specific GU-rich ssRNA plays a very important role in the cytokine storm associated with a dysregulation of the innate immunity. This study not only presents new evidence about the immunopathologic damage caused by overactive inflammation during the SARS-CoV infection, but also provides a useful clue for a new therapeutic strategy. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome

NASA Astrophysics Data System (ADS)

Lu, Rui; Folimonov, Alexey; Shintaku, Michael; Li, Wan-Xiang; Falk, Bryce W.; Dawson, William O.; Ding, Shou-Wei

2004-11-01

Viral infection in both plant and invertebrate hosts requires a virus-encoded function to block the RNA silencing antiviral defense. Here, we report the identification and characterization of three distinct suppressors of RNA silencing encoded by the 20-kb plus-strand RNA genome of citrus tristeza virus (CTV). When introduced by genetic crosses into plants carrying a silencing transgene, both p20 and p23, but not coat protein (CP), restored expression of the transgene. Although none of the CTV proteins prevented DNA methylation of the transgene, export of the silencing signal (capable of mediating intercellular silencing spread) was detected only from the F1 plants expressing p23 and not from the CP- or p20-expressing F1 plants, demonstrating suppression of intercellular silencing by CP and p20 but not by p23. Thus, intracellular and intercellular silencing are each targeted by a CTV protein, whereas the third, p20, inhibits silencing at both levels. Notably, CP suppresses intercellular silencing without interfering with intracellular silencing. The novel property of CP suggests a mechanism distinct to p20 and all of the other viral suppressors known to interfere with intercellular silencing and that this class of viral suppressors may not be consistently identified by Agrobacterium coinfiltration because it also induces RNA silencing against the infiltrated suppressor transgene. Our analyses reveal a sophisticated viral counter-defense strategy that targets the silencing antiviral pathway at multiple steps and may be essential for protecting CTV with such a large RNA genome from antiviral silencing in the perennial tree host. RNA interference | citrus tristeza virus | virus synergy | antiviral immunity

Comprehensive Genetic Dissection of the Hemocyte Immune Response in the Malaria Mosquito Anopheles gambiae

PubMed Central

Lombardo, Fabrizio; Ghani, Yasmeen; Kafatos, Fotis C.; Christophides, George K.

2013-01-01

Reverse genetics in the mosquito Anopheles gambiae by RNAi mediated gene silencing has led in recent years to an advanced understanding of the mosquito immune response against infections with bacteria and malaria parasites. We developed RNAi screens in An. gambiae hemocyte-like cells using a library of double-stranded RNAs targeting 109 genes expressed highly or specifically in mosquito hemocytes to identify novel regulators of the hemocyte immune response. Assays included phagocytosis of bacterial bioparticles, expression of the antimicrobial peptide CEC1, and basal and induced expression of the mosquito complement factor LRIM1. A cell viability screen was also carried out to assess dsRNA cytotoxicity and to identify genes involved in cell growth and survival. Our results identify 22 novel immune regulators, including proteins putatively involved in phagosome assembly and maturation (Ca2+ channel, v-ATPase and cyclin-dependent protein kinase), pattern recognition (fibrinogen-domain lectins and Nimrod), immune modulation (peptidase and serine protease homolog), immune signaling (Eiger and LPS-induced factor), cell adhesion and communication (Laminin B1 and Ninjurin) and immune homeostasis (Lipophorin receptor). The development of robust functional cell-based assays paves the way for genome-wide functional screens to study the mosquito immune response to infections with human pathogens. PMID:23382679

RNA interference as a method for target-site screening in the Western Corn Rootworm, Diabrotica virgifera virgifera

USDA-ARS?s Scientific Manuscript database

RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most

Establishing RNA virus resistance in plants by harnessing CRISPR immune system.

PubMed

Zhang, Tong; Zheng, Qiufeng; Yi, Xin; An, Hong; Zhao, Yaling; Ma, Siqi; Zhou, Guohui

2018-01-11

Recently, CRISPR-Cas (clustered, regularly interspaced short palindromic repeats-CRISPR-associated proteins) system has been used to produce plants resistant to DNA virus infections. However, there is no RNA virus control method in plants that uses CRISPR-Cas system to target the viral genome directly. Here, we reprogrammed the CRISPR-Cas9 system from Francisella novicida to confer molecular immunity against RNA viruses in Nicotiana benthamiana and Arabidopsis plants. Plants expressing FnCas9 and sgRNA specific for the cucumber mosaic virus (CMV) or tobacco mosaic virus (TMV) exhibited significantly attenuated virus infection symptoms and reduced viral RNA accumulation. Furthermore, in the transgenic virus-targeting plants, the resistance was inheritable and the progenies showed significantly less virus accumulation. These data reveal that the CRISPR/Cas9 system can be used to produce plant that stable resistant to RNA viruses, thereby broadening the use of such technology for virus control in agricultural field. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.

PubMed

Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian

2017-10-01

Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.

Modulation of Immune Signaling and Metabolism Highlights Host and Fungal Transcriptional Responses in Mouse Models of Invasive Pulmonary Aspergillosis.

PubMed

Kale, Shiv D; Ayubi, Tariq; Chung, Dawoon; Tubau-Juni, Nuria; Leber, Andrew; Dang, Ha X; Karyala, Saikumar; Hontecillas, Raquel; Lawrence, Christopher B; Cramer, Robert A; Bassaganya-Riera, Josep

2017-12-06

Incidences of invasive pulmonary aspergillosis, an infection caused predominantly by Aspergillus fumigatus, have increased due to the growing number of immunocompromised individuals. While A. fumigatus is reliant upon deficiencies in the host to facilitate invasive disease, the distinct mechanisms that govern the host-pathogen interaction remain enigmatic, particularly in the context of distinct immune modulating therapies. To gain insights into these mechanisms, RNA-Seq technology was utilized to sequence RNA derived from lungs of 2 clinically relevant, but immunologically distinct murine models of IPA on days 2 and 3 post inoculation when infection is established and active disease present. Our findings identify notable differences in host gene expression between the chemotherapeutic and steroid models at the interface of immunity and metabolism. RT-qPCR verified model specific and nonspecific expression of 23 immune-associated genes. Deep sequencing facilitated identification of highly expressed fungal genes. We utilized sequence similarity and gene expression to categorize the A. fumigatus putative in vivo secretome. RT-qPCR suggests model specific gene expression for nine putative fungal secreted proteins. Our analysis identifies contrasting responses by the host and fungus from day 2 to 3 between the two models. These differences may help tailor the identification, development, and deployment of host- and/or fungal-targeted therapeutics.

Emerging strategies for RNA interference (RNAi) applications in insects.

PubMed

Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W

2015-01-01

RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.

Aedes aegypti uses RNA interference in defense against Sindbis virus infection.

PubMed

Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D

2008-03-17

RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.

RNA Interference of Gonadotropin-Inhibitory Hormone Gene Induces Arousal in Songbirds

PubMed Central

Ubuka, Takayoshi; Mukai, Motoko; Wolfe, Jordan; Beverly, Ryan; Clegg, Sarah; Wang, Ariel; Hsia, Serena; Li, Molly; Krause, Jesse S.; Mizuno, Takanobu; Fukuda, Yujiro; Tsutsui, Kazuyoshi; Bentley, George E.; Wingfield, John C.

2012-01-01

Gonadotropin-inhibitory hormone (GnIH) was originally identified in quail as a hypothalamic neuropeptide inhibitor of pituitary gonadotropin synthesis and release. However, GnIH neuronal fibers do not only terminate in the median eminence to control anterior pituitary function but also extend widely in the brain, suggesting it has multiple roles in the regulation of behavior. To identify the role of GnIH neurons in the regulation of behavior, we investigated the effect of RNA interference (RNAi) of the GnIH gene on the behavior of white-crowned sparrows, a highly social songbird species. Administration of small interfering RNA against GnIH precursor mRNA into the third ventricle of male and female birds reduced resting time, spontaneous production of complex vocalizations, and stimulated brief agonistic vocalizations. GnIH RNAi further enhanced song production of short duration in male birds when they were challenged by playbacks of novel male songs. These behaviors resembled those of breeding birds during territorial defense. The overall results suggest that GnIH gene silencing induces arousal. In addition, the activities of male and female birds were negatively correlated with GnIH mRNA expression in the paraventricular nucleus. Density of GnIH neuronal fibers in the ventral tegmental area was decreased by GnIH RNAi treatment in female birds, and the number of gonadotropin-releasing hormone neurons that received close appositions of GnIH neuronal fiber terminals was negatively correlated with the activity of male birds. In summary, GnIH may decrease arousal level resulting in the inhibition of specific motivated behavior such as in reproductive contexts. PMID:22279571

Mechanism of MicroRNA-Target Interaction: Molecular Dynamics Simulations and Thermodynamics Analysis

PubMed Central

Wang, Yonghua; Li, Yan; Ma, Zhi; Yang, Wei; Ai, Chunzhi

2010-01-01

MicroRNAs (miRNAs) are endogenously produced ∼21-nt riboregulators that associate with Argonaute (Ago) proteins to direct mRNA cleavage or repress the translation of complementary RNAs. Capturing the molecular mechanisms of miRNA interacting with its target will not only reinforce the understanding of underlying RNA interference but also fuel the design of more effective small-interfering RNA strands. To address this, in the present work the RNA-bound (Ago-miRNA, Ago-miRNA-target) and RNA-free Ago forms were analyzed by performing both molecular dynamics simulations and thermodynamic analysis. Based on the principal component analysis results of the simulation trajectories as well as the correlation analysis in fluctuations of residues, we discover that: 1) three important (PAZ, Mid and PIWI) domains exist in Argonaute which define the global dynamics of the protein; 2) the interdomain correlated movements are so crucial for the interaction of Ago-RNAs that they not only facilitate the relaxation of the interactions between residues surrounding the RNA binding channel but also induce certain conformational changes; and 3) it is just these conformational changes that expand the cavity of the active site and open putative pathways for both the substrate uptake and product release. In addition, by thermodynamic analysis we also discover that for both the guide RNA 5′-end recognition and the facilitated site-specific cleavage of the target, the presence of two metal ions (of Mg2+) plays a predominant role, and this conclusion is consistent with the observed enzyme catalytic cleavage activity in the ternary complex (Ago-miRNA-mRNA). Our results find that it is the set of arginine amino acids concentrated in the nucleotide-binding channel in Ago, instead of the conventionally-deemed seed base-paring, that makes greater contributions in stabilizing the binding of the nucleic acids to Ago. PMID:20686687

Evidence for Viral Interference and Cross-reactive Protective Immunity Between Influenza B Virus Lineages.

PubMed

Laurie, Karen L; Horman, William; Carolan, Louise A; Chan, Kok Fei; Layton, Daniel; Bean, Andrew; Vijaykrishna, Dhanasekaran; Reading, Patrick C; McCaw, James M; Barr, Ian G

2018-01-30

Two influenza B virus lineages, B/Victoria and B/Yamagata, cocirculate in the human population. While the lineages are serologically distinct, cross-reactive responses to both lineages have been detected. Viral interference describes the situation whereby infection with one virus limits infection and replication of a second virus. We investigated the potential for viral interference between the influenza B virus lineages. Ferrets were infected and then challenged 3, 10, or 28 days later with pairs of influenza B/Victoria and B/Yamagata viruses. Viral interference occurred at challenge intervals of 3 and 10 days and occasionally at 28 days. At the longer interval, shedding of challenge virus was reduced, and this correlated with cross-reactive interferon γ responses from lymph nodes from virus-infected animals. Viruses from both lineages could prevent or significantly limit subsequent infection with a virus from the other lineage. Coinfections were rare, indicating the potential for reassortment between lineages is limited. These data suggest that innate and cross-reactive immunity mediate viral interference and that this may contribute to the dominance of a specific influenza B virus lineage in any given influenza season. Furthermore, infection with one influenza B virus lineage may be beneficial in protecting against subsequent infection with either influenza B virus lineage. © The Author(s) 2018. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Shrimp miRNAs regulate innate immune response against white spot syndrome virus infection.

PubMed

Kaewkascholkul, Napol; Somboonviwat, Kulwadee; Asakawa, Shuichi; Hirono, Ikuo; Tassanakajon, Anchalee; Somboonwiwat, Kunlaya

2016-07-01

MicroRNAs are short noncoding RNAs of RNA interference pathways that regulate gene expression through partial complementary base-pairing to target mRNAs. In this study, miRNAs that are expressed in white spot syndrome virus (WSSV)-infected Penaeus monodon, were identified using next generation sequencing. Forty-six miRNA homologs were identified from WSSV-infected shrimp hemocyte. Stem-loop real-time RT-PCR analysis showed that 11 out of 16 selected miRNAs were differentially expressed upon WSSV infection. Of those, pmo-miR-315 and pmo-miR-750 were highly responsive miRNAs. miRNA target prediction revealed that the miRNAs were targeted at 5'UTR, ORF, and 3'UTR of several immune-related genes such as genes encoding antimicrobial peptides, signaling transduction proteins, heat shock proteins, oxidative stress proteins, proteinases or proteinase inhibitors, proteins in blood clotting system, apoptosis-related proteins, proteins in prophenoloxidase system, pattern recognition proteins and other immune molecules. The highly conserved miRNA homolog, pmo-bantam, was characterized for its function in shrimp. The pmo-bantam was predicted to target the 3'UTR of Kunitz-type serine protease inhibitor (KuSPI). Binding of pmo-bantam to the target sequence of KuSPI gene was analyzed by luciferase reporter assay. Correlation of pmo-bantam and KuSPI expression was observed in lymphoid organ of WSSV-infected shrimp. These results implied that miRNAs might play roles as immune gene regulators in shrimp antiviral response. Copyright © 2016. Published by Elsevier Ltd.

Co-Channel Interference Mitigation Using Satellite Based Receivers

DTIC Science & Technology

2014-12-01

NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS CO-CHANNEL INTERFERENCE MITIGATION USING SATELLITE BASED RECEIVERS by John E. Patterson...07-02-2012 to 12-19-2014 4. TITLE AND SUBTITLE CO-CHANNEL INTERFERENCE MITIGATION USING SATELLITE BASED RE- CEIVERS 5. FUNDING NUMBERS 6. AUTHOR(S...Approved for public release; distribution is unlimited CO-CHANNEL INTERFERENCE MITIGATION USING SATELLITE BASED RECEIVERS John E. Patterson Commander

Identification and Characterization of microRNA319a and Its Putative Target Gene, PvPCF5, in the Bioenergy Grass Switchgrass (Panicum virgatum).

PubMed

Xie, Qi; Liu, Xue; Zhang, Yinbing; Tang, Jinfu; Yin, Dedong; Fan, Bo; Zhu, Lihuang; Han, Liebao; Song, Guilong; Li, Dayong

2017-01-01

Due to its high biomass yield, low environmental impact, and widespread adaptability to poor soils and harsh conditions, switchgrass ( Panicum virgatum L.), a warm-region perennial herbaceous plant, has attracted much attention in recent years. However, little is known about microRNAs (miRNAs) and their functions in this bioenergy grass. Here, we identified and characterized a miRNA gene, Pvi-MIR319a , encoding microRNA319a in switchgrass. Transgenic rice lines generated by overexpressing the Pvi-MIR319a precursor gene exhibited broader leaves and delayed flowering compared with the control. Gene expression analysis indicated at least four putative target genes were downregulated. Additionally, we cloned a putative target gene ( PvPCF5 ) of Pvi-MIR319a from switchgrass. PvPCF5, a TCP transcription factor, is a nuclear-localized protein with transactivation activity and control the development of leaf. Our results suggest that Pvi-MIR319a and its target genes may be used as potential genetic regulators for future switchgrass genetic improvement.

A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

PubMed

Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

2018-02-12

Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens

PubMed Central

Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.

2012-01-01

Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330

DNA/RNA-based formulations for treatment of breast cancer.

PubMed

Xie, Zhaolu; Zeng, Xianghui

2017-12-01

To develop a successful formulation for the gene therapy of breast cancer, an effective therapeutic nucleic acid and a proper delivery system are essential. Increased understanding of breast cancer, and developments in biotechnology, material science and nanotechnology have provided a major impetus in the development of effective formulations for the gene therapy of breast cancer. Areas covered: We discuss DNA/RNA-based formulations that can inhibit the growth of breast cancer cells and control the progress of breast cancer. Targets for the gene therapy of breast cancer, DNA/RNA-based therapeutics and delivery systems are summarized. And examples of successful DNA/RNA-based formulations for breast cancer gene therapy are reviewed. Expert opinion: Several challenges remain in developing effective DNA/RNA-based formulations for treatment of breast cancer. Firstly, most of the currently utilized targets are not effective enough as monotherapy for breast cancer. Secondly, the requirements for co-delivery system make the preparation of formulation more complicated. Thirdly, nanoparticles with the modification of tumor-targeting ligands could be more unstable in circulation and normal tissues. Lastly, immune responses against the viral vectors are unfavorable for the gene therapy of breast cancer because of the damage to the host and the impaired therapeutic ability.

A member of the polymerase beta nucleotidyltransferase superfamily is required for RNA interference in C. elegans.

PubMed

Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C

2005-02-22

RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.

Reduced expression of selective immune-related genes in silver catfish (Rhamdia quelen) monocytes exposed to atrazine.

PubMed

Kirsten, Karina Schreiner; Canova, Raíssa; Soveral, Lucas de Figueiredo; Friedrich, Maria Tereza; Frandoloso, Rafael; Kreutz, Luiz Carlos

2017-05-01

The effect of atrazine (ATZ) and its metabolites on aquatic vertebrate species has been a matter of concern to researchers and environmentalist. In this study we exposed head kidney monocytes to sublethal concentrations of atrazine (1 and 10 μg/ml -1 ), corresponding to 1% and 10% of the LC 50-96h , to evaluate the expression of immune-related genes central to immune stimulation. The mRNA levels of TNF-α, Mieloperoxidase and Mx genes were significantly reduced following 24 h exposure to both concentrations of ATZ. The mRNA levels of iRAK4 were reduced only at the higher ATZ concentration and the mRNA levels of IL-1β were not affected. The results reported here support our previous findings on the immunosuppressive effect of ATZ indicating its potential to interfere with the expression of immune-related genes, and strengthen the need to regulate ATZ usage aiming to preserve animal and human health. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dicer-2-Dependent Generation of Viral DNA from Defective Genomes of RNA Viruses Modulates Antiviral Immunity in Insects.

PubMed

Poirier, Enzo Z; Goic, Bertsy; Tomé-Poderti, Lorena; Frangeul, Lionel; Boussier, Jérémy; Gausson, Valérie; Blanc, Hervé; Vallet, Thomas; Loyd, Hyelee; Levi, Laura I; Lanciano, Sophie; Baron, Chloé; Merkling, Sarah H; Lambrechts, Louis; Mirouze, Marie; Carpenter, Susan; Vignuzzi, Marco; Saleh, Maria-Carla

2018-03-14

The RNAi pathway confers antiviral immunity in insects. Virus-specific siRNA responses are amplified via the reverse transcription of viral RNA to viral DNA (vDNA). The nature, biogenesis, and regulation of vDNA are unclear. We find that vDNA produced during RNA virus infection of Drosophila and mosquitoes is present in both linear and circular forms. Circular vDNA (cvDNA) is sufficient to produce siRNAs that confer partially protective immunity when challenged with a cognate virus. cvDNAs bear homology to defective viral genomes (DVGs), and DVGs serve as templates for vDNA and cvDNA synthesis. Accordingly, DVGs promote the amplification of vDNA-mediated antiviral RNAi responses in infected Drosophila. Furthermore, vDNA synthesis is regulated by the DExD/H helicase domain of Dicer-2 in a mechanism distinct from its role in siRNA generation. We suggest that, analogous to mammalian RIG-I-like receptors, Dicer-2 functions like a pattern recognition receptor for DVGs to modulate antiviral immunity in insects. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

27nt-RNAs guide histone variant deposition via 'RNA-induced DNA replication interference' and thus transmit parental genome partitioning in Stylonychia.

PubMed

Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim

2018-06-12

During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.

Knockdown of the Chromatin Remodeling Gene Brahma by RNA Interference Reduces Reproductive Fitness and Lifespan in Common Bed Bug (Hemiptera: Cimicidae).

PubMed

Basnet, Sanjay; Kamble, Shripat T

2018-05-04

The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.

Differential microRNA Analysis of Glandular Trichomes and Young Leaves in Xanthium strumarium L. Reveals Their Putative Roles in Regulating Terpenoid Biosynthesis.

PubMed

Fan, Rongyan; Li, Yuanjun; Li, Changfu; Zhang, Yansheng

2015-01-01

The medicinal plant Xanthium strumarium L. (X. strumarium) is covered with glandular trichomes, which are the sites for synthesizing pharmacologically active terpenoids such as xanthatin. MicroRNAs (miRNAs) are a class of 21-24 nucleotide (nt) non-coding RNAs, most of which are identified as regulators of plant growth development. Identification of miRNAs involved in the biosynthesis of plant secondary metabolites remains limited. In this study, high-throughput Illumina sequencing, combined with target gene prediction, was performed to discover novel and conserved miRNAs with potential roles in regulating terpenoid biosynthesis in X. strumarium glandular trichomes. Two small RNA libraries from leaves and glandular trichomes of X. strumarium were established. In total, 1,185 conserved miRNAs and 37 novel miRNAs were identified, with 494 conserved miRNAs and 18 novel miRNAs being differentially expressed between the two tissue sources. Based on the X. strumarium transcriptome data that we recently constructed, 3,307 annotated mRNA transcripts were identified as putative targets of the differentially expressed miRNAs. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis suggested that some of the differentially expressed miRNAs, including miR6435, miR5021 and miR1134, might be involved in terpenoid biosynthesis in the X. strumarium glandular trichomes. This study provides the first comprehensive analysis of miRNAs in X. strumarium, which forms the basis for further understanding of miRNA-based regulation on terpenoid biosynthesis.

Differential microRNA Analysis of Glandular Trichomes and Young Leaves in Xanthium strumarium L. Reveals Their Putative Roles in Regulating Terpenoid Biosynthesis

PubMed Central

Fan, Rongyan; Li, Yuanjun; Li, Changfu; Zhang, Yansheng

2015-01-01

The medicinal plant Xanthium strumarium L. (X. strumarium) is covered with glandular trichomes, which are the sites for synthesizing pharmacologically active terpenoids such as xanthatin. MicroRNAs (miRNAs) are a class of 21–24 nucleotide (nt) non-coding RNAs, most of which are identified as regulators of plant growth development. Identification of miRNAs involved in the biosynthesis of plant secondary metabolites remains limited. In this study, high-throughput Illumina sequencing, combined with target gene prediction, was performed to discover novel and conserved miRNAs with potential roles in regulating terpenoid biosynthesis in X. strumarium glandular trichomes. Two small RNA libraries from leaves and glandular trichomes of X. strumarium were established. In total, 1,185 conserved miRNAs and 37 novel miRNAs were identified, with 494 conserved miRNAs and 18 novel miRNAs being differentially expressed between the two tissue sources. Based on the X. strumarium transcriptome data that we recently constructed, 3,307 annotated mRNA transcripts were identified as putative targets of the differentially expressed miRNAs. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis suggested that some of the differentially expressed miRNAs, including miR6435, miR5021 and miR1134, might be involved in terpenoid biosynthesis in the X. strumarium glandular trichomes. This study provides the first comprehensive analysis of miRNAs in X. strumarium, which forms the basis for further understanding of miRNA-based regulation on terpenoid biosynthesis. PMID:26406988

An sRNA and Cold Shock Protein Homolog-Based Feedforward Loop Post-transcriptionally Controls Cell Cycle Master Regulator CtrA

PubMed Central

Robledo, Marta; Schlüter, Jan-Philip; Loehr, Lars O.; Linne, Uwe; Albaum, Stefan P.; Jiménez-Zurdo, José I.; Becker, Anke

2018-01-01

Adjustment of cell cycle progression is crucial for bacterial survival and adaptation under adverse conditions. However, the understanding of modulation of cell cycle control in response to environmental changes is rather incomplete. In α-proteobacteria, the broadly conserved cell cycle master regulator CtrA underlies multiple levels of control, including coupling of cell cycle and cell differentiation. CtrA levels are known to be tightly controlled through diverse transcriptional and post-translational mechanisms. Here, small RNA (sRNA)-mediated post-transcriptional regulation is uncovered as an additional level of CtrA fine-tuning. Computational predictions as well as transcriptome and proteome studies consistently suggested targeting of ctrA and the putative cold shock chaperone cspA5 mRNAs by the trans-encoded sRNA (trans-sRNA) GspR (formerly SmelC775) in several Sinorhizobium species. GspR strongly accumulated in the stationary growth phase, especially in minimal medium (MM) cultures. Lack of the gspR locus confers a fitness disadvantage in competition with the wild type, while its overproduction hampers cell growth, suggesting that this riboregulator interferes with cell cycle progression. An eGFP-based reporter in vivo assay, involving wild-type and mutant sRNA and mRNA pairs, experimentally confirmed GspR-dependent post-transcriptional down-regulation of ctrA and cspA5 expression, which most likely occurs through base-pairing to the respective mRNA. The energetically favored secondary structure of GspR is predicted to comprise three stem-loop domains, with stem-loop 1 and stem-loop 3 targeting ctrA and cspA5 mRNA, respectively. Moreover, this work reports evidence for post-transcriptional control of ctrA by CspA5. Thus, this regulation and GspR-mediated post-transcriptional repression of ctrA and cspA5 expression constitute a coherent feed-forward loop, which may enhance the negative effect of GspR on CtrA levels. This novel regulatory circuit involving

An sRNA and Cold Shock Protein Homolog-Based Feedforward Loop Post-transcriptionally Controls Cell Cycle Master Regulator CtrA.

PubMed

Robledo, Marta; Schlüter, Jan-Philip; Loehr, Lars O; Linne, Uwe; Albaum, Stefan P; Jiménez-Zurdo, José I; Becker, Anke

2018-01-01

Adjustment of cell cycle progression is crucial for bacterial survival and adaptation under adverse conditions. However, the understanding of modulation of cell cycle control in response to environmental changes is rather incomplete. In α-proteobacteria, the broadly conserved cell cycle master regulator CtrA underlies multiple levels of control, including coupling of cell cycle and cell differentiation. CtrA levels are known to be tightly controlled through diverse transcriptional and post-translational mechanisms. Here, small RNA (sRNA)-mediated post-transcriptional regulation is uncovered as an additional level of CtrA fine-tuning. Computational predictions as well as transcriptome and proteome studies consistently suggested targeting of ctrA and the putative cold shock chaperone cspA5 mRNAs by the trans- encoded sRNA ( trans- sRNA) GspR (formerly SmelC775) in several Sinorhizobium species. GspR strongly accumulated in the stationary growth phase, especially in minimal medium (MM) cultures. Lack of the gspR locus confers a fitness disadvantage in competition with the wild type, while its overproduction hampers cell growth, suggesting that this riboregulator interferes with cell cycle progression. An eGFP-based reporter in vivo assay, involving wild-type and mutant sRNA and mRNA pairs, experimentally confirmed GspR-dependent post-transcriptional down-regulation of ctrA and cspA5 expression, which most likely occurs through base-pairing to the respective mRNA. The energetically favored secondary structure of GspR is predicted to comprise three stem-loop domains, with stem-loop 1 and stem-loop 3 targeting ctrA and cspA5 mRNA, respectively. Moreover, this work reports evidence for post-transcriptional control of ctrA by CspA5. Thus, this regulation and GspR-mediated post-transcriptional repression of ctrA and cspA5 expression constitute a coherent feed-forward loop, which may enhance the negative effect of GspR on CtrA levels. This novel regulatory circuit involving

Plant innate immunity: an updated insight into defense mechanism.

PubMed

Muthamilarasan, Mehanathan; Prasad, Manoj

2013-06-01

Plants are invaded by an array of pathogens of which only a few succeed in causing disease. The attack by others is countered by a sophisticated immune system possessed by the plants. The plant immune system is broadly divided into two, viz. microbial-associated molecular-patterns-triggered immunity (MTI) and effector-triggered immunity (ETI). MTI confers basal resistance, while ETI confers durable resistance, often resulting in hypersensitive response. Plants also possess systemic acquired resistance (SAR), which provides long-term defense against a broad-spectrum of pathogens. Salicylic-acid-mediated systemic acquired immunity provokes the defense response throughout the plant system during pathogen infection at a particular site. Trans-generational immune priming allows the plant to heritably shield their progeny towards pathogens previously encountered. Plants circumvent the viral infection through RNA interference phenomena by utilizing small RNAs. This review summarizes the molecular mechanisms of plant immune system, and the latest breakthroughs reported in plant defense. We discuss the plant–pathogen interactions and integrated defense responses in the context of presenting an integral understanding in plant molecular immunity.

In cell mutational interference mapping experiment (in cell MIME) identifies the 5' polyadenylation signal as a dual regulator of HIV-1 genomic RNA production and packaging.

PubMed

Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland

2018-05-18

Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.

Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA.

PubMed

Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep

2016-03-01

Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.

Identification of Immunity-Related Genes in Ostrinia furnacalis against Entomopathogenic Fungi by RNA-Seq Analysis

PubMed Central

Zhou, Fan; Wang, Guirong; An, Chunju

2014-01-01

Background The Asian corn borer (Ostrinia furnacalis (Guenée)) is one of the most serious corn pests in Asia. Control of this pest with entomopathogenic fungus Beauveria bassiana has been proposed. However, the molecular mechanisms involved in the interactions between O. furnacalis and B. bassiana are unclear, especially under the conditions that the genomic information of O. furnacalis is currently unavailable. So we sequenced and characterized the transcriptome of O. furnacalis larvae infected by B. bassiana with special emphasis on immunity-related genes. Methodology/Principal Findings Illumina Hiseq2000 was used to sequence 4.64 and 4.72 Gb of the transcriptome from water-injected and B. bassiana-injected O. furnacalis larvae, respectively. De novo assembly generated 62,382 unigenes with mean length of 729 nt. All unigenes were searched against Nt, Nr, Swiss-Prot, COG, and KEGG databases for annotations using BLASTN or BLASTX algorithm with an E-value cut-off of 10−5. A total of 35,700 (57.2%) unigenes were annotated to at least one database. Pairwise comparisons resulted in 13,890 differentially expressed genes, with 5,843 up-regulated and 8,047 down-regulated. Based on sequence similarity to homologs known to participate in immune responses, we totally identified 190 potential immunity-related unigenes. They encode 45 pattern recognition proteins, 33 modulation proteins involved in the prophenoloxidase activation cascade, 46 signal transduction molecules, and 66 immune responsive effectors, respectively. The obtained transcriptome contains putative orthologs for nearly all components of the Toll, Imd, and JAK/STAT pathways. We randomly selected 24 immunity-related unigenes and investigated their expression profiles using quantitative RT-PCR assay. The results revealed variant expression patterns in response to the infection of B. bassiana. Conclusions/Significance This study provides the comprehensive sequence resource and expression profiles of the

Exaptive origins of regulated mRNA decay in eukaryotes

PubMed Central

Hamid, Fursham M.

2016-01-01

Eukaryotic gene expression is extensively controlled at the level of mRNA stability and the mechanisms underlying this regulation are markedly different from their archaeal and bacterial counterparts. We propose that two such mechanisms, nonsense‐mediated decay (NMD) and motif‐specific transcript destabilization by CCCH‐type zinc finger RNA‐binding proteins, originated as a part of cellular defense against RNA pathogens. These branches of the mRNA turnover pathway might have been used by primeval eukaryotes alongside RNA interference to distinguish their own messages from those of RNA viruses and retrotransposable elements. We further hypothesize that the subsequent advent of “professional” innate and adaptive immunity systems allowed NMD and the motif‐triggered mechanisms to be efficiently repurposed for regulation of endogenous cellular transcripts. This scenario explains the rapid emergence of archetypical mRNA destabilization pathways in eukaryotes and argues that other aspects of post‐transcriptional gene regulation in this lineage might have been derived through a similar exaptation route. PMID:27438915

Maternal antibodies protect offspring from severe influenza infection and do not lead to detectable interference with subsequent offspring immunization.

PubMed

van der Lubbe, Joan E M; Vreugdenhil, Jessica; Damman, Sarra; Vaneman, Joost; Klap, Jaco; Goudsmit, Jaap; Radošević, Katarina; Roozendaal, Ramon

2017-06-26

Various studies have shown that infants under the age of 6 months are especially vulnerable for complications due to influenza. Currently there are no vaccines licensed for use in this age group. Vaccination of pregnant women during the last trimester, recommended by the WHO as protective measure for this vulnerable female population, may provide protection of newborns at this early age. Although it has been observed that maternal vaccination can passively transfer protection, maternal antibodies could possibly also interfere with subsequent active vaccination of the offspring. Using a mouse model, we evaluated in depth the ability of maternal influenza vaccination to protect offspring and the effect of maternal immunization on the subsequent influenza vaccination of the offspring. By varying the regimen of maternal immunization we explored the impact of different levels of maternal antibodies on the longevity of these antibodies in their progeny. We subsequently assessed to what extent maternal antibodies can mediate direct protection against influenza in their offspring, and whether these antibodies interfere with protection induced by active vaccination of the offspring. The number of immunizations of pregnant mice correlates to the level and longevity of maternal antibodies in the offspring. When these antibodies are present at time of influenza challenge they protect offspring against lethal influenza challenge, even in the absence of detectable HAI titers. Moreover, no detectable interference of passively-transferred maternal antibodies on the subsequent vaccination of the offspring was observed. In the absence of a licensed influenza vaccine for young children, vaccination of pregnant women is a promising measure to provide protection of young infants against severe influenza infection.

Comparison of Total RNA Isolation Methods for Analysis of Immune-Related microRNAs in Market Milks

PubMed Central

2015-01-01

Bovine milk provides essential nutrients, including immunologically important molecules, as the primary source of nutrition to newborns. Recent studies showed that RNAs from bovine milk contain immune-related microRNAs (miRNA) that regulate various immune systems. To evaluate the biological and immunological activity of miRNAs from milk products, isolation methods need to be established. Six methods for extracting total RNAs from bovine colostrums were adopted to evaluate the isolating efficiency and expression of miRNAs. Total RNA from milk was presented in formulation of small RNAs, rather than ribosomal RNAs. Column-combined phenol isolating methods showed high recovery of total RNAs, especially the commercial columns for biofluid samples, which demonstrated outstanding efficiency for recovering miRNAs. We also evaluated the quantity of five immune-related miRNAs (miR-93, miR-106a, miR-155, miR-181a, miR-451) in milk processed by temperature treatments including low temperature for long time (LTLT, 63℃ for 30 min)-, high temperature for short time (HTST, 75℃ for 15 s)-, and ultra heat treatment (UHT, 120-130℃ for 0.5-4 s). All targeted miRNAs had significantly reduced levels in processed milks compared to colostrum and raw mature milk. Interestingly, the amount of immune-related miRNAs from HTST milk was more resistant than those of LTLT and UHT milks. Our present study examined defined methods of RNA isolation and quantification of immune-specific miRNAs from small volumes of milk for use in further analysis. PMID:26761866

Comparison of Total RNA Isolation Methods for Analysis of Immune-Related microRNAs in Market Milks.

PubMed

Oh, Sangnam; Park, Mi Ri; Son, Seok Jun; Kim, Younghoon

2015-01-01

Bovine milk provides essential nutrients, including immunologically important molecules, as the primary source of nutrition to newborns. Recent studies showed that RNAs from bovine milk contain immune-related microRNAs (miRNA) that regulate various immune systems. To evaluate the biological and immunological activity of miRNAs from milk products, isolation methods need to be established. Six methods for extracting total RNAs from bovine colostrums were adopted to evaluate the isolating efficiency and expression of miRNAs. Total RNA from milk was presented in formulation of small RNAs, rather than ribosomal RNAs. Column-combined phenol isolating methods showed high recovery of total RNAs, especially the commercial columns for biofluid samples, which demonstrated outstanding efficiency for recovering miRNAs. We also evaluated the quantity of five immune-related miRNAs (miR-93, miR-106a, miR-155, miR-181a, miR-451) in milk processed by temperature treatments including low temperature for long time (LTLT, 63℃ for 30 min)-, high temperature for short time (HTST, 75℃ for 15 s)-, and ultra heat treatment (UHT, 120-130℃ for 0.5-4 s). All targeted miRNAs had significantly reduced levels in processed milks compared to colostrum and raw mature milk. Interestingly, the amount of immune-related miRNAs from HTST milk was more resistant than those of LTLT and UHT milks. Our present study examined defined methods of RNA isolation and quantification of immune-specific miRNAs from small volumes of milk for use in further analysis.

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells

PubMed Central

Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan

2008-01-01

P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720

DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.

PubMed

Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan

2008-03-01

P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).

Polyethylenimine-based polyplex delivery of self-replicating RNA vaccines.

PubMed

Démoulins, Thomas; Milona, Panagiota; Englezou, Pavlos C; Ebensen, Thomas; Schulze, Kai; Suter, Rolf; Pichon, Chantal; Midoux, Patrick; Guzmán, Carlos A; Ruggli, Nicolas; McCullough, Kenneth C

2016-04-01

Self-amplifying replicon RNA (RepRNA) are large molecules (12-14 kb); their self-replication amplifies mRNA template numbers, affording several rounds of antigen production, effectively increasing vaccine antigen payloads. Their sensitivity to RNase-sensitivity and inefficient uptake by dendritic cells (DCs) - absolute requirements for vaccine design - were tackled by condensing RepRNA into synthetic, nanoparticulate, polyethylenimine (PEI)-polyplex delivery vehicles. Polyplex-delivery formulations for small RNA molecules cannot be transferred to RepRNA due to its greater size and complexity; the N:P charge ratio and impact of RepRNA folding would influence polyplex condensation, post-delivery decompaction and the cytosolic release essential for RepRNA translation. Polyplex-formulations proved successful for delivery of RepRNA encoding influenza virus hemagglutinin and nucleocapsid to DCs. Cytosolic translocation was facilitated, leading to RepRNA translation. This efficacy was confirmed in vivo, inducing both humoral and cellular immune responses. Accordingly, this paper describes the first PEI-polyplexes providing efficient delivery of the complex and large, self-amplifying RepRNA vaccines. The use of self-amplifying replicon RNA (RepRNA) to increase vaccine antigen payloads can potentially be useful in effective vaccine design. Nonetheless, its use is limited by the degradation during the uptake process. Here, the authors attempted to solve this problem by packaging RepRNA using polyethylenimine (PEI)-polyplex delivery vehicles. The efficacy was confirmed in vivo by the appropriate humoral and cellular immune responses. This novel delivery method may prove to be very useful for future vaccine design. Copyright © 2015 Elsevier Inc. All rights reserved.

In Silico Prediction and Validation of Novel RNA Binding Proteins and Residues in the Human Proteome.

PubMed

Chowdhury, Shomeek; Zhang, Jian; Kurgan, Lukasz

2018-05-28

Deciphering a complete landscape of protein-RNA interactions in the human proteome remains an elusive challenge. We computationally elucidate RNA binding proteins (RBPs) using an approach that complements previous efforts. We employ two modern complementary sequence-based methods that provide accurate predictions from the structured and the intrinsically disordered sequences, even in the absence of sequence similarity to the known RBPs. We generate and analyze putative RNA binding residues on the whole proteome scale. Using a conservative setting that ensures low, 5% false positive rate, we identify 1511 putative RBPs that include 281 known RBPs and 166 RBPs that were previously predicted. We empirically demonstrate that these overlaps are statistically significant. We also validate the putative RBPs based on two major hallmarks of their RNA binding residues: high levels of evolutionary conservation and enrichment in charged amino acids. Moreover, we show that the novel RBPs are significantly under-annotated functionally which coincides with the fact that they were not yet found to interact with RNAs. We provide two examples of our novel putative RBPs for which there is recent evidence of their interactions with RNAs. The dataset of novel putative RBPs and RNA binding residues for the future hypothesis generation is provided in the Supporting Information. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Induced antiviral innate immunity in Drosophila.

PubMed

Lamiable, Olivier; Imler, Jean-Luc

2014-08-01

Immunity to viral infections in the model organism Drosophila melanogaster involves both RNA interference and additional induced responses. The latter include not only cellular mechanisms such as programmed cell death and autophagy, but also the induction of a large set of genes, some of which contribute to the control of viral replication and resistance to infection. This induced response to infection is complex and involves both virus-specific and cell-type specific mechanisms. We review here recent developments, from the sensing of viral infection to the induction of signaling pathways and production of antiviral effector molecules. Our current understanding, although still partial, validates the Drosophila model of antiviral induced immunity for insect pests and disease vectors, as well as for mammals. Copyright © 2014 Elsevier Ltd. All rights reserved.

The immune signaling pathways of Manduca sexta

PubMed Central

Cao, Xiaolong; He, Yan; Hu, Yingxia; Wang, Yang; Chen, Yun-Ru; Bryant, Bart; Clem, Rollie J.; Schwartz, Lawrence M.; Blissard, Gary; Jiang, Haobo

2015-01-01

Signal transduction pathways and their coordination are critically important for proper functioning of animal immune systems. Our knowledge of the constituents of the intracellular signaling network in insects mainly comes from genetic analyses in Drosophila melanogaster. To facilitate future studies of similar systems in the tobacco hornworm and other lepidopteran insects, we have identified and examined the homologous genes in the genome of Manduca sexta. Based on 1:1 orthologous relationships in most cases, we hypothesize that the Toll, Imd, MAPK-JNK-p38 and JAK-STAT pathways are intact and operative in this species, as are most of the regulatory mechanisms. Similarly, cellular processes such as autophagy, apoptosis and RNA interference probably function in similar ways, because their mediators and modulators are mostly conserved in this lepidopteran species. We have annotated a total of 186 genes encoding 199 proteins, studied their domain structures and evolution, and examined their mRNA levels in tissues at different life stages. Such information provides a genomic perspective of the intricate signaling system in a non-drosophiline insect. PMID:25858029

Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.

PubMed

Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L

2016-12-05

Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.

The RNA-mediated, asymmetric ring regulatory mechanism of the transcription termination Rho helicase decrypted by time-resolved nucleotide analog interference probing (trNAIP).

PubMed

Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc

2014-08-01

Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

RNA interference in the Asian Longhorned Beetle:Identification of Key RNAi Genes and Reference Genes for RT-qPCR

USDA-ARS?s Scientific Manuscript database

Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...

Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

PubMed

Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

2016-07-08

Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

RNA Interference towards the Potato Psyllid, Bactericera cockerelli, Is Induced in Plants Infected with Recombinant Tobacco mosaic virus (TMV)

PubMed Central

Wuriyanghan, Hada; Falk, Bryce W.

2013-01-01

The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will

Functional Nanostructures for Effective Delivery of Small Interfering RNA Therapeutics

PubMed Central

Hong, Cheol Am; Nam, Yoon Sung

2014-01-01

Small interfering RNA (siRNA) has proved to be a powerful tool for target-specific gene silencing via RNA interference (RNAi). Its ability to control targeted gene expression gives new hope to gene therapy as a treatment for cancers and genetic diseases. However, siRNA shows poor pharmacological properties, such as low serum stability, off-targeting, and innate immune responses, which present a significant challenge for clinical applications. In addition, siRNA cannot cross the cell membrane for RNAi activity because of its anionic property and stiff structure. Therefore, the development of a safe, stable, and efficient system for the delivery of siRNA therapeutics into the cytoplasm of targeted cells is crucial. Several nanoparticle platforms for siRNA delivery have been developed to overcome the major hurdles facing the therapeutic uses of siRNA. This review covers a broad spectrum of non-viral siRNA delivery systems developed for enhanced cellular uptake and targeted gene silencing in vitro and in vivo and discusses their characteristics and opportunities for clinical applications of therapeutic siRNA. PMID:25285170

Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.

PubMed

Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E

2013-04-01

Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.

RNA interference-mediated NOTCH3 knockdown induces phenotype switching of vascular smooth muscle cells in vitro

PubMed Central

Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming

2015-01-01

Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway. PMID:26550181

RNA interference-mediated NOTCH3 knockdown induces phenotype switching of vascular smooth muscle cells in vitro.

PubMed

Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming

2015-01-01

Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway.

Viral evasion of intracellular DNA and RNA sensing

PubMed Central

Chan, Ying Kai; Gack, Michaela U.

2016-01-01

The co-evolution of viruses with their hosts has led to the emergence of viral pathogens that are adept at evading or actively suppressing host immunity. Pattern recognition receptors (PRRs) are key components of antiviral immunity that detect conserved molecular features of viral pathogens and initiate signalling that results in the expression of antiviral genes. In this Review, we discuss the strategies that viruses use to escape immune surveillance by key intracellular sensors of viral RNA or DNA, with a focus on RIG-I-like receptors (RLRs), cyclic GMP–AMP synthase (cGAS) and interferon-γ (IFNγ)-inducible protein 16 (IFI16). Such viral strategies include the sequestration or modification of viral nucleic acids, interference with specific post-translational modifications of PRRs or their adaptor proteins, the degradation or cleavage of PRRs or their adaptors, and the sequestration or relocalization of PRRs. An understanding of viral immune-evasion mechanisms at the molecular level may guide the development of vaccines and antivirals. PMID:27174148

Analogous modified DNA probe and immune competition method-based electrochemical biosensor for RNA modification.

PubMed

Dai, Tao; Pu, Qinli; Guo, Yongcan; Zuo, Chen; Bai, Shulian; Yang, Yujun; Yin, Dan; Li, Yi; Sheng, Shangchun; Tao, Yiyi; Fang, Jie; Yu, Wen; Xie, Guoming

2018-08-30

N6-methyladenosine (m6A), one of the most abundant RNA methylation which is ubiquitous in eukaryotic RNA, plays vital roles in many biological progresses. Therefore, the rapid and accurate quantitative detection of m6A is particularly important for its functional research. Herein, a label-free and highly selective electrochemical immunosensor was developed for the detection of m6A. The method is established on that the anti-m6A-Ab can recognize both m6A-RNA and m6A-DNA. An analogous modified DNA probe (L1) serves as a signal molecule, by competing with m6A-RNA for binding to Abs to broaden the linear range. The detection of m6A-RNA by this method is unaffected by the lengths and base sequences of RNA. Under optimal conditions, the proposed immunosensor presented a wide linear range from 0.05 to 200 nM with a detection limit as low as 0.016 nM (S/N = 3). The specificity and reproducibility of the method are satisfactory. Furthermore, the developed immunosensor was validated for m6A determination in human cell lines. Thus, the immunosensor provides a promising platform for m6A-RNA detection with simplicity, high specificity and sensitivity. Copyright © 2018 Elsevier B.V. All rights reserved.

Expression and RNA interference of salivary polygalacturonase genes in the tarnished plant bug, Lygus lineolaris.

PubMed

Walker, William B; Allen, Margaret L

2010-01-01

Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.

Expression and RNA Interference of Salivary Polygalacturonase Genes in the Tarnished Plant Bug, Lygus lineolaris

PubMed Central

Walker, William B.; Allen, Margaret L.

2010-01-01

Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205

seq-ImmuCC: Cell-Centric View of Tissue Transcriptome Measuring Cellular Compositions of Immune Microenvironment From Mouse RNA-Seq Data.

PubMed

Chen, Ziyi; Quan, Lijun; Huang, Anfei; Zhao, Qiang; Yuan, Yao; Yuan, Xuye; Shen, Qin; Shang, Jingzhe; Ben, Yinyin; Qin, F Xiao-Feng; Wu, Aiping

2018-01-01

The RNA sequencing approach has been broadly used to provide gene-, pathway-, and network-centric analyses for various cell and tissue samples. However, thus far, rich cellular information carried in tissue samples has not been thoroughly characterized from RNA-Seq data. Therefore, it would expand our horizons to better understand the biological processes of the body by incorporating a cell-centric view of tissue transcriptome. Here, a computational model named seq-ImmuCC was developed to infer the relative proportions of 10 major immune cells in mouse tissues from RNA-Seq data. The performance of seq-ImmuCC was evaluated among multiple computational algorithms, transcriptional platforms, and simulated and experimental datasets. The test results showed its stable performance and superb consistency with experimental observations under different conditions. With seq-ImmuCC, we generated the comprehensive landscape of immune cell compositions in 27 normal mouse tissues and extracted the distinct signatures of immune cell proportion among various tissue types. Furthermore, we quantitatively characterized and compared 18 different types of mouse tumor tissues of distinct cell origins with their immune cell compositions, which provided a comprehensive and informative measurement for the immune microenvironment inside tumor tissues. The online server of seq-ImmuCC are freely available at http://wap-lab.org:3200/immune/.

Enhancement of single guide RNA transcription for efficient CRISPR/Cas-based genomic engineering.

PubMed

Ui-Tei, Kumiko; Maruyama, Shohei; Nakano, Yuko

2017-06-01

Genomic engineering using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) protein is a promising approach for targeting the genomic DNA of virtually any organism in a sequence-specific manner. Recent remarkable advances in CRISPR/Cas technology have made it a feasible system for use in therapeutic applications and biotechnology. In the CRISPR/Cas system, a guide RNA (gRNA), interacting with the Cas protein, recognizes a genomic region with sequence complementarity, and the double-stranded DNA at the target site is cleaved by the Cas protein. A widely used gRNA is an RNA polymerase III (pol III)-driven single gRNA (sgRNA), which is produced by artificial fusion of CRISPR RNA (crRNA) and trans-activation crRNA (tracrRNA). However, we identified a TTTT stretch, known as a termination signal of RNA pol III, in the scaffold region of the sgRNA. Here, we revealed that sgRNA carrying a TTTT stretch reduces the efficiency of sgRNA transcription due to premature transcriptional termination, and decreases the efficiency of genome editing. Unexpectedly, it was also shown that the premature terminated sgRNA may have an adverse effect of inducing RNA interference. Such disadvantageous effects were avoided by substituting one base in the TTTT stretch.

A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC

PubMed Central

Kenesi, Erzsébet; Lózsa, Rita

2017-01-01

Abstract In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. PMID:28499009

RNA interference-based functional knockdown of the voltage-gated potassium channel Kv7.2 in dorsal root ganglion neurons after in vitro and in vivo gene transfer by adeno-associated virus vectors.

PubMed

Valdor, Markus; Wagner, Anke; Röhrs, Viola; Berg, Johanna; Fechner, Henry; Schröder, Wolfgang; Tzschentke, Thomas M; Bahrenberg, Gregor; Christoph, Thomas; Kurreck, Jens

2018-01-01

Activation of the neuronal potassium channel Kv7.2 encoded by the KCNQ2 gene has recently been shown to be an attractive mechanism to inhibit nociceptive transmission. However, potent, selective, and clinically proven activators of Kv7.2/Kv7.3 currents with analgesic properties are still lacking. An important prerequisite for the development of new drugs is a model to test the selectivity of novel agonists by abrogating Kv7.2/Kv7.3 function. Since constitutive knockout mice are not viable, we developed a model based on RNA interference-mediated silencing of KCNQ2. By delivery of a KCNQ2-specific short hairpin RNA with adeno-associated virus vectors, we completely abolished the activity of the specific Kv7.2/Kv7.3-opener ICA-27243 in rat sensory neurons. Results obtained in the silencing experiments were consistent between freshly prepared and cryopreserved dorsal root ganglion neurons, as well as in dorsal root ganglion neurons dissociated and cultured after in vivo administration of the silencing vector by intrathecal injections into rats. Interestingly, the tested associated virus serotypes substantially differed with respect to their transduction capability in cultured neuronal cell lines and primary dorsal root ganglion neurons and the in vivo transfer of transgenes by intrathecal injection of associated virus vectors. However, our study provides the proof-of-concept that RNA interference-mediated silencing of KCNQ2 is a suitable approach to create an ex vivo model for testing the specificity of novel Kv7.2/Kv7.3 agonists.

miRNome Expression Analysis Reveals New Players on Leprosy Immune Physiopathology

PubMed Central

Salgado, Claudio Guedes; Pinto, Pablo; Bouth, Raquel Carvalho; Gobbo, Angélica Rita; Messias, Ana Caroline Cunha; Sandoval, Tatiana Vinasco; dos Santos, André Mauricio Ribeiro; Moreira, Fabiano Cordeiro; Vidal, Amanda Ferreira; Goulart, Luiz Ricardo; Barreto, Josafá Gonçalves; da Silva, Moisés Batista; Frade, Marco Andrey Cipriani; Spencer, John Stewart; Santos, Sidney; Ribeiro-dos-Santos, Ândrea

2018-01-01

Leprosy remains as a public health problem and its physiopathology is still not fully understood. MicroRNAs (miRNA) are small RNA non-coding that can interfere with mRNA to regulate gene expression. A few studies using DNA chip microarrays have explored the expression of miRNA in leprosy patients using a predetermined set of genes as targets, providing interesting findings regarding the regulation of immune genes. However, using a predetermined set of genes restricted the possibility of finding new miRNAs that might be involved in different mechanisms of disease. Thus, we examined the miRNome of tuberculoid (TT) and lepromatous (LL) patients using both blood and lesional biopsies from classical leprosy patients (LP) who visited the Dr. Marcello Candia Reference Unit in Sanitary Dermatology in the State of Pará and compared them with healthy subjects. Using a set of tools to correlate significantly differentially expressed miRNAs with their gene targets, we identified possible interactions and networks of miRNAs that might be involved in leprosy immunophysiopathology. Using this approach, we showed that the leprosy miRNA profile in blood is distinct from that in lesional skin as well as that four main groups of genes are the targets of leprosy miRNA: (1) recognition and phagocytosis, with activation of immune effector cells, where the immunosuppressant profile of LL and immunoresponsive profile of TT are clearly affected by miRNA expression; (2) apoptosis, with supportive data for an antiapoptotic leprosy profile based on BCL2, MCL1, and CASP8 expression; (3) Schwann cells (SCs), demyelination and epithelial–mesenchymal transition (EMT), supporting a role for different developmental or differentiation gene families, such as Sox, Zeb, and Hox; and (4) loss of sensation and neuropathic pain, revealing that RHOA, ROCK1, SIGMAR1, and aquaporin-1 (AQP1) may be involved in the loss of sensation or leprosy pain, indicating possible new therapeutic targets. Additionally

miRNome Expression Analysis Reveals New Players on Leprosy Immune Physiopathology.

PubMed

Salgado, Claudio Guedes; Pinto, Pablo; Bouth, Raquel Carvalho; Gobbo, Angélica Rita; Messias, Ana Caroline Cunha; Sandoval, Tatiana Vinasco; Dos Santos, André Mauricio Ribeiro; Moreira, Fabiano Cordeiro; Vidal, Amanda Ferreira; Goulart, Luiz Ricardo; Barreto, Josafá Gonçalves; da Silva, Moisés Batista; Frade, Marco Andrey Cipriani; Spencer, John Stewart; Santos, Sidney; Ribeiro-Dos-Santos, Ândrea

2018-01-01

Leprosy remains as a public health problem and its physiopathology is still not fully understood. MicroRNAs (miRNA) are small RNA non-coding that can interfere with mRNA to regulate gene expression. A few studies using DNA chip microarrays have explored the expression of miRNA in leprosy patients using a predetermined set of genes as targets, providing interesting findings regarding the regulation of immune genes. However, using a predetermined set of genes restricted the possibility of finding new miRNAs that might be involved in different mechanisms of disease. Thus, we examined the miRNome of tuberculoid (TT) and lepromatous (LL) patients using both blood and lesional biopsies from classical leprosy patients (LP) who visited the Dr. Marcello Candia Reference Unit in Sanitary Dermatology in the State of Pará and compared them with healthy subjects. Using a set of tools to correlate significantly differentially expressed miRNAs with their gene targets, we identified possible interactions and networks of miRNAs that might be involved in leprosy immunophysiopathology. Using this approach, we showed that the leprosy miRNA profile in blood is distinct from that in lesional skin as well as that four main groups of genes are the targets of leprosy miRNA: (1) recognition and phagocytosis, with activation of immune effector cells, where the immunosuppressant profile of LL and immunoresponsive profile of TT are clearly affected by miRNA expression; (2) apoptosis, with supportive data for an antiapoptotic leprosy profile based on BCL2, MCL1 , and CASP8 expression; (3) Schwann cells (SCs), demyelination and epithelial-mesenchymal transition (EMT), supporting a role for different developmental or differentiation gene families, such as Sox, Zeb, and Hox; and (4) loss of sensation and neuropathic pain, revealing that RHOA, ROCK1, SIGMAR1 , and aquaporin-1 ( AQP1 ) may be involved in the loss of sensation or leprosy pain, indicating possible new therapeutic targets

Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

PubMed

Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

2011-04-29

RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

RNA interference of carboxyesterases causes nymph mortality in the Asian citrus psyllid, Diaphorina citri.

PubMed