Sample records for putative type iv

  1. Serotype IV Sequence Type 468 Group B Streptococcus Neonatal Invasive Disease, Minnesota, USA.

    PubMed

    Teatero, Sarah; Ferrieri, Patricia; Fittipaldi, Nahuel

    2016-11-01

    To further understand the emergence of serotype IV group B Streptococcus (GBS) invasive disease, we used whole-genome sequencing to characterize 3 sequence type 468 strains isolated from neonates in Minnesota, USA. We found that strains of tetracycline-resistant sequence type 468 GBS have acquired virulence genes from a putative clonal complex 17 GBS donor by recombination.

  2. Campylobacter fetus subspecies contain conserved type IV secretion systems on multiple genomic islands and plasmids

    USDA-ARS?s Scientific Manuscript database

    The features contributing to the differences in pathogenicity of the C. fetus subspecies are unknown. Putative factors involved in pathogenesis are located in genomic islands that encode type IV secretion system (T4SS) and fic-domain (filamentation induced by cyclic AMP) proteins. In the genomes of ...

  3. The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.

    2010-04-20

    Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less

  4. AtlA functions as a peptidoglycan lytic transglycosylase in the Neisseria gonorrhoeae type IV secretion system.

    PubMed

    Kohler, Petra L; Hamilton, Holly L; Cloud-Hansen, Karen; Dillard, Joseph P

    2007-08-01

    Type IV secretion systems require peptidoglycan lytic transglycosylases for efficient secretion, but the function of these enzymes is not clear. The type IV secretion system gene cluster of Neisseria gonorrhoeae encodes two peptidoglycan transglycosylase homologues. One, LtgX, is similar to peptidoglycan transglycosylases from other type IV secretion systems. The other, AtlA, is similar to endolysins from bacteriophages and is not similar to any described type IV secretion component. We characterized the enzymatic function of AtlA in order to examine its role in the type IV secretion system. Purified AtlA was found to degrade macromolecular peptidoglycan and to produce 1,6-anhydro peptidoglycan monomers, characteristic of lytic transglycosylase activity. We found that AtlA can functionally replace the lambda endolysin to lyse Escherichia coli. In contrast, a sensitive measure of lysis demonstrated that AtlA does not lyse gonococci expressing it or gonococci cocultured with an AtlA-expressing strain. The gonococcal type IV secretion system secretes DNA during growth. A deletion of ltgX or a substitution in the putative active site of AtlA severely decreased DNA secretion. These results indicate that AtlA and LtgX are actively involved in type IV secretion and that AtlA is not involved in lysis of gonococci to release DNA. This is the first demonstration that a type IV secretion peptidoglycanase has lytic transglycosylase activity. These data show that AtlA plays a role in type IV secretion of DNA that requires peptidoglycan breakdown without cell lysis.

  5. Co-ordinated expression of MMP-2 and its putative activator, MT1-MMP, in human placentation.

    PubMed

    Bjørn, S F; Hastrup, N; Lund, L R; Danø, K; Larsen, J F; Pyke, C

    1997-08-01

    The spatial expression of mRNA for matrix metalloproteinase 2 (MMP-2), its putative activator, the membrane-type 1 matrix metalloproteinase (MT1-MMP), and the MMP-2 substrate type IV collagen was investigated in human placentas of both normal and tubal ectopic pregnancies and in cyclic endometrium using in-situ hybridization. Cytokeratin staining applied to adjacent sections was used to identify epithelial and trophoblast cells. In both normal and tubal pregnancies MT1-MMP, MMP-2 and type IV collagen mRNA were highly expressed and co-localized in the extravillous cytotrophoblasts of anchoring villi, in cytotrophoblasts that had penatrated into the placental bed and in cytotrophoblastic cell islands. In addition, the decidual cells of normal pregnancies in some areas co-expressed MT1-MMP and MMP-2 mRNA, with moderate signals for both components. Fibroblast-like stromal cells in tubal pregnancies were positive for MMP-2 mRNA but generally negative for MT1-MMP mRNA. The consistent co-localization of MT1-MMP with MMP-2 and type IV collagen in the same subset of cytotrophoblasts strongly suggests that all three components co-operate in the tightly regulated fetal invasion process. The co-expression of MT1-MMP and MMP-2 mRNA in some of the decidual cells indicates that these cells are also actively involved in the placentation process.

  6. The chemotaxis regulator pilG of Xylella fastidiosa is required for virulence in Vitis vinifera grapevines

    USDA-ARS?s Scientific Manuscript database

    Type IV pili of X. fastidiosa are regulated by pilG, a response regulator protein putatively involved in chemotaxis-like operon sensing stimuli through signal transduction pathways. To elucidate roles of pilG in pathogenicity of X. fastidiosa, the pilG-deletion mutant and complementary strain contai...

  7. Characterisation of putative oxygen chemoreceptors in bowfin (Amia calva).

    PubMed

    Porteus, Cosima S; Wright, Patricia A; Milsom, William K

    2014-04-15

    Serotonin containing neuroepithelial cells (NECs) are putative oxygen sensing cells found in different locations within the gills of fish. In this study we wished to determine the effect of sustained internal (blood) hypoxaemia versus external (aquatic) hypoxia on the size and density of NECs in the first gill arch of bowfin (Amia calva), a facultative air breather. We identified five different populations of serotonergic NECs in this species (Types I-V) based on location, presence of synaptic vesicles (SV) that stain for the antibody SV2, innervation and labelling with the neural crest marker HNK-1. Cell Types I-III were innervated, and these cells, which participate in central O2 chemoreflexes, were studied further. Although there was no change in the density of any cell type in bowfin after exposure to sustained hypoxia (6.0 kPa for 7 days) without access to air, all three of these cell types increased in size. In contrast, only Type II and III cells increased in size in bowfin exposed to sustained hypoxia with access to air. These data support the suggestion that NECs are putative oxygen-sensing cells, that they occur in several locations, and that Type I cells monitor only hypoxaemia, whereas both other cell types monitor hypoxia and hypoxaemia.

  8. Investigation of a Putative Estrogen-Imprinting Gene, Phosphodiesterase Type IV Variant (PDE4D4), in Determining Prostate Cancer Risk

    DTIC Science & Technology

    2007-04-01

    ductal prostate adenocarcinomas in NBL / Cr and Sprague-Dawley Hsd:SD rats treated with a combination of testosterone and estradiol-17h or...Androl 1981;2(6):293–9. 80] Bosland MC, Ford H, Horton L. Induction at high incidence of ductal prostate adenocarcinomas in NBL /Cr and Sprague–Dawley

  9. Identification of Surprisingly Diverse Type IV Pili, across a Broad Range of Gram-Positive Bacteria

    PubMed Central

    Roos, David S.; Pohlschröder, Mechthild

    2011-01-01

    Background In Gram-negative bacteria, type IV pili (TFP) have long been known to play important roles in such diverse biological phenomena as surface adhesion, motility, and DNA transfer, with significant consequences for pathogenicity. More recently it became apparent that Gram-positive bacteria also express type IV pili; however, little is known about the diversity and abundance of these structures in Gram-positives. Computational tools for automated identification of type IV pilins are not currently available. Results To assess TFP diversity in Gram-positive bacteria and facilitate pilin identification, we compiled a comprehensive list of putative Gram-positive pilins encoded by operons containing highly conserved pilus biosynthetic genes (pilB, pilC). A surprisingly large number of species were found to contain multiple TFP operons (pil, com and/or tad). The N-terminal sequences of predicted pilins were exploited to develop PilFind, a rule-based algorithm for genome-wide identification of otherwise poorly conserved type IV pilins in any species, regardless of their association with TFP biosynthetic operons (http://signalfind.org). Using PilFind to scan 53 Gram-positive genomes (encoding >187,000 proteins), we identified 286 candidate pilins, including 214 in operons containing TFP biosynthetic genes (TBG+ operons). Although trained on Gram-positive pilins, PilFind identified 55 of 58 manually curated Gram-negative pilins in TBG+ operons, as well as 53 additional pilin candidates in operons lacking biosynthetic genes in ten species (>38,000 proteins), including 27 of 29 experimentally verified pilins. False positive rates appear to be low, as PilFind predicted only four pilin candidates in eleven bacterial species (>13,000 proteins) lacking TFP biosynthetic genes. Conclusions We have shown that Gram-positive bacteria contain a highly diverse set of type IV pili. PilFind can be an invaluable tool to study bacterial cellular processes known to involve type IV pilus-like structures. Its use in combination with other currently available computational tools should improve the accuracy of predicting the subcellular localization of bacterial proteins. PMID:22216142

  10. Investigation of a Putative Estrogen-Imprinting Gene, Phosphodiesterase Type IV Variant (Pde4d4), in Determining Prostate Cancer Risk

    DTIC Science & Technology

    2008-04-01

    margins ” of one’s genetic make-up. Keywords DNAmethylation . Histone modification . Chromatin remodeling . Nongenomic heritage . Developmental plasticity...palliative care to personalized preventive medicine which could be based, in part, on the epigenetic marks engraved along the “book- margins ” of one’s...investigations. Other demands for successful utilization of RLGS are he requirements for a fairly elaborate gel electrophoresis set-up and a powerful mage

  11. Type IV Pili in Francisella tularensis: Roles of pilF and pilT in Fiber Assembly, Host Cell Adherence, and Virulence ▿

    PubMed Central

    Chakraborty, Subhra; Monfett, Michael; Maier, Tamara M.; Benach, Jorge L.; Frank, Dara W.; Thanassi, David G.

    2008-01-01

    Francisella tularensis, a highly virulent facultative intracellular bacterium, is the causative agent of tularemia. Genome sequencing of all F. tularensis subspecies revealed the presence of genes that could encode type IV pili (Tfp). The live vaccine strain (LVS) expresses surface fibers resembling Tfp, but it was not established whether these fibers were indeed Tfp encoded by the pil genes. We show here that deletion of the pilF putative Tfp assembly ATPase in the LVS resulted in a complete loss of surface fibers. Disruption of the pilT putative disassembly ATPase also caused a complete loss of pili, indicating that pilT functions differently in F. tularensis than in model Tfp systems such as those found in Pseudomonas aeruginosa and Neisseria spp. The LVS pilF and pilT mutants were attenuated for virulence in a mouse model of tularemia by the intradermal route. Furthermore, although absence of pili had no effect on the ability of the LVS to replicate intracellularly, the pilF and pilT mutants were defective for adherence to macrophages, pneumocytes, and hepatocytes. This work confirms that the surface fibers expressed by the LVS are encoded by the pil genes and provides evidence that the Francisella pili contribute to host cell adhesion and virulence. PMID:18426883

  12. Roles of the Putative Type IV-like Secretion System Key Component VirD4 and PrsA in Pathogenesis of Streptococcus suis Type 2

    PubMed Central

    Jiang, Xiaowu; Yang, Yunkai; Zhou, Jingjing; Zhu, Lexin; Gu, Yuanxing; Zhang, Xiaoyan; Li, Xiaoliang; Fang, Weihuan

    2016-01-01

    Streptococcus suis type 2 (SS2) is a zoonotic pathogen causing septic infection, meningitis and pneumonia in pigs and humans. SS2 may cause streptococcal toxic shock syndrome (STSS) probably due to excessive release of inflammatory cytokines. A previous study indicated that the virD4 gene in the putative type IV-like secretion system (T4SS) within the 89K pathogenicity island specific for recent epidemic strains contributed to the development of STSS. However, the functional basis of VirD4 in STSS remains unclear. Here we show that deletion of virD4 led to reduced virulence as shown by about 65% higher LD50, lower bacterial load in liver and brain, and lower level of expression of inflammatory cytokines in mice and cell lines than its parent strain. The ΔVirD4 mutant was more easily phagocytosed, suggesting its role as an anti-phagocytic factor. Oxidative stress that mimic bacterial exposure to respiratory burst of phagocytes upregulated expression of virD4. Proteomic analysis identified 10 secreted proteins of significant differences between the parent and mutant strains under oxidative stress, including PrsA, a peptidyl-prolyl isomerase. The SS2 PrsA expressed in E. coli caused a dose-dependent cell death and increased expression of proinflammatory IL-1β, IL-6 and TNF-α in murine macrophage cells. Our data provide novel insights into the contribution of the VirD4 factor to STSS pathogenesis, possibly via its anti-phagocytic activity, upregulation of its expression upon oxidative stress and its involvement in increased secretion of PrsA as a cell death inducer and proinflammatory effector. PMID:27995095

  13. Comparative c-type cytochrome expression analysis in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C grown with soluble and insoluble oxidised metal electron acceptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nissen, Silke; Liu, Xiaoxin; Chourey, Karuna

    2012-01-01

    The genomes of Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C encode 40 and 69 putative c-type cytochrome genes, respectively. Deletion mutant and biochemical studies have assigned specific functions to a few c-type cytochromes involved in electron transfer to oxidised metals in Shewanella oneidensis strain MR-1. Although promising, the genetic approach is limited to gene deletions that produce a distinct phenotype, and organism for which a genetic system is available. To more comprehensively investigate and compare c-type cytochrome expression in Shewanella oneidensis strain MR-1 and Anaeromyxobacter dehalogenans strain 2CP-C, proteomic measurements were used to characterise lysates of cells grownmore » with soluble Fe(III) (as ferric citrate) and insoluble Mn(IV) (as MnO2) as electron acceptors. Strain MR-1 expressed 19 and 20, and strain 2CP-C expressed 27 and 25 c-type cytochromes when grown with Fe(III) and Mn(IV), respectively. The majority of c-type cytochromes (77% for strain MR-1 and 63% for strain 2CP-C) were expressed under both growth conditions; however, the analysis also revealed unique c-type cytochromes that were specifically expressed in cells grown with soluble Fe(III) or insoluble Mn(IV). Proteomic characterisation proved to be a promising approach for determining the c-type cytochrome complement expressed under different growth conditions, and will help elucidating the specific functions of more c-type cytochromes that are the basis for Shewanella and Anaeromyxobacter respiratory versatility.« less

  14. Large-Scale Phylogenetic Classification of Fungal Chitin Synthases and Identification of a Putative Cell-Wall Metabolism Gene Cluster in Aspergillus Genomes

    PubMed Central

    Pacheco-Arjona, Jose Ramon; Ramirez-Prado, Jorge Humberto

    2014-01-01

    The cell wall is a protective and versatile structure distributed in all fungi. The component responsible for its rigidity is chitin, a product of chitin synthase (Chsp) enzymes. There are seven classes of chitin synthase genes (CHS) and the amount and type encoded in fungal genomes varies considerably from one species to another. Previous Chsp sequence analyses focused on their study as individual units, regardless of genomic context. The identification of blocks of conserved genes between genomes can provide important clues about the interactions and localization of chitin synthases. On the present study, we carried out an in silico search of all putative Chsp encoded in 54 full fungal genomes, encompassing 21 orders from five phyla. Phylogenetic studies of these Chsp were able to confidently classify 347 out of the 369 Chsp identified (94%). Patterns in the distribution of Chsp related to taxonomy were identified, the most prominent being related to the type of fungal growth. More importantly, a synteny analysis for genomic blocks centered on class IV Chsp (the most abundant and widely distributed Chsp class) identified a putative cell wall metabolism gene cluster in members of the genus Aspergillus, the first such association reported for any fungal genome. PMID:25148134

  15. A 2,4-dichlorophenoxyacetic acid degradation plasmid pM7012 discloses distribution of an unclassified megaplasmid group across bacterial species.

    PubMed

    Sakai, Yoriko; Ogawa, Naoto; Shimomura, Yumi; Fujii, Takeshi

    2014-03-01

    Analysis of the complete nucleotide sequence of plasmid pM7012 from 2,4-dichlorophenoxyacetic-acid (2,4-D)-degrading bacterium Burkholderia sp. M701 revealed that the plasmid had 582 142 bp, with 541 putative protein-coding sequences and 39 putative tRNA genes for the transport of the standard 20 aa. pM7012 contains sequences homologous to the regions involved in conjugal transfer and plasmid maintenance found in plasmids byi_2p from Burkholderia sp. YI23 and pBVIE01 from Burkholderia sp. G4. No relaxase gene was found in any of these plasmids, although genes for a type IV secretion system and type IV coupling proteins were identified. Plasmids with no relaxase gene have been classified as non-mobile plasmids. However, nucleotide sequences with a high level of similarity to the genes for plasmid transfer, plasmid maintenance, 2,4-D degradation and arsenic resistance contained on pM7012 were also detected in eight other megaplasmids (~600 or 900 kb) found in seven Burkholderia strains and a strain of Cupriavidus, which were isolated as 2,4-D-degrading bacteria in Japan and the United States. These results suggested that the 2,4-D degradation megaplasmids related to pM7012 are mobile and distributed across various bacterial species worldwide, and that the plasmid group could be distinguished from known mobile plasmid groups.

  16. A Homologue of an Operon Required for DNA Transfer in Agrobacterium Is Required in Brucella abortus for Virulence and Intracellular Multiplication

    PubMed Central

    Sieira, Rodrigo; Comerci, Diego J.; Sánchez, Daniel O.; Ugalde, Rodolfo A.

    2000-01-01

    As part of a Brucella abortus 2308 genome project carried out in our laboratory, we identified, cloned, and sequenced a genomic DNA fragment containing a locus (virB) highly homologous to bacterial type IV secretion systems. The B. abortus virB locus is a collinear arrangement of 13 open reading frames (ORFs). Between virB1 and virB2 and downstream of ORF12, two degenerated, palindromic repeat sequences characteristic of Brucella intergenic regions were found. Gene reporter studies demonstrated that the B. abortus virB locus constitutes an operon transcribed from virB1 which is turned on during the stationary phase of growth. A B. abortus polar virB1 mutant failed to replicate in HeLa cells, indicating that the virB operon plays a critical role in intracellular multiplication. Mutants with polar and nonpolar mutations introduced in virB10 showed different behaviors in mice and in the HeLa cell infection assay, suggesting that virB10 per se is necessary for the correct function of this type IV secretion apparatus. Mouse infection assays demonstrated that the virB operon constitutes a major determinant of B. abortus virulence. It is suggested that putative effector molecules secreted by this type IV secretion system determine routing of B. abortus to an endoplasmic reticulum-related replication compartment. PMID:10940027

  17. Localization of type IV collagen a 1 to a 6 chains in basement membrane during mouse molar germ development.

    PubMed

    Nagai, N; Nakano, K; Sado, Y; Naito, I; Gunduz, M; Tsujigiwa, H; Nagatsuka, H; Ninomiya, Y; Siar, C H

    2001-10-01

    The dental basement membrane (BM) putatively mediates epithelial-mesenchymal interactions during tooth morphogenesis and cytodifferentiation. Type IV collagen alpha chains, a major network-forming protein of the dental BM, was studied and results disclosed distinct expression patterns at different stages of mouse molar germ development. At the dental placode and bud stage, the BM of the oral epithelium expressed alpha 1, alpha 2, alpha 5 and alpha 6 chains while the gubernaculum dentis, in addition to the above four chains, also expressed a 4 chain. An asymmetrical expression for alpha 4, alpha 5 and alpha 6 chains was observed at the bud stage. At the early bell stage, the BM associated with the inner enamel epithelium (IEE) of molar germ expressed alpha 1, alpha 2 and alpha 4 chains while the BM of the outer enamel epithelium (OEE) expressed only alpha 1 and a 2 chains. With the onset of dentinogenesis, the collagen a chain profile of the IEE BM gradually disappeared. Howeverfrom the early to late bell stage, the gubernaculum dentis consistently expressed alpha 1, alpha 2, alpha 5 and a 6 chains resembling fetal oral mucosa. These findings suggest that stage- and position-specific distribution of type IV collagen alpha subunits occur during molar germ development and that these changes are essential for molar morphogenesis and cytodifferentiation.

  18. Effects of bfp Mutations on Biogenesis of Functional Enteropathogenic Escherichia coli Type IV Pili

    PubMed Central

    Anantha, Ravi P.; Stone, Kelly D.; Donnenberg, Michael S.

    2000-01-01

    Enteropathogenic Escherichia coli expresses a type IV fimbria known as the bundle-forming pilus (BFP) that is required for autoaggregation and localized adherence (LA) to host cells. A cluster of 14 genes is sufficient to reconstitute BFP biogenesis in a laboratory strain of E. coli. We have undertaken a systematic mutagenesis of the individual genes to determine the effect of each mutation on BFP biogenesis and LA. Here we report the construction and analysis of nonpolar mutations in six genes of the bfp cluster, bfpG, bfpB, bfpC, bfpD, bfpP, and bfpH, as well as the further analysis of a previously described bfpA mutant strain that is unable to express bundlin, the pilin protein. We found that mutations in bfpB, which encodes an outer membrane protein; bfpD, which encodes a putative nucleotide-binding protein; and bfpG and bfpC, which do not have sequence homologues in other type IV pilus systems, do not affect prebundlin expression or processing but block both BFP biogenesis and LA. The mutation in bfpP, the prepilin peptidase gene, does not affect prebundlin expression but blocks signal sequence cleavage of prebundlin, BFP biogenesis, and LA. The mutation in bfpH, which is predicted to encode a lytic transglycosylase, has no effect on prebundlin expression, prebundlin processing, BFP biogenesis, or LA. For each mutant for which altered phenotypes were detected, complementation with a plasmid containing the corresponding wild-type allele restored the wild-type phenotypes. We also found that association of prebundlin or bundlin with sucrose density flotation gradient fractions containing both inner and outer membrane proteins does not require any accessory proteins. These studies indicate that many bfp gene products are required for biogenesis of functional type IV pili but that mutations in the individual genes do not lead to the identification of new phases of pilus assembly. PMID:10762251

  19. Identification and tissue distribution of mRNAs encoding salmon-type calcitonins-IV and -V in the rainbow trout.

    PubMed

    Hidaka, Yoshie; Suzuki, Masakazu

    2004-06-01

    Four types of calcitonin are produced in salmonid fish, although their functional diversity is almost unknown. To explore the significance of these isoforms, we have characterized salmon-type calcitonin (sCT) mRNAs in the rainbow trout (Oncorhynchus mykiss), and examined their tissue distribution. In addition to the previously isolated sCT-I cDNAs, two new forms of sCT cDNA were cloned from the ultimobranchial gland, and one of them (sCT-IV cDNA) was predicted to encode an N-terminal peptide of 80 amino acid residues, a putative cleavage site Lys-Arg, sCT-IV, a cleavage and amidation sequence Gly-Lys-Lys-Arg, and a C-terminal peptide of 18 amino acids. The sCT-IV precursor was 78% identical with the rainbow trout sCT-I precursors. The other cloned cDNA encoded a precursor for a novel CT, sCT-V. The sCT-V peptide was different from sCT-IV by only one amino acid residue: Val at position 8 in the latter was replaced by Met. The sCT-V precursor had 80 and 90% identity with the sCT-I and -IV precursors respectively. No cDNA clones were obtained for sCTs-II or -III.Tissue distribution of sCT-I, -IV and -V mRNAs was examined by RT-PCR and specific cleavage with restriction enzymes. An amplified fragment from sCT-I mRNA was detected not only in the ultimobranchial gland, but also in the gills, testis and ovary. RT-PCR analysis coupled to restriction digestion further revealed that sCT-IV mRNA was expressed in both the testis and the ultimobranchial gland. The expression sites of sCT-IV mRNA were localized to the Leydig cells of the testis and to the parenchymal cells of the ultimobranchial gland, by in situ hybridization histochemistry. Although the amino acid sequence of sCT-V peptide was nearly the same as that of sCT-IV, the sCT-V gene showed a much wider pattern of expression: the band amplified by RT-PCR was detected in all the tissues examined except the kidney, gills and blood cells. The sCT-V mRNA was shown to be localized in the parenchymal cells of the ultimobranchial gland, but not in other tissues at the cellular level, suggesting very low expression of sCT-V mRNA in those tissues. Our results show different patterns of tissue expression of three types of sCT genes in the rainbow trout, suggesting that sCTs-I, -IV and -V might differ in their local actions.

  20. Legionella oakridgensis ATCC 33761 genome sequence and phenotypic characterization reveals its replication capacity in amoebae.

    PubMed

    Brzuszkiewicz, Elzbieta; Schulz, Tino; Rydzewski, Kerstin; Daniel, Rolf; Gillmaier, Nadine; Dittmann, Christine; Holland, Gudrun; Schunder, Eva; Lautner, Monika; Eisenreich, Wolfgang; Lück, Christian; Heuner, Klaus

    2013-12-01

    Legionella oakridgensis is able to cause Legionnaires' disease, but is less virulent compared to L. pneumophila strains and very rarely associated with human disease. L. oakridgensis is the only species of the family legionellae which is able to grow on media without additional cysteine. In contrast to earlier publications, we found that L. oakridgensis is able to multiply in amoebae. We sequenced the genome of L. oakridgensis type strain OR-10 (ATCC 33761). The genome is smaller than the other yet sequenced Legionella genomes and has a higher G+C-content of 40.9%. L. oakridgensis lacks a flagellum and it also lacks all genes of the flagellar regulon except of the alternative sigma-28 factor FliA and the anti-sigma-28 factor FlgM. Genes encoding structural components of type I, type II, type IV Lvh and type IV Dot/Icm, Sec- and Tat-secretion systems could be identified. Only a limited set of Dot/Icm effector proteins have been recognized within the genome sequence of L. oakridgensis. Like in L. pneumophila strains, various proteins with eukaryotic motifs and eukaryote-like proteins were detected. We could demonstrate that the Dot/Icm system is essential for intracellular replication of L. oakridgensis. Furthermore, we identified new putative virulence factors of Legionella. Copyright © 2013 Elsevier GmbH. All rights reserved.

  1. Noninvasive in situ evaluation of osteogenic differentiation by time-resolved laser-induced fluorescence spectroscopy.

    PubMed

    Ashjian, Peter; Elbarbary, Amir; Zuk, Patricia; DeUgarte, Daniel A; Benhaim, Prosper; Marcu, Laura; Hedrick, Marc H

    2004-01-01

    The clinical implantation of bioengineered tissues requires an in situ nondestructive evaluation of the quality of tissue constructs developed in vitro before transplantation. Time-resolved laser-induced fluorescence spectroscopy (TR-LIFS) is demonstrated here to noninvasively monitor the formation of osteogenic extracellular matrix (ECM) produced by putative stem cells (PLA cells) derived from human adipose tissue. We show that this optical spectroscopy technique can assess the relative expression of collagens (types I, III, IV, and V) within newly forming osteogenic ECM. The results are consistent with those obtained by conventional histochemical techniques (immunofluorescence and Western blot) and demonstrate that TR-LIFS is a potential tool for monitoring the expression of distinct collagen types and the formation of collagen cross-links in intact tissue constructs.

  2. Neuregulin 1 transcripts are differentially expressed in schizophrenia and regulated by 5′ SNPs associated with the disease

    PubMed Central

    Law, Amanda J.; Lipska, Barbara K.; Weickert, Cynthia Shannon; Hyde, Thomas M.; Straub, Richard E.; Hashimoto, Ryota; Harrison, Paul J.; Kleinman, Joel E.; Weinberger, Daniel R.

    2006-01-01

    Genetic variation in neuregulin 1 (NRG1) is associated with schizophrenia. The disease-associated SNPs are noncoding, and their functional implications remain unknown. We hypothesized that differential expression of the NRG1 gene explains its association to the disease. We examined four of the disease-associated SNPs that make up the original risk haplotype in the 5′ upstream region of the gene for their effects on mRNA abundance of NRG1 types I–IV in human postmortem hippocampus. Diagnostic comparisons revealed a 34% increase in type I mRNA in schizophrenia and an interaction of diagnosis and genotype (SNP8NRG221132) on this transcript. Of potentially greater interest, a single SNP within the risk haplotype (SNP8NRG243177) and a 22-kb block of this core haplotype are associated with mRNA expression for the novel type IV isoform in patients and controls. Bioinformatic promoter analyses indicate that both SNPs lead to a gain/loss of putative binding sites for three transcription factors, serum response factor, myelin transcription factor-1, and High Mobility Group Box Protein-1. These data implicate variation in isoform expression as a molecular mechanism for the genetic association of NRG1 with schizophrenia. PMID:16618933

  3. Genotyping microsatellite DNA markers at putative disease loci in inbred/multiplex families with respiratory chain complex I deficiency allows rapid identification of a novel nonsense mutation (IVS1nt -1) in the NDUFS4 gene in Leigh syndrome.

    PubMed

    Bénit, Paule; Steffann, Julie; Lebon, Sophie; Chretien, Dominique; Kadhom, Noman; de Lonlay, Pascale; Goldenberg, Alice; Dumez, Yves; Dommergues, Marc; Rustin, Pierre; Munnich, Arnold; Rötig, Agnès

    2003-05-01

    Complex I deficiency, the most common cause of mitochondrial disorders, accounts for a variety of clinical symptoms and its genetic heterogeneity makes identification of the disease genes particularly tedious. Indeed, most of the 43 complex I subunits are encoded by nuclear genes, only seven of them being mitochondrially encoded. In order to offer urgent prenatal diagnosis, we have studied an inbred/multiplex family with complex I deficiency by using microsatellite DNA markers flanking the putative disease loci. Microsatellite DNA markers have allowed us to exclude the NDUFS7, NDUFS8, NDUFV1 and NDUFS1 genes and to find homozygosity at the NDUFS4 locus. Direct sequencing has led to identification of a homozygous splice acceptor site mutation in intron 1 of the NDUFS4 gene (IVS1nt -1, G-->A); this was not found in chorion villi of the ongoing pregnancy. We suggest that genotyping microsatellite DNA markers at putative disease loci in inbred/multiplex families helps to identify the disease-causing mutation. More generally, we suggest giving consideration to a more systematic microsatellite analysis of putative disease loci for identification of disease genes in inbred/multiplex families affected with genetically heterogeneous conditions.

  4. Dioxygen Activation and O–O Bond Formation Reactions by Manganese Corroles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, Mian; Lee, Yong-Min; Gupta, Ranjana

    Activation of dioxygen (O 2) in enzymatic and biomimetic reactions has been intensively investigated over the past several decades. More recently, O–O bond formation, which is the reverse of the O 2-activation reaction, has been the focus of current research. Herein, we report the O 2-activation and O–O bond formation reactions by manganese corrole complexes. In the O 2-activation reaction, Mn(V)-oxo and Mn(IV)-peroxo intermediates were formed when Mn(III) corroles were exposed to O 2 in the presence of base (e.g., OH –) and hydrogen atom (H atom) donor (e.g., THF or cyclic olefins); the O 2-activation reaction did not occurmore » in the absence of base and H atom donor. Moreover, formation of the Mn(V)-oxo and Mn(IV)-peroxo species was dependent on the amounts of base present in the reaction solution. The role of the base was proposed to lower the oxidation potential of the Mn(III) corroles, thereby facilitating the binding of O 2 and forming a Mn(IV)-superoxo species. The putative Mn(IV)-superoxo species was then converted to the corresponding Mn(IV)-hydroperoxo species by abstracting a H atom from H atom donor, followed by the O–O bond cleavage of the putative Mn(IV)-hydroperoxo species to form a Mn(V)-oxo species. We have also shown that addition of hydroxide ion to the Mn(V)-oxo species afforded the Mn(IV)-peroxo species via O–O bond formation and the resulting Mn(IV)-peroxo species reverted to the Mn(V)-oxo species upon addition of proton, indicating that the O–O bond formation and cleavage reactions between the Mn(V)-oxo and Mn(IV)-peroxo complexes are reversible. The present paper reports the first example of using the same manganese complex in both O 2-activation and O–O bond formation reactions.« less

  5. Dioxygen Activation and O–O Bond Formation Reactions by Manganese Corroles

    DOE PAGES

    Guo, Mian; Lee, Yong-Min; Gupta, Ranjana; ...

    2017-10-22

    Activation of dioxygen (O 2) in enzymatic and biomimetic reactions has been intensively investigated over the past several decades. More recently, O–O bond formation, which is the reverse of the O 2-activation reaction, has been the focus of current research. Herein, we report the O 2-activation and O–O bond formation reactions by manganese corrole complexes. In the O 2-activation reaction, Mn(V)-oxo and Mn(IV)-peroxo intermediates were formed when Mn(III) corroles were exposed to O 2 in the presence of base (e.g., OH –) and hydrogen atom (H atom) donor (e.g., THF or cyclic olefins); the O 2-activation reaction did not occurmore » in the absence of base and H atom donor. Moreover, formation of the Mn(V)-oxo and Mn(IV)-peroxo species was dependent on the amounts of base present in the reaction solution. The role of the base was proposed to lower the oxidation potential of the Mn(III) corroles, thereby facilitating the binding of O 2 and forming a Mn(IV)-superoxo species. The putative Mn(IV)-superoxo species was then converted to the corresponding Mn(IV)-hydroperoxo species by abstracting a H atom from H atom donor, followed by the O–O bond cleavage of the putative Mn(IV)-hydroperoxo species to form a Mn(V)-oxo species. We have also shown that addition of hydroxide ion to the Mn(V)-oxo species afforded the Mn(IV)-peroxo species via O–O bond formation and the resulting Mn(IV)-peroxo species reverted to the Mn(V)-oxo species upon addition of proton, indicating that the O–O bond formation and cleavage reactions between the Mn(V)-oxo and Mn(IV)-peroxo complexes are reversible. The present paper reports the first example of using the same manganese complex in both O 2-activation and O–O bond formation reactions.« less

  6. A new compound heterozygous frameshift mutation in the type II 3{beta}-hydroxysteroid dehydrogenase 3{beta}-HSD gene causes salt-wasting 3{beta}-HSD deficiency congenital adrenal hyperplasia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, L.; Sakkal-Alkaddour, S.; Chang, Ying T.

    1996-01-01

    We report a new compound heterozygous frameshift mutation in the type II 3{Beta}-hydroxysteroid dehydrogenase (3{beta}-HSD) gene in a Pakistanian female child with the salt-wasting form of 3{Beta}-HSD deficiency congenital adrenal hyperplasia. The etiology for her congenital adrenal hyperplasia was not defined. Although the family history suggested possible 3{beta}-HSd deficiency disorder, suppressed adrenal function caused by excess glucocorticoid therapy in this child at 7 yr of age did not allow hormonal diagnosis. To confirm 3{beta}-HSD deficiency, we sequenced the type II 3{beta}-HSD gene in the patient, her family, and the parents of her deceased paternal cousins. The type II 3{beta}-HSD genemore » region of a putative promotor, exons I, II, III, and IV, and exon-intron boundaries were amplified by PCR and sequenced in all subjects. The DNA sequence of the child revealed a single nucleotide deletion at codon 318 [ACA(Thr){r_arrow}AA] in exon IV in one allele, and two nucleotide deletions at codon 273 [AAA(Lys){r_arrow}A] in exon IV in the other allele. The remaining gene sequences were normal. The codon 318 mutation was found in one allele from the father, brother, and parents of the deceased paternal cousins. The codon 273 mutation was found in one allele of the mother and a sister. These findings confirmed inherited 3{beta}-HSD deficiency in the child caused by the compound heterozygous type II 3{beta}-HSD gene mutation. Both codons at codons 279 and 367, respectively, are predicted to result in an altered and truncated type II 3{beta}-HSD protein, thereby causing salt-wasting 3{beta}-HSD deficiency in the patient. 21 refs., 2 figs., 1 tab.« less

  7. Integration of biological networks and gene expression data using Cytoscape

    PubMed Central

    Cline, Melissa S; Smoot, Michael; Cerami, Ethan; Kuchinsky, Allan; Landys, Nerius; Workman, Chris; Christmas, Rowan; Avila-Campilo, Iliana; Creech, Michael; Gross, Benjamin; Hanspers, Kristina; Isserlin, Ruth; Kelley, Ryan; Killcoyne, Sarah; Lotia, Samad; Maere, Steven; Morris, John; Ono, Keiichiro; Pavlovic, Vuk; Pico, Alexander R; Vailaya, Aditya; Wang, Peng-Liang; Adler, Annette; Conklin, Bruce R; Hood, Leroy; Kuiper, Martin; Sander, Chris; Schmulevich, Ilya; Schwikowski, Benno; Warner, Guy J; Ideker, Trey; Bader, Gary D

    2013-01-01

    Cytoscape is a free software package for visualizing, modeling and analyzing molecular and genetic interaction networks. This protocol explains how to use Cytoscape to analyze the results of mRNA expression profiling, and other functional genomics and proteomics experiments, in the context of an interaction network obtained for genes of interest. Five major steps are described: (i) obtaining a gene or protein network, (ii) displaying the network using layout algorithms, (iii) integrating with gene expression and other functional attributes, (iv) identifying putative complexes and functional modules and (v) identifying enriched Gene Ontology annotations in the network. These steps provide a broad sample of the types of analyses performed by Cytoscape. PMID:17947979

  8. Oxygen Activation at Mononuclear Nonheme Iron Centers: A Superoxo Perspective

    PubMed Central

    Mukherjee, Anusree; Cranswick, Matthew A.; Chakraborti, Mrinmoy; Paine, Tapan K.; Fujisawa, Kiyoshi; Münck, Eckard; Que, Lawrence

    2010-01-01

    Dioxygen activation by iron enzymes is responsible for many metabolically important transformations in biology. Often a high-valent iron-oxo oxidant is proposed to form upon dioxygen activation at a mononuclear nonheme iron center, presumably via intervening iron-superoxo and iron-peroxo species. While iron(IV)-oxo intermediates have been trapped and characterized in enzymes and models, less is known of the putative iron(III)-superoxo species. Utilizing a synthetic model for the 2-oxoglutarate-dependent monoiron enzymes, [(TpiPr2)FeII(O2CC(O)CH3)], we have obtained indirect evidence for the formation of the putative iron(III)-superoxo species, which can undergo one-electron reduction, hydrogen-atom transfer, or conversion to an iron(IV)-oxo species, depending on the reaction conditions. These results demonstrate the various roles the iron(III)-superoxo species can play in the course of dioxygen activation at a nonheme iron center. PMID:20380464

  9. Oxygen activation at mononuclear nonheme iron centers: a superoxo perspective.

    PubMed

    Mukherjee, Anusree; Cranswick, Matthew A; Chakrabarti, Mrinmoy; Paine, Tapan K; Fujisawa, Kiyoshi; Münck, Eckard; Que, Lawrence

    2010-04-19

    Dioxygen (O(2)) activation by iron enzymes is responsible for many metabolically important transformations in biology. Often a high-valent iron oxo oxidant is proposed to form upon O(2) activation at a mononuclear nonheme iron center, presumably via intervening iron superoxo and iron peroxo species. While iron(IV) oxo intermediates have been trapped and characterized in enzymes and models, less is known of the putative iron(III) superoxo species. Utilizing a synthetic model for the 2-oxoglutarate-dependent monoiron enzymes, [(Tp(iPr2))Fe(II)(O(2)CC(O)CH(3))], we have obtained indirect evidence for the formation of the putative iron(III) superoxo species, which can undergo one-electron reduction, hydrogen-atom transfer, or conversion to an iron(IV) oxo species, depending on the reaction conditions. These results demonstrate the various roles that the iron(III) superoxo species can play in the course of O(2) activation at a nonheme iron center.

  10. In vitro transcription activities of Pol IV, Pol V and RDR2 reveal coupling of Pol IV and RDR2 for dsRNA synthesis in plant RNA silencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haag, Jeremy R.; Ream, Thomas S.; Marasco, Michelle

    2012-12-14

    In Arabidopsis, RNA-dependent DNA methylation and transcriptional silencing involves three nuclear RNA polymerases that are biochemically undefined: the presumptive DNA-dependent RNA polymerases, Pol IV and Pol V and the putative RNA-dependent RNA polymerase, RDR2. Here, we demonstrate their RNA polymerase activities in vitro. Unlike Pol II, Pols IV and V require an RNA primer, are insensitive to alpha-amanitin and differ in their ability to displace non-template DNA during transcription. Biogenesis of 24 nt small interfering RNAs (siRNAs) requires both Pol IV and RDR2, which physically associate in vivo. Pol IV does not require RDR2 for activity, but RDR2 is nonfunctionalmore » in the absence of associated Pol IV, suggesting that their coupling explains the channeling of Pol IV transcripts into double-stranded RNAs that are then diced into 24 nt siRNAs.« less

  11. The adherent abilities of Clostridium perfringens strains are critical for the pathogenesis of avian necrotic enteritis.

    PubMed

    Wade, Ben; Keyburn, Anthony L; Haring, Volker; Ford, Mark; Rood, Julian I; Moore, Robert J

    2016-12-25

    Necrotic enteritis of poultry is an emerging disease of substantial economic importance, but aspects of the pathogenesis of this multi-factorial disease are still unclear. We recently demonstrated that the ability of avian strains of the causative bacterium, Clostridium perfringens, to bind to specific collagen types correlated strongly with their virulence and we postulated that binding of the pathogen to collagen types IV and V and gelatin may involve the putative adhesin-encoding gene cnaA, which is found in the VR-10B locus. In this study we have used site-directed mutagenesis to demonstrate that disruption of the cnaA gene leads to a reduction in the expression of the three genes immediately downstream of cnaA and reduced adherence to collagen types IV and V and gelatin. In addition, a cnaA mutant of strain EHE-NE18 was no longer capable of causing necrotic enteritis in a chicken disease induction model and had a significantly reduced ability to colonise the chicken intestinal mucosa. These results were confirmed by generating and analysing a similar mutant in an independent necrotic enteritis causing C. perfringens strain. This study expands our understanding of the mechanisms involved in necrotic enteritis pathogenesis by demonstrating the importance of C. perfringens adherence to extracellular matrix proteins. Copyright © 2016. Published by Elsevier B.V.

  12. Extensive Genetic Diversity Identified among Sporadic Methicillin-Resistant Staphylococcus aureus Isolates Recovered in Irish Hospitals between 2000 and 2012

    PubMed Central

    Kinnevey, Peter M.; Shore, Anna C.; Brennan, Grainne I.; Sullivan, Derek J.; Ehricht, Ralf; Monecke, Stefan

    2014-01-01

    Clonal replacement of predominant nosocomial methicillin-resistant Staphylococcus aureus (MRSA) strains has occurred several times in Ireland during the last 4 decades. However, little is known about sporadically occurring MRSA in Irish hospitals or in other countries. Eighty-eight representative pvl-negative sporadic MRSA isolates recovered in Irish hospitals between 2000 and 2012 were investigated. These yielded unusual pulsed-field gel electrophoresis and antibiogram-resistogram typing patterns distinct from those of the predominant nosocomial MRSA clone, ST22-MRSA-IV, during the study period. Isolates were characterized by spa typing and DNA microarray profiling for multilocus sequence type (MLST) clonal complex (CC) and/or sequence type (ST) and SCCmec type assignment, as well as for detection of virulence and antimicrobial resistance genes. Conventional PCR-based SCCmec subtyping was undertaken when necessary. Extensive diversity was detected, including 38 spa types, 13 MLST-CCs (including 18 STs among 62 isolates assigned to STs), and 25 SCCmec types (including 2 possible novel SCCmec elements and 7 possible novel SCCmec subtypes). Fifty-four MLST-spa-SCCmec type combinations were identified. Overall, 68.5% of isolates were assigned to nosocomial lineages, with ST8-t190-MRSA-IID/IIE ± SCCM1 predominating (17.4%), followed by CC779/ST779-t878-MRSA-ψSCCmec-SCC-SCCCRISPR (7.6%) and CC22/ST22-t032-MRSA-IVh (5.4%). Community-associated clones, including CC1-t127/t386/t2279-MRSA-IV, CC59-t216-MRSA-V, CC8-t008-MRSA-IVa, and CC5-t002/t242-MRSA-IV/V, and putative animal-associated clones, including CC130-t12399-MRSA-XI, ST8-t064-MRSA-IVa, ST398-t011-MRSA-IVa, and CC6-t701-MRSA-V, were also identified. In total, 53.3% and 47.8% of isolates harbored genes for resistance to two or more classes of antimicrobial agents and two or more mobile genetic element-encoded virulence-associated factors, respectively. Effective ongoing surveillance of sporadic nosocomial MRSA is warranted for early detection of emerging clones and reservoirs of virulence, resistance, and SCCmec genes. PMID:24395241

  13. A Gene Transfer Agent and a Dynamic Repertoire of Secretion Systems Hold the Keys to the Explosive Radiation of the Emerging Pathogen Bartonella

    PubMed Central

    Guy, Lionel; Nystedt, Björn; Toft, Christina; Zaremba-Niedzwiedzka, Katarzyna; Berglund, Eva C.; Granberg, Fredrik; Näslund, Kristina; Eriksson, Ann-Sofie; Andersson, Siv G. E.

    2013-01-01

    Gene transfer agents (GTAs) randomly transfer short fragments of a bacterial genome. A novel putative GTA was recently discovered in the mouse-infecting bacterium Bartonella grahamii. Although GTAs are widespread in phylogenetically diverse bacteria, their role in evolution is largely unknown. Here, we present a comparative analysis of 16 Bartonella genomes ranging from 1.4 to 2.6 Mb in size, including six novel genomes from Bartonella isolated from a cow, two moose, two dogs, and a kangaroo. A phylogenetic tree inferred from 428 orthologous core genes indicates that the deadly human pathogen B. bacilliformis is related to the ruminant-adapted clade, rather than being the earliest diverging species in the genus as previously thought. A gene flux analysis identified 12 genes for a GTA and a phage-derived origin of replication as the most conserved innovations. These are located in a region of a few hundred kb that also contains 8 insertions of gene clusters for type III, IV, and V secretion systems, and genes for putatively secreted molecules such as cholera-like toxins. The phylogenies indicate a recent transfer of seven genes in the virB gene cluster for a type IV secretion system from a cat-adapted B. henselae to a dog-adapted B. vinsonii strain. We show that the B. henselae GTA is functional and can transfer genes in vitro. We suggest that the maintenance of the GTA is driven by selection to increase the likelihood of horizontal gene transfer and argue that this process is beneficial at the population level, by facilitating adaptive evolution of the host-adaptation systems and thereby expansion of the host range size. The process counters gene loss and forces all cells to contribute to the production of the GTA and the secreted molecules. The results advance our understanding of the role that GTAs play for the evolution of bacterial genomes. PMID:23555299

  14. A gene transfer agent and a dynamic repertoire of secretion systems hold the keys to the explosive radiation of the emerging pathogen Bartonella.

    PubMed

    Guy, Lionel; Nystedt, Björn; Toft, Christina; Zaremba-Niedzwiedzka, Katarzyna; Berglund, Eva C; Granberg, Fredrik; Näslund, Kristina; Eriksson, Ann-Sofie; Andersson, Siv G E

    2013-03-01

    Gene transfer agents (GTAs) randomly transfer short fragments of a bacterial genome. A novel putative GTA was recently discovered in the mouse-infecting bacterium Bartonella grahamii. Although GTAs are widespread in phylogenetically diverse bacteria, their role in evolution is largely unknown. Here, we present a comparative analysis of 16 Bartonella genomes ranging from 1.4 to 2.6 Mb in size, including six novel genomes from Bartonella isolated from a cow, two moose, two dogs, and a kangaroo. A phylogenetic tree inferred from 428 orthologous core genes indicates that the deadly human pathogen B. bacilliformis is related to the ruminant-adapted clade, rather than being the earliest diverging species in the genus as previously thought. A gene flux analysis identified 12 genes for a GTA and a phage-derived origin of replication as the most conserved innovations. These are located in a region of a few hundred kb that also contains 8 insertions of gene clusters for type III, IV, and V secretion systems, and genes for putatively secreted molecules such as cholera-like toxins. The phylogenies indicate a recent transfer of seven genes in the virB gene cluster for a type IV secretion system from a cat-adapted B. henselae to a dog-adapted B. vinsonii strain. We show that the B. henselae GTA is functional and can transfer genes in vitro. We suggest that the maintenance of the GTA is driven by selection to increase the likelihood of horizontal gene transfer and argue that this process is beneficial at the population level, by facilitating adaptive evolution of the host-adaptation systems and thereby expansion of the host range size. The process counters gene loss and forces all cells to contribute to the production of the GTA and the secreted molecules. The results advance our understanding of the role that GTAs play for the evolution of bacterial genomes.

  15. Lipids during Bufo arenarum oogenesis.

    PubMed

    Bruzzone, Ariana; Buschiazzo, Jorgelina; Alonso, Telma S

    2003-05-01

    The content and composition of phospholipids and triacylglycerols (TAGs) in Bufo arenarum oocytes in stages III and IV of their oogenesis were studied. The total amount of phospholipids in stage IV oocytes is 0.5-fold higher than in stage III oocytes. In both cases, the main phospholipids are phosphatidylcholine (PC) and phosphatidylethanolamine (PE). A striking observation concerns the high level of diphosphatidylglycerol (DPG) in stage III oocytes, which could be indicative of a relatively larger mitochondrial population with respect to other oogenetic stages. A net increase in sphingomyelin content was found during oogenesis. This fact could be related to the role of this phospholipid in the signal transductional pathways. In PC, palmitic (16:0), linoleic (18:2) and oleic (18:1) are the major fatty acids for both types of oocytes, while in PE the main acyl groups are 18:1, 16:0, arachidonic acid (20:4n6) and 18:2. PE is more unsaturated than PC and both phospholipids are more unsaturated in stage III oocytes than in stage IV oocytes. The amount of triacylglycerols is 0.3-fold higher in stage IV oocytes than in stage III oocytes. In both stages, the main fatty acids are 18:2, 18:1 and 16:0. During oogenesis, a significant increase in 18:1 and 18:3n3, and a decrease in 18:2 of TAG were found. The unsaturation index of TAGs from stage IV oocytes is higher than that from stage III oocytes. The TAG increase during oogenesis is consistent with the putative use of these lipids as a source of energy in embryo development.

  16. Non-perturbative String Theory from Water Waves

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iyer, Ramakrishnan; Johnson, Clifford V.; /Southern California U.

    2012-06-14

    We use a combination of a 't Hooft limit and numerical methods to find non-perturbative solutions of exactly solvable string theories, showing that perturbative solutions in different asymptotic regimes are connected by smooth interpolating functions. Our earlier perturbative work showed that a large class of minimal string theories arise as special limits of a Painleve IV hierarchy of string equations that can be derived by a similarity reduction of the dispersive water wave hierarchy of differential equations. The hierarchy of string equations contains new perturbative solutions, some of which were conjectured to be the type IIA and IIB string theoriesmore » coupled to (4, 4k ? 2) superconformal minimal models of type (A, D). Our present paper shows that these new theories have smooth non-perturbative extensions. We also find evidence for putative new string theories that were not apparent in the perturbative analysis.« less

  17. Evolutionary, Molecular and Genetic Analyses of Tic22 Homologues in Arabidopsis thaliana Chloroplasts

    PubMed Central

    Kasmati, Ali Reza; Patel, Ramesh; Ling, Qihua; Karim, Sazzad; Aronsson, Henrik; Jarvis, Paul

    2013-01-01

    The Tic22 protein was previously identified in pea as a putative component of the chloroplast protein import apparatus. It is a peripheral protein of the inner envelope membrane, residing in the intermembrane space. In Arabidopsis, there are two Tic22 homologues, termed atTic22-III and atTic22-IV, both of which are predicted to localize in chloroplasts. These two proteins defined clades that are conserved in all land plants, which appear to have evolved at a similar rates since their separation >400 million years ago, suggesting functional conservation. The atTIC22-IV gene was expressed several-fold more highly than atTIC22-III, but the genes exhibited similar expression profiles and were expressed throughout development. Knockout mutants lacking atTic22-IV were visibly normal, whereas those lacking atTic22-III exhibited moderate chlorosis. Double mutants lacking both isoforms were more strongly chlorotic, particularly during early development, but were viable and fertile. Double-mutant chloroplasts were small and under-developed relative to those in wild type, and displayed inefficient import of precursor proteins. The data indicate that the two Tic22 isoforms act redundantly in chloroplast protein import, and that their function is non-essential but nonetheless required for normal chloroplast biogenesis, particularly during early plant development. PMID:23675512

  18. 5' diversity of human hepatic PXR (NR1I2) transcripts and identification of the major transcription initiation site.

    PubMed

    Kurose, Kouichi; Koyano, Satoru; Ikeda, Shinobu; Tohkin, Masahiro; Hasegawa, Ryuichi; Sawada, Jun-Ichi

    2005-05-01

    The human pregnane X receptor (PXR) is a crucial regulator of the genes encoding several major cytochrome P450 enzymes and transporters, such as CYP3A4 and MDR1, but its own transcriptional regulation remains unclear. To elucidate the transcriptional mechanisms of human PXR gene, we first endeavored to identify the transcription initiation site of human PXR using 5'-RACE. Five types of 5'-variable transcripts (a, b, c, d, and e) with common exon 2 sequence were found, and comparison of these sequences with the genomic sequence suggested that their 5' diversity is derived from initiation by alternative promoters and alternative splicing. None of the exons found in our study contain any new in-frame coding regions. Newly identified introns IVS-a and IVS-b were found to have CT-AC splice sites that do not follow the GT-AG rule of conventional donor and acceptor splice sites. Of the five types of 5' variable transcripts identified, RT-PCR showed that type-a was the major transcript type. Four transcription initiation sites (A-D) for type-a transcript were identified by 5'-RACE using GeneRacer RACE Ready cDNA (human liver) constructed by the oligo-capping method. Putative TATA boxes were located approximately 30 bp upstream from the transcriptional start sites of the major transcript (C) and the longest minor transcript (A) expressed in the human liver. These results indicate that the initiation of transcription of human PXR is more complex than previously reported.

  19. New generic primer system targeting mucosal/genital and cutaneous human papillomaviruses leads to the characterization of HPV 115, a novel Beta-papillomavirus species 3

    PubMed Central

    Chouhy, Diego; Gorosito, Mario; Sánchez, Adriana; Serra, Esteban C; Bergero, Adriana; Bussy, Ramón Fernandez; Giri, Adriana A

    2009-01-01

    We explored the cutaneotropic HPV genetic diversity in 71 subjects from Argentina. New generic primers (CUT) targeting 88 mucosal/cutaneous HPV were designed and compared to FAP primers. Overall, 69 different HPV types/putative types were identified, being 17 of them novel putative types. Phylogenetic analysis of partial L1 sequences grouped 2 novel putative types in the Beta-PV, 14 in the Gamma-PV and 1 in the Mu-PV genera. CUT primers showed broader capacity than FAP primers in detecting different genera/species and novel putative types (p<0.01). Using overlapping PCR, the full-length genome of a Beta-PV putative type was amplified and cloned. The new virus, designated HPV 115, encodes 5 early genes and 2 late genes. Phylogenetic analysis indicated HPV 115 as the most divergent type within the genus Beta-PV species 3. This report is the first providing data on cutaneous HPVs circulating in South America and expands our knowledge of the Papillomaviridae family. PMID:19948351

  20. The Cycle of Schizoaffective Disorder, Cognitive Ability, Alcoholism, and Suicidality

    ERIC Educational Resources Information Center

    Goldstein, Gerald; Haas, Gretchen L.; Pakrashi, Manish; Novero, Ada M.; Luther, James F.

    2006-01-01

    In this study we investigated the putative role of cognitive dysfunction, diagnosis (schizoaffective versus schizophrenia disorder), and alcoholism as risk factors for suicidal behavior among individuals with DSM-IV schizophrenia or schizoaffective disorders. Subjects received cognitive tests and medical records were reviewed for evidence of a…

  1. Sodium-dependent Vitamin C transporter 2 deficiency impairs myelination and remyelination after injury: Roles of collagen and demethylation.

    PubMed

    Röhr, Dominik; Halfter, Hartmut; Schulz, Jörg B; Young, Peter; Gess, Burkhard

    2017-07-01

    Peripheral nerve myelination involves rapid production of tightly bound lipid layers requiring cholesterol biosynthesis and myelin protein expression, but also a collagen-containing extracellular matrix providing mechanical stability. In previous studies, we showed a function of ascorbic acid in peripheral nerve myelination and extracellular matrix formation in adult mice. Here, we sought the mechanism of action of ascorbic acid in peripheral nerve myelination using different paradigms of myelination in vivo and in vitro. We found impaired myelination and reduced collagen expression in Sodium-dependent Vitamin C Transporter 2 heterozygous mice (SVCT2 +/- ) during peripheral nerve development and after peripheral nerve injury. In dorsal root ganglion (DRG) explant cultures, hypo-myelination could be rescued by precoating with different collagen types. The activity of the ascorbic acid-dependent demethylating Ten-eleven-translocation (Tet) enzymes was reduced in ascorbic acid deprived and SVCT2 +/- DRG cultures. Further, in ascorbic acid-deprived DRG cultures, methylation of a CpG island in the collagen alpha1 (IV) and alpha2 (IV) bidirectional promoter region was increased compared to wild-type and ascorbic acid treated controls. Taken together, these results provide further evidence for the function of ascorbic acid in myelination and extracellular matrix formation in peripheral nerves and suggest a putative molecular mechanism of ascorbic acid function in Tet-dependent demethylation of collagen promoters. © 2017 Wiley Periodicals, Inc.

  2. oriTfinder: a web-based tool for the identification of origin of transfers in DNA sequences of bacterial mobile genetic elements.

    PubMed

    Li, Xiaobin; Xie, Yingzhou; Liu, Meng; Tai, Cui; Sun, Jingyong; Deng, Zixin; Ou, Hong-Yu

    2018-05-04

    oriTfinder is a web server that facilitates the rapid identification of the origin of transfer site (oriT) of a conjugative plasmid or chromosome-borne integrative and conjugative element. The utilized back-end database oriTDB was built upon more than one thousand known oriT regions of bacterial mobile genetic elements (MGEs) as well as the known MGE-encoding relaxases and type IV coupling proteins (T4CP). With a combination of similarity searches for the oriTDB-archived oriT nucleotide sequences and the co-localization of the flanking relaxase homologous genes, the oriTfinder can predict the oriT region with high accuracy in the DNA sequence of a bacterial plasmid or chromosome in minutes. The server also detects the other transfer-related modules, including the potential relaxase gene, T4CP gene and the type IV secretion system gene cluster, and the putative genes coding for virulence factors and acquired antibiotic resistance determinants. oriTfinder may contribute to meeting the increasing demands of re-annotations for bacterial conjugative, mobilizable or non-transferable elements and aid in the rapid risk accession of disease-relevant trait dissemination in pathogenic bacteria of interest. oriTfinder is freely available to all users without any login requirement at http://bioinfo-mml.sjtu.edu.cn/oriTfinder.

  3. Frequency and expression of mutacin biosynthesis genes in isolates of Streptococcus mutans with different mutacin-producing phenotypes.

    PubMed

    Kamiya, Regianne Umeko; Höfling, José Francisco; Gonçalves, Reginaldo Bruno

    2008-05-01

    The aim of this study was to analyse the frequency and expression of biosynthesis genes in 47 Streptococcus mutans isolates with different mutacin-producing phenotypes. Detection of the frequency and expression of genes encoding mutacin types I, II, III and IV were carried out by PCR and semi-quantitative RT-PCR, respectively, using primers specific for each type of biosynthesis gene. In addition, a further eight genes encoding putative bacteriocins, designated bsm 283, bsm 299, bsm 423, bsm 1889c, bsm 1892c, bsm 1896, bsm 1906c and bsm 1914, were also screened. There was a high phenotypic diversity; some Streptococcus mutans isolates presented broad antimicrobial spectra against other Streptococcus mutans clinical isolates, including bacteria resistant to common antibiotics, as well as Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis and Streptococcus pyogenes. The expression frequency of the bsm gene was higher than that of the previously characterized mutacins (I-IV). There was no positive correlation between the number of indicator strains inhibited (antimicrobial spectra) and the number of biosynthesis genes expressed (Spearman correlation test, r=-0.03, P>0.05). In conclusion, the high diversity of mutacin-producing phenotypes, associated with high frequency of expression of the biosynthesis genes screened, reveals a broad repertoire of genetic determinants encoding antimicrobial peptides that can act in different combinations.

  4. Cag3 Is a Novel Essential Component of the Helicobacter pylori Cag Type IV Secretion System Outer Membrane Subcomplex ▿ †

    PubMed Central

    Pinto-Santini, Delia M.; Salama, Nina R.

    2009-01-01

    Helicobacter pylori strains harboring the cag pathogenicity island (PAI) have been associated with more severe gastric disease in infected humans. The cag PAI encodes a type IV secretion (T4S) system required for CagA translocation into host cells as well as induction of proinflammatory cytokines, such as interleukin-8 (IL-8). cag PAI genes sharing sequence similarity with T4S components from other bacteria are essential for Cag T4S function. Other cag PAI-encoded genes are also essential for Cag T4S, but lack of sequence-based or structural similarity with genes in existing databases has precluded a functional assignment for the encoded proteins. We have studied the role of one such protein, Cag3 (HP0522), in Cag T4S and determined Cag3 subcellular localization and protein interactions. Cag3 is membrane associated and copurifies with predicted inner and outer membrane Cag T4S components that are essential for Cag T4S as well as putative accessory factors. Coimmunoprecipitation and cross-linking experiments revealed specific interactions with HpVirB7 and CagM, suggesting Cag3 is a new component of the Cag T4S outer membrane subcomplex. Finally, lack of Cag3 lowers HpVirB7 steady-state levels, further indicating Cag3 makes a subcomplex with this protein. PMID:19801411

  5. Suicide inactivation of rat liver aryl sulfotransferase IV (AST IV) by the sulfuric acid ester of N-hydroxy-2-acetylaminofluorene (NOH-AAF)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ringer, D.P.; Norton, T.R.; Self, R.R.

    Rat liver NOH-AAf sulfotransferase activity is mediated by AST IV and causes the bioactivation of NOH-AAF to a highly reactive, mutagenic sulfuric acid ester form which putatively has a role in inducing liver cancer. Unexpectedly, AAF has been found to decrease liver NOH-AAF sulfotransferase activity in dietary protocols used to induce hepatocarcinogenesis. The authors have thus examined reaction-product, suicide inactivation of AST IV as a possible mechanism for the loss in sulfotransferase activity. In initial experiments, purified AST IV was found to undergo a PAPS-dependent binding with ({sup 14}C)-NOH-AAF. Alkaline hydrolysis and C18-HPLC analysis of the AST IV:AAF conjugates revealedmore » that linkage primarily involved cysteine and methionine residues of AST IV. Experiments testing the effect of pretreatment of AST IV with NOH-AAF upon subsequent assay of sulfotransferase activity, showed that there was a NOH-AAF and PAPS dependent loss in AST IV sulfotransferase activity. These results demonstrate the highly reactive, sulfuric acid ester of NOH-AAF can covalently link with AST IV causing suicide inactivation of the enzyme, and suggests that it deserves consideration as an in vivo mechanism for loss of NOH-AAF sulfotransferase activity.« less

  6. Maturation experiments reveal bias in the fossil record of feathers

    NASA Astrophysics Data System (ADS)

    McNamara, Maria; Field, Daniel

    2016-04-01

    The evolutionary history of birds and feathers is a major focus in palaeobiology and evolutionary biology. Diverse exceptionally preserved birds and feathered dinosaurs from Jurassic and Cretaceous biotas in China have provided pivotal evidence of early feathers and feather-like integumentary features, but the true nature of many of these fossil soft tissues is still debated. Interpretations of feathers at intermediate developmental stages (i.e. Stages II, III and IV) and of simple quill-like (Stage I) feathers are particularly controversial. This reflects key uncertainties relating to the preservation potential of feathers at different evolutionary-developmental stages, and to the relative preservation potential of diagnostic features of Stage I feathers and hair. To resolve these issues, we used high pressure-high temperature autoclave experiments to simulate the effects of burial on modern feathers from the Black Coucal (Centropus grilii) and Common Starling (Sturnus vulgaris), and on human hair. Our results reveal profound differences in the recalcitrance of feathers of different types during maturation: Stage I and Stage V feathers retain diagnostic morphological and ultrastructural details following maturation, whereas other feather types do not. Further, the morphology and arrangement of certain ultrastructural features diagnostic of Stages III and IV, e.g. barbules, are preferentially lost during maturation. These results indicate a pervasive bias in the fossil record of feathers, whereby preservation of feathers at Stages I and V is favored. Critical stages in the evolution of feathers, i.e. Stages II, III and IV, are less likely to be preserved and more likely to be misinterpreted as feathers at earlier developmental stages. Our discovery has major implications for our understanding of the fidelity of the fossil record of feathers and provides a framework for testing the significance of putative examples of fossil feathers at different developmental stages.

  7. Genome-Wide Identification and Expression Analysis of Homeodomain Leucine Zipper Subfamily IV (HDZ IV) Gene Family from Musa accuminata

    PubMed Central

    Pandey, Ashutosh; Misra, Prashant; Alok, Anshu; Kaur, Navneet; Sharma, Shivani; Lakhwani, Deepika; Asif, Mehar H.; Tiwari, Siddharth; Trivedi, Prabodh K.

    2016-01-01

    The homeodomain zipper family (HD-ZIP) of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV) has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV encoding genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana, and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV encoding genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV encoding genes and for their possible use in the banana improvement programs. PMID:26870050

  8. Connection between nitrogen and manganese cycles revealed by transcriptomic analysis in Shewanella algae C6G3

    NASA Astrophysics Data System (ADS)

    Michotey, V.; Aigle, A.; Armougom, F.; Mejean, V.; Guasco, S.; Bonin, P.

    2016-02-01

    In sedimentary systems, the repartition of terminal electron-accepting molecules is often stratified on a permanent or seasonal basis. Just below to oxic zone, the suboxic one is characterized by high concentrations of oxidized inorganic compounds such as nitrate, manganese oxides (MnIII/IV) and iron oxides that are in close vicinity. Several studies have reported unexpected anaerobic nitrite/nitrate production at the expense of ammonium mediated by MnIII/IV, however this transient processes is difficult to discern and poorly understood. In the frame of this study, genes organization of nitrate and MnIII/IV respiration was investigated in S.algae. Additional genes were identified in S. algae compare to S. oneidensis: genes coding for nitrate and nitrite reductase (napA-a and nrfA-2) and an OMC protein (mtrH). In contrast to S. oneidensis, an anaerobic transitory nitrite accumulation at the expense of ammonium was observed in S. algae during growth with MnIII/IV, concomitantly with expression of nitrate/nitrite reductase genes (napA, nrfA, nrfA-2). Among the hypothesis explaining this data, the potential putative expression of unidentified gene able to perform ammonium oxidation was not observed on the global transcriptional level, however several signs of oxidative stress were detected and the existence of a secondary reaction generated by a putative oxidative s could not be excluded. Another option could be the action of reverse reaction by an enzyme such as NrfA or NrfA-2 due to the electron flow equilibrium. Whatever the electron acceptor (Nitrate/ MnIII/IV), the unexpected expression level of of omcA, mtrF, mtrH, mtrC was observed and peaked at the end of the exponential phase. Different expression patterns of the omc genes were observed depending on electron acceptor and growth phase. Only mtrF-2 gene was specifically expressed in Mn(III/IV) condition. Nitrate and Mn(III/IV) respirations seem connected at physiological as well as at transcriptional level

  9. Multilocus sequence typing (MLST) for lineage assignment and high resolution diversity studies in Trypanosoma cruzi.

    PubMed

    Yeo, Matthew; Mauricio, Isabel L; Messenger, Louisa A; Lewis, Michael D; Llewellyn, Martin S; Acosta, Nidia; Bhattacharyya, Tapan; Diosque, Patricio; Carrasco, Hernan J; Miles, Michael A

    2011-06-01

    Multilocus sequence typing (MLST) is a powerful and highly discriminatory method for analysing pathogen population structure and epidemiology. Trypanosoma cruzi, the protozoan agent of American trypanosomiasis (Chagas disease), has remarkable genetic and ecological diversity. A standardised MLST protocol that is suitable for assignment of T. cruzi isolates to genetic lineage and for higher resolution diversity studies has not been developed. We have sequenced and diplotyped nine single copy housekeeping genes and assessed their value as part of a systematic MLST scheme for T. cruzi. A minimum panel of four MLST targets (Met-III, RB19, TcGPXII, and DHFR-TS) was shown to provide unambiguous assignment of isolates to the six known T. cruzi lineages (Discrete Typing Units, DTUs TcI-TcVI). In addition, we recommend six MLST targets (Met-II, Met-III, RB19, TcMPX, DHFR-TS, and TR) for more in depth diversity studies on the basis that diploid sequence typing (DST) with this expanded panel distinguished 38 out of 39 reference isolates. Phylogenetic analysis implies a subdivision between North and South American TcIV isolates. Single Nucleotide Polymorphism (SNP) data revealed high levels of heterozygosity among DTUs TcI, TcIII, TcIV and, for three targets, putative corresponding homozygous and heterozygous loci within DTUs TcI and TcIII. Furthermore, individual gene trees gave incongruent topologies at inter- and intra-DTU levels, inconsistent with a model of strict clonality. We demonstrate the value of systematic MLST diplotyping for describing inter-DTU relationships and for higher resolution diversity studies of T. cruzi, including presence of recombination events. The high levels of heterozygosity will facilitate future population genetics analysis based on MLST haplotypes.

  10. New insights into Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis.

    PubMed

    Smith, Michael G; Gianoulis, Tara A; Pukatzki, Stefan; Mekalanos, John J; Ornston, L Nicholas; Gerstein, Mark; Snyder, Michael

    2007-03-01

    Acinetobacter baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections including pneumonia, meningitis, septicemia, and urinary tract infections. We explored the pathogenic content of this harmful pathogen using a combination of DNA sequencing and insertional mutagenesis. The genome of this organism was sequenced using a strategy involving high-density pyrosequencing, a novel, rapid method of high-throughput sequencing. Excluding the rDNA repeats, the assembled genome is 3,976,746 base pairs (bp) and has 3830 ORFs. A significant fraction of ORFs (17.2%) are located in 28 putative alien islands, indicating that the genome has acquired a large amount of foreign DNA. Consistent with its role in pathogenesis, a remarkable number of the islands (16) contain genes implicated in virulence, indicating the organism devotes a considerable portion of its genes to pathogenesis. The largest island contains elements homologous to the Legionella/Coxiella Type IV secretion apparatus. Type IV secretion systems have been demonstrated to be important for virulence in other organisms and thus are likely to help mediate pathogenesis of A. baumannii. Insertional mutagenesis generated avirulent isolates of A. baumannii and verified that six of the islands contain virulence genes, including two novel islands containing genes that lacked homology with others in the databases. The DNA sequencing approach described in this study allows the rapid elucidation of the DNA sequence of any microbe and, when combined with genetic screens, can identify many novel genes important for microbial pathogenesis.

  11. Type IV Effector Proteins Involved in the Medicago-Sinorhizobium Symbiosis.

    PubMed

    Nelson, Matthew S; Chun, Chan Lan; Sadowsky, Michael J

    2017-01-01

    In this study, we investigated genetic elements of the type IV secretion system (T4SS) found in Sinorhizobium spp. and the role they play in symbiosis. Sinorhizobium meliloti and S. medicae each contain a putative T4SS similar to that used by Agrobacterium tumefaciens during pathogenesis. The Cre reporter assay for translocation system was used to validate potential effector proteins. Both S. meliloti and S. medicae contained the effector protein TfeA, which was translocated into the host plant. Sequence analysis revealed the presence of a nod box involved in transcriptional activation of symbiosis-related genes, upstream of the transcriptional regulator (virG) in the Sinorhizobium T4SS. Replicate quantitative reverse transcription-polymerase chain reaction analyses indicated that luteolin, released by roots and seeds of Medicago truncatula, upregulated transcription of tfeA and virG. Mutations in the T4SS apparatus or tfeA alone resulted in reduced numbers of nodules formed on M. truncatula genotypes. In addition, S. meliloti KH46c, which contains a deletion in the T4SS, was less competitive for nodule formation when coinoculated with an equal number of cells of the wild-type strain. To our knowledge, TfeA is the first T4SS effector protein identified in Sinorhizobium spp. Our results indicate that Sinorhizobium i) uses a T4SS during initiation of symbiosis with Medicago spp., and ii) alters Medicago cells in planta during symbiosis. This study also offers additional bioinformatic evidence that several different rhizobial species may use the T4SS in symbiosis with other legumes.

  12. Accurate prediction of bacterial type IV secreted effectors using amino acid composition and PSSM profiles.

    PubMed

    Zou, Lingyun; Nan, Chonghan; Hu, Fuquan

    2013-12-15

    Various human pathogens secret effector proteins into hosts cells via the type IV secretion system (T4SS). These proteins play important roles in the interaction between bacteria and hosts. Computational methods for T4SS effector prediction have been developed for screening experimental targets in several isolated bacterial species; however, widely applicable prediction approaches are still unavailable In this work, four types of distinctive features, namely, amino acid composition, dipeptide composition, .position-specific scoring matrix composition and auto covariance transformation of position-specific scoring matrix, were calculated from primary sequences. A classifier, T4EffPred, was developed using the support vector machine with these features and their different combinations for effector prediction. Various theoretical tests were performed in a newly established dataset, and the results were measured with four indexes. We demonstrated that T4EffPred can discriminate IVA and IVB effectors in benchmark datasets with positive rates of 76.7% and 89.7%, respectively. The overall accuracy of 95.9% shows that the present method is accurate for distinguishing the T4SS effector in unidentified sequences. A classifier ensemble was designed to synthesize all single classifiers. Notable performance improvement was observed using this ensemble system in benchmark tests. To demonstrate the model's application, a genome-scale prediction of effectors was performed in Bartonella henselae, an important zoonotic pathogen. A number of putative candidates were distinguished. A web server implementing the prediction method and the source code are both available at http://bioinfo.tmmu.edu.cn/T4EffPred.

  13. Impact of Insulin Degrading Enzyme and Neprilysin in Alzheimer's Disease Biology: Characterization of Putative Cognates for Therapeutic Applications.

    PubMed

    Jha, Niraj Kumar; Jha, Saurabh Kumar; Kumar, Dhiraj; Kejriwal, Noopur; Sharma, Renu; Ambasta, Rashmi K; Kumar, Pravir

    2015-01-01

    Alzheimer's disease (AD) is a neurodegenerative process primarily characterized by amyloid-β (Aβ) agglomeration, neuroinflammation, and cognitive dysfunction. The prominent cause for dementia is the deposition of Aβ plaques and tau-neurofibrillary tangles that hamper the neuronal organization and function. Aβ pathology further affects numerous signaling cascades that disturb the neuronal homeostasis. For instance, Aβ deposition is responsible for altered expression of insulin encoding genes that lead to insulin resistance, and thereby affecting insulin signaling pathway and glucose metabolism in the brain. As a result, the common pathology of insulin resistance between Type-2 diabetes mellitus and AD has led AD to be proposed as a form of diabetes and termed 'Type-3 diabetes'. Since accumulation of Aβ is the prominent cause of neuronal toxicity in AD, its clearance is the prime requisite for therapeutic prospects. This purpose is expertly fulfilled by the potential role of Aβ degrading enzymes such as insulin degrading enzyme (IDE) and Neprilysin (NEP). Therefore, their molecular study is important to uncover the proteolytic and regulatory mechanism of Aβ degradation. Herein, (i) In silico sequential and structural analysis of IDE and NEP has been performed to identify the molecular entities for proteolytic degradation of Aβ in the AD brain, (ii) to analyze their catalytic site to demonstrate the enzymatic action played by IDE and NEP, (iii) to identify their structural homologues that could behave as putative partners of IDE and NEP with similar catalytic action and (iv) to illustrate various IDE- and NEP-mediated therapeutic approaches and factors for clearing Aβ in AD.

  14. Histoplasma capsulatum encodes a dipeptidyl peptidase active against the mammalian immunoregulatory peptide, substance P.

    PubMed

    Cooper, Kendal G; Zarnowski, Robert; Woods, Jon P

    2009-01-01

    The pathogenic fungus Histoplasma capsulatum secretes dipeptidyl peptidase (Dpp) IV enzyme activity and has two putative DPPIV homologs (HcDPPIVA and HcDPPIVB). We previously showed that HcDPPIVB is the gene responsible for the majority of secreted DppIV activity in H. capsulatum culture supernatant, while we could not detect any functional contribution from HcDPPIVA. In order to determine whether HcDPPIVA encodes a functional DppIV enzyme, we expressed HcDPPIVA in Pichia pastoris and purified the recombinant protein. The recombinant enzyme cleaved synthetic DppIV substrates and had similar biochemical properties to other described DppIV enzymes, with temperature and pH optima of 42 degrees C and 8, respectively. Recombinant HcDppIVA cleaved the host immunoregulatory peptide substance P, indicating the enzyme has the potential to affect the immune response during infection. Expression of HcDPPIVA under heterologous regulatory sequences in H. capsulatum resulted in increased secreted DppIV activity, indicating that the encoded protein can be expressed and secreted by its native organism. However, HcDPPIVA was not required for virulence in a murine model of histoplasmosis. This work reports a fungal enzyme that can function to cleave the immunomodulatory host peptide substance P.

  15. Genetic and molecular characterization of a gene encoding a wide specificity purine permease of Aspergillus nidulans reveals a novel family of transporters conserved in prokaryotes and eukaryotes.

    PubMed

    Diallinas, G; Gorfinkiel, L; Arst, H N; Cecchetto, G; Scazzocchio, C

    1995-04-14

    In Aspergillus nidulans, loss-of-function mutations in the uapA and azgA genes, encoding the major uric acid-xanthine and hypoxanthine-adenine-guanine permeases, respectively, result in impaired utilization of these purines as sole nitrogen sources. The residual growth of the mutant strains is due to the activity of a broad specificity purine permease. We have identified uapC, the gene coding for this third permease through the isolation of both gain-of-function and loss-of-function mutations. Uptake studies with wild-type and mutant strains confirmed the genetic analysis and showed that the UapC protein contributes 30% and 8-10% to uric acid and hypoxanthine transport rates, respectively. The uapC gene was cloned, its expression studied, its sequence and transcript map established, and the sequence of its putative product analyzed. uapC message accumulation is: (i) weakly induced by 2-thiouric acid; (ii) repressed by ammonium; (iii) dependent on functional uaY and areA regulatory gene products (mediating uric acid induction and nitrogen metabolite repression, respectively); (iv) increased by uapC gain-of-function mutations which specifically, but partially, suppress a leucine to valine mutation in the zinc finger of the protein coded by the areA gene. The putative uapC gene product is a highly hydrophobic protein of 580 amino acids (M(r) = 61,251) including 12-14 putative transmembrane segments. The UapC protein is highly similar (58% identity) to the UapA permease and significantly similar (23-34% identity) to a number of bacterial transporters. Comparisons of the sequences and hydropathy profiles of members of this novel family of transporters yield insights into their structure, functionally important residues, and possible evolutionary relationships.

  16. The Role of Ventral Tegmental Area Gamma-Aminobutyric Acid in Chronic Neuropathic Pain after Spinal Cord Injury in Rats.

    PubMed

    Ko, Moon Yi; Jang, Eun Young; Lee, June Yeon; Kim, Soo Phil; Whang, Sung Hun; Lee, Bong Hyo; Kim, Hee Young; Yang, Chae Ha; Cho, Hee Jung; Gwak, Young S

    2018-04-20

    Spinal cord injury (SCI) frequently results in chronic neuropathic pain (CNP). However, the understanding of brain neural circuits in CNP modulation is unclear. The present study examined the changes of ventral tegmental area (VTA) putative GABAergic and dopaminergic neuronal activity with CNP attenuation in rats. SCI was established by T10 clip compression injury (35 g, 1 min) in rats, and neuropathic pain behaviors, in vivo extracellular single-cell recording of putative VTA gamma-aminobutyric acid (GABA)/dopamine neurons, extracellular GABA level, glutamic acid decarboxylase (GAD), and vesicular GABA transporters (VGATs) were measured in the VTA, respectively. The results revealed that extracellular GABA level was significantly increased in the CNP group (50.5 ± 18.9 nM) compared to the sham control group (10.2 ± 1.7 nM). In addition, expression of GAD 65/67 , c-Fos, and VGAT exhibited significant increases in the SCI groups compared to the sham control group. With regard to neuropathic pain behaviors, spontaneous pain measured by ultrasound vocalizations (USVs) and evoked pain measured by paw withdrawal thresholds showed significant alteration, which was reversed by intravenous (i.v.) administration of morphine (0.5-5.0 mg/kg). With regard to in vivo electrophysiology, VTA putative GABAergic neuronal activity (13.6 ± 1.7 spikes/sec) and putative dopaminergic neuronal activity (2.4 ± 0.8 spikes/sec) were increased and decreased, respectively, in the SCI group compared to the sham control group. These neuronal activities were reversed by i.v. administration of morphine. The present study suggests that chronic increase of GABAergic neuronal activity suppresses dopaminergic neuronal activity in the VTA and is responsible for negative emotion and motivation for attenuation of SCI-induced CNP.

  17. Stimulus selectivity and response latency in putative inhibitory and excitatory neurons of the primate inferior temporal cortex

    PubMed Central

    Mruczek, Ryan E. B.

    2012-01-01

    The cerebral cortex is composed of many distinct classes of neurons. Numerous studies have demonstrated corresponding differences in neuronal properties across cell types, but these comparisons have largely been limited to conditions outside of awake, behaving animals. Thus the functional role of the various cell types is not well understood. Here, we investigate differences in the functional properties of two widespread and broad classes of cells in inferior temporal cortex of macaque monkeys: inhibitory interneurons and excitatory projection cells. Cells were classified as putative inhibitory or putative excitatory neurons on the basis of their extracellular waveform characteristics (e.g., spike duration). Consistent with previous intracellular recordings in cortical slices, putative inhibitory neurons had higher spontaneous firing rates and higher stimulus-evoked firing rates than putative excitatory neurons. Additionally, putative excitatory neurons were more susceptible to spike waveform adaptation following very short interspike intervals. Finally, we compared two functional properties of each neuron's stimulus-evoked response: stimulus selectivity and response latency. First, putative excitatory neurons showed stronger stimulus selectivity compared with putative inhibitory neurons. Second, putative inhibitory neurons had shorter response latencies compared with putative excitatory neurons. Selectivity differences were maintained and latency differences were enhanced during a visual search task emulating more natural viewing conditions. Our results suggest that short-latency inhibitory responses are likely to sculpt visual processing in excitatory neurons, yielding a sparser visual representation. PMID:22933717

  18. Preferential Representation of Past Outcome Information and Future Choice Behavior by Putative Inhibitory Interneurons Rather Than Putative Pyramidal Neurons in the Primate Dorsal Anterior Cingulate Cortex.

    PubMed

    Kawai, Takashi; Yamada, Hiroshi; Sato, Nobuya; Takada, Masahiko; Matsumoto, Masayuki

    2018-05-02

    The dorsal anterior cingulate cortex (dACC) plays crucial roles in monitoring the outcome of a choice and adjusting a subsequent choice behavior based on the outcome information. In the present study, we investigated how different types of dACC neurons, that is, putative pyramidal neurons and putative inhibitory interneurons, contribute to these processes. We analyzed single-unit database obtained from the dACC in monkeys performing a reversal learning task. The monkey was required to adjust choice behavior from past outcome experiences. Depending on their action potential waveforms, the recorded neurons were classified into putative pyramidal neurons and putative inhibitory interneurons. We found that these neurons do not equally contribute to outcome monitoring and behavioral adjustment. Although both neuron types evenly responded to the current outcome, a larger proportion of putative inhibitory interneurons than putative pyramidal neurons stored the information about the past outcome. The putative inhibitory interneurons further represented choice-related signals more frequently, such as whether the monkey would shift the last choice to an alternative at the next choice opportunity. Our findings suggest that putative inhibitory interneurons, which are thought not to project to brain areas outside the dACC, preferentially transmit signals that would adjust choice behavior based on past outcome experiences.

  19. Fire Interest and Antisociality as Risk Factors in the Severity and Persistence of Juvenile Firesetting

    ERIC Educational Resources Information Center

    MacKay, Sherri; Henderson, Joanna; Del Bove, Giannetta; Marton, Peter; Warling, Diane; Root, Carol

    2006-01-01

    Objective: In the DSM-IV-TR, firesetting is included as a criterion for the diagnoses of conduct disorder and pyromania. The link between firesetting and antisocial behavior is well established in the empirical literature. Although theoretical models of firesetting often include fire interest as a putative risk factor, there is little research on…

  20. Histone H1 functions as a stimulatory factor in backup pathways of NHEJ

    PubMed Central

    Rosidi, Bustanur; Wang, Minli; Wu, Wenqi; Sharma, Aparna; Wang, Huichen; Iliakis, George

    2008-01-01

    DNA double-strand breaks (DSBs) induced in the genome of higher eukaryotes by ionizing radiation (IR) are predominantly removed by two pathways of non-homologous end-joining (NHEJ) termed D-NHEJ and B-NHEJ. While D-NHEJ depends on the activities of the DNA-dependent protein kinase (DNA-PK) and DNA ligase IV/XRCC4/XLF, B-NHEJ utilizes, at least partly, DNA ligase III/XRCC1 and PARP-1. Using in vitro end-joining assays and protein fractionation protocols similar to those previously applied for the characterization of DNA ligase III as an end-joining factor, we identify here histone H1 as an additional putative NHEJ factor. H1 strongly enhances DNA-end joining and shifts the product spectrum from circles to multimers. While H1 enhances the DNA-end-joining activities of both DNA Ligase IV and DNA Ligase III, the effect on ligase III is significantly stronger. Histone H1 also enhances the activity of PARP-1. Since histone H1 has been shown to counteract D-NHEJ, these observations and the known functions of the protein identify it as a putative alignment factor operating preferentially within B-NHEJ. PMID:18250087

  1. pA506, a Conjugative Plasmid of the Plant Epiphyte Pseudomonas fluorescens A506

    PubMed Central

    Stockwell, Virginia O.; Davis, Edward W.; Carey, Alyssa; Shaffer, Brenda T.; Mavrodi, Dmitri V.; Hassan, Karl A.; Hockett, Kevin; Thomashow, Linda S.; Paulsen, Ian T.

    2013-01-01

    Conjugative plasmids are known to facilitate the acquisition and dispersal of genes contributing to the fitness of Pseudomonas spp. Here, we report the characterization of pA506, the 57-kb conjugative plasmid of Pseudomonas fluorescens A506, a plant epiphyte used in the United States for the biological control of fire blight disease of pear and apple. Twenty-nine of the 67 open reading frames (ORFs) of pA506 have putative functions in conjugation, including a type IV secretion system related to that of MOBP6 family plasmids and a gene cluster for type IV pili. We demonstrate that pA506 is self-transmissible via conjugation between A506 and strains of Pseudomonas spp. or the Enterobacteriaceae. The origin of vegetative replication (oriV) of pA506 is typical of those in pPT23A family plasmids, which are present in many pathovars of Pseudomonas syringae, but pA506 lacks repA, a defining locus for pPT23A plasmids, and has a novel partitioning region. We selected a plasmid-cured derivative of A506 and compared it to the wild type to identify plasmid-encoded phenotypes. pA506 conferred UV resistance, presumably due to the plasmid-borne rulAB genes, but did not influence epiphytic fitness of A506 on pear or apple blossoms in the field. pA506 does not appear to confer resistance to antibiotics or other toxic elements. Based on the conjugative nature of pA506 and the large number of its genes that are shared with plasmids from diverse groups of environmental bacteria, the plasmid is likely to serve as a vehicle for genetic exchange between A506 and its coinhabitants on plant surfaces. PMID:23811504

  2. A putative hybrid swarm within Oonopsis foliosa (Asteraceae: Astereae)

    USGS Publications Warehouse

    Hughes, J.F.; Brown, G.K.

    2004-01-01

    Oo??nopsis foliosa var. foliosa and var. monocephala are endemic to short-grass steppe of southeastern Colorado and until recently were considered geographically disjunct. The only known qualitative feature separating these 2 varieties is floral head type; var. foliosa has radiate heads, whereas var. monocephala heads are discoid. Sympatry between these varieties is restricted to a small area in which a range of parental types and intermediate head morphologies is observed. We used distribution mapping, morphometric analyses, chromosome cytology, and pollen stainability to characterize the sympatric zone. Morphometrics confirms that the only discrete difference between var. foliosa and var. monocephala is radiate versus discoid heads, respectively. The outer florets of putative hybrid individuals ranged from conspicuously elongated yet radially symmetric disc-floret corollas, to elongated radially asymmetric bilabiate- or deeply cleft corollas, to stunted ray florets with appendages remnant of corolla lobes. Chromosome cytology of pollen mother cells from both putative parental varieties and a series of intermediate morphological types collected at the sympatric zone reveal evidence of translocation heterozygosity. Pollen stainability shows no significant differences in viability between the parental varieties and putative hybrids. The restricted distribution of putative hybrids to a narrow zone of sympatry between the parental types and the presence of meiotic chromosome-pairing anomalies in these intermediate plants are consistent with a hybrid origin. The high stainability of putative-hybrid pollen adds to a growing body of evidence that hybrids are not universally unfit.

  3. The nature of electron acceptor (MnIV/NO3) triggers differential expression of genes associated with stress and ammonium limitation responses in Shewanella algae C6G3.

    PubMed

    Aigle, Axel; Bonin, Patricia; -Nunez, Nicolas Fernandez; Loriod, Béatrice; Guasco, Sophie; Bergon, Aurélie; Armougom, Fabrice; Iobbi-Nivol, Chantal; Imbert, Jean; Michotey, Valérie

    2018-03-16

    Shewanella algae C6G3 can reduce dissimilatively nitrate into ammonium and manganese-oxide (MnIV) into MnII. It has the unusual ability to produce anaerobically nitrite from ammonium in the presence of MnIV. To gain insight into their metabolic capabilities, global mRNA expression patterns were investigated by RNA-seq and qRT-PCR in cells growing with lactate and ammonium as carbon and nitrogen sources and with either MnIV or nitrate as electron acceptors. Gene exhibiting higher expression levels in the presence of MnIV belonged to functional categories of carbohydrate, coenzyme, lipid metabolisms and inorganic ion transport. Comparative transcriptomic pattern between MnIV and NO3 revealed that the strain presented an ammonium limitation status with MnIV, despite the presence of non-limiting concentration of ammonium under both culture conditions. In addition, in presence of MnIV, ntrB/nrtC regulators, ammonium channel, nitrogen regulatory protein P-II, glutamine synthetase and asparagine synthetase glutamine dependent genes were over-represented. Under nitrate condition, the expression of genes involved in the synthesis of several amino acids was increased. Finally, expression level of genes associated with the general stress response was also amplified and among them, katE, a putative catalase/peroxidase present on several Shewanella genomes, was highly expressed with a relative median value higher in MnIV condition.

  4. Prospective Cohort Study of Enterotoxigenic Escherichia coli Infections in Argentinean Children

    PubMed Central

    Viboud, Gloria I.; Jouve, Mabel J.; Binsztein, Norma; Vergara, Marta; Rivas, Marta; Quiroga, Marina; Svennerholm, Ann-Mari

    1999-01-01

    In a follow-up study, enterotoxigenic Escherichia coli (ETEC) infections in 145 children from two communities located in northeastern Argentina were monitored for 2 years. The occurrence of diarrhea was monitored by weekly household visits. Of 730 fecal specimens collected, 137 (19%) corresponded to diarrheal episodes. ETEC was isolated from a significantly higher proportion of symptomatic (18.3%) than asymptomatic (13.3%) children (P = 0.04541). Individuals of up to 24 months of age were found to have a higher risk of developing ETEC diarrhea than older children (odds ratio [OR], 3.872; P = 0.00021). When the toxin profiles were considered, only heat stable enterotoxin (ST)-producing ETEC was directly associated with diarrhea (P = 0.00035). Fifty-five percent of the ETEC isolated from symptomatic children and 19% of the ETEC isolated from asymptomatic children expressed one of the colonization factors (CFs) investigated, i.e., CF antigen I (CFA/I), CFA/II, CFA/III, and CFA/IV; coli surface antigens CS7 and CS17; and putative CFs PCFO159, PCFO166, and PCFO20, indicating a clear association between diarrhea and ETEC strains that carry these factors (P = 0.0000034). The most frequently identified CFs were CFA/IV (16%), CFA/I (10%), and CS17 (9%). CFs were mostly associated with ETEC strains that produce ST and both heat-labile enterotoxin and ST. Logistic regression analysis, applied to remove confounding effects, revealed that the expression of CFs was associated with illness independently of the toxin type (OR, 4.81; P = 0.0003). When each CF was considered separately, CS17 was the only factor independently associated with illness (OR, 16.6; P = 0.0151). Most CFs (the exception was CFA/IV) fell within a limited array of serotypes, while the CF-negative isolates belonged to many different O:H types. These results demonstrate that some CFs are risk factors for the development of ETEC diarrhea. PMID:10449460

  5. The autoinducer synthase LqsA and putative sensor kinase LqsS regulate phagocyte interactions, extracellular filaments and a genomic island of Legionella pneumophila.

    PubMed

    Tiaden, André; Spirig, Thomas; Sahr, Tobias; Wälti, Martin A; Boucke, Karin; Buchrieser, Carmen; Hilbi, Hubert

    2010-05-01

    The amoebae-resistant opportunistic pathogen Legionella pneumophila employs a biphasic life cycle to replicate in host cells and spread to new niches. Upon entering the stationary growth phase, the bacteria switch to a transmissive (virulent) state, which involves a complex regulatory network including the lqs gene cluster (lqsA-lqsR-hdeD-lqsS). LqsR is a putative response regulator that promotes host-pathogen interactions and represses replication. The autoinducer synthase LqsA catalyses the production of the diffusible signalling molecule 3-hydroxypentadecan-4-one (LAI-1) that is presumably recognized by the sensor kinase LqsS. Here, we analysed L. pneumophila strains lacking lqsA or lqsS. Compared with wild-type L. pneumophila, the DeltalqsS strain was more salt-resistant and impaired for the Icm/Dot type IV secretion system-dependent uptake by phagocytes. Legionella pneumophila strains lacking lqsS, lqsR or the alternative sigma factor rpoS sedimented more slowly and produced extracellular filaments. Deletion of lqsA moderately reduced the uptake of L. pneumophila by phagocytes, and the defect was complemented by expressing lqsA in trans. Unexpectedly, the overexpression of lqsA also restored the virulence defect and reduced filament production of L. pneumophila mutant strains lacking lqsS or lqsR, but not the phenotypes of strains lacking rpoS or icmT. These results suggest that LqsA products also signal through sensors not encoded by the lqs gene cluster. A transcriptome analysis of the DeltalqsA and DeltalqsS mutant strains revealed that under the conditions tested, lqsA regulated only few genes, whereas lqsS upregulated the expression of 93 genes at least twofold. These include 52 genes clustered in a 133 kb high plasticity genomic island, which is flanked by putative DNA-mobilizing genes and encodes multiple metal ion efflux pumps. Upon overexpression of lqsA, a cluster of 19 genes in the genomic island was also upregulated, suggesting that LqsA and LqsS participate in the same regulatory circuit.

  6. Histoplasma capsulatum Encodes a Dipeptidyl Peptidase Active against the Mammalian Immunoregulatory Peptide, Substance P

    PubMed Central

    Cooper, Kendal G.; Zarnowski, Robert; Woods, Jon P.

    2009-01-01

    The pathogenic fungus Histoplasma capsulatum secretes dipeptidyl peptidase (Dpp) IV enzyme activity and has two putative DPPIV homologs (HcDPPIVA and HcDPPIVB). We previously showed that HcDPPIVB is the gene responsible for the majority of secreted DppIV activity in H. capsulatum culture supernatant, while we could not detect any functional contribution from HcDPPIVA. In order to determine whether HcDPPIVA encodes a functional DppIV enzyme, we expressed HcDPPIVA in Pichia pastoris and purified the recombinant protein. The recombinant enzyme cleaved synthetic DppIV substrates and had similar biochemical properties to other described DppIV enzymes, with temperature and pH optima of 42°C and 8, respectively. Recombinant HcDppIVA cleaved the host immunoregulatory peptide substance P, indicating the enzyme has the potential to affect the immune response during infection. Expression of HcDPPIVA under heterologous regulatory sequences in H. capsulatum resulted in increased secreted DppIV activity, indicating that the encoded protein can be expressed and secreted by its native organism. However, HcDPPIVA was not required for virulence in a murine model of histoplasmosis. This work reports a fungal enzyme that can function to cleave the immunomodulatory host peptide substance P. PMID:19384411

  7. Genomes of Candidatus Wolbachia bourtzisii wDacA and Candidatus Wolbachia pipientis wDacB from the Cochineal Insect Dactylopius coccus (Hemiptera: Dactylopiidae).

    PubMed

    Ramírez-Puebla, Shamayim T; Ormeño-Orrillo, Ernesto; Vera-Ponce de León, Arturo; Lozano, Luis; Sanchez-Flores, Alejandro; Rosenblueth, Mónica; Martínez-Romero, Esperanza

    2016-10-13

    Dactylopius species, known as cochineal insects, are the source of the carminic acid dye used worldwide. The presence of two Wolbachia strains in Dactylopius coccus from Mexico was revealed by PCR amplification of wsp and sequencing of 16S rRNA genes. A metagenome analysis recovered the genome sequences of Candidatus Wolbachia bourtzisii wDacA (supergroup A) and Candidatus Wolbachia pipientis wDacB (supergroup B). Genome read coverage, as well as 16S rRNA clone sequencing, revealed that wDacB was more abundant than wDacA. The strains shared similar predicted metabolic capabilities that are common to Wolbachia, including riboflavin, ubiquinone, and heme biosynthesis, but lacked other vitamin and cofactor biosynthesis as well as glycolysis, the oxidative pentose phosphate pathway, and sugar uptake systems. A complete tricarboxylic acid cycle and gluconeogenesis were predicted as well as limited amino acid biosynthesis. Uptake and catabolism of proline were evidenced in Dactylopius Wolbachia strains. Both strains possessed WO-like phage regions and type I and type IV secretion systems. Several efflux systems found suggested the existence of metal toxicity within their host. Besides already described putative virulence factors like ankyrin domain proteins, VlrC homologs, and patatin-like proteins, putative novel virulence factors related to those found in intracellular pathogens like Legionella and Mycobacterium are highlighted for the first time in Wolbachia Candidate genes identified in other Wolbachia that are likely involved in cytoplasmic incompatibility were found in wDacB but not in wDacA. Copyright © 2016 Ramírez-Puebla et al.

  8. Predominance of hybrid discrete typing units of Trypanosoma cruzi in domestic Triatoma infestans from the Bolivian Gran Chaco region.

    PubMed

    Perez, Esdenka; Monje, Marcelo; Chang, Boris; Buitrago, Rosio; Parrado, Rudy; Barnabé, Christian; Noireau, François; Brenière, Simone Frédérique

    2013-01-01

    In the Gran Chaco region the reinfestation by Triatoma infestans remains a major problem for control of Chagas disease. Trypanosoma cruzi the agent of the illness presents a broad genetic intraspecific variability which is poorly documented in the Bolivian Gran Chaco. This work presents the identification of the discrete typing units (DTUs) currently recognized for T. cruzi in T. infestans populations collected before and after residual insecticide spraying in four villages in this region. Before spraying, of 84 samples, the frequencies of the DTUs identified by using the multiplex PCR based on the non transcribed spacer of the mini-exon gene (MMPCR) were 0.21 for TcI, 0.70 for TcII/TcV/TcVI, and 0.17 for TcIII/TcIV and no significant difference was observed after spraying (76 samples). Moreover 13% of the total sample corresponds to T. infestans specimens with mixed infection of DTUs of which three were TcII/TcV/TcVI with TcIII/TcIV. The partial sequences of T. cruzi Gpi gene obtained from 14 PCR products agree the MMPCR DTU identification and allowed to precise the occurrence of TcIII, TcII and hybrid TcV/TcVI stocks which were not discriminated by the MMPCR. Given the high prevalence of hybrid stocks, the authors ask whether the recombination event at the origin of hybrids would have taken place in the Gran Chaco where the putative parents are also present. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Host-Associated Genomic Features of the Novel Uncultured Intracellular Pathogen Ca. Ichthyocystis Revealed by Direct Sequencing of Epitheliocysts

    PubMed Central

    Qi, Weihong; Vaughan, Lloyd; Katharios, Pantelis; Schlapbach, Ralph; Seth-Smith, Helena M.B.

    2016-01-01

    Advances in single-cell and mini-metagenome sequencing have enabled important investigations into uncultured bacteria. In this study, we applied the mini-metagenome sequencing method to assemble genome drafts of the uncultured causative agents of epitheliocystis, an emerging infectious disease in the Mediterranean aquaculture species gilthead seabream. We sequenced multiple cyst samples and constructed 11 genome drafts from a novel beta-proteobacterial lineage, Candidatus Ichthyocystis. The draft genomes demonstrate features typical of pathogenic bacteria with an obligate intracellular lifestyle: a reduced genome of up to 2.6 Mb, reduced G + C content, and reduced metabolic capacity. Reconstruction of metabolic pathways reveals that Ca. Ichthyocystis genomes lack all amino acid synthesis pathways, compelling them to scavenge from the fish host. All genomes encode type II, III, and IV secretion systems, a large repertoire of predicted effectors, and a type IV pilus. These are all considered to be virulence factors, required for adherence, invasion, and host manipulation. However, no evidence of lipopolysaccharide synthesis could be found. Beyond the core functions shared within the genus, alignments showed distinction into different species, characterized by alternative large gene families. These comprise up to a third of each genome, appear to have arisen through duplication and diversification, encode many effector proteins, and are seemingly critical for virulence. Thus, Ca. Ichthyocystis represents a novel obligatory intracellular pathogenic beta-proteobacterial lineage. The methods used: mini-metagenome analysis and manual annotation, have generated important insights into the lifestyle and evolution of the novel, uncultured pathogens, elucidating many putative virulence factors including an unprecedented array of novel gene families. PMID:27190004

  10. Attachment of Actinobacillus suis H91-0380 and Its Isogenic Adhesin Mutants to Extracellular Matrix Components of the Tonsils of the Soft Palate of Swine

    PubMed Central

    Bujold, Adina R.

    2016-01-01

    Tonsils conduct immune surveillance of antigens entering the upper respiratory tract. Despite their immunological function, they are also sites of persistence and invasion of bacterial pathogens. Actinobacillus suis is a common resident of the tonsils of the soft palate in pigs, but under certain circumstances it can invade, causing septicemia and related sequelae. Twenty-four putative adhesins are predicted in the A. suis genome, but to date, little is known about how they might participate in colonization or invasion. To better understand these processes, swine tonsil lysates were characterized by mass spectrometry. Fifty-nine extracellular matrix (ECM) proteins were identified, including small leucine-rich proteoglycans, integrins, and other cell surface receptors. Additionally, attachment of the wild type and 3 adhesin mutants to 5 ECM components was evaluated. Exponential cultures of wild-type A. suis adhered significantly more than stationary cultures to all ECM components studied except collagen I. During exponential growth, the A. suis Δflp1 mutant attached less to collagen IV while the ΔompA mutant attached less to all ECMs. The ΔcomE1 strain attached less to collagen IV, fibronectin, and vitronectin during exponential growth and exhibited differential attachment to collagen I over short adherence time points. These results suggest that Flp1, OmpA, and ComE1 are important during early stages of attachment to ECM components found in tonsils, which supports the notion that other adhesins have compensatory effects during later stages of attachment. PMID:27481253

  11. Extension of the classical classification of β-turns

    PubMed Central

    de Brevern, Alexandre G.

    2016-01-01

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3rd of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years. PMID:27627963

  12. Extension of the classical classification of β-turns.

    PubMed

    de Brevern, Alexandre G

    2016-09-15

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3(rd) of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years.

  13. Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

    PubMed

    Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

    2017-01-01

    The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  14. [Diagnostic values of serum type III procollagen N-terminal peptide in type IV gastric cancer].

    PubMed

    Akazawa, S; Fujiki, T; Kanda, Y; Kumai, R; Yoshida, S

    1985-04-01

    Since increased synthesis of collagen has been demonstrated in tissue of type IV gastric cancer, we attempted to distinguish type IV gastric cancer from other cancers by measuring serum levels of type III procollagen N-terminal peptide (type III-N-peptide). Mean serum levels in type IV gastric cancer patients without metastasis were found to be elevated above normal values and developed a tendency to be higher than those in types I, II and III gastric cancer patients without metastasis. Highly positive ratios were found in patients with liver diseases including hepatoma and colon cancer, biliary tract cancer, and esophageal cancer patients with liver, lung or bone metastasis, but only 2 out of 14 of these cancer patients without such metastasis showed positive serum levels of type III-N-peptide. Positive cases in patients with type IV gastric cancer were obtained not only in the group with clinical stage IV but also in the groups with clinical stages II and III. In addition, high serum levels of type III-N-peptide in patients with type IV gastric cancer were seen not only in the cases with liver, lung or bone metastasis but also in cases with disseminated peritoneal metastasis alone. These results suggest that if the serum level of type III-N-peptide is elevated above normal values, type IV gastric cancer should be suspected after ruling out liver diseases, myelofibrosis and liver, lung or bone metastasis.

  15. Low Level Chemical Toxicity: Relevance to Chemical Agent Defense

    DTIC Science & Technology

    2005-07-01

    elevation in stress hormones in the blood serum. Electron microscropy indicated no damage to cochlear tissues of the ear (not shown). At the...neural activity occurring primarily in the cochlear nucleus of the brainstem auditory pathway. Peak II is usually the last major peak to disappear...IV). Peak II is generally the strongest peak and is regarded as a putative indicator of neural activity occurring primarily in the cochlear nucleus

  16. An Individual with Gilles de la Tourette Syndrome and Smith-Magenis Microdeletion Syndrome: Is Chromosome 17p11.2 a Candidate Region for Tourette Syndrome Putative Susceptibility Genes?

    ERIC Educational Resources Information Center

    Shelley, B. P.; Robertson, M. M.; Turk, J.

    2007-01-01

    This is the first published case description in the current literature of the association of definite Gilles de la Tourette syndrome (GTS) and the Smith-Magenis syndrome (SMS), both confirmed by DSM-IV-TR criteria and molecular cytogenetic analysis, respectively. The co-occurrence of GTS, SMS and their common behavioural/neuropsychiatric…

  17. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues.

    PubMed

    Foldager, Casper Bindzus; Toh, Wei Seong; Gomoll, Andreas H; Olsen, Bjørn Reino; Spector, Myron

    2014-04-01

    The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti-collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM.

  18. Genetics Home Reference: familial porencephaly

    MedlinePlus

    ... one component of a protein called type IV collagen. Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

  19. A type IV burst associated with a coronal streamer disruption event

    NASA Technical Reports Server (NTRS)

    Kundu, M. R.

    1987-01-01

    A type IV burst was observed on February 17, 1985 with the Clark Lake Radio Observatory multifrequency radioheliograph operating in the frequency range 20-125 MHz. This burst was associated with a coronal streamer disruption event. From two-dimensional images produced at 50 MHz, evidence of a type II burst and a slow moving type IV burst are shown. The observations of the moving type IV burst suggests that a plasmoid containing energetic electrons can result from the disruption of a coronal streamer.

  20. Ballistics Modeling for Non-Axisymmetric Hypervelocity Smart Bullets

    DTIC Science & Technology

    2014-06-03

    can in principle come from experiments or computational fluid dynamics ( CFD ) calculations. CFD calculations are carried out for a standard bullet...come from experiments or com- putational fluid dynamics ( CFD ) calculations. CFD calculations are carried out for a standard bullet (0.308” 168 grain...11 2. Spin and Pitch Damping 11 3. Magnus Moment 12 IV. CFD Simulations and Ballistic Trajectories 12 A. CFD Modeling of a Standard Bullet 12 B

  1. Laser Flash Photolysis Generation of High-Valent Transition Metal-Oxo Species: Insights from Kinetic Studies in Real Time

    PubMed Central

    Zhang, Rui; Newcomb, Martin

    2010-01-01

    Conspectus High-valent transition metal-oxo species are active oxidizing species in many metal-catalyzed oxidation reactions in both Nature and the laboratory. In homogeneous catalytic oxidations, a transition metal catalyst is oxidized to a metal-oxo species by a sacrificial oxidant, and the activated transition metal-oxo intermediate oxidizes substrates. Mechanistic studies of these oxidizing species can provide insights for understanding commercially important catalytic oxidations and the oxidants in cytochrome P450 enzymes. In many cases, however, the transition metal oxidants are so reactive that they do not accumulate to detectable levels in mixing experiments, which have millisecond mixing times, and successful generation and direct spectroscopic characterization of these highly reactive transients remain a considerable challenge. Our strategy for understanding homogeneous catalysis intermediates employs photochemical generation of the transients with spectroscopic detection on time-scales as short as nanoseconds and direct kinetic studies of their reactions with substrates by laser flash photolysis (LFP) methods. This Account describes studies of high-valent manganese- and iron-oxo intermediates. Irradiation of porphyrin-manganese(III) nitrates and chlorates or corrole-manganese(IV) chlorates resulted in homolytic cleavage of the O-X bonds in the ligands, whereas irradiation of porphyrin-manganese(III) perchlorates resulted in heterolytic cleavage of O-Cl bonds to give porphyrin-manganese(V)-oxo cations. Similar reactions of corrole- and porphyrin-iron(IV) complexes gave highly reactive transients that were tentatively identified as macrocyclic ligand-iron(V)-oxo species. Kinetic studies demonstrated high reactivity of the manganese(V)-oxo species, and even higher reactivities of the putative iron(V)-oxo transients. For example, second-order rate constants for oxidations of cis-cyclooctene at room temperature were 6 × 103 M−1 s−1 for a corrole-iron(V)-oxo species and 1.6 × 106 M−1 s−1 for the putative tetramesitylporphyrin-iron(V)-oxo perchlorate species. The latter rate constant is 25,000 times larger than that for oxidation of cis-cyclooctene by iron(IV)-oxo perchlorate tetramesitylporphyrin radical cation, which is the thermodynamically favored electronic isomer of the putative iron(V)-oxo species. The LFP-determined rate constants can be used to implicate the transient oxidants in catalytic reactions under turnover conditions where high-valent species are not observable. Similarly, the observed reactivities of the putative porphyrin-iron(V)-oxo species might explain the unusually high reactivity of oxidants produced in the cytochrome P450 enzymes, heme-thiolate enzymes that are capable of oxidizing unactivated carbon-hydrogen bonds in substrates so rapidly that iron-oxo intermediates have not been detected under physiological conditions. PMID:18278877

  2. Laser flash photolysis generation of high-valent transition metal-oxo species: insights from kinetic studies in real time.

    PubMed

    Zhang, Rui; Newcomb, Martin

    2008-03-01

    High-valenttransition metal-oxo species are active oxidizing species in many metal-catalyzed oxidation reactions in both Nature and the laboratory. In homogeneous catalytic oxidations, a transition metal catalyst is oxidized to a metal-oxo species by a sacrificial oxidant, and the activated transition metal-oxo intermediate oxidizes substrates. Mechanistic studies of these oxidizing species can provide insights for understanding commercially important catalytic oxidations and the oxidants in cytochrome P450 enzymes. In many cases, however, the transition metal oxidants are so reactive that they do not accumulate to detectable levels in mixing experiments, which have millisecond mixing times, and successful generation and direct spectroscopic characterization of these highly reactive transients remain a considerable challenge. Our strategy for understanding homogeneous catalysis intermediates employs photochemical generation of the transients with spectroscopic detection on time scales as short as nanoseconds and direct kinetic studies of their reactions with substrates by laser flash photolysis (LFP) methods. This Account describes studies of high-valent manganese- and iron-oxo intermediates. Irradiation of porphyrin-manganese(III) nitrates and chlorates or corrole-manganese(IV) chlorates resulted in homolytic cleavage of the O-X bonds in the ligands, whereas irradiation of porphyrin-manganese(III) perchlorates resulted in heterolytic cleavage of O-Cl bonds to give porphyrin-manganese(V)-oxo cations. Similar reactions of corrole- and porphyrin-iron(IV) complexes gave highly reactive transients that were tentatively identified as macrocyclic ligand-iron(V)-oxo species. Kinetic studies demonstrated high reactivity of the manganese(V)-oxo species, and even higher reactivities of the putative iron(V)-oxo transients. For example, second-order rate constants for oxidations of cis-cyclooctene at room temperature were 6 x 10(3) M(-1) s(-1) for a corrole-iron(V)-oxo species and 1.6 x 10(6) M(-1) s(-1) for the putative tetramesitylporphyrin-iron(V)-oxo perchlorate species. The latter rate constant is 25,000 times larger than that for oxidation of cis-cyclooctene by iron(IV)-oxo perchlorate tetramesitylporphyrin radical cation, which is the thermodynamically favored electronic isomer of the putative iron(V)-oxo species. The LFP-determined rate constants can be used to implicate the transient oxidants in catalytic reactions under turnover conditions where high-valent species are not observable. Similarly, the observed reactivities of the putative porphyrin-iron(V)-oxo species might explain the unusually high reactivity of oxidants produced in the cytochrome P450 enzymes, heme-thiolate enzymes that are capable of oxidizing unactivated carbon-hydrogen bonds in substrates so rapidly that iron-oxo intermediates have not been detected under physiological conditions.

  3. Genetics Home Reference: multicentric osteolysis, nodulosis, and arthropathy

    MedlinePlus

    ... to cut (cleave) a protein called type IV collagen. Type IV collagen is a major structural component of basement membranes, ... enzyme, preventing the normal cleavage of type IV collagen. It is unclear how a loss of enzyme ...

  4. viking: identification and characterization of a second type IV collagen in Drosophila.

    PubMed

    Yasothornsrikul, S; Davis, W J; Cramer, G; Kimbrell, D A; Dearolf, C R

    1997-10-01

    We have taken an enhancer trap approach to identify genes that are expressed in hematopoietic cells and tissues of Drosophila. We conducted a molecular analysis of two P-element insertion strains that have reporter gene expression in embryonic hemocytes, strain 197 and vikingICO. This analysis has determined that viking encodes a collagen type IV gene, alpha2(IV). The viking locus is located adjacent to the previously described DCg1, which encodes collagen alpha1(IV), and in the opposite orientation. The alpha2(IV) and alpha1(IV) collagens are structurally very similar to one another, and to vertebrate type IV collagens. In early development, viking and DCg1 are transcribed in the same tissue-specific pattern, primarily in the hemocytes and fat body cells. Our results suggest that both the alpha1 and alpha2 collagen IV chains may contribute to basement membranes in Drosophila. This work also provides the foundation for a more complete genetic dissection of collagen type IV molecules and their developmental function in Drosophila.

  5. Distribution of type IV collagen in pancreatic adenocarcinoma and chronic pancreatitis.

    PubMed Central

    Lee, C. S.; Montebello, J.; Georgiou, T.; Rode, J.

    1994-01-01

    Changes in the basement membrane are present in various neoplastic conditions such as neurofibrosarcoma, cervical carcinoma, colorectal cancers and hepatoblastoma. This study examines the expression of type IV collagen in the basement membrane, using an immunohistochemical method, in the normal pancreas (n = 10), chronic pancreatitis (n = 15) and pancreatic adenocarcinoma (n = 30). The formalin fixed, paraffin embedded tissue was sectioned and pretreated with protease prior to immunostaining for type IV collagen. There was a statistically significant difference in type IV collagen expression between pancreatic carcinoma and chronic pancreatitis (P = 0.0001; chi 2 test with continuity correction). In pancreatic adenocarcinoma, type IV collagen distribution in the basement membrane was discontinuous and irregular or absent around individual or groups of neoplastic cells (n = 30). Most cases of chronic pancreatitis showed continuous pattern of basement membrane type IV collagen around residual ducts (n = 10). In the normal pancreas, only one of the ten cases showed discontinuous basement membrane around pancreatic ducts, while in the rest of the cases, the pattern was continuous. This study suggests that there is abnormal distribution of type IV collagen in the basement membrane in pancreatic carcinoma, which may be related to either abnormal deposition or degradation of the collagen. Immunostaining for type IV collagen may be of some diagnostic use for distinguishing pancreatic adenocarcinoma from problematic cases of chronic pancreatitis. Images Figure 1 Figure 2 Figure 3 PMID:8199008

  6. Effects of salinity on metabolic rate and branchial expression of genes involved in ion transport and metabolism in Mozambique tilapia (Oreochromis mossambicus).

    PubMed

    Zikos, Aris; Seale, Andre P; Lerner, Darren T; Grau, E Gordon; Korsmeyer, Keith E

    2014-12-01

    This study investigated the effects of two rearing salinities, and acute salinity transfer, on the energetic costs of osmoregulation and the expression of metabolic and osmoregulatory genes in the gill of Mozambique tilapia. Using automated, intermittent-flow respirometry, measured standard metabolic rates (SMRs) of tilapia reared in seawater (SW, 130 mg O₂ kg⁻¹ h⁻¹) were greater than those reared in fresh water (FW, 103 mg O₂ kg⁻¹ h⁻¹), when normalized to a common mass of 0.05 kg and at 25±1°C. Transfer from FW to 75% SW increased SMR within 18h, to levels similar to SW-reared fish, while transfer from SW to FW decreased SMR to levels similar to FW-reared fish. Branchial gene expression of Na⁺-K⁺-2Cl⁻ cotransporter (NKCC), an indicator of SW-type mitochondria-rich (MR) cells, was positively correlated with SMR, while Na⁺-Cl⁻ cotransporter (NCC), an indicator of FW-type MR cells, was negatively correlated. Principal Components Analysis also revealed that branchial expression of cytochrome c oxidase subunit IV (COX-IV), glycogen phosphorylase (GP), and a putative mitochondrial biogenesis regulator in fish, peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α), were correlated with a higher SMR, plasma osmolality, and environmental salinity, while expression of glycogen synthase (GS), PGC-1β, and nuclear respiratory factor 1 (NRF-1) had negative correlations. These results suggest that the energetic costs of osmoregulation are higher in SW than in FW, which may be related to the salinity-dependent differences in osmoregulatory mechanisms found in the gills of Mozambique tilapia. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Brucella Modulates Secretory Trafficking via Multiple Type IV Secretion Effector Proteins

    PubMed Central

    Myeni, Sebenzile; Child, Robert; Ng, Tony W.; Kupko, John J.; Wehrly, Tara D.; Porcella, Stephen F.; Knodler, Leigh A.; Celli, Jean

    2013-01-01

    The intracellular pathogenic bacterium Brucella generates a replicative vacuole (rBCV) derived from the endoplasmic reticulum via subversion of the host cell secretory pathway. rBCV biogenesis requires the expression of the Type IV secretion system (T4SS) VirB, which is thought to translocate effector proteins that modulate membrane trafficking along the endocytic and secretory pathways. To date, only a few T4SS substrates have been identified, whose molecular functions remain unknown. Here, we used an in silico screen to identify putative T4SS effector candidate proteins using criteria such as limited homology in other bacterial genera, the presence of features similar to known VirB T4SS effectors, GC content and presence of eukaryotic-like motifs. Using β-lactamase and CyaA adenylate cyclase reporter assays, we identified eleven proteins translocated into host cells by Brucella, five in a VirB T4SS-dependent manner, namely BAB1_0678 (BspA), BAB1_0712 (BspB), BAB1_0847 (BspC), BAB1_1671 (BspE) and BAB1_1948 (BspF). A subset of the translocated proteins targeted secretory pathway compartments when ectopically expressed in HeLa cells, and the VirB effectors BspA, BspB and BspF inhibited protein secretion. Brucella infection also impaired host protein secretion in a process requiring BspA, BspB and BspF. Single or combined deletions of bspA, bspB and bspF affected Brucella ability to replicate in macrophages and persist in the liver of infected mice. Taken together, these findings demonstrate that Brucella modulates secretory trafficking via multiple T4SS effector proteins that likely act coordinately to promote Brucella pathogenesis. PMID:23950720

  8. Genetics Home Reference: hereditary angiopathy with nephropathy, aneurysms, and muscle cramps syndrome

    MedlinePlus

    ... one component of a protein called type IV collagen . Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

  9. Type IV collagen is a novel DEJ biomarker that is reduced by radiotherapy.

    PubMed

    McGuire, J D; Gorski, J P; Dusevich, V; Wang, Y; Walker, M P

    2014-10-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy--teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. © International & American Associations for Dental Research.

  10. Type IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy

    PubMed Central

    McGuire, J.D.; Gorski, J.P.; Dusevich, V.; Wang, Y.; Walker, M.P.

    2014-01-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy – teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. PMID:25146181

  11. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues

    PubMed Central

    Toh, Wei Seong; Gomoll, Andreas H.; Olsen, Bjørn Reino; Spector, Myron

    2014-01-01

    Objective: The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Design: Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti–collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. Results: When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. Conclusions: We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM. PMID:26069692

  12. A Multi-Observatory View of the Alpha Persei Coronal Conundrum

    NASA Astrophysics Data System (ADS)

    Ayres, Thomas R.

    2017-01-01

    A ROSAT pointed survey of the Alpha Per open cluster in the 1990's detected its brightest star, mid-F supergiant α Persei, with an X-ray luminosity and spectral hardness similar to coronally active late-type dwarf members. Later, in 2010, a Hubble Cosmic Origins Spectrograph SNAPshot observation of α Per found far-ultraviolet (FUV) coronal-proxy emissions (specifically Si IV 1393 Å) unexpectedly weak. Together with a slight, but suspicious, offset of the ROSAT source, these anomalies raised the possibility that an unrecognized late-type companion might be responsible for the coronal X-rays. Recently, a multi-observatory program was carried out to test that premise; on the one hand to directly detect the putative companion, but on the other to better characterize the FUV spectrum of α Per in case it also was captured in X-rays. Initially, ground-based optical coronography from the Apache Point 3.5m, and later near-UV imaging with HST Wide Field Camera 3, searched for any close-in faint objects that plausibly could be significant X-ray emitters, but without success. Then, a Chandra pointing showed that the X-ray source is single and coincident with the bright star. In tandem, HST COS collected a much deeper FUV spectrum of α Per than the earlier brief SNAP. In hindsight, F supergiant Canopus (α Car: F0 Ib) also has a high X-ray luminosity and the same type of low Si IV/X-ray index as α Per. Significantly, the FUV Si IV emissions of both α Per and Canopus align well with the chromospheric atomic oxygen emissions (which must be intrinsic to the luminous stars), within the context of cooler late-F and early-G supergiants, including Cepheid variables. This pointed to the X-rays as the fundamental anomaly. Ironically, the over-luminous X-rays still support the case for a hyperactive dwarf secondary, albeit now spatially unresolved. However, an equally viable alternative is that both F supergiants are members of a novel class of X-ray emitters. Resolving the first possibility now has become more difficult, because the easy solution -- a well separated hyperactive companion -- has been eliminated; while testing the second will require a broader high-energy census of the early-F supergiant class.

  13. DNA Microarray-Based Identification of Genes Controlled by Autoinducer 2-Stimulated Quorum Sensing in Escherichia Coli

    DTIC Science & Technology

    2001-09-01

    and pathogenicity in Erwinia carotovora (rsmA) (12). Additionally, csrA has been documented to affect cell size and surface properties, which is in...machinery to cell wall 13.1 b1502 Putative adhesin; similar to FimH protein 13.0 tap Methyl-accepting chemotaxis protein IV, peptide sensor receptor...oxohexanoyl)-L-homoserine lactone 5246 DELISA ET AL. J. BACTERIOL. regulates carbapenem antibiotic production in Erwinia carotovora . Biochem. J. 288:997

  14. Type IV Ehlers-Danlos Syndrome: A Surgical Emergency? A Case of Massive Retroperitoneal Hemorrhage

    PubMed Central

    Chun, Stephen G; Pedro, Patrick; Yu, Mihae; Takanishi, Danny M

    2011-01-01

    Retroperitoneal hemorrhagic bleeding is a known manifestation of Type-IV Ehlers-Danlos Syndrome that is caused by loss-of-function mutations of the pro-alpha-1 chains of type III pro-collagen (COL3A1) resulting in vascular fragility. A number of previous reports describe futile surgical intervention for retroperitoneal bleeding in Type-IV Ehlers-Danlos Syndrome with high post-operative mortality, although the rarity of retroperitoneal bleeding associated with Type-IV Ehlers-Danlos Syndrome precludes an evidence-based approach to clinical management. We report a 23-year-old male with history of Type-IV Ehlers-Danlos Syndrome who presented with severe abdominal pain and tachycardia following an episode of vomiting. Further work-up of his abdominal pain revealed massive retroperitoneal bleeding by CT-scan of the abdomen. Given numerous cases of catastrophic injury caused by surgical intervention in Type-IV Ehlers-Danlos Syndrome, the patient was treated non-operatively, and the patient made a full recovery. This case suggests that even in cases of large retroperitoneal hemorrhages associated with Ehlers-Danlos Syndrome, it may not truly represent a surgical emergency. PMID:21966332

  15. Consensus in controversy: The modified Delphi method applied to Gynecologic Oncology practice.

    PubMed

    Cohn, David E; Havrilesky, Laura J; Osann, Kathryn; Lipscomb, Joseph; Hsieh, Susie; Walker, Joan L; Wright, Alexi A; Alvarez, Ronald D; Karlan, Beth Y; Bristow, Robert E; DiSilvestro, Paul A; Wakabayashi, Mark T; Morgan, Robert; Mukamel, Dana B; Wenzel, Lari

    2015-09-01

    To determine the degree of consensus regarding the probabilities of outcomes associated with IP/IV and IV chemotherapy. A survey was administered to an expert panel using the Delphi method. Ten ovarian cancer experts were asked to estimate outcomes for patients receiving IP/IV or IV chemotherapy. The clinical estimates were: 1) probability of completing six cycles of chemotherapy, 2) probability of surviving five years, 3) median survival, and 4) probability of ER/hospital visits during treatment. Estimates for two patients, one with a low comorbidity index (patient 1) and the other with a moderate index (patient 2), were included. The survey was administered in three rounds, and panelists could revise their subsequent responses based on review of the anonymous opinions of their peers. The ranges were smaller for IV compared with IP/IV therapy. Ranges decreased with each round. Consensus converged around outcomes related to IP/IV chemotherapy for: 1) completion of 6 cycles of therapy (type 1 patient, 62%, type 2 patient, 43%); 2) percentage of patients surviving 5 years (type 1 patient, 66%, type 2 patient, 47%); and 3) median survival (type 1 patient, 83 months, type 2 patient, 58 months). The group required three rounds to achieve consensus on the probabilities of ER/hospital visits (type 1 patient, 24%, type 2 patient, 35%). Initial estimates of survival and adverse events associated with IP/IV chemotherapy differ among experts. The Delphi process works to build consensus and may be a pragmatic tool to inform patients of their expected outcomes. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Change in genotype of methicillin-resistant Staphylococcus aureus (MRSA) affects the antibiogram of hospital-acquired MRSA.

    PubMed

    Harada, Dai; Nakaminami, Hidemasa; Miyajima, Eri; Sugiyama, Taku; Sasai, Nao; Kitamura, Yoshinobu; Tamura, Taku; Kawakubo, Takashi; Noguchi, Norihisa

    2018-07-01

    Recently, the dissemination of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) into hospitals has frequently been reported worldwide. Hospital-acquired MRSA (HA-MRSA) strains exhibit high-level resistance to multiple antimicrobial agents, whereas CA-MRSA strains are usually susceptible to non-β-lactams. Thus, it is predicted that the antibiogram of the HA-MRSA population would change along with the change in genotype of MRSA. Here, we investigated the changes in the MRSA population along with the MRSA antibiogram in a hospital between 2010 and 2016. Staphylococcal cassette chromosome (SCC) mec typing showed that the predominant HA-MRSA strains in the hospital dramatically changed from SCCmec type II, which is the major type of HA-MRSA, to SCCmec type IV, which is the major type of CA-MRSA. Multilocus sequence typing revealed that the predominant SCCmec type IV strain was a clonal complex (CC) 8 clone, which is mainly found among CA-MRSA. Furthermore, the CC1-SCCmec type IV (CC1-IV) clone significantly increased. Both the CC8-IV and CC1-IV clones exhibited high antimicrobial susceptibility. The antibiogram change of the HA-MRSA population was consistent with the antimicrobial susceptibilities and increased prevalence of the CC8-IV and CC1-IV clones. Our data reveal that the change in the genotypes of MRSA strains could impact the antibiogram of HA-MRSA population. Copyright © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  17. Differential distribution of annexins-I, -II, -IV, and -VI in synovium.

    PubMed Central

    Goulding, N J; Dixey, J; Morand, E F; Dodds, R A; Wilkinson, L S; Pitsillides, A A; Edwards, J C

    1995-01-01

    OBJECTIVES--To examine the distribution of four annexins in non-inflamed rheumatoid arthritic and osteoarthritic synovial tissue. METHODS--Frozen sections were stained with monoclonal antibodies (MAb) specific for annexins-I, -II, -IV, and -VI, and for cell lineage related markers including CD68 and CD14 (macrophages), prolyl hydroxylase (fibroblasts), and CD3 (T cells). RESULTS--Each of the annexins was present in synovial tissues in significant amounts in the three groups studied. Annexin-I was predominantly found within the synovial lining layer and double labelling showed it to be present predominantly in cells of the macrophage lineage. In rheumatoid specimens there was increased staining within the lining layer, perivascularly and on macrophages within the tissue stroma. Annexin-II was present in a distribution similar to that of annexin-I, but with more prominent perivascular staining. Annexins-IV and -VI were seen chiefly in association with areas of lymphocyte infiltration in rheumatoid tissue, whereas annexins-I and -II were absent from these areas. Endothelial cells stained weakly positive for annexins-I and -II, and more strongly for -IV and -VI. CONCLUSIONS--This study demonstrates that annexins (particularly annexin-I, a putative mediator of the anti-inflammatory activities of glucocorticoids) are abundant in rheumatoid and non-rheumatoid synovial tissue, annexins-IV and -VI having a distribution distinct from that of -I and -II. Images PMID:7492225

  18. Differential expression of basement membrane type IV collagen α2 and α6 chains as a prognostic factor in patients with extrahepatic bile duct carcinoma.

    PubMed

    Hirashima, Kotaro; Iyama, Ken-Ichi; Baba, Yoshifumi; Honda, Yumi; Sado, Yoshikazu; Ninomiya, Yoshifumi; Watanabe, Masayuki; Takamori, Hiroshi; Beppu, Toru; Baba, Hideo

    2013-03-01

    The destruction of the basement membrane (BM) is the first step in cancer invasion and metastasis. Type IV collagen is a major component of the BM, and is composed of six genetically distinct α(IV) chains; α1(IV) to α6(IV). The loss of α5(IV) and α6(IV) chains from the epithelial BM at the early stage of cancer invasion has been reported in several types of cancers. However, the expression of α5(IV) and α6(IV) chains in extrahepatic bile duct carcinoma (EBDC) remains unclear. We examined the expression of α(IV) chains by immunohistochemistry using 71 resected EBDC specimens. Prognostic significance of α(IV) chains was examined by Cox regression and Kaplan-Meier analyses. In the invasive cancer, the expression of α6(IV) chain in the BM was lost partially or completely preceded by the loss of α2(IV) chain. The loss of α6(IV) chain in the BM of the invasive cancer was related to the tumor classification, TNM stages, and the expression of α2(IV) chain. The patients with α2(IV)-negative and α6(IV)-negative chains had significantly poorer prognosis than those with α2(IV)-positive and α6(IV)-positive/negative chains (P = 0.04). The loss of α2(IV) and α6(IV) chains might be a useful prognostic factor in patients with EBDC. Copyright © 2012 Wiley Periodicals, Inc.

  19. Essential core of the Hawking–Ellis types

    NASA Astrophysics Data System (ADS)

    Martín-Moruno, Prado; Visser, Matt

    2018-06-01

    The Hawking–Ellis (Segre–Plebański) classification of possible stress–energy tensors is an essential tool in analyzing the implications of the Einstein field equations in a more-or-less model-independent manner. In the current article the basic idea is to simplify the Hawking–Ellis type I, II, III, and IV classification by isolating the ‘essential core’ of the type II, type III, and type IV stress–energy tensors; this being done by subtracting (special cases of) type I to simplify the (Lorentz invariant) eigenvalue structure as much as possible without disturbing the eigenvector structure. We will denote these ‘simplified cores’ type II0, type III0, and type IV0. These ‘simplified cores’ have very nice and simple algebraic properties. Furthermore, types I and II0 have very simple classical interpretations, while type IV0 is known to arise semi-classically (in renormalized expectation values of standard stress–energy tensors). In contrast type III0 stands out in that it has neither a simple classical interpretation, nor even a simple semi-classical interpretation. We will also consider the robustness of this classification considering the stability of the different Hawking–Ellis types under perturbations. We argue that types II and III are definitively unstable, whereas types I and IV are stable.

  20. Potassium recycling pathways in the human cochlea.

    PubMed

    Weber, P C; Cunningham, C D; Schulte, B A

    2001-07-01

    Potential pathways for recycling potassium (K+) used in the maintenance of inner ear electrochemical gradients have been elucidated in animal models. However, little is known about K+ transport in the human cochlea. This study was designed to characterize putative K+ recycling pathways in the human ear and to determine whether observations from animal models can be extrapolated to humans. A prospective laboratory study using an immunohistochemical approach to analyze the distribution of key ion transport mediators in the human cochlea. Human temporal bones were fixed in situ within 1 to 6 hours of death and subsequently harvested at autopsy. Decalcification was accomplished with the aid of microwaving. Immunohistochemical staining was then performed to define the presence and cell type-specific distribution of Na,K-ATPase, sodium-potassium-chloride cotransporter (NKCC), and carbonic anhydrase (CA) in the inner ear. Staining patterns visualized in the human cochlea closely paralleled those seen in other species. Anti-Na,K-ATPase stained strongly the basolateral plasma membrane of strial marginal cells and nerve endings underlying hair cells. This antibody also localized Na,K-ATPase to type II, type IV, and type V fibrocytes in the spiral ligament and in limbal fibrocytes. NKCC was present in the basolateral membrane of strial marginal cells as well as in type II, type V, and limbal fibrocytes. Immunoreactive carbonic anhydrase was present in type I and type III fibrocytes and in epithelial cells lining Reissner's membrane and the spiral prominence. The distribution of several major ion transport proteins in the human cochlea is similar but not identical to that described in various rodent models. These results support the presence of a complex system for recycling and regulating K+ homeostasis in the human cochlea, similar to that described in other mammalian species.

  1. Observational properties of decameter type IV bursts

    NASA Astrophysics Data System (ADS)

    Melnik, Valentin; Brazhenko, Anatoly; Rucker, Helmut; Konovalenko, Alexander; Briand, Carine; Dorovskyy, Vladimir; Zarka, Philippe; Frantzusenko, Anatoly; Panchenko, Michael; Poedts, Stefan; Zaqarashvili, Teimuraz; Shergelashvili, Bidzina

    2013-04-01

    Oscillations of decameter type IV bursts were registered during observations of solar radio emission by UTR-2, URAN-2 and NDA in 2011-2012. Large majority of these bursts were accompanied by coronal mass ejections (CMEs), which were observed by SOHO and STEREO in the visible light. Only in some cases decameter type IV bursts were not associated with CMEs. The largest periods of oscillations P were some tens of minutes. There were some modes of long periods of oscillations simultaneously. Periods of oscillations in flux and in polarization profiles were close. Detailed properties of oscillations at different frequencies were analyzed on the example of two type IV bursts. One of them was observed on April 7, 2011 when a CME happened. Another one (August 1, 2011) was registered without any CME. The 7 April type IV burst had two periods in the frames 75-85 and 35-85 minutes. Interesting feature of these oscillations is decreasing periods with time. The observed decreasing rates dP/dt equaled 0.03-0.07. Concerning type IV burst observed on August 1, 2011 the period of its oscillations increases from 17 min. at 30 MHz to 44 min. at 10 MHz. Connection of type IV burst oscillations with oscillations of magnetic arches and CMEs at corresponding altitudes are discussed. The work is fulfilled in the frame of FP7 project "SOLSPANET".

  2. Clonal population of adult stem cells: life span and differentiation potential.

    PubMed

    Seruya, Mitchel; Shah, Anup; Pedrotty, Dawn; du Laney, Tracey; Melgiri, Ryan; McKee, J Andrew; Young, Henry E; Niklason, Laura E

    2004-01-01

    Adult stem cells derived from bone marrow, connective tissue, and solid organs can exhibit a range of differentiation potentials. Some controversy exists regarding the classification of mesenchymal stem cells as bona fide stem cells, which is in part derived from the limited ability to propagate true clonal populations of precursor cells. We isolated putative mesenchymal stem cells from the connective tissue of an adult rat (rMSC), and generated clonal populations via three rounds of dilutional cloning. The replicative potential of the clonal rMSC line far exceeded Hayflick's limit of 50-70 population doublings. The high capacity for self-renewal in vitro correlated with telomerase activity, as demonstrated by telomerase repeat amplification protocol (TRAP) assay. Exposure to nonspecific differentiation culture medium revealed multilineage differentiation potential of rMSC clones. Immunostaining confirmed the appearance of mesodermal phenotypes, including adipocytes possessing lipid-rich vacuoles, chondrocytes depositing pericellular type II collagen, and skeletal myoblasts expressing MyoD1. Importantly, the spectrum of differentiation capability was sustained through repeated passaging. Furthermore, serum-free conditions that led to high-efficiency smooth muscle differentiation were identified. rMSCs plated on collagen IV-coated surfaces and exposed to transforming growth factor-beta1 (TGF-beta1) differentiated into a homogeneous population expressing alpha-actin and calponin. Hence, clonogenic analysis confirmed the presence of a putative MSC population derived from the connective tissue of rat skeletal muscle. The ability to differentiate into a smooth muscle cell (SMC) phenotype, combined with a high proliferative capacity, make such a connective tissue-derived MSC population ideal for applications in vascular tissue construction.

  3. Over Six Thousand Trypanosoma cruzi Strains Classified into Discrete Typing Units (DTUs): Attempt at an Inventory.

    PubMed

    Brenière, Simone Frédérique; Waleckx, Etienne; Barnabé, Christian

    2016-08-01

    Trypanosoma cruzi, the causative agent of Chagas disease, presents wide genetic diversity. Currently, six discrete typing units (DTUs), named TcI to TcVI, and a seventh one called TcBat are used for strain typing. Beyond the debate concerning this classification, this systematic review has attempted to provide an inventory by compiling the results of 137 articles that have used it. A total of 6,343 DTU identifications were analyzed according to the geographical and host origins. Ninety-one percent of the data available is linked to South America. This sample, although not free of potential bias, nevertheless provides today's picture of T. cruzi genetic diversity that is closest to reality. DTUs were genotyped from 158 species, including 42 vector species. Remarkably, TcI predominated in the overall sample (around 60%), in both sylvatic and domestic cycles. This DTU known to present a high genetic diversity, is very widely distributed geographically, compatible with a long-term evolution. The marsupial is thought to be its most ancestral host and the Gran Chaco region the place of its putative origin. TcII was rarely sampled (9.6%), absent, or extremely rare in North and Central America, and more frequently identified in domestic cycles than in sylvatic cycles. It has a low genetic diversity and has probably found refuge in some mammal species. It is thought to originate in the south-Amazon area. TcIII and TcIV were also rarely sampled. They showed substantial genetic diversity and are thought to be composed of possible polyphyletic subgroups. Even if they are mostly associated with sylvatic transmission cycles, a total of 150 human infections with these DTUs have been reported. TcV and TcVI are clearly associated with domestic transmission cycles. Less than 10% of these DTUs were identified together in sylvatic hosts. They are thought to originate in the Gran Chaco region, where they are predominant and where putative parents exist (TcII and TcIII). Trends in host-DTU specificities exist, but generally it seems that the complexity of the cycles and the participation of numerous vectors and mammal hosts in a shared area, maintains DTU diversity.

  4. Endovascular repair of an iliac artery aneurysm in a patient with Ehlers-Danlos syndrome type IV.

    PubMed

    Tonnessen, Britt H; Sternbergh, W Charles; Mannava, Krishna; Money, Samuel R

    2007-01-01

    Ehlers-Danlos type IV (EDS-IV) is an inherited condition most notable for its associated vascular complications. Patients are prone to aneurysm formation, arterial dissection, and spontaneous vessel rupture. Intervention for the vascular pathology of EDS-IV carries high morbidity and mortality. We describe a case of a 57-year-old man with EDS-IV and an expanding iliac aneurysm who underwent successful endovascular repair with a stent-graft. Endovascular aneurysm repair is feasible and should be considered for patients with EDS-IV.

  5. Urinary type IV collagen is related to left ventricular diastolic function and brain natriuretic peptide in hypertensive patients with prediabetes.

    PubMed

    Iida, Masato; Yamamoto, Mitsuru; Ishiguro, Yuko S; Yamazaki, Masatoshi; Ueda, Norihiro; Honjo, Haruo; Kamiya, Kaichirou

    2014-01-01

    Urinary type IV collagen is an early biomarker of diabetic nephropathy. Concomitant prediabetes (the early stage of diabetes) was associated with left ventricular (LV) diastolic dysfunction and increased brain natriuretic peptide (BNP) in hypertensive patients. We hypothesized that urinary type IV collagen may be related to these cardiac dysfunctions. We studied hypertensive patients with early prediabetes (HbA1c <5.7% and fasting glucose >110, n=18), those with prediabetes (HbA1c 5.7-6.4, n=98), and those with diabetes (HbA1c>6.5 or on diabetes medications, n=92). The participants underwent echocardiography to assess left atrial volume/body surface area (BSA) and the ratio of early mitral flow velocity to mitral annular velocity (E/e'). Left ventricular diastolic dysfunction (LVDD) was defined if patients had E/e'≥15, or E/e'=9-14 accompanied by left atrial volume/BSA≥32ml/mm(2). Urinary samples were collected for type IV collagen and albumin, and blood samples were taken for BNP and HbA1c. Urinary type IV collagen and albumin increased in parallel with the deterioration of glycemic status. In hypertensive patients with prediabetes, subjects with LVDD had higher levels of BNP and urinary type IV collagen than those without LVDD. In contrast, in hypertensive patients with diabetes, subjects with LVDD had higher urinary albumin and BNP than those without LVDD. Urinary type IV collagen correlated positively with BNP in hypertensive patients with prediabetes, whereas it correlated with HbA1c in those with diabetes. In hypertensive patients with prediabetes, urinary type IV collagen was associated with LV diastolic dysfunction and BNP. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. A comparative study of percutaneous atherectomy for femoropopliteal arterial occlusive disease.

    PubMed

    Gu, Yongquan; Malas, Mahmoud B; Qi, Lixing; Guo, Lianrui; Guo, Jianming; Yu, Hengxi; Tong, Zhu; Gao, Xixiang; Zhang, Jian; Wang, Zhonggao

    2017-08-01

    SilverHawk™ directional atherectomy has been used to treat more than 300 thousand cases of lower extremity atherosclerotic occlusive disease in the world since it was approved by FDA in 2003. This study aimed to analyze the safety and effectiveness of symptomatic femoral popliteal atherosclerotic disease treated by directional atherectomy (DA). Clinical data of all consecutive patients treated with percutaneous atherectomy utilizing the SilverHawk™ plaque excision was retrospectively analyzed. The anatomic criteria of the atherosclerotic lesions were divided into four types: type I stenosis; type II occlusion; type III in-stent restenosis; type IV stent occlusion. There were 160 patients treated during the study period. Intermittent claudication in 75 patients (47%), rest pain in 55 patients (34.5%) and tissue loss in 30 patients (18.5%). The number of patients was 72, 15, 49 and 24 in type I, II, III and IV lesions, respectively. Technical success rate was 98.6%, 93.3%, 97.9% and 91.7% in type I, II, III and IV lesions, respectively. Debris of intimal plaque was captured by protection device in 92 patients (71.3%). The mean follow-up period was 23.5±10.4 months. Restenosis rate of type I to IV lesions was 21%, 36%, 36% and 40% respectively. Restenosis rate in type I lesion was significantly lower than that in type III and IV lesions (P<0.05). Patients with tissue loss responded to revascularization as follow: type I, 11/13 healed or reduced (84.6%), type II, 3/3 patients improved (100%), type III, 5/6 patients improved (83.3%) and type IV 4/4 healed (100%). In type IV group, four patients had in-stent thrombosis found by postoperative Duplex ultrasonography. They all underwent DA after catheter-directed thrombolysis with good angiographic results. Percutaneous DA is safe and effective for both de-novo atherosclerotic and in-stent stenotic or occlusive lesions. Thrombolysis before plaque excision is recommended in case of in-stenting thrombosis.

  7. Genetic ablation or pharmacological blockade of dipeptidyl peptidase IV does not impact T cell-dependent immune responses

    PubMed Central

    Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M

    2009-01-01

    Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731

  8. The putative forkhead transcription factor FOXL2 is mutated in blepharophimosis/ptosis/epicanthus inversus syndrome.

    PubMed

    Crisponi, L; Deiana, M; Loi, A; Chiappe, F; Uda, M; Amati, P; Bisceglia, L; Zelante, L; Nagaraja, R; Porcu, S; Ristaldi, M S; Marzella, R; Rocchi, M; Nicolino, M; Lienhardt-Roussie, A; Nivelon, A; Verloes, A; Schlessinger, D; Gasparini, P; Bonneau, D; Cao, A; Pilia, G

    2001-02-01

    In type I blepharophimosis/ptosis/epicanthus inversus syndrome (BPES), eyelid abnormalities are associated with ovarian failure. Type II BPES shows only the eyelid defects, but both types map to chromosome 3q23. We have positionally cloned a novel, putative winged helix/forkhead transcription factor gene, FOXL2, that is mutated to produce truncated proteins in type I families and larger proteins in type II. Consistent with an involvement in those tissues, FOXL2 is selectively expressed in the mesenchyme of developing mouse eyelids and in adult ovarian follicles; in adult humans, it appears predominantly in the ovary. FOXL2 represents a candidate gene for the polled/intersex syndrome XX sex-reversal goat.

  9. Secretion of TcpF by the Vibrio cholerae Toxin-Coregulated Pilus Biogenesis Apparatus Requires an N-Terminal Determinant

    PubMed Central

    Megli, Christina J.

    2013-01-01

    Type IV pili are important for microcolony formation, biofilm formation, twitching motility, and attachment. We and others have shown that type IV pili are important for protein secretion across the outer membrane, similar to type II secretion systems. This study explored the relationship between protein secretion and pilus formation in Vibrio cholerae. The toxin-coregulated pilus (TCP), a type IV pilus required for V. cholerae pathogenesis, is necessary for the secretion of the colonization factor TcpF (T. J. Kirn, N. Bose, and R. K. Taylor, Mol. Microbiol. 49:81–92, 2003). This phenomenon is not unique to V. cholerae; secreted virulence factors that are dependent on the presence of components of the type IV pilus biogenesis apparatus for secretion have been reported with Dichelobacter nodosus (R. M. Kennan, O. P. Dhungyel, R. J. Whittington, J. R. Egerton, and J. I. Rood, J. Bacteriol. 183:4451–4458, 2001) and Francisella tularensis (A. J. Hager et al., Mol. Microbiol. 62:227–237, 2006). Using site-directed mutagenesis, we demonstrated that the secretion of TcpF is dependent on the presence of selected amino acid R groups at position five. We were unable to find other secretion determinants, suggesting that Y5 is the major secretion determinant within TcpF. We also report that proteins secreted in a type IV pilus biogenesis apparatus-dependent manner have a YXS motif within the first 15 amino acids following the Sec cleavage site. The YXS motif is not present in proteins secreted by type II secretion systems, indicating that this is unique to type IV pilus-mediated secretion. Moreover, we show that TcpF interacts with the pilin TcpA, suggesting that these proteins are secreted by the type IV pilus biogenesis system. These data provide a starting point for understanding how type IV pili can mediate secretion of virulence factors important for bacterial pathogenesis. PMID:23564177

  10. Type IV pili mechanochemically regulate virulence factors in Pseudomonas aeruginosa.

    PubMed

    Persat, Alexandre; Inclan, Yuki F; Engel, Joanne N; Stone, Howard A; Gitai, Zemer

    2015-06-16

    Bacteria have evolved a wide range of sensing systems to appropriately respond to environmental signals. Here we demonstrate that the opportunistic pathogen Pseudomonas aeruginosa detects contact with surfaces on short timescales using the mechanical activity of its type IV pili, a major surface adhesin. This signal transduction mechanism requires attachment of type IV pili to a solid surface, followed by pilus retraction and signal transduction through the Chp chemosensory system, a chemotaxis-like sensory system that regulates cAMP production and transcription of hundreds of genes, including key virulence factors. Like other chemotaxis pathways, pili-mediated surface sensing results in a transient response amplified by a positive feedback that increases type IV pili activity, thereby promoting long-term surface attachment that can stimulate additional virulence and biofilm-inducing pathways. The methyl-accepting chemotaxis protein-like chemosensor PilJ directly interacts with the major pilin subunit PilA. Our results thus support a mechanochemical model where a chemosensory system measures the mechanically induced conformational changes in stretched type IV pili. These findings demonstrate that P. aeruginosa not only uses type IV pili for surface-specific twitching motility, but also as a sensor regulating surface-induced gene expression and pathogenicity.

  11. Neoadjuvant chemotherapy modifies serum angiotensinase activities in women with breast cancer.

    PubMed

    Ramírez-Expósito, María Jesús; Carrera-González, María del Pilar; Mayas, María Dolores; Dueñas, Basilio; Martínez-Ferrol, Julia; Martínez-Martos, José Manuel

    2012-05-01

    The aim of this study was to investigate the putative changes in serum angiotensinase activities (aminopeptidase N, APN; aminopeptidase B, APB; aminopeptidase A, APA; aspartyl aminopeptidase, ASAP) involved in the renin-angiotensin system (RAS) in women with breast cancer treated or not with a neoadjuvant therapy of paclitaxel and anthracycline and in healthy women volunteers. We fluorometrically analysed serum APN, APB, APA and ASAP activities using their corresponding aminoacyl-β-naphthylamides as substrates in women with breast cancer treated with a neoadjuvant therapy of paclitaxel and anthracycline. When compared with healthy controls, women with breast cancer not treated with neoadjuvant chemotherapy, showed a decrease in angiotensinase activity, which support the putative increase of angiotensin II (Ang II) levels, indicating that the tumour process would favour the development of the disease. Also, an increase in APN and APB activities was observed, which support a role for angiotensin IV (Ang IV). In women treated with a neoadjuvant therapy, we described an increase in ASAP and APA activities, supporting the idea that this treatment increases Ang II catabolism. The resulting decrease in Ang II level could lead to an inhibition of the tumour growth. Present results show changes in serum angiotensinase activities in women with breast cancer and in women with breast cancer treated with a neoadjuvant therapy of paclitaxel and anthracycline. Therefore, considerable attention should be focused on the development of RAS blockade therapy as a new strategy for breast cancer treatment. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  12. Rapid tachyphylaxis to hemodynamic effects of PACAP-27 after inhibition of nitric oxide synthesis

    NASA Technical Reports Server (NTRS)

    Whalen, E. J.; Travis, M. D.; Johnson, A. K.; Lewis, S. J.

    1999-01-01

    The vasodilator effects of pituitary adenylate cyclase-activating polypeptide (PACAP)-27 are subject to tachyphylaxis in rats treated with the nitric oxide (NO) synthase inhibitor NG-nitro-L-arginine methyl ester (L-NAME). We examined whether this tachyphylaxis could be prevented by administration of the putative endothelium-derived nitrosyl factor S-nitroso-L-cysteine (L-SNC) and whether L-SNC may exert its effects via increases in cGMP levels in vascular smooth muscle. Five doses of PACAP-27 (2 nmol/kg iv) produced pronounced vasodilator responses in saline-treated rats. These responses were not subject to tachyphylaxis. The first injection of PACAP-27 (2 nmol/kg iv) in L-NAME-treated (50 micromol/kg iv) rats produced vasodilator responses similar to those in saline-treated rats, whereas subsequent injections produced progressively smaller responses. The injection of L-SNC (1,200 nmol/kg iv) before each injection of PACAP-27 prevented tachyphylaxis to the Gs protein-coupled receptor agonist in L-NAME-treated rats, whereas equihypotensive doses of the NO donor sodium nitroprusside (100 micrograms/kg iv) did not. The injection of the membrane-permeant cGMP analog 8-(4-chlorophenylthio)guanosine 3',5'-cyclic monophosphate (8-CPT-cGMP; 30 micromol/kg iv) to L-NAME-treated rats restored resting hemodynamic values to pre-L-NAME levels but did not prevent the development of tachyphylaxis to PACAP-27. These results suggest that nitrosyl factors prevent the development of tachyphylaxis to the hemodynamic actions of PACAP-27. These nitrosyl factors may act independently of their ability to generate cGMP in vascular smooth muscle.

  13. Functional classification of mitochondrion-rich cells in euryhaline Mozambique tilapia (Oreochromis mossambicus) embryos, by means of triple immunofluorescence staining for Na+/K+-ATPase, Na +/K+/2Cl- cotransporter and CFTR anion channel

    USGS Publications Warehouse

    Hiroi, J.; McCormick, S.D.; Ohtani-Kaneko, R.; Kaneko, T.

    2005-01-01

    Mozambique tilapia Oreochromis mossambicus embryos were transferred from freshwater to seawater and vice versa, and short-term changes in the localization of three major ion transport proteins, Na+/K +-ATPase, Na+/K+/2Cl- cotransporter (NKCC) and cystic fibrosis transmembrane conductance regulator (CFTR) were examined within mitochondrion-rich cells (MRCs) in the embryonic yolk-sac membrane. Triple-color immunofluorescence staining allowed us to classify MRCs into four types: type I, showing only basolateral Na+/K +-ATPase staining; type II, basolateral Na+/K +-ATPase and apical NKCC; type III, basolateral Na+/K +-ATPase and basolateral NKCC; type IV, basolateral Na +/K+-ATPase, basolateral NKCC and apical CFTR. In freshwater, type-I, type-II and type-III cells were observed. Following transfer from freshwater to seawater, type-IV cells appeared at 12 h and showed a remarkable increase in number between 24 h and 48 h, whereas type-III cells disappeared. When transferred from seawater back to freshwater, type-IV cells decreased and disappeared at 48 h, type-III cells increased, and type-II cells, which were not found in seawater, appeared at 12 h and increased in number thereafter. Type-I cells existed consistently irrespective of salinity changes. These results suggest that type I is an immature MRC, type II is a freshwater-type ion absorptive cell, type III is a dormant type-IV cell and/or an ion absorptive cell (with a different mechanism from type II), and type IV is a seawater-type ion secretory cell. The intracellular localization of the three ion transport proteins in type-IV cells is completely consistent with a widely accepted model for ion secretion by MRCs. A new model for ion absorption is proposed based on type-II cells possessing apical NKCC.

  14. Modulation of type I immediate and type IV delayed immunoreactivity using direct suggestion and guided imagery during hypnosis.

    PubMed

    Zachariae, R; Bjerring, P; Arendt-Nielsen, L

    1989-11-01

    Cutaneous reactivity against histamine skin prick test (Type I) and purified tuberculin protein derivative (Mantoux reaction, Type IV) was studied in eight volunteers under hypnosis. Types I and IV immunoreactivity were modulated by direct suggestion (Type I) and guided imagery (Type IV). The volunteers were highly susceptible subjects, selected by means of the Harvard Group Scale of Hypnotic Susceptibility, Form A. When the volunteers underwent hypnotic suggestion to decrease the cutaneous reaction to histamine prick test, a significant (P less than 0.02) reduction of the flare reaction (area of erythema) was observed compared with control histamine skin prick tests. The wheal reaction did not respond to hypnotic suggestion. Neither wheal nor flare reaction could be increased in size by hypnotic suggestion compared with control histamine skin prick tests. A hypnotic suggestion of increasing the Type IV reaction on one arm and decreasing the reaction on the other revealed a significant difference in both erythema size (P less than 0.02) and palpable induration (P less than 0.01). In two cases the reactions were monitored by laser doppler blood flowmetry and skin thickness measurement by ultrasound. The difference between the suggested increased and decreased reaction was 19% for the laser doppler bloodflow (in favor of the augmented side), and 44% for the dermal infiltrate thickness. This study objectively supports the numerous uncontrolled case reports of modulation of immunoreactivity in allergic diseases involving both Type I and Type IV skin reactions following hypnotic suggestions.

  15. Amplified QCM biosensor for type IV collagenase based on collagenase-cleavage of gold nanoparticles functionalized peptide.

    PubMed

    Dong, Zong-Mu; Jin, Xin; Zhao, Guang-Chao

    2018-05-30

    The present study develops a rapid, simple and efficient method for the determination of type IV collagenase by using a specific peptide-modified quartz crystal microbalance (QCM). A small peptide (P1), contains a specific sequence (Pro-Gly) and a terminal cysteine, was synthetized and immobilized to the surface of QCM electrode via the reaction between Au and thiol of the cysteine. The peptide bond between proline and glycine can be specific hydrolyzed cleavage by type IV collagenase, which enabled the modified electrode with a high selectivity toward type IV collagenase. The cleaving process caused a frequency change of QCM to give a signal related to the concentration of type IV collagenase. The morphologies of the modified electrodes were characterized by scanning electron microscope (SEM) and the specific hydrolyzed cleavage process was monitored by QCM. When P1 was modified with gold nanoparticles (P1-Au NPs), the signal could be amplified to further enhance the sensitivity of the designed sensor due to the high-mass of the modified Au NPs. Compared the direct unamplified assay, the values obtained for the limit of detection for type IV collagenase was 0.96 ng mL -1 , yielding about 6.5 times of magnitude improvement in sensitivity. This signal enhanced peptide based QCM biosensor for type IV collagenase also showed good selectivity and sensitivity in complex matrix. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Ultrastructural sinusoidal changes in extrahepatic cholestasis. Light and electron microscopic immunohistochemical localization of collagen type III and type IV.

    PubMed

    Gulubova, M V

    1996-07-01

    Extrahepatic cholestasis causes excessive extracellular matrix formation perisinusoidally. Ito cells, transitional and endothelial cells are considered to be a source of extracellular matrix proteins in experimental cholestasis. The localization of collagens type III and type IV in human liver in extrahepatic cholestasis was investigated immunohistochemically in the present study. Immersion fixation was used after modification to be applied to surgical biopsies with commercially available kits. Sinusoidal changes were observed that indicated excessive collagen and matrix formation. Light microscopically, increased immunostaining with the two collagen antibodies was found perisinusoidally and portally. Ultrastructurally, collagen type III positive fibres were found beneath basement membranes of vessels, in collagen bundles and as a fibrillar network in the space of Disse. Collagen type IV immunostaining was located in portal tracts and near hepatocyte microvilli. Intracellular staining with collagen type IV was detected in the rough endoplasmic reticulum of some transitional cells. Immunostaining was located around transitional cells, Ito cells or endothelial cells mainly. Our study indicates that Ito cells, transitional and endothelial cells are the main source of collagens type III and IV in the space of Disse in extrahepatic cholestasis in humans.

  17. Oxygen microprofile in the prepared sediments and its implication for the sediment oxygen consuming process in a heavily polluted river of China.

    PubMed

    Wang, Chao; Zhai, Wanying; Shan, Baoqing

    2016-05-01

    Dissolved oxygen (DO) microprofiles of prepared sediments from 24 sampling sites in the Fuyang River were measured using a gold amalgam microelectrode in this study. The measured microprofiles can be divided into four types. In type I profiles, DO kept constant in the overlying water and decreased smoothly in the pore water; in type II profile, DO showed fluctuation in the pore water; in type III profiles, DO showed peak in the SWI; in type IV profiles, DO decreased obviously in the overlying water. Type I profiles indicated the absence of benthic organisms and thus the degradation of the sediment habitat. Type II and III profiles indicated the activity of benthic animal and epipelic algae, which is common in the healthy aquatic sediment. Type IV profiles indicated that the excessive accumulation of pollutants in the sediment and thus the serious sediment pollution. There are nine sites showing type I profile, three sites showing type II profile, nine sites showing type III profile, and three sites showing type IV profile in the Fuyang River. The dominance of type I and appearance of type IV indicated that sediment oxygen consumption processes in the Fuyang River were strongly influenced by the sediment pollutants release and the vanish of benthic organisms. The pharmacy, metallurgy, and curriery industries may contribute to the sediment deterioration and thus to the occurrence of type I and type IV oxygen profiles in the Fuyang River.

  18. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome

    PubMed Central

    Kim, Jeong Gyun; Cho, Won-Sang; Kim, Jeong Eun

    2014-01-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure. PMID:24653803

  19. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome.

    PubMed

    Kim, Jeong Gyun; Cho, Won-Sang; Kang, Hyun-Seung; Kim, Jeong Eun

    2014-02-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure.

  20. Symmetrical drug-related intertriginous and flexural exanthema.

    PubMed

    Tan, Sze-Chin; Tan, Justina W-L

    2011-08-01

    Symmetrical drug-related intertriginous and flexural exanthema (SDRIFE), previously termed drug-related baboon syndrome, is a benign and self-limiting type IV hypersensitivity reaction characterized by symmetrical erythema involving the gluteal and intertriginous areas in the absence of systemic involvement. It may also occur in the absence of previous drug exposure. Antibiotics, in particular beta-lactams, comprise the majority of causes of SDRIFE. Other drugs which have been implicated include antihypertensives, radiocontrast media, chemotherapeutic agents, and biologics. Histology of lesional skin is variable with predominance of superficial perivascular inflammatory cell infiltrates. Outcomes of allergy tests are variable with positive delayed intradermal tests reported for penicillin V, allopurinol; positive patch tests for erythromycin, mitomycin, nystatin, pseudoephdrine; positive lymphocyte transformation tests for erythromycin; and positive drug provocation tests for clindamycin, cimetidine, corticosteroids, terbinafine, and valacyclovir. Diagnosis of SDRIFE is dependent upon recognition of the clinical morphology and distribution of the rash, and its temporal relationship to the use of the suspected drug. Outcomes of in-vivo and in-vitro tests have been inconsistent, and thus may not be useful in the identification of the putative drug.

  1. The gene for fibroblast activation protein {alpha} (FAP), a putative cell surface-bound serine protease expressed in cancer stroma and wound healing, maps to chromosome band 2q23

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mathew, S.; Murty, V.V.V.S.; Chaganti, R.S.K.

    The human fibroblast activation protein {alpha} (FAP{alpha}) is an inducible cell surface glycoprotein of M{sub r} 95,000 recognized by a number of monoclonal antibodies (mAbs), including the prototype mAb F19. Immunohistochemical studies have shown that FAP{alpha} expression in vivo is tightly regulated, with transient expression in some fetal mesenchymal tissues but absence of expression in most normal adult tissues. Reexpression of FAP{alpha} is observed in the reactive stromal fibroblasts of several common types of epithelial cancers, including >90% of breast, colorectal, and lung carcinomas and healing wounds. Cloning and sequence analysis of an FAP{alpha}-specific cDNA has revealed that the moleculemore » is encoded by a novel gene, FAP, which shows sequence similarity to members of the serine protease family of integral membrane proteins, namely dipeptidyl peptidase IV (DPPIV, also known as lymphocyte activation antigen, CD26, or adenosine dearoinase binding protein) and DPPX, a DPPIV-related molecule of unknown function. 15 refs., 1 fig.« less

  2. A new system for cultivation of human keratinocytes on acellular dermal matrix substitute with the use of human fibroblast feeder layer.

    PubMed

    Xiao, S; Zhu, S; Ma, B; Xia, Z-F; Yang, J; Wang, G

    2008-01-01

    To improve the proliferative potential of human keratinocytes (HK) cultured on acellular dermal matrix (ADM), HK and mitomycin C-treated human fibroblasts (MMC-HF) were seeded onto ADM to form four types of composite skin: type I, HK were seeded onto the epidermal side of ADM; type II, both HK and MMC-HF were seeded onto the epidermal side; type III, MMC-HF were preseeded onto the dermal side of ADM, and then HK were seeded onto the epidermal side, and type IV, where MMC-HF were preseeded onto both sides, and then HK were seeded onto the epidermal side. Compared with type I and III, the proliferative potential of HK of type II and IV was significantly higher on day 3, 5, 7 and 9 in vitro. In type I and III, HK grew into one layer on day 7-9, while in type II and IV keratinocytes grew into a confluent monolayer by day 4-6. The adherence to ADM of HK in types II and IV was stronger than that in type I and III. The take rate of type II and IV composite skin was also significantly higher. In conclusion, when MMC-HF and HK were cocultured on the epidermal side of ADM, MMC-HF could serve as excellent feeder cells. Copyright 2007 S. Karger AG, Basel.

  3. Ultraviolet properties of IRAS-selected Be stars

    NASA Technical Reports Server (NTRS)

    Bjorkman, Karen S.; Snow, Theodore P.

    1988-01-01

    New IUE observations were obtained of 35 Be stars from a list of stars which show excess infrared fluxes in IRAS data. The IRAS-selected Be stars show larger C IV and Si IV equivalent widths than other Be stars. Excess C IV and Si IV absorption seems to be independent of spectral type for IRAS-selected Be stars later than spectral type B4. This is interpreted as evidence for a possible second mechanism acting in conjunction with radiation pressure for producing the winds in Be stars. No clear correlation of IR excess of v sin i with C IV or Si IV equivalent widths is seen, although a threshold for the occurrence of excess C IV and Si IV absorption appears at a v sin i of 150 km/sec.

  4. Genetics Home Reference: congenital insensitivity to pain with anhidrosis

    MedlinePlus

    ... is also known as hereditary sensory and autonomic neuropathy type IV. The signs and symptoms of CIPA ... to pain with anhidrosis hereditary sensory and autonomic neuropathy type IV hereditary sensory and autonomic neuropathy, type ...

  5. Collagen type IV at the fetal-maternal interface.

    PubMed

    Oefner, C M; Sharkey, A; Gardner, L; Critchley, H; Oyen, M; Moffett, A

    2015-01-01

    Extracellular matrix proteins play a crucial role in influencing the invasion of trophoblast cells. However the role of collagens and collagen type IV (col-IV) in particular at the implantation site is not clear. Immunohistochemistry was used to determine the distribution of collagen types I, III, IV and VI in endometrium and decidua during the menstrual cycle and the first trimester of pregnancy. Expression of col-IV alpha chains during the reproductive cycle was determined by qPCR and protein localisation by immunohistochemistry. The structure of col-IV in placenta was examined using transmission electron microscopy. Finally, the expression of col-IV alpha chain NC1 domains and collagen receptors was localised by immunohistochemistry. Col-IV alpha chains were selectively up-regulated during the menstrual cycle and decidualisation. Primary extravillous trophoblast cells express collagen receptors and secrete col-IV in vitro and in vivo, resulting in the increased levels found in decidua basalis compared to decidua parietalis. A novel expression pattern of col-IV in the mesenchyme of placental villi, as a three-dimensional network, was found. NC1 domains of col-IV alpha chains are known to regulate tumour cell migration and the selective expression of these domains in decidua basalis compared to decidua parietalis was determined. Col-IV is expressed as novel forms in the placenta. These findings suggest that col-IV not only represents a structural protein providing tissue integrity but also influences the invasive behaviour of trophoblast cells at the implantation site. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  7. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  8. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  9. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Xiu-Li, E-mail: usually.158@163.com; Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, No 169 Donghu Road, Wuchang District, Wuhan 430071; Peng, Chun-Wei, E-mail: pqc278@163.com

    Highlights: {yields} HER2 level is closely related to the biologic behaviors of breast cancer cells. {yields} A new method to simultaneously image HER2 and type IV collagen was established. {yields} HER2 status and type IV collagen degradation predict breast cancer invasion. {yields} The complex interactions between tumor and its environment were revealed. -- Abstract: It has been well recognized that human epidermal growth factor receptor 2 (HER2) level in breast cancer (BC) is closely related to the malignant biologic behaviors of the tumor, including invasion and metastasis. Yet, there has been a lack of directly observable evidence to support suchmore » notion. Here we report a quantum dots (QDs)-based double-color imaging technique to simultaneously show the HER2 level on BC cells and the type IV collagen in the tumor matrix. In benign breast tumor, the type IV collagen was intact. With the increasing of HER2 expression level, there has been a progressive decrease in type IV collagen around the cancer nest. At HER2 (3+) expression level, there has virtually been a total destruction of type IV collagen. Moreover, HER2 (3+) BC cells also show direct invasion into the blood vessels. This novel imaging method provides direct observable evidence to support the theory that the HER2 expression level is directly related to BC invasion.« less

  11. On the Directivity of Low-Frequency Type IV Radio Bursts

    NASA Technical Reports Server (NTRS)

    Gopalswamy, N.; Akiyama, S.; Makela, P.; Yashiro, S.; Cairns, I. H.

    2016-01-01

    An intense type IV radio burst was observed by the STEREO Behind (STB) spacecraft located about 144 deg. behind Earth. The burst was associated with a large solar eruption that occurred on the backside of the Sun (N05E151) close to the disk center in the STB view. The eruption was also observed by the STEREO Ahead (STA) spacecraft (located at 149 deg. ahead of Earth) as an eruption close to the west limb (N05W60) in that view. The type IV burst was complete in STB observations in that the envelope reached the lowest frequency and then receded to higher frequencies. The burst was partial viewed from STA, revealing only the edge coming down to the lowest frequency. The type IV burst was not observed at all near Earth because the source was 61 deg. behind the east limb. The eruption was associated with a low-frequency type II burst observed in all three views, although it was not very intense. Solar energetic particles were also observed at both STEREOs and at SOHO, suggesting that the shock was much extended, consistent with the very high speed of the CME (2048 km/s). These observations suggest that the type IV emission is directed along a narrow cone above the flare site. We confirm this result statistically using the type IV bursts of solar cycle 23.

  12. Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

    PubMed

    Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

    2012-06-01

    Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

    PubMed Central

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

    1999-01-01

    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the control of a constitutive promoter resulted in heterologous enterocin A production in both E. faecalis and Lactococcus lactis. PMID:10103244

  14. Type IV carbonic anhydrase is present in the gills of spiny dogfish (Squalus acanthias).

    PubMed

    Gilmour, K M; Bayaa, M; Kenney, L; McNeill, B; Perry, S F

    2007-01-01

    Physiological and biochemical studies have provided indirect evidence for a membrane-associated carbonic anhydrase (CA) isoform, similar to mammalian type IV CA, in the gills of dogfish (Squalus acanthias). This CA isoform is linked to the plasma membrane of gill epithelial cells by a glycosylphosphatidylinositol anchor and oriented toward the plasma, such that it can catalyze the dehydration of plasma HCO(3)(-) ions. The present study directly tested the hypothesis that CA IV is present in dogfish gills in a location amenable to catalyzing plasma HCO(3)(-) dehydration. Homology cloning techniques were used to assemble a 1,127 base pair cDNA that coded for a deduced protein of 306 amino acids. Phylogenetic analysis suggested that this protein was a type IV CA. For purposes of comparison, a second cDNA (1,107 base pairs) was cloned from dogfish blood; it encoded a deduced protein of 260 amino acids that was identified as a cytosolic CA through phylogenetic analysis. Using real-time PCR and in situ hybridization, mRNA expression for the dogfish type IV CA was detected in gill tissue and specifically localized to pillar cells and branchial epithelial cells that flanked the pillar cells. Immunohistochemistry using a polyclonal antibody raised against rainbow trout type IV CA revealed a similar pattern of CA IV immunoreactivity and demonstrated a limited degree of colocalization with Na(+)-K(+)-ATPase immunoreactivity. The presence and localization of a type IV CA isoform in the gills of dogfish is consistent with the hypothesis that branchial membrane-bound CA with an extracellular orientation contributes to CO(2) excretion in dogfish by catalyzing the dehydration of plasma HCO(3)(-) ions.

  15. Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

    1994-04-01

    The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

  16. Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

    PubMed

    Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

    2015-04-02

    Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

  17. Genomic Organization and Molecular Analysis of Virulent Bacteriophage 2972 Infecting an Exopolysaccharide-Producing Streptococcus thermophilus Strain

    PubMed Central

    Lévesque, Céline; Duplessis, Martin; Labonté, Jessica; Labrie, Steve; Fremaux, Christophe; Tremblay, Denise; Moineau, Sylvain

    2005-01-01

    The Streptococcus thermophilus virulent pac-type phage 2972 was isolated from a yogurt made in France in 1999. It is a representative of several phages that have emerged with the industrial use of the exopolysaccharide-producing S. thermophilus strain RD534. The genome of phage 2972 has 34,704 bp with an overall G+C content of 40.15%, making it the shortest S. thermophilus phage genome analyzed so far. Forty-four open reading frames (ORFs) encoding putative proteins of 40 or more amino acids were identified, and bioinformatic analyses led to the assignment of putative functions to 23 ORFs. Comparative genomic analysis of phage 2972 with the six other sequenced S. thermophilus phage genomes confirmed that the replication module is conserved and that cos- and pac-type phages have distinct structural and packaging genes. Two group I introns were identified in the genome of 2972. They interrupted the genes coding for the putative endolysin and the terminase large subunit. Phage mRNA splicing was demonstrated for both introns, and the secondary structures were predicted. Eight structural proteins were also identified by N-terminal sequencing and/or matrix-assisted laser desorption ionization—time-of-flight mass spectrometry. Detailed analysis of the putative minor tail proteins ORF19 and ORF21 as well as the putative receptor-binding protein ORF20 showed the following interesting features: (i) ORF19 is a hybrid protein, because it displays significant identity with both pac- and cos-type phages; (ii) ORF20 is unique; and (iii) a protein similar to ORF21 of 2972 was also found in the structure of the cos-type phage DT1, indicating that this structural protein is present in both S. thermophilus phage groups. The implications of these findings for phage classification are discussed. PMID:16000821

  18. Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

    PubMed

    Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

    2005-04-01

    The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

  19. The Role of Dipeptidyl Peptidase IV in Lung Metastasis of Breast Cancer Cells

    DTIC Science & Technology

    1999-05-01

    Our studies focused on (1) cloning and sequencing of wild-type endothelial DPP IV (wtDPP IV) and preparation of truncated DPP IV ( tDPP IV); (2...that was identical to hepatic DPP IV. Acid extraction of rat lung yielded a tDPP IV, which was an effective inhibitor of breast cancer cell adhesion to

  20. Characterization of a Theta-Type Plasmid from Lactobacillus sakei: a Potential Basis for Low-Copy-Number Vectors in Lactobacilli

    PubMed Central

    Alpert, Carl-Alfred; Crutz-Le Coq, Anne-Marie; Malleret, Christine; Zagorec, Monique

    2003-01-01

    The complete nucleotide sequence of the 13-kb plasmid pRV500, isolated from Lactobacillus sakei RV332, was determined. Sequence analysis enabled the identification of genes coding for a putative type I restriction-modification system, two genes coding for putative recombinases of the integrase family, and a region likely involved in replication. The structural features of this region, comprising a putative ori segment containing 11- and 22-bp repeats and a repA gene coding for a putative initiator protein, indicated that pRV500 belongs to the pUCL287 subfamily of theta-type replicons. A 3.7-kb fragment encompassing this region was fused to an Escherichia coli replicon to produce the shuttle vector pRV566 and was observed to be functional in L. sakei for plasmid replication. The L. sakei replicon alone could not support replication in E. coli. Plasmid pRV500 and its derivative pRV566 were determined to be at very low copy numbers in L. sakei. pRV566 was maintained at a reasonable rate over 20 generations in several lactobacilli, such as Lactobacillus curvatus, Lactobacillus casei, and Lactobacillus plantarum, in addition to L. sakei, making it an interesting basis for developing vectors. Sequence relationships with other plasmids are described and discussed. PMID:12957947

  1. Gene Discovery through Genomic Sequencing of Brucella abortus

    PubMed Central

    Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

    2001-01-01

    Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979

  2. Mn(II,III) oxidation and MnO 2 mineralization by an expressed bacterial multicopper oxidase

    DOE PAGES

    Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung -Woo; ...

    2013-07-01

    Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of themore » enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. Lastly, with the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs.« less

  3. Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase

    NASA Astrophysics Data System (ADS)

    Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung-Woo; Spiro, Thomas G.; Tebo, Bradley M.

    2013-07-01

    Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. With the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs.

  4. Mn(II,III) oxidation and MnO2 mineralization by an expressed bacterial multicopper oxidase

    PubMed Central

    Butterfield, Cristina N.; Soldatova, Alexandra V.; Lee, Sung-Woo; Spiro, Thomas G.; Tebo, Bradley M.

    2013-01-01

    Reactive Mn(IV) oxide minerals are ubiquitous in the environment and control the bioavailability and distribution of many toxic and essential elements and organic compounds. Their formation is thought to be dependent on microbial enzymes, because spontaneous Mn(II) to Mn(IV) oxidation is slow. Several species of marine Bacillus spores oxidize Mn(II) on their exosporium, the outermost layer of the spore, encrusting them with Mn(IV) oxides. Molecular studies have identified the mnx (Mn oxidation) genes, including mnxG, encoding a putative multicopper oxidase (MCO), as responsible for this two-electron oxidation, a surprising finding because MCOs only catalyze single-electron transfer reactions. Characterization of the enzymatic mechanism has been hindered by the lack of purified protein. By purifying active protein from the mnxDEFG expression construct, we found that the resulting enzyme is a blue (absorption maximum 590 nm) complex containing MnxE, MnxF, and MnxG proteins. Further, by analyzing the Mn(II)- and (III)-oxidizing activity in the presence of a Mn(III) chelator, pyrophosphate, we found that the complex facilitates both electron transfers from Mn(II) to Mn(III) and from Mn(III) to Mn(IV). X-ray absorption spectroscopy of the Mn mineral product confirmed its similarity to Mn(IV) oxides generated by whole spores. Our results demonstrate that Mn oxidation from soluble Mn(II) to Mn(IV) oxides is a two-step reaction catalyzed by an MCO-containing complex. With the purification of active Mn oxidase, we will be able to uncover its mechanism, broadening our understanding of Mn mineral formation and the bioinorganic capabilities of MCOs. PMID:23818588

  5. The distal short consensus repeats 1 and 2 of the membrane cofactor protein CD46 and their distance from the cell membrane determine productive entry of species B adenovirus serotype 35.

    PubMed

    Fleischli, Christoph; Verhaagh, Sandra; Havenga, Menzo; Sirena, Dominique; Schaffner, Walter; Cattaneo, Roberto; Greber, Urs F; Hemmi, Silvio

    2005-08-01

    The human regulator of complement activation membrane cofactor protein (CD46) has recently been identified as an attachment receptor for most species B adenoviruses (Ads), including Ad type 3 (Ad3), Ad11, and Ad35, as well as species D Ad37. To characterize the interaction between Ad35 and CD46, hybrid receptors composed of different CD46 short consensus repeat (SCR) domains fused to immunoglobulin-like domains of CD4 and a set of 36 CD46 mutants containing semiconservative changes of single amino acids within SCR domains I and II were tested in binding and in Ad35-mediated luciferase transduction assays. In addition, anti-CD46 antibodies and soluble polypeptides constituting various CD46 domains were used in binding inhibition studies. Our data indicate that (i) CD46 SCR I or SCR II alone confers low but significant Ad35 binding; (ii) the presence of SCR I and II is required for optimal binding and transgene expression; (iii) transduction efficiencies equivalent to that of full-length CD46 are obtained if SCR I and II are at an appropriate distance from the cell membrane; (iv) ablation of the N-glycan attached to SCR I has no influence on receptor function, whereas ablation of the SCR II N-glycan results in about a two- to threefold reduction of binding and transgene expression; (v) most putative Ad35 binding residues are located on the same solvent-exposed face of the SCR I or SCR II domain, which are twisted by about 90 degrees ; and (vi) the putative Ad35 binding sites partly overlap with the measles virus binding surface.

  6. The Distal Short Consensus Repeats 1 and 2 of the Membrane Cofactor Protein CD46 and Their Distance from the Cell Membrane Determine Productive Entry of Species B Adenovirus Serotype 35

    PubMed Central

    Fleischli, Christoph; Verhaagh, Sandra; Havenga, Menzo; Sirena, Dominique; Schaffner, Walter; Cattaneo, Roberto; Greber, Urs F.; Hemmi, Silvio

    2005-01-01

    The human regulator of complement activation membrane cofactor protein (CD46) has recently been identified as an attachment receptor for most species B adenoviruses (Ads), including Ad type 3 (Ad3), Ad11, and Ad35, as well as species D Ad37. To characterize the interaction between Ad35 and CD46, hybrid receptors composed of different CD46 short consensus repeat (SCR) domains fused to immunoglobulin-like domains of CD4 and a set of 36 CD46 mutants containing semiconservative changes of single amino acids within SCR domains I and II were tested in binding and in Ad35-mediated luciferase transduction assays. In addition, anti-CD46 antibodies and soluble polypeptides constituting various CD46 domains were used in binding inhibition studies. Our data indicate that (i) CD46 SCR I or SCR II alone confers low but significant Ad35 binding; (ii) the presence of SCR I and II is required for optimal binding and transgene expression; (iii) transduction efficiencies equivalent to that of full-length CD46 are obtained if SCR I and II are at an appropriate distance from the cell membrane; (iv) ablation of the N-glycan attached to SCR I has no influence on receptor function, whereas ablation of the SCR II N-glycan results in about a two- to threefold reduction of binding and transgene expression; (v) most putative Ad35 binding residues are located on the same solvent-exposed face of the SCR I or SCR II domain, which are twisted by about 90°; and (vi) the putative Ad35 binding sites partly overlap with the measles virus binding surface. PMID:16014961

  7. Transcriptional and Functional Studies of Acidithiobacillus ferrooxidans Genes Related to Survival in the Presence of Copper▿

    PubMed Central

    Navarro, Claudio A.; Orellana, Luis H.; Mauriaca, Cecilia; Jerez, Carlos A.

    2009-01-01

    The acidophilic Acidithiobacillus ferrooxidans can resist exceptionally high copper (Cu) concentrations. This property is important for its use in biomining processes, where Cu and other metal levels range usually between 15 and 100 mM. To learn about the mechanisms that allow A. ferrooxidans cells to survive in this environment, a bioinformatic search of its genome showed the presence of at least 10 genes that are possibly related to Cu homeostasis. Among them are three genes coding for putative ATPases related to the transport of Cu (A. ferrooxidans copA1 [copA1Af], copA2Af, and copBAf), three genes related to a system of the resistance nodulation cell division family involved in the extraction of Cu from the cell (cusAAf, cusBAf, and cusCAf), and two genes coding for periplasmic chaperones for this metal (cusFAf and copCAf). The expression of most of these open reading frames was studied by real-time reverse transcriptase PCR using A. ferrooxidans cells adapted for growth in the presence of high concentrations of Cu. The putative A. ferrooxidans Cu resistance determinants were found to be upregulated when this bacterium was exposed to Cu in the range of 5 to 25 mM. These A. ferrooxidans genes conferred to Escherichia coli a greater Cu resistance than wild-type cells, supporting their functionality. The results reported here and previously published data strongly suggest that the high resistance of the extremophilic A. ferrooxidans to Cu may be due to part or all of the following key elements: (i) a wide repertoire of Cu resistance determinants, (ii) the duplication of some of these Cu resistance determinants, (iii) the existence of novel Cu chaperones, and (iv) a polyP-based Cu resistance system. PMID:19666734

  8. A global analysis of protein expression profiles in Sinorhizobium meliloti: discovery of new genes for nodule occupancy and stress adaptation.

    PubMed

    Djordjevic, Michael A; Chen, Han Cai; Natera, Siria; Van Noorden, Giel; Menzel, Christian; Taylor, Scott; Renard, Clotilde; Geiger, Otto; Weiller, Georg F

    2003-06-01

    A proteomic examination of Sinorhizobium meliloti strain 1021 was undertaken using a combination of 2-D gel electrophoresis, peptide mass fingerprinting, and bioinformatics. Our goal was to identify (i) putative symbiosis- or nutrient-stress-specific proteins, (ii) the biochemical pathways active under different conditions, (iii) potential new genes, and (iv) the extent of posttranslational modifications of S. meliloti proteins. In total, we identified the protein products of 810 genes (13.1% of the genome's coding capacity). The 810 genes generated 1,180 gene products, with chromosomal genes accounting for 78% of the gene products identified (18.8% of the chromosome's coding capacity). The activity of 53 metabolic pathways was inferred from bioinformatic analysis of proteins with assigned Enzyme Commission numbers. Of the remaining proteins that did not encode enzymes, ABC-type transporters composed 12.7% and regulatory proteins 3.4% of the total. Proteins with up to seven transmembrane domains were identified in membrane preparations. A total of 27 putative nodule-specific proteins and 35 nutrient-stress-specific proteins were identified and used as a basis to define genes and describe processes occurring in S. meliloti cells in nodules and under stress. Several nodule proteins from the plant host were present in the nodule bacteria preparations. We also identified seven potentially novel proteins not predicted from the DNA sequence. Post-translational modifications such as N-terminal processing could be inferred from the data. The posttranslational addition of UMP to the key regulator of nitrogen metabolism, PII, was demonstrated. This work demonstrates the utility of combining mass spectrometry with protein arraying or separation techniques to identify candidate genes involved in important biological processes and niche occupations that may be intransigent to other methods of gene expression profiling.

  9. Matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in paediatric burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors.

    PubMed

    Weremijewicz, Artur; Matuszczak, Ewa; Sankiewicz, Anna; Tylicka, Marzena; Komarowska, Marta; Tokarzewicz, Anna; Debek, Wojciech; Gorodkiewicz, Ewa; Hermanowicz, Adam

    2018-06-01

    The purpose of this study was the determination of matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in the blood plasma of burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors. 31 children scalded by hot water who were managed at the Department of Paediatric Surgery between 2014-2015, after primarily presenting with burns in 4-20% TBSA were included into the study (age 9 months up to 14 years, mean age 2,5+1 years). There were 10 girls and 21 boys. Venous blood samples were drawn 2-6h, and 12-16h after the thermal injury, and on the subsequent days 3, 5 and 7. The matrix metalloproteinase-2, collagen type IV and laminin-5 concentrations were assessed using Surface Plasmon Resonance Imaging by the investigators blinded to the other data. The MMP-2, laminin-5 and collagen type IV concentrations in the blood plasma of patients with burns, were highest 12-16h after thermal injury, the difference was statistically significant. The MMP-2, laminin-5 and collagen type IV concentrations measured 3 days, 5 days and 7 days after the thermal injury, slowly decreased over time, and on the 7th day reached the normal range, when compared with the concentration measured in controls. Current work is the first follow-up study regarding MMP-2 in burns. MMP-2, laminin-5 and collagen type IV levels were elevated early after burn injury in the plasma of studied patients, and were highest 12-16h after the injury. MMP-2, laminin-5 and collagen type IV levels were not proportional to the severity of the burn. We believe in the possibility that the gradual decrease of MMP-2, collagen type IV and laminin-5 concentrations could be connected with the process of healing, but to prove it, more investigation is needed in this area. The SPR imaging biosensor is a good diagnostic tool for determination of MMP-2, laminin-5 and collagen type IV in blood plasma of patients with burns. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

  10. Endovascular Treatment of a Carotid Dissecting Pseudoaneurysm in a Patient with Ehlers-Danlos Syndrome Type IV with Fatal Outcome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lim, Siok Ping, E-mail: siokpinglim@yahoo.co.uk; Duddy, Martin J.

    2008-01-15

    We present a patient with Ehlers-Danlos syndrome type IV (EDS IV) with a carotid dissecting pseudoaneurysm causing severe carotid stenosis. This lesion was treated endovascularly. Unfortunately, the patient died of remote vascular catastrophes (intracranial hemorrhage and abdominal aortic rupture). This unique case illustrates the perils of endovascular treatment of EDS IV patients and the need for preoperative screening for concomitant lesions. It also shows that a dissecting pseudoaneurysm can feasibly be treated with a covered stent and that closure is effective using Angioseal in patients with EDS IV.

  11. Analysis of the Legionella longbeachae Genome and Transcriptome Uncovers Unique Strategies to Cause Legionnaires' Disease

    PubMed Central

    Rusniok, Christophe; Lomma, Mariella; Dervins-Ravault, Delphine; Newton, Hayley J.; Sansom, Fiona M.; Jarraud, Sophie; Zidane, Nora; Ma, Laurence; Bouchier, Christiane; Etienne, Jerôme; Hartland, Elizabeth L.; Buchrieser, Carmen

    2010-01-01

    Legionella pneumophila and L. longbeachae are two species of a large genus of bacteria that are ubiquitous in nature. L. pneumophila is mainly found in natural and artificial water circuits while L. longbeachae is mainly present in soil. Under the appropriate conditions both species are human pathogens, capable of causing a severe form of pneumonia termed Legionnaires' disease. Here we report the sequencing and analysis of four L. longbeachae genomes, one complete genome sequence of L. longbeachae strain NSW150 serogroup (Sg) 1, and three draft genome sequences another belonging to Sg1 and two to Sg2. The genome organization and gene content of the four L. longbeachae genomes are highly conserved, indicating strong pressure for niche adaptation. Analysis and comparison of L. longbeachae strain NSW150 with L. pneumophila revealed common but also unexpected features specific to this pathogen. The interaction with host cells shows distinct features from L. pneumophila, as L. longbeachae possesses a unique repertoire of putative Dot/Icm type IV secretion system substrates, eukaryotic-like and eukaryotic domain proteins, and encodes additional secretion systems. However, analysis of the ability of a dotA mutant of L. longbeachae NSW150 to replicate in the Acanthamoeba castellanii and in a mouse lung infection model showed that the Dot/Icm type IV secretion system is also essential for the virulence of L. longbeachae. In contrast to L. pneumophila, L. longbeachae does not encode flagella, thereby providing a possible explanation for differences in mouse susceptibility to infection between the two pathogens. Furthermore, transcriptome analysis revealed that L. longbeachae has a less pronounced biphasic life cycle as compared to L. pneumophila, and genome analysis and electron microscopy suggested that L. longbeachae is encapsulated. These species-specific differences may account for the different environmental niches and disease epidemiology of these two Legionella species. PMID:20174605

  12. Pseudomonas aeruginosa type IV minor pilins and PilY1 regulate virulence by modulating FimS-AlgR activity.

    PubMed

    Marko, Victoria A; Kilmury, Sara L N; MacNeil, Lesley T; Burrows, Lori L

    2018-05-18

    Type IV pili are expressed by a wide range of prokaryotes, including the opportunistic pathogen Pseudomonas aeruginosa. These flexible fibres mediate twitching motility, biofilm maturation, surface adhesion, and virulence. The pilus is composed mainly of major pilin subunits while the low abundance minor pilins FimU-PilVWXE and the putative adhesin PilY1 prime pilus assembly and are proposed to form the pilus tip. The minor pilins and PilY1 are encoded in an operon that is positively regulated by the FimS-AlgR two-component system. Independent of pilus assembly, PilY1 was proposed to be a mechanosensory component that-in conjunction with minor pilins-triggers up-regulation of acute virulence phenotypes upon surface attachment. Here, we investigated the link between the minor pilins/PilY1 and virulence. pilW, pilX, and pilY1 mutants had reduced virulence towards Caenorhabditis elegans relative to wild type or a major pilin mutant, implying a role in pathogenicity that is independent of pilus assembly. We hypothesized that loss of specific minor pilins relieves feedback inhibition on FimS-AlgR, increasing transcription of the AlgR regulon and delaying C. elegans killing. Reporter assays confirmed that FimS-AlgR were required for increased expression of the minor pilin operon upon loss of select minor pilins. Overexpression of AlgR or its hyperactivation via a phosphomimetic mutation reduced virulence, and the virulence defects of pilW, pilX, and pilY1 mutants required FimS-AlgR expression and activation. We propose that PilY1 and the minor pilins inhibit their own expression, and that loss of these proteins leads to FimS-mediated activation of AlgR that suppresses expression of acute-phase virulence factors and delays killing. This mechanism could contribute to adaptation of P. aeruginosa in chronic lung infections, as mutations in the minor pilin operon result in the loss of piliation and increased expression of AlgR-dependent virulence factors-such as alginate-that are characteristic of such infections.

  13. Role of 17 beta-estradiol on type IV collagen fibers volumetric density in the basement membrane of bladder wall.

    PubMed

    de Fraga, Rogerio; Dambros, Miriam; Miyaoka, Ricardo; Riccetto, Cássio Luís Zanettini; Palma, Paulo César Rodrigues

    2007-10-01

    The authors quantified the type IV collagen fibers volumetric density in the basement membrane of bladder wall of ovariectomized rats with and without estradiol replacement. This study was conducted on 40 Wistar rats (3 months old) randomly divided in 4 groups: group 1, remained intact (control); group 2, submitted to bilateral oophorectomy and daily replacement 4 weeks later of 17 beta-estradiol for 12 weeks; group 3, sham operated and daily replacement 4 weeks later of sesame oil for 12 weeks; and group 4, submitted to bilateral oophorectomy and killed after 12 weeks. It was used in immunohistochemistry evaluation using type IV collagen polyclonal antibody to stain the fibers on paraffin rat bladder sections. The M-42 stereological grid system was used to analyze the fibers. Ovariectomy had an increase effect on the volumetric density of the type IV collagen fibers in the basement membrane of rat bladder wall. Estradiol replacement in castrated animals demonstrated a significative difference in the stereological parameters when compared to the castrated group without hormonal replacement. Surgical castration performed on rats induced an increasing volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall and the estradiol treatment had a significant effect in keeping a low volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall.

  14. Characterization of Staphylococcus aureus faecal isolates associated with food-borne disease in Korea.

    PubMed

    Shin, E; Hong, H; Park, J; Oh, Y; Jung, J; Lee, Y

    2016-07-01

    To characterize Staphylococcus aureus faecal isolates from people suspected to be infected with food poisoning by using antimicrobial susceptibility testing and molecular techniques. A total of 340 Staph. aureus isolates from 6226 people suspected to be infected with food poisoning were identified and characterized by biochemical methods, antimicrobial susceptibility testing and PCR. Samples were obtained from January 2006 to December 2008 from the National Notifiable Diseases Surveillance System at the Research Institute of Public Health and Environment in Seoul Metropolitan, Korea. All strains carried at least one of the eight staphylococcal enterotoxin (se) genes tested and a total of 27 se profiles were produced; the most frequent se profile was seg-sei and the next was sea. Among the total isolates, 36 methicillin-resistant Staphylococcus aureus (MRSAs) isolates were further analysed by multilocus sequence typing (MLST), Staphylococcal cassette chromosome mec (SCCmec) typing, pulsed-field gel electrophoresis (PFGE) and PCR detection for pvl. ST72-SCCmec type IV was the most predominant clone (27 isolates, 75%) followed by ST1-SCCmec type IV (five isolates, 13·8%), ST20-SCCmec type IV (one isolate, 2·8%), ST493-SCCmec type IV (one isolate, 2·8%), ST903-SCCmec type IV (one isolate, 2·8%) and ST5-SCCmec type II (one isolate, 2·8%). By PFGE typing, MRSAs isolated during the same period were grouped together although they were isolated from different regions. None of MRSAs had PVL gene and nine MRSAs were multidrug resistant. Analysis of MRSAs by MLST, SCCmec typing, PFGE and pvl detection showed that the majority of strain associated with food-borne diseases belonged to a Korean community-acquired (CA) MRSA clone with ST72-SCCmec type IV-PVL negative-SEG/SEI and its variations while one strain was hospital-acquired (HA) MRSA. CA-MRSA clone which possessed ST72-SCCmec type IV-PVL negative-SEG/SEI was spread most commonly among MRSAs that were associated with food-borne diseases. This is the first report of ST903 strain in Korea. © 2016 The Society for Applied Microbiology.

  15. Adenocarcinoma of the lung with scattered consolidation: radiological-pathological correlation and prognosis.

    PubMed

    Jiang, Binghu; Takashima, Shodayu; Hakucho, Tomoaki; Hodaka, Numasaki; Yasuhiko, Tomita; Masahiko, Higashiyama

    2013-10-01

    To investigate the clinicopathological features and prognosis in patients with adenocarcinoma of the lung with scattered consolidation (ALSC). Between January 2006 and March 2010, 139 consecutive patients with lung adenocarcinoma of ≤3 cm, who underwent pulmonary resection for lung cancer, were investigated retrospectively. Radiologic classification was based on the findings of thin-section CT such as the presence of consolidation or ground-glass opacity (GGO). Type I (n=15) and Type II (n=14), showed a pure GGO and a mixed GGO with consolidation <50%, respectively. Type IV (n=38) and Type V (n=52) showed a mixed GGO with consolidation ≥50% and a pure consolidation, respectively. Type III (n=20) was the adenocarcinoma of the lung with scattered consolidation (ALSC). The clinicopathological features and prognosis of ALSC was investigated with comparative analysis and survival analysis. Because of the similar recurrence rate for Type I and Type II (P=1.000), Type IV and Type V (P=0.343), we merged Type I and Type II as Type I+II, Type IV and Type V as Type IV+V, respectively. In the 20 (14.4%) patients with ALSC, lymph node metastasis was not observed, and it was rare in lymphatic invasion and vascular invasion. On the basis of IASLC/ATS/ERS 2011 classification, 80% of the ALSC were preinvasive lesions. In Noguchi classification, there was no significant difference between Type I+II and ALSC (P=0.260). The prognosis of ALSC was similar to Type I+II (P=0.408), but better than Type IV+V (P=0.040). Adenocarcinoma of the lung with scattered consolidation (ALSC) on thin-section CT was a relatively favorable prognostic factor. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  16. 46 CFR 164.019-3 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Guard-approved PFDs. Commandant means the Chief of the Lifesaving and Fire Safety Division, Office of... code PFD type acceptable for use 1 I, II, and III. 2 II and III. 3 III. 4B IV (all Ring Buoys). 4BC IV (Buoyant Cushions). 4RB IV (Recreational Ring Buoys only). 5 Wearable Type V (intended use must be...

  17. Metachronous Bilateral Posterior Tibial Artery Aneurysms in Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagspiel, Klaus D., E-mail: kdh2n@virginia.edu; Bonatti, Hugo; Sabri, Saher

    2011-04-15

    Ehlers-Danlos syndrome type IV is a life-threatening genetic connective tissue disorder. We report a 24-year-old woman with EDS-IV who presented with metachronous bilateral aneurysms/pseudoaneurysms of the posterior tibial arteries 15 months apart. Both were treated successfully with transarterial coil embolization from a distal posterior tibial approach.

  18. Genetic Characterization of the Carotenoid Biosynthetic Pathway in Methylobacterium extorquens AM1 and Isolation of a Colorless Mutant

    PubMed Central

    Van Dien, Stephen J.; Marx, Christopher J.; O'Brien, Brooke N.; Lidstrom, Mary E.

    2003-01-01

    Genomic searches were used to reconstruct the putative carotenoid biosynthesis pathway in the pink-pigmented facultative methylotroph Methylobacterium extorquens AM1. Four genes for putative phytoene desaturases were identified. A colorless mutant was obtained by transposon mutagenesis, and the insertion was shown to be in one of the putative phytoene desaturase genes. Mutations in the other three did not affect color. The tetracycline marker was removed from the original transposon mutant, resulting in a pigment-free strain with wild-type growth properties useful as a tool for future experiments. PMID:14660416

  19. Genetic characterization of the carotenoid biosynthetic pathway in Methylobacterium extorquens AM1 and isolation of a colorless mutant.

    PubMed

    Van Dien, Stephen J; Marx, Christopher J; O'Brien, Brooke N; Lidstrom, Mary E

    2003-12-01

    Genomic searches were used to reconstruct the putative carotenoid biosynthesis pathway in the pink-pigmented facultative methylotroph Methylobacterium extorquens AM1. Four genes for putative phytoene desaturases were identified. A colorless mutant was obtained by transposon mutagenesis, and the insertion was shown to be in one of the putative phytoene desaturase genes. Mutations in the other three did not affect color. The tetracycline marker was removed from the original transposon mutant, resulting in a pigment-free strain with wild-type growth properties useful as a tool for future experiments.

  20. Molecular determinants of Cytochrome C oxidase IV mRNA axonal trafficking

    PubMed Central

    Kar, Amar N.; Vargas, Jose Norberto S.; Chen, Cai-Yun; Kowalak, Jeffrey A; Gioio, Anthony E.; Kaplan, Barry B.

    2017-01-01

    In previous studies, we identified a putative 38-nucleotide stem-loop structure (zipcode) in the 3′ untranslated region of the cytochrome c oxidase subunit IV (COXIV) mRNA that was necessary and sufficient for the axonal localization of the message in primary superior cervical ganglion (SCG) neurons. However, little is known about the proteins that interact with the COXIV-zipcode and regulate the axonal trafficking and local translation of the COXIV message. To identify proteins involved in the axonal transport of the COXIV mRNA, we used the biotinylated 38-nucleotide COXIV RNA zipcode as bait in the affinity purification of COXIV zipcode binding proteins. Gel-shift assays of the biotinylated COXIV zipcode indicated that the putative stem-loop structure functions as a nucleation site for the formation of ribonucleoprotein complexes. Mass spectrometric analysis of the COXIV zipcode ribonucleoprotein complex led to the identification of a large number RNA binding proteins, including fused in sarcoma/translated in liposarcoma (FUS/TLS), and Y-box protein 1 (YB-1). Validation experiments, using western analyses, confirmed the presence of the candidate proteins in the COXIV zipcode affinity purified complexes obtained from SCG axons. Immunohistochemical studies show that FUS, and YB-1 are present in SCG axons. Importantly, RNA immunoprecipitation studies show that FUS, and YB-1 interact with endogenous axonal COXIV transcripts. siRNA-mediated downregulation of the candidate proteins FUS and YB-1 expression in the cell-bodies diminishes the levels of COXIV mRNA in the axon, suggesting functional roles for these proteins in the axonal trafficking of COXIV mRNA. PMID:28161363

  1. Interstellar C IV and Si IV column densities toward early-type stars

    NASA Technical Reports Server (NTRS)

    Bruhweiler, F. C.; Kondo, Y.; Mccluskey, G. E.

    1980-01-01

    Equivalent widths and deduced column densities of Si IV and C IV are examined for 18 early-type close binaries, and physical processes responsible for the origin of these ions in the interstellar medium are investigated. The available C IV/Si IV column density ratios typically lie within a narrow range from 0.8 to 4.5, and there is evidence that the column density of C IV is higher than that of N V along most lines of sight, suggesting that C IV is not formed in the same hot region as O VI. In addition, the existence of regions with a narrowly defined new temperature range around 50,000 deg K is indicated. The detection of the semitorrid gas of Bruhweiler, Kondo, and McCluskey (1978, 1979) is substantiated, and the relation of this gas to the observations of coronal gas in the galactic halo is discussed.

  2. Serotype IV and invasive group B Streptococcus disease in neonates, Minnesota, USA, 2000-2010.

    PubMed

    Ferrieri, Patricia; Lynfield, Ruth; Creti, Roberta; Flores, Aurea E

    2013-04-01

    Group B Streptococcus (GBS) is a major cause of invasive disease in neonates in the United States. Surveillance of invasive GBS disease in Minnesota, USA, during 2000-2010 yielded 449 isolates from 449 infants; 257 had early-onset (EO) disease (by age 6 days) and 192 late-onset (LO) disease (180 at age 7-89 days, 12 at age 90-180 days). Isolates were characterized by capsular polysaccharide serotype and surface-protein profile; types III and Ia predominated. However, because previously uncommon serotype IV constitutes 5/31 EO isolates in 2010, twelve type IV isolates collected during 2000-2010 were studied further. By pulsed-field gel electrophoresis, they were classified into 3 profiles; by multilocus sequence typing, representative isolates included new sequence type 468. Resistance to clindamycin or erythromycin was detected in 4/5 serotype IV isolates. Emergence of serotype IV GBS in Minnesota highlights the need for serotype prevalence monitoring to detect trends that could affect prevention strategies.

  3. The effects of wearing Passenger Protective Breathing Equipment on evacuation times through type III and type IV emergency aircraft exits in clear air and smoke.

    DOT National Transportation Integrated Search

    1989-11-01

    The effects of Passenger Protective Breathing Equipment (PPBE) on the time required for simulated emergency evacuations through Type III and Type IV overwing aircraft exits were studied in two quasi-independent experiments, one in clear air and anoth...

  4. An Analysis of Type IV Precision Measurement Equipment Laboratory Logistical Support Relative to the Implementation of F-15/F-16 Two-Level Maintenance

    DTIC Science & Technology

    1994-09-01

    wife, Margie, for her patience and understanding. Graduate school definitely affects the family . Margie allowed me to use many valuable family hours...Consolidations and reorganizations, in which the face of logistics is changing day -by- day , are taking place throughout the Department of Defense. Two...will focus on Type IV F-15 and Type IV F-16 PMELs. Imporane of Research The two-level maintenance concept significantly alters the structure of

  5. Collagen IV Diseases: A Focus on the Glomerular Basement Membrane in Alport Syndrome

    PubMed Central

    Cosgrove, Dominic; Liu, Shiguang

    2016-01-01

    Alport syndrome is the result of mutations in any of three type IV collagen genes, COL4A3, COL4A4, or COL4A5. Because the three collagen chains form heterotrimers, there is an absence of all three proteins in the basement membranes where they are expressed. In the glomerulus, the mature glomerular basement membrane type IV collagen network, normally comprised of two separate networks, α3(IV)/α4(IV)/α5(IV) and α1(IV)/α2(IV), is comprised entirely of collagen α1(IV)/α2. This review addresses the current state of our knowledge regarding the consequence of this change in basement membrane composition, including both the direct, via collagen receptor binding, and indirect, regarding influences on glomerular biomechanics. The state of our current understanding regarding mechanisms of glomerular disease initiation and progression will be examined, as will the current state of the art regarding emergent therapeutic approaches to slow or arrest glomerular disease in Alport patients. PMID:27576055

  6. Glomerular basement membrane injuries in IgA nephropathy evaluated by double immunostaining for α5(IV) and α2(IV) chains of type IV collagen and low-vacuum scanning electron microscopy.

    PubMed

    Masuda, Yukinari; Yamanaka, Nobuaki; Ishikawa, Arimi; Kataoka, Mitue; Arai, Takashi; Wakamatsu, Kyoko; Kuwahara, Naomi; Nagahama, Kiyotaka; Ichikawa, Kaori; Shimizu, Akira

    2015-06-01

    The glomerulus contains well-developed capillaries, which are at risk of injury due to high hydrostatic pressure, hyperfiltration, hypertension and inflammation. However, the pathological alterations of the injured glomerular basement membrane (GBM), the main component of the glomerular filtration barrier, are still uncertain in cases of glomerulonephritis. We examined the alterations of the GBM in 50 renal biopsy cases with IgA nephropathy (31.8 ± 17.6 years old) using double immunostaining for the α2(IV) and α5(IV) chains of type IV collagen, and examining the ultrastructural alterations by transmission electron microscopy (TEM) and low-vacuum scanning electron microscopy (LV-SEM). The GBM of IgA nephropathy cases showed various morphological and qualitative alterations. In the TEM findings, thinning, gaps, rupture, thickening with a lamellar and reticular structure and double contours were detected in the GBM. Double immunostaining for α5(IV) and α2(IV) showed thickening of the GBM with reduced α5(IV) and increased α2(IV), or mosaic images of α5(IV) and α2(IV), and holes, fractures, spiny projections and rupture of α5(IV) in the GBM. In addition, LV-SEM showed an etched image and multiple holes in a widening and wavy GBM. These findings might be associated with the development of a brittle GBM in IgA nephropathy. Glomerular basement membrane alterations were frequently noted in IgA nephropathy, and were easily evaluated by double immunostaining for α2(IV) and α5(IV) of type IV collagen and LV-SEM. The application of these analyses to human renal biopsy specimens may enhance our understanding of the alterations of the GBM that occur in human glomerular diseases.

  7. Genetics Home Reference: glycogen storage disease type IV

    MedlinePlus

    ... 000 to 800,000 individuals worldwide. Type IV accounts for roughly 3 percent of all cases of glycogen storage disease. Related Information What information about a genetic condition can statistics ...

  8. Proteomic profiling of tandem affinity purified 14-3-3 protein complexes in Arabidopsis thaliana.

    PubMed

    Chang, Ing-Feng; Curran, Amy; Woolsey, Rebekah; Quilici, David; Cushman, John C; Mittler, Ron; Harmon, Alice; Harper, Jeffrey F

    2009-06-01

    In eukaryotes, 14-3-3 dimers regulate hundreds of functionally diverse proteins (clients), typically in phosphorylation-dependent interactions. To uncover new clients, 14-3-3 omega (At1g78300) from Arabidopsis was engineered with a "tandem affinity purification" tag and expressed in transgenic plants. Purified complexes were analyzed by tandem MS. Results indicate that 14-3-3 omega can dimerize with at least 10 of the 12 14-3-3 isoforms expressed in Arabidopsis. The identification here of 121 putative clients provides support for in vivo 14-3-3 interactions with a diverse array of proteins, including those involved in: (i) Ion transport, such as a K(+) channel (GORK), a Cl(-) channel (CLCg), Ca(2+) channels belonging to the glutamate receptor family (1.2, 2.1, 2.9, 3.4, 3.7); (ii) hormone signaling, such as ACC synthase (isoforms ACS-6, -7 and -8 involved in ethylene synthesis) and the brassinolide receptors BRI1 and BAK1; (iii) transcription, such as 7 WRKY family transcription factors; (iv) metabolism, such as phosphoenol pyruvate carboxylase; and (v) lipid signaling, such as phospholipase D (beta and gamma). More than 80% (101) of these putative clients represent previously unidentified 14-3-3 interactors. These results raise the number of putative 14-3-3 clients identified in plants to over 300.

  9. Type 4 pili are dispensable for biofilm development in the cyanobacterium Synechococcus elongatus.

    PubMed

    Nagar, Elad; Zilberman, Shaul; Sendersky, Eleonora; Simkovsky, Ryan; Shimoni, Eyal; Gershtein, Diana; Herzberg, Moshe; Golden, Susan S; Schwarz, Rakefet

    2017-07-01

    The hair-like cell appendages denoted as type IV pili are crucial for biofilm formation in diverse eubacteria. The protein complex responsible for type IV pilus assembly is homologous with the type II protein secretion complex. In the cyanobacterium Synechococcus elongatus PCC 7942, the gene Synpcc7942_2071 encodes an ATPase homologue of type II/type IV systems. Here, we report that inactivation of Synpcc7942_2071 strongly affected the suite of proteins present in the extracellular milieu (exo-proteome) and eliminated pili observable by electron microscopy. These results support a role for this gene product in protein secretion as well as in pili formation. As we previously reported, inactivation of Synpcc7942_2071 enables biofilm formation and suppresses the planktonic growth of S. elongatus. Thus, pili are dispensable for biofilm development in this cyanobacterium, in contrast to their biofilm-promoting function in type IV pili-producing heterotrophic bacteria. Nevertheless, pili removal is not required for biofilm formation as evident by a piliated mutant of S. elongatus that develops biofilms. We show that adhesion and timing of biofilm development differ between the piliated and non-piliated strains. The study demonstrates key differences in the process of biofilm formation between cyanobacteria and well-studied type IV pili-producing heterotrophic bacteria. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  10. 10 CFR Appendix IV to Part 960 - Types of Information for the Nomination of Sites as Suitable for Characterization

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Types of Information for the Nomination of Sites as Suitable for Characterization IV Appendix IV to Part 960 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR..., diapirism, tilting, subsidence, faulting, and volcanism. • Estimate of the geothermal gradient. • Estimate...

  11. In silico analysis to identify vaccine candidates common to multiple serotypes of Shigella and evaluation of their immunogenicity.

    PubMed

    Pahil, Sapna; Taneja, Neelam; Ansari, Hifzur Rahman; Raghava, G P S

    2017-01-01

    Shigellosis or bacillary dysentery is an important cause of diarrhea, with the majority of the cases occurring in developing countries. Considering the high disease burden, increasing antibiotic resistance, serotype-specific immunity and the post-infectious sequelae associated with shigellosis, there is a pressing need of an effective vaccine against multiple serotypes of the pathogen. In the present study, we used bio-informatics approach to identify antigens shared among multiple serotypes of Shigella spp. This approach led to the identification of many immunogenic peptides. The five most promising peptides based on MHC binding efficiency were a putative lipoprotein (EL PGI I), a putative heat shock protein (EL PGI II), Spa32 (EL PGI III), IcsB (EL PGI IV) and a hypothetical protein (EL PGI V). These peptides were synthesized and the immunogenicity was evaluated in BALB/c mice by ELISA and cytokine assays. The putative heat shock protein (HSP) and the hypothetical protein elicited good humoral response, whereas putative lipoprotein, Spa32 and IcsB elicited good T-cell response as revealed by increased IFN-γ and TNF-α cytokine levels. The patient sera from confirmed cases of shigellosis were also evaluated for the presence of peptide specific antibodies with significant IgG and IgA antibodies against the HSP and the hypothetical protein, bestowing them as potential future vaccine candidates. The antigens reported in this study are novel and have not been tested as vaccine candidates against Shigella. This study offers time and cost-effective way of identifying unprecedented immunogenic antigens to be used as potential vaccine candidates. Moreover, this approach should easily be extendable to find new potential vaccine candidates for other pathogenic bacteria.

  12. Very low density lipoprotein triglyceride transport in type IV hyperlipoproteinemia and the effects of carbohydrate-rich diets.

    PubMed

    Quarfordt, S H; Frank, A; Shames, D M; Berman, M; Steinberg, D

    1970-12-01

    Transport of plasma-free fatty acids (FFA) and of fatty acids in triglycerides of plasma very low density lipoproteins (VLDL-TGFA) was studied in two normal subjects, five patients with type IV hyperlipoproteinemia, and two patients with type I hyperlipoproteinemia. After intravenous pulse-labeling with albumin-bound 1-palmitate-(14)C, specific radioactivity of plasma FFA and VLDL-TGFA were determined at intervals up to 24 hr. The results were analyzed using several different multicompartmental models each compatible with the experimental data. Fractional transport of VLDL-TGFA was distinctly lower (no overlap) in the type IV patients than in the control subjects, both on a usual balanced diet (40% of calories from carbohydrate) and on a high-carbohydrate diet (80% of calories). However, net or total transport of VLDL-TGFA in the type IV patients was not clearly distinguishable from that in the control subjects, there being considerable overlap on either diet. The results suggest that in this group of type IV patients the underlying defect leading to the increased pool size of VLDL-TGFA is not overproduction but a relative defect in mechanisms for removal of VLDL-TGFA. Since some of these type IV patients had only a moderate degree of hypertriglyceridemia at the time they were studied, and since it is not established that patients with the type IV phenotype constitute a biochemically homogeneous population, the present results should not be generalized. Four studies were done (in two control subjects and two type IV patients) in which the kinetic parameters in the same individual were determined on the balanced diet and on the high-carbohydrate diet. All subjects showed an increase in VLDL-TGFA pool size. Using two of the models for analysis, all showed an increase in net transport of VLDL-TGFA; using the third model, three of the four studies showed an increase in VLDL-TGFA transport. The results are compatible with the interpretation that the carbohydrate-induced increase in VLDL-TGFA, both in controls and type IV patients, is at least in part due to an increased rate of production of VLDL-TGFA. The magnitude of the increase was approximately the same in controls and patients. Thus, metabolic adjustment to a high-carbohydrate regimen in these type IV patients may not be basically different from that in normal controls; the higher levels of VLDL-TGFA reached may simply be another reflection of a defective removal mechanism. An alternative interpretation, compatible with the data, would involve both a carbohydrate-induced increase in fractional rate of release of VLDL-TGFA from liver to plasma and a decrease in fractional removal of VLDL-TGFA from plasma without increase in net production rate. The simpler hypothesis of a single primary effect on net VLDL-TGFA production from FFA seems more likely.

  13. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    PubMed

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  14. Ciprofloxacin triggered glutamate production by Corynebacterium glutamicum.

    PubMed

    Lubitz, Dorit; Wendisch, Volker F

    2016-10-07

    Corynebacterium glutamicum is a well-studied bacterium which naturally overproduces glutamate when induced by an elicitor. Glutamate production is accompanied by decreased 2-oxoglutatate dehydrogenase activity. Elicitors of glutamate production by C. glutamicum analyzed to molecular detail target the cell envelope. Ciprofloxacin, an inhibitor of bacterial DNA gyrase and topoisomerase IV, was shown to inhibit growth of C. glutamicum wild type with concomitant excretion of glutamate. Enzyme assays showed that 2-oxoglutarate dehydrogenase activity was decreased due to ciprofloxacin addition. Transcriptome analysis revealed that this inhibitor of DNA gyrase increased RNA levels of genes involved in DNA synthesis, repair and modification. Glutamate production triggered by ciprofloxacin led to glutamate titers of up to 37 ± 1 mM and a substrate specific glutamate yield of 0.13 g/g. Even in the absence of the putative glutamate exporter gene yggB, ciprofloxacin effectively triggered glutamate production. When C. glutamicum wild type was cultivated under nitrogen-limiting conditions, 2-oxoglutarate rather than glutamate was produced as consequence of exposure to ciprofloxacin. Recombinant C. glutamicum strains overproducing lysine, arginine, ornithine, and putrescine, respectively, secreted glutamate instead of the desired amino acid when exposed to ciprofloxacin. Ciprofloxacin induced DNA synthesis and repair genes, reduced 2-oxoglutarate dehydrogenase activity and elicited glutamate production by C. glutamicum. Production of 2-oxoglutarate could be triggered by ciprofloxacin under nitrogen-limiting conditions.

  15. Alport Syndrome Diagnosis

    MedlinePlus

    ... the presence or absence of the type IV collagen alpha-3, alpha-4 and alpha-5 chains ( ... linked Alport syndrome) is suspected. The type IV collagen alpha-5 chain (COL4A5) is normally present in ...

  16. Urinary type IV collagen excretion predicts subsequent declining renal function in type 2 diabetic patients with proteinuria.

    PubMed

    Katavetin, Pisut; Katavetin, Paravee; Susantitaphong, Paweena; Townamchai, Natavudh; Tiranathanagul, Khajohn; Tungsanga, Kriang; Eiam-Ong, Somchai

    2010-08-01

    Baseline urinary type IV collagen excretion was negatively correlated with the subsequent GFR change (r(s)=-0.39, p=0.04) in our cohort of 30 type 2 diabetic patients with proteinuria. Therefore, it could be used to predict subsequent declining renal function in type 2 diabetic patients with proteinuria. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  17. [Preliminary proteomics analysis of the total proteins of HL Type cytoplasmic male sterility rice anther].

    PubMed

    Wen, Li; Liu, Gai; Zhang, Zai-Jun; Tao, Jun; Wan, Cui-Xiang; Zhu, Ying-Guo

    2006-03-01

    The proteins of HL type cytoplasmic male sterility rice anther of YTA (CMS) and YTB (maintenance line) were separated by two-dimensional electrophoresis with immobilized ph (3-10 non-linear) gradients as the first dimension and SDS-PAGE as the second. The silver-stained proteins spots were analyzed using Image Master 2D software, there were about 1800 detectable spots on each 2D-gel, and about 85 spots were differential expressed. With direct MALDI-TOF mass spectrometry analysis and protein database searching, 9 protein spots out of 16 were identified. Among those proteins, there were Putative nucleic acid binding protein, glucose-1-phosphate adenylyltransferase (ADP-glucose pyrophosphorylase, AGPase) (EC: 2.7.7.27) large chain, UDP-glucuronic acid decarboxylase, putative calcium-binding protein annexin, putative acetyl-CoA synthetase and putative lipoamide dehydrogenase etc. They were closely associated with metabolism, protein biosynthesis, transcription, signal transduction and so on, all of which are cell activities that are essential to pollen development. Some of the identified proteins, i.e. AGPase, putative lipoamide dehydrogenase and putative acetyl-CoA synthetase were deeply discussed on the relationship to CMS. AGPase catalyzes a very important step in the biosynthesis of alpha 1,4-glucans (glycogen or starch) in bacteria and plants: synthesis of the activated glucosyl donor, ADP-glucose, from glucose-1-phosphate and ATP. The lack of the AGPase in male sterile line might directly result in the reduction of starch, and the synthesis of starch was the most important processes during the development of pollen. In present research, the descent or reduction of putative lipoamide dehydrogenase and putative acetyl-CoA synthetase seemed involved in pollen sterility in rice. The degeneration and formation of various tissues during pollen development may impose high demands for energy and key biosynthetic intermediates. Under such conditions, the TCA cycle needs to operate fully, because the TCA cycle is an important source for many intermediates required for biosynthetic pathways, in addition to performing an oxidative, energy-producing role. Thus, it seemed reasonable to infer that the decrease of putative lipoamide dehydrogenase and putative acetyl-CoA synthetase in anther might prevent the conversion of pyruvate into acetyl-CoA, and as a result, the TCA cycle could no longer operate at a sufficient rate to meet all requirements in anther cells, leading to pollen sterility. This study gave new insights into the mechanism of CMS in rice and demonstrated the power of the proteomic approach in plant biology studies.

  18. Coming to Terms With Risk Factors for Eating Disorders: Application of Risk Terminology and Suggestions for a General Taxonomy

    ERIC Educational Resources Information Center

    Jacobi, Corinna; Hayward, Chris; de Zwaan, Martina; Kraemer, Helena C.; Agras, W. Steward

    2004-01-01

    The aims of the present review are to apply a recent risk factor approach (H. C. Kraemer et al., 1997) to putative risk factors for eating disorders, to order these along a timeline, and to deduce general taxonomic questions. Putative risk factors were classified according to risk factor type, outcome (anorexia nervosa, bulimia nervosa,…

  19. Two type IV pili of Vibrio parahaemolyticus play different roles in biofilm formation.

    PubMed

    Shime-Hattori, Akiko; Iida, Tetsuya; Arita, Michiko; Park, Kwon-Sam; Kodama, Toshio; Honda, Takeshi

    2006-11-01

    Vibrio parahaemolyticus RIMD2210633 has two sets of type IV-A pilus genes. One set is similar to that found in other Gram-negative bacteria, such as Pseudomonas aeruginosa, Vibrio cholerae (chitin-regulated pilus; ChiRP), and Vibrio vulnificus. The other is homologous to the genes for the mannose-sensitive hemagglutinin (MSHA) pilus. In this study, we analyzed the effects of the deletions in the pilin genes for each type IV pilus (the ChiRP and the MSHA pilus) on biofilm formation. Although the MSHA pilin mutant formed aggregates, the number of bacteria that attached directly to the coverslip was reduced, suggesting that this pilus contributes to the bacterial attachment to the surface of the coverslip. In contrast, the ChiRP mutant attached to the surface of the coverslip, but did not form aggregates, suggesting that ChiRP plays a role in bacterial agglutination during biofilm formation. These results suggest that the two type IV pili of V. parahaemolyticus contribute to biofilm formation in different ways. Both mutants showed a lower fitness for adsorption onto chitin particles than that of the wild type. Collectively, these data suggest that the use of two type IV pili is a refined strategy of V. parahaemolyticus for survival in natural environments.

  20. A Split-Luciferase-Based Trimer Formation Assay as a High-throughput Screening Platform for Therapeutics in Alport Syndrome.

    PubMed

    Omachi, Kohei; Kamura, Misato; Teramoto, Keisuke; Kojima, Haruka; Yokota, Tsubasa; Kaseda, Shota; Kuwazuru, Jun; Fukuda, Ryosuke; Koyama, Kosuke; Matsuyama, Shingo; Motomura, Keishi; Shuto, Tsuyoshi; Suico, Mary Ann; Kai, Hirofumi

    2018-05-17

    Alport syndrome is a hereditary glomerular disease caused by mutation in type IV collagen α3-α5 chains (α3-α5(IV)), which disrupts trimerization, leading to glomerular basement membrane degeneration. Correcting the trimerization of α3/α4/α5 chain is a feasible therapeutic approach, but is hindered by lack of information on the regulation of intracellular α(IV) chain and the absence of high-throughput screening (HTS) platforms to assess α345(IV) trimer formation. Here, we developed sets of split NanoLuc-fusion α345(IV) proteins to monitor α345(IV) trimerization of wild-type and clinically associated mutant α5(IV). The α345(IV) trimer assay, which satisfied the acceptance criteria for HTS, enabled the characterization of intracellular- and secretion-dependent defects of mutant α5(IV). Small interfering RNA-based and chemical screening targeting the ER identified several chemical chaperones that have potential to promote α345(IV) trimer formation. This split luciferase-based trimer formation assay is a functional HTS platform that realizes the feasibility of targeting α345(IV) trimers to treat Alport syndrome. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. Over Six Thousand Trypanosoma cruzi Strains Classified into Discrete Typing Units (DTUs): Attempt at an Inventory

    PubMed Central

    Brenière, Simone Frédérique; Waleckx, Etienne; Barnabé, Christian

    2016-01-01

    Trypanosoma cruzi, the causative agent of Chagas disease, presents wide genetic diversity. Currently, six discrete typing units (DTUs), named TcI to TcVI, and a seventh one called TcBat are used for strain typing. Beyond the debate concerning this classification, this systematic review has attempted to provide an inventory by compiling the results of 137 articles that have used it. A total of 6,343 DTU identifications were analyzed according to the geographical and host origins. Ninety-one percent of the data available is linked to South America. This sample, although not free of potential bias, nevertheless provides today’s picture of T. cruzi genetic diversity that is closest to reality. DTUs were genotyped from 158 species, including 42 vector species. Remarkably, TcI predominated in the overall sample (around 60%), in both sylvatic and domestic cycles. This DTU known to present a high genetic diversity, is very widely distributed geographically, compatible with a long-term evolution. The marsupial is thought to be its most ancestral host and the Gran Chaco region the place of its putative origin. TcII was rarely sampled (9.6%), absent, or extremely rare in North and Central America, and more frequently identified in domestic cycles than in sylvatic cycles. It has a low genetic diversity and has probably found refuge in some mammal species. It is thought to originate in the south-Amazon area. TcIII and TcIV were also rarely sampled. They showed substantial genetic diversity and are thought to be composed of possible polyphyletic subgroups. Even if they are mostly associated with sylvatic transmission cycles, a total of 150 human infections with these DTUs have been reported. TcV and TcVI are clearly associated with domestic transmission cycles. Less than 10% of these DTUs were identified together in sylvatic hosts. They are thought to originate in the Gran Chaco region, where they are predominant and where putative parents exist (TcII and TcIII). Trends in host-DTU specificities exist, but generally it seems that the complexity of the cycles and the participation of numerous vectors and mammal hosts in a shared area, maintains DTU diversity. PMID:27571035

  2. Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures.

    PubMed

    Lassak, Kerstin; Ghosh, Abhrajyoti; Albers, Sonja-Verena

    2012-01-01

    Archaea have evolved fascinating surface structures allowing rapid adaptation to changing environments. The archaeal surface appendages display such diverse biological roles as motility, adhesion, biofilm formation, exchange of genetic material and species-specific interactions and, in turn, increase fitness of the cells. Intriguingly, despite sharing the same functions with their bacterial counterparts, the assembly mechanism of many archaeal surface structures is rather related to assembly of bacterial type IV pili. This review summarizes our state-of-the-art knowledge about unique structural and biochemical properties of archaeal surface appendages with a particular focus on archaeal type IV pili-like structures. The latter comprise not only widely distributed archaella (formerly known as archaeal flagella), but also different highly specialized archaeal pili, which are often restricted to certain species. Recent findings regarding assembly mechanisms, structural aspects and physiological roles of these type IV pili-like structures will be discussed in detail. Recently, first regulatory proteins involved in transition from both planktonic to sessile lifestyle and in assembly of archaella were identified. To conclude, we provide novel insights into regulatory mechanisms underlying the assembly of archaeal surface structures. Copyright © 2012. Published by Elsevier Masson SAS.

  3. Minor Type IV Collagen α5 Chain Promotes Cancer Progression through Discoidin Domain Receptor-1

    PubMed Central

    Xiao, Qian; Jiang, Yan; Liu, Qingbo; Yue, Jiao; Liu, Chunying; Zhao, Xiaotong; Qiao, Yuemei; Ji, Hongbin; Chen, Jianfeng; Ge, Gaoxiang

    2015-01-01

    Type IV collagens (Col IV), components of basement membrane, are essential in the maintenance of tissue integrity and proper function. Alteration of Col IV is related to developmental defects and diseases, including cancer. Col IV α chains form α1α1α2, α3α4α5 and α5α5α6 protomers that further form collagen networks. Despite knowledge on the functions of major Col IV (α1α1α2), little is known whether minor Col IV (α3α4α5 and α5α5α6) plays a role in cancer. It also remains to be elucidated whether major and minor Col IV are functionally redundant. We show that minor Col IV α5 chain is indispensable in cancer development by using α5(IV)-deficient mouse model. Ablation of α5(IV) significantly impeded the development of KrasG12D-driven lung cancer without affecting major Col IV expression. Epithelial α5(IV) supports cancer cell proliferation, while endothelial α5(IV) is essential for efficient tumor angiogenesis. α5(IV), but not α1(IV), ablation impaired expression of non-integrin collagen receptor discoidin domain receptor-1 (DDR1) and downstream ERK activation in lung cancer cells and endothelial cells. Knockdown of DDR1 in lung cancer cells and endothelial cells phenocopied the cells deficient of α5(IV). Constitutively active DDR1 or MEK1 rescued the defects of α5(IV)-ablated cells. Thus, minor Col IV α5(IV) chain supports lung cancer progression via DDR1-mediated cancer cell autonomous and non-autonomous mechanisms. Minor Col IV can not be functionally compensated by abundant major Col IV. PMID:25992553

  4. Root canal morphology of South Asian Indian maxillary molar teeth

    PubMed Central

    Singh, Shishir; Pawar, Mansing

    2015-01-01

    Objective: The objective was to study the root canal morphology of South Asian Indian Maxillary molars using a tooth clearing technique. Materials and Methods: Hundred teeth each comprising of first, second, and third molars collected from different dental schools and clinics in India were subjected to standard dye penetration, decalcification and clearing procedure before being studied. Results: The first molar mesiobuccal roots exhibited 69% Type I, 24% Type II, 4% Type IV, 2% Type V, and 1% exhibited a Vertuccis Type VIII canal anatomy. In the group with three separate roots the second molar mesiobuccal roots in exhibited 80.6% Type I, 15.3% Type II, 2.7% Type IV, and 1.4% Type V canal anatomy while the third molars mesiobuccal roots exhibited 57.4% Type I, 32% Type II, 2.1% Type III, 8.5% Type IV, 1% had a Type V canal anatomy in the similar group. Conclusion: A varied root canal anatomy was seen in the mesiobuccal root canal of the maxillary molars. PMID:25713497

  5. Native structure of a type IV secretion system core complex essential for Legionella pathogenesis.

    PubMed

    Kubori, Tomoko; Koike, Masafumi; Bui, Xuan Thanh; Higaki, Saori; Aizawa, Shin-Ichi; Nagai, Hiroki

    2014-08-12

    Bacterial type IV secretion systems are evolutionarily related to conjugation systems and play a pivotal role in infection by delivering numerous virulence factors into host cells. Using transmission electron microscopy, we report the native molecular structure of the core complex of the Dot/Icm type IV secretion system encoded by Legionella pneumophila, an intracellular human pathogen. The biochemically isolated core complex, composed of at least five proteins--DotC, DotD, DotF, DotG, and DotH--has a ring-shaped structure. Intriguingly, morphologically distinct premature complexes are formed in the absence of DotG or DotF. Our data suggest that DotG forms a central channel spanning inner and outer membranes. DotF, a component dispensable for type IV secretion, plays a role in efficient embedment of DotG into the functional core complex. These results highlight a common scheme for the biogenesis of transport machinery.

  6. Polyvalent type IV sensitizations to multiple fragrances and a skin protection cream in a metal worker.

    PubMed

    Tanko, Zita; Shab, Arna; Diepgen, Thomas Ludwig; Weisshaar, Elke

    2009-06-01

    Fragrances are very common in everyday products. A metalworker with chronic hand eczema and previously diagnosed type IV sensitizations to epoxy resin, balsam of Peru, fragrance mix and fragrance mix II was diagnosed with additional type IV sensitizations to geraniol, hydroxycitronellal, lilial, tree moss, oak moss absolute, citral, citronellol, farnesol, Lyral, fragrance mix II and fragrance mix (with sorbitan sesquioleate). In addition, a type IV sensitization to the skin protection cream containing geraniol and citronellol used at the workplace was detected, and deemed occupationally relevant in this case. The patient could have had contact to fragrances through private use of cosmetics and detergents. On the other hand, the fragrance-containing skin protection cream supports occupational exposure. This case report demonstrates that fragrance contact allergy has to be searched for and clarified individually, which requires a thorough history and a detailed analysis of the work place.

  7. Solid-state NMR studies of metal-free SOD1 fibrillar structures.

    PubMed

    Banci, Lucia; Blaževitš, Olga; Cantini, Francesca; Danielsson, Jens; Lang, Lisa; Luchinat, Claudio; Mao, Jiafei; Oliveberg, Mikael; Ravera, Enrico

    2014-06-01

    Copper-zinc superoxide dismutase 1 (SOD1) is present in the protein aggregates deposited in motor neurons of amyotrophic lateral sclerosis (ALS) patients. ALS is a neurodegenerative disease that can be either sporadic (ca. 90%) or familial (fALS). The most widely studied forms of fALS are caused by mutations in the sequence of SOD1. Ex mortuo SOD1 aggregates are usually found to be amorphous. In vitro SOD1, in its immature reduced and apo state, forms fibrillar aggregates. Previous literature data have suggested that a monomeric SOD1 construct, lacking loops IV and VII, (apoSODΔIV-VII), shares the same fibrillization properties of apoSOD1, both proteins having the common structural feature of the central β-barrel. In this work, we show that structural information can be obtained at a site-specific level from solid-state NMR. The residues that are sequentially assignable are found to be located at the putative nucleation site for fibrillar species formation in apoSOD, as detected by other experimental techniques.

  8. Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli*

    PubMed Central

    Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

    2015-01-01

    Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. PMID:26324721

  9. Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli.

    PubMed

    Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

    2015-10-23

    Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Whole-genome comparison of urinary pathogenic Escherichia coli and faecal isolates of UTI patients and healthy controls.

    PubMed

    Nielsen, Karen Leth; Stegger, Marc; Kiil, Kristoffer; Godfrey, Paul A; Feldgarden, Michael; Lilje, Berit; Andersen, Paal S; Frimodt-Møller, Niels

    2017-12-01

    The faecal flora is a common reservoir for urinary tract infection (UTI), and Escherichia coli (E. coli) is frequently found in this reservoir without causing extraintestinal infection. We investigated these E. coli reservoirs by whole-genome sequencing a large collection of E. coli from healthy controls (faecal), who had never previously had UTI, and from UTI patients (faecal and urinary) sampled from the same geographical area. We compared MLST types, phylogenetic relationship, accessory genome content and FimH type between patient and control faecal isolates as well as between UTI and faecal-only isolates, respectively. Comparison of the accessory genome of UTI isolates to faecal isolates revealed 35 gene families which were significantly more prevalent in the UTI isolates compared to the faecal isolates, although none of these were unique to one of the two groups. Of these 35, 22 belonged to a genomic island and three putatively belonged to a type VI secretion system (T6SS). MLST types and SNP phylogeny indicated no clustering of the UTI or faecal E. coli from patients distinct from the control faecal isolates, although there was an overrepresentation of UTI isolates belonging to clonal lineages CC73 and CC12. One combination of mutations in FimH, N70S/S78N, was significantly associated to UTI, while phylogenetic analysis of FimH and fimH identified no signs of distinct adaptation of UTI isolates compared to faecal-only isolates not causing UTI. In summary, the results showed that (i) healthy women who had never previously had UTI carried faecal E. coli which were overall closely related to UTI and faecal isolates from UTI patients; (ii) UTI isolates do not cluster separately from faecal-only isolates based on SNP analysis; and (iii) 22 gene families of a genomic island, putative T6SS proteins as well as specific metabolism and virulence associated proteins were significantly more common in UTI isolates compared to faecal-only isolates and (iv) evolution of fimH for these isolates was not linked to the clinical source of the isolates, apart from the mutation combination N70S/S78N, which was correlated to UTI isolates of phylogroup B2. Combined, these findings illustrate that faecal and UTI isolates, as well as faecal-only and faecal-UTI isolates, are closely related and can only be distinguished, if at all, by their accessory genome. Copyright © 2017 Elsevier GmbH. All rights reserved.

  11. Influence of putative exopolysaccharide genes on Pseudomonas putida KT2440 biofilm stability.

    PubMed

    Nilsson, Martin; Chiang, Wen-Chi; Fazli, Mustafa; Gjermansen, Morten; Givskov, Michael; Tolker-Nielsen, Tim

    2011-05-01

    We report a study of the role of putative exopolysaccharide gene clusters in the formation and stability of Pseudomonas putida KT2440 biofilm. Two novel putative exopolysaccharide gene clusters, pea and peb, were identified, and evidence is provided that they encode products that stabilize P. putida KT2440 biofilm. The gene clusters alg and bcs, which code for proteins mediating alginate and cellulose biosynthesis, were found to play minor roles in P. putida KT2440 biofilm formation and stability under the conditions tested. A P. putida KT2440 derivative devoid of any identifiable exopolysaccharide genes was found to form biofilm with a structure similar to wild-type biofilm, but with a stability lower than that of wild-type biofilm. Based on our data, we suggest that the formation of structured P. putida KT2440 biofilm can occur in the absence of exopolysaccharides; however, exopolysaccharides play a role as structural stabilizers. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  12. Chromite oxidation by manganese oxides in subseafloor basalts and the presence of putative fossilized microorganisms.

    PubMed

    Ivarsson, Magnus; Broman, Curt; Holm, Nils G

    2011-06-03

    Chromite is a mineral with low solubility and is thus resistant to dissolution. The exception is when manganese oxides are available, since they are the only known naturally occurring oxidants for chromite. In the presence of Mn(IV) oxides, Cr(III) will oxidise to Cr(VI), which is more soluble than Cr(III), and thus easier to be removed. Here we report of chromite phenocrysts that are replaced by rhodochrosite (Mn(II) carbonate) in subseafloor basalts from the Koko Seamount, Pacific Ocean, that were drilled and collected during the Ocean Drilling Program (ODP) Leg 197. The mineral succession chromite-rhodochrosite-saponite in the phenocrysts is interpreted as the result of chromite oxidation by manganese oxides. Putative fossilized microorganisms are abundant in the rhodochrosite and we suggest that the oxidation of chromite has been mediated by microbial activity. It has previously been shown in soils and in laboratory experiments that chromium oxidation is indirectly mediated by microbial formation of manganese oxides. Here we suggest a similar process in subseafloor basalts.

  13. Chromite oxidation by manganese oxides in subseafloor basalts and the presence of putative fossilized microorganisms

    PubMed Central

    2011-01-01

    Chromite is a mineral with low solubility and is thus resistant to dissolution. The exception is when manganese oxides are available, since they are the only known naturally occurring oxidants for chromite. In the presence of Mn(IV) oxides, Cr(III) will oxidise to Cr(VI), which is more soluble than Cr(III), and thus easier to be removed. Here we report of chromite phenocrysts that are replaced by rhodochrosite (Mn(II) carbonate) in subseafloor basalts from the Koko Seamount, Pacific Ocean, that were drilled and collected during the Ocean Drilling Program (ODP) Leg 197. The mineral succession chromite-rhodochrosite-saponite in the phenocrysts is interpreted as the result of chromite oxidation by manganese oxides. Putative fossilized microorganisms are abundant in the rhodochrosite and we suggest that the oxidation of chromite has been mediated by microbial activity. It has previously been shown in soils and in laboratory experiments that chromium oxidation is indirectly mediated by microbial formation of manganese oxides. Here we suggest a similar process in subseafloor basalts. PMID:21639896

  14. Low dose morphine adjuvant therapy for enhanced efficacy of antipsychotic drug action: potential involvement of endogenous morphine in the pathophysiology of schizophrenia.

    PubMed

    Stefano, George B; Králíčková, Milena; Ptacek, Radek; Kuzelova, Hana; Esch, Tobias; Kream, Richard M

    2012-07-01

    Major thematic threads linking extensive preclinical and clinical efforts have established a working mechanistic scheme whereby atypical antipsychotic drugs ameliorate negative DSM IV diagnostic criteria by effecting relatively potent blockade of serotonin (5-HT)(2A) receptors coupled with weaker antagonism of dopamine D(2) receptors in frontal cortical areas. These contentions are more or less supported by in vitro binding experiments employing cloned receptors on cultured cells, although significant functional involvement of 5-HT(2C) receptors has also been proposed. It is interesting that a key statistical analysis indicates a major shift in usage back to typical antipsychotic agents for management of schizophrenia from 1995-2008, whereas off-label usage of atypical antipsychotic agents was markedly increased or expanded for bipolar affective disorder. Importantly, meta-analyses generally did not support efficacy differences between the other atypical antipsychotics compared with the older typical agents. A critical examination of putative functional linkages of morphine and its type-selective mu opioid receptor to higher order cortical regulation of cognitive processes may provide novel insights into human behavioral processes that are severely impaired in schizophrenia spectrum disorders.

  15. Legionella pneumophila prevents proliferation of its natural host Acanthamoeba castellanii

    PubMed Central

    Mengue, Luce; Régnacq, Matthieu; Aucher, Willy; Portier, Emilie; Héchard, Yann; Samba-Louaka, Ascel

    2016-01-01

    Legionella pneumophila is a ubiquitous, pathogenic, Gram-negative bacterium responsible for legionellosis. Like many other amoeba-resistant microorganisms, L. pneumophila resists host clearance and multiplies inside the cell. Through its Dot/Icm type IV secretion system, the bacterium injects more than three hundred effectors that modulate host cell physiology in order to promote its own intracellular replication. Here we report that L. pneumophila prevents proliferation of its natural host Acanthamoeba castellanii. Infected amoebae could not undergo DNA replication and no cell division was observed. The Dot/Icm secretion system was necessary for L. pneumophila to prevent the eukaryotic proliferation. The absence of proliferation was associated with altered amoebal morphology and with a decrease of mRNA transcript levels of CDC2b, a putative regulator of the A. castellanii cell cycle. Complementation of CDC28-deficient Saccharomyces cerevisiae by the CDC2b cDNA was sufficient to restore proliferation of CDC28-deficient S. cerevisiae and suggests for the first time that CDC2b from A. castellanii could be functional and a bona fide cyclin-dependent kinase. Hence, our results reveal that L. pneumophila impairs proliferation of A. castellanii and this effect could involve the cell cycle protein CDC2b. PMID:27805070

  16. Activation of Ran GTPase by a Legionella Effector Promotes Microtubule Polymerization, Pathogen Vacuole Motility and Infection

    PubMed Central

    Rothmeier, Eva; Pfaffinger, Gudrun; Hoffmann, Christine; Harrison, Christopher F.; Grabmayr, Heinrich; Repnik, Urska; Hannemann, Mandy; Wölke, Stefan; Bausch, Andreas; Griffiths, Gareth; Müller-Taubenberger, Annette; Itzen, Aymelt; Hilbi, Hubert

    2013-01-01

    The causative agent of Legionnaires' disease, Legionella pneumophila, uses the Icm/Dot type IV secretion system (T4SS) to form in phagocytes a distinct “Legionella-containing vacuole” (LCV), which intercepts endosomal and secretory vesicle trafficking. Proteomics revealed the presence of the small GTPase Ran and its effector RanBP1 on purified LCVs. Here we validate that Ran and RanBP1 localize to LCVs and promote intracellular growth of L. pneumophila. Moreover, the L. pneumophila protein LegG1, which contains putative RCC1 Ran guanine nucleotide exchange factor (GEF) domains, accumulates on LCVs in an Icm/Dot-dependent manner. L. pneumophila wild-type bacteria, but not strains lacking LegG1 or a functional Icm/Dot T4SS, activate Ran on LCVs, while purified LegG1 produces active Ran(GTP) in cell lysates. L. pneumophila lacking legG1 is compromised for intracellular growth in macrophages and amoebae, yet is as cytotoxic as the wild-type strain. A downstream effect of LegG1 is to stabilize microtubules, as revealed by conventional and stimulated emission depletion (STED) fluorescence microscopy, subcellular fractionation and Western blot, or by microbial microinjection through the T3SS of a Yersinia strain lacking endogenous effectors. Real-time fluorescence imaging indicates that LCVs harboring wild-type L. pneumophila rapidly move along microtubules, while LCVs harboring ΔlegG1 mutant bacteria are stalled. Together, our results demonstrate that Ran activation and RanBP1 promote LCV formation, and the Icm/Dot substrate LegG1 functions as a bacterial Ran activator, which localizes to LCVs and promotes microtubule stabilization, LCV motility as well as intracellular replication of L. pneumophila. PMID:24068924

  17. Spatial and Functional Relationships Among Pol V-Associated loci, Pol IV-Dependent siRNAs, and Cytosine Methylation in the Arabidopsis Epigenome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop

    2012-08-15

    Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sitesmore » of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.« less

  18. Neurons of human nucleus accumbens.

    PubMed

    Sazdanović, Maja; Sazdanović, Predrag; Zivanović-Macuzić, Ivana; Jakovljević, Vladimir; Jeremić, Dejan; Peljto, Amir; Tosevski, Jovo

    2011-08-01

    Nucleus accumbens is a part of the ventral striatum also known as a drug active brain region, especially related with drug addiction. The aim of the study was to investigate the Golgi morphology of the nucleus accumbens neurons. The study was performed on the frontal and sagittal sections of 15 human brains by the Golgi Kopsch method. We classified neurons in the human nucleus accumbens according to their morphology and size into four types: type I--fusiform neurons; type II--fusiform neurons with lateral dendrite, arising from a part of the cell body; type III--pyramidal-like neuron; type IV--multipolar neuron. The medium spiny neurons, which are mostly noted regarding to the drug addictive conditions of the brain, correspond to the type IV--multipolar neurons. Two regions of human nucleus accumbens could be clearly recognized on Nissl and Golgi preparations each containing different predominant neuronal types. Central part of nucleus accumbens, core region, has a low density of impregnated neurons with predominant type III, pyramidal-like neurons, with spines on secondary branches and rare type IV, multipolar neurons. Contrary to the core, peripheral region, shell of nucleus, has a high density of impregnated neurons predominantly contained of type I and type IV--multipolar neurons, which all are rich in spines on secondary and tertiary dendritic branches. Our results indicate great morphological variability of human nucleus accumbens neurons. This requires further investigations and clarifying clinical significance of this important brain region.

  19. Putative Monofunctional Type I Polyketide Synthase Units: A Dinoflagellate-Specific Feature?

    PubMed Central

    Eichholz, Karsten; Beszteri, Bánk; John, Uwe

    2012-01-01

    Marine dinoflagellates (alveolata) are microalgae of which some cause harmful algal blooms and produce a broad variety of most likely polyketide synthesis derived phycotoxins. Recently, novel polyketide synthesase (PKS) transcripts have been described from the Florida red tide dinoflagellate Karenia brevis (gymnodiniales) which are evolutionarily related to Type I PKS but were apparently expressed as monofunctional proteins, a feature typical of Type II PKS. Here, we investigated expression units of PKS I-like sequences in Alexandrium ostenfeldii (gonyaulacales) and Heterocapsa triquetra (peridiniales) at the transcript and protein level. The five full length transcripts we obtained were all characterized by polyadenylation, a 3′ UTR and the dinoflagellate specific spliced leader sequence at the 5′end. Each of the five transcripts encoded a single ketoacylsynthase (KS) domain showing high similarity to K. brevis KS sequences. The monofunctional structure was also confirmed using dinoflagellate specific KS antibodies in Western Blots. In a maximum likelihood phylogenetic analysis of KS domains from diverse PKSs, dinoflagellate KSs formed a clade placed well within the protist Type I PKS clade between apicomplexa, haptophytes and chlorophytes. These findings indicate that the atypical PKS I structure, i.e., expression as putative monofunctional units, might be a dinoflagellate specific feature. In addition, the sequenced transcripts harbored a previously unknown, apparently dinoflagellate specific conserved N-terminal domain. We discuss the implications of this novel region with regard to the putative monofunctional organization of Type I PKS in dinoflagellates. PMID:23139807

  20. Skin phototyping in a Chinese female population: analysis of four hundred and four cases from four major cities of China.

    PubMed

    Liu, W; Lai, W; Wang, X M; Li, L; Tian, Y; Lu, Y; Wu, Y Y; Li, Y; Zhang, P; Wu, Y; Chen, L

    2006-08-01

    The sun-reactive skin types in 404 Chinese females living in different cities were investigated in this study. A questionnaire was designed according to the original concept of skin types proposed by Fitzpatrick and the investigation was conducted in two ways: self-administered reporting and then a personal interview. Minimal erythema dose (MED) and minimal persistent pigmentation dose (MPPD) were also measured in part of the volunteers with a standard solar simulator. The results show that in the way of personal interview, the predominant skin type of the investigated group is type III (71.4%), and then type II (14.7%) and type IV (14.2%), while in the self-reporting manner, the result is as follows: type III, 74.3%, type II, 25.6% and type IV, 1%. There are no skin type I, V or VI in the studied group. MED and MPPD from the same population show some relevance to the skin types, e.g. with the change of skin type from Type II to IV, the mean value of MED increases gradually and the MPPD decreases slightly. From the study we concluded that the skin types of the investigated Chinese females are principally type III (more than 70%), and then type II and type IV. The different ways of answering the questionnaire did not affect the results remarkably. The measurements of photobiology parameters confirmed that there is a certain correlation between skin types and MED or MPPD determined in this group of volunteers.

  1. Proposal for a histopathological consensus classification of the periprosthetic interface membrane

    PubMed Central

    Morawietz, L; Classen, R‐A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer‐Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

    2006-01-01

    Aims The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Methods Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Results Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter‐observer reproducibility sufficient (85%). Conclusion The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non‐infectious, non‐particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients. PMID:16731601

  2. Proposal for a histopathological consensus classification of the periprosthetic interface membrane.

    PubMed

    Morawietz, L; Classen, R-A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer-Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

    2006-06-01

    The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter-observer reproducibility sufficient (85%). The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non-infectious, non-particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients.

  3. Environmentally Safe and Effective Processes for Paint Removal

    DTIC Science & Technology

    1995-04-01

    Urea Formaldehyde 3.5 1.5 Type III Melamine Formaldehyde 4.0 1.5 Type IV Phenol Formaldehyde 3.5 1.5...Polyester 3.0 34 - 42 1.04 - 1.46 Type II Urea Formaldehyde 3.5 54 - 62 1.47- 1.54 Type III Melamine Formaldehyde 4.0 64- 72 1.47- 1.52 Type IV Phenol... Melamine Formaldehyde electronics industry and to remove coatings from fibreglass and composite materials. Melamine formaldehyde resin is produced

  4. Epidemiological cut-off values for Flavobacterium psychrophilum MIC data generated by a standard test protocol.

    PubMed

    Smith, P; Endris, R; Kronvall, G; Thomas, V; Verner-Jeffreys, D; Wilhelm, C; Dalsgaard, I

    2016-02-01

    Epidemiological cut-off values were developed for application to antibiotic susceptibility data for Flavobacterium psychrophilum generated by standard CLSI test protocols. The MIC values for ten antibiotic agents against Flavobacterium psychrophilum were determined in two laboratories. For five antibiotics, the data sets were of sufficient quality and quantity to allow the setting of valid epidemiological cut-off values. For these agents, the cut-off values, calculated by the application of the statistically based normalized resistance interpretation method, were ≤16 mg L(-1) for erythromycin, ≤2 mg L(-1) for florfenicol, ≤0.025 mg L(-1) for oxolinic acid (OXO), ≤0.125 mg L(-1) for oxytetracycline and ≤20 (1/19) mg L(-1) for trimethoprim/sulphamethoxazole. For ampicillin and amoxicillin, the majority of putative wild-type observations were 'off scale', and therefore, statistically valid cut-off values could not be calculated. For ormetoprim/sulphadimethoxine, the data were excessively diverse and a valid cut-off could not be determined. For flumequine, the putative wild-type data were extremely skewed, and for enrofloxacin, there was inadequate separation in the MIC values for putative wild-type and non-wild-type strains. It is argued that the adoption of OXO as a class representative for the quinolone group would be a valid method of determining susceptibilities to these agents. © 2014 John Wiley & Sons Ltd.

  5. Isolation of pheromone precursor genes of Magnaporthe grisea.

    PubMed

    Shen, W C; Bobrowicz, P; Ebbole, D J

    1999-01-01

    In heterothallic ascomycetes one mating partner serves as the source of female tissue and is fertilized with spermatia from a partner of the opposite mating type. The role of pheromone signaling in mating is thought to involve recognition of cells of the opposite mating type. We have isolated two putative pheromone precursor genes of Magnaporthe grisea. The genes are present in both mating types of the fungus but they are expressed in a mating type-specific manner. The MF1-1 gene, expressed in Mat1-1 strains, is predicted to encode a 26-amino-acid polypeptide that is processed to produce a lipopeptide pheromone. The MF2-1 gene, expressed in Mat1-2 strains, is predicted to encode a precursor polypeptide that is processed by a Kex2-like protease to yield a pheromone with striking similarity to the predicted pheromone sequence of a close relative, Cryphonectria parasitica. Expression of the M. grisea putative pheromone precursor genes was observed under defined nutritional conditions and in field isolates. This suggests that the requirement for complex media for mating and the poor fertility of field isolates may not be due to limitation of pheromone precursor gene expression. Detection of putative pheromone precursor gene mRNA in conidia suggests that pheromones may be important for the fertility of conidia acting as spermatia. Copyright 1999 Academic Press.

  6. Ehlers-Danlos syndrome type IV

    PubMed Central

    Germain, Dominique P

    2007-01-01

    Ehlers-Danlos syndrome type IV, the vascular type of Ehlers-Danlos syndromes (EDS), is an inherited connective tissue disorder defined by characteristic facial features (acrogeria) in most patients, translucent skin with highly visible subcutaneous vessels on the trunk and lower back, easy bruising, and severe arterial, digestive and uterine complications, which are rarely, if at all, observed in the other forms of EDS. The estimated prevalence for all EDS varies between 1/10,000 and 1/25,000, EDS type IV representing approximately 5 to 10% of cases. The vascular complications may affect all anatomical areas, with a tendency toward arteries of large and medium diameter. Dissections of the vertebral arteries and the carotids in their extra- and intra-cranial segments (carotid-cavernous fistulae) are typical. There is a high risk of recurrent colonic perforations. Pregnancy increases the likelihood of a uterine or vascular rupture. EDS type IV is inherited as an autosomal dominant trait that is caused by mutations in the COL3A1 gene coding for type III procollagen. Diagnosis is based on clinical signs, non-invasive imaging, and the identification of a mutation of the COL3A1 gene. In childhood, coagulation disorders and Silverman's syndrome are the main differential diagnoses; in adulthood, the differential diagnosis includes other Ehlers-Danlos syndromes, Marfan syndrome and Loeys-Dietz syndrome. Prenatal diagnosis can be considered in families where the mutation is known. Choriocentesis or amniocentesis, however, may entail risk for the pregnant woman. In the absence of specific treatment for EDS type IV, medical intervention should be focused on symptomatic treatment and prophylactic measures. Arterial, digestive or uterine complications require immediate hospitalisation, observation in an intensive care unit. Invasive imaging techniques are contraindicated. Conservative approach is usually recommended when caring for a vascular complication in a patient suffering from EDS type IV. Surgery may, however, be required urgently to treat potentially fatal complications. PMID:17640391

  7. Computational prediction of secretion systems and secretomes of Brucella: identification of novel type IV effectors and their interaction with the host.

    PubMed

    Sankarasubramanian, Jagadesan; Vishnu, Udayakumar S; Dinakaran, Vasudevan; Sridhar, Jayavel; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

    2016-01-01

    Brucella spp. are facultative intracellular pathogens that cause brucellosis in various mammals including humans. Brucella survive inside the host cells by forming vacuoles and subverting host defence systems. This study was aimed to predict the secretion systems and the secretomes of Brucella spp. from 39 complete genome sequences available in the databases. Furthermore, an attempt was made to identify the type IV secretion effectors and their interactions with host proteins. We predicted the secretion systems of Brucella by the KEGG pathway and SecReT4. Brucella secretomes and type IV effectors (T4SEs) were predicted through genome-wide screening using JVirGel and S4TE, respectively. Protein-protein interactions of Brucella T4SEs with their hosts were analyzed by HPIDB 2.0. Genes coding for Sec and Tat pathways of secretion and type I (T1SS), type IV (T4SS) and type V (T5SS) secretion systems were identified and they are conserved in all the species of Brucella. In addition to the well-known VirB operon coding for the type IV secretion system (T4SS), we have identified the presence of additional genes showing homology with T4SS of other organisms. On the whole, 10.26 to 14.94% of total proteomes were found to be either secreted (secretome) or membrane associated (membrane proteome). Approximately, 1.7 to 3.0% of total proteomes were identified as type IV secretion effectors (T4SEs). Prediction of protein-protein interactions showed 29 and 36 host-pathogen specific interactions between Bos taurus (cattle)-B. abortus and Ovis aries (sheep)-B. melitensis, respectively. Functional characterization of the predicted T4SEs and their interactions with their respective hosts may reveal the secrets of host specificity of Brucella.

  8. Study of the relationship between mononuclear inflammatory infiltrate and Ki-67 and basement membrane and extracellular matrix protein expression in radicular cysts.

    PubMed

    Mourão, R V C; Júnior, E C Pinheiro; Barros Silva, P G; Turatti, E; Mota, M R L; Alves, A P N N

    2016-05-01

    To evaluate the relationship between mononuclear inflammatory infiltrate and the expression of a proliferative immunomarker (Ki-67) as well as to evaluate basement membrane and extracellular matrix proteins (laminin and collagen type IV) in radicular cysts and dentigerous cysts (DC). Immunohistochemical analyses were performed in heavily inflamed radicular cysts (HIRC), slightly inflamed radicular cysts (SIRC) and DC (n = 20) using Ki-67 (Dako(®) , 1 : 50), anticollagen type IV (DBS(®) , 1 : 40) and antilaminin (DBS(®) , 1 : 20). The data were analysed using anova/Tukey's test (Ki-67) and Kruskal-Wallis/Dunn's test (collagen type IV and laminin) (P < 0.05). The immunoexpression of Ki-67 was significantly greater in the SIRC group compared with the HIRC and DC (P = 0.0040). Likewise, the immunoexpression of collagen type IV in the basement membrane of the SIRC group was significantly more continuous (P = 0.0475) than in the HIRC group. DC had significantly less collagen type IV in extracellular matrix immunoexpression than HIRC and SIRC (P = 0.0246). Laminin was absent in the basement membrane in the SIRC and DC groups, and the extracellular matrix of the HIRC was weak and punctate. The presence of inflammatory factors in the radicular cyst wall modified the expression of proliferation factors in the epithelial lining and the expression of collagen type IV and laminin in the basement membrane, but did not modify extracellular matrix behaviour in radicular cysts. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  9. [Elective reconstruction of thoracoabdominal aortic aneurysm type IV by transabdominal approach].

    PubMed

    Marjanović, Ivan; Jevtić, Miodrag; Misović, Sidor; Sarac, Momir

    2012-01-01

    Thoracoabdominal aortic aneurysm (TAAA) type IV represents an aortic dilatation from the level of the diaphragmatic hiatus to the iliac arteries branches, including visceral branches of the aorta. In the traditional procedure of TAAA type IV repair, the body is opened using thoractomy and laparotomy in order to provide adequate exposure of the descending thoracic and abdominal aorta for safe aortic reconstruction. We reported a 71-year-old man with elective reconstruction of the TAAA type IV performed by transabdominal approach. Computed tomography scans angiography revealed a TAAA type IV with diameter of 62 mm in the region of celiac trunk andsuperior mesenteric artery branching, and the largest diameter of 75 mm in the infrarenal aortic level. The patient comorbidity included a chronic obstructive pulmonary disease and hypertension, therefore he was treated for a prolonged period. In preparation for the planned aortic reconstruction asymptomatic carotid disease (occlusion of the left internal carotid artery and subtotal stenosis of the right internal carotid artery) was diagnosed. Within the same intervention percutaneous transluminal angioplasty with stent placement in right internal carotid artery was made. In general, under endotracheal anesthesia and epidural analgesia, with transabdominal approach performed aortic reconstruction with tubular dakron graft 24 mm were, and reimplantation of visceral aortic branches into the graft performed. Postoperative course was uneventful, and the patient was discharged on the postoperative day 17. Control computed tomography scan angiography performed three months after the operation showed vascular state of the patient to be in order. Complete transabdominal approach to TAAA type IV represents an appropriate substitute for thoracoabdominal approach, without compromising safety of the patient. This approach is less traumatic, especially in patients with impaired pulmonary function, because there is no thoracotomy and any complications that could follow this approach.

  10. Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

    PubMed Central

    Miyakawa, T; Kojima, M; Ui, M

    1998-01-01

    Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation. PMID:9405282

  11. Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

    PubMed

    Miyakawa, T; Kojima, M; Ui, M

    1998-01-01

    Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation.

  12. Multi-Virulence-Locus Sequence Typing of Staphylococcus lugdunensis Generates Results Consistent with a Clonal Population Structure and Is Reliable for Epidemiological Typing

    PubMed Central

    Didi, Jennifer; Lemée, Ludovic; Gibert, Laure; Pons, Jean-Louis

    2014-01-01

    Staphylococcus lugdunensis is an emergent virulent coagulase-negative staphylococcus responsible for severe infections similar to those caused by Staphylococcus aureus. To understand its potentially pathogenic capacity and have further detailed knowledge of the molecular traits of this organism, 93 isolates from various geographic origins were analyzed by multi-virulence-locus sequence typing (MVLST), targeting seven known or putative virulence-associated loci (atlLR2, atlLR3, hlb, isdJ, SLUG_09050, SLUG_16930, and vwbl). The polymorphisms of the putative virulence-associated loci were moderate and comparable to those of the housekeeping genes analyzed by multilocus sequence typing (MLST). However, the MVLST scheme generated 43 virulence types (VTs) compared to 20 sequence types (STs) based on MLST, indicating that MVLST was significantly more discriminating (Simpson's index [D], 0.943). No hypervirulent lineage or cluster specific to carriage strains was defined. The results of multilocus sequence analysis of known and putative virulence-associated loci are consistent with a clonal population structure for S. lugdunensis, suggesting a coevolution of these genes with housekeeping genes. Indeed, the nonsynonymous to synonymous evolutionary substitutions (dN/dS) ratio, the Tajima's D test, and Single-likelihood ancestor counting (SLAC) analysis suggest that all virulence-associated loci were under negative selection, even atlLR2 (AtlL protein) and SLUG_16930 (FbpA homologue), for which the dN/dS ratios were higher. In addition, this analysis of virulence-associated loci allowed us to propose a trilocus sequence typing scheme based on the intragenic regions of atlLR3, isdJ, and SLUG_16930, which is more discriminant than MLST for studying short-term epidemiology and further characterizing the lineages of the rare but highly pathogenic S. lugdunensis. PMID:25078912

  13. Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

    PubMed

    Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

    2007-01-01

    Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

  14. Mechanisms of chiral discrimination by topoisomerase IV

    PubMed Central

    Neuman, K. C.; Charvin, G.; Bensimon, D.; Croquette, V.

    2009-01-01

    Topoisomerase IV (Topo IV), an essential ATP-dependent bacterial type II topoisomerase, transports one segment of DNA through a transient double-strand break in a second segment of DNA. In vivo, Topo IV unlinks catenated chromosomes before cell division and relaxes positive supercoils generated during DNA replication. In vitro, Topo IV relaxes positive supercoils at least 20-fold faster than negative supercoils. The mechanisms underlying this chiral discrimination by Topo IV and other type II topoisomerases remain speculative. We used magnetic tweezers to measure the relaxation rates of single and multiple DNA crossings by Topo IV. These measurements allowed us to determine unambiguously the relative importance of DNA crossing geometry and enzymatic processivity in chiral discrimination by Topo IV. Our results indicate that Topo IV binds and passes DNA strands juxtaposed in a nearly perpendicular orientation and that relaxation of negative supercoiled DNA is perfectly distributive. Together, these results suggest that chiral discrimination arises primarily from dramatic differences in the processivity of relaxing positive and negative supercoiled DNA: Topo IV is highly processive on positively supercoiled DNA, whereas it is perfectly distributive on negatively supercoiled DNA. These results provide fresh insight into topoisomerase mechanisms and lead to a model that reconciles contradictory aspects of previous findings while providing a framework to interpret future results. PMID:19359479

  15. Diagnostic Accuracy of History and Physical Examination of Superior Labrum Anterior-Posterior Lesions

    PubMed Central

    Michener, Lori A.; Doukas, William C.; Murphy, Kevin P.; Walsworth, Matthew K.

    2011-01-01

    Context: Type I superior labrum anterior-posterior (SLAP) lesions involve degenerative fraying and probably are not the cause of shoulder pain. Type II to IV SLAP lesions are tears of the labrum. Objective: To determine the diagnostic accuracy of patient history and the active compression, anterior slide, and crank tests for type I and type II to IV SLAP lesions. Design: Cohort study. Setting: Clinic. Patients or Other Participants: Fifty-five patients (47 men, 8 women; age = 40.6 ± 15.1 years) presenting with shoulder pain. Intervention(s): For each patient, an orthopaedic surgeon conducted a clinical examination of history of trauma; sudden onset of symptoms; history of popping, clicking, or catching; age; and active compression, crank, and anterior slide tests. The reference standard was the intraoperative diagnosis. The operating surgeon was blinded to the results of the clinical examination. Main Outcome Measure(s): Diagnostic utility was calculated using the receiver operating characteristic curve and area under the curve (AUC), sensitivity, specificity, positive likelihood ratio (+LR), and negative likelihood ratio (−LR). Forward stepwise binary regression was used to determine a combination of tests for diagnosis. Results: No history item or physical examination test had diagnostic accuracy for type I SLAP lesions (n = 13). The anterior slide test had utility (AUC = 0.70, +LR = 2.25, −LR = 0.44) to confirm and exclude type II to IV SLAP lesions (n = 10). The combination of a history of popping, clicking, or catching and the anterior slide test demonstrated diagnostic utility for confirming type II to IV SLAP lesions (+LR = 6.00). Conclusions: The anterior slide test had limited diagnostic utility for confirming and excluding type II to IV SLAP lesions; diagnostic values indicated only small shifts in probability. However, the combination of the anterior slide test with a history of popping, clicking, or catching had moderate diagnostic utility for confirming type II to IV SLAP lesions. No single item or combination of history items and physical examination tests had diagnostic utility for type I SLAP lesions. PMID:21944065

  16. Terminal ileum gangrene secondary to a type IV paraesophageal hernia.

    PubMed

    Hsu, Ching Tsai; Hsiao, Po Jen; Chiu, Chih Chien; Chan, Jenq Shyong; Lin, Yee Fung; Lo, Yuan Hung; Hsiao, Chia Jen

    2016-02-28

    Type IV paraesophageal hernia (PEH) is very rare, and is characterized by the intrathoracic herniation of the abdominal viscera other than the stomach into the chest. We describe a 78-year-old woman who presented at our emergency department because of epigastric pain that she had experienced over the past 24 h. On the day after admission, her pain became severe and was accompanied by right chest pain and dyspnea. Chest radiography revealed an intrathoracic intestinal gas bubble occupying the right lower lung field. Emergency explorative laparotomy identified a type IV PEH with herniation of only the terminal ileum through a hiatal defect into the right thoracic cavity. In this report, we also present a review of similar cases in the literature published between 1980 and 2015 in PubMed. There were four published cases of small bowel herniation into the thoracic cavity during this period. Our patient represents a rare case of an individual diagnosed with type IV PEH with incarceration of only the terminal ileum.

  17. Atypical hereditary sensory and autonomic neuropathy type IV with neither mental retardation nor pain insensitivity.

    PubMed

    Jung, Chae Lim; Ki, Chang-Seok; Kim, Byoung Joon; Lee, Jong-Hyuck; Sung, Ki-Sun; Kim, Jong-Won; Park, Youn-Soo

    2013-12-01

    Hereditary sensory and autonomic neuropathy type IV is an autosomal recessive disorder characterized by severe mental retardation and self-mutilation-related complications. Recently, we investigated a 16-year-old Korean boy with normal intelligence. He had preserved pain sensation but was suspected of having hereditary sensory and autonomic neuropathy type IV because of the recurrent bone fractures and painless joint destruction in the absence of any predisposing medical conditions. Genetic analysis of the NTRK1 gene revealed compound heterozygous mutations including c.851-33T>A and c.2303C>T (p.Pro768Leu) in the NTRK1 gene. The p.Pro768Leu mutation has been identified in 2 Japanese patients with a mild phenotype. Therefore, although it is rare, hereditary sensory and autonomic neuropathy type IV should be considered in patients with recurrent bone fractures and painless joint destruction who do not have any predisposing conditions even when they do not have typical clinical features such as mental retardation or pain insensitivity.

  18. Type IV Hypersensitivity to Gold Weight Upper-Eyelid Implant: Case Report and Review of the Literature.

    PubMed

    Kilduff, Caroline L S; Casswell, Edward J; Imonikhe, Richard; Marjanovic, Branka

    2017-05-04

    Complications associated with gold-weight insertion for lagophthalmos are uncommon, recent reports have provided evidence to suggest that type IV hypersensitivity to gold can cause a persistent inflammatory reaction. We present a case of a 46-year-old man who experienced persistent post-operative inflammation, and summarize previously documented cases. This patient underwent uncomplicated insertion of an upper eyelid gold weight for right-sided facial nerve palsy. He had no allergies or implanted metalwork. Post-operatively erythema was noted at seven-weeks and did not resolve. The weight was removed after six-months. The histopathological findings were in keeping with type IV hypersensitivity and similar to previous cases. Although infrequent, this complication has poor outcomes. The definitive management is removal of the weight. Information regarding implanted gold, and previous reactions should be elicited pre-operatively. Type IV hypersensitivity should be considered in patients with persistent inflammation that do not respond to antibiotic or steroid therapy.

  19. A Putative O-Linked β-N-Acetylglucosamine Transferase Is Essential for Hormogonium Development and Motility in the Filamentous Cyanobacterium Nostoc punctiforme.

    PubMed

    Khayatan, Behzad; Bains, Divleen K; Cheng, Monica H; Cho, Ye Won; Huynh, Jessica; Kim, Rachelle; Omoruyi, Osagie H; Pantoja, Adriana P; Park, Jun Sang; Peng, Julia K; Splitt, Samantha D; Tian, Mason Y; Risser, Douglas D

    2017-05-01

    Most species of filamentous cyanobacteria are capable of gliding motility, likely via a conserved type IV pilus-like system that may also secrete a motility-associated polysaccharide. In a subset of these organisms, motility is achieved only after the transient differentiation of hormogonia, which are specialized filaments that enter a nongrowth state dedicated to motility. Despite the fundamental importance of hormogonia to the life cycles of many filamentous cyanobacteria, the molecular regulation of hormogonium development is largely undefined. To systematically identify genes essential for hormogonium development and motility in the model heterocyst-forming filamentous cyanobacterium Nostoc punctiforme , a forward genetic screen was employed. The first gene identified using this screen, designated ogtA , encodes a putative O-linked β- N -acetylglucosamine transferase (OGT). The deletion of ogtA abolished motility, while ectopic expression of ogtA induced hormogonium development even under hormogonium-repressing conditions. Transcription of ogtA is rapidly upregulated (1 h) following hormogonium induction, and an OgtA-GFPuv fusion protein localized to the cytoplasm. In developing hormogonia, accumulation of PilA but not HmpD is dependent on ogtA Reverse transcription-quantitative PCR (RT-qPCR) analysis indicated equivalent levels of pilA transcript in the wild-type and Δ ogtA mutant strains, while a reporter construct consisting of the intergenic region in the 5' direction of pilA fused to gfp produced lower levels of fluorescence in the Δ ogtA mutant strain than in the wild type. The production of hormogonium polysaccharide in the Δ ogtA mutant strain is reduced compared to that in the wild type but comparable to that in a pilA deletion strain. Collectively, these results imply that O -GlcNAc protein modification regulates the accumulation of PilA via a posttranscriptional mechanism in developing hormogonia. IMPORTANCE Filamentous cyanobacteria are among the most developmentally complex prokaryotes. Species such as Nostoc punctiforme develop an array of cell types, including nitrogen-fixing heterocysts, spore-like akinetes, and motile hormogonia, that function in dispersal as well as the establishment of nitrogen-fixing symbioses with plants and fungi. These symbioses are major contributors to global nitrogen fixation. Despite the fundamental importance of hormogonia to the life cycle of filamentous cyanobacteria and the establishment of symbioses, the molecular regulation of hormogonium development is largely undefined. We employed a genetic screen to identify genes essential for hormogonium development and motility in Nostoc punctiforme The first gene identified using this screen encodes a eukaryotic-like O-linked β- N -acetylglucosamine transferase that is required for accumulation of PilA in hormogonia. Copyright © 2017 American Society for Microbiology.

  20. [Clinical study on vocal cords spontaneous rehabilitation after CO2 laser surgery].

    PubMed

    Zhang, Qingxiang; Hu, Huiying; Sun, Guoyan; Yu, Zhenkun

    2014-10-01

    To study the spontaneous rehabilitation and phonation quality of vocal cords after different types of CO2 laser microsurgery. Surgical procedures based on Remacle system Type I, Type II, Type III, Type IV and Type V a respectively. Three hundred and fifteen cases with hoarseness based on strobe laryngoscopy results were prospectively assigned to different group according to vocal lesions apperence,vocal vibration and imaging of larynx CT/MRI. Each group holded 63 cases. The investigation included the vocal cords morphological features,the patients' subjective feelings and objective results of vocal cords. There are no severe complications for all patients in perioperative period. Vocal scar found in Type I ,1 case; Type II, 9 cases ;Type III, 47 cases; Type IV, 61 cases and Type Va 63 cases respectively after surgery. The difference of Vocal scar formation after surgery between surgical procedures are statistical significance (χ2 = 222.24, P < 0.05). Hoarseness improved after the surgery in 59 cases of Type I , 51 cases of Type II, 43 cases of Type III, 21 cases of Type IV and 17 cases of Type Va. There are statistically significance (χ2 = 89.46, P < 0.05) between different surgical procedures. The parameters of strobe laryngoscope: there are statistical significance on jitter between procedures (F 44.51, P < 0.05), but without difference within Type I and Type II (P > 0.05). This happened in shimmer parameter and the maximum phonation time (MPT) as jitter. There are no statistical significance between Type IV and Type Va on MPT (P > 0.05). Morphological and functional rehabilitation of vocal cord will be affected obviously when the body layer is injured. The depth and range of the CO2 laser microsurgery are the key factors affecting the vocal rehabilitation.

  1. Streptococcus suis serotype 9 strain GZ0565 contains a type VII secretion system putative substrate EsxA that contributes to bacterial virulence and a vanZ-like gene that confers resistance to teicoplanin and dalbavancin in Streptococcus agalactiae.

    PubMed

    Lai, Liying; Dai, Jiao; Tang, Huanyu; Zhang, Shouming; Wu, Chunyan; Qiu, Wancen; Lu, Chengping; Yao, Huochun; Fan, Hongjie; Wu, Zongfu

    2017-06-01

    Streptococcus suis (SS), an important pathogen for pigs, is not only considered as a zoonotic agent for humans, but is also recognized as a major reservoir of antimicrobial resistance contributing to the spread of resistance genes to other pathogenic Streptococcus species. In addition to serotype 2 (SS2), serotype 9 (SS9) is another prevalent serotype isolated from diseased pigs. Although many SS strains have been sequenced, the complete genome of a non-SS2 virulent strain has been unavailable to date. Here, we report the complete genome of GZ0565, a virulent strain of SS9, isolated from a pig with meningitis. Comparative genomic analysis revealed five new putative virulence or antimicrobial resistance-associated genes in strain GZ0565 but not in SS2 virulent strains. These five genes encode a putative triacylglycerol lipase, a TipAS antibiotic-recognition domain protein, a putative TetR family transcriptional repressor, a protein containing a LPXTG domain and a G5 domain, and a type VII secretion system (T7SS) putative substrate (EsxA), respectively. Western blot analysis showed that strain GZ0565 can secrete EsxA. We generated an esxA deletion mutant and showed that EsxA contributes to SS virulence in a mouse infection model. Additionally, the antibiotic resistance gene vanZ SS was identified and expression of vanZ SS conferred resistance to teicoplanin and dalbavancin in Streptococcus agalactiae. We believe this is the first experimental demonstration of the existence of the T7SS putative substrate EsxA and its contribution to bacterial virulence in SS. Together, our results contribute to further understanding of the virulence and antimicrobial resistance characteristics of SS. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Accentuated hyperparathyroidism in type II Bartter syndrome.

    PubMed

    Landau, Daniel; Gurevich, Evgenia; Sinai-Treiman, Levana; Shalev, Hannah

    2016-07-01

    Bartter syndrome (BS) may be associated with different degrees of hypercalciuria, but marked parathyroid hormone (PTH) abnormalities have not been described. We compared clinical and laboratory data of patients with either ROMK-deficient type II BS (n = 14) or Barttin-deficient type IV BS (n = 20). Only BS-IV patients remained mildly hypokalemic in spite of a higher need for potassium supplementation. Estimated glomerular filtration rate (eGFR) was mildly decreased in only four BS-IV patients. Average PTH values were significantly higher in BS-II (160.6 ± 85.8 vs. 92.5 ± 48 pg/ml in BS-IV, p = 0.006). In both groups, there was a positive correlation between age and log(PTH). Levels of 25(OH) vitamin D were not different. Total serum calcium was lower (within normal limits) and age-related serum phosphate (Pi)-SDS was increased in BS-II (1.19 ± 0.71 vs. 0.01 ± 1.04 in BS-IV, p < 0.001). The GFR threshold for Pi reabsorption was higher in BS-II (5.63 ± 1.25 vs. 4.36 ± 0.98, p = 0.002). Spot urine calcium/creatinine ratio and nephrocalcinosis rate (100 vs. 16 %) were higher in the BS-II group. PTH, serum Pi levels, and urinary threshold for Pi reabsorption are significantly elevated in type II vs. type IV BS, suggesting a PTH resistance state. This may be a response to more severe long-standing hypercalciuria, leading to a higher rate of nephrocalcinosis in BS-II.

  3. Properties of the highly ionized disk and halo gas toward two distant high-latitude stars

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, K. R.

    1994-01-01

    Goddard High Resolution Spectrograph (GHRS) intermediate -resolution observations of S III, Si III, Al III, Si IV, C IV, and N V absorption along the sight lines to HD 18100 (l = 217.9 deg, b = -62.7, d = 3.1 kpc, z = -2.8 kpc) and HD 100340 (l = 258.9 deg, b = +61.2 deg, d = 5.3 kpc, z = 4.6 kpc) are presented. These small science aperture spectra have resolutions ranging from 11 to 20 km/s full width at half maximum (FWHM) and S/N from 30 to 65 per diode substep. Strong absorption by moderately and highly ionized gas is seen in each direction. The absorption in the direction of the south Galactic polar region (HD 18100) is kinematically simple, while the absorption in the direction of north Galactic polar region (HD 100304) is kinematically complex. In each case the absorption by the highly ionized gas lies within the velocity range of absorption by neutral and weakly ionized gas. Along each sight line, the velocity dispersion determined from the unsaturated absorption lines increases with the energy required to create each ion. The logarithmic column densities for Al III, Si IV, C IV, and N V are log N(atoms/sq cm = 12.71, 13.10, 13.58, and 12.75 toward HD 18100 and log N = 12.88, 13.31, 13.83, and 13.04 toward HD 100340. Average ionic ratios among these species are very similar along the two sight lines. Differences in profile shape between the absorption for AL II, Si IV, C IV, and N V provide additional support for the claim of Savage, Sembach, & Cardelli (1994) that there exists two types of highly ionized gas in the interstellar medium. One type of highly ionized gas is responsible for the structured Si IV absorption and part of the C IV absorption. In this gas N(C IV)/N(Si IV) approximately 3.0 and N(C IV)/N(N V) greater than 6. The absorption by this gas seems to be associated with some type of self-regulating interface or mixing layer between the warm and hot interstellar medium. The other type of highly ionized gas is responsible for most of the N V absorption, part of the C IV absorption, and has very little associated Si IV absorption. In this gas N(C IV)/N(N V) is approximately 1 to 3. This gas is hot (T greater than 2 x 10(exp 5) K) and may be tracing the cooling gas of supernova (SN) bubbles or a Galactic fountain. The relative mixture of these two types of highly ionized gas varies from one sight line to the next. The two sight lines in this study sample halo gas in the solar neighborhood and have a smaller percentage of the more highly ionized gas than inner Galaxy sight lines.

  4. The Physical, Chemical and Physiological Limits of Life

    PubMed Central

    Schulze-Makuch, Dirk; Schulze-Makuch, Alexander; Houtkooper, Joop M.

    2015-01-01

    Life on Earth displays an incredible diversity in form and function, which allows it to survive not only physical extremes, but also periods of time when it is exposed to non-habitable conditions. Extreme physiological adaptations to bridge non-habitable conditions include various dormant states, such as spores or tuns. Here, we advance the hypothesis that if the environmental conditions are different on some other planetary body, a deviating biochemistry would evolve with types of adaptations that would manifest themselves with different physical and chemical limits of life. In this paper, we discuss two specific examples: putative life on a Mars-type planet with a hydrogen peroxide-water solvent and putative life on a Titan-type planetary body with liquid hydrocarbons as a solvent. Both examples would have the result of extending the habitable envelope of life in the universe. PMID:26193325

  5. Selective thoracic surgery in the Lenke type 1A: King III and King IV type curves.

    PubMed

    Parisini, P; Di Silvestre, M; Lolli, F; Bakaloudis, G

    2009-06-01

    Pedicle screw fixation enables enhanced three-dimensional correction of spinal deformities and effectively shortens the distal fusion level. However, the choice of distal fusion level is still controversial in single thoracic idiopathic scoliosis with the lumbar compensatory curve not crossing the middle line (Lenke type 1 with modifier A or King type III and IV curves).The authors retrospectively analyzed 31 patients treated by segmental pedicular instrumentation alone, affected by a single thoracic adolescent idiopathic scoliosis with a compensatory lumbar curve not crossing the midline (Lenke 1A), with an average age of 16.3 years (range 10-22 years). The patients with regard to the King classification were also assessed. A statistical analysis was performed to determine whether the two groups (King III, King IV) presented differences concerning the level of the stable vertebra (SV), end vertebra (EV), and neutral vertebra (NV) and were also analyzed the results at follow-up regarding the relationships between the SV, EV, and lowest instrumented vertebra (LIV). The statistical analysis showed a significant difference between the two curve types. In the King III type curve the SV, EV, and NV appeared to be more proximal than those of the King IV type curve and the segments between the SV, EV, and NV appeared to be reduced in King III curves compared with King IV curves. At a follow-up of 3.2 years (range 2.2-5) the thoracic curve showed a correction of 58.4% (from 62.3 degrees to 26.6 degrees ) and compensatory lumbar curve an average spontaneous correction of 52.4% (from 38.1 degrees to 18.1 degrees ).The position of the LIV was shorter than the position of the SV in 30 patients (97%) with an average "salvage" of 2.1 (from 1 to 4) distal fusion levels. Four cases (13%), all affected by a King IV type curve, presented at follow-up an unsatisfactory results due to an "adding on" phenomenon. The statistical analysis confirmed that this phenomenon was correlated with The King IV curve (P = 0.043; Chi-square test) and that the only predictive parameter for its onset was the LIV-SV difference (odds ratio = 0.093; with a confidence interval of 0.008-1): every time that in King IV curve type the LIV was three or more levels shorter than the stable vertebra at follow-up the "adding on" phenomenon was present. The authors conclude that Lenke's type 1 with modifier A includes two kinds of curves, King III and King IV and that the Lenke's type 2 curves and King V with the lumbar curve not crossing the middle line have a similar behavior. Therefore, it is of authors' opinion that "the adding on phenomenon" could be prevented by more rigidly defining K. IV versus K. III curves. In Lenke's 1/2 A-K. IV/V type with the rotation of the first vertebra just below the thoracic lower EV in the same direction as the thoracic curve, and when SV and EV show more than two levels of difference, it is necessary to extend the lower fusion down to L2 or L3 (not more than two levels shorter than the SV). Whereas in Lenke's 1/2 A-K. III/V with the rotation of the first proximal vertebra of lumbar curve in the opposite direction to the thoracic apex and when SV and EV show not more than two level gap differences, the position of the lowest instrumented vertebra can be two or three levels shorter than the stable vertebra with satisfactory postoperative spinal balance. Therefore, the stable vertebra and the rotation of lumbar curve are considered to be a reliable guide for selecting the lower level of fusion.

  6. Specific Accumulation of Tumor-Derived Adhesion Factor in Tumor Blood Vessels and in Capillary Tube-Like Structures of Cultured Vascular Endothelial Cells

    NASA Astrophysics Data System (ADS)

    Akaogi, Kotaro; Okabe, Yukie; Sato, Junji; Nagashima, Yoji; Yasumitsu, Hidetaro; Sugahara, Kazuyuki; Miyazaki, Kaoru

    1996-08-01

    Tumor-derived adhesion factor (TAF) was previously identified as a cell adhesion molecule secreted by human bladder carcinoma cell line EJ-1. To elucidate the physiological function of TAF, we examined its distribution in human normal and tumor tissues. Immunochemical staining with an anti-TAF monoclonal antibody showed that TAF was specifically accumulated in small blood vessels and capillaries within and adjacent to tumor nests, but not in those in normal tissues. Tumor blood vessel-specific staining of TAF was observed in various human cancers, such as esophagus, brain, lung, and stomach cancers. Double immunofluorescent staining showed apparent colocalization of TAF and type IV collagen in the vascular basement membrane. In vitro experiments demonstrated that TAF preferentially bound to type IV collagen among various extracellular matrix components tested. In cell culture experiments, TAF promoted adhesion of human umbilical vein endothelial cells to type IV collagen substrate and induced their morphological change. Furthermore, when the endothelial cells were induced to form capillary tube-like structures by type I collagen, TAF and type IV collagen were exclusively detected on the tubular structures. The capillary tube formation in vitro was prevented by heparin, which inhibited the binding of TAF to the endothelial cells. These results strongly suggest that TAF contributes to the organization of new capillary vessels in tumor tissues by modulating the interaction of endothelial cells with type IV collagen.

  7. Successful Multiresistant Community-Associated Methicillin-Resistant Staphylococcus aureus Lineage from Taipei, Taiwan, That Carries Either the Novel Staphylococcal Chromosome Cassette mec (SCCmec) Type VT or SCCmec Type IV

    PubMed Central

    Boyle-Vavra, Susan; Ereshefsky, Ben; Wang, Chih-Chien; Daum, Robert S.

    2005-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) isolates carry the methicillin resistance gene (mecA) on a horizontally transferred genetic element called the staphylococcal chromosome cassette mec (SCCmec). Community-acquired MRSA (CAMRSA) isolates usually carry SCCmec type IV. We previously reported that 76% of 17 CAMRSA isolates (multilocus sequence type 59) obtained from pediatric patients with skin and soft tissue infections (SSTI) from Taipei did not carry SCCmec types I to IV. We used DNA sequence analysis to determine that the element harbored by these nontypeable isolates is a novel subtype of SCCmec V called SCCmec VT. It contains a ccrC recombinase gene variant (ccrC2) and mec complex C2. One SSTI isolate contained molecular features of SCCmec IV but also contained ccrC2 (a feature of SCCmec VT), suggesting that it may harbor a composite SCCmec element. The genes lukS-PV and lukF-PV encoding the Panton-Valentine leukocidin (PVL) were present in all CAMRSA SSTI isolates whether they contained SCCmec type IV or VT. SCCmec VT was also present in 5 of 34 (14.7%) CAMRSA colonization isolates collected from healthy children from Taipei who lacked MRSA risk factors. Four (80%) of the these isolates contained lukS-PV and lukF-PV, as did 1 of 27 (3.7%) SCCmec IV-containing colonization isolates. A total of 63% (10 of 16) of the SSTI isolates and 61.7% (21 of 34) of the colonization isolates tested were resistant to at least four classes of non-β-lactam antimicrobials. SCCmec VT is a novel SCCmec variant that is found in multiply resistant CAMRSA strains with sequence type 59 in Taipei in association with the PVL leukotoxin genes. PMID:16145133

  8. Five-factor model personality traits as predictors of incident coronary heart disease in the community: a 10.5-year cohort study based on the Baltimore epidemiologic catchment area follow-up study.

    PubMed

    Lee, Hochang Benjamin; Offidani, Emanuela; Ziegelstein, Roy C; Bienvenu, Oscar Joseph; Samuels, Jack; Eaton, William W; Nestadt, Gerald

    2014-01-01

    Certain personality and behavioral traits (e.g., type A and type D) have been reported to be associated with development and progression of coronary heart disease (CHD), but few have examined the relationship using a comprehensive assessment of personality along with a structured assessment of psychiatric disorders. Based on participants (age: 47.3 ± 12.8; female: 62.6%) of the Baltimore Epidemiologic Catchment Area follow-up study, we examined the relationship between the 5 major domains of personality traits (neuroticism, extraversion, openness, agreeableness, and conscientiousness) and incident CHD between Wave III (1993-1996) and Wave IV (2004-2005). Incident CHD developed in 65 participants during the follow-up. Those with incident CHD had lower on openness (44.06 ± 9.29 vs. 47.18 ± 8.80; p = 0.007) and extraversion (45.98 ± 9.25 vs. 49.12 ± 8.92; p = 0.007) scores than those without. Logistic regression models revealed an inverse association (OR = 0.73; 95% CI = 0.54-0.98) between openness factor z-scores and incident CHD after adjusting for putative confounding factors, including DSM III-R Major Depressive Disorder. High openness appears to be an independent protective factor for incident CHD in the community. Future studies should examine behavioral and pathophysiologic mechanisms underlying this association. Copyright © 2014 Academy of Psychosomatic Medicine. Published by Elsevier Inc. All rights reserved.

  9. The mutagenesis of a type IV secretion system locus of Piscirickettsia salmonis leads to the attenuation of the pathogen in Atlantic salmon, Salmo salar.

    PubMed

    Mancilla, M; Saavedra, J; Grandón, M; Tapia, E; Navas, E; Grothusen, H; Bustos, P

    2018-04-01

    Piscirickettsiosis is a threatening infectious disease for the salmon industry, due to it being responsible for significant economic losses. The control of outbreaks also poses considerable environmental challenges. Despite Piscirickettsia salmonis having been discovered as the aetiological agent of the disease more than 25 years ago, its pathogenicity remains poorly understood. Among virulence factors identified so far, type four secretion systems (T4SS) seem to play a key role during the infection caused by the bacterium. We report here the genetic manipulation of P. salmonis by means of the transference of plasmid DNA in mating assays. An insertion cassette was engineered for targeting the icmB gene, which encodes a putative T4SS-ATPase and is carried by one of the chromosomal T4SS clusters found within the genome of P. salmonis PM15972A1, a virulent representative of the EM-90-like strain. The molecular characterization of the resulting mutant strain demonstrated that the insertion interrupted the target gene. Further in vitro testing of the icmB mutant showed a dramatic drop in infectivity as tested in CHSE-214 cells, which is in agreement with its attenuated behaviour observed in vivo. Altogether, our results demonstrate that, similar to other facultative intracellular pathogens, P. salmonis' virulence relies on an intact T4SS. © 2017 The Authors. Journal of Fish Diseases Published by John Wiley & Sons Ltd.

  10. Characterization of a restriction modification system from the commensal Escherichia coli strain A0 34/86 (O83:K24:H31).

    PubMed

    Weiserová, Marie; Ryu, Junichi

    2008-06-27

    Type I restriction-modification (R-M) systems are the most complex restriction enzymes discovered to date. Recent years have witnessed a renaissance of interest in R-M enzymes Type I. The massive ongoing sequencing programmes leading to discovery of, so far, more than 1 000 putative enzymes in a broad range of microorganisms including pathogenic bacteria, revealed that these enzymes are widely represented in nature. The aim of this study was characterisation of a putative R-M system EcoA0ORF42P identified in the commensal Escherichia coli A0 34/86 (O83: K24: H31) strain, which is efficiently used at Czech paediatric clinics for prophylaxis and treatment of nosocomial infections and diarrhoea of preterm and newborn infants. We have characterised a restriction-modification system EcoA0ORF42P of the commensal Escherichia coli strain A0 34/86 (O83: K24: H31). This system, designated as EcoAO83I, is a new functional member of the Type IB family, whose specificity differs from those of known Type IB enzymes, as was demonstrated by an immunological cross-reactivity and a complementation assay. Using the plasmid transformation method and the RM search computer program, we identified the DNA recognition sequence of the EcoAO83I as GGA(8N)ATGC. In consistence with the amino acids alignment data, the 3' TRD component of the recognition sequence is identical to the sequence recognized by the EcoEI enzyme. The A-T (modified adenine) distance is identical to that in the EcoAI and EcoEI recognition sites, which also indicates that this system is a Type IB member. Interestingly, the recognition sequence we determined here is identical to the previously reported prototype sequence for Eco377I and its isoschizomers. Putative restriction-modification system EcoA0ORF42P in the commensal Escherichia coli strain A0 34/86 (O83: K24: H31) was found to be a member of the Type IB family and was designated as EcoAO83I. Combination of the classical biochemical and bacterial genetics approaches with comparative genomics might contribute effectively to further classification of many other putative Type-I enzymes, especially in clinical samples.

  11. (2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, D.; Wang, L.; Beconi, M.

    2010-11-10

    A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

  12. Genetics Home Reference: mucolipidosis type IV

    MedlinePlus

    ... PubMed Vergarajauregui S, Puertollano R. Mucolipidosis type IV: the importance of functional lysosomes for efficient autophagy. Autophagy. 2008 ... Reviewed : August 2013 Published : June 26, 2018 The resources on this site should not be used as a substitute ... Department of Health & Human Services National Institutes of Health National Library of ...

  13. Pro-apoptotic effect of a Mycoplasma hyopneumoniae putative type I signal peptidase on PK(15) swine cells.

    PubMed

    Paes, Jéssica A; Virginio, Veridiana G; Cancela, Martín; Leal, Fernanda M A; Borges, Thiago J; Jaeger, Natália; Bonorino, Cristina; Schrank, Irene S; Ferreira, Henrique B

    2017-03-01

    Mycoplasma hyopneumoniae is an economically significant swine pathogen that causes porcine enzootic pneumonia (PEP). Important processes for swine infection by M. hyopneumoniae depend on cell surface proteins, many of which are secreted by secretion pathways not completely elucidated so far. A putative type I signal peptidase (SPase I), a possible component of a putative Sec-dependent pathway, was annotated as a product of the sipS gene in the pathogenic M. hyopneumoniae 7448 genome. This M. hyopneumoniae putative SPase I (MhSPase I) displays only 14% and 23% of sequence identity/similarity to Escherichia coli bona fide SPase I, and, in complementation assays performed with a conditional E. coli SPase I mutant, only a partial restoration of growth was achieved with the heterologous expression of a recombinant MhSPase I (rMhSPase I). Considering the putative surface location of MhSPase I and its previously demonstrated capacity to induce a strong humoral response, we then assessed its potential to elicit a cellular and possible immunomodulatory response. In assays for immunogenicity assessment, rMhSPase I unexpectedly showed a cytotoxic effect on murine splenocytes. This cytotoxic effect was further confirmed using the swine epithelial PK(15) cell line in MTT and annexin V-flow cytometry assays, which showed that rMhSPase I induces apoptosis in a dose dependent-way. It was also demonstrated that this pro-apoptotic effect of rMhSPase I involves activation of a caspase-3 cascade. The potential relevance of the rMhSPase I pro-apoptotic effect for M. hyopneumoniae-host interactions in the context of PEP is discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Mass loss in the interacting semi-detached binary delta librae

    NASA Technical Reports Server (NTRS)

    Mccluskey, George E., Jr.; Mccluskey, Carolina P. S.; Kondo, Yoji

    1995-01-01

    The interacting Algol-type binary Delta Librae (AOV + G: V) has been observed with the International Ultraviolet Explorer (IUE) satellite. More than fifty high resolution spectra in the far-ultraviolet and mid-ultraviolet spectrum have been analyzed in order to model the mass flow in the Delta Librae system. The resonance lines of Si IV and C IV are present in absorption and vary in strength both secularly and with phase. The radial velocities of the Si IV and C IV absorption lines generally follow the orbital motion of the primary star but deviate by typically a few tens of kilometers per second in the direction of the observer. The presence of Si IV and C IV features indicates the existence of a region considerably hotter than the normal AOV photosphere and, since these lines are present at all phases, this region must be fairly extensive. These results are interpreted in terms of a 'pseudo-photosphere' around the equatorial region of the AOV star, created by matter being accreted from the G-type companion. The widths of the Si IV and C IV absorption features imply that some of the matter lost by the G-star leaves the system entirely.

  15. Genome mining of the sordarin biosynthetic gene cluster from Sordaria araneosa Cain ATCC 36386: characterization of cycloaraneosene synthase and GDP-6-deoxyaltrose transferase.

    PubMed

    Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi

    2016-07-01

    Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed.

  16. Comparative genome analysis of 24 bovine-associated Staphylococcus isolates with special focus on the putative virulence genes

    PubMed Central

    Åvall-Jääskeläinen, Silja; Paulin, Lars; Blom, Jochen

    2018-01-01

    Non-aureus staphylococci (NAS) are most commonly isolated from subclinical mastitis. Different NAS species may, however, have diverse effects on the inflammatory response in the udder. We determined the genome sequences of 20 staphylococcal isolates from clinical or subclinical bovine mastitis, belonging to the NAS species Staphylococcus agnetis, S. chromogenes, and S. simulans, and focused on the putative virulence factor genes present in the genomes. For comparison we used our previously published genome sequences of four S. aureus isolates from bovine mastitis. The pan-genome and core genomes of the non-aureus isolates were characterized. After that, putative virulence factor orthologues were searched in silico. We compared the presence of putative virulence factors in the NAS species and S. aureus and evaluated the potential association between bacterial genotype and type of mastitis (clinical vs. subclinical). The NAS isolates had much less virulence gene orthologues than the S. aureus isolates. One third of the virulence genes were detected only in S. aureus. About 100 virulence genes were present in all S. aureus isolates, compared to about 40 to 50 in each NAS isolate. S. simulans differed the most. Several of the virulence genes detected among NAS were harbored only by S. simulans, but it also lacked a number of genes present both in S. agnetis and S. chromogenes. The type of mastitis was not associated with any specific virulence gene profile. It seems that the virulence gene profiles or cumulative number of different virulence genes are not directly associated with the type of mastitis (clinical or subclinical), indicating that host derived factors such as the immune status play a pivotal role in the manifestation of mastitis. PMID:29610707

  17. Structural studies of a bifunctional inhibitor of neprilysin and DPP-IV.

    PubMed

    Oefner, Christian; Pierau, Sabine; Schulz, Henk; Dale, Glenn E

    2007-09-01

    Neutral endopeptidase (NEP) is the major enzyme involved in the metabolic inactivation of a number of bioactive peptides including the enkephalins, substance P, endothelin, bradykinin and atrial natriuretic factor, as well as the incretin hormone glucagon-like peptide 1 (GLP-1), which is a potent stimulator of insulin secretion. The activity of GLP-1 is also rapidly abolished by the serine protease dipeptidyl peptidase IV (DPP-IV), which led to an elevated interest in inhibitors of this enzyme for the treatment of type II diabetes. A dual NEP/DPP-IV inhibitor concept is proposed, offering an alternative strategy for the treatment of type 2 diabetes. Here, the synthesis and crystal structures of the soluble extracellular domain of human NEP (residues 52-749) complexed with the NEP, competitive and potent dual NEP/DPP-IV inhibitor MCB3937 are described.

  18. [Mucolipidoses type IV in a patient with mapuche ancestry].

    PubMed

    Hernández Ch, Marta; Méndez C, José Ignacio; Concha G, María José; Huete L, Isidro; González B, Sergio; Durán S, Gloria P

    2008-07-01

    We report a 7 year-old girl with mapuche ancestors, diagnosed as a cerebral palsy since infancy and on active rehabilitation. She acquired motor and cognitive skills at 3 years of age. At 5 years of age, a slow neurological deterioration started, associated to visual impairment. Optic atrophy was added to the typical neurological exam of ataxic cerebral palsy and the diagnosis was re-considered. Neuroimaging showed a slow and progressive atrophy of intracerebral structures and ultramicroscopy revealed intracytoplasmatic inclusions in conjunctiva and skin, compatible with mucolipidoses type IV (ML-IV). ML-IV must be included in the differential diagnosis of cerebral palsy associated with loss of acquired skills and progressive visual impairment. Electron microscopy of skin or conjunctiva is a useful diagnostic test. Suspicion of ML-IV must not be restricted to Ashkenazi Jewish population.

  19. BDNF expression in the hippocampus of maternally separated rats: does Bifidobacterium breve 6330 alter BDNF levels?

    PubMed

    O'Sullivan, E; Barrett, E; Grenham, S; Fitzgerald, P; Stanton, C; Ross, R P; Quigley, E M M; Cryan, J F; Dinan, T G

    2011-09-01

    Brain-derived neurotrophic factor (BDNF) is of interest because of its putative role in stress and psychiatric disorders. Maternal separation is used as an animal model of early-life stress and of irritable bowel syndrome (IBS). Animals exposed to the paradigm show altered gut function together with heightened levels of arousal and corticosterone. Some probiotic organisms have been shown to be of benefit in IBS and influence the brain-gut axis. Our objective was to investigate the effects of maternal separation on BDNF under basal conditions and in response to the probiotic Bifidobacterium breve 6330. The study implemented the maternal separation model which we have previously described. Polymerase chain reaction and in situ hybridisation were performed to measure the effect of maternal separation on both BDNF total variants and BDNF splice variant (exon) IV in the hippocampus. Maternally separated and non-separated rats were treated with B. breve 6330, to investigate the effect of this probiotic on BDNF total variant and BDNF exon IV expression. Maternal separation increased BDNF total variants (P<0.01), whilst having no effect on BDNF exon IV. B. breve 6330 increased BDNF total variants (P<0.01), and decreased BDNF splice variant IV, in non-separated rats (P<0.01). B. breve 6330 did not alter BDNF levels in the maternally separated rats. Maternal separation caused a marked increase in BDNF in the hippocampus. While B. breve 6330 influenced BDNF in normal animals, it had no significant effect on BDNF in those which were maternally separated. We have demonstrated that an orally administered probiotic can influence hippocampal BDNF.

  20. Basement Membrane Type IV Collagen and Laminin: An Overview of Their Biology and Value as Fibrosis Biomarkers of Liver Disease.

    PubMed

    Mak, Ki M; Mei, Rena

    2017-08-01

    Basement membranes provide structural support to epithelium, endothelium, muscles, fat cells, Schwann cells, and axons. Basement membranes are multifunctional: they modulate cellular behavior, regulate organogenesis, promote tissue repair, form a barrier to filtration and tumor metastasis, bind growth factors, and mediate angiogenesis. All basement membranes contain type IV collagen (Col IV), laminin, nidogen, and perlecan. Col IV and laminin self-assemble into two independent supramolecular networks that are linked to nidogen and perlecan to form a morphological discernable basement membrane/basal lamina. The triple helical region, 7S domain and NCI domain of Col IV, laminin and laminin fragment P1 have been evaluated as noninvasive fibrosis biomarkers of alcoholic liver disease, viral hepatitis, and nonalcoholic fatty liver disease. Elevated serum Col IV and laminin are related to degrees of fibrosis and severity of hepatitis, and may reflect hepatic basement membrane metabolism. But the serum assays have not been linked to disclosing the anatomical sites and lobular distribution of perisinusoidal basement membrane formation in the liver. Hepatic sinusoids normally lack a basement membrane, although Col IV is a normal matrix component of the space of Disse. In liver disease, laminin deposits in the space of Disse and codistributes with Col IV, forming a perisinusoidal basement membrane. Concomitantly, the sinusoidal endothelium loses its fenestrae and is transformed into vascular type endothelium. These changes lead to capillarization of hepatic sinusoids, a significant pathology that impairs hepatic function. Accordingly, codistribution of Col IV and laminin serves as histochemical marker of perisinusoidal basement membrane formation in liver disease. Anat Rec, 300:1371-1390, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  1. Odorant transfer characteristics of white bread during baking.

    PubMed

    Onishi, Masanobu; Inoue, Michiko; Araki, Tetsuya; Iwabuchi, Hisakatsu; Sagara, Yasuyuki

    2011-01-01

    The potent odorants in the crust and crumb of white bread were identified and quantified by gas chromatography-mass spectrometry and gas chromatography/olfactometry. The weight loss ratio of the samples baked at 220 °C was controlled in the range of 0-28%. The odorants were classified into 5 types by the transfer characteristics: i) All amounts of odorant transferred from the crust to external space (type-I). ii) All transferred from the crust to the crumb and external space (type-II). iii) Certain amount remaining in the crust and the rest transferred to the crumb and external space (type-III). iv) All transferred from the crumb to external space (type-IV). v) Certain amount remaining in the crumb and the rest transferred to the crust and external space (type-V). The odorants of type-IV were not apparent after the crust had formed. The results indicate that the crust could be a barrier to prevent the odorants from being transferred to external space.

  2. Putative pyramidal neurons and interneurons in the monkey parietal cortex make different contributions to the performance of a visual grouping task.

    PubMed

    Yokoi, Isao; Komatsu, Hidehiko

    2010-09-01

    Visual grouping of discrete elements is an important function for object recognition. We recently conducted an experiment to study neural correlates of visual grouping. We recorded neuronal activities while monkeys performed a grouping detection task in which they discriminated visual patterns composed of discrete dots arranged in a cross and detected targets in which dots with the same contrast were aligned horizontally or vertically. We found that some neurons in the lateral bank of the intraparietal sulcus exhibit activity related to visual grouping. In the present study, we analyzed how different types of neurons contribute to visual grouping. We classified the recorded neurons as putative pyramidal neurons or putative interneurons, depending on the duration of their action potentials. We found that putative pyramidal neurons exhibited selectivity for the orientation of the target, and this selectivity was enhanced by attention to a particular target orientation. By contrast, putative interneurons responded more strongly to the target stimuli than to the nontargets, regardless of the orientation of the target. These results suggest that different classes of parietal neurons contribute differently to the grouping of discrete elements.

  3. Occurrence of putative virulence genes on Arcobacter butzleri isolated from three different environmental sites throughout the dairy chain.

    PubMed

    Piva, S; Gariano, G R; Bonilauri, P; Giacometti, F; Decastelli, L; Florio, D; Massella, E; Serraino, A

    2017-04-01

    This comparative study investigated the occurrence of cadF, cj1349, ciaB, pldA, tlyA, hecA, hecB, mviN, irgA and IroE genes in 212 Arcobacter butzleri isolated from three different environmental sites linked to the dairy chain (farms, industrial and artisanal dairy plants) located in three Italian regions (Lombardy, Emilia-Romagna and Calabria). According to the presence of these genes, different pathotypes (P-types) were determined. The main genes detected were ciaB, mviN, tlyA, cj1349, pldA and cadF, while the least common genes were iroE, hecA, hecB and irgA. TlyA, irgA, hecA, hecB and iroE, which were significantly more frequent in isolates recovered in industrial dairy plants. Twelve P-types were detected. The occurrence of the most frequently detected P-types (P-types 1, 2, 3 and 5) differed significantly (P < 0·001) in relation to both the environmental site and geographical area of isolation. The highest diversity in P-types was observed in industrial dairy plants and in the Calabria region. The results of this study show a correlation between the occurrence of putative virulence genes and virulence genotype variability depending on the environmental site and geographical origin of the isolates. The present study provides insights into the similar distribution of putative virulence genes in a dairy chain and other sources' isolates and also into a geographical distribution of some P-types. We have shown that industrial dairy plants may represent an environmental site favouring a selection of the isolates with a higher pathogenetic pattern. © 2017 The Society for Applied Microbiology.

  4. Modulation of substance P signaling by dipeptidyl peptidase-IV enzymatic activity in human glioma cell lines.

    PubMed

    Busek, P; Stremenová, J; Krepela, E; Sedo, A

    2008-01-01

    Dipeptidyl peptidase-IV (DPP-IV, CD26) is a serine protease almost ubiquitously expressed on cell surface and present in body fluids. DPP-IV has been suggested to proteolytically modify a number of biologically active peptides including substance P (SP) and the chemokine stromal cell derived factor-1alpha (SDF-1alpha, CXCL12). SP and SDF-1alpha have been implicated in the regulation of multiple biological processes and also induce responses that may be relevant for glioma progression. Both SP and SDF-1alpha are signaling through cell surface receptors and use intracellular calcium as a second messenger. The effect of DPP-IV on intracellular calcium mobilization mediated by SP and SDF-1alpha was monitored in suspension of wild type U373 and DPP-IV transfected U373DPPIV glioma cells using indicator FURA-2. Nanomolar concentrations of SP triggered a transient dose dependent increase in intracellular calcium rendering the cells refractory to repeated stimulation, while SDF-1 had no measurable effect. SP signaling in DPP-IV overexpressing U373DPPIV cells was not substantially different from that in wild type cells. However, preincubation of SP with the DPP-IV overexpressing cells lead to the loss of its signaling potential, which could be prevented with DPP-IV inhibitors. Taken together, DPP-IV may proteolytically inactivate local mediators involved in gliomagenesis.

  5. Immunotherapy using regulatory T cells in cancer suggests more flavors of hypersensitivity type IV.

    PubMed

    Pakravan, Nafiseh; Hassan, Zuhair Mohammad

    2018-03-01

    Regulatory T cells (Tregs) profoundly affect tumor microenvironment and exert dominant suppression over antitumor immunity in response to self-antigen expressed by tumor. Immunotherapy targeting Tregs lead to a significant improvement in antitumor immunity. Intradermal injection of tumor antigen results in negative delayed-type hypersensitivity (DTH) type IV. However, anti-Tregs treatment/use of adjuvant along with tumor antigens turns DTH to positive. Considering Tregs as the earliest tumor sensor/responders, tumor can be regarded as Treg-mediated type IV hypersensitivity and negative DTH to tumor antigen is due to anti-inflammatory action of Tregs to tumor antigens at the injection site. Such a view would help us in basic and clinical situations to testify a candidate vaccine via dermal administration and evaluation of Treg proportion at injection site.

  6. THE FURTHER SEPARATION OF TYPES AMONG THE PNEUMOCOCCI HITHERTO INCLUDED IN GROUP IV AND THE DEVELOPMENT OF THERAPEUTIC ANTISERA FOR THESE TYPES

    PubMed Central

    Cooper, Georgia; Rosenstein, Carolyn; Walter, Annabel; Peizer, Lenore

    1932-01-01

    The unclassified strains known as Group IV have been separated into twenty-nine types which are designated by the Roman numerals IV and XXXII. Only a small percentage of the pneumococcus strains isolated in New York City for this study were left unclassified. The majority of the types gave very slight cross-reactions, the exceptions being Types II and V, III and VIII, VII and XVIII and XV and XXX. In the series of cases studied, Types IV, V, VII and VIII were found more prevalent in the lobar pneumonia of adults and Types V, VI a and XIV in children. The majority of the types were also found in normal individuals and in persons having respiratory infections other than pneumonia. Types VI a and XIX were most prevalent in the limited number of strains studied by us. Fourteen of the types were found in pneumococcus meningitis; Type XVIII was found most often. Antisera suitable for clinical trial have been prepared for fourteen types. From the majority of the horses inoculated for more than a year, antisera having 500 to 1000 units per cc. were obtained. Antisera of lower potency were concentrated and preparations obtained equal to or stronger than high grade unconcentrated serum. Potent bivalent antisera have been prepared for types which were found to give marked cross-agglutination reactions. The results with each type as to prevalence, severity of cases, presence in normal individuals, and in spinal meningitis, potency of antisera produced for therapeutic trial and virulence of strains for mice have been considered under the different type headings. PMID:19870011

  7. Evidence for an interaction between leptin, T cell costimulatory antigens CD28, CTLA-4 and CD26 (dipeptidyl peptidase IV) in BCG-induced immune responses of leptin- and leptin receptor-deficient mice.

    PubMed

    Rüter, Jens; Hoffmann, Torsten; Demuth, Hans-Ulrich; Moschansky, Petra; Klapp, Burghard F; Hildebrandt, Martin

    2004-06-01

    We assessed changes of the enzyme dipeptidyl peptidase IV (DPP IV, CD26) in the context of leptin or leptin receptor deficiency. C57BL/6 mice, Leptin-deficient mice (ob/ob mice, B6.V-Lep) and Leptin-receptor-deficient mice (db/db mice, B6.Cg-m+/+Lepr) were infected with B. Calmette-Guerin (BCG) and sacrificed three days later. DPP IV activity in serum was higher in ob/ob mice and in db/db mice than in wild-type mice. The expression of DPP IV/CD26 on splenocytes was higher in ob/ob mice than in wild-type animals, and lower in db/db mice, and decreased upon stimulation with BCG in ob/ob mice only. Several T cell antigens including CTLA-4 were expressed aberrantly in ob/ob and in db/db mice. Our observations provide evidence for a relationship between DPP IV and leptin.

  8. Cardiac arrest after anesthetic management in a patient with hereditary sensory autonomic neuropathy type IV.

    PubMed

    Ergül, Yakup; Ekici, Bariş; Keskin, Sabiha

    2011-01-01

    Hereditary sensory autonomic neuropathy type IV is a rare disorder with an autosomal recessive transmission and characterized by self-mutilation due to a lack in pain and heat sensation. Recurrent hyperpyrexia and anhydrosis are seen in patients as a result of a lack of sweat gland innervation. Self-mutilation and insensitivity to pain result in orthopedic complications and patients undergone recurrent surgical interventions with anesthesia. However, these patients are prone to perioperative complications such as hyperthermia, hypothermia, and cardiac complications like bradycardia and hypotension. We report a 5-year-old boy with hereditary sensory autonomic neuropathy type IV, developing hyperpyrexia and cardiac arrest after anesthesia.

  9. Transcriptional and functional studies of Acidithiobacillus ferrooxidans genes related to survival in the presence of copper.

    PubMed

    Navarro, Claudio A; Orellana, Luis H; Mauriaca, Cecilia; Jerez, Carlos A

    2009-10-01

    The acidophilic Acidithiobacillus ferrooxidans can resist exceptionally high copper (Cu) concentrations. This property is important for its use in biomining processes, where Cu and other metal levels range usually between 15 and 100 mM. To learn about the mechanisms that allow A. ferrooxidans cells to survive in this environment, a bioinformatic search of its genome showed the presence of at least 10 genes that are possibly related to Cu homeostasis. Among them are three genes coding for putative ATPases related to the transport of Cu (A. ferrooxidans copA1 [copA1(Af)], copA2(Af), and copB(Af)), three genes related to a system of the resistance nodulation cell division family involved in the extraction of Cu from the cell (cusA(Af), cusB(Af), and cusC(Af)), and two genes coding for periplasmic chaperones for this metal (cusF(Af) and copC(Af)). The expression of most of these open reading frames was studied by real-time reverse transcriptase PCR using A. ferrooxidans cells adapted for growth in the presence of high concentrations of Cu. The putative A. ferrooxidans Cu resistance determinants were found to be upregulated when this bacterium was exposed to Cu in the range of 5 to 25 mM. These A. ferrooxidans genes conferred to Escherichia coli a greater Cu resistance than wild-type cells, supporting their functionality. The results reported here and previously published data strongly suggest that the high resistance of the extremophilic A. ferrooxidans to Cu may be due to part or all of the following key elements: (i) a wide repertoire of Cu resistance determinants, (ii) the duplication of some of these Cu resistance determinants, (iii) the existence of novel Cu chaperones, and (iv) a polyP-based Cu resistance system.

  10. Decameter Type IV Burst Associated with a Behind-the-limb CME Observed on 7 November 2013

    NASA Astrophysics Data System (ADS)

    Melnik, V. N.; Brazhenko, A. I.; Konovalenko, A. A.; Dorovskyy, V. V.; Rucker, H. O.; Panchenko, M.; Frantsuzenko, A. V.; Shevchuk, M. V.

    2018-03-01

    We report on the results of observations of a type IV burst made by the Ukrainian Radio interferometer of the Academy of Sciences (URAN-2) in the frequency range 22 - 33 MHz. The burst is associated with a coronal mass ejection (CME) initiated by a behind-the-limb active region (N05E151) and was also observed by the Nançay Decameter Array (NDA) radio telescope in the frequency band 30 - 60 MHz. The purpose of the article is the determination of the source of this type IV burst. After analysis of the observational data obtained with the URAN-2, the NDA, the Solar-Terrestrial Relations Observatory (STEREO) A and B spacecraft, and the Solar and Heliospheric Observatory (SOHO) spacecraft, we come to the conclusion that the source of the burst is the core of a behind-the-limb CME. We conclude that the radio emission can escape the center of the CME core at a frequency of 60 MHz and originates from the periphery of the core at a frequency of 30 MHz that is due to occultation by the solar corona at the corresponding frequencies. We find plasma densities in these regions assuming the plasma mechanism of radio emission. We show that the frequency drift of the start of the type IV burst is governed by an expansion of the CME core. The type III bursts that were observed against this type IV burst are shown to be generated by fast electrons propagating through the CME core plasma. A type II burst was registered at frequencies of 44 - 64 MHz and 3 - 16 MHz and was radiated by a shock with velocities of about 1000 km s^{-1} and 800 km s^{-1}, respectively.

  11. Transport Modeling for Metallic Electrode: Semiconducting Nanotube Systems

    NASA Technical Reports Server (NTRS)

    Yamada, Toshishige; Biegel, Bryan (Technical Monitor)

    2001-01-01

    Recently, current-voltage (I-V) characteristics have been reported by Collins et al. for a system with a scanning tunneling microscope (STM) tip and a carbon nanotube. The STM tip was driven forward into a film of many entangled nanotubes on a substrate, and then was retracted, so that one of nanotubes bridged the STM and the film. I-V characteristics had two different patterns for different heights. One showed large dI/ dV with V greater than 0, small dI/dV with V less than 0, and I = 0 near V = 0 (type-I), while the other showed rectification, i.e., I does not equal 0 only with V less than 0 (type-II), with the tip grounded. We propose a physical mechanism to explain the observed I-V patterns. We consider that the observed characteristics strongly reflected the nature of the tip (metal) - nanotube (semiconductor) contact. The other end of the nanotube was entangled well in the film, and simply provided a good Ohmic contact. We will argue that there are two different contact modes: vacuum gap and touching modes, depending on the presence or absence of a tiny vacuum gap d approx. 0.1 - 0.2 nm at the junction. These modes may be related to physisorption and chemisorption, respectively. Once admitting their existence, it is naturally shown that I-V characteristics are type-I in the vacuum gap mode, and type-II in the touching mode. We argue that the nanotube had to be an n-type semiconductor judging from the I-V characteristics, contrary to often observed p-type in the transistor applications, where p-type is probably due to the oxidation in air or the trapped charges in the silicon dioxide. Additional information is contained in the original extended abstract.

  12. Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors.

    PubMed

    Richter, Lubna V; Franks, Ashley E; Weis, Robert M; Sandler, Steven J

    2017-04-15

    Geobacter sulfurreducens , an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c -type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. Copyright © 2017 American Society for Microbiology.

  13. Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors

    PubMed Central

    Franks, Ashley E.; Weis, Robert M.; Sandler, Steven J.

    2017-01-01

    ABSTRACT Geobacter sulfurreducens, an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c-type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. PMID:28138101

  14. Hereditary sensory and autonomic neuropathy type IV and orthopaedic complications.

    PubMed

    Kim, W; Guinot, A; Marleix, S; Chapuis, M; Fraisse, B; Violas, P

    2013-11-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN-IV) is a very rare autosomal recessive disorder characterized by recurrent episodes of unexplained fever, extensive anhidrosis, total insensitivity to pain, hypotonia, and mental retardation. The most frequent complications of this disease are corneal scarring, multiple fractures, joint deformities, osteomyelitis, and disabling self-mutilations. We reported the case of a 12-year-old boy. The goal was to discuss our decision-making and compare this case with cases described in the literature. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  15. A unique evolution of the kidney phenotype in a patient with autosomal recessive Alport syndrome.

    PubMed

    Vischini, Gisella; Kapp, Meghan E; Wheeler, Ferrin C; Hopp, Laszlo; Fogo, Agnes B

    2018-03-09

    Alport syndrome is due to mutations in one of the genes encoding (α3,4,5) type IV collagen resulting in defective type IV collagen, a key component of the glomerular basement membrane (GBM). The GBM is initially thin, and with ongoing remodeling, develops a thickened basket-woven appearance. We report a unique case of a 9-year-old boy who was biopsied for hematuria and proteinuria, diagnosed as IgA nephropathy, with normal GBM appearance and thickness. Due to a family history of hematuria and chronic kidney disease, he subsequently underwent genetic evaluation and a mutation of α3 type IV collagen (COL4A3) was detected. Additional studies of the initial biopsy demonstrated abnormal type IV collagen immunostaining. A repeat biopsy 4years later showed characteristic glomerular basement membrane morphology of Alport syndrome, and scarring consistent with sequelae of IgA nephropathy. This is the first description of this unusual transition from an initial normal appearance of the glomerular basement membrane to the classic Alport phenotype. Copyright © 2018. Published by Elsevier Inc.

  16. Colorectal laterally spreading tumors show characteristic expression of cell polarity factors, including atypical protein kinase C λ/ι, E-cadherin, β-catenin and basement membrane component.

    PubMed

    Ichikawa, Yasushi; Nagashima, Yoji; Morioka, Kaori; Akimoto, Kazunori; Kojima, Yasuyuki; Ishikawa, Takashi; Goto, Ayumu; Kobayashi, Noritoshi; Watanabe, Kazuteru; Ota, Mitsuyoshi; Fujii, Shoichi; Kawamata, Mayumi; Takagawa, Ryo; Kunizaki, Chikara; Takahashi, Hirokazu; Nakajima, Atsushi; Maeda, Shin; Shimada, Hiroshi; Inayama, Yoshiaki; Ohno, Shigeo; Endo, Itaru

    2014-09-01

    Colorectal flat-type tumors include laterally spreading tumors (LSTs) and flat depressed-type tumors. The former of which shows a predominant lateral spreading growth rather than an invasive growth. The present study examined the morphological characteristics of LSTs, in comparison with polypoid- or flat depressed-type tumors, along with the expression of atypical protein kinase C (aPKC) λ/ι, a pivotal cell polarity regulator, and the hallmarks of cell polarity, as well as with type IV collagen, β-catenin and E-cadherin. In total, 37 flat-type (24 LSTs and 13 flat depressed-type tumors) and 20 polypoid-type colorectal tumors were examined. The LSTs were classified as 15 LST adenoma (LST-A) and nine LST cancer in adenoma (LST-CA). An immunohistochemical examination was performed on aPKC λ/ι, type IV collagen, β-catenin and E-cadherin. The LST-A and -CA showed a superficial replacing growth pattern, with expression of β-catenin and E-cadherin in the basolateral membrane and type IV collagen along the basement membrane. In addition, 86.6% of LST-A and 55.6% of LST-CA showed aPKC λ/ι expression of 1+ (weak to normal intensity staining in the cytoplasm compared with the normal epithelium). Furthermore, ~45% of the polypoid-type adenomas showed 2+ (moderate intensity staining in the cytoplasm and/or nucleus) and 66.7% of the polypoid-type cancer in adenoma were 3+ (strong intensity staining in the cytoplasm and nucleus). A statistically significant positive correlation was observed between the expression of aPKC λ/ι and β-catenin (r=0.842; P<0.001), or type IV collagen (r=0.823; P<0.001). The LSTs showed a unique growth pattern, different from the expanding growth pattern presented by a polypoid tumor and invasive cancer. The growth characteristics of LST appear to be caused by adequate coexpression of β-catenin, type IV collagen and aPKC λ/ι.

  17. Effect of intravenously-administered putative and potential antagonists of ethanol on sleep time in ethanol-narcotized mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hatch, R.C.; Jernigan, A.D.

    Groups of male CD-1 mice (n = 12/group) were injected intraperitoneally (IP) with 5 g ethanol/kg of body weight. After loss of righting reflex, they were given vehicle or one of 2-3 doses of reputed or potential antagonists of ethanol intravenously (IV). Sleep time was measured from loss to return of righting reflex. Mean sleep time (MST) was increased significantly by a large dose of dl-amphetamine and by 4-aminopyridine. Significant increases were also produced by small and large doses of aminophylline and by yohimbine. MST was not altered significantly by small and medium doses of dl-amphetamine, a medium dose ofmore » aminophylline, or by any doses of naloxone, thyrotropin-releasing hormone, propranolol, physostigmine, doxapram, or Ro 15-4513. When Ro 15-4513 was given IP 15 minutes before ethanol (n = 6/group), onset and duration of narcosis were not altered. None of the compounds tested was an effective IV antidote for deep ethanol narcosis because of drug side effects, toxicity, prolongation of MST, or insufficient shortening of MST. 36 references, 1 table.« less

  18. Exploring new classification criteria for the earliest type stars: the 3400 Aregion

    NASA Astrophysics Data System (ADS)

    Morrell, Nidia I.; Walborn, Nolan R.; Arias, Julia I.

    2002-02-01

    We propose spectroscopic observations of a sample of standard O2-O4 stars in the wavelength region containing the N IV 3479-83-85 Aand O IV 3381-85-3412 Alines, in order to analyze the behavior of these spectral features as a function of the spectral type. We aim to define new classification criteria for the hottest stars, evaluating these N IV and O IV lines near 3400 Aas possible temperature and luminosity discriminators. The former spectral class O3 has just been split into three different classes: O2, O3 and O3.5 (Walborn et al. 2001). The paucity of classification criteria at these types in the traditional wavelength domain (4000 - 4700 Å), makes clear the need to explore other spectral ranges in order to define additional constraints on the determination of spectral types and luminosity classes. The wavelength range around 3400 Ahas been observed in many faint, crowded early O-type stars by HST/FOS, the corresponding data being available from the HST archive. This enhances our interest in observing this spectral range in the classification standards for the early O-type stars in order to make these existing HST observations even more useful, allowing the determination of accurate spectral types for unknown objects from them, once the behavior of the new criteria in the standards has been charted.

  19. Annotation: a computational solution for streamlining metabolomics analysis

    PubMed Central

    Domingo-Almenara, Xavier; Montenegro-Burke, J. Rafael; Benton, H. Paul; Siuzdak, Gary

    2017-01-01

    Metabolite identification is still considered an imposing bottleneck in liquid chromatography mass spectrometry (LC/MS) untargeted metabolomics. The identification workflow usually begins with detecting relevant LC/MS peaks via peak-picking algorithms and retrieving putative identities based on accurate mass searching. However, accurate mass search alone provides poor evidence for metabolite identification. For this reason, computational annotation is used to reveal the underlying metabolites monoisotopic masses, improving putative identification in addition to confirmation with tandem mass spectrometry. This review examines LC/MS data from a computational and analytical perspective, focusing on the occurrence of neutral losses and in-source fragments, to understand the challenges in computational annotation methodologies. Herein, we examine the state-of-the-art strategies for computational annotation including: (i) peak grouping or full scan (MS1) pseudo-spectra extraction, i.e., clustering all mass spectral signals stemming from each metabolite; (ii) annotation using ion adduction and mass distance among ion peaks; (iii) incorporation of biological knowledge such as biotransformations or pathways; (iv) tandem MS data; and (v) metabolite retention time calibration, usually achieved by prediction from molecular descriptors. Advantages and pitfalls of each of these strategies are discussed, as well as expected future trends in computational annotation. PMID:29039932

  20. A well-defined terminal vanadium(III) oxo complex.

    PubMed

    King, Amanda E; Nippe, Michael; Atanasov, Mihail; Chantarojsiri, Teera; Wray, Curtis A; Bill, Eckhard; Neese, Frank; Long, Jeffrey R; Chang, Christopher J

    2014-11-03

    The ubiquity of vanadium oxo complexes in the V+ and IV+ oxidation states has contributed to a comprehensive understanding of their electronic structure and reactivity. However, despite being predicted to be stable by ligand-field theory, the isolation and characterization of a well-defined terminal mononuclear vanadium(III) oxo complex has remained elusive. We present the synthesis and characterization of a unique terminal mononuclear vanadium(III) oxo species supported by the pentadentate polypyridyl ligand 2,6-bis[1,1-bis(2-pyridyl)ethyl]pyridine (PY5Me2). Exposure of [V(II)(NCCH3)(PY5Me2)](2+) (1) to either dioxygen or selected O-atom-transfer reagents yields [V(IV)(O)(PY5Me2)](2+) (2). The metal-centered one-electron reduction of this vanadium(IV) oxo complex furnishes a stable, diamagnetic [V(III)(O)(PY5Me2)](+) (3) species. The vanadium(III) oxo species is unreactive toward H- and O-atom transfer but readily reacts with protons to form a putative vanadium hydroxo complex. Computational results predict that further one-electron reduction of the vanadium(III) oxo species will result in ligand-based reduction, even though pyridine is generally considered to be a poor π-accepting ligand. These results have implications for future efforts toward low-valent vanadyl chemistry, particularly with regard to the isolation and study of formal vanadium(II) oxo species.

  1. A Solar Stationary Type IV Radio Burst and Its Radiation Mechanism

    NASA Astrophysics Data System (ADS)

    Liu, Hongyu; Chen, Yao; Cho, Kyungsuk; Feng, Shiwei; Vasanth, Veluchamy; Koval, Artem; Du, Guohui; Wu, Zhao; Li, Chuanyang

    2018-04-01

    A stationary Type IV (IVs) radio burst was observed on September 24, 2011. Observations from the Nançay RadioHeliograph (NRH) show that the brightness temperature (TB) of this burst is extremely high, over 10^{11} K at 150 MHz and over 108 K in general. The degree of circular polarization (q) is between -60% ˜ -100%, which means that it is highly left-handed circularly polarized. The flux-frequency spectrum follows a power-law distribution, and the spectral index is considered to be roughly -3 ˜ -4 throughout the IVs. Radio sources of this event are located in the wake of the coronal mass ejection and are spatially dispersed. They line up to present a formation in which lower-frequency sources are higher. Based on these observations, it is suggested that the IVs was generated through electron cyclotron maser emission.

  2. Practice patterns for the use of iodinated i.v. contrast media for pediatric CT studies: a survey of the Society for Pediatric Radiology.

    PubMed

    Callahan, Michael J; Servaes, Sabah; Lee, Edward Y; Towbin, Alexander J; Westra, Sjirk J; Frush, Donald P

    2014-04-01

    There are limited data available on the use of i.v. contrast media for CT studies in the pediatric population. The purpose of this study is to determine the practice patterns of i.v. contrast media usage for pediatric CT by members of the Society for Pediatric Radiology (SPR). SPR members were surveyed regarding the use of i.v. contrast media for pediatric CT studies. Questions pertained to information required before administering i.v. contrast media, types of central catheters for injecting i.v. contrast media, injection rates based on angiocatheter size and study type, and management of i.v. contrast media extravasation. The response rate of 6% (88/1545) represented practice patterns of 26% (401/1545) of the SPR membership. Most respondents thought the following clinical information was mandatory before i.v. contrast media administration: allergy to i.v. contrast media (97%), renal insufficiency (97%), current metformin use (72%), significant allergies (61%), diabetes (54%), and asthma (52%). Most administered i.v. contrast media through nonimplanted central venous catheters (78%), implanted venous ports (78%), and peripherally inserted central catheters (72%). The most common maximum i.v. contrast media injection rates were 5.0 mL/s or greater for a 16-gauge angiocatheter, 4.0 mL/s for an 18-gauge angiocatheter, 3.0 mL/s for a 20-gauge angiocatheter, and 2.0 mL/s for a 22-gauge angiocatheter. For soft-tissue extravasation of i.v. contrast media, 95% elevate the affected extremity, 76% use ice, and 45% use heat. The results of this survey illustrate the collective opinion of a subset of SPR members relating to the use of i.v. contrast media in pediatric CT, providing guidelines for clinical histories needed before i.v. contrast media, maximum i.v. contrast injection rates for standard angiocatheters, contrast media injection rates for specific CT studies, and management of i.v. contrast media soft-tissue extravasation.

  3. The Legionella pneumophila PilT Homologue DotB Exhibits ATPase Activity That Is Critical for Intracellular Growth

    PubMed Central

    Sexton, Jessica A.; Pinkner, Jerome S.; Roth, Robyn; Heuser, John E.; Hultgren, Scott J.; Vogel, Joseph P.

    2004-01-01

    The ability of Legionella pneumophila to grow and cause disease in the host is completely dependent on a type IV secretion system known as the Dot/Icm complex. This membrane-spanning apparatus translocates effector molecules into host cells in a process that is poorly understood but that is known to require the putative ATPase DotB. One possible role for DotB is suggested by its similarity to the PilT family of proteins, which mediate pilus retraction. To better understand the molecular behavior of DotB, we have purified the protein and shown that it forms stable homohexameric rings and hydrolyzes ATP with a specific activity of 6.4 nmol of ATP/min/mg of protein. ATPase activity is critical to the function of DotB, as alteration of the conserved Walker box lysine residue resulted in a mutant protein, DotB K162Q, which failed to bind or hydrolyze ATP and which could not complement a ΔdotB strain for intracellular growth in macrophages. Consistent with the ability of DotB to interact with itself, the dotBK162Q allele exhibited transdominance over wild-type dotB, providing the first example of such a mutation in L. pneumophila. Finally, the DotB K162Q mutant protein had a significantly enhanced membrane localization in L. pneumophila compared to wild-type DotB, suggesting a relationship between nucleotide binding and membrane association. These results are consistent with a model in which DotB cycles between the cytoplasm and the Dot/Icm complex at the membrane, where it hydrolyzes nucleotides to provide energy to the complex. PMID:14996796

  4. Spontaneous chemical reversion of an active site mutation: deamidation of an asparagine residue replacing the catalytic aspartic acid of glutamate dehydrogenase.

    PubMed

    Paradisi, Francesca; Dean, Jonathan L E; Geoghegan, Kieran F; Engel, Paul C

    2005-03-08

    A mutant (D165N) of clostridial glutamate dehydrogenase (GDH) in which the catalytic Asp is replaced by Asn surprisingly showed a residual 2% of wild-type activity when purified after expression in Escherichia coli at 37 degrees C. This low-level activity also displayed Michaelis constants for substrates that were remarkably similar to those of the wild-type enzyme. Expression at 8 degrees C gave a mutant enzyme preparation 1000 times less active than the first preparation, but progressively, over 2 weeks' incubation at 37 degrees C in sealed vials, this enzyme regained 90% of the specific activity of wild type. This suggested that the mutant might undergo spontaneous deamidation. Mass spectrometric analysis of tryptic peptides derived from D165N samples treated in various ways showed (i) that the Asn is in place in D165N GDH freshly prepared at 8 degrees C; (ii) that there is a time-dependent reversion of this Asn to Asp over the 2-week incubation period; (iii) that detectable deamidation of other Asn residues, in Asn-Gly sequences, mainly occurred in sample workup rather than during the 2-week incubation; (iv) that there is no significant deamidation of other randomly chosen Asn residues in this mutant over the same period; and (v) that when the protein is denatured before incubation, no deamidation at Asn-165 is detectable. It appears that this deamidation depends on the residual catalytic machinery of the mutated GDH active site. A literature search indicates that this finding is not unique and that Asn may not be a suitable mutational replacement in the assessment of putative catalytic Asp residues by site-directed mutagenesis.

  5. A study of lip print pattern in Goan dental students - A digital approach.

    PubMed

    Prabhu, Rachana V; Dinkar, Ajit; Prabhu, Vishnudas

    2012-10-01

    To find the incidence of different types of lip patterns, the dominant pattern, quadrant wise, amongst the Goan population. To assess, the quadrant wise differences in lip patterns among males and females and to report new lip print pattern in Goan population. Lip prints of 100 students studying in Goa Dental College & Hospital were taken using 14 mm wide and 50 mm long Scotch tape without any distortion. These prints were then scanned (256 gray shades at a resolution of 300 dpi.) for the digital analysis. Using various applications of Adobe Photoshop 7 software an attempt was made to trace each and every line. K. Suzuki and Y. Tsuchihashi's classification was followed to define the patterns of the grooves. The current study has found the most predominant pattern in Quadrant I to be Type V (580 lines; 52.39%) followed in order by Type I' (196 lines; 17.70%), Type I (166 lines; 14.99%), Type II (166 lines; 10.47%), Type IV (40 lines; 3.61%), Type III (9 lines; 0.81%). In Quadrant II of this study the most predominant pattern recorded was Type V (589 lines; 50.47%) followed in order by Type I' (209 lines; 17.90%), Type I (204 lines; 17.48%), Type II (130 lines; 11.13%), Type IV (34 lines; 2.91%), Type III (1 line; 0.08%). In Quadrant III of this study the most predominant pattern recorded was again Type V (484 lines; 52.09%) followed in order by Type I' (174 lines; 18.72%), Type I (155 lines; 16.68%), Type II (102 lines; 10.97%), Type IV (9 lines; 0.96%), Type III (5 lines; 0.53%). In Quadrant IV of this study the most predominant pattern recorded was Type V (543 lines; 58.19%) followed in order by Type I (151 lines; 16.18%), Type I' (138 lines; 14.79%), Type II (85 lines; 9.11%), Type III (9 lines; 0.96%), Type IV (7 line; 0.75%). In all four Quadrants the most predominant pattern found in males and females was Type V. The present study recorded the following types of type V patterns for the first time; Trifurcations, Bridge or 'H' pattern, Horizontal Lines, Cartwheel, Pineapple Skin and Multiple Branching Appearance. The digital method of analyzing the Lip Print images using Adobe Photoshop 7 software serves as a convenient method that provides better visualization and ease in identification and recording of the Lip Print pattern. Predominant pattern in all four quadrants was Type V followed by the linear pattern i.e. Type I' in quadrants I, II, and III and Type I in quadrant IV in the studied population. Distribution of pattern is not affected by the sex. Although type V is the most predominant pattern found in Goan population, the sub-classification of this type defines the more defined term and aids in accuracy of the classification. Copyright © 2012. Published by Elsevier Ltd.

  6. Insights into early extracellular matrix evolution: spongin short chain collagen-related proteins are homologous to basement membrane type IV collagens and form a novel family widely distributed in invertebrates.

    PubMed

    Aouacheria, Abdel; Geourjon, Christophe; Aghajari, Nushin; Navratil, Vincent; Deléage, Gilbert; Lethias, Claire; Exposito, Jean-Yves

    2006-12-01

    Collagens are thought to represent one of the most important molecular innovations in the metazoan line. Basement membrane type IV collagen is present in all Eumetazoa and was found in Homoscleromorpha, a sponge group with a well-organized epithelium, which may represent the first stage of tissue differentiation during animal evolution. In contrast, spongin seems to be a demosponge-specific collagenous protein, which can totally substitute an inorganic skeleton, such as in the well-known bath sponge. In the freshwater sponge Ephydatia mülleri, we previously characterized a family of short-chain collagens that are likely to be main components of spongins. Using a combination of sequence- and structure-based methods, we present evidence of remote homology between the carboxyl-terminal noncollagenous NC1 domain of spongin short-chain collagens and type IV collagen. Unexpectedly, spongin short-chain collagen-related proteins were retrieved in nonsponge animals, suggesting that a family related to spongin constitutes an evolutionary sister to the type IV collagen family. Formation of the ancestral NC1 domain and divergence of the spongin short-chain collagen-related and type IV collagen families may have occurred before the parazoan-eumetazoan split, the earliest divergence among extant animal phyla. Molecular phylogenetics based on NC1 domain sequences suggest distinct evolutionary histories for spongin short-chain collagen-related and type IV collagen families that include spongin short-chain collagen-related gene loss in the ancestors of Ecdyzosoa and of vertebrates. The fact that a majority of invertebrates encodes spongin short-chain collagen-related proteins raises the important question to the possible function of its members. Considering the importance of collagens for animal structure and substratum attachment, both families may have played crucial roles in animal diversification.

  7. Anomalous ionization seen in the spectra of B supergiants

    NASA Technical Reports Server (NTRS)

    Cassinelli, J. P.; Abbott, D. C.

    1981-01-01

    An IUE survey of B supergiants has been conducted to study the persistence with spectral type of the ultraviolet resonance lines of N V, C IV and Si IV. N V is seen as late as B2.5Ia, C IV until B6Ia and Si IV throughout the range from B1.5 to B9. This is in fairly good agreement with the Auger ionization model of Cassinelli and Olson (1979). The terminal velocities are derived for the 20 stars in the sample and it is found that the ratio v(T)/v(esc) decreases monotonically with spectral type from the value of 3.0 that it has in the O spectral range to the value 1.0 at B9Ia.

  8. SOME COMMENTS ON TYPE IV BURSTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, H.; Kakinuma, T.

    1962-01-01

    It has become clear that a large continuum burst is composed of 4 distinctive types, CM/sub 1/, CM/sub 2/, DM, and IV, which originate from different altitudes over the photosphere. The observational characters of each type are given. CM/sub 1/ is the main phase of a centimeter-wave burst originating from about 0.02-0.05 R/sub S/ in height. DM burst is polarized in the ordinary sense, which is the cause of reversal of polarization with frequency. Its center frequency lies between about 1000 and 200 Mc/s, and is often misunderstood as the original Type IV burst. The movement of magnetic field duringmore » a burst is suggested. CM/sub 2/ may be considered as an enhancement of the upper part of the source of S-component caused by this movement of the field. (auth)« less

  9. Singular cosmological evolution using canonical and ghost scalar fields

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nojiri, Shin'ichi; Odintsov, S.D.; Oikonomou, V.K.

    2015-09-01

    We demonstrate that finite time singularities of Type IV can be consistently incorporated in the Universe's cosmological evolution, either appearing in the inflationary era, or in the late-time regime. While using only one scalar field instabilities can in principle occur at the time of the phantom-divide crossing, when two fields are involved we are able to avoid such instabilities. Additionally, the two-field scalar-tensor theories prove to be able to offer a plethora of possible viable cosmological scenarios, at which various types of cosmological singularities can be realized. Amongst others, it is possible to describe inflation with the appearance of amore » Type IV singularity, and phantom late-time acceleration which ends in a Big Rip. Finally, for completeness, we also present the Type IV realization in the context of suitably reconstructed F(R) gravity.« less

  10. Effects of Mineral Compositions on Matrix Diffusion and Sorption of 75Se(IV) in Granite.

    PubMed

    Yang, Xiaoyu; Ge, Xiangkun; He, Jiangang; Wang, Chunli; Qi, Liye; Wang, Xiangyun; Liu, Chunli

    2018-02-06

    Exploring the migration behaviors of selenium in granite is critical for the safe disposal of radioactive waste. The matrix diffusion and sorption of 75 Se(IV) (analogue for 79 Se) in granite were systematically studied to set reliable parameters in this work. Through-diffusion and batch sorption experiments were conduct with four types of Beishan granite. The magnitudes of the obtained apparent diffusion coefficient (D a ) values are of the following order: monzogranite > granodiorite-2 > granodiorite-1, which is opposite to the sequence of the K d values obtained from both the diffusion model and batch sorption experiments. The EPMA results of the granitic flakes showed that there was no obvious enrichment of Se(IV) on quartz, microcline and albite. Only biotite showed a weak affinity for Se(IV). Macroscopic sorption behaviors of Se(IV) on the four types of granite were identical with the sequence of the granitic biotite contents. Quantitative fitting results were also provided. XPS and XANES spectroscopy data revealed that bidentate inner-sphere complexes were formed between Se(IV) and Fe(III). Our results indicate that biotite can be representative of the Se(IV) sorption in complex mineral assemblages such as granite, and the biotite contents are critically important to evaluate Se(IV) transport in granite.

  11. [Detection of putative polysaccharide biosynthesis genes in Azospirillum brasilense strains from serogroups I and II].

    PubMed

    Petrova, L P; Prilipov, A G; Katsy, E I

    2017-01-01

    It is known that in Azospirillum brasilense strains Sp245 and SR75 included in serogroup I, the repeat units of their O-polysaccharides consist of five residues of D-rhamnose, and in strain SR15, of four; and the heteropolymeric O-polysaccharide of A. brasilense type strain Sp7 from serogroup II contains not less than five types of repeat units. In the present work, a complex of nondegenerate primers to the genes of A. brasilense Sp245 plasmids AZOBR_p6, AZOBR_p3, and AZOBR_p2, which encode putative enzymes for the biosynthesis of core oligosaccharide and O-polysaccharide of lipopolysaccharide, capsular polysaccharides, and exopolysaccharides, was proposed. By using the designed primers, products of the expected sizes were synthesized in polymerase chain reactions on genomic DNA of A. brasilense Sp245, SR75, SR15, and Sp7 in 36, 29, 23, and 12 cases, respectively. As a result of sequencing of a number of amplicons, a high (86–99%) level of identity of the corresponding putative polysaccharide biosynthesis genes in three A. brasilense strains from serogroup I was detected. In a blotting-hybridization reaction with the biotin-labeled DNA of the A. brasilense gene AZOBR_p60122 coding for putative permease of the ABC transporter of polysaccharides, localization of the homologous gene in ~120-MDa plasmids of the bacteria A. brasilense SR15 and SR75 was revealed.

  12. Beta-ketoacyl-acyl carrier protein synthase IV: a key enzyme for regulation of medium-chain fatty acid synthesis in Cuphea lanceolata seeds.

    PubMed

    Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich

    2002-09-01

    With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.

  13. Pros and Cons While Looking Through an Asian Window on the Rome IV Criteria for Irritable Bowel Syndrome: Pros.

    PubMed

    Ghoshal, Uday C

    2017-07-30

    A decade after Rome III, in 2016, Rome IV criteria were published. There are major differences between Rome IV and the earlier iteration, some of which are in line with Asian viewpoints. The clinical applicability of the Rome IV criteria of irritable bowel syndrome (IBS) in Asian perspective is reviewed here. Instead of considering functional gastrointestinal disorders (FGIDs) to be largely psychogenic, Rome IV suggested the importance of the gut over brain ("disorders of gut-brain interaction" not "brain-gut interaction"). The word "functional" is underplayed. Multi-dimensional clinical profile attempts to recognize micro-organic nature, like slow colon transit and fecal evacuation disorders in constipation and dietary intolerance including that of lactose and fructose, bile acid malabsorption, non-celiac wheat sensitivity, small intestinal bacterial overgrowth, and gastrointestinal infection in diarrhea. Overlap between different FGIDs has been recognized as Rome IV suggests these to be a spectrum rather than discrete disorders. Bloating, common in Asia, received attention, though less. Sub-typing of IBS may be more clinician-friendly now as the patient-reported stool form may be used than a diary. However, a few issues, peculiar to Asia, need consideration; Rome IV, like Rome III, suggests that Bristol type I-II stool to denote constipation though Asian experts include type III as well. Work-up for physiological factors should be given greater importance. Language issue is important. Bloating, common in IBS, should be listed in the criteria. Threshold values for symptoms in Rome IV criteria are based on Western data. Post-infectious malabsorption (tropical sprue) should be excluded to diagnose post-infectious IBS, particularly in Asia.

  14. Glycated Apolipoprotein A-IV Induces Atherogenesis in Patients With CAD in Type 2 Diabetes.

    PubMed

    Dai, Yang; Shen, Ying; Li, Qing Run; Ding, Feng Hua; Wang, Xiao Qun; Liu, Hong Juan; Yan, Xiao Xiang; Wang, Ling Jie; Yang, Ke; Wang, Hai Bo; Chen, Qiu Jing; Shen, Wei Feng; Zhang, Rui Yan; Lu, Lin

    2017-10-17

    Nonenzymatic glycation of apolipoproteins plays a role in the pathogenesis of the vascular complications of diabetes. This study investigated whether apolipoprotein (apo) A-IV was glycated in patients with type 2 diabetes mellitus (T2DM) and whether apoA-IV glycation was related to coronary artery disease (CAD). The study also determined the biological effects of glycated apoA-IV. The authors consecutively enrolled 204 patients with T2DM without CAD (Group I), 515 patients with T2DM with CAD (Group II), and 176 healthy subjects (control group) in this study. ApoA-IV was precipitated from ultracentrifugally isolated high-density lipoprotein, and its glycation level was determined based on Western blotting densitometry (relative intensity of apoA-IV glycation). ApoA-IV NƐ-(carboxylmethyl) lysine (CML) modification sites were identified by mass spectrometry in 37 control subjects, 63 patients in Group I, and 138 patients in Group II. Saline or glycated apoA-IV (g-apoA-IV) generated by glyoxal culture was injected into apoE -/- mice to evaluate atherogenesis, and was also used for the cell experiments. The relative intensity and the abundance of apoA-IV glycation were associated with the presence and severity of CAD in patients with T2DM (all p < 0.05). The experiments showed that g-apoA-IV induced proinflammatory reactions in vitro and promoted atherogenesis in apoE -/- mice through the nuclear receptor NR4A3. G-apoA-IV with mutations (K-A) at high-frequency glycation sites exhibited more weakened proinflammatory and atherogenic effects than did g-apoA-IV both in vitro and in vivo. ApoA-IV glycation is associated with CAD severity in patients with T2DM, and g-apoA-IV induces atherogenesis through NR4A3 in apoE -/- mice. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  15. Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

    PubMed

    Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

    2008-05-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

  16. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Technical Reports Server (NTRS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-01-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  17. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Astrophysics Data System (ADS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-08-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  18. Genome sequence analyses of two isolates from the recent Escherichia coli outbreak in Germany reveal the emergence of a new pathotype: Entero-Aggregative-Haemorrhagic Escherichia coli (EAHEC).

    PubMed

    Brzuszkiewicz, Elzbieta; Thürmer, Andrea; Schuldes, Jörg; Leimbach, Andreas; Liesegang, Heiko; Meyer, Frauke-Dorothee; Boelter, Jürgen; Petersen, Heiko; Gottschalk, Gerhard; Daniel, Rolf

    2011-12-01

    The genome sequences of two Escherichia coli O104:H4 strains derived from two different patients of the 2011 German E. coli outbreak were determined. The two analyzed strains were designated E. coli GOS1 and GOS2 (German outbreak strain). Both isolates comprise one chromosome of approximately 5.31 Mbp and two putative plasmids. Comparisons of the 5,217 (GOS1) and 5,224 (GOS2) predicted protein-encoding genes with various E. coli strains, and a multilocus sequence typing analysis revealed that the isolates were most similar to the entero-aggregative E. coli (EAEC) strain 55989. In addition, one of the putative plasmids of the outbreak strain is similar to pAA-type plasmids of EAEC strains, which contain aggregative adhesion fimbrial operons. The second putative plasmid harbors genes for extended-spectrum β-lactamases. This type of plasmid is widely distributed in pathogenic E. coli strains. A significant difference of the E. coli GOS1 and GOS2 genomes to those of EAEC strains is the presence of a prophage encoding the Shiga toxin, which is characteristic for enterohemorrhagic E. coli (EHEC) strains. The unique combination of genomic features of the German outbreak strain, containing characteristics from pathotypes EAEC and EHEC, suggested that it represents a new pathotype Entero-Aggregative-Haemorrhagic E scherichia c oli (EAHEC).

  19. Genomics of an emerging clone of Salmonella serovar Typhimurium ST313 from Nigeria and the Democratic Republic of Congo.

    PubMed

    Leekitcharoenphon, Pimlapas; Friis, Carsten; Zankari, Ea; Svendsen, Christina Aaby; Price, Lance B; Rahmani, Maral; Herrero-Fresno, Ana; Fashae, Kayode; Vandenberg, Olivier; Aarestrup, Frank M; Hendriksen, Rene S

    2013-10-15

    Salmonella enterica serovar Typhimurium ST313 is an invasive and phylogenetically distinct lineage present in sub-Saharan Africa. We report the presence of S. Typhimurium ST313 from patients in the Democratic Republic of Congo and Nigeria. Eighteen S. Typhimurium ST313 isolates were characterized by antimicrobial susceptibility testing, pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). Additionally, six of the isolates were characterized by whole genome sequence typing (WGST). The presence of a putative virulence determinant was examined in 177 Salmonella isolates belonging to 57 different serovars. All S. Typhimurium ST313 isolates harbored resistant genes encoded by blaTEM1b, catA1, strA/B, sul1, and dfrA1. Additionally, aac(6')1aa gene was detected. Phylogenetic analyses revealed close genetic relationships among Congolese and Nigerian isolates from both blood and stool. Comparative genomic analyses identified a putative virulence fragment (ST313-TD) unique to S. Typhimurium ST313 and S. Dublin. We showed in a limited number of isolates that S. Typhimurium ST313 is a prevalent sequence-type causing gastrointestinal diseases and septicemia in patients from Nigeria and DRC. We found three distinct phylogenetic clusters based on the origin of isolation suggesting some spatial evolution. Comparative genomics showed an interesting putative virulence fragment (ST313-TD) unique to S. Typhimurium ST313 and invasive S. Dublin.

  20. Immunohistochemical diagnosis of Alport's syndrome in paraffin-embedded renal sections: antigen retrieval with autoclave heating.

    PubMed

    Naito, Ichiro; Ninomiya, Yoshifumi; Nomura, Shinsuke

    2003-03-01

    Alport's syndrome (AS) is a hereditary renal disease caused by mutations in the genes encoding collagen type IV. Immunohistochemical analysis of the alpha chains of collagen type IV has been found to be useful for the diagnosis of this disease. The monoclonal antibodies (mAbs) generated by us recognize alpha 1(IV) through alpha 6(IV) chains of collagen type IV on fresh-frozen sections but not on paraffin-embedded sections. Antigen retrieval by autoclave heating has been found to restore the epitopes recognized by the mAbs; however the heating conditions had not been well established. In this study, the heating conditions were carefully examined using renal sections obtained from AS and non-AS patients. The heating was performed in an autoclave, at 105 degrees -127 degrees C for 6-8 min. During the heating, the sections were immersed in 0.2 N HCl solution (pH 0.9). Then, the mAbs were applied for 30 min, and the bound mAbs were detected using the LSAB kit. The optimal temperature for the antigen retrieval varied among specimens, and was dependent on the type of basement membrane examined. Thus, it was considered that heating at two or three different temperatures could be helpful for the precise diagnosis of AS. Adopting the antigen retrieval method could extend the possibility of immunohistochemical diagnosis of AS to cases without using fresh-frozen sections.

  1. Anaerobic Nitrate-Dependent Metal Bio-Oxidation

    NASA Astrophysics Data System (ADS)

    Weber, K.; Knox, T.; Achenbach, L. A.; Coates, J. D.

    2007-12-01

    Direct biological oxidation of reduced metals (Fe(II) and U(IV)) coupled to nitrate reduction at circumneutral pH under anaerobic conditions has been recognized in several environments as well as pure culture. Several phylogentically diverse mesophilic bacteria have been described as capable of anaerobic, nitrate-dependent Fe(II) oxidation (NFOx). Our recent identification of a freshwater mesophilic, lithoautotroph, Ferrutens nitratireducens strain 2002, capable of growth through NFOx presents an opportunity to further study metal bio- oxidation. Continuing physiological studies revealed that in addition to Fe(II) oxidation, strain 2002 is capable of oxidizing U(IV) (4 μM) in washed cell suspensions with nitrate serving as the electron acceptor. Pasteurized cultures exhibited abiotic oxidation of 2 μM U(IV). Under growth conditions, strain 2002 catalyzed the oxidation of 12 μM U(IV) within a two week period. Cultures amended with sodium azide, an electron transport inhibitor, demonstrated limited oxidation (7 μM) similar to pasteurized cultures, supporting the direct role of electron transport in U(IV) bio-oxidation. The oxidation of U(IV) coupled denitrification at circumneutral pH would yield enough energy to support anaerobic microbial growth (ΔG°'= -460.36 kJ/mole). It is currently unknown whether or not strain 2002 can couple this metabolism to growth. The growth of F. nitratireducens strain 2002 utilizing Fe(II) as the sole electron donor was previously demonstrated. The amount of U(IV) (~12 μM) that strain 2002 oxidized under similar autotrophic growth conditions yields 0.0019 kJ, enough energy for the generation of ATP (5.3 x 10-20 kJ ATP-1), but not enough energy for cell replication as calculated for nitrate-dependent Fe(II) oxidizing conditions (0.096 kJ) assuming a similar metabolism. In addition to F. nitratireducens strain 2002, a nitrate-dependent Fe(II) oxidizing bacterium isolated from U contaminated groundwater, Diaphorobacter sp. strain TPSY, was also capable of nitrate- dependent U(IV) oxidation (8 μM over 24 hours, pseudo first order rate constant of 0.12 ± 0.02 hr-1) in washed cell suspensions. Further biochemical investigation of nitrate-dependent U(IV) oxidation in strain TPSY revealed the expression of several putative high molecular weight proteins specific to this metabolism. Together with the previously described metabolic ability of Geobacter metallireducens (Finneran et al. 2002) and Thiobacillus denitrificans (Beller 2005), these data indicate that anaerobic, metal oxidation may be a ubiquitous microbial metabolism.

  2. Variation in arterial supply to the floor of the mouth and assessment of relative hemorrhage risk in implant surgery.

    PubMed

    Katsumi, Yuji; Tanaka, Ray; Hayashi, Takafumi; Koga, Taketo; Takagi, Ritsuo; Ohshima, Hayato

    2013-04-01

    Bleeding in the floor of the mouth during implant surgery is attributed to arterial injuries in the sublingual space: clinicians may injure the submental and sublingual arteries, which originate from the facial and lingual arteries, respectively. This study aimed to clarify the three-dimensional courses of submental and sublingual arteries and their topographic relation to the mandible. During the gross anatomy course at the Faculty of Dentistry and Graduate School, Niigata University (2009-2011), we investigated the relationship between the courses of submental and sublingual arteries and their dividing patterns of the mylohyoid muscle, sublingual gland, and mandible using 27 human cadavers. The courses of submental and sublingual arteries were divided into four patterns: (1) the sublingual space was supplied by the sublingual artery (type I: 63%), (2) it was supplied by both the sublingual and submental arteries (type II: 5.6%), (3) it was supplied by the submental artery without the sublingual artery (type III: 29.6%), and (4) type III without the deep lingual artery originated from the lingual artery (type IV: 1.8%). In type II, III, and IV, the submental artery perforates the mylohyoid muscle or takes a roundabout route to travel near the surface of the mandible. The percentage occurrence of arteries traveling between the sublingual gland and mandible in type II, III, and IV (55%) is higher than that in type I (8.8%). Susceptibility of the submental artery in type II, III, and IV to injury during implant surgery is suggested. © 2011 John Wiley & Sons A/S.

  3. A systematic review of the management and outcome of ERCP related duodenal perforations using a standardized classification system.

    PubMed

    Cirocchi, Roberto; Kelly, Michael Denis; Griffiths, Ewen A; Tabola, Renata; Sartelli, Massimo; Carlini, Luigi; Ghersi, Stefania; Di Saverio, Salomone

    2017-12-01

    The incidence of duodenal perforation after ERCP ranges from 0.09% to 1.67% and mortality up to 8%. This systematic review was registered in Prospective Register of Systematic Reviews, PROSPERO. Stapfer classification of ERCP-related duodenal perforations was used. The systematic search yielded 259 articles. Most frequent post-ERCP perforation was Stapfer type II (58.4%), type I second most frequent perforation (17.8%) followed by Stapfer type III in 13.2% and type IV in 10.6%. Rate of NOM was lowest in Stapfer type I perforations (13%), moderate in type III lesions (58.1%) and high in other types of perforations (84.2% in type II and 84.6% in IV). In patients underwent early surgical treatment (<24 h from ERCP) the most frequent operation was simple duodenal suture with or without omentopexy (93.7%). In patients undergoing late surgical treatment (>24 h from ERCP) interventions performed were more complex. In type I lesions post-operative mortality rate was higher in patients underwent late operation (>24 h). In type I lesions, failure of NOM occurred in 42.8% of patients. In type II failure of NOM occurred in 28.9% of patients and in type III there was failure of NOM in only 11.1%, none in type IV. Postoperative mortality after NOM failure was 75% in type I, 22.5% in type II and none died after surgical treatment for failure of NOM in type III perforations. This systematic review showed that in patients with Stapfer type I lesions, early surgical treatment gives better results, however the opposite seems true in Stapfer III and IV lesions. Copyright © 2017 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

  4. Multi-virulence-locus sequence typing of Staphylococcus lugdunensis generates results consistent with a clonal population structure and is reliable for epidemiological typing.

    PubMed

    Didi, Jennifer; Lemée, Ludovic; Gibert, Laure; Pons, Jean-Louis; Pestel-Caron, Martine

    2014-10-01

    Staphylococcus lugdunensis is an emergent virulent coagulase-negative staphylococcus responsible for severe infections similar to those caused by Staphylococcus aureus. To understand its potentially pathogenic capacity and have further detailed knowledge of the molecular traits of this organism, 93 isolates from various geographic origins were analyzed by multi-virulence-locus sequence typing (MVLST), targeting seven known or putative virulence-associated loci (atlLR2, atlLR3, hlb, isdJ, SLUG_09050, SLUG_16930, and vwbl). The polymorphisms of the putative virulence-associated loci were moderate and comparable to those of the housekeeping genes analyzed by multilocus sequence typing (MLST). However, the MVLST scheme generated 43 virulence types (VTs) compared to 20 sequence types (STs) based on MLST, indicating that MVLST was significantly more discriminating (Simpson's index [D], 0.943). No hypervirulent lineage or cluster specific to carriage strains was defined. The results of multilocus sequence analysis of known and putative virulence-associated loci are consistent with a clonal population structure for S. lugdunensis, suggesting a coevolution of these genes with housekeeping genes. Indeed, the nonsynonymous to synonymous evolutionary substitutions (dN/dS) ratio, the Tajima's D test, and Single-likelihood ancestor counting (SLAC) analysis suggest that all virulence-associated loci were under negative selection, even atlLR2 (AtlL protein) and SLUG_16930 (FbpA homologue), for which the dN/dS ratios were higher. In addition, this analysis of virulence-associated loci allowed us to propose a trilocus sequence typing scheme based on the intragenic regions of atlLR3, isdJ, and SLUG_16930, which is more discriminant than MLST for studying short-term epidemiology and further characterizing the lineages of the rare but highly pathogenic S. lugdunensis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  5. Continued expansion of USA300-like methicillin-resistant Staphylococcus aureus (MRSA) among hospitalized patients in the United States.

    PubMed

    Tickler, Isabella A; Goering, Richard V; Mediavilla, Jose R; Kreiswirth, Barry N; Tenover, Fred C

    2017-08-01

    We characterized spa types, SCCmec types, and antimicrobial resistance patterns of 516 methicillin-resistant Staphylococcus aureus (MRSA) isolates, collected between 2011 and 2014 from nares and blood cultures of United States patients. Among nares isolates, 45 spa types were observed; 29.9% were t002/SCCmec II and 30.9% were t008/SCCmec IV. Among blood isolates, 40 spa types were identified; 24.4% were t002/SCCmec II and 39.9% were type t008/SCCmec IV. Compared to data from our 2009-2010 survey, the percentage of t008/SCCmec IV isolates from nares increased significantly (20.4%-30.9%; P=0.004) while the percentage from positive blood cultures remained similar (39.2% versus 39.9%; P=0.921). There were also significant changes in the overall antimicrobial resistance patterns observed, including the decrease of the clindamycin, erythromycin, levofloxacin and moxifloxacin multidrug resistance pattern, likely the result of t002/SCCmec II strains being displaced by t008/SCCmec IV strains. Rates of high-level mupirocin resistance did not change significantly from our past study (4.1% compared to 4.7%; P=0.758) but an increase in low-level resistance, particularly among t002/SCCmec II isolates, was observed. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Multidrug resistance in epilepsy and polymorphisms in the voltage-gated sodium channel genes SCN1A, SCN2A, and SCN3A: correlation among phenotype, genotype, and mRNA expression.

    PubMed

    Kwan, Patrick; Poon, Wai Sang; Ng, Ho-Keung; Kang, David E; Wong, Virginia; Ng, Ping Wing; Lui, Colin H T; Sin, Ngai Chuen; Wong, Ka S; Baum, Larry

    2008-11-01

    Many antiepileptic drugs (AEDs) prevent seizures by blocking voltage-gated brain sodium channels. However, treatment is ineffective in 30% of epilepsy patients, which might, at least in part, result from polymorphisms of the sodium channel genes. We investigated the association of AED responsiveness with genetic polymorphisms and correlated any association with mRNA expression of the neuronal sodium channels. We performed genotyping of tagging and candidate single nucleotide polymorphisms (SNPs) of SCN1A, 2A, and 3A in 471 Chinese epilepsy patients (272 drug responsive and 199 drug resistant). A total of 27 SNPs were selected based on the HapMap database. Genotype distributions in drug-responsive and drug-resistant patients were compared. SCN2A mRNA was quantified by real-time PCR in 24 brain and 57 blood samples. Its level was compared between patients with different genotypes of an SCN2A SNP found to be associated with drug responsiveness. SCN2A IVS7-32A>G (rs2304016) A alleles were associated with drug resistance (odds ratio = 2.1, 95% confidence interval: 1.2-3.7, P=0.007). Haplotypes containing the IVS7-32A>G allele A were also associated with drug resistance. IVS7-32A>G is located within the putative splicing branch site for splicing exons 7 and 9. PCR of reverse-transcribed RNA from blood or brain of patients with different IVS7-32A>G genotypes using primers in exons 7 and 9 showed no skipping of exon 8, and real-time PCR showed no difference in SCN2A mRNA levels among genotypes. Results of this study suggest an association between SCN2A IVS7-32A>G and AED responsiveness, without evidence of an effect on splicing or mRNA expression.

  7. Detection and modeling of leakage current in AlGaN-based deep ultraviolet light-emitting diodes

    DOE PAGES

    Moseley, Michael William; Allerman, Andrew A.; Crawford, Mary H.; ...

    2015-03-01

    Current-voltage (IV) characteristics of two AlGaN-based deep ultraviolet (DUV) light-emitting diodes (LEDs) with differing densities of open-core threading dislocations (nanopipes) are analyzed. A three-diode circuit is simulated to emulate the IV characteristics of the DUV-LEDs, but is only able to accurately model the lower leakage current, lower nanopipe density DUV-LED. It was found that current leakage through the nanopipes in these structures is rectifying, despite nanopipes being previously established as inherently n-type. Using defect-sensitive etching, the nanopipes are revealed to terminate within the p-type GaN capping layer of the DUV-LEDs. The circuit model is modified to account for another p-nmore » junction between the n-type nanopipes and the p-type GaN, and an excellent fit to the IV characteristics of the leaky DUV-LED is achieved.« less

  8. Chemical Basis for Qualitative and Quantitative Differences Between ABO Blood Groups and Subgroups: Implications for Organ Transplantation.

    PubMed

    Jeyakanthan, M; Tao, K; Zou, L; Meloncelli, P J; Lowary, T L; Suzuki, K; Boland, D; Larsen, I; Burch, M; Shaw, N; Beddows, K; Addonizio, L; Zuckerman, W; Afzali, B; Kim, D H; Mengel, M; Shapiro, A M J; West, L J

    2015-10-01

    Blood group ABH(O) carbohydrate antigens are carried by precursor structures denoted type I-IV chains, creating unique antigen epitopes that may differ in expression between circulating erythrocytes and vascular endothelial cells. Characterization of such differences is invaluable in many clinical settings including transplantation. Monoclonal antibodies were generated and epitope specificities were characterized against chemically synthesized type I-IV ABH and related glycans. Antigen expression was detected on endomyocardial biopsies (n = 50) and spleen (n = 11) by immunohistochemical staining and on erythrocytes by flow cytometry. On vascular endothelial cells of heart and spleen, only type II-based ABH antigens were expressed; type III/IV structures were not detected. Type II-based ABH were expressed on erythrocytes of all blood groups. Group A1 and A2 erythrocytes additionally expressed type III/IV precursors, whereas group B and O erythrocytes did not. Intensity of A/B antigen expression differed among group A1 , A2 , A1 B, A2 B and B erythrocytes. On group A2 erythrocytes, type III H structures were largely un-glycosylated with the terminal "A" sugar α-GalNAc. Together, these studies define qualitative and quantitative differences in ABH antigen expression between erythrocytes and vascular tissues. These expression profiles have important implications that must be considered in clinical settings of ABO-incompatible transplantation when interpreting anti-ABO antibodies measured by hemagglutination assays with reagent erythrocytes. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  9. Bevacizumab and Cediranib Maleate in Treating Patients With Metastatic or Unresectable Solid Tumor, Lymphoma, Intracranial Glioblastoma, Gliosarcoma or Anaplastic Astrocytoma

    ClinicalTrials.gov

    2014-02-14

    Adult Grade III Lymphomatoid Granulomatosis; Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Childhood Burkitt Lymphoma; Childhood Diffuse Large Cell Lymphoma; Childhood Grade III Lymphomatoid Granulomatosis; Childhood Immunoblastic Large Cell Lymphoma; Childhood Nasal Type Extranodal NK/T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Noncutaneous Extranodal Lymphoma; Peripheral T-cell Lymphoma; Progressive Hairy Cell Leukemia, Initial Treatment; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Childhood Anaplastic Large Cell Lymphoma; Recurrent Childhood Large Cell Lymphoma; Recurrent Childhood Lymphoblastic Lymphoma; Recurrent Childhood Small Noncleaved Cell Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent/Refractory Childhood Hodgkin Lymphoma; Refractory Hairy Cell Leukemia; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Childhood Anaplastic Large Cell Lymphoma; Stage IV Childhood Hodgkin Lymphoma; Stage IV Childhood Large Cell Lymphoma; Stage IV Childhood Lymphoblastic Lymphoma; Stage IV Childhood Small Noncleaved Cell Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IVA Mycosis Fungoides/Sezary Syndrome; Stage IVB Mycosis Fungoides/Sezary Syndrome; T-cell Large Granular Lymphocyte Leukemia; Testicular Lymphoma; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific; Waldenström Macroglobulinemia

  10. Specific Phobia among U.S. Adolescents: Phenomenology and Typology

    PubMed Central

    Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

    2014-01-01

    Background Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. Methods The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13–18 years in the continental United States. Results Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Conclusions Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. PMID:23108894

  11. Protease nexin 1 is a potent urinary plasminogen activator inhibitor in the presence of collagen type IV.

    PubMed

    Crisp, Robert J; Knauer, Mary F; Knauer, Daniel J

    2002-12-06

    Protease nexin 1 (PN1) in solution forms inhibitory complexes with thrombin or urokinase, which have opposing effects on the blood coagulation cascade. An initial report provided data supporting the idea that PN1 target protease specificity is under the influence of collagen type IV (1). Although collagen type IV demonstrated no effect on the association rate between PN1 and thrombin, the study reported that the association rate between PN1 and urokinase was allosterically reduced 10-fold. This has led to the generally accepted idea that the primary role of PN1 in the brain is to act as a rapid thrombin inhibition and clearance mechanism during trauma and loss of vascular integrity. In studies to identify the structural determinants of PN1 that mediate the allosteric interaction with collagen type IV, we found that protease specificity was only affected after transient exposure of PN1 to acidic conditions that mimic the elution protocol from a monoclonal antibody column. Because PN1 used in previous studies was purified over a monoclonal antibody column, we propose that the allosteric regulation of PN1 target protease specificity by collagen type IV is a result of the purification protocol. We provide both biochemical and kinetic data to support this conclusion. This finding is significant because it implies that PN1 may play a much larger role in the modeling and remodeling of brain tissues during development and is not simply an extravasated thrombin clearance mechanism as previously suggested.

  12. Two aspartate residues at the putative p10 subunit of a type II metacaspase from Nicotiana tabacum L. may contribute to the substrate-binding pocket.

    PubMed

    Acosta-Maspons, Alexis; Sepúlveda-García, Edgar; Sánchez-Baldoquín, Laura; Marrero-Gutiérrez, Junier; Pons, Tirso; Rocha-Sosa, Mario; González, Lien

    2014-01-01

    Metacaspases are cysteine proteases present in plants, fungi, prokaryotes, and early branching eukaryotes, although a detailed description of their cellular function remains unclear. Currently, three-dimensional (3D) structures are only available for two metacaspases: Trypanosoma brucei (MCA2) and Saccharomyces cerevisiae (Yca1). Furthermore, metacaspases diverged from animal caspases of known structure, which limits straightforward homology-based interpretation of functional data. We report for the first time the identification and initial characterization of a metacaspase of Nicotiana tabacum L., NtMC1. By combining domain search, multiple sequence alignment (MSA), and protein fold-recognition studies, we provide compelling evidences that NtMC1 is a plant metacaspase type II, and predict its 3D structure using the crystal structure of two type I metacaspases (MCA2 and Yca1) and Gsu0716 protein from Geobacter sulfurreducens as template. Analysis of the predicted 3D structure allows us to propose Asp353, at the putative p10 subunit, as a new member of the aspartic acid triad that coordinates the P1 arginine/lysine residue of the substrate. Nevertheless, site-directed mutagenesis and expression analysis in bacteria and Nicotiana benthamiana indicate the functionality of both Asp348 and Asp353. Through the co-expression of mutant and wild-type proteins by transient expression in N. benthamiana leaves we found that polypeptide processing seems to be intramolecular. Our results provide the first evidence in plant metacaspases concerning the functionality of the putative p10 subunit.

  13. High-Molecular-Mass Multi-c-Heme Cytochromes from Methylococcus capsulatus Bath†

    PubMed Central

    Bergmann, David J.; Zahn, James A.; DiSpirito, Alan A.

    1999-01-01

    The polypeptide and structural gene for a high-molecular-mass c-type cytochrome, cytochrome c553O, was isolated from the methanotroph Methylococcus capsulatus Bath. Cytochrome c553O is a homodimer with a subunit molecular mass of 124,350 Da and an isoelectric point of 6.0. The heme c concentration was estimated to be 8.2 ± 0.4 mol of heme c per subunit. The electron paramagnetic resonance spectrum showed the presence of multiple low spin, S = 1/2, hemes. A degenerate oligonucleotide probe synthesized based on the N-terminal amino acid sequence of cytochrome c553O was used to identify a DNA fragment from M. capsulatus Bath that contains occ, the gene encoding cytochrome c553O. occ is part of a gene cluster which contains three other open reading frames (ORFs). ORF1 encodes a putative periplasmic c-type cytochrome with a molecular mass of 118,620 Da that shows approximately 40% amino acid sequence identity with occ and contains nine c-heme-binding motifs. ORF3 encodes a putative periplasmic c-type cytochrome with a molecular mass of 94,000 Da and contains seven c-heme-binding motifs but shows no sequence homology to occ or ORF1. ORF4 encodes a putative 11,100-Da protein. The four ORFs have no apparent similarity to any proteins in the GenBank database. The subunit molecular masses, arrangement and number of hemes, and amino acid sequences demonstrate that cytochrome c553O and the gene products of ORF1 and ORF3 constitute a new class of c-type cytochrome. PMID:9922265

  14. A double tyrosine motif in the cardiac sodium channel domain III-IV linker couples calcium-dependent calmodulin binding to inactivation gating.

    PubMed

    Sarhan, Maen F; Van Petegem, Filip; Ahern, Christopher A

    2009-11-27

    Voltage-gated sodium channels maintain the electrical cadence and stability of neurons and muscle cells by selectively controlling the transmembrane passage of their namesake ion. The degree to which these channels contribute to cellular excitability can be managed therapeutically or fine-tuned by endogenous ligands. Intracellular calcium, for instance, modulates sodium channel inactivation, the process by which sodium conductance is negatively regulated. We explored the molecular basis for this effect by investigating the interaction between the ubiquitous calcium binding protein calmodulin (CaM) and the putative sodium channel inactivation gate composed of the cytosolic linker between homologous channel domains III and IV (DIII-IV). Experiments using isothermal titration calorimetry show that CaM binds to a novel double tyrosine motif in the center of the DIII-IV linker in a calcium-dependent manner, N-terminal to a region previously reported to be a CaM binding site. An alanine scan of aromatic residues in recombinant DIII-DIV linker peptides shows that whereas multiple side chains contribute to CaM binding, two tyrosines (Tyr(1494) and Tyr(1495)) play a crucial role in binding the CaM C-lobe. The functional relevance of these observations was then ascertained through electrophysiological measurement of sodium channel inactivation gating in the presence and absence of calcium. Experiments on patch-clamped transfected tsA201 cells show that only the Y1494A mutation of the five sites tested renders sodium channel steady-state inactivation insensitive to cytosolic calcium. The results demonstrate that calcium-dependent calmodulin binding to the sodium channel inactivation gate double tyrosine motif is required for calcium regulation of the cardiac sodium channel.

  15. Resolving the Inner Arcsecond of the RY Tau Jet with HST

    NASA Astrophysics Data System (ADS)

    Skinner, Stephen L.; Schneider, P. Christian; Audard, Marc; Güdel, Manuel

    2018-03-01

    Faint X-ray emission from hot plasma (T x > 106 K) has been detected extending outward a few arcseconds along the optically delineated jets of some classical T Tauri stars including RY Tau. The mechanism and location where the jets are heated to X-ray temperatures are unknown. We present high spatial resolution Hubble Space Telescope (HST) far-ultraviolet long-slit observations of RY Tau with the slit aligned along the jet. The primary objective was to search for C IV emission from warm plasma at T C IV ∼ 105 K within the inner jet (<1″) that cannot be fully resolved by X-ray telescopes. Spatially resolved C IV emission is detected in the blueshifted jet extending outward from the star to 1″ and in the redshifted jet out to 0.″5. C IV line centroid shifts give a radial velocity in the blueshifted jet of ‑136 ± 10 km s‑1 at an offset of 0.″29 (39 au) and deceleration outward is detected. The deprojected jet speed is subject to uncertainties in the jet inclination, but values ≳200 km s‑1 are likely. The mass-loss rate in the blueshifted jet is at least {\\dot{M}}jet,{blue}}=2.3× {10}-9 M ⊙ yr‑1, consistent with optical determinations. We use the HST data along with optically determined jet morphology to place meaningful constraints on candidate jet-heating models including a hot-launch model in which the jet is heated near the base to X-ray temperatures by an unspecified (but probably magnetic) process, and downstream heating from shocks or a putative jet magnetic field.

  16. Highly ionized gas absorption in the disk and halo toward HD 167756 at 3.5 kilometers per second resolution

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, Kenneth R.; Cardelli, Jason A.

    1994-01-01

    High-resolution spectra of interstellar Si IV, C IV, and N V absorption lines along the 4 kpc path to the inner Galaxy star HD 167756 at z = -0.85 kpc are presented. The spectra were obtained with the echelle mode of Goddard High Resolution Spectrograph (GHRS) aboard the Hubble Space Telescope (HST) and have signal-to-noise ratios ranging from 23 to 38. The high resolution of the measurements full width at half maximum (FWHM = 3.5 km/s) results in fully resolved line profiles for the highly ionized gas absorption. The measurements provide information on the column density per unit velocity, N(v), as a function of velocity for Si IV, C IV, and N V. The C IV and N V profiles extend from -70 to +70 km/s, while the Si IV profiles extend from -40 to +70 km/s. The integrated logarithmic column densities are long N(Si IV) = 13.09 +/- 0.02, log N(C IV) = 13.83 +/- 0.02, and log N(N V) = 13.56 +/- 0.03. The N V profile is broad, asymmetric, and featureless, while the Si IV profile contains narrow absorption components near V(sub LSR) = -19, 0, +20, and +52 km/s with Doppler spread parameters, b about = 10-12 km/s. The C IV profile contains both broad and narrow structure. The high ion feature near +52 km/s is also detected in the low-ionization lines of Ca II, O I, Si II, and Fe II. The other narrow Si IV and C IV components occur within several km/s of components seen in low-ionization species. The sight line contains at least two types of highly ionized gas. One type gives rise to a broad N V profile, and the other results in the more structured Si IV profile. The C IV profile contains contributions from both types of highly ionized gas. The broad but asymmetric N V profile is well represented by a large Galactic scale height gas which is participating in Galactic rotation and has a combination of thermal and turbulent broadening with b(sub tot) about = 42 km/s. The C IV to N V abundance ratio of 1.0 +/- 0.3 for the gas implies T about 1.6 x 10(exp 5) K or about 8 x 10(exp 5) K if the gas is in collisional ionization equilibrium and has a solar carbon to nitrogen abundance ratio. This absorption may be associated with cooling hot gas situated in Galactic shells and supershells along the sight line. The gas producing the narrow Si IV and C IV absorption components has line widths that are compatible with origins in conductive interfaces between the warm and hot interstellar medium. Kinematic flows associated with the photoionized edges of clouds might also produce Si IV and C IV lines with Doppler spread parameters similar to those observed, but the C IV to Si IV ratio in this gas is 3.5, which leads us to favor the conductive interface interpretation.

  17. Community-associated methicillin-resistant Staphylococcus aureus causing chronic pneumonia.

    PubMed

    Enayet, Iram; Nazeri, Ali; Johnson, Leonard B; Riederer, Kathleen; Pawlak, Joan; Saravolatz, Louis D

    2006-04-01

    A young woman presented with pneumonia of a 3-month duration with predominantly nodular pulmonary infiltrates. Methicillin-resistant Staphylococcus aureus was identified in multiple cultures of sputum specimens. According to findings of pulsed-field gel electrophoresis, the isolate was identical to USA 300 and carried a type IV Staphylococcus cassette chromosome mec type IV gene and the genes for Panton-Valentine leukocidin.

  18. Treatment with 17-allylamino-17-demethoxygeldanamycin ameliorated symptoms of Bartter syndrome type IV caused by mutated Bsnd in mice.

    PubMed

    Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich

    2013-11-22

    Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Comorbid Anxiety and Depression and Their Impact on Cardiovascular Disease in Type 2 Diabetes: The Fremantle Diabetes Study Phase II.

    PubMed

    Bruce, David G; Davis, Wendy A; Dragovic, Milan; Davis, Timothy M E; Starkstein, Sergio E

    2016-10-01

    The aims were to determine whether anxious depression, defined by latent class analysis (LCA), predicts cardiovascular outcomes in type 2 diabetes and to compare the predictive power of anxious depression with Diagnostic & Statistical Manual Versions IV and 5 (DSM-IV/5) categories of depression and generalized anxiety disorder (GAD). Prospective observational study of 1,337 type 2 participants. Baseline assessment with the 9-item Patient Health Questionnaire and the GAD Scale; LCA-defined groups with minor or major anxious depression based on anxiety and depression symptoms. Cox modeling used to compare the independent impact of: (1) LCA anxious depression, (2) DSM-IV/5 depression, (3) GAD on incident cardiovascular events and deaths after 4 years. LCA minor and major anxious depression was present in 21.9 and 7.8% of participants, respectively, DSM-IV/5 minor and major depression in 6.2 and 6.1%, respectively, and GAD in 4.8%. There were 110 deaths, 31 cardiovascular deaths, and 199 participants had incident cardiovascular events. In adjusted models, minor anxious depression (Hazard ratio (95% confidence intervals): 1.70 (1.15-2.50)) and major anxious depression (1.90 (1.11-3.25)) predicted incident cardiovascular events and major anxious depression also predicted cardiovascular mortality (4.32 (1.35-13.86)). By comparison, incident cardiovascular events were predicted by DSM-IV/5 major depression (2.10 (1.22-3.62)) only and cardiovascular mortality was predicted by both DSM-IV/5 major depression (3.56 (1.03-12.35)) and GAD (5.92 (1.84-19.08)). LCA-defined anxious depression is more common than DSM-IV/5 categories and is a strong predictor of cardiovascular outcomes in type 2 diabetes. These data suggest that this diagnostic scheme has predictive validity and clinical relevance. © 2016 Wiley Periodicals, Inc.

  20. The willingness of patients to pay for intravenous patient-controlled analgesia in Korea.

    PubMed

    Lim, Hyungsun; Lee, Duck-Hyoung; Lee, Jeongwoo; Han, Young Jin; Choe, Huhn; Son, Ji-Seon

    2012-06-01

    The use of intravenous patient-controlled analgesia (IV-PCA) has been increasing because it has advantages such as improved pain relief, greater patient satisfaction, and fewer postoperative complications. However, current research has not considered the patients' thoughts about IV-PCA's cost-effectiveness. The purpose of this study was to investigate the willingness to pay (WTP) for IV-PCA and the relationship between patients' characteristics and WTP in Korea. We enrolled 400 adult patients who were scheduled for elective surgery. The patient was requested to indicate a series of predefined amounts of money (Korean won; 30,000/50,000/100,000/150,000/200,000/300,000/500,000). We also recorded patient characteristics, such as age, sex, type of surgery, IV-PCA history, education level, the person responsible for medical expenses, type of insurance, net annual income, and residential area. Three days after surgery, we asked about the degree of satisfaction and the WTP for IV-PCA. For IV-PCA, the median WTP was 100,000 won (25-75%; 50,000-200,000 won: US$1 = W1078.04; July 19, 2011) before surgery. All patients' characteristics were not related to preoperative WTP for IV-PCA, whereas the increase in WTP after surgery showed a tendency correlated to higher IV-PCA satisfaction. The median WTP was 100,000 won. The satisfaction of IV-PCA increased patients' WTP after surgery, but the WTP may be independent of patient characteristics in Korea.

  1. Bond Strength of Gold Alloys Laser Welded to Cobalt-Chromium Alloy

    PubMed Central

    Watanabe, Ikuya; Wallace, Cameron

    2008-01-01

    The objective of this study was to investigate the joint properties between cast gold alloys and Co-Cr alloy laser-welded by Nd:YAG laser. Cast plates were fabricated from three types of gold alloys (Type IV, Type II and low-gold) and a Co-Cr alloy. Each gold alloy was laser-welded to Co-Cr using a dental laser-welding machine. Homogeneously-welded and non-welded control specimens were also prepared. Tensile testing was conducted and data were statistically analyzed using ANOVA. The homogeneously-welded groups showed inferior fracture load compared to corresponding control groups, except for Co-Cr. In the specimens welded heterogeneously to Co-Cr, Type IV was the greatest, followed by low-gold and Type II. There was no statistical difference (P<0.05) in fracture load between Type II control and that welded to Co-Cr. Higher elongations were obtained for Type II in all conditions, whereas the lowest elongation occurred for low-gold welded to Co-Cr. This study indicated that, of the three gold alloys tested, the Type IV gold alloy was the most suitable alloy for laser-welding to Co-Cr. PMID:19088892

  2. Regulation of COX-2–mediated signaling by α3 type IV noncollagenous domain in tumor angiogenesis

    PubMed Central

    Boosani, Chandra Shekhar; Mannam, Arjuna P.; Cosgrove, Dominic; Silva, Rita; Hodivala-Dilke, Kairbaan M.; Keshamouni, Venkateshwar G.

    2007-01-01

    Human α3 chain, a noncollagenous domain of type IV collagen [α3(IV)NC1], inhibits angiogenesis and tumor growth. These biologic functions are partly attributed to the binding of α3(IV)NC1 to αVβ3 and α3β1 integrins. α3(IV)NC1 binds αVβ3 integrin, leading to translation inhibition by inhibiting focal adhesion kinase/phosphatidylinositol 3-kinase/Akt/mTOR/4E-BP1 pathways. In the present study, we evaluated the role of α3β1 and αVβ3 integrins in tube formation and regulation of cyclooxygenase-2 (COX-2) on α3(IV)NC1 stimulation. We found that although both integrins were required for the inhibition of tube formation by α3(IV)NC1 in endothelial cells, only α3β1 integrin was sufficient to regulate COX-2 in hypoxic endothelial cells. We show that binding of α3(IV)NC1 to α3β1 integrin leads to inhibition of COX-2–mediated pro-angiogenic factors, vascular endothelial growth factor, and basic fibroblast growth factor by regulating IκBα/NFκB axis, and is independent of αVβ3 integrin. Furthermore, β3 integrin–null endothelial cells, when treated with α3(IV)NC1, inhibited hypoxia-mediated COX-2 expression, whereas COX-2 inhibition was not observed in α3 integrin–null endothelial cells, indicating that regulation of COX-2 by α3(IV)NC1 is mediated by integrin α3β1. Our in vitro and in vivo findings demonstrate that α3β1 integrin is critical for α3(IV)NC1-mediated inhibition of COX-2–dependent angiogenic signaling and inhibition of tumor progression. PMID:17426256

  3. Loss of Intralipid®- but Not Sevoflurane-Mediated Cardioprotection in Early Type-2 Diabetic Hearts of Fructose-Fed Rats: Importance of ROS Signaling

    PubMed Central

    Zhang, Liyan; Affolter, Andreas; Gandhi, Manoj; Hersberger, Martin; Warren, Blair E.; Lemieux, Hélène; Sobhi, Hany F.; Clanachan, Alexander S.; Zaugg, Michael

    2014-01-01

    Background Insulin resistance and early type-2 diabetes are highly prevalent. However, it is unknown whether Intralipid® and sevoflurane protect the early diabetic heart against ischemia-reperfusion injury. Methods Early type-2 diabetic hearts from Sprague-Dawley rats fed for 6 weeks with fructose were exposed to 15 min of ischemia and 30 min of reperfusion. Intralipid® (1%) was administered at the onset of reperfusion. Peri-ischemic sevoflurane (2 vol.-%) served as alternative protection strategy. Recovery of left ventricular function was recorded and the activation of Akt and ERK 1/2 was monitored. Mitochondrial function was assessed by high-resolution respirometry and mitochondrial ROS production was measured by Amplex Red and aconitase activity assays. Acylcarnitine tissue content was measured and concentration-response curves of complex IV inhibition by palmitoylcarnitine were obtained. Results Intralipid® did not exert protection in early diabetic hearts, while sevoflurane improved functional recovery. Sevoflurane protection was abolished by concomitant administration of the ROS scavenger N-2-mercaptopropionyl glycine. Sevoflurane, but not Intralipid® produced protective ROS during reperfusion, which activated Akt. Intralipid® failed to inhibit respiratory complex IV, while sevoflurane inhibited complex I. Early diabetic hearts exhibited reduced carnitine-palmitoyl-transferase-1 activity, but palmitoylcarnitine could not rescue protection and enhance postischemic functional recovery. Cardiac mitochondria from early diabetic rats exhibited an increased content of subunit IV-2 of respiratory complex IV and of uncoupling protein-3. Conclusions Early type-2 diabetic hearts lose complex IV-mediated protection by Intralipid® potentially due to a switch in complex IV subunit expression and increased mitochondrial uncoupling, but are amenable to complex I-mediated sevoflurane protection. PMID:25127027

  4. Comparison of adverse events of laser and light-assisted hair removal systems in skin types IV-VI.

    PubMed

    Breadon, Jonith Y; Barnes, Chad A

    2007-01-01

    Photoepilation, utilizing lasers and noncoherent light sources, is designed to irradiate as much of the follicular unit as possible, with melanin as the target chromophore. Wavelength absorption should generate energy sufficient to heat and destroy the hair follicle, while preserving the surrounding tissue. When performing photoepilation on African-American skin (Fitzpatrick skin types IV-VI) a greater risk of potential epidermal adverse events, such as dyspigmentation, blistering, crusting, edema, and subsequent scarring, is possible. To reduce epidermal melanin absorption of energy longer wavelengths are considered safer for use on Fitzpatrick skin types IV to VI. This article reviews and compares the reported incidences of adverse events in African-American skin, utilizing lasers and noncoherent light sources for assisted hair removal.

  5. Identification of dipeptidyl peptidase-IV inhibitory peptides from mare whey protein hydrolysates.

    PubMed

    Song, J J; Wang, Q; Du, M; Ji, X M; Mao, X Y

    2017-09-01

    Inhibition of dipeptidyl peptidase-IV (DPP-IV) activity is a promising strategy for treatment of type 2 diabetes. In the current study, DPP-IV inhibitory peptides were identified from mare whey protein hydrolysates obtained by papain. The results showed that all the mare whey protein hydrolysates obtained at various hydrolysis durations possessed more potent DPP-IV inhibitory activity compared with intact whey protein. The 4-h hydrolysates showed the greatest DPP-IV inhibitory activity with half-maximal inhibitory concentration of 0.18 mg/mL. The 2 novel peptides from 4-h hydrolysate fractions separated by successive chromatographic steps were characterized by liquid chromatography-electrospray ionization tandem mass spectrometry. The novel peptides Asn-Leu-Glu-Ile-Ile-Leu-Arg and Thr-Gln-Met-Val-Asp-Glu-Glu-Ile-Met-Glu-Lys-Phe-Arg, which corresponded to β-lactoglobulin 1 f(71-77) and β-lactoglobulin 1 f(143-155), demonstrated DPP-IV inhibitory activity with half-maximal inhibitory concentrations of 86.34 and 69.84 μM, respectively. The DPP-IV inhibitory activity of the 2 peptides was retained or even improved after simulated gastrointestinal digestion in vitro. Our findings indicate that mare whey protein-derived peptides may possess potential as functional food ingredients in the management of type 2 diabetes. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  6. Equilibrium between Different Coordination Geometries in Oxidovanadium(IV) Complexes

    ERIC Educational Resources Information Center

    Ugone, Valeria; Garribba, Eugenio; Micera, Giovanni; Sanna, Daniele

    2015-01-01

    In this laboratory activity, the equilibrium between square pyramidal and octahedral V(IV)O[superscript 2+] complexes is described. We propose a set of experiments to synthesize and characterize two types of V(IV)O[superscript 2+] complexes. The experiment allows great flexibility and may be effectively used at a variety of levels and the activity…

  7. Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

    PubMed

    Lees, George E

    2013-01-01

    To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

  8. Chronic constipation recognized as a sign of a SOX10 mutation in a patient with Waardenburg syndrome.

    PubMed

    Arimoto, Yukiko; Namba, Kazunori; Nakano, Atsuko; Matsunaga, Tatsuo

    2014-05-01

    Waardenburg syndrome is characterized by hearing loss, pigmentation abnormalities, dysmorphologic features, and neurological phenotypes. Waardenburg syndrome consists of four distinct subtypes, and SOX10 mutations have been identified in type II and type IV. Type IV differs from type II owing to the presence of Hirschsprung disease. We identified a de novo nonsense mutation in SOX10 (p.G39X) in a female pediatric patient with Waardenburg syndrome with heterochromia iridis, profound bilateral sensorineural hearing loss, inner ear malformations, and overall hypopigmentation of the hair without dystopia canthorum. This patient has experienced chronic constipation since she was a neonate, but anorectal manometry showed a normal anorectal reflex. Chronic constipation in this patient was likely to be a consequence of a mild intestinal disorder owing to the SOX10 mutation, and this patient was considered to have a clinical phenotype intermediate between type II and type IV of the syndrome. Chronic constipation may be recognized as indicative of a SOX10 mutation in patients with Waardenburg syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Classification of corkscrew collaterals in thromboangiitis obliterans (Buerger's disease): relationship between corkscrew type and prevalence of ischemic ulcers.

    PubMed

    Fujii, Yuichi; Soga, Junko; Nakamura, Shuji; Hidaka, Takayuki; Hata, Takaki; Idei, Naomi; Fujimura, Noritaka; Nishioka, Kenji; Chayama, Kazuaki; Kihara, Yasuki; Higashi, Yukihito

    2010-08-01

    A corkscrew collateral appearance on angiography is one of the diagnostic criteria for Buerger's disease. The purpose of the present study was to classify the angiographic findings of corkscrew collaterals and to evaluate the relationship between corkscrew collateral type and the severity of Buerger's disease. Corkscrew collaterals were assessed on digital subtraction angiography in lower extremities of 28 patients with Buerger's disease (55 limbs). The corkscrew sign was classified into 4 types by size and pattern as follows: type I, artery diameter >2 mm, large helical sign; type II, diameter >1.5 mm and or=1 mm and

  10. Level III and IV Ecoregions by State

    EPA Pesticide Factsheets

    Information and links to downloadable maps and datasets for Level III and IV ecoregions, listed by state. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  11. Level III and IV Ecoregions by EPA Region

    EPA Pesticide Factsheets

    Information and downloadable maps and datasets for Level III and IV ecoregions, listed by EPA region. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  12. Complete Genome Analysis of Three Novel Picornaviruses from Diverse Bat Species▿

    PubMed Central

    Lau, Susanna K. P.; Woo, Patrick C. Y.; Lai, Kenneth K. Y.; Huang, Yi; Yip, Cyril C. Y.; Shek, Chung-Tong; Lee, Paul; Lam, Carol S. F.; Chan, Kwok-Hung; Yuen, Kwok-Yung

    2011-01-01

    Although bats are important reservoirs of diverse viruses that can cause human epidemics, little is known about the presence of picornaviruses in these flying mammals. Among 1,108 bats of 18 species studied, three novel picornaviruses (groups 1, 2, and 3) were identified from alimentary specimens of 12 bats from five species and four genera. Two complete genomes, each from the three picornaviruses, were sequenced. Phylogenetic analysis showed that they fell into three distinct clusters in the Picornaviridae family, with low homologies to known picornaviruses, especially in leader and 2A proteins. Moreover, group 1 and 2 viruses are more closely related to each other than to group 3 viruses, which exhibit genome features distinct from those of the former two virus groups. In particular, the group 3 virus genome contains the shortest leader protein within Picornaviridae, a putative type I internal ribosome entry site (IRES) in the 5′-untranslated region instead of the type IV IRES found in group 1 and 2 viruses, one instead of two GXCG motifs in 2A, an L→V substitution in the DDLXQ motif in 2C helicase, and a conserved GXH motif in 3C protease. Group 1 and 2 viruses are unique among picornaviruses in having AMH instead of the GXH motif in 3Cpro. These findings suggest that the three picornaviruses belong to two novel genera in the Picornaviridae family. This report describes the discovery and complete genome analysis of three picornaviruses in bats, and their presence in diverse bat genera/species suggests the ability to cross the species barrier. PMID:21697464

  13. Distribution of Porphyromonas gingivalis fimA genotypes in chronic apical periodontitis associated with symptoms.

    PubMed

    Wang, Qian; Zhou, Xue-dong; Zheng, Qing-hua; Wang, Yao; Tang, Lu; Huang, Ding-ming

    2010-11-01

    Porphyromonas gingivalis (P. gingivalis) is an anaerobic bacterium involved in root canal infections whose fimbriae are classified into six genotypes (types I-V and Ib) based on nucleotide sequence. Accumulated evidence suggests there is significant association between P. gingivalis and some clinical symptoms of periodontal diseases. The present study aims to determine the prevalence of P. gingivalis fimA genotypes in apical periodontitis and to investigate the correlation between P. gingivalis fimA genotypes and clinical symptoms. Samples were obtained from 158 infected root canals with apical periodontitis. DNA was extracted and analyzed with a polymerase chain reaction-based identification assay. Odds ratios, 95% confidence intervals, and contingency coefficient were calculated for associating the fimA-specific genes with clinical symptoms. P. gingivalis was detected in 39.9% of the inflected root canal samples and was found in 44.5% of P. gingivalis-positive specimens with symptoms. Types II (69.4%) were the most frequent in the symptomatic cases followed by type IV (32.7%). The occurrence of type I (64.3%) was significantly higher than any other genotypes in the asymptomatic apical periodontitis, whereas type II and type Ib were not identified. Statistical analysis revealed that the occurrences of types II, IV, and Ib fimA were associated with greater risk of clinical signs (swelling, sinus tract, or intracanal exudates) than type I. Results from this study reinforce the association between P. gingivalis-specific fimA genotypic clones and apical periodontitis, indicating that fimA genotypes (types II, IV, and Ib) were related to the etiology of symptomatic periradicular diseases. Copyright © 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  14. Comparison of DNA decatenation by Escherichia coli topoisomerase IV and topoisomerase III: implications for non-equilibrium topology simplification

    PubMed Central

    Seol, Yeonee; Hardin, Ashley H.; Strub, Marie-Paule; Charvin, Gilles; Neuman, Keir C.

    2013-01-01

    Type II topoisomerases are essential enzymes that regulate DNA topology through a strand-passage mechanism. Some type II topoisomerases relax supercoils, unknot and decatenate DNA to below thermodynamic equilibrium. Several models of this non-equilibrium topology simplification phenomenon have been proposed. The kinetic proofreading (KPR) model postulates that strand passage requires a DNA-bound topoisomerase to collide twice in rapid succession with a second DNA segment, implying a quadratic relationship between DNA collision frequency and relaxation rate. To test this model, we used a single-molecule assay to measure the unlinking rate as a function of DNA collision frequency for Escherichia coli topoisomerase IV (topo IV) that displays efficient non-equilibrium topology simplification activity, and for E. coli topoisomerase III (topo III), a type IA topoisomerase that unlinks and unknots DNA to equilibrium levels. Contrary to the predictions of the KPR model, topo IV and topo III unlinking rates were linearly related to the DNA collision frequency. Furthermore, topo III exhibited decatenation activity comparable with that of topo IV, supporting proposed roles for topo III in DNA segregation. This study enables us to rule out the KPR model for non-equilibrium topology simplification. More generally, we establish an experimental approach to systematically control DNA collision frequency. PMID:23460205

  15. Identification of druggable cancer driver genes amplified across TCGA datasets.

    PubMed

    Chen, Ying; McGee, Jeremy; Chen, Xianming; Doman, Thompson N; Gong, Xueqian; Zhang, Youyan; Hamm, Nicole; Ma, Xiwen; Higgs, Richard E; Bhagwat, Shripad V; Buchanan, Sean; Peng, Sheng-Bin; Staschke, Kirk A; Yadav, Vipin; Yue, Yong; Kouros-Mehr, Hosein

    2014-01-01

    The Cancer Genome Atlas (TCGA) projects have advanced our understanding of the driver mutations, genetic backgrounds, and key pathways activated across cancer types. Analysis of TCGA datasets have mostly focused on somatic mutations and translocations, with less emphasis placed on gene amplifications. Here we describe a bioinformatics screening strategy to identify putative cancer driver genes amplified across TCGA datasets. We carried out GISTIC2 analysis of TCGA datasets spanning 16 cancer subtypes and identified 486 genes that were amplified in two or more datasets. The list was narrowed to 75 cancer-associated genes with potential "druggable" properties. The majority of the genes were localized to 14 amplicons spread across the genome. To identify potential cancer driver genes, we analyzed gene copy number and mRNA expression data from individual patient samples and identified 42 putative cancer driver genes linked to diverse oncogenic processes. Oncogenic activity was further validated by siRNA/shRNA knockdown and by referencing the Project Achilles datasets. The amplified genes represented a number of gene families, including epigenetic regulators, cell cycle-associated genes, DNA damage response/repair genes, metabolic regulators, and genes linked to the Wnt, Notch, Hedgehog, JAK/STAT, NF-KB and MAPK signaling pathways. Among the 42 putative driver genes were known driver genes, such as EGFR, ERBB2 and PIK3CA. Wild-type KRAS was amplified in several cancer types, and KRAS-amplified cancer cell lines were most sensitive to KRAS shRNA, suggesting that KRAS amplification was an independent oncogenic event. A number of MAP kinase adapters were co-amplified with their receptor tyrosine kinases, such as the FGFR adapter FRS2 and the EGFR family adapters GRB2 and GRB7. The ubiquitin-like ligase DCUN1D1 and the histone methyltransferase NSD3 were also identified as novel putative cancer driver genes. We discuss the patient tailoring implications for existing cancer drug targets and we further discuss potential novel opportunities for drug discovery efforts.

  16. Heterogeneity of signal transduction by Na-K-ATPase α-isoforms: role of Src interaction.

    PubMed

    Yu, Hui; Cui, Xiaoyu; Zhang, Jue; Xie, Joe X; Banerjee, Moumita; Pierre, Sandrine V; Xie, Zijian

    2018-02-01

    Of the four Na-K-ATPase α-isoforms, the ubiquitous α1 Na-K-ATPase possesses both ion transport and Src-dependent signaling functions. Mechanistically, we have identified two putative pairs of domain interactions between α1 Na-K-ATPase and Src that are critical for α1 signaling function. Our subsequent report that α2 Na-K-ATPase lacks these putative Src-binding sites and fails to carry on Src-dependent signaling further supported our proposed model of direct interaction between α1 Na-K-ATPase and Src but fell short of providing evidence for a causative role. This hypothesis was specifically tested here by introducing key residues of the two putative Src-interacting domains present on α1 but not α2 sequence into the α2 polypeptide, generating stable cell lines expressing this mutant, and comparing its signaling properties to those of α2-expressing cells. The mutant α2 was fully functional as a Na-K-ATPase. In contrast to wild-type α2, the mutant gained α1-like signaling function, capable of Src interaction and regulation. Consistently, the expression of mutant α2 redistributed Src into caveolin-1-enriched fractions and allowed ouabain to activate Src-mediated signaling cascades, unlike wild-type α2 cells. Finally, mutant α2 cells exhibited a growth phenotype similar to that of the α1 cells and proliferated much faster than wild-type α2 cells. These findings reveal the structural requirements for the Na-K-ATPase to function as a Src-dependent receptor and provide strong evidence of isoform-specific Src interaction involving the identified key amino acids. The sequences surrounding the putative Src-binding sites in α2 are highly conserved across species, suggesting that the lack of Src binding may play a physiologically important and isoform-specific role.

  17. Identification of Druggable Cancer Driver Genes Amplified across TCGA Datasets

    PubMed Central

    Chen, Ying; McGee, Jeremy; Chen, Xianming; Doman, Thompson N.; Gong, Xueqian; Zhang, Youyan; Hamm, Nicole; Ma, Xiwen; Higgs, Richard E.; Bhagwat, Shripad V.; Buchanan, Sean; Peng, Sheng-Bin; Staschke, Kirk A.; Yadav, Vipin; Yue, Yong; Kouros-Mehr, Hosein

    2014-01-01

    The Cancer Genome Atlas (TCGA) projects have advanced our understanding of the driver mutations, genetic backgrounds, and key pathways activated across cancer types. Analysis of TCGA datasets have mostly focused on somatic mutations and translocations, with less emphasis placed on gene amplifications. Here we describe a bioinformatics screening strategy to identify putative cancer driver genes amplified across TCGA datasets. We carried out GISTIC2 analysis of TCGA datasets spanning 14 cancer subtypes and identified 461 genes that were amplified in two or more datasets. The list was narrowed to 73 cancer-associated genes with potential “druggable” properties. The majority of the genes were localized to 14 amplicons spread across the genome. To identify potential cancer driver genes, we analyzed gene copy number and mRNA expression data from individual patient samples and identified 40 putative cancer driver genes linked to diverse oncogenic processes. Oncogenic activity was further validated by siRNA/shRNA knockdown and by referencing the Project Achilles datasets. The amplified genes represented a number of gene families, including epigenetic regulators, cell cycle-associated genes, DNA damage response/repair genes, metabolic regulators, and genes linked to the Wnt, Notch, Hedgehog, JAK/STAT, NF-KB and MAPK signaling pathways. Among the 40 putative driver genes were known driver genes, such as EGFR, ERBB2 and PIK3CA. Wild-type KRAS was amplified in several cancer types, and KRAS-amplified cancer cell lines were most sensitive to KRAS shRNA, suggesting that KRAS amplification was an independent oncogenic event. A number of MAP kinase adapters were co-amplified with their receptor tyrosine kinases, such as the FGFR adapter FRS2 and the EGFR family adapter GRB7. The ubiquitin-like ligase DCUN1D1 and the histone methyltransferase NSD3 were also identified as novel putative cancer driver genes. We discuss the patient tailoring implications for existing cancer drug targets and we further discuss potential novel opportunities for drug discovery efforts. PMID:24874471

  18. A MADS box protein interacts with a mating-type protein and is required for fruiting body development in the homothallic ascomycete Sordaria macrospora.

    PubMed

    Nolting, Nicole; Pöggeler, Stefanie

    2006-07-01

    MADS box transcription factors control diverse developmental processes in plants, metazoans, and fungi. To analyze the involvement of MADS box proteins in fruiting body development of filamentous ascomycetes, we isolated the mcm1 gene from the homothallic ascomycete Sordaria macrospora, which encodes a putative homologue of the Saccharomyces cerevisiae MADS box protein Mcm1p. Deletion of the S. macrospora mcm1 gene resulted in reduced biomass, increased hyphal branching, and reduced hyphal compartment length during vegetative growth. Furthermore, the S. macrospora Deltamcm1 strain was unable to produce fruiting bodies or ascospores during sexual development. A yeast two-hybrid analysis in conjugation with in vitro analyses demonstrated that the S. macrospora MCM1 protein can interact with the putative transcription factor SMTA-1, encoded by the S. macrospora mating-type locus. These results suggest that the S. macrospora MCM1 protein is involved in the transcriptional regulation of mating-type-specific genes as well as in fruiting body development.

  19. A clinicopathological study of the expression of extracellular matrix components in urothelial carcinoma.

    PubMed

    Ioachim, Elli; Michael, Michalis; Stavropoulos, Nicolaos E; Kitsiou, Evangelia; Salmas, Marios; Malamou-Mitsi, Vasiliki

    2005-03-01

    To measure the immunohistochemical expression of the extracellular matrix (ECM) components tenascin, fibronectin, collagen type IV and laminin in urothelial carcinomas, and to correlate their expression with clinicopathological features to clarify the prognostic value of these molecules and their role in tumour progression. Tumour specimens obtained during transurethral resection of bladder tumour (TURBT) from 103 patients (82 men and 2 1 women, mean age 66.7 years, range 27-89) were studied retrospectively. The expression of tenascin, fibronectin, collagen type IV and laminin was correlated with clinicopathological features (tumour grade and stage, multiplicity, simultaneous in situ component, the proliferative activity as estimated by the two proliferation associated indices, Ki-67 and proliferating cell nuclear antigen, the recurrence rate, and the progression of invading tumour). Specimens investigated for tenascin expression from patients with superficial bladder cancers were categorized into 28 treated by TURBT only and 53 who had TURBT followed by intravesical instillations of interferon. Cytoplasmic tenascin expression was detected in tumour cells in 20% of specimens. Tenascin was expressed in the tumour stroma in 76% of specimens, and was positively correlated with tumour grade and stage. Stromal tenascin expression was positively correlated with proliferative activity, and with the expression of fibronectin and collagen type IV. Fibronectin was expressed in the tumour stroma in 89% of specimens and was positively correlated with tumour stage, proliferative activity, and expression of collagen type IV and laminin. Collagen type IV was expressed in 93% of specimens, and was positively correlated with tumour grade and stage. Laminin was expressed in 78% of specimens and had no significant correlation with the clinicopathological features. Patients treated with TURBT alone and who had low levels of tenascin had a longer tumour-free interval than those with high levels of tenascin. Levels of tenascin might be valuable for predicting the risk of early recurrence. The expression of tenascin, fibronectin and collagen type IV seems to be correlated with more aggressive tumour behaviour. Furthermore, their interrelationships could indicate that they are involved in the remodelling of bladder cancer tissue, probably influencing tumour progression.

  20. A novel arctigenin-containing latex glove prevents latex allergy by inhibiting type I/IV allergic reactions.

    PubMed

    Wang, Yong-Xin; Xue, Dan-Ting; Liu, Meng; Zhou, Zheng-Min; Shang, Jing

    2016-03-01

    The present study aimed at developing a natural compound with anti-allergic effect and stability under latex glove manufacturing conditions and investigating whether its anti-allergic effect is maintained after its addition into the latex. The effects of nine natural compounds on growth of the RBL-2H3 cells and mouse primary spleen lymphocytes were determined using MTT assay. The compounds included glycyrrhizin, osthole, tetrandrine, tea polyphenol, catechin, arctigenin, oleanolic acid, baicalin and oxymatrine. An ELISA assay was used for the in vitro anti-type I/IV allergy screening; in this process β-hexosaminidase, histamine, and IL-4 released from RBL-2H3 cell lines and IFN-γ and IL-2 released from mouse primary spleen lymphocytes were taken as screening indices. The physical stability of eight natural compounds and the dissolubility of arctigenin, selected based on the in vitro pharnacodynamaic screening and the stability evaluation, were detected by HPLC. The in vivo pharmacodynamic confirmation of arctigenin and final latex product was evaluated with a passive cutaneous anaphylaxis (PCA) model and an allergen-specific skin response model. Nine natural compounds showed minor growth inhibition on RBL-2H3 cells and mouse primary spleen lymphocytes. Baicalin and arctigenin had the best anti-type I and IV allergic effects among the natural compounds based on the in vitro pharmacodynamic screening. Arctigenin and catechin had the best physical stability under different manufacturing conditions. Arctigenin was the selected for further evaluation and proven to have anti-type I and IV allergic effects in vivo in a dose-dependent manner. The final product of the arctigenin-containing latex glove had anti-type I and IV allergic effects in vivo which were mainly attributed to arctigenin as proved from the dissolubility results. Arctigenin showed anti-type I and IV allergic effects in vitro and in vivo, with a good stability under latex glove manufacturing conditions, and a persistent anti-allergic effect after being added into the latex to prevent latex allergy. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  1. Period variations of Algol-type eclipsing binaries AD And, TWCas and IV Cas

    NASA Astrophysics Data System (ADS)

    Parimucha, Štefan; Gajdoš, Pavol; Kudak, Viktor; Fedurco, Miroslav; Vaňko, Martin

    2018-04-01

    We present new analyses of variations in O – C diagrams of three Algol-type eclipsing binary stars: AD And, TW Cas and IV Cas. We have used all published minima times (including visual and photographic) as well as newly determined ones from our and SuperWasp observations. We determined orbital parameters of 3rd bodies in the systems with statistically significant errors, using our code based on genetic algorithms and Markov chain Monte Carlo simulations. We confirmed the multiple nature of AD And and the triple-star model of TW Cas, and we proposed a quadruple-star model of IV Cas.

  2. Degree of Hybridization in Seed Stands of Pinus engelmannii Carr. In the Sierra Madre Occidental, Durango, Mexico

    PubMed Central

    Ávila-Flores, Israel Jaime; Hernández-Díaz, José Ciro; González-Elizondo, Maria Socorro; Prieto-Ruíz, José Ángel; Wehenkel, Christian

    2016-01-01

    Hybridization is an important evolutionary force, because interspecific gene transfer can introduce more new genetic material than is directly generated by mutations. Pinus engelmannii Carr. is one of the nine most common pine species in the pine-oak forest ecoregion in the state of Durango, Mexico. This species is widely harvested for lumber and is also used in reforestation programmes. Interspecific hybrids between P.engelmannii and Pinus arizonica Engelm. have been detected by morphological analysis. The presence of hybrids in P. engelmannii seed stands may affect seed quality and reforestation success. Therefore, the goals of this research were to identify introgressive hybridization between P. engelmannii and other pine species in eight seed stands of this species in Durango, Mexico, and to examine how hybrid proportion is related to mean genetic dissimilarity between trees in these stands, using Amplified Fragment Length Polymorphism (AFLP) markers and morphological traits. Differences in the average current annual increment of putative hybrids and pure trees were also tested for statistical significance. Morphological and genetic analyses of 280 adult trees were carried out. Putative hybrids were found in all the seed stands studied. The hybrids did not differ from the pure trees in vigour or robustness. All stands with putative P. engelmannii hybrids detected by both AFLPs and morphological traits showed the highest average values of the Tanimoto distance, which indicates: i) more heterogeneous genetic material, ii) higher genetic variation and therefore iii) the higher evolutionary potential of these stands, and iv) that the morphological differentiation (hybrid/not hybrid) is strongly associated with the Tanimoto distance per stand. We conclude that natural pairwise hybrids are very common in the studied stands. Both morphological and molecular approaches are necessary to confirm the genetic identity of forest reproductive material. PMID:27064490

  3. Degree of Hybridization in Seed Stands of Pinus engelmannii Carr. In the Sierra Madre Occidental, Durango, Mexico.

    PubMed

    Ávila-Flores, Israel Jaime; Hernández-Díaz, José Ciro; González-Elizondo, Maria Socorro; Prieto-Ruíz, José Ángel; Wehenkel, Christian

    2016-01-01

    Hybridization is an important evolutionary force, because interspecific gene transfer can introduce more new genetic material than is directly generated by mutations. Pinus engelmannii Carr. is one of the nine most common pine species in the pine-oak forest ecoregion in the state of Durango, Mexico. This species is widely harvested for lumber and is also used in reforestation programmes. Interspecific hybrids between P.engelmannii and Pinus arizonica Engelm. have been detected by morphological analysis. The presence of hybrids in P. engelmannii seed stands may affect seed quality and reforestation success. Therefore, the goals of this research were to identify introgressive hybridization between P. engelmannii and other pine species in eight seed stands of this species in Durango, Mexico, and to examine how hybrid proportion is related to mean genetic dissimilarity between trees in these stands, using Amplified Fragment Length Polymorphism (AFLP) markers and morphological traits. Differences in the average current annual increment of putative hybrids and pure trees were also tested for statistical significance. Morphological and genetic analyses of 280 adult trees were carried out. Putative hybrids were found in all the seed stands studied. The hybrids did not differ from the pure trees in vigour or robustness. All stands with putative P. engelmannii hybrids detected by both AFLPs and morphological traits showed the highest average values of the Tanimoto distance, which indicates: i) more heterogeneous genetic material, ii) higher genetic variation and therefore iii) the higher evolutionary potential of these stands, and iv) that the morphological differentiation (hybrid/not hybrid) is strongly associated with the Tanimoto distance per stand. We conclude that natural pairwise hybrids are very common in the studied stands. Both morphological and molecular approaches are necessary to confirm the genetic identity of forest reproductive material.

  4. Acute pancreatitis complicating choledochal cysts in children.

    PubMed

    Muthucumaru, Mathievathaniy; Ljuhar, Damir; Panabokke, Gayathri; Paul, Eldho; Nataraja, Ramesh; Ferguson, Peter; Dagia, Charuta; Clarnette, Tom; King, Sebastian

    2017-03-01

    To analyse the characteristics of patients with choledochal cysts presenting with acute pancreatitis. Multicenter retrospective review of all paediatric patients (<18 years) with choledochal cysts managed over a 14-year period (2001-2014) at two tertiary paediatric surgical centres. Patient data were analysed for demographics, presentation, radiological classification of cyst type (Todani), operative interventions, complications and long-term follow-up. A total of 49 patients with choledochal cysts were identified with 15 (31%) being Type I fusiform, 18 (37%) Type I cystic and 16 (32%) Type IV-A. Seventeen (35%) patients presented with acute pancreatitis, one having had an ante-natally diagnosed choledochal cyst. Patients presenting with pancreatitis were older when compared to the non-pancreatitis group (5.1 vs. 1.2 years, P = 0.005). Nine out of 16 (53%) patients with Type IV-A cysts presented with pancreatitis compared to five (33%) of Type I fusiform and three (17%) of Type I cystic. There was however no statistically significant association between Todani types and the development of pancreatitis (Type I fusiform, P = 1.0; Type I cystic, P = 0.063; Type IV-A, P = 0.053). The rate of complications was similar in both groups. Pancreatitis was a common presentation in children with a choledochal cyst, however, there was no clear statistically significant association with Todani types and pancreatitis. © 2016 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

  5. Identification of the DotL coupling protein subcomplex of the Legionella Dot/Icm type IV secretion system.

    PubMed

    Vincent, Carr D; Friedman, Jonathan R; Jeong, Kwang Cheol; Sutherland, Molly C; Vogel, Joseph P

    2012-07-01

    Legionella pneumophila, the causative agent of Legionnaires' disease, survives in macrophages by altering the endocytic pathway of its host cell. To accomplish this, the bacterium utilizes a type IVB secretion system to deliver effector molecules into the host cell cytoplasm. In a previous report, we performed an extensive characterization of the L. pneumophila type IVB secretion system that resulted in the identification of a critical five-protein subcomplex that forms the core of the secretion apparatus. Here we describe a second Dot/Icm protein subassembly composed of the type IV coupling protein DotL, the apparatus proteins DotM and DotN, and the secretion adaptor proteins IcmS and IcmW. In the absence of IcmS or IcmW, DotL becomes destabilized at the transition from the exponential to stationary phases of growth, concurrent with the expression of many secreted substrates. Loss of DotL is dependent on ClpA, a regulator of the cytoplasmic protease ClpP. The resulting decreased levels of DotL in the icmS and icmW mutants exacerbates the intracellular defects of these strains and can be partially suppressed by overproduction of DotL. Thus, in addition to their role as chaperones for Legionella type IV secretion system substrates, IcmS and IcmW perform a second function as part of the Dot/Icm type IV coupling protein subcomplex. © 2012 Blackwell Publishing Ltd.

  6. The diagnostic accuracy of multiparametric MRI to determine pediatric brain tumor grades and types.

    PubMed

    Koob, Mériam; Girard, Nadine; Ghattas, Badih; Fellah, Slim; Confort-Gouny, Sylviane; Figarella-Branger, Dominique; Scavarda, Didier

    2016-04-01

    Childhood brain tumors show great histological variability. The goal of this retrospective study was to assess the diagnostic accuracy of multimodal MR imaging (diffusion, perfusion, MR spectroscopy) in the distinction of pediatric brain tumor grades and types. Seventy-six patients (range 1 month to 18 years) with brain tumors underwent multimodal MR imaging. Tumors were categorized by grade (I-IV) and by histological type (A-H). Multivariate statistical analysis was performed to evaluate the diagnostic accuracy of single and combined MR modalities, and of single imaging parameters to distinguish the different groups. The highest diagnostic accuracy for tumor grading was obtained with diffusion-perfusion (73.24%) and for tumor typing with diffusion-perfusion-MR spectroscopy (55.76%). The best diagnostic accuracy was obtained for tumor grading in I and IV and for tumor typing in embryonal tumor and pilocytic astrocytoma. Poor accuracy was seen in other grades and types. ADC and rADC were the best parameters for tumor grading and typing followed by choline level with an intermediate echo time, CBV for grading and Tmax for typing. Multiparametric MR imaging can be accurate in determining tumor grades (primarily grades I and IV) and types (mainly pilocytic astrocytomas and embryonal tumors) in children.

  7. [Purging behaviors and nutritional status in anorexia nervosa and bulimia nervosa].

    PubMed

    Vaz, F J; García-Herráiz, A; López-Vinuesa, B; Monge, M; Fernández-Gil, M A; Guisado, J A

    2003-01-01

    The aim of the study was to investigate whether the use of purgative methods in patients with eating disorders (anorexia nervosa [AN] and bulimia nervosa [BN]) could be capable of producing changes in the nutritional status of the patients. The group under study was composed of 184 female eating disordered outpatients. One hundred and sixteen patients (63.0%) fulfilled the DSM-IV diagnostic criteria for BN (90 purging type, 26 nonpurging type). Sixty eight patients (37.0%) fulfilled the DSM-IV criteria for the diagnosis of AN (48 restricting type, 20 binging-purging type). The assessment process included anthropometry (body circumferences and skinfold thickness) and body impedance analysis. The two subgroups of AN patients significantly differed from each of the BN subgroups. From a nutritional point of view, some significant differences between the two DSM-IV subtypes of AN existed, but not between the purging type and the nonpurging type of BN. The paper discusses the clinical significance of these findings. An alternative subtypification of AN patients is proposed: 1) restricting type [patients who control their food intake and do not purge]; 2) purging type [patient with true episodes of binging which are followed by purgative behaviors]; and 3) pseudopurging type [patients with subjective binging episodes who use purging methods].

  8. Free testosterone concentration is inversely associated with markers of liver fibrosis in men with type 2 diabetes mellitus.

    PubMed

    Miyauchi, Shozo; Miyake, Teruki; Miyazaki, Masumi; Eguchi, Toru; Niiya, Tetsuji; Yamamoto, Shin; Senba, Hidenori; Furukawa, Shinya; Matsuura, Bunzo; Hiasa, Yoichi

    2017-12-28

    The association between serum testosterone level and liver fibrosis in patients with non-alcoholic fatty liver disease is unclear. To clarify this association, we investigated the relationship between serum free testosterone concentration and markers of liver fibrosis in men with type 2 diabetes mellitus but no obvious features of alcohol consumption. This retrospective observational cross-sectional study enrolled 248 men with type 2 diabetes mellitus. The FIB-4 index was measured as a marker of liver fibrosis, and multiple linear regression analysis was performed to examine its association with serum free testosterone concentration. In addition, the 7S domain of type IV collagen (IV-7S) was examined in 140 of the 248 patients. The mean free testosterone concentration was 10.6 ± 6.8 pg/mL and the means of the FIB-4 index and IV-7S were 1.64 ± 1.19 and 4.02 ± 1.11 ng/mL, respectively. After adjusting for all relevant variables, serum free testosterone concentrations were inversely associated with both the FIB-4 index and IV-7S (β; -0.28, P < 0.0001, and β; -0.28, P = 0.002, respectively). Measuring serum free testosterone concentrations in men with type 2 diabetes mellitus may help to predict progression to advanced liver disease. Identifying patients at risk may help to prevent the development of cirrhosis and hepatocellular carcinoma.

  9. Conjecture Regarding Posttranslational Modifications to the Arabidopsis Type I Proton-Pumping Pyrophosphatase (AVP1)

    PubMed Central

    Pizzio, Gaston A.; Hirschi, Kendal D.; Gaxiola, Roberto A.

    2017-01-01

    Agbiotechnology uses genetic engineering to improve the output and value of crops. Altering the expression of the plant Type I Proton-pumping Pyrophosphatase (H+-PPase) has already proven to be a useful tool to enhance crop productivity. Despite the effective use of this gene in translational research, information regarding the intracellular localization and functional plasticity of the pump remain largely enigmatic. Using computer modeling several putative phosphorylation, ubiquitination and sumoylation target sites were identified that may regulate Arabidopsis H+-PPase (AVP1- Arabidopsis Vacuolar Proton-pump 1) subcellular trafficking and activity. These putative regulatory sites will direct future research that specifically addresses the partitioning and transport characteristics of this pump. We posit that fine-tuning H+-PPases activity and cellular distribution will facilitate rationale strategies for further genetic improvements in crop productivity. PMID:28955362

  10. Identification and molecular characterization of five putative toxins from the venom gland of the snake Philodryas chamissonis (Serpentes: Dipsadidae).

    PubMed

    Urra, Félix A; Pulgar, Rodrigo; Gutiérrez, Ricardo; Hodar, Christian; Cambiazo, Verónica; Labra, Antonieta

    2015-12-15

    Philodryas chamissonis is a rear-fanged snake endemic to Chile. Its bite produces mild to moderate symptoms with proteolytic and anti-coagulant effects. Presently, the composition of the venom, as well as, the biochemical and structural characteristics of its toxins, remains unknown. In this study, we cloned and reported the first full-length sequences of five toxin-encoding genes from the venom gland of this species: Type III snake venom metalloprotease (SVMP), snake venom serine protease (SVSP), Cysteine-rich secretory protein (CRISP), α and β subunits of C-type lectin-like protein (CLP) and C-type natriuretic peptide (NP). These genes are highly expressed in the venom gland and their sequences exhibited a putative signal peptide, suggesting that these are components of the venom. These putative toxins had different evolutionary relationships with those reported for some front-fanged snakes, being SVMP, SVSP and CRISP of P. chamissonis closely related to the toxins present in Elapidae species, while NP was more related to those of Viperidae species. In addition, analyses suggest that the α and β subunits of CLP of P. chamissonis might have a α-subunit scaffold in common with Viperidae species, whose highly variable C-terminal region might have allowed the diversification in α and β subunits. Our results provide the first molecular description of the toxins possibly implicated in the envenomation of prey and humans by the bite of P. chamissonis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Specific phobia among U.S. adolescents: phenomenology and typology.

    PubMed

    Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

    2012-12-01

    Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13-18 years in the continental United States. Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  12. Irradiation Alters MMP-2/TIMP-2 System and Collagen Type IV Degradation in Brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Won Hee; Warrington, Junie P.; Sonntag, William E.

    Purpose: Blood-brain barrier (BBB) disruption is one of the major consequences of radiation-induced normal tissue injury in the central nervous system. We examined the effects of whole-brain irradiation on matrix metalloproteinases (MMPs)/tissue inhibitors of metalloproteinases (TIMPs) and extracellular matrix (ECM) degradation in the brain. Methods and Materials: Animals received either whole-brain irradiation (a single dose of 10 Gy {gamma}-rays or a fractionated dose of 40 Gy {gamma}-rays, total) or sham-irradiation and were maintained for 4, 8, and 24 h following irradiation. mRNA expression levels of MMPs and TIMPs in the brain were analyzed by real-time reverse transcriptase-polymerase chain reaction (PCR).more » The functional activity of MMPs was measured by in situ zymography, and degradation of ECM was visualized by collagen type IV immunofluorescent staining. Results: A significant increase in mRNA expression levels of MMP-2, MMP-9, and TIMP-1 was observed in irradiated brains compared to that in sham-irradiated controls. In situ zymography revealed a strong gelatinolytic activity in the brain 24 h postirradiation, and the enhanced gelatinolytic activity mediated by irradiation was significantly attenuated in the presence of anti-MMP-2 antibody. A significant reduction in collagen type IV immunoreactivity was also detected in the brain at 24 h after irradiation. In contrast, the levels of collagen type IV were not significantly changed at 4 and 8 h after irradiation compared with the sham-irradiated controls. Conclusions: The present study demonstrates for the first time that radiation induces an imbalance between MMP-2 and TIMP-2 levels and suggests that degradation of collagen type IV, a major ECM component of BBB basement membrane, may have a role in the pathogenesis of brain injury.« less

  13. Multiparametric in situ mRNA hybridization analysis to predict disease recurrence in patients with colon carcinoma.

    PubMed Central

    Kitadai, Y.; Ellis, L. M.; Tucker, S. L.; Greene, G. F.; Bucana, C. D.; Cleary, K. R.; Takahashi, Y.; Tahara, E.; Fidler, I. J.

    1996-01-01

    We examined the expression level of several genes that regulate different steps of metastasis in formalin-fixed, paraffin-embedded archival specimens of primary human colon carcinomas from patients with at least 5 years of follow-up. The expression of epidermal growth factor receptor, basic fibroblast growth factor, type IV collagenase, E-cadherin, and multidrug resistance (mdr-1) was examined by a colorimetric in situ mRNA hybridization technique concentrating on reactivity at the periphery of the neoplasms. The in situ hybridization technique revealed inter- and intratumor heterogeneity for expression of the metastasis-related genes. The expression of basic fibroblast growth factor, collagenase type IV, epidermal growth factor receptor, and mdr-1 mRNA was higher in Dukes's stage D than in Dukes' stage B tumors. Among the 22 Dukes' stage B neoplasms, 5 specimens exhibited a high expression level of epidermal growth factor receptor, basic fibroblast growth factor, and collagenase type IV. Clinical outcome data (5-year follow-up) revealed that all 5 patients with Dukes' stage B tumors developed distant metastasis (recurrent disease), whereas the other 17 patients with Dukes' stage B tumors expressing low levels of the metastasis-related genes were disease-free. Multivariate analysis identified high levels of expression of collagenase type IV and low levels of expression of E-cadherin as independent factors significantly associated with metastasis or recurrent disease. More specifically, metastatic or recurrent disease was associated with a high ratio (> 1.35) of expression of collagenase type IV to E-cadherin (specificity of 95%). Collectively, the data show that multiparametric in situ hybridization analysis for several metastasis-related genes may predict the metastatic potential, and hence the clinical outcome, of individual lymph-node-negative human colon cancers. Images Figure 1 Figure 2 PMID:8909244

  14. Level III and IV Ecoregions of the Continental United States

    EPA Pesticide Factsheets

    Information and downloadable maps and datasets for Level III and IV ecoregions of the continental United States. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  15. Enteral Contrast in the Computed Tomography Diagnosis of Appendicitis

    PubMed Central

    Drake, Frederick Thurston; Alfonso, Rafael; Bhargava, Puneet; Cuevas, Carlos; Dighe, Manjiri K.; Florence, Michael G.; Johnson, Morris G.; Jurkovich, Gregory J.; Steele, Scott R.; Symons, Rebecca Gaston; Thirlby, Richard C.; Flum, David R.

    2014-01-01

    Objective Our goal was to perform a comparative effectiveness study of intravenous (IV)-only versus IV + enteral contrast in computed tomographic (CT) scans performed for patients undergoing appendectomy across a diverse group of hospitals. Background Small randomized trials from tertiary centers suggest that enteral contrast does not improve diagnostic performance of CT for suspected appendicitis, but generalizability has not been demonstrated. Eliminating enteral contrast may improve efficiency, patient comfort, and safety. Methods We analyzed data for adult patients who underwent nonelective appendectomy at 56 hospitals over a 2-year period. Data were obtained directly from patient charts by trained abstractors. Multivariate logistic regression was utilized to adjust for potential confounding. The main outcome measure was concordance between final radiology interpretation and final pathology report. Results A total of 9047 adults underwent appendectomy and 8089 (89.4%) underwent CT, 54.1% of these with IV contrast only and 28.5% with IV + enteral contrast. Pathology findings correlated with radiographic findings in 90.0% of patients who received IV + enteral contrast and 90.4% of patients scanned with IV contrast alone. Hospitals were categorized as rural or urban and by their teaching status. Regardless of hospital type, there was no difference in concordance between IV-only and IV + enteral contrast. After adjusting for age, sex, comorbid conditions, weight, hospital type, and perforation, odds ratio of concordance for IV + enteral contrast versus IV contrast alone was 0.95 (95% CI: 0.72–1.25). Conclusions Enteral contrast does not improve CT evaluation of appendicitis in patients undergoing appendectomy. These broadly generalizable results from a diverse group of hospitals suggest that enteral contrast can be eliminated in CT scans for suspected appendicitis. PMID:24598250

  16. Grazer Impacts on Synechococcus Populations in the Coastal Gulf of Maine; Identifying Specific Microbial Interactions to Understand Bloom Dynamics

    NASA Astrophysics Data System (ADS)

    Countway, P. D.; Poulton, N.; Sieracki, M.; Hoeglund, A.; Anderson, S.; Burns, W. G.

    2016-02-01

    Protistan grazers help to shape the diversity, abundance, and composition of bacterial and phytoplankton communities, yet very little is known about the specific interactions between grazers and their prey. Grazers play key roles in the demise of phytoplankton blooms, with the abundance of grazers often increasing dramatically as prey-species decline. The timing and fate of Synechococcus blooms was investigated over a two-year period in Booth Bay, Maine (USA). The Synechococcus bloom in this region is characterized by several peaks in cell abundance, followed by periods of rapid decline. Two clades of Synechococcus (rpoC1 gene clades I and IV) were detected at our study site, with clade I typically present at higher abundance than clade IV. Modified grazing experiments were conducted at different stages of the Synechococcus bloom in which the natural plankton community was diluted with either 0.45 µm (grazer-free) or 30 kDa (grazer- and virus-free) filtered seawater. In general, the impact of grazers on Synechococcus populations was greater than the impact due to encounters with viruses during 24-hour in situ incubations. Interactions between grazers and Synechococcus were investigated using Fluorescence Activated Cell Sorting (FACS) combined with single-cell genomics to identify specific associations between sorted-grazers and their prey. Single-cell sequencing revealed a diverse array of heterotrophic protists on sampling dates that occurred after periods of rapid decrease in the abundance of Synechococcus. Cultures of Synechococcus were added to natural plankton communities to stimulate grazers, which were subsequently cell-sorted in bulk mode and sequenced. These experiments revealed similar taxonomic affiliations of putative grazer types (e.g., Cercozoa) that responded to the presence of Synechococcus prey. Protistan grazers appear to exert a strong degree of control on the abundance and duration of the annual Synechococcus bloom in the coastal Gulf of Maine.

  17. Genomic analyses of bacterial porin-cytochrome gene clusters

    DOE PAGES

    Shi, Liang; Fredrickson, James K.; Zachara, John M.

    2014-11-26

    In this study, the porin-cytochrome (Pcc) protein complex is responsible for trans-outer membrane electron transfer during extracellular reduction of Fe(III) by the dissimilatory metal-reducing bacterium Geobacter sulfurreducens PCA. The identified and characterized Pcc complex of G. sulfurreducens PCA consists of a porin-like outer-membrane protein, a periplasmic 8-heme c type cytochrome (c-Cyt) and an outer-membrane 12-heme c-Cyt, and the genes encoding the Pcc proteins are clustered in the same regions of genome (i.e., the pcc gene clusters) of G. sulfurreducens PCA. A survey of additionally microbial genomes has identified the pcc gene clusters in all sequenced Geobacter spp. and other bacteriamore » from six different phyla, including Anaeromyxobacter dehalogenans 2CP-1, A. dehalogenans 2CP-C, Anaeromyxobacter sp. K, Candidatus Kuenenia stuttgartiensis, Denitrovibrio acetiphilus DSM 12809, Desulfurispirillum indicum S5, Desulfurivibrio alkaliphilus AHT2, Desulfurobacterium thermolithotrophum DSM 11699, Desulfuromonas acetoxidans DSM 684, Ignavibacterium album JCM 16511, and Thermovibrio ammonificans HB-1. The numbers of genes in the pcc gene clusters vary, ranging from two to nine. Similar to the metal-reducing (Mtr) gene clusters of other Fe(III)-reducing bacteria, such as Shewanella spp., additional genes that encode putative c-Cyts with predicted cellular localizations at the cytoplasmic membrane, periplasm and outer membrane often associate with the pcc gene clusters. This suggests that the Pcc-associated c-Cyts may be part of the pathways for extracellular electron transfer reactions. The presence of pcc gene clusters in the microorganisms that do not reduce solid-phase Fe(III) and Mn(IV) oxides, such as D. alkaliphilus AHT2 and I. album JCM 16511, also suggests that some of the pcc gene clusters may be involved in extracellular electron transfer reactions with the substrates other than Fe(III) and Mn(IV) oxides.« less

  18. The type IV pilin of Burkholderia mallei is highly immunogenic but fails to protect against lethal aerosol challenge in a murine model.

    PubMed

    Fernandes, Paula J; Guo, Qin; Waag, David M; Donnenberg, Michael S

    2007-06-01

    Burkholderia mallei is the cause of glanders and a proven biological weapon. We identified and purified the type IV pilin protein of this organism to study its potential as a subunit vaccine. We found that purified pilin was highly immunogenic. Furthermore, mice infected via sublethal aerosol challenge developed significant increases in titers of antibody against the pilin, suggesting that it is expressed in vivo. Nevertheless, we found no evidence that high-titer antipilin antisera provided passive protection against a sublethal or lethal aerosol challenge and no evidence of protection afforded by active immunization with purified pilin. These results contrast with the utility of type IV pilin subunit vaccines against other infectious diseases and highlight the need for further efforts to identify protective responses against this pathogen.

  19. Resolution of Large Azygos Vein Aneurysm Following Stent-Graft Shunt Placement in a Patient with Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Souza, Estelle S.; Williams, David M.; Deeb, G.M.

    2006-10-15

    Ehlers-Danlos syndrome (EDS) type IV is a rare connective tissue disorder associated with thin-walled, friable arteries and veins predisposing patients to aneurysm formation, dissection, fistula formation, and vessel rupture. Azygos vein aneurysm is an extremely rare condition which has not been reported in association with EDS in the literature. We present a patient with EDS type IV and interrupted inferior vena cava (IVC) with azygos continuation who developed an azygos vein aneurysm. In order to decrease flow through the azygos vein and reduce the risk of aneurysm rupture, a stent-graft shunt was created from the right hepatic vein to themore » azygos vein via a transhepatic, retroperitoneal route. At 6 month follow-up the shunt was open and the azygos vein aneurysm had resolved.« less

  20. Differential recognition of geometric isomers by the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae): Evidence for only three essential components in aggregation pheromone.

    PubMed

    Dickens, J C; Prestwich, G D

    1989-02-01

    For two decades, the aggregation pheromone of the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae), was thought to consist of four compounds: I [(+)-(Z)-2-isopropenyl-1-methylcyclobutane ethanol]; II [(Z)-3,3-dimethyl-Δ(I,β)-cyclohexane ethanol]; III [(Z)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde); and IV [(E)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde). Evidence is presented from behavioral and electrophysiological studies to show that only three of these components, I, II, and IV, are essential for attraction. Competitive field tests, in which each possible three-component blend was tested against the four-component mixture, demonstrated that omission of I, II. or IV resulted in decreased trap captures (P < 0.01). Trap captures by these blends lacking I, II, or IV resembled those by the hexane solvent alone in a similar experiment. However, omission of III did not significantly alter field attractiveness of the blend. Dosage-response curves constructed from electroantennogram responses of both males and females to serial dilutions of III, IV, and a 50∶50 mixture of the geometric isomers III and IV showed both sexes to be 10- to 100-fold more sensitive to IV than III. Data from the electrophysiological studies were consistent with a single acceptor type for the (E)-cyclohexylidene aldehyde, IV, for males, and possibly one or two acceptor types for III and IV for females. Possible roles for the (Z)-cyclohexylidene aldehyde, III, and implications for the pheromonal attractant currently used in boll weevil eradication/suppression programs are discussed.

  1. Identification of a c-Type Cytochrome Specific for Manganese Dioxide (MnO2) Reduction in Anaeromyxobacter dehalogenans Strain 2CP-C

    NASA Astrophysics Data System (ADS)

    Pfiffner, S. M.; Nissen, S.; Liu, X.; Chourey, K.; Vishnivetskaya, T. A.; Hettich, R.; Loeffler, F.

    2014-12-01

    Anaeromyxobacter dehalogenans is a metabolically versatile Deltaproteobacterium and conserves energy from the reduction of various electron acceptors, including insoluble MnO2 and ferric oxides/oxyhydroxides (FeOOH). The goal of this study was to identify c-type cytochromes involved in electron transfer to MnO2. The characterization of deletion mutants has revealed a number of c-type cytochromes involved in electron transfer to solid metal oxides in Shewanella spp. and Geobacter spp; however, a genetic system for Anaeromyxobacter is not available. The A. dehalogenans str. 2CP-C genome encodes 68 putative c-type cytochromes, which all lack functional assignments. To identify c-type cytochromes involved in electron transfer to solid MnO2, protein expression profiles of A. dehalogenans str. 2CP-C cells grown with acetate as electron donor and MnO2, ferric citrate, FeOOH, nitrate or fumarate as electron acceptors were compared. Whole cell proteomes were analyzed after trypsin proteolysis using liquid chromatography-tandem mass spectrometry (LC-MS/MS). Distinct c-type cytochrome expression patterns were observed with cells grown with different electron acceptors. A. dehalogenans str. 2CP-C grown with MnO2 expressed 25 out of the 68 c-type cytochromes encoded on the genome. The c-type cytochrome Adeh_1278 was only expressed in strain 2CP-C grown with MnO2. Reverse transcription PCR confirmed that the Adeh_1278 gene was transcribed in MnO2-grown cells but not in cells grown with other terminal electron acceptors. The expression of the Adeh_1278 gene correlated with Mn(IV) reduction activity. Adeh_1278 has three heme binding motifs and is predicted to be located in the periplasm. The identification of Adeh_1278 as a protein uniquely expressed when MnO2 serves as electron acceptor suggests its utility as a biomarker for MnO2 reduction. This example demonstrates the value of the LC-MS/MS approach for identifying specific proteins of interest and making functional assignments to proteins, including c-type cytochromes that have not been characterized. The distinctive expression of c-type cytochromes in response to growth with different terminal electron acceptors offers opportunities for functional (i.e., activity) in situ monitoring using metaproteomics or transcript-targeted approaches.

  2. Predominance of Three Closely Related Methicillin-Resistant Staphylococcus aureus Clones Carrying a Unique ccrC-Positive SCCmec type III and the Emergence of spa t304 and t690 SCCmec type IV pvl+ MRSA Isolates in Kinta Valley, Malaysia.

    PubMed

    Ho, Wai-Yew; Choo, Quok-Cheong; Chew, Choy-Hoong

    2017-03-01

    We investigated the epidemiology and clonality of 175 nonrepetitive methicillin-resistant Staphylococcus aureus (MRSA) isolates from clinical specimens collected between 2011 and 2012 in Kinta Valley in Malaysia. Molecular tools such as polymerase chain reaction, pulsed-field gel electrophoresis, and staphylococcal protein A (spa) typing were used. Our study revealed the predominance of three closely related ermA + SCCmec type III pulsotypes belonging to spa type t037 (Brazilian-Hungarian clone), which were deficient in the locus F, but positive for the ccrC gene in majority (65.7%) of the MRSA infections in this region. The first evidence of SCCmec type II MRSA in the country, belonging to spa type t2460, was also noted. Although the carriage of pvl gene was uncommon (8.6%) and mostly confined to either SCCmec type IV or SCCmec type V isolates, most of these isolates belonged to spa types t345 or t657, which are associated with the Bengal-Bay CA-MRSA clone. Interestingly, spa t304 and t690 SCCmec type IV pvl + were also detected among the MRSA isolates. Data from this study show the rise of uncommon clones among MRSA isolates in Malaysia.

  3. Multidisciplinary Treatment of Severe Osteogenesis Imperfecta: Functional Outcomes at Skeletal Maturity.

    PubMed

    Montpetit, Kathleen; Palomo, Telma; Glorieux, Francis H; Fassier, François; Rauch, Frank

    2015-10-01

    To determine the functional outcomes associated with long-term multidisciplinary treatment, intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation in children with severe osteogenesis imperfecta (OI) (diagnosed clinically as OI types III or IV). Retrospective study where outcomes were measured prospectively. Pediatric orthopedic hospital. Adolescents (N=41; age range, 15-21y) with severe OI (OI type III: n=17; OI type IV: n=24) who had started therapy before the age of 6 years, had received treatment for at least 10 years, and had achieved final height. Intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation. Pediatric Evaluation of Disability Inventory. At the time of the last available follow-up examination, none of the individuals diagnosed with OI type III (most severely affected group) was able to ambulate without ambulation aids, whereas 20 (83%) patients with OI type IV were able to ambulate without ambulation aids. Regarding self-care, we specifically assessed 8 skills that we deemed essential for living independently (grooming; dressing; toileting; bed, chair, toilet, tub, and car transfers). Only 6 (35%) of the youths with OI type III were able to complete all 8 items, whereas 23 (96%) individuals with OI type IV managed to perform all tasks. Teens with OI type III often needed assistance for the transfer to toilet, tub, and car and for personal hygiene and clothing management associated with toileting, usually because of limitations in upper-extremity function. These observations suggest that further improvements in the functional status of the most severely affected children with OI are contingent on advances in the clinical management of upper-extremity issues. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  4. Multiple blocks in the engagement of oxidative phosphorylation in putative ovarian cancer stem cells: implication for maintenance therapy with glycolysis inhibitors.

    PubMed

    Alvero, Ayesha B; Montagna, Michele K; Sumi, Natalia J; Joo, Won Duk; Graham, Emma; Mor, Gil

    2014-09-30

    Survival rate in ovarian cancer has not improved since chemotherapy was introduced a few decades ago. The dismal prognosis is mostly due to disease recurrence where majority of the patients succumb to the disease. The demonstration that tumors are comprised of subfractions of cancer cells displaying heterogeneity in stemness potential, chemoresistance, and tumor repair capacity suggests that recurrence may be driven by the chemoresistant cancer stem cells. Thus to improve patient survival, novel therapies should eradicate this cancer cell population. We show that in contrast to the more differentiated ovarian cancer cells, the putative CD44+/MyD88+ ovarian cancer stem cells express lower levels of pyruvate dehydrogenase, Cox-I, Cox-II, and Cox-IV, and higher levels of UCP2. Together, this molecular phenotype establishes a bioenergetic profile that prefers the use of glycolysis over oxidative phosphorylation to generate ATP. This bioenergetic profile is conserved in vivo and therefore a maintenance regimen of 2-deoxyglucose administered after Paclitaxel treatment is able to delay the progression of recurrent tumors and decrease tumor burden in mice. Our findings strongly suggest the value of maintenance with glycolysis inhibitors with the goal of improving survival in ovarian cancer patients.

  5. Transposon variation by order during allopolyploidisation between Brassica oleracea and Brassica rapa.

    PubMed

    An, Z; Tang, Z; Ma, B; Mason, A S; Guo, Y; Yin, J; Gao, C; Wei, L; Li, J; Fu, D

    2014-07-01

    Although many studies have shown that transposable element (TE) activation is induced by hybridisation and polyploidisation in plants, much less is known on how different types of TE respond to hybridisation, and the impact of TE-associated sequences on gene function. We investigated the frequency and regularity of putative transposon activation for different types of TE, and determined the impact of TE-associated sequence variation on the genome during allopolyploidisation. We designed different types of TE primers and adopted the Inter-Retrotransposon Amplified Polymorphism (IRAP) method to detect variation in TE-associated sequences during the process of allopolyploidisation between Brassica rapa (AA) and Brassica oleracea (CC), and in successive generations of self-pollinated progeny. In addition, fragments with TE insertions were used to perform Blast2GO analysis to characterise the putative functions of the fragments with TE insertions. Ninety-two primers amplifying 548 loci were used to detect variation in sequences associated with four different orders of TE sequences. TEs could be classed in ascending frequency into LTR-REs, TIRs, LINEs, SINEs and unknown TEs. The frequency of novel variation (putative activation) detected for the four orders of TEs was highest from the F1 to F2 generations, and lowest from the F2 to F3 generations. Functional annotation of sequences with TE insertions showed that genes with TE insertions were mainly involved in metabolic processes and binding, and preferentially functioned in organelles. TE variation in our study severely disturbed the genetic compositions of the different generations, resulting in inconsistencies in genetic clustering. Different types of TE showed different patterns of variation during the process of allopolyploidisation. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

  6. Fatal Peritoneal Bleeding Following Embolization of a Carotid-Cavernous Fistula in Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Usinskiene, Jurgita; Mazighi, Mikael; Bisdorff, Annouk

    2006-12-15

    We report the case of a 25-year-old woman treated for a spontaneous carotid-cavernous fistula in a context of Ehlers-Danlos syndrome type IV. Embolization with a transvenous approach was achieved without complications; however, the patient died 72 hr later of massive intraperitoneal bleeding. At autopsy, no lesion of the digestive arteries was identified. Possible causes of this bleeding are discussed.

  7. Structure and function of the adhesive type IV pilus of Sulfolobus acidocaldarius

    PubMed Central

    Henche, Anna-Lena; Ghosh, Abhrajyoti; Yu, Xiong; Jeske, Torsten; Egelman, Edward; Albers, Sonja-Verena

    2014-01-01

    Archaea display a variety of type IV pili on their surface and employ them in different physiological functions. In the crenarchaeon Sulfolobus acidocaldarius the most abundant surface structure is the aap pilus (archaeal adhesive pilus). The construction of in frame deletions of the aap genes revealed that all the five genes (aapA, aapX, aapE, aapF, aapB) are indispensible for assembly of the pilus and an impact on surface motility and biofilm formation was observed. Our analyses revealed that there exists a regulatory cross-talk between the expression of aap genes and archaella (formerly archaeal flagella) genes during different growth phases. The structure of the aap pilus is entirely different from the known bacterial type IV pili as well as other archaeal type IV pili. An aap pilus displayed 3 stranded helices where there is a rotation per subunit of ~ 138° and a rise per subunit of ~ 5.7 Å. The filaments have a diameter of ~ 110 Å and the resolution was judged to be ~ 9 Å. We concluded that small changes in sequence might be amplified by large changes in higher-order packing. Our finding of an extraordinary stability of aap-pili possibly represents an adaptation to harsh environments that S. acidocaldarius encounters. PMID:23078543

  8. Alteration of Escherichia coli topoisomerase IV to novobiocin resistance.

    PubMed

    Hardy, Christine D; Cozzarelli, Nicholas R

    2003-03-01

    DNA gyrase and topoisomerase IV (topo IV) are the two essential type II topoisomerases of Escherichia coli. Gyrase is responsible for maintaining negative supercoiling of the bacterial chromosome, whereas topo IV's primary role is in disentangling daughter chromosomes following DNA replication. Coumarins, such as novobiocin, are wide-spectrum antimicrobial agents that primarily interfere with DNA gyrase. In this work we designed an alteration in the ParE subunit of topo IV at a site homologous to that which confers coumarin resistance in gyrase. This parE mutation renders the encoded topo IV approximately 40-fold resistant to inhibition by novobiocin in vitro and imparts a similar resistance to inhibition of topo IV-mediated relaxation of supercoiled DNA in vivo. We conclude that topo IV is a secondary target of novobiocin and that it is very likely to be inhibited by the same mechanism as DNA gyrase.

  9. First Report of cfr-Carrying Plasmids in the Pandemic Sequence Type 22 Methicillin-Resistant Staphylococcus aureus Staphylococcal Cassette Chromosome mec Type IV Clone

    PubMed Central

    Shore, Anna C.; Lazaris, Alexandros; Kinnevey, Peter M.; Brennan, Orla M.; Brennan, Gráinne I.; O'Connell, Brian; Feßler, Andrea T.; Schwarz, Stefan

    2016-01-01

    Linezolid is often the drug of last resort for serious methicillin-resistant Staphylococcus aureus (MRSA) infections. Linezolid resistance is mediated by mutations in 23S rRNA and genes for ribosomal proteins; cfr, encoding phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A (PhLOPSA) resistance; its homologue cfr(B); or optrA, conferring oxazolidinone and phenicol resistance. Linezolid resistance is rare in S. aureus, and cfr is even rarer. This study investigated the clonality and linezolid resistance mechanisms of two MRSA isolates from patients in separate Irish hospitals. Isolates were subjected to cfr PCR, PhLOPSA susceptibility testing, 23S rRNA PCR and sequencing, DNA microarray profiling, spa typing, pulsed-field gel electrophoresis (PFGE), plasmid curing, and conjugative transfer. Whole-genome sequencing was used for single-nucleotide variant (SNV) analysis, multilocus sequence typing, L protein mutation identification, cfr plasmid sequence analysis, and optrA and cfr(B) detection. Isolates M12/0145 and M13/0401 exhibited linezolid MICs of 64 and 16 mg/liter, respectively, and harbored identical 23S rRNA and L22 mutations, but M12/0145 exhibited the mutation in 2/6 23S rRNA alleles, compared to 1/5 in M13/0401. Both isolates were sequence type 22 MRSA staphylococcal cassette chromosome mec type IV (ST22-MRSA-IV)/spa type t032 isolates, harbored cfr, exhibited the PhLOPSA phenotype, and lacked optrA and cfr(B). They differed by five PFGE bands and 603 SNVs. Isolate M12/0145 harbored cfr and fexA on a 41-kb conjugative pSCFS3-type plasmid, whereas M13/0401 harbored cfr and lsa(B) on a novel 27-kb plasmid. This is the first report of cfr in the pandemic ST22-MRSA-IV clone. Different cfr plasmids and mutations associated with linezolid resistance in genotypically distinct ST22-MRSA-IV isolates highlight that prudent management of linezolid use is essential. PMID:26953212

  10. Lesch typology and temperament in opioid dependence: a cross-sectional study.

    PubMed

    Salem, B A; Vyssoki, B; Lesch, O M; Erfurth, A

    2014-08-01

    The first aim of this study is to investigate the impact of different temperaments in opiate dependency patients. The second aim of this study is to define therapy relevant subgroups in opiate addiction for further basic clinical research and therapy. In the time period from September to November 2010, 101 patients (72 males and 29 females) which fulfilled the diagnosis of opiate dependency according to DSM-IV-TR were recruited consecutively. All patients were in treatment at the Oum El Nour rehabilitation center/Lebanon (Inpatient and Outpatient groups). Lesch Alcoholism Typology modified for assessment of opiate addicts, and the briefTEMPS-M, Arabic version were used. The organic Type IV group was the most prevalent (48.5%) among the sample followed by the Affective Type III group (41.6%) and the minority represented the two other types (I & II). The organic Type IV group represented the major type in the cyclothymic and anxious temperament. In the contrary the other two groups (I & II) were the minority among the cyclothymics. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis.

    PubMed

    Luvan, M; Kanthan, S R; Roshan, G; Saw, A

    2015-11-01

    Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy.

  12. Enterococcus faecium biofilm formation: identification of major autolysin AtlAEfm, associated Acm surface localization, and AtlAEfm-independent extracellular DNA Release.

    PubMed

    Paganelli, Fernanda L; Willems, Rob J L; Jansen, Pamela; Hendrickx, Antoni; Zhang, Xinglin; Bonten, Marc J M; Leavis, Helen L

    2013-04-16

    Enterococcus faecium is an important multidrug-resistant nosocomial pathogen causing biofilm-mediated infections in patients with medical devices. Insight into E. faecium biofilm pathogenesis is pivotal for the development of new strategies to prevent and treat these infections. In several bacteria, a major autolysin is essential for extracellular DNA (eDNA) release in the biofilm matrix, contributing to biofilm attachment and stability. In this study, we identified and functionally characterized the major autolysin of E. faecium E1162 by a bioinformatic genome screen followed by insertional gene disruption of six putative autolysin genes. Insertional inactivation of locus tag EfmE1162_2692 resulted in resistance to lysis, reduced eDNA release, deficient cell attachment, decreased biofilm, decreased cell wall hydrolysis, and significant chaining compared to that of the wild type. Therefore, locus tag EfmE1162_2692 was considered the major autolysin in E. faecium and renamed atlAEfm. In addition, AtlAEfm was implicated in cell surface exposure of Acm, a virulence factor in E. faecium, and thereby facilitates binding to collagen types I and IV. This is a novel feature of enterococcal autolysins not described previously. Furthermore, we identified (and localized) autolysin-independent DNA release in E. faecium that contributes to cell-cell interactions in the atlAEfm mutant and is important for cell separation. In conclusion, AtlAEfm is the major autolysin in E. faecium and contributes to biofilm stability and Acm localization, making AtlAEfm a promising target for treatment of E. faecium biofilm-mediated infections. IMPORTANCE Nosocomial infections caused by Enterococcus faecium have rapidly increased, and treatment options have become more limited. This is due not only to increasing resistance to antibiotics but also to biofilm-associated infections. DNA is released in biofilm matrix via cell lysis, caused by autolysin, and acts as a matrix stabilizer. In this study, we identified and characterized the major autolysin in E. faecium, which we designated AtlAEfm. atlAEfm disruption resulted in resistance to lysis, reduced extracellular DNA (eDNA), deficient cell attachment, decreased biofilm, decreased cell wall hydrolysis, and chaining. Furthermore, AtlAEfm is associated with Acm cell surface localization, resulting in less binding to collagen types I and IV in the atlAEfm mutant. We also identified AtlAEfm-independent eDNA release that contributes to cell-cell interactions in the atlAEfm mutant. These findings indicate that AtlAEfm is important in biofilm and collagen binding in E. faecium, making AtlAEfm a promising target for treatment of E. faecium infections.

  13. A unifying concept: pancreatic ductal anatomy both predicts and determines the major complications resulting from pancreatitis.

    PubMed

    Nealon, William H; Bhutani, Manoop; Riall, Taylor S; Raju, Gottumukkala; Ozkan, Orhan; Neilan, Ryan

    2009-05-01

    Precepts about acute pancreatitis, necrotizing pancreatitis, and pancreatic fluid collections or pseudocyst rarely include the impact of pancreatic ductal injuries on their natural course and outcomes. We previously examined and established a system to categorize ductal changes. We sought a unifying concept that may predict course and direct therapies in these complex patients. We use our system categorizing ductal changes in pseudocyst of the pancreas and severe necrotizing pancreatitis (type I, normal duct; type II, duct stricture; type III, duct occlusion or "disconnected duct"; and type IV, chronic pancreatitis). From 1985 to 2006, a policy was implemented of routine imaging (cross-sectional, endoscopic retrograde cholangiopancreatography, or magnetic resonance cholangiopancreatography). Clinical outcomes were measured. Among 563 patients with pseudocyst, 142 resolved spontaneously (87% of type I, 5% of type II, and no type III, and 3% of type IV). Percutaneous drainage was successful in 83% of type I, 49% of type II, and no type III or type IV. Among 174 patients with severe acute pancreatitis percutaneous drainage was successful in 64% of type I, 38% of type II, and no type III. Operative debridement was required in 39% of type I and 83% and 85% of types II and III, respectively. Persistent fistula after debridement occurred in 27%, 54%, and 85% of types I, II, and III ducts, respectively. Late complications correlated with duct injury. Pancreatic ductal changes predict spontaneous resolution, success of nonoperative measures, and direct therapies in pseudocyst. Ductal changes also predict patients with necrotizing pancreatitis who are most likely to have immediate and delayed complications.

  14. Niche differentiation of bacterial communities at a millimeter scale in Shark Bay microbial mats

    NASA Astrophysics Data System (ADS)

    Wong, Hon Lun; Smith, Daniela-Lee; Visscher, Pieter T.; Burns, Brendan P.

    2015-10-01

    Modern microbial mats can provide key insights into early Earth ecosystems, and Shark Bay, Australia, holds one of the best examples of these systems. Identifying the spatial distribution of microorganisms with mat depth facilitates a greater understanding of specific niches and potentially novel microbial interactions. High throughput sequencing coupled with elemental analyses and biogeochemical measurements of two distinct mat types (smooth and pustular) at a millimeter scale were undertaken in the present study. A total of 8,263,982 16S rRNA gene sequences were obtained, which were affiliated to 58 bacterial and candidate phyla. The surface of both mats were dominated by Cyanobacteria, accompanied with known or putative members of Alphaproteobacteria and Bacteroidetes. The deeper anoxic layers of smooth mats were dominated by Chloroflexi, while Alphaproteobacteria dominated the lower layers of pustular mats. In situ microelectrode measurements revealed smooth mats have a steeper profile of O2 and H2S concentrations, as well as higher oxygen production, consumption, and sulfate reduction rates. Specific elements (Mo, Mg, Mn, Fe, V, P) could be correlated with specific mat types and putative phylogenetic groups. Models are proposed for these systems suggesting putative surface anoxic niches, differential nitrogen fixing niches, and those coupled with methane metabolism.

  15. Comparative transcriptome analysis links distinct peritoneal tumor spread types, miliary and non-miliary, with putative origin, tubes and ovaries, in high grade serous ovarian cancer.

    PubMed

    Auer, Katharina; Bachmayr-Heyda, Anna; Aust, Stefanie; Grunt, Thomas W; Pils, Dietmar

    2017-03-01

    High grade serous ovarian cancer (HGSOC) is characterized by extensive local, i.e. peritoneal, tumor spread, manifested in two different clinical presentations, miliary (many millet sized peritoneal implants) and non-miliary (few large exophytically growing peritoneal nodes), and an overall unfavorable outcome. HGSOC is thought to arise from fallopian tube secretory epithelial cells, via so called serous tubal intraepithelial carcinomas (STICs) but an ovarian origin was never ruled out for at least some cases. Comparative transcriptome analyses of isolated tumor cells from fresh HGSOC tissues and (immortalized) ovarian surface epithelial and fallopian tube secretory epithelial cell lines revealed a close relation between putative origin and tumor spread characteristic, i.e. miliary from tubes and non-miliary from ovaries. The latter were characterized by more mesenchymal cell characteristics, more adaptive tumor immune infiltration, and a favorable overall survival. Several molecular sub-classification systems (Crijns' overall survival signature, Yoshihara's subclasses, and a collagen-remodeling signature) seem to already indicate origin. Putative origin alone is a significant independent predictor for HGSOC outcome, validated in independent patient cohorts. Characteristics of both spread types could guide development of new targeted therapeutics, which are urgently needed. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  16. [Outcome of operative treatment for supination-external rotation Lauge-Hansen stage IV ankle fractures].

    PubMed

    Kołodziej, Łukasz; Boczar, Tomasz; Bohatyrewicz, Andrzej; Zietek, Paweł

    2010-01-01

    Ankle fractures are among the most common musculoskeletal injures. These fractures occur with an overall age- and sex-adjusted incidence rate around 180 per 100 000 person-years. The most frequent mechanism is considered to be supination-external rotation (60 to 80% of all ankle fractures) consisting of pathologic external rotation of the foot initially placed in some degree of supination. According to Lauge-Hansen classification, ankle joint structures are damaged in a sequence where the final, stage IV injuries, represents transverse fracture of the medial malleolus or its equivalent-rupture of the deltoid ligament. The aim of this study is to compare the results of two subtypes of supination-external rotation stage IV fractures. 43 patients treated surgically in 2006 to 2007 at Authors institution because of stage IV supination-external rotation ankle fracture were submitted to retrospective analysis. There were 25 patients with bimalleolar fracture (type 1) and in 18 patients with lateral malleolar fracture with accompanying rupture of the deltoid ligament (type 2). The mean age was 46 years (from 20 to 82 years). Average follow up period was 37 months (from 24 to 46 months). For the evaluation of treatment AOFAS hind-foot score (American Orthopedic Foot and Ankle Society) was used. The mean AOFAS score scale for Type 1 fractures was 85 points and for type 2 was significantly higher and amounted to 91 points (p < 0.05). Supination-external rotation stage IV ankle fractures with medial malleolar fracture, requires the implementation of additional diagnostic and therapeutic strategies and procedures in order to improve the outcome of results.

  17. Adult presentation of Bartter syndrome type IV with erythrocytosis.

    PubMed

    Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

    2015-01-01

    Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis.

  18. Audiological findings in children with mucopolysaccharidoses type i-iv.

    PubMed

    Vargas-Gamarra, María F; de Paula-Vernetta, Carlos; Vitoria Miñana, Isidro; Ibañez-Alcañiz, Isabel; Cavallé-Garrido, Laura; Alamar-Velazquez, Agustín

    The aim of our study is to reflect hearing impairment of 23children diagnosed with mucopolysaccharidosis (MPS) typeI, II, III and IV. Retrospective study of the clinical, audiological and treatment (medical vs surgical) findings of 23children diagnosed with MPS typeI, II, III or IV followed at a Tertiary Referral Hospital between 1997 and 2015. Six cases of MPSI, 8 of MPSII, 4 of MPSIII and 5 of MPSIV were reviewed. 71.2% of patients had secretory otitis media (SOM) and 54% of patients had some type of hearing loss (HL). The behaviour of hearing loss was variable in each of the subgroups of MPS, finding greater involvement and variability in typesI and II. Children with MPS have a high risk of hearing loss. A significant percentage of transmissive HL progressing to mixed or sensorineural HL was observed. This was more common in typesI and II. Periodic follow up of these patients is mandatory because of hearing impairment and consequences for their development and quality of life. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. All rights reserved.

  19. PRGdb: a bioinformatics platform for plant resistance gene analysis

    PubMed Central

    Sanseverino, Walter; Roma, Guglielmo; De Simone, Marco; Faino, Luigi; Melito, Sara; Stupka, Elia; Frusciante, Luigi; Ercolano, Maria Raffaella

    2010-01-01

    PRGdb is a web accessible open-source (http://www.prgdb.org) database that represents the first bioinformatic resource providing a comprehensive overview of resistance genes (R-genes) in plants. PRGdb holds more than 16 000 known and putative R-genes belonging to 192 plant species challenged by 115 different pathogens and linked with useful biological information. The complete database includes a set of 73 manually curated reference R-genes, 6308 putative R-genes collected from NCBI and 10463 computationally predicted putative R-genes. Thanks to a user-friendly interface, data can be examined using different query tools. A home-made prediction pipeline called Disease Resistance Analysis and Gene Orthology (DRAGO), based on reference R-gene sequence data, was developed to search for plant resistance genes in public datasets such as Unigene and Genbank. New putative R-gene classes containing unknown domain combinations were discovered and characterized. The development of the PRG platform represents an important starting point to conduct various experimental tasks. The inferred cross-link between genomic and phenotypic information allows access to a large body of information to find answers to several biological questions. The database structure also permits easy integration with other data types and opens up prospects for future implementations. PMID:19906694

  20. Tentacle Transcriptome and Venom Proteome of the Pacific Sea Nettle, Chrysaora fuscescens (Cnidaria: Scyphozoa).

    PubMed

    Ponce, Dalia; Brinkman, Diane L; Potriquet, Jeremy; Mulvenna, Jason

    2016-04-05

    Jellyfish venoms are rich sources of toxins designed to capture prey or deter predators, but they can also elicit harmful effects in humans. In this study, an integrated transcriptomic and proteomic approach was used to identify putative toxins and their potential role in the venom of the scyphozoan jellyfish Chrysaora fuscescens. A de novo tentacle transcriptome, containing more than 23,000 contigs, was constructed and used in proteomic analysis of C. fuscescens venom to identify potential toxins. From a total of 163 proteins identified in the venom proteome, 27 were classified as putative toxins and grouped into six protein families: proteinases, venom allergens, C-type lectins, pore-forming toxins, glycoside hydrolases and enzyme inhibitors. Other putative toxins identified in the transcriptome, but not the proteome, included additional proteinases as well as lipases and deoxyribonucleases. Sequence analysis also revealed the presence of ShKT domains in two putative venom proteins from the proteome and an additional 15 from the transcriptome, suggesting potential ion channel blockade or modulatory activities. Comparison of these potential toxins to those from other cnidarians provided insight into their possible roles in C. fuscescens venom and an overview of the diversity of potential toxin families in cnidarian venoms.

  1. The Caenorhabditis elegans mucolipin-like gene cup-5 is essential for viability and regulates lysosomes in multiple cell types.

    PubMed

    Hersh, Bradley M; Hartwieg, Erika; Horvitz, H Robert

    2002-04-02

    The misregulation of programmed cell death, or apoptosis, contributes to the pathogenesis of many diseases. We used Nomarski microscopy to screen for mutants containing refractile cell corpses in a C. elegans strain in which all programmed cell death is blocked and such corpses are absent. We isolated a mutant strain that accumulates refractile bodies resembling irregular cell corpses. We rescued this mutant phenotype with the C. elegans mucolipidosis type IV (ML-IV) homolog, the recently identified cup-5 (coelomocyte-uptake defective) gene. ML-IV is a human autosomal recessive lysosomal storage disease characterized by psychomotor retardation and ophthalmological abnormalities. Our null mutations in cup-5 cause maternal-effect lethality. In addition, cup-5 mutants contain excess lysosomes in many and possibly all cell types and contain lamellar structures similar to those observed in ML-IV cell lines. The human ML-IV gene is capable of rescuing both the maternal-effect lethality and the lysosome-accumulation abnormality of cup-5 mutants. cup-5 mutants seem to contain excess apoptotic cells as detected by staining with terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling. We suggest that the increased apoptosis seen in cup-5 mutants is a secondary consequence of the lysosomal defect, and that abnormalities in apoptosis may be associated with human lysosomal storage disorders.

  2. Risk evaluation for in-vehicle sign information.

    DOT National Transportation Integrated Search

    2016-05-01

    The goal of the study was to examine the influence of in-vehicle signing (IVS) pertaining to four types of changing : driving conditions and determine the utility and potential safety costs associated with the IVS information. Signage : displayed on ...

  3. Nonstatic radiating spheres in general relativity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krori, K.D.; Borgohain, P.; Sarma, R.

    1985-02-15

    The method of Herrera, Jimenez, and Ruggeri of obtaining nonstatic solutions of Einstein's field equations to study the evolution of stellar bodies is applied to obtain two models of nonstatic radiating spheres from two well-known static solutions of field equations, viz., Tolman's solutions IV and V. Whereas Tolman's type-IV model is found to be contracting for the period under investigation, Tolman's type-V model shows a bounce after attaining a minimum radius.

  4. Retrobulbar Hematoma from Warfarin Toxicity and the Limitations of Bedside Ocular Sonography

    DTIC Science & Technology

    2010-05-01

    Nontraumatic RBH occurs rarely and has been associated with arteriovenous malformations,1 following thrombolysis,2 Type IV Ehlers - Danlos Syndrome ,3...infarction. N Engl J Med. 2007; 357:1448-9. 3. Shaikh S, Braun M, Eliason J. Spontaneous retrobulbar hemorrhage in type IV Ehlers - Danlos syndrome . Am J...compartment syndrome . DISCUSSION We believe this is the first case report of a nontraumatic RBH associated with warfarin toxicity. Our patient also had

  5. Electro-mechanical coupling of semiconductor film grown on stainless steel by oxidation

    NASA Astrophysics Data System (ADS)

    Lin, M. C.; Wang, G.; Guo, L. Q.; Qiao, L. J.; Volinsky, Alex A.

    2013-09-01

    Electro-mechanical coupling phenomenon in oxidation film on stainless steel has been discovered by using current-sensing atomic force microscopy, along with the I-V curves measurements. The oxidation films exhibit either ohmic, n-type, or p-type semiconductor properties, according to the obtained I-V curves. This technique allows characterizing oxidation films with high spatial resolution. Semiconductor properties of oxidation films must be considered as additional stress corrosion cracking mechanisms.

  6. Characteristics of functional enrichment and gene expression level of human putative transcriptional target genes.

    PubMed

    Osato, Naoki

    2018-01-19

    Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional enrichments were related to the cellular functions. The normalized number of functional enrichments of human putative transcriptional target genes changed according to the criteria of enhancer-promoter assignments and correlated with the median expression level of the target genes. These analyses and characters of human putative transcriptional target genes would be useful to examine the criteria of enhancer-promoter assignments and to predict the novel mechanisms and factors such as DNA binding proteins and DNA sequences of enhancer-promoter interactions.

  7. Type IV-a choledochal cyst--a rare adolescent presentation as acute abdomen.

    PubMed

    Satya, Ramadass; Vijayakumar, Vani

    2006-10-01

    A 17-year-old adolescent girl from El Salvador presented to the emergency room (ER) with severe abdominal pain associated with one episode of nausea and vomiting. The pain that started 5 days earlier was sharp in nature and epigastric in location with radiation to back and was relieved by half a tablet of Vicodin. The patient has a history of intermittent epigastric pain for the past 2 years and was treated for Helicobacter pylori for 1 year. In the ER, the serum chemistry demonstrated elevated amylase. Further workup with abdominal ultrasonography (US), computed tomography (CT), magnetic resonance cholangiopancreatography (MRCP), and hepatobiliary scintigraphy confirmed a type IV-a choledochal cyst with intra- and extrahepatic dilation of bile ducts. We report an unusual acute abdomen presentation of type IV-a choledochal cyst in a 17-year-old young adult from El Salvador.

  8. Evaluation of Different Disinfactants on Dimensional Accuracy and Surface Quality of Type IV Gypsum Casts Retrieved from Elastomeric Impression Materials.

    PubMed

    Pal, P K; Kamble, Suresh S; Chaurasia, Ranjitkumar Rampratap; Chaurasia, Vishwajit Rampratap; Tiwari, Samarth; Bansal, Deepak

    2014-06-01

    The present study was done to evaluate the dimensional stability and surface quality of Type IV gypsum casts retrieved from disinfected elastomeric impression materials. In an in vitro study contaminated impression material with known bacterial species was disinfected with disinfectants followed by culturing the swab sample to assess reduction in level of bacterial colony. Changes in surface detail reproduction of impression were assessed fallowing disinfection. All the three disinfectants used in the study produced a 100% reduction in colony forming units of the test organisms. All the three disinfectants produced complete disinfection, and didn't cause any deterioration in surface detail reproduction. How to cite the article: Pal PK, Kamble SS, Chaurasia RR, Chaurasia VR, Tiwari S, Bansal D. Evaluation of dimensional stability and surface quality of type IV gypsum casts retrieved from disinfected elastomeric impression materials. J Int Oral Health 2014;6(3):77-81.

  9. Biomarker for Glycogen Storage Diseases

    ClinicalTrials.gov

    2017-07-03

    Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

  10. Localization of migraine susceptibility genes in human brain by single-cell RNA sequencing.

    PubMed

    Renthal, William

    2018-01-01

    Background Migraine is a debilitating disorder characterized by severe headaches and associated neurological symptoms. A key challenge to understanding migraine has been the cellular complexity of the human brain and the multiple cell types implicated in its pathophysiology. The present study leverages recent advances in single-cell transcriptomics to localize the specific human brain cell types in which putative migraine susceptibility genes are expressed. Methods The cell-type specific expression of both familial and common migraine-associated genes was determined bioinformatically using data from 2,039 individual human brain cells across two published single-cell RNA sequencing datasets. Enrichment of migraine-associated genes was determined for each brain cell type. Results Analysis of single-brain cell RNA sequencing data from five major subtypes of cells in the human cortex (neurons, oligodendrocytes, astrocytes, microglia, and endothelial cells) indicates that over 40% of known migraine-associated genes are enriched in the expression profiles of a specific brain cell type. Further analysis of neuronal migraine-associated genes demonstrated that approximately 70% were significantly enriched in inhibitory neurons and 30% in excitatory neurons. Conclusions This study takes the next step in understanding the human brain cell types in which putative migraine susceptibility genes are expressed. Both familial and common migraine may arise from dysfunction of discrete cell types within the neurovascular unit, and localization of the affected cell type(s) in an individual patient may provide insight into to their susceptibility to migraine.

  11. Spectrophotometric Measurement of Minimal Erythema Dose Sites after Narrowband Ultraviolet B Phototesting: Clinical Implication of Spetrophotometric Values in Phototherapy

    PubMed Central

    Jeon, Su-Young; Lee, Chae-Young; Song, Ki-Hoon

    2014-01-01

    Background The spectrophotometer is well known to be a useful tool for estimating the objective minimal erythema dose (MED) during planning of phototherapy protocol. However, only a few spectrophotometric values are used to evaluate the erythema and pigmentation of the MED site during phototesting. Objective To determinea new meaning of the relationships among spectrophotometric values during phototesting. Methods Twenty-five patients with psoriasis and 23 patients with vitiligo were selected before undergoing narrowband ultraviolet B phototherapy. We interpreted the gross findings of erythema and measured the L*a*b* values using a spectrophotometer at each phototest spot. We compared MEDs, basic spectrophotometric values (L*a*b*), and b*/L* values separately according to skin type, and determined the correlation of each spectrophotometric value and the correlation between a* and b*/L* values. Results Among L*a*b* values, only b* values showed a statistically significant difference between the type III and IV groups (p=0.003). There was a positive correlation only between MEDs and b* values (p<0.05). The average b*/L*value in the type IV group was significantly higher than the type III group (p<0.05). Conclusion The higher b* values in type IV skin indicates that skin tanning develops more prominently than type III. The correlation between MEDs and b* values may signify that the skin pigmentation status is deepened with the higher MEDs. The difference in b*/L*values between type III and IV skin reflects that the b*/L*value is thought to be an index of tanning. The a* value, known as an index of erythema, does not influence the degree of tanning. PMID:24648682

  12. Self aligned hysteresis free carbon nanotube field-effect transistors

    NASA Astrophysics Data System (ADS)

    Shlafman, M.; Tabachnik, T.; Shtempluk, O.; Razin, A.; Kochetkov, V.; Yaish, Y. E.

    2016-04-01

    Hysteresis phenomenon in the transfer characteristics of carbon nanotube field effect transistor (CNT FET) is being considered as the main obstacle for successful realization of electronic devices based on CNTs. In this study, we prepare four kinds of CNTFETs and explore their hysteretic behavior. Two kinds of devices comprise on-surface CNTs (type I) and suspended CNTs (type II) with thin insulating layer underneath and a single global gate which modulates the CNT conductance. The third and fourth types (types III and IV) consist of suspended CNT over a metallic local gate underneath, where for type IV the local gate was patterned self aligned with the source and drain electrodes. The first two types of devices, i.e., type I and II, exhibit substantial hysteresis which increases with scanning range and sweeping time. Under high vacuum conditions and moderate electric fields ( |E |>4 ×106 V /cm ), the hysteresis for on-surface devices cannot be eliminated, as opposed to suspended devices. Interestingly, type IV devices exhibit no hysteresis at all at ambient conditions, and from the different roles which the global and local gates play for the four types of devices, we could learn about the hysteresis mechanism of this system. We believe that these self aligned hysteresis free FETs will enable the realization of different electronic devices and sensors based on CNTs.

  13. The human clone ST22 SCCmec IV methicillin-resistant Staphylococcus aureus isolated from swine herds and wild primates in Nepal: is man the common source?

    PubMed

    Roberts, Marilyn C; Joshi, Prabhu Raj; Greninger, Alexander L; Melendez, Daira; Paudel, Saroj; Acharya, Mahesh; Bimali, Nabin Kishor; Koju, Narayan P; No, David; Chalise, Mukesh; Kyes, Randall C

    2018-05-01

    Swine nasal samples [n = 282] were collected from 12 randomly selected farms around Kathmandu, Nepal, from healthy animals. In addition, wild monkey (Macaca mulatta) saliva samples [n = 59] were collected near temples areas in Kathmandu using a non-invasive sampling technique. All samples were processed for MRSA using standardized selective media and conventional biochemical tests. MRSA verification was done and isolates characterized by SCCmec, multilocus sequence typing, whole genome sequencing [WGS] and antibiotic susceptibilities. Six (2.1%) swine MRSA were isolated from five of the different swine herds tested, five were ST22 type IV and one ST88 type V. Four (6.8%) macaques MRSA were isolated, with three ST22 SCCmec type IV and one ST239 type III. WGS sequencing showed that the eight ciprofloxacin resistant ST22 isolates carried gyrA mutation [S84L]. Six isolates carried the erm(C) genes, five isolates carried aacC-aphD genes and four isolates carried blaZ genes. The swine linezolid resistant ST22 did not carry any known acquired linezolid resistance genes but had a mutation in ribosomal protein L22 [A29V] and an insertion in L4 [68KG69], both previously associated with linezolid resistance. Multiple virulence factors were also identified. This is the first time MRSA ST22 SCCmec IV has been isolated from livestock or primates.

  14. Immunohistochemical assessment of collagen types I, III, IV and VI in biopsy samples of the bovine uterine wall collected during the oestrous cycle.

    PubMed

    Boos, A

    2000-01-01

    Uterine biopsies were collected at cycle days 1 (oestrous), 8, 15 and 19 in six cows. Unfixed cryostat sections were used to immunolocalise collagen types I, III, IV and VI by an indirect FITC method. Collagen I was sparsely found in the endometrium where it formed a fine meshwork of thin fibres directly below the surface epithelium, clearly visible only at cycle days 8 and 15. Collagen III formed the bulk of connective tissue fibres and was arranged in fine aggregates within the superficial endometrial stroma, while in the deeper areas it consisted of many thick fibre bundles. Collagen IV was found in basement membranes underlying all endometrial epithelia. Furthermore, it surrounded smooth muscle cells of blood vessels. A few single fibrils also stained positively within the endometrial stroma, more numerous at cycle days 1 and 19 as compared to days 8 and 15. Collagen VI formed a mesh of fine and pericellularly situated fibrils within the endometrial stroma. The contribution of the collagen types studied to the connective tissue of caruncles, blood vessels, lymph follicles, and myometrium is also reported. The results of the present study indicate that the connective tissue of the bovine uterine wall is composed of different collagen types, which exhibit a characteristic distribution pattern each. The day of cycle may influence amounts and organisation of collagen types I and IV as demonstrated here at the light-microscopical level. Copyright 2000 S. Karger AG, Basel

  15. Mutational Analysis of the QRRQ Motif in the Yeast Hig1 Type 2 Protein Rcf1 Reveals a Regulatory Role for the Cytochrome c Oxidase Complex*

    PubMed Central

    Garlich, Joshua; Strecker, Valentina; Wittig, Ilka; Stuart, Rosemary A.

    2017-01-01

    The yeast Rcf1 protein is a member of the conserved family of proteins termed the hypoxia-induced gene (domain) 1 (Hig1 or HIGD1) family. Rcf1 interacts with components of the mitochondrial oxidative phosphorylation system, in particular the cytochrome bc1 (complex III)-cytochrome c oxidase (complex IV) supercomplex (termed III-IV) and the ADP/ATP carrier proteins. Rcf1 plays a role in the assembly and modulation of the activity of complex IV; however, the molecular basis for how Rcf1 influences the activity of complex IV is currently unknown. Hig1 type 2 isoforms, which include the Rcf1 protein, are characterized in part by the presence of a conserved motif, (Q/I)X3(R/H)XRX3Q, termed here the QRRQ motif. We show that mutation of conserved residues within the Rcf1 QRRQ motif alters the interactions between Rcf1 and partner proteins and results in the destabilization of complex IV and alteration of its enzymatic properties. Our findings indicate that Rcf1 does not serve as a stoichiometric component, i.e. as a subunit of complex IV, to support its activity. Rather, we propose that Rcf1 serves to dynamically interact with complex IV during its assembly process and, in doing so, regulates a late maturation step of complex IV. We speculate that the Rcf1/Hig1 proteins play a role in the incorporation and/or remodeling of lipids, in particular cardiolipin, into complex IV and. possibly, other mitochondrial proteins such as ADP/ATP carrier proteins. PMID:28167530

  16. Impact of Type of Needle on Incidence of Intravascular Injection During Diagnostic Lumbar Medial Branch Block.

    PubMed

    Joo, Young; Kim, Yong Chul; Lee, Sang Chul; Kim, Hye Young; Park, Keun Suk; Choi, Eun Joo; Moon, Jee Youn

    2016-01-01

    Intravascular (IV) injection of local anesthetics is a potential cause of false-negative results after lumbar medial branch nerve blockade (L-MBB) performed to diagnose facetogenic back pain. The aim of the present study was to identify the relationship between the needle type and the incidence of IV injection in patients undergoing L-MBB using fluoroscopy with digital subtraction imaging (DSI). In this prospective randomized study, we compared the incidence of IV uptake of contrast medium using the Quincke needle and Whitacre needle under real-time DSI during L-MBB. Clinical and demographic factors associated with the occurrence of IV uptake were also investigated. In total, 126 patients were randomized into the Quincke needle group (n = 62) and Whitacre needle group (n = 64). Intravascular uptake of contrast medium was observed in 66 (9.8%) of 671 L-MBB procedures under DSI. The incidence of IV uptake was 13.9% (47/338) using the Quincke needle and 5.7% (19/333) using the Whitacre needle. In the multivariate generalized estimating equations analysis, use of a Quincke needle was related to positive IV injection at a 1.898-fold higher rate than was use of a Whitacre needle (95% confidence interval, 1.025-3.516) and a positive aspiration test predicted IV injection at a 21.735-fold higher rate (95% confidence interval, 11.996-52.258). Lumbar medial branch nerve blockade using the Quincke needle was associated with a 1.9-fold higher rate of IV injection than was L-MBB using the Whitacre needle under DSI. Although further study is needed to confirm the clinical efficacy, Whitacre needles can be considered to reduce the risk of IV injection during L-MBB.

  17. Shifts in the Clonal Distribution of Methicillin-Resistant Staphylococcus aureus in Kuwait Hospitals: 1992-2010

    PubMed Central

    Boswihi, Samar S.; Udo, Edet E.; Al-Sweih, Noura

    2016-01-01

    Background As the epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) is constantly changing globally, determining the prevailing MRSA clones in a local healthcare facility is important for better management of infections. This study investigated clonal composition and distribution of MRSA isolates in Kuwait’s hospitals using a combination of molecular typing methods. Materials and Methods In total, 400 non-repeat MRSA isolates were obtained between 1992 and 2010 in 13 public hospitals and were characterized using antibiogram, SCCmec typing, spa typing, and multilocus-sequence typing. Clonal assignment and detection of virulence factors and antibiotic resistance genes were performed by DNA microarray. Results The isolates were resistant to kanamycin (74.2%), erythromycin (69.5%), tetracycline (66.7%), gentamicin (61%), ciprofloxacin, (61%), fusidic acid (53.5%), clindamycin (41.5%), high-level mupirocin resistance (5.2%) and carried aphA3, aacA-aphD, ermA, ermC, mupA, tetK, tetM, fusC and far1. Molecular typing revealed 31 different MRSA clones consisting of ST239-MRSA-III (52.2%), ST22-MRSA-IV (9.2%), ST80-MRSA-IV (7.5%), ST5-MRSA-II/IV/V/VI (6.5%), ST30-MRSA-IV (3.5%), ST241-MRSA-III (2.7%), ST6-MRSA-IV (2.2%), ST36-MRSA-II (2%) and ST772-MRSA-V (1.75%). The isolates differed in the carriage of genes for enterotoxins, Panton–Valentine leukocidin (PVL), toxic shock syndrome toxin (tst-1), arginine catabolic mobile element (ACME) and exfoliative toxins. The number of clones increased from one (ST239-III-t037) in 1992 to 30 in 2010 including ST8-IV-t008 [PVL+] [ACME+] (USA300), ST772-V (Bengal Bay clone) and ST2816 identified for the first time in Kuwait. Conclusion The study revealed that the MRSA isolates belonged to diverse clones that changed in numbers and diversity overtime. Although ST239-MRSA-III, a healthcare-associated clone remained the dominant MRSA clone overtime, the newly emerged clones consisted mostly of community-associated. PMID:27631623

  18. Community-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complex 80 Type IV (CC80-MRSA-IV) Isolated from the Middle East: A Heterogeneous Expanding Clonal Lineage

    PubMed Central

    Harastani, Houda H.; Tokajian, Sima T.

    2014-01-01

    Background The emergence of community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) has caused a change in MRSA epidemiology worldwide. In the Middle East, the persistent spread of CA-MRSA isolates that were associated with multilocus sequence type (MLST) clonal complex 80 and with staphylococcal cassette chromosome mec (SCCmec) type IV (CC80-MRSA-IV), calls for novel approaches for infection control that would limit its spread. Methodology/Principal Findings In this study, the epidemiology of CC80-MRSA-IV was investigated in Jordan and Lebanon retrospectively covering the period from 2000 to 2011. Ninety-four S. aureus isolates, 63 (67%) collected from Lebanon and 31 (33%) collected from Jordan were included in this study. More than half of the isolates (56%) were associated with skin and soft tissue infections (SSTIs), and 73 (78%) were Panton-Valentine Leukocidin (PVL) positive. Majority of the isolates (84%) carried the gene for exofoliative toxin d (etd), 19% had the Toxic Shock Syndrome Toxin-1 gene (tst), and seven isolates from Jordan had a rare combination being positive for both tst and PVL genes. spa typing showed the prevalence of type t044 (85%) and pulsed-field gel electrophoresis (PFGE) recognized 21 different patterns. Antimicrobial susceptibility testing showed the prevalence (36%) of a unique resistant profile, which included resistance to streptomycin, kanamycin, and fusidic acid (SKF profile). Conclusions The genetic diversity among the CC80 isolates observed in this study poses an additional challenge to infection control of CA-MRSA epidemics. CA-MRSA related to ST80 in the Middle East was distinguished in this study from the ones described in other countries. Genetic diversity observed, which may be due to mutations and differences in the antibiotic regimens between countries may have led to the development of heterogeneous strains. Hence, it is difficult to maintain “the European CA-MRSA clone” as a uniform clone and it is better to designate as CC80-MRSA-IV isolates. PMID:25078407

  19. Navy Family Advocacy Program. Appendix. Analysis of Central Registry Reports.

    DTIC Science & Technology

    1983-12-01

    2/76) 2 Suspected Abuzso/Malect/Sexua1 Assault an ae2404 65.) "Suspected Abuso /Neglect/ Sexual Assault and Rape Report" 2226 60.5 NAVMED 6320/15A...ANALYSIS OF SEXUAL ASSAULT REPORTS ........... 50 HAPTER V: SUMAY ANALYSIS Or rAMILY ADVOCACY PROGRAM REPORTS . 56 APPENDIX...cont’d)I PAGE CHAPTER IV: SEXUAL ASSAULT TV-1 Fore . . . . . . . . . . . . . . . . . . . . . 51 IV-2 Type of Maltreatment ............... 53 IV-3

  20. Involvement of DPP IV/CD26 in cutaneous wound healing process in mice.

    PubMed

    Baticic Pucar, Lara; Pernjak Pugel, Ester; Detel, Dijana; Varljen, Jadranka

    2017-01-01

    Dipeptidyl peptidase IV (DPP IV/CD26) is a widely distributed multifunctional protein that plays a significant role in different physiological as well as pathological processes having a broad spectrum of bioactive substrates and immunomodulative properties. It has potential influence on different processes crucial for wound healing, including cell adhesion, migration, apoptosis, and extracellular matrix degradation. However, despite its known enzymatic and immunomodulative functions, limited data characterize the role of DPP IV/CD26 in cutaneous wound healing mechanisms. The aim of this study was to investigate the process of wound healing in conditions of CD26 deficiency in order to obtain better insights on the role of DPP IV/CD26 in cutaneous regeneration. Experimental wounds were made on the dorsal part of CD26 deficient (CD26 -/- ) and wild-type mice (C57BL/6). The process of cutaneous wound healing was monitored on defined time schedule postwounding by macroscopic, microscopic, and biochemical analyses. Obtained results revealed a better rate of wound closure, revascularization and cell proliferation in CD26 -/- mice, with enhanced local expression of hypoxia-inducible factor 1α and vascular endothelial growth factor. CD26 deficiency induced prompt macrophage recruitment at the site of skin damage but did not influence mobilization of T-cells in comparison with wild-type mice. CD26 -/- mice have significantly higher values of IP-10 in serum and control skins compared with wild-type mice but values in wounds did not differ significantly on days 2, 4, and 7 of wound healing. DPP IV/CD26 activity was found to be decreased 4 days postwounding in serum and 2, 4, and 7 days postwounding in wounds of wild-type animals compared with control skins. These findings contribute to better understanding of wound healing mechanisms and could give a support in finding new therapeutic approaches for wound healing and tissue regeneration. © 2016 by the Wound Healing Society.

  1. AN ERUPTIVE HOT-CHANNEL STRUCTURE OBSERVED AT METRIC WAVELENGTH AS A MOVING TYPE-IV SOLAR RADIO BURST

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasanth, V.; Chen, Yao; Feng, Shiwei

    2016-10-10

    Hot-channel (HC) structure, observed in the high-temperature passbands of the Atmospheric Imaging Assembly/ Solar Dynamic Observatory , is regarded as one candidate of coronal flux rope that is an essential element of solar eruptions. Here, we present the first radio imaging study of an HC structure in the metric wavelength. The associated radio emission manifests as a moving type-IV (t-IVm) burst. We show that the radio sources co-move outward with the HC, indicating that the t-IV emitting energetic electrons are efficiently trapped within the structure. The t-IV sources at different frequencies present no considerable spatial dispersion during the early stagemore » of the event, while the sources spread gradually along the eruptive HC structure at later stage with significant spatial dispersion. The t-IV bursts are characterized by a relatively high brightness temperature (∼10{sup 7}–10{sup 9} K), a moderate polarization, and a spectral shape that evolves considerably with time. This study demonstrates the possibility of imaging the eruptive HC structure at the metric wavelength and provides strong constraints on the t-IV emission mechanism, which, if understood, can be used to diagnose the essential parameters of the eruptive structure.« less

  2. Clinical and radiographic outcomes of femoral head fractures: excision vs. fixation of fragment in Pipkin type I: what is the optimal choice for femoral head fracture?

    PubMed

    Park, Kyung-Soon; Lee, Keun-Bae; Na, Bo-Ram; Yoon, Taek-Rim

    2015-07-01

    In this work, we present relatively long-term results of femoral head fractures with a specific focus on Pipkin type I fractures. Fifty-nine femoral head fractures were treated according to modified Pipkin's classification as follows: type I, small fragment distal to the fovea centralis (FC); type II, large fragment distal to the FC; type III, large fragment proximal to the FC; type IV, comminuted fracture. There were 15 cases of type I, 28 of type II, 9 of type III, and 7 of type IV fractures. Conservative treatment with skeletal traction was performed in 4 type II cases, excision of the fragment in 15 type I and 10 type II cases, fixation of the fragment in 14 type II and all 9 type III cases, and total hip replacement in all 7 type IV cases. The overall clinical and radiographic outcomes were evaluated using previously published criteria, focusing on the results in Pipkin type I fractures with relatively large fragments. Based on Epstein criteria, in type II fractures, excellent or good clinical results were seen in 6 of 10 patients (60.0 %) treated by excision of the fragment and 12 of 14 patients (85.7 %) treated by internal fixation (p = 0.05). Also, excellent or good radiologic results were seen in 4 of 10 (40.0 %) patients treated by excision of the fragment and 12 of 14 (85.7 %) patients treated by internal fixation (p = 0.03). Even in Pipkin type I fractures, if the fragment is large (modified Pipkin type II), early reduction and internal fixation can produce good results.

  3. Computational and Experimental Analysis of the Secretome of Methylococcus capsulatus (Bath)

    PubMed Central

    Indrelid, Stine; Mathiesen, Geir; Jacobsen, Morten; Lea, Tor; Kleiveland, Charlotte R.

    2014-01-01

    The Gram-negative methanotroph Methylococcus capsulatus (Bath) was recently demonstrated to abrogate inflammation in a murine model of inflammatory bowel disease, suggesting interactions with cells involved in maintaining mucosal homeostasis and emphasizing the importance of understanding the many properties of M. capsulatus. Secreted proteins determine how bacteria may interact with their environment, and a comprehensive knowledge of such proteins is therefore vital to understand bacterial physiology and behavior. The aim of this study was to systematically analyze protein secretion in M. capsulatus (Bath) by identifying the secretion systems present and the respective secreted substrates. Computational analysis revealed that in addition to previously recognized type II secretion systems and a type VII secretion system, a type Vb (two-partner) secretion system and putative type I secretion systems are present in M. capsulatus (Bath). In silico analysis suggests that the diverse secretion systems in M.capsulatus transport proteins likely to be involved in adhesion, colonization, nutrient acquisition and homeostasis maintenance. Results of the computational analysis was verified and extended by an experimental approach showing that in addition an uncharacterized protein and putative moonlighting proteins are released to the medium during exponential growth of M. capsulatus (Bath). PMID:25479164

  4. Identifying Novel Type ZBGs and Nonhydroxamate HDAC Inhibitors Through a SVM Based Virtual Screening Approach.

    PubMed

    Liu, X H; Song, H Y; Zhang, J X; Han, B C; Wei, X N; Ma, X H; Cui, W K; Chen, Y Z

    2010-05-17

    Histone deacetylase inhibitors (HDACi) have been successfully used for the treatment of cancers and other diseases. Search for novel type ZBGs and development of non-hydroxamate HDACi has become a focus in current research. To complement this, it is desirable to explore a virtual screening (VS) tool capable of identifying different types of potential inhibitors from large compound libraries with high yields and low false-hit rates similar to HTS. This work explored the use of support vector machines (SVM) combined with our newly developed putative non-inhibitor generation method as such a tool. SVM trained by 702 pre-2008 hydroxamate HDACi and 64334 putative non-HDACi showed good yields and low false-hit rates in cross-validation test and independent test using 220 diverse types of HDACi reported since 2008. The SVM hit rates in scanning 13.56 M PubChem and 168K MDDR compounds are comparable to HTS rates. Further structural analysis of SVM virtual hits suggests its potential for identification of non-hydroxamate HDACi. From this analysis, a series of novel ZBG and cap groups were proposed for HDACi design. Copyright © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Analysis of complete genome sequence of Neorickettsia risticii: causative agent of Potomac horse fever

    PubMed Central

    Lin, Mingqun; Zhang, Chunbin; Gibson, Kathryn; Rikihisa, Yasuko

    2009-01-01

    Neorickettsia risticii is an obligate intracellular bacterium of the trematodes and mammals. Horses develop Potomac horse fever (PHF) when they ingest aquatic insects containing encysted N. risticii-infected trematodes. The complete genome sequence of N. risticii Illinois consists of a single circular chromosome of 879 977 bp and encodes 38 RNA species and 898 proteins. Although N. risticii has limited ability to synthesize amino acids and lacks many metabolic pathways, it is capable of making major vitamins, cofactors and nucleotides. Comparison with its closely related human pathogen N. sennetsu showed that 758 (88.2%) of protein-coding genes are conserved between N. risticii and N. sennetsu. Four-way comparison of genes among N. risticii and other Anaplasmataceae showed that most genes are either shared among Anaplasmataceae (525 orthologs that generally associated with housekeeping functions), or specific to each genome (>200 genes that are mostly hypothetical proteins). Genes potentially involved in the pathogenesis of N. risticii were identified, including those encoding putative outer membrane proteins, two-component systems and a type IV secretion system (T4SS). The bipolar localization of T4SS pilus protein VirB2 on the bacterial surface was demonstrated for the first time in obligate intracellular bacteria. These data provide insights toward genomic potential of N. risticii and intracellular parasitism, and facilitate our understanding of PHF pathogenesis. PMID:19661282

  6. Analysis of complete genome sequence of Neorickettsia risticii: causative agent of Potomac horse fever.

    PubMed

    Lin, Mingqun; Zhang, Chunbin; Gibson, Kathryn; Rikihisa, Yasuko

    2009-10-01

    Neorickettsia risticii is an obligate intracellular bacterium of the trematodes and mammals. Horses develop Potomac horse fever (PHF) when they ingest aquatic insects containing encysted N. risticii-infected trematodes. The complete genome sequence of N. risticii Illinois consists of a single circular chromosome of 879 977 bp and encodes 38 RNA species and 898 proteins. Although N. risticii has limited ability to synthesize amino acids and lacks many metabolic pathways, it is capable of making major vitamins, cofactors and nucleotides. Comparison with its closely related human pathogen N. sennetsu showed that 758 (88.2%) of protein-coding genes are conserved between N. risticii and N. sennetsu. Four-way comparison of genes among N. risticii and other Anaplasmataceae showed that most genes are either shared among Anaplasmataceae (525 orthologs that generally associated with housekeeping functions), or specific to each genome (>200 genes that are mostly hypothetical proteins). Genes potentially involved in the pathogenesis of N. risticii were identified, including those encoding putative outer membrane proteins, two-component systems and a type IV secretion system (T4SS). The bipolar localization of T4SS pilus protein VirB2 on the bacterial surface was demonstrated for the first time in obligate intracellular bacteria. These data provide insights toward genomic potential of N. risticii and intracellular parasitism, and facilitate our understanding of PHF pathogenesis.

  7. Identification of a functional toxin-antitoxin system located in the genomic island PYG1 of piezophilic hyperthermophilic archaeon Pyrococcus yayanosii.

    PubMed

    Li, Zhen; Song, Qinghao; Wang, Yinzhao; Xiao, Xiang; Xu, Jun

    2018-05-01

    Toxin-antitoxin (TA) system is bacterial or archaeal genetic module consisting of toxin and antitoxin gene that be organized as a bicistronic operon. TA system could elicit programmed cell death, which is supposed to play important roles for the survival of prokaryotic population under various physiological stress conditions. The phage abortive infection system (AbiE family) belongs to bacterial type IV TA system. However, no archaeal AbiE family TA system has been reported so far. In this study, a putative AbiE TA system (PygAT), which is located in a genomic island PYG1 in the chromosome of Pyrococcus yayanosii CH1, was identified and characterized. In Escherichia coli, overexpression of the toxin gene pygT inhibited its growth while the toxic effect can be suppressed by introducing the antitoxin gene pygA in the same cell. PygAT also enhances the stability of shuttle plasmids with archaeal plasmid replication protein Rep75 in E. coli. In P. yayanosii, disruption of antitoxin gene pygA cause a significantly growth delayed under high hydrostatic pressure (HHP). The antitoxin protein PygA can specifically bind to the PygAT promoter region and regulate the transcription of pygT gene in vivo. These results show that PygAT is a functional TA system in P. yayanosii, and also may play a role in the adaptation to HHP environment.

  8. Metformin repositioning as antitumoral agent: selective antiproliferative effects in human glioblastoma stem cells, via inhibition of CLIC1-mediated ion current

    PubMed Central

    Barbieri, Federica; Peretti, Marta; Pizzi, Erika; Pattarozzi, Alessandra; Carra, Elisa; Sirito, Rodolfo; Daga, Antonio; Curmi, Paul M.G.; Mazzanti, Michele; Florio, Tullio

    2014-01-01

    Epidemiological and preclinical studies propose that metformin, a first-line drug for type-2 diabetes, exerts direct antitumor activity. Although several clinical trials are ongoing, the molecular mechanisms of this effect are unknown. Here we show that chloride intracellular channel-1 (CLIC1) is a direct target of metformin in human glioblastoma cells. Metformin exposure induces antiproliferative effects in cancer stem cell-enriched cultures, isolated from three individual WHO grade IV human glioblastomas. These effects phenocopy metformin-mediated inhibition of a chloride current specifically dependent on CLIC1 functional activity. CLIC1 ion channel is preferentially active during the G1-S transition via transient membrane insertion. Metformin inhibition of CLIC1 activity induces G1 arrest of glioblastoma stem cells. This effect was time-dependent, and prolonged treatments caused antiproliferative effects also for low, clinically significant, metformin concentrations. Furthermore, substitution of Arg29 in the putative CLIC1 pore region impairs metformin modulation of channel activity. The lack of drugs affecting cancer stem cell viability is the main cause of therapy failure and tumor relapse. We identified CLIC1 not only as a modulator of cell cycle progression in human glioblastoma stem cells but also as the main target of metformin's antiproliferative activity, paving the way for novel and needed pharmacological approaches to glioblastoma treatment. PMID:25361004

  9. Metformin repositioning as antitumoral agent: selective antiproliferative effects in human glioblastoma stem cells, via inhibition of CLIC1-mediated ion current.

    PubMed

    Gritti, Marta; Würth, Roberto; Angelini, Marina; Barbieri, Federica; Peretti, Marta; Pizzi, Erika; Pattarozzi, Alessandra; Carra, Elisa; Sirito, Rodolfo; Daga, Antonio; Curmi, Paul M G; Mazzanti, Michele; Florio, Tullio

    2014-11-30

    Epidemiological and preclinical studies propose that metformin, a first-line drug for type-2 diabetes, exerts direct antitumor activity. Although several clinical trials are ongoing, the molecular mechanisms of this effect are unknown. Here we show that chloride intracellular channel-1 (CLIC1) is a direct target of metformin in human glioblastoma cells. Metformin exposure induces antiproliferative effects in cancer stem cell-enriched cultures, isolated from three individual WHO grade IV human glioblastomas. These effects phenocopy metformin-mediated inhibition of a chloride current specifically dependent on CLIC1 functional activity. CLIC1 ion channel is preferentially active during the G1-S transition via transient membrane insertion. Metformin inhibition of CLIC1 activity induces G1 arrest of glioblastoma stem cells. This effect was time-dependent, and prolonged treatments caused antiproliferative effects also for low, clinically significant, metformin concentrations. Furthermore, substitution of Arg29 in the putative CLIC1 pore region impairs metformin modulation of channel activity. The lack of drugs affecting cancer stem cell viability is the main cause of therapy failure and tumor relapse. We identified CLIC1 not only as a modulator of cell cycle progression in human glioblastoma stem cells but also as the main target of metformin's antiproliferative activity, paving the way for novel and needed pharmacological approaches to glioblastoma treatment.

  10. Muscle-specific inositide phosphatase (MIP/MTMR14) is reduced with age and its loss accelerates skeletal muscle aging process by altering calcium homeostasis.

    PubMed

    Romero-Suarez, Sandra; Shen, Jinhua; Brotto, Leticia; Hall, Todd; Mo, Chenglin; Valdivia, Héctor H; Andresen, Jon; Wacker, Michael; Nosek, Thomas M; Qu, Cheng-Kui; Brotto, Marco

    2010-08-01

    We have recently reported that a novel muscle-specific inositide phosphatase (MIP/MTMR14) plays a critical role in [Ca2+]i homeostasis through dephosphorylation of sn-1-stearoyl-2-arachidonoyl phosphatidylinositol (3,5) bisphosphate (PI(3,5)P2). Loss of function mutations in MIP have been identified in human centronuclear myopathy. We developed a MIP knockout (MIPKO) animal model and found that MIPKO mice were more susceptible to exercise-induced muscle damage, a trademark of muscle functional changes in older subjects. We used wild-type (Wt) mice and MIPKO mice to elucidate the roles of MIP in muscle function during aging. We found MIP mRNA expression, MIP protein levels, and MIP phosphatase activity significantly decreased in old Wt mice. The mature MIPKO mice displayed phenotypes that closely resembled those seen in old Wt mice: i) decreased walking speed, ii) decreased treadmill activity, iii) decreased contractile force, and iv) decreased power generation, classical features of sarcopenia in rodents and humans. Defective Ca2+ homeostasis is also present in mature MIPKO and old Wt mice, suggesting a putative role of MIP in the decline of muscle function during aging. Our studies offer a new avenue for the investigation of MIP roles in skeletal muscle function and as a potential therapeutic target to treat aging sarcopenia.

  11. [Alcohol-related cognitive impairment and the DSM-5].

    PubMed

    Walvoort, S J W; Wester, A J; Doorakkers, M C; Kessels, R P C; Egger, J I M

    2016-01-01

    It is evident from the dsm-iv-tr that alcohol-related impairment is extremely difficult to classify accurately. As a result, cognitive deficits can easily be overlooked. The dsm-5, however, incorporates a new category, namely 'neurocognitive disorders', which may lead to significant improvements in clinical practice. To compare the classification of alcohol-related cognitive dysfunction in dsm-iv-tr and dsm-5 and to discuss the clinical relevance of the revised classification in the dsm-5. We compare the chapters of the dsm-iv-tr and the dsm-5 concerning alcohol-related cognitive impairment and describe the changes that have been made. The dsm-5 puts greater emphasis on alcohol-related neurocognitive impairment. Not only does dsm-5 distinguish between the degree of severity (major or minor neurocognitive disorder), it also distinguishes between the type of impairment (non-amnestic-type versus confabulating-amnestic type). It also makes a distinction between the durations of impairment (behavioural and/or persistent disorders). The dsm-5 gives a clearer description of alcohol-related neurocognitive dysfunction than does dsm-iv-tr and it stresses the essential role of neuropsychological assessment in the classification, diagnosis, and treatment of neurocognitive disorders.

  12. Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis

    PubMed Central

    Luvan, M; Roshan, G; Saw, A

    2015-01-01

    Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy. PMID:28611907

  13. Cell surface expression of channel catfish leukocyte immune-type receptors (IpLITRs) and recruitment of both Src homology 2 domain-containing protein tyrosine phosphatase (SHP)-1 and SHP-2.

    PubMed

    Montgomery, Benjamin C S; Mewes, Jacqueline; Davidson, Chelsea; Burshtyn, Deborah N; Stafford, James L

    2009-04-01

    Channel catfish leukocyte immune-type receptors (IpLITRs) are immunoglobulin superfamily (IgSF) members believed to play a role in the control and coordination of cellular immune responses in teleost. Putative stimulatory and inhibitory IpLITRs are co-expressed by different types of catfish immune cells (e.g. NK cells, T cells, B cells, and macrophages) but their signaling potential has not been determined. Following cationic polymer-mediated transfections into human cell lines we examined the surface expression, tyrosine phosphorylation, and phosphatase recruitment potential of two types of putative inhibitory IpLITRs using 'chimeric' expression constructs and an epitope-tagged 'native' IpLITR. We also cloned and expressed the teleost Src homology 2 domain-containing protein tyrosine phosphatases (SHP)-1 and SHP-2 and examined their expression in adult tissues and developing zebrafish embryos. Co-immunoprecipitation experiments support the inhibitory signaling potential of distinct IpLITR-types that bound both SHP-1 and SHP-2 following the phosphorylation of tyrosine residues within their cytoplasmic tail (CYT) regions. Phosphatase recruitment by IpLITRs represents an important first step in understanding their influence on immune cell effector functions and suggests that certain inhibitory signaling pathways are conserved among vertebrates.

  14. The Molecular Epidemiology of the Highly Virulent ST93 Australian Community Staphylococcus aureus Strain

    PubMed Central

    Coombs, Geoffrey W.; Goering, Richard V.; Chua, Kyra Y. L.; Monecke, Stefan; Howden, Benjamin P.; Stinear, Timothy P.; Ehricht, Ralf; O’Brien, Frances G.; Christiansen, Keryn J.

    2012-01-01

    In Australia the PVL - positive ST93-IV [2B], colloquially known as “Queensland CA-MRSA” has become the dominant CA-MRSA clone. First described in the early 2000s, ST93-IV [2B] is associated with skin and severe invasive infections including necrotizing pneumonia. A singleton by multilocus sequence typing (MLST) eBURST analysis ST93 is distinct from other S aureus clones. To determine if the increased prevalence of ST93-IV [2B] is due to the widespread transmission of a single strain of ST93-IV [2B] the genetic relatedness of 58 S. aureus ST93 isolated throughout Australia over an extended period were studied in detail using a variety of molecular methods including pulsed-field gel electrophoresis, spa typing, MLST, microarray DNA, SCCmec typing and dru typing. Identification of the phage harbouring the lukS-PV/lukF-PV Panton Valentine leucocidin genes, detection of allelic variations in lukS-PV/lukF-PV, and quantification of LukF-PV expression was also performed. Although ST93-IV [2B] is known to have an apparent enhanced clinical virulence, the isolates harboured few known virulence determinants. All PVL-positive isolates carried the PVL-encoding phage ΦSa2USA and the lukS-PV/lukF-PV genes had the same R variant SNP profile. The isolates produced similar expression levels of LukF-PV. Although multiple rearrangements of the spa sequence have occurred, the core genome in ST93 is very stable. The emergence of ST93-MRSA is due to independent acquisitions of different dru-defined type IV and type V SCCmec elements in several spa-defined ST93-MSSA backgrounds. Rearrangement of the spa sequence in ST93-MRSA has subsequently occurred in some of these strains. Although multiple ST93-MRSA strains were characterised, little genetic diversity was identified for most isolates, with PVL-positive ST93-IVa [2B]-t202-dt10 predominant across Australia. Whether ST93-IVa [2B] t202-dt10 arose from one PVL-positive ST93-MSSA-t202, or by independent acquisitions of SCCmec-IVa [2B]-dt10 into multiple PVL-positive ST93-MSSA-t202 strains is not known. PMID:22900085

  15. Breast cancer risk associated with genotypic polymorphism of the nonhomologous end-joining genes: a multigenic study on cancer susceptibility.

    PubMed

    Fu, Yi-Ping; Yu, Jyh-Cherng; Cheng, Ting-Chih; Lou, M Ann; Hsu, Giu-Cheng; Wu, Chia-Yun; Chen, Sou-Tong; Wu, Hurng-Sheng; Wu, Pei-Ei; Shen, Chen-Yang

    2003-05-15

    The role of the familial breast cancer susceptibility genes, BRCA1 and BRCA2, in the homologous recombination pathway for DNA double-strand break (DSB) repair suggests that the mechanisms involved in DNA DSB repair are of particular etiological importance during breast tumorigenesis. However, there is currently no evidence for an association between breast cancer and the other DSB repair pathway, the nonhomologous end-joining (NHEJ) pathway. It is possible that, because this DNA repair pathway is so crucial for mammalian cells to maintain genomic stability, any severe defects in it would result in serious outcomes, such as genomic instability and cell death, and block subsequent cell outgrowth and tumor formation. Thus, only subtle defects arising from low-penetrance alleles would escape lethality accumulating essential genetic changes and be associated with cancer formation, and the tumorigenic contribution of these alleles would become more obvious if individual putative high-risk genotypes of each NHEJ gene act jointly. Furthermore, this joint effect might be modified by specific environmental factors, and we hypothesized that estrogen exposure might be one such factor because estrogen is suggested to cause DNA DSBs, triggering breast tumorigenesis. Because single nucleotide polymorphisms (SNPs) are the most subtle genetic variation in the genome, to examine these hypotheses, we have genotyped 30 SNPs in all five NHEJ genes (Ku70, Ku80, DNA-PKcs, Ligase IV, and XRCC4) in 254 primary breast cancer patients and 379 healthy controls. Support for these hypotheses came from the observations that (a) two SNPs in Ku70 and XRCC4 were associated with breast cancer risk (P < 0.05); (b) a trend toward increased risk of developing breast cancer was found in women harboring a greater number of putative high-risk genotypes of NHEJ genes (an adjusted odds ratio of 1.46 for having one additional putative high-risk genotype; 95% confidence interval, 1.19-1.80); (c) this association between risk and the number of putative high-risk genotypes was stronger and more significant in women thought to be more susceptible to estrogen, i.e., those with no history of full-term pregnancy; and (d) the protective effect conferred by a history of full-term pregnancy was only significant in women with a lower number of putative high-risk genotypes of NHEJ genes. Based on comprehensive NHEJ gene profiles, this study provides new insights to suggest the role of the NHEJ pathway in breast cancer development and supports the possibility that breast cancer is initiated by estrogen exposure, which causes DNA DSBs.

  16. Actin homolog MreB affects chromosome segregation by regulating topoisomerase IV in Escherichia coli.

    PubMed

    Madabhushi, Ram; Marians, Kenneth J

    2009-01-30

    In Escherichia coli, topoisomerase IV, a type II topoisomerase, mediates the resolution of topological linkages between replicated daughter chromosomes and is essential for chromosome segregation. Topo IV activity is restricted to only a short interval late in the cell cycle. However, the mechanism that confers this temporal regulation is unknown. Here we report that the bacterial actin homolog MreB participates in the temporal oscillation of Topo IV activity. We show that mreB mutant strains are deficient in Topo IV activity. In addition, we demonstrate that, depending upon whether it is in a monomeric or polymerized state, MreB affects Topo IV activity differentially. In addition, MreB physically interacts with the ParC subunit of Topo IV. Together, these results may explain how dynamics of the bacterial cytoskeleton are coordinated with the timing of chromosome segregation.

  17. Serum Levels of Soluble CD26/Dipeptidyl Peptidase-IV in Type 2 Diabetes Mellitus and Its Association with Metabolic Syndrome and Therapy with Antidiabetic Agents in Malaysian Subjects.

    PubMed

    Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Muniandy, Sekaran

    2015-01-01

    A soluble form of CD26/dipeptidyl peptidase-IV (sCD26/DPP-IV) induces DPP-IV enzymatic activity that degrades incretin. We investigated fasting serum levels of sCD26/DPP-IV and active glucagon-like peptide-1 (GLP-1) in Malaysian patients with type 2 diabetes mellitus (T2DM) with and without metabolic syndrome (MetS), as well as the associations between sCD26/DPP-IV levels, MetS, and antidiabetic therapy. We assessed sCD26/DPP-IV levels, active GLP-1 levels, body mass index (BMI), glucose, insulin, A1c, glucose homeostasis indices, and lipid profiles in 549 Malaysian subjects (including 257 T2DM patients with MetS, 57 T2DM patients without MetS, 71 non-diabetics with MetS, and 164 control subjects without diabetes or metabolic syndrome). Fasting serum levels of sCD26/DPP-IV were significantly higher in T2DM patients with and without MetS than in normal subjects. Likewise, sCD26/DPP-IV levels were significantly higher in patients with T2DM and MetS than in non-diabetic patients with MetS. However, active GLP-1 levels were significantly lower in T2DM patients both with and without MetS than in normal subjects. In T2DM subjects, sCD26/DPP-IV levels were associated with significantly higher A1c levels, but were significantly lower in patients using monotherapy with metformin. In addition, no significant differences in sCD26/DPP-IV levels were found between diabetic subjects with and without MetS. Furthermore, sCD26/DPP-IV levels were negatively correlated with active GLP-1 levels in T2DM patients both with and without MetS. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-cholesterol (LDL-c) levels. Serum sCD26/DPP-IV levels increased in T2DM subjects with and without MetS. Active GLP-1 levels decreased in T2DM patients both with and without MetS. In addition, sCD26/DPP-IV levels were associated with Alc levels and negatively correlated with active GLP-1 levels. Moreover, metformin monotherapy was associated with reduced sCD26/DPP-IV levels. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-c.

  18. Incidence of intravenous contrast extravasation: increased risk for patients with deep brachial catheter placement from the emergency department.

    PubMed

    Hardie, Andrew D; Kereshi, Borko

    2014-06-01

    Deep brachial intravenous catheter (IV) placement can be performed in emergency department patients with difficult vascular access, but the safety of deep brachial IV for iodinated contrast administration has not been assessed. This study compares the relative risk for extravasation of deep brachial IV compared with antecubital IV during power injected computed tomography (CT) examinations. A departmental practice quality improvement was performed to assess the rate of IV extravasation for all CT examinations during a 1 year period. De-identified data was analyzed with a waiver of informed consent to identify the rate and relative risk of iodinated contrast extravasation by catheter type. A total of 10,750 injections were performed, with 82 extravasation events (0.8 %). There were 51 extravasations of antecubital IV from approximately 8,599 placed (0.6 %). For 123 deep brachial IV placed, there were eight extravasations (6.5 %). The relative risk of a deep brachial IV extravasation was 9.4 compared to 0.4 for antecubital placement. Deep brachial IV demonstrated a markedly higher rate of contrast extravasation than antecubital IV. For power injected iodinated contrast administration, it is recommended to avoid the use of deep brachial IV whenever possible.

  19. Initial Screening of Environmentally Sustainable Surface Pretreatments for Adhesive Bonding Applications

    DTIC Science & Technology

    2017-05-17

    490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as bonding...sustainable TT-C-490F pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as...pretreatment was applied. Environmentally sustainable TT-C-490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during

  20. Palliative treatment with radiation-emitting metallic stents in unresectable Bismuth type III or IV hilar cholangiocarcinoma.

    PubMed

    Lu, Jian; Guo, Jin-He; Zhu, Hai-Dong; Zhu, Guang-Yu; Wang, Yong; Zhang, Qi; Chen, Li; Wang, Chao; Pan, Tian-Fan; Teng, Gao-Jun

    2017-01-01

    The emerging data for stenting in combination with brachytherapy in unresectable hilar cholangiocarcinoma are encouraging. The aim of this study was to evaluate the efficacy and safety of radiation-emitting metallic stents (REMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma. Consecutive patients who underwent percutaneous placement with REMS or uncovered self-expandable metallic stent (SEMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma between September 2011 and April 2016 were identified into this retrospective study. Data on patient demographics and overall survival, functional success, stent patency and complications were collected at the authors' hospital. A total of 59 patients were included: 33 (55.9%) in the REMS group and 26 (44.1%) in the SEMS group. The median overall survival was 338 days in the REMS group and 141 days in the SEMS group (p<0.001). The median stent patency time was 385 days for REMS and 142 days for SEMS (p<0.001). The functional success rate (87.9% vs 84.6%, p=0.722) and incidence of overall complications (27.3% vs 26.9%, p=0.999) did not differ in the two groups. Placement with REMS is safe and effective in palliation for unresectable Bismuth type III or IV hilar cholangiocarcinoma, and seems to prolong survival as well as patency of stent in these patients.

  1. A MADS Box Protein Interacts with a Mating-Type Protein and Is Required for Fruiting Body Development in the Homothallic Ascomycete Sordaria macrospora

    PubMed Central

    Nolting, Nicole; Pöggeler, Stefanie

    2006-01-01

    MADS box transcription factors control diverse developmental processes in plants, metazoans, and fungi. To analyze the involvement of MADS box proteins in fruiting body development of filamentous ascomycetes, we isolated the mcm1 gene from the homothallic ascomycete Sordaria macrospora, which encodes a putative homologue of the Saccharomyces cerevisiae MADS box protein Mcm1p. Deletion of the S. macrospora mcm1 gene resulted in reduced biomass, increased hyphal branching, and reduced hyphal compartment length during vegetative growth. Furthermore, the S. macrospora Δmcm1 strain was unable to produce fruiting bodies or ascospores during sexual development. A yeast two-hybrid analysis in conjugation with in vitro analyses demonstrated that the S. macrospora MCM1 protein can interact with the putative transcription factor SMTA-1, encoded by the S. macrospora mating-type locus. These results suggest that the S. macrospora MCM1 protein is involved in the transcriptional regulation of mating-type-specific genes as well as in fruiting body development. PMID:16835449

  2. Evidence for regulation of columnar habit in apple by a putative 2OG-Fe(II) oxygenase.

    PubMed

    Wolters, Pieter J; Schouten, Henk J; Velasco, Riccardo; Si-Ammour, Azeddine; Baldi, Paolo

    2013-12-01

    Understanding the genetic mechanisms controlling columnar-type growth in the apple mutant 'Wijcik' will provide insights on how tree architecture and growth are regulated in fruit trees. In apple, columnar-type growth is controlled by a single major gene at the Columnar (Co) locus. By comparing the genomic sequence of the Co region of 'Wijcik' with its wild-type 'McIntosh', a novel non-coding DNA element of 1956 bp specific to Pyreae was found to be inserted in an intergenic region of 'Wijcik'. Expression analysis of selected genes located in the vicinity of the insertion revealed the upregulation of the MdCo31 gene encoding a putative 2OG-Fe(II) oxygenase in axillary buds of 'Wijcik'. Constitutive expression of MdCo31 in Arabidopsis thaliana resulted in compact plants with shortened floral internodes, a phenotype reminiscent of the one observed in columnar apple trees. We conclude that MdCo31 is a strong candidate gene for the control of columnar growth in 'Wijcik'. No claim to original European Union works. New Phytologist © 2013 New Phytologist Trust.

  3. Adult presentation of Bartter syndrome type IV with erythrocytosis

    PubMed Central

    Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

    2015-01-01

    Abstract Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis. PMID:26537508

  4. An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications

    PubMed Central

    MANOHARAN, A.; ZHANG, L.; POOJARY, A.; BHANDARKAR, L.; KOPPIKAR, G.; ROBINSON, D. A.

    2012-01-01

    SUMMARY A cluster of methicillin-resistant Staphylococcus aureus (MRSA) breast abscesses in women who had given birth at a hospital in Mumbai, India was investigated retrospectively. Nineteen of twenty cases were caused by a single clone: pvl-positive, spa type 648 (Ridom t852), ccrB:dru subtype 3:0, ST22-MRSA-IV. Despite the presence of pvl and SCCmec type IV, which are common genetic markers among community-associated MRSA, this outbreak was caused by a healthcare-associated, community-onset MRSA that was common in the hospital environment. Thus, infection control practices may have an important role in limiting the spread of this virulent clone. PMID:22475374

  5. PADI4 and HLA-DRB1 are genetic risks for radiographic progression in RA patients, independent of ACPA status: results from the IORRA cohort study.

    PubMed

    Suzuki, Taku; Ikari, Katsunori; Yano, Koichiro; Inoue, Eisuke; Toyama, Yoshiaki; Taniguchi, Atsuo; Yamanaka, Hisashi; Momohara, Shigeki

    2013-01-01

    Rheumatoid arthritis (RA) is a systemic, chronic inflammatory disease influenced by both genetic and environmental factors, leading to joint destruction and functional impairment. Recently, a large-scaled GWAS meta-analysis using more than 37,000 Japanese samples were conducted and 13 RA susceptibility loci were identified. However, it is not clear whether these loci have significant impact on joint destruction or not. This is the first study focused on the 13 loci to investigate independent genetic risk factors for radiographic progression in the first five years from onset of RA. Sharp/van der Heijde score of hands at 5-year disease duration, which represents joint damage, were measured retrospectively and used as an outcome variable in 865 Japanese RA patients. Genetic factors regarded as putative risk factors were RA-susceptible polymorphisms identified by the Japanese GWAS meta-analysis, including HLA-DRB1 (shared epitope, SE), rs2240340 (PADI4), rs2230926 (TNFAIP3), rs3093024 (CCR6), rs11900673 (B3GNT2), rs2867461 (ANXA3), rs657075 (CSF2), rs12529514 (CD83), rs2233434 (NFKBIE), rs10821944 (ARID5B), rs3781913 (PDE2A-ARAP1), rs2841277 (PLD4) and rs2847297 (PTPN2). These putative genetic risk factors were assessed by a stepwise multiple regression analysis adjusted for possible non-genetic risk factors: autoantibody positivity (anti-citrullinated peptide antibody [ACPA] and rheumatoid factor), history of smoking, gender and age at disease onset. The number of SE alleles (P = 0.002) and risk alleles of peptidyl arginine deiminase type IV gene (PADI4, P = 0.04) had significant impact on progressive joint destruction, as well as following non-genetic factors: ACPA positive (P = 0.0006), female sex (P = 0.006) and younger age of onset (P = 0.02). In the present study, we found that PADI4 risk allele and HLA-DRB1 shared epitope are independent genetic risks for radiographic progression in Japanese rheumatoid arthritis patients. The results of this study give important knowledge of the risks on progressive joint damage in RA patients.

  6. The toothless pterosaur Jidapterus edentus (Pterodactyloidea: Azhdarchoidea) from the Early Cretaceous Jehol Biota and its paleoecological implications

    PubMed Central

    Wu, Wen-Hao; Zhou, Chang-Fu; Andres, Brian

    2017-01-01

    Background In the Early Cretaceous Jehol Biota, the toothless pterosaurs flourished with the chaoyangopterids and tapejarids playing a key role in understanding the early diversity and evolution of the Azhdarchoidea. Unlike the more diverse tapejarids, the rarer chaoyangopterids are characterized by a long and low rostrum, supporting a close relationship with the huge azhdarchids. Unfortunately, our knowledge is still limited in the osteology, paleoecology, and taxonomy of the Chaoyangopteridae. As one of the best preserved skeletons, the type and only specimen of Jidapterus edentus provides an opportunity to understand the morphology and paleoecology of the chaoyangopterids. Results Our study of the osteology of Jidapterus edentus reveals valuable information about the morphology of the Chaoyangopteridae such as a rostrum with a curved dorsal profile, high Rostral Index (RI), larger angle between the dorsal and postorbital processes of the jugal, sequentially shorter fourth to seventh cervical vertebrae, sternum with a plate wider than long, contact of the metacarpal I with the distal syncarpal, pneumatic foramen on first wing phalanx, hatchet-like postacetabular process with unconstricted neck and small dorsal process, distinctly concave anterior margin of pubis, subrectangular pubic plate with nearly parallel anterior and posterior margins, longer proximal phalanges of pedal digits III and IV, as well as reduced and less curved pedal unguals. These features further support the validity of Jidapterus edentus as a distinct species and the close relationship of the chaoyangopterids with the azhdarchids. Paleoecologically, the chaoyangopterids are probably like the azhdarchids, more terrestrial than the contemporaneous and putatively arboreal tapejarids, which may have been limited to the forest-dominated ecosystem of the Jehol Biota. Discussion The osteology of Jidapterus edentus further supports the close relationship of the Chaoyangopteridae with the Azhdarchidae in sharing a high RI value and reduced and mildly-curved pedal unguals, and it also implies a possible paleoecological similarity in their terrestrial capability. Combined with the putatively arboreal and herbivorous tapejarids, this distinct lifestyle of the chaoyangopterids provides new insights into the diversity of pterosaurs in the ecosystem of the Jehol Biota. PMID:28950013

  7. Diagnostic accuracy of level IV portable sleep monitors versus polysomnography for obstructive sleep apnea: a systematic review and meta-analysis.

    PubMed

    Abrahamyan, Lusine; Sahakyan, Yeva; Chung, Suzanne; Pechlivanoglou, Petros; Bielecki, Joanna; Carcone, Steven M; Rac, Valeria E; Fitzpatrick, Michael; Krahn, Murray

    2018-01-09

    Obstructive sleep apnea (OSA) is the most common sleep-related breathing disorder. In-laboratory, overnight type I polysomnography (PSG) is the current "gold standard" for diagnosing OSA. Home sleep apnea testing (HSAT) using portable monitors (PMs) is an alternative testing method offering better comfort and lower costs. We aimed to systematically review the evidence on diagnostic ability of type IV PMs compared to PSG in diagnosing OSA. Participants: patients ≥16 years old with symptoms suggestive of OSA;intervention: type IV PMs (devices with < 2 respiratory channels); comparator: in-laboratory PSG; outcomes: diagnostic accuracy measures;studies: cross-sectional, prospective observational/experimental/quasi-experimental studies; information sources: MEDLINE and Cochrane Library from January 1, 2010 to May 10, 2016. All stages of review were conducted independently by two investigators. We screened 6054 abstracts and 117 full-text articles to select 24 full-text articles for final review. These 24 studies enrolled a total of 2068 patients with suspected OSA and evaluated 10 different PMs with one to six channels. Only seven (29%) studies tested PMs in the home setting. The mean difference (bias) between PSG-measured and PM-measured apnea-hypopnea index (AHI) ranged from - 14.8 to 10.6 events/h. At AHI ≥ 5 events/h, the sensitivity of type IV PMs ranged from 67.5-100% and specificity ranged from 25 to 100%. While current evidence is not very strong for the stand-alone use of level IV PMs in clinical practice, they can potentially widen access to diagnosis and treatment of OSA. Policy recommendations regarding HSAT use should also consider the health and broader social implications of false positive and false negative diagnoses.

  8. Fine-mapping and cross-validation of QTLs linked to fatty acid composition in multiple independent interspecific crosses of oil palm.

    PubMed

    Ting, Ngoot-Chin; Yaakub, Zulkifli; Kamaruddin, Katialisa; Mayes, Sean; Massawe, Festo; Sambanthamurthi, Ravigadevi; Jansen, Johannes; Low, Leslie Eng Ti; Ithnin, Maizura; Kushairi, Ahmad; Arulandoo, Xaviar; Rosli, Rozana; Chan, Kuang-Lim; Amiruddin, Nadzirah; Sritharan, Kandha; Lim, Chin Ching; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Singh, Rajinder

    2016-04-14

    The commercial oil palm (Elaeis guineensis Jacq.) produces a mesocarp oil (commonly called 'palm oil') with approximately equal proportions of saturated and unsaturated fatty acids (FAs). An increase in unsaturated FAs content or iodine value (IV) as a measure of the degree of unsaturation would help to open up new markets for the oil. One way to manipulate the fatty acid composition (FAC) in palm oil is through introgression of favourable alleles from the American oil palm, E. oleifera, which has a more unsaturated oil. In this study, a segregating E. oleifera x E. guineensis (OxG) hybrid population for FAC is used to identify quantitative trait loci (QTLs) linked to IV and various FAs. QTL analysis revealed 10 major and two putative QTLs for IV and six FAs, C14:0, C16:0, C16:1, C18:0, C18:1 and C18:2 distributed across six linkage groups (LGs), OT1, T2, T3, OT4, OT6 and T9. The major QTLs for IV and C16:0 on LGOT1 explained 60.0 - 69.0 % of the phenotypic trait variation and were validated in two independent BC2 populations. The genomic interval contains several key structural genes in the FA and oil biosynthesis pathways such as PATE/FATB, HIBCH, BASS2, LACS4 and DGAT1 and also a relevant transcription factor (TF), WRI1. The literature suggests that some of these genes can exhibit pleiotropic effects in the regulatory networks of these traits. Using the whole genome sequence data, markers tightly linked to the candidate genes were also developed. Clustering trait values according to the allelic forms of these candidate markers revealed significant differences in the IV and FAs of the palms in the mapping and validation crosses. The candidate gene approach described and exploited here is useful to identify the potential causal genes linked to FAC and can be adopted for marker-assisted selection (MAS) in oil palm.

  9. The Drosophila TRPA channel, Painless, regulates sexual receptivity in virgin females

    PubMed Central

    Sakai, Takaomi; Kasuya, Junko; Kitamoto, Toshihiro; Aigaki, Toshiro

    2009-01-01

    Transient receptor potential (TRP) channels play crucial roles in sensory perception. Expression of the Drosophila painless (pain) gene, a homolog of the mammalian TRPA1/ANKTM1 gene, in the peripheral nervous system is required for avoidance behavior of noxious heat or wasabi. Here we report a novel role of the Pain TRP channel expressed in the nervous system in the sexual receptivity in Drosophila virgin females. Compared with wild-type females, pain mutant females copulated with wild-type males significantly earlier. Wild-type males showed comparable courtship latency and courtship index toward wild-type and pain mutant females. Therefore, the early copulation observed in wild-type male and pain mutant female pairs is the result of enhanced sexual receptivity in pain mutant females. Involvement of pain in enhanced female sexual receptivity was confirmed by rescue experiments in which expression of a pain transgene in a pain mutant background restored the female sexual receptivity to the wild-type level. Targeted expression of pain RNAi in putative cholinergic or GABAergic neurons phenocopied the mutant phenotype of pain females. On the other hand, target expression of pain RNAi in dopaminergic neurons did not affect female sexual receptivity. In addition, conditional suppression of neurotransmission in putative GABAergic neurons resulted in a similar enhanced sexual receptivity. Our results suggest that Pain TRP channels expressed in cholinergic and/or GABAergic neurons are involved in female sexual receptivity. PMID:19531155

  10. The Drosophila TRPA channel, Painless, regulates sexual receptivity in virgin females.

    PubMed

    Sakai, T; Kasuya, J; Kitamoto, T; Aigaki, T

    2009-07-01

    Transient receptor potential (TRP) channels play crucial roles in sensory perception. Expression of the Drosophila painless (pain) gene, a homolog of the mammalian TRPA1/ANKTM1 gene, in the peripheral nervous system is required for avoidance behavior of noxious heat or wasabi. In this study, we report a novel role of the Pain TRP channel expressed in the nervous system in the sexual receptivity in Drosophila virgin females. Compared with wild-type females, pain mutant females copulated with wild-type males significantly earlier. Wild-type males showed comparable courtship latency and courtship index toward wild-type and pain mutant females. Therefore, the early copulation observed in wild-type male and pain mutant female pairs is the result of enhanced sexual receptivity in pain mutant females. Involvement of pain in enhanced female sexual receptivity was confirmed by rescue experiments in which expression of a pain transgene in a pain mutant background restored the female sexual receptivity to the wild-type level. Targeted expression of pain RNA interference (RNAi) in putative cholinergic or GABAergic neurons phenocopied the mutant phenotype of pain females. However, target expression of pain RNAi in dopaminergic neurons did not affect female sexual receptivity. In addition, conditional suppression of neurotransmission in putative GABAergic neurons resulted in a similar enhanced sexual receptivity. Our results suggest that Pain TRP channels expressed in cholinergic and/or GABAergic neurons are involved in female sexual receptivity.

  11. The effect of dipeptidyl peptidase-IV inhibition on bone in a mouse model of type 2 diabetes

    PubMed Central

    Gallagher, Emily Jane; Sun, Hui; Kornhauser, Caroline; Tobin-Hess, Aviva; Epstein, Sol; Yakar, Shoshana; LeRoith, Derek

    2017-01-01

    Background Individuals with type 2 diabetes (T2D) are at greater risk of bone fractures than those without diabetes. Certain oral diabetic medications may further increase the risk of fracture. Dipeptidyl peptidase-IV (DPP-IV) inhibitors are incretin-based therapies that are being increasingly used for the management of T2D. It has been hypothesized that these agents may reduce fracture risk in those with T2D. In this study, we used a mouse model of T2D to examine the effects of the DPP-IV inhibitor, MK-0626, on bone. Methods Male wild type (WT) and diabetic muscle-lysine-arginine (MKR) mice were treated with MK-0626, pioglitazone, alendronate or vehicle. The effects of treatment with MK-0626 on bone microarchitecture and turnover were compared with treatment with pioglitazone, alendronate and vehicle. Osteoblast differentiation was determined by alkaline phosphatase staining of bone marrow cells from WT and MKR mice after treatment with pioglitazone, MK-0626 or phosphate buffered saline. Results We found that MK-0626 had neutral effects on cortical and trabecular bone in diabetic mice. Pioglitazone had detrimental effects on the trabecular bone of WT but not of diabetic mice. Alendronate caused improvements in cortical and trabecular bone architecture in diabetic and WT mice. MK-0626 did not alter osteoblast differentiation, but pioglitazone impaired osteoblast differentiation in vitro. Conclusions Overall, the DPP-IV inhibitor, MK-0626, had no adverse effects on bone in an animal model of T2D or directly on osteoblasts in culture. These findings are reassuring as DPP-IV inhibitors are being widely used to treat patients with T2D who are already at an increased risk of fractures. PMID:24023014

  12. Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1.

    PubMed Central

    Slepkov, Emily R; Chow, Signy; Lemieux, M Joanne; Fliegel, Larry

    2004-01-01

    NHE1 (Na+/H+ exchanger isoform 1) is a ubiquitously expressed integral membrane protein that regulates intracellular pH in mammalian cells. Proline residues within transmembrane segments have unusual properties, acting as helix breakers and increasing flexibility of membrane segments, since they lack an amide hydrogen. We examined the importance of three conserved proline residues in TM IV (transmembrane segment IV) of NHE1. Pro167 and Pro168 were mutated to Gly, Ala or Cys, and Pro178 was mutated to Ala. Pro168 and Pro178 mutant proteins were expressed at levels similar to wild-type NHE1 and were targeted to the plasma membrane. However, the mutants P167G (Pro167-->Gly), P167A and P167C were expressed at lower levels compared with wild-type NHE1, and a significant portion of P167G and P167C were retained intracellularly, possibly indicating induced changes in the structure of TM IV. P167G, P167C, P168A and P168C mutations abolished NHE activity, and P167A and P168G mutations caused markedly decreased activity. In contrast, the activity of the P178A mutant was not significantly different from that of wild-type NHE1. The results indicate that both Pro167 and Pro168 in TM IV of NHE1 are required for normal NHE activity. In addition, mutation of Pro167 affects the expression and membrane targeting of the exchanger. Thus both Pro167 and Pro168 are strictly required for NHE function and may play critical roles in the structure of TM IV of the NHE. PMID:14680478

  13. Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review

    PubMed Central

    Abdulgader, Shima M.; Shittu, Adebayo O.; Nicol, Mark P.; Kaba, Mamadou

    2015-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) infections are a serious global problem, with considerable impact on patients and substantial health care costs. This systematic review provides an overview on the clonal diversity of MRSA, as well as the prevalence of Panton-Valentine leukocidin (PVL)-positive MRSA in Africa. A search on the molecular characterization of MRSA in Africa was conducted by two authors using predefined terms. We screened for articles published in English and French through to October 2014 from five electronic databases. A total of 57 eligible studies were identified. Thirty-four reports from 15 countries provided adequate genotyping data. CC5 is the predominant clonal complex in the healthcare setting in Africa. The hospital-associated MRSA ST239/ST241-III [3A] was identified in nine African countries. This clone was also described with SCCmec type IV [2B] in Algeria and Nigeria, and type V [5C] in Niger. In Africa, the European ST80-IV [2B] clone was limited to Algeria, Egypt and Tunisia. The clonal types ST22-IV [2B], ST36-II [2A], and ST612-IV [2B] were only reported in South Africa. No clear distinctions were observed between MRSA responsible for hospital and community infections. The community clones ST8-IV [2B] and ST88-IV [2B] were reported both in the hospital and community settings in Angola, Cameroon, Gabon, Ghana, Madagascar, Nigeria, and São Tomé and Príncipe. The proportion of PVL-positive MRSA carriage and/or infections ranged from 0.3 to 100% in humans. A number of pandemic clones were identified in Africa. Moreover, some MRSA clones are limited to specific countries or regions. We strongly advocate for more surveillance studies on MRSA in Africa. PMID:25983721

  14. Validity of DSM-IV attention–deficit/hyperactivity disorder symptom dimensions and subtypes

    PubMed Central

    Willcutt, Erik G.; Nigg, Joel T.; Pennington, Bruce F.; Solanto, Mary V.; Rohde, Luis A.; Tannock, Rosemary; Loo, Sandra K.; Carlson, Caryn L.; McBurnett, Keith; Lahey, Benjamin B.

    2013-01-01

    DSM-IV criteria for ADHD specify two dimensions of inattention and hyperactivity-impulsivity symptoms that are used to define three nominal subtypes: predominantly hyperactive-impulsive type (ADHD-H), predominantly inattentive type (ADHD-I), and combined type (ADHD-C). To aid decision-making for DSM-5 and other future diagnostic systems, a comprehensive literature review and meta-analysis of 546 studies was completed to evaluate the validity of the DSM-IV model of ADHD. Results indicated that DSM-IV criteria identify individuals with significant and persistent impairment in social, academic, occupational, and adaptive functioning when intelligence, demographic factors, and concurrent psychopathology are controlled. Available data overwhelmingly support the concurrent, predictive, and discriminant validity of the distinction between inattention and hyperactivity-impulsivity symptoms, and indicate that nearly all differences among the nominal subtypes are consistent with the relative levels of inattention and hyperactivity-impulsivity symptoms that define the subtypes. In contrast, the validity of the DSM-IV subtype model is compromised by weak evidence for the validity of ADHD-H after first grade, minimal support for the distinction between ADHD-I and ADHD-C in studies of etiological influences, academic and cognitive functioning, and treatment response, and the marked longitudinal instability of all three subtypes. Overall, it is concluded that the DSM-IV ADHD subtypes provide a convenient clinical shorthand to describe the functional and behavioral correlates of current levels of inattention and hyperactivity-impulsivity symptoms, but do not identify discrete subgroups with sufficient long-term stability to justify the classification of distinct forms of the disorder. Empirical support is stronger for an alternative model that would replace the subtypes with dimensional modifiers that reflect the number of inattention and hyperactivity-impulsivity symptoms at the time of assessment. PMID:22612200

  15. Choice of intravenous antibiotic prophylaxis for colorectal surgery does matter.

    PubMed

    Deierhoi, Rhiannon J; Dawes, Lillian G; Vick, Catherine; Itani, Kamal M F; Hawn, Mary T

    2013-11-01

    The Surgical Care Improvement Program endorses mandatory compliance with approved intravenous prophylactic antibiotics; however, oral antibiotics are optional. We hypothesized that surgical site infection (SSI) rates may vary depending on the choice of antibiotic prophylaxis. A retrospective cohort study of elective colorectal procedures using Veterans Affairs Surgical Quality Improvement Program (VASQIP) and SSI outcomes data was linked to the Office of Informatics and Analytics (OIA) and Pharmacy Benefits Management (PBM) antibiotic data from 2005 to 2009. Surgical site infection rates by type of IV antibiotic agent alone (IV) or in combination with oral antibiotic (IV + OA) were determined. Generalized estimating equations were used to examine the association between type of antibiotic prophylaxis and SSI for the entire cohort and stratified by use of oral antibiotics. After 5,750 elective colorectal procedures, 709 SSIs (12.3%) developed within 30 days. Oral antibiotic + IV (n = 2,426) had a lower SSI rate than IV alone (n = 3,324) (6.3% vs 16.7%, p < 0.0001). There was a significant difference in the SSI rate based on type of preoperative IV antibiotic given (p ≤ 0.0001). Generalized estimating equations adjusting for significant covariates of age, body mass index, procedure work relative value units, and operation duration demonstrated an independent protective effect of oral antibiotics (odds ratio [OR] 0.37, 95% CI 0.29 to 0.46), as well as increased rates of SSI associated with ampicillin/sulbactam (OR 2.21, 95% CI 1.37 to 3.56) and second generation cephalosporins (cefoxitin, OR 2.50, 95% CI 1.83 to 3.42; cefotetan, OR 2.70, 95% CI 1.72 to 4.22) when compared with first generation cephalosporin/metronidazole. The choice of IV antibiotic was related to the SSI rate; however, oral antibiotics were associated with reduced SSI rate for every antibiotic class. Published by Elsevier Inc.

  16. Influence of hospital type on survival in stage IV colorectal cancer.

    PubMed

    Hoshino, Nobuaki; Hasegawa, Suguru; Hida, Koya; Kawada, Kenji; Okamura, Ryosuke; Hamada, Madoka; Munemoto, Yoshinori; Sakai, Yoshiharu; Watanabe, Masahiko

    2016-08-01

    Hospital factors along with various patient and surgeon factors are considered to affect the prognosis of colorectal cancer. Hospital volume is well known, but little is known regarding other hospital factors. We reviewed data on 853 patients with stage IV colorectal cancer who underwent elective palliative primary tumor resection between January 2006 and December 2007. To detect the hospital factors that could influence the prognosis of incurable colorectal cancer, the relationships between patient/hospital factors and overall survival were analyzed. Among hospital factors, hospital type (Group A: university hospital or cancer center; Group B: community hospital), hospital volume, and number of colorectal surgeons were examined. In univariate analysis, Group A hospitals showed significantly better prognosis than Group B hospitals (p = 0.034), while hospital volume and number of colorectal surgeons were not associated with overall survival. After adjustment for patient factors in multivariate analysis, hospital type was significantly associated with overall survival (hazard ratio: 1.31; 95 % confidence interval: 1.05-1.63; p = 0.016). However, there was no significant difference in short-term outcomes between hospital types. Hospital type was identified as a hospital factor that possibly affects the prognosis of stage IV colorectal cancer patients.

  17. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  18. Identification of type IV collagen exposure as a molecular imaging target for early detection of thoracic aortic dissection

    PubMed Central

    Xu, Ke; Xu, Chen; Zhang, Yanzhenzi; Qi, Feiran; Yu, Bingran; Li, Ping; Jia, Lixin; Li, Yulin; Xu, Fu-jian; Du, Jie

    2018-01-01

    Thoracic aortic dissection (TAD) is an aggressive and life-threatening vascular disease and there is no effective means of early diagnosis of dissection. Type IV collagen (Col-IV) is a major component of the sub-endothelial basement membrane, which is initially exposed followed by endothelial injury as early-stage event of TAD. So, we want to build a noninvasive diagnostic method to detect early dissection by identifying the exposed Col-IV via MRI. Methods: Col-IV-targeted magnetic resonance/ fluorescence dual probe (Col-IV-DOTA-Gd-rhodamine B; CDR) was synthesized by amide reaction and coordination reaction. Flow cytometry analysis was used to evaluate the cell viability of SMC treated with CDR and fluorescence assays were used to assess the Col-IV targeting ability of CDR in vitro. We then examined the sensitivity and specificity of CDR at different stages of TAD via MRI and bioluminescence imaging in vivo. Results: The localization of Col-IV (under the intima) was observed by histology images. CDR bound specifically to Col-IV-expressing vascular smooth muscle cells and BAPN-induced dissected aorta. The CDR signal was co-detected by magnetic resonance imaging (MRI) and bioluminescence imaging as early as 2 weeks after BAPN administration (pre-dissection stage). The ability to detect rupture of dissected aorta was indicated by a strong normalized signal enhancement (NSE) in vivo. Moreover, NSE was negatively correlated with the time of dissection rupture after BAPN administration (r2 = 0.8482). Conclusion: As confirmed by in vivo studies, the CDR can identify the exposed Col-IV in degenerated aorta to monitor the progress of aortic dissection from the early stage to the rupture via MRI. Thus, CDR-enhanced MRI proposes a potential method for dissection screening, and for monitoring disease progression and therapeutic response. PMID:29290819

  19. Identification and partial characterization of the enzyme of omega: one of five putative DPP IV genes in Drosophila melanogaster

    PubMed Central

    Chihara, Carol J.; Song, Chunyan; LaMonte, Greg; Fetalvero, Kristina; Hinchman, Kristy; Phan, Helen; Pineda, Mario; Robinson, Kelly; Schneider, Gregory P.

    2005-01-01

    The omega (ome) gene product is a modifier of larval cuticle protein 5 and its alleles (and duplicates) in the third instar of Drosophila melanogaster. Using deletion mapping the locus mapped to 70F-71A on the left arm of chromosome 3. A homozygote null mutant (ome 1) shows a pleiotropic phenotype that affected the size, developmental time of the flies, and the fertility (or perhaps the behavior) of homozygous mutant males. The omega gene was verified as producing a dipeptidyl peptidase IV (DPPIV) by genetic analysis, substrate specificity and pH optimum. The identity of the gene was confirmed as CG32145 (cytology 70F4) in the Celera Database (Berkeley Drosophila Genome Project), which is consistent with its deletion map position. The genomic structure of the gene is described and the decrease in DPPIV activity in the mutant ome1 is shown to be due to the gene CG32145 (omega). The D. melanogaster omega DPPIV enzyme was partially purified and characterized. The exons of the ome1 mutant were sequenced and a base substitution mutation in exon 4 was identified that would yield a truncated protein caused by a stop codon. A preliminary study of the compartmentalization of the omega DPPIV enzyme in several organs is also reported. Abbreviations: DPPIV dipeptidyl peptidase IV LCP5 & LCP6 third instar larval cuticle proteins 5 & 6 ome & ome1 omega locus name (CG32145) and mutant allele in D. melanogaster pNA paranotroanilide PMID:17119608

  20. Intelligence in DSM-IV combined type attention-deficit/hyperactivity disorder is not predicted by either dopamine receptor/transporter genes or other previously identified risk alleles for attention-deficit/hyperactivity disorder.

    PubMed

    Sonuga-Barke, Edmund J S; Brookes, Keeley-Joanne; Buitelaar, Jan; Anney, Richard; Bitsakou, Paraskevi; Baeyens, Dieter; Buschgens, Cathelijne; Chen, Wai; Christiansen, Hanna; Eisenberg, Jacques; Kuntsi, Jonna; Manor, Iris; Meliá, Amanda; Mulligan, Aisling; Rommelse, Nanda; Müller, Ueli C; Uebel, Henrik; Banaschewski, Tobias; Ebstein, Richard; Franke, Barbara; Gill, Michael; Miranda, Ana; Oades, Robert D; Roeyers, Herbert; Rothenberger, Aribert; Sergeant, Joseph; Steinhausen, Hans Christoph; Thompson, Margaret; Taylor, Eric; Asherson, Philip; Faraone, Stephen V

    2008-04-05

    A major goal of genetic studies of attention deficit hyperactivity disorder (ADHD) is to identify individual characteristics that might help segregate the disorder's inherent heterogeneity. [Mill et al. (2006); Arch Ger Psychiatry 63:462-469] recently reported a potentially important association between two dopamine-related risk polymorphisms (DRD4 variable number tandem repeat (VNTR) in exon 3 and DAT1 VNTR in the 3' UTR) and lowered IQ in ADHD. The objective of the current study was to replicate the [Mill et al. (2006); Arch Ger Psychiatry 63:462-469] findings in a clinical sample and to extend the analysis to a large range of alternative SNP markers of putative ADHD risk alleles identified in a recent study [Brookes et al. (2006); Mol Genet 11:934-953]. Participants were 1081 children and adolescents with a research-confirmed combined type ADHD diagnosis and 1300 unaffected siblings who took part in the International Multi-centre ADHD Genetics (IMAGE) project. They were recruited from multiple settings from across Europe: Belgium, Britain, Germany, Ireland, Israel, Netherlands, Spain and Switzerland. The results were that ADHD was associated with reduced IQ. However, there was no association between the two dopamine-related risk polymorphisms and IQ in either the probands or their siblings. Furthermore, other selected genetic markers previously demonstrated to be associated with ADHD in this sample were not associated with IQ. This large scale study with a clinically ascertained and regorously diagnosed sample failed to replicate the association between genetic polymorphisms in the dopamine system and IQ in ADHD. We also observed no association of other SNPs with IQ in ADHD. Copyright 2007 Wiley-Liss, Inc.

  1. Enterococcus faecium Biofilm Formation: Identification of Major Autolysin AtlAEfm, Associated Acm Surface Localization, and AtlAEfm-Independent Extracellular DNA Release

    PubMed Central

    Paganelli, Fernanda L.; Willems, Rob J. L.; Jansen, Pamela; Hendrickx, Antoni; Zhang, Xinglin; Bonten, Marc J. M.; Leavis, Helen L.

    2013-01-01

    ABSTRACT Enterococcus faecium is an important multidrug-resistant nosocomial pathogen causing biofilm-mediated infections in patients with medical devices. Insight into E. faecium biofilm pathogenesis is pivotal for the development of new strategies to prevent and treat these infections. In several bacteria, a major autolysin is essential for extracellular DNA (eDNA) release in the biofilm matrix, contributing to biofilm attachment and stability. In this study, we identified and functionally characterized the major autolysin of E. faecium E1162 by a bioinformatic genome screen followed by insertional gene disruption of six putative autolysin genes. Insertional inactivation of locus tag EfmE1162_2692 resulted in resistance to lysis, reduced eDNA release, deficient cell attachment, decreased biofilm, decreased cell wall hydrolysis, and significant chaining compared to that of the wild type. Therefore, locus tag EfmE1162_2692 was considered the major autolysin in E. faecium and renamed atlAEfm. In addition, AtlAEfm was implicated in cell surface exposure of Acm, a virulence factor in E. faecium, and thereby facilitates binding to collagen types I and IV. This is a novel feature of enterococcal autolysins not described previously. Furthermore, we identified (and localized) autolysin-independent DNA release in E. faecium that contributes to cell-cell interactions in the atlAEfm mutant and is important for cell separation. In conclusion, AtlAEfm is the major autolysin in E. faecium and contributes to biofilm stability and Acm localization, making AtlAEfm a promising target for treatment of E. faecium biofilm-mediated infections. PMID:23592262

  2. Depressed mitochondrial function and electron transport Complex II-mediated H2O2 production in the cortex of type 1 diabetic rodents.

    PubMed

    Chowdhury, Subir Roy; Djordjevic, Jelena; Thomson, Ella; Smith, Darrell R; Albensi, Benedict C; Fernyhough, Paul

    2018-05-23

    Abnormalities in mitochondrial function under diabetic conditions can lead to deficits in function of cortical neurons and their support cells exhibiting a pivotal role in the pathogenesis of several neurodegenerative disorders, including Alzheimer's disease. We aimed to assess simultaneously mitochondrial respiration rates and membrane potential or H 2 O 2 generation and proteins involved in mitochondrial dynamics, antioxidants and AMPK/SIRT/PGC-1α pathway activity in cortex under diabetic conditions. Cortical mitochondria from streptozotocin (STZ)-induced type 1 diabetic rats or mice, and aged-match controls were used for simultaneous measurements of mitochondrial respiration rates and mitochondrial membrane potential (mtMP) or H 2 O 2 using OROBOROS oxygraph and measurements of enzymatic activities by a spectrophotometer. Protein levels in cortical mitochondria and homogenates were determined by Western blotting. Mitochondrial coupled respiration rates and FCCP-induced uncoupled respiration rates were significantly decreased in mitochondria of STZ-diabetic cortical rats compared to controls. The mtMP in the presence of ADP was significantly depolarized and succinate-dependent respiration rates and H 2 O 2 were significantly diminished in mitochondria of diabetic animals compared to controls, accompanied with reduced expression of CuZn- and Mn-superoxide dismutase. The enzymatic activities of Complex I, II, and IV and protein levels of certain components of Complex I and II, mitofusin 2 (Mfn2), dynamin-related protein 1 (DRP1), P-AMPK, SIRT2 and PGC-1α were significantly diminished in diabetic cortex. Deficits in mitochondrial function, dynamics, and antioxidant capabilities putatively mediated through sub-optimal AMPK/SIRT/PGC-1α signaling, are involved in the development of early sub-clinical neurodegeneration in the cortex under diabetic conditions. Copyright © 2017. Published by Elsevier Inc.

  3. Identification of a Novel Feline Picornavirus from the Domestic Cat

    PubMed Central

    Lau, Susanna K. P.; Woo, Patrick C. Y.; Yip, Cyril C. Y.; Choi, Garnet K. Y.; Wu, Ying; Bai, Ru; Fan, Rachel Y. Y.; Lai, Kenneth K. Y.; Chan, Kwok-Hung

    2012-01-01

    While picornaviruses are known to infect different animals, their existence in the domestic cat was unknown. We describe the discovery of a novel feline picornavirus (FePV) from stray cats in Hong Kong. From samples from 662 cats, FePV was detected in fecal samples from 14 cats and urine samples from 2 cats by reverse transcription-PCR (RT-PCR). Analysis of five FePV genomes revealed a distinct phylogenetic position and genomic features, with low sequence homologies to known picornaviruses especially in leader and 2A proteins. Among the viruses that belong to the closely related bat picornavirus groups 1 to 3 and the genus Sapelovirus, G+C content and sequence analysis of P1, P2, and P3 regions showed that FePV is most closely related to bat picornavirus group 3. However, FePV possessed other distinct features, including a putative type IV internal ribosome entry site/segment (IRES) instead of type I IRES in bat picornavirus group 3, protein cleavage sites, and H-D-C catalytic triad in 3Cpro different from those in sapeloviruses and bat picornaviruses, and the shortest leader protein among known picornaviruses. These results suggest that FePV may belong to a new genus in the family Picornaviridae. Western blot analysis using recombinant FePV VP1 polypeptide showed a high seroprevalence of 33.6% for IgG among the plasma samples from 232 cats tested. IgM was also detected in three cats positive for FePV in fecal samples, supporting recent infection in these cats. Further studies are important to understand the pathogenicity, epidemiology, and genetic evolution of FePV in these common pet animals. PMID:22031936

  4. "Features of two proteins of Leptospira interrogans with potential role in host-pathogen interactions"

    PubMed Central

    2012-01-01

    Background Leptospirosis is considered a re-emerging infectious disease caused by pathogenic spirochaetes of the genus Leptospira. Pathogenic leptospires have the ability to survive and disseminate to multiple organs after penetrating the host. Leptospires were shown to express surface proteins that interact with the extracellular matrix (ECM) and to plasminogen (PLG). This study examined the interaction of two putative leptospiral proteins with laminin, collagen Type I, collagen Type IV, cellular fibronectin, plasma fibronectin, PLG, factor H and C4bp. Results We show that two leptospiral proteins encoded by LIC11834 and LIC12253 genes interact with laminin in a dose - dependent and saturable mode, with dissociation equilibrium constants (KD) of 367.5 and 415.4 nM, respectively. These proteins were named Lsa33 and Lsa25 (Leptospiral surface adhesin) for LIC11834 and LIC12253, respectively. Metaperiodate - treated laminin reduced Lsa25 - laminin interaction, suggesting that sugar moieties of this ligand participate in this interaction. The Lsa33 is also PLG - binding receptor, with a KD of 23.53 nM, capable of generating plasmin in the presence of an activator. Although in a weak manner, both proteins interact with C4bp, a regulator of complement classical route. In silico analysis together with proteinase K and immunoflorescence data suggest that these proteins might be surface exposed. Moreover, the recombinant proteins partially inhibited leptospiral adherence to immobilized laminin and PLG. Conclusions We believe that these multifunctional proteins have the potential to participate in the interaction of leptospires to hosts by mediating adhesion and by helping the bacteria to escape the immune system and to overcome tissue barriers. To our knowledge, Lsa33 is the first leptospiral protein described to date with the capability of binding laminin, PLG and C4bp in vitro. PMID:22463075

  5. Expression of heat shock protein 47 is increased in remnant kidney and correlates with disease progression

    PubMed Central

    SUNAMOTO, MASAAKI; KUZE, KOGO; IEHARA, NORIYUKI; TAKEOKA, HIROYA; NAGATA, KAZUHIRO; KITA, TORU; DOI, TOSHIO

    1998-01-01

    Glomerulosclerosis is characterized by accumulation of the mesangial extracellular matrix, including type I and IV collagen. The processing for the collagens in the glomeruli may play a critical role for development of glomerulosclerosis. We examined the expression of heat shock protein 47 (HSP47), a collagen-binding molecular chaperone in the progresive glomerulosclerosis model. Subtotally nephrectomized rats, unlike sham-operated rats, developed focal and segmental glomerulosclerosis. Immunological staining demonstrated an increased expression of HSP47 which paralleled the expression of type I and IV collagen in the glomeruli of the nephrectomized rats as the glomerulosclerosis developed. The mRNA levels encoding type I and type IV collagen and HSP47 were increased 3.4 fold, 3.6 fold and 2.8 fold, respectively, at week 7 after nephrectomy. By in situ hybridization, the expression of HSP47 mRNA was determined to be localized to the glomeruli with segmental sclerosis. These results suggest that HSP47 may play a central role in the process of extracellular matrix accumulation during the development of glomerulosclerosis. PMID:9741355

  6. Chondroitin sulphates A, B and C, collagen types I-IV and fibronectin in venous sinus of the red pulp in human spleen.

    PubMed

    Rovenská, E; Michalka, P; Papincák, J; Durdík, S; Jakubovský, J

    2005-01-01

    The morphological relationship of chondroitin sulphates A, B, and C, collagen types I-IV and fibronectin in the wall of venous sinuses of the red pulp in human spleen has not been a focus of interest among morphologists. Regarding the hypothesis that the structure of the spleen lends it the function of a blood filter the substances described in our study might play a significant role in the functional morphology. Of 146 human spleen surgical specimens, groups of 12 specimens each were examined under a light microscope using the method of antibodies against fibronectin, against collagen types I-IV and against chondroitin sulphates A, B, and C. The sections of the red pulp of human spleen stained with hematoxylin and eosin provided limited information about the wall of the sinuses. Chondroitin sulphates A and B were observed on the surface of sinus-lining cells (SLC), and fibronectin was detected on the surface of the annular fibers. Collagen type 11 was observed almost in the same places as chondroitin sulphates A and B. Collagen type IV was present in annular fibers of the wall of the sinus and in the basement membrane, like fibronectin. Chondroitin sulphate was not present in the walls of sinuses. Binding of antibodies against chondroitin sulphate A and against chondroitin sulphate B indicates the presence of chondroitin sulfates on the surface of SLC, where they probably play a role in helping the human organism to recognize alien and self substances. The presence of chondroitin,sulphates A and B probably affects inhibition of binding of cells with collagen type I, but not with fibronectin.

  7. Association of history of allergies and influenza-like infections with laryngeal cancer in a case-control study.

    PubMed

    Filippidis, Filippos T; Schwartz, Stephen M; Becker, Nikolaus; Dyckhoff, Gerhard; Kirschfink, Michael; Dietz, Andreas; Becher, Heiko; Ramroth, Heribert

    2015-08-01

    Prior studies suggest that history of allergy and infections early in life might be inversely associated with cancer. We explored the association between allergies, recent influenza infections and laryngeal cancer risk. We used data from a case-control study which included 229 cases of laryngeal cancer and 769 population controls matched for age and sex. History of a physician-diagnosed allergy, influenza-like infections in the past 5 years, smoking, alcohol consumption and occupational exposure to carcinogens were self-reported. Allergies were classified into two groups (Type I and Type IV), according to the underlying immunologic mechanism. Conditional logistic regression models were fitted using laryngeal cancer as the outcome, adjusting for smoking, alcohol consumption and occupational exposure and stratified for age and sex. Having any allergy was not associated significantly with laryngeal cancer. Although Type I and Type IV allergies were non-significantly associated with laryngeal cancer, Type IV allergies showed a strong inverse association after adjusting for smoking and alcohol (OR 0.50, 95 % CI 0.22-1.2). Participants who reported at least one influenza-like infection during the past 5 years were significantly less likely to have laryngeal cancer (OR 0.57, 95 % CI 0.39-0.81). After considering fever (≥38.5 °C) as a criterion for influenza infection, the association between influenza infection and laryngeal cancer was even stronger (OR 0.29, 95 % CI 0.13-0.63). We found no significant association between any allergy and laryngeal cancer, some indication of an inverse association between Type IV allergy and laryngeal cancer, whereas recent influenza infections were inversely associated with laryngeal cancer risk.

  8. Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

    PubMed Central

    Charvin, G.; Bensimon, D.; Croquette, V.

    2003-01-01

    Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541

  9. L-arginine mediated renaturation enhances yield of human, α6 type IV collagen non-collagenous domain from bacterial inclusion bodies

    PubMed Central

    Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Akul Sudhakar, Yakkanti

    2012-01-01

    The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated. PMID:22512648

  10. L-arginine mediated renaturation enhances yield of human, α6 Type IV collagen non-collagenous domain from bacterial inclusion bodies.

    PubMed

    Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Sudhakar, Yakkanti Akul

    2012-10-01

    The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated.

  11. [Joint endoprosthesis pathology. Histopathological diagnostics and classification].

    PubMed

    Krenn, V; Morawietz, L; Jakobs, M; Kienapfel, H; Ascherl, R; Bause, L; Kuhn, H; Matziolis, G; Skutek, M; Gehrke, T

    2011-05-01

    Prosthesis durability has steadily increased with high 10-year rates of 88-95%. However, four pathogenetic groups of diseases can decrease prosthesis durability: (1) periprosthetic wear particle disease (aseptic loosening) (2) bacterial infection (septic loosening) (3) periprosthetic ossification, and (4) arthrofibrosis. The histopathological "extended consensus classification of periprosthetic membranes" includes four types of membranes, arthrofibrosis, and osseous diseases of endoprosthetics: The four types of neosynovia are: wear particle-induced type (type I), mean prosthesis durability (MPD) in years 12.0; infectious type (type II), MPD 2.5; combined type (type III) MPD 4.2; and indeterminate type (type IV), MPD 5.5. Arthrofibrosis can be determined in three grades: grade 1 needs clinical information to be differentiated from a type IV membrane, and grades 2 & 3 can be diagnosed histopathologically. Periprosthetic ossification, osteopenia-induced fractures, and aseptic osteonecrosis can be histopathologically diagnosed safely with clinical information. The extended consensus classification of periprosthetic membranes may be a diagnostic groundwork for a future national endoprosthesis register.

  12. The Zur regulon of Corynebacterium glutamicum ATCC 13032

    PubMed Central

    2010-01-01

    Background Zinc is considered as an essential element for all living organisms, but it can be toxic at large concentrations. Bacteria therefore tightly regulate zinc metabolism. The Cg2502 protein of Corynebacterium glutamicum was a candidate to control zinc metabolism in this species, since it was classified as metalloregulator of the zinc uptake regulator (Zur) subgroup of the ferric uptake regulator (Fur) family of DNA-binding transcription regulators. Results The cg2502 (zur) gene was deleted in the chromosome of C. glutamicum ATCC 13032 by an allelic exchange procedure to generate the zur-deficient mutant C. glutamicum JS2502. Whole-genome DNA microarray hybridizations and real-time RT-PCR assays comparing the gene expression in C. glutamicum JS2502 with that of the wild-type strain detected 18 genes with enhanced expression in the zur mutant. The expression data were combined with results from cross-genome comparisons of shared regulatory sites, revealing the presence of candidate Zur-binding sites in the mapped promoter regions of five transcription units encoding components of potential zinc ABC-type transporters (cg0041-cg0042/cg0043; cg2911-cg2912-cg2913), a putative secreted protein (cg0040), a putative oxidoreductase (cg0795), and a putative P-loop GTPase of the COG0523 protein family (cg0794). Enhanced transcript levels of the respective genes in C. glutamicum JS2502 were verified by real-time RT-PCR, and complementation of the mutant with a wild-type zur gene reversed the effect of differential gene expression. The zinc-dependent expression of the putative cg0042 and cg2911 operons was detected in vivo with a gfp reporter system. Moreover, the zinc-dependent binding of purified Zur protein to double-stranded 40-mer oligonucleotides containing candidate Zur-binding sites was demonstrated in vitro by DNA band shift assays. Conclusion Whole-genome expression profiling and DNA band shift assays demonstrated that Zur directly represses in a zinc-dependent manner the expression of nine genes organized in five transcription units. Accordingly, the Zur (Cg2502) protein is the key transcription regulator for genes involved in zinc homeostasis in C. glutamicum. PMID:20055984

  13. NATIONAL COASTAL CONDITION REPORT IV | Science ...

    EPA Pesticide Factsheets

    The National Coastal Condition Report IV (NCCR IV) is the fourth in a series of environmental assessments of U.S. coastal waters and the Great Lakes. The report includes assessments of all the nation’s estuaries in the contiguous 48 states and Puerto Rico, south-eastern Alaska, Hawaii, the U.S. Virgin Islands, Guam, and American Samoa. The NCCR IV presents four main types of data: (1) coastal monitoring data, (2) coastal ocean/ offshore monitoring data, (3) offshore fisheries data, and (4) assessment and advisory data (new to NCCR IV). The NCCR IV relies heavily on coastal monitoring data from EPA’s National Coastal Assessment (NCA) to assess coastal condition by evaluating five indicators of condition—water quality, sediment quality, benthic community condition, coastal habitat loss, and fish tissue contaminants. To assess and report on the condition of the nation's coastal resources

  14. Genetic dissimilarity of putative gamma-ray-induced 'Preciosa-AAAB-Pome type' banana (Musa sp) mutants based on multivariate statistical analysis.

    PubMed

    Pestana, R K N; Amorim, E P; Ferreira, C F; Amorim, V B O; Oliveira, L S; Ledo, C A S; Silva, S O

    2011-10-25

    Bananas are among the most important fruit crops worldwide, being cultivated in more than 120 countries, mainly by small-scale producers. However, short-stature high-yielding bananas presenting good agronomic characteristics are hard to find. Consequently, wind continues to damage a great number of plantations each year, leading to lodging of plants and bunch loss. Development of new cultivars through conventional genetic breeding methods is hindered by female sterility and the low number of seeds. Mutation induction seems to have great potential for the development of new cultivars. We evaluated genetic dissimilarity among putative 'Preciosa' banana mutants generated by gamma-ray irradiation, using morphoagronomic characteristics and ISSR markers. The genetic distances between the putative 'Preciosa' mutants varied from 0.21 to 0.66, with a cophenetic correlation coefficient of 0.8064. We found good variability after irradiation of 'Preciosa' bananas; this procedure could be useful for banana breeding programs aimed at developing short-stature varieties with good agronomic characteristics.

  15. Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

    PubMed

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

  16. 2- and 3-substituted imidazo[1,2-a]pyrazines as inhibitors of bacterial type IV secretion

    PubMed Central

    Sayer, James R.; Walldén, Karin; Pesnot, Thomas; Campbell, Frederick; Gane, Paul J.; Simone, Michela; Koss, Hans; Buelens, Floris; Boyle, Timothy P.; Selwood, David L.; Waksman, Gabriel; Tabor, Alethea B.

    2014-01-01

    A novel series of 8-amino imidazo[1,2-a]pyrazine derivatives has been developed as inhibitors of the VirB11 ATPase HP0525, a key component of the bacterial type IV secretion system. A flexible synthetic route to both 2- and 3-aryl substituted regioisomers has been developed. The resulting series of imidazo[1,2-a]pyrazines has been used to probe the structure–activity relationships of these inhibitors, which show potential as antibacterial agents. PMID:25438770

  17. Sfg

    NASA Astrophysics Data System (ADS)

    Fischer, R. X.; Baur, W. H.

    This document is part of Subvolume E `Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes RON to STI' of Volume 14 `Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV `Physical Chemistry'.

  18. Vet

    NASA Astrophysics Data System (ADS)

    Fischer, R. X.; Baur, W. H.

    This document is part of Subvolume F 'Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes STO to ZON' of Volume 14 'Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV 'Physical Chemistry'.

  19. Juvenile pityriasis rubra pilaris: report of 28 cases in Taiwan.

    PubMed

    Yang, Chao-Chun; Shih, I-Hsin; Lin, Wan-Lung; Yu, Yi-Sheng; Chiu, Hsien-Ching; Huang, Po-Han; Cheng, Yu-Wen; Lee, Julia Yu-Yun; Chen, WenChieh

    2008-12-01

    Pityriasis rubra pilaris (PRP) is a papulosquamous dermatosis uncommon in juveniles. Large-scale studies are limited, especially from Asian countries. We sought to analyze the clinical manifestations of juvenile PRP in Taiwanese patients and compare them with reported series in the literature. The diagnosis of juvenile PRP was made based on clinical-histopathologic correlation. The therapeutic response and disease course were followed up by re-examination of the patients or by telephone. A total of 47 patients were identified, with histopathologic confirmation of the clinical diagnosis of juvenile PRP in 28 cases. A preponderance of Griffiths' type IV PRP (85.7%) rather than type III PRP (14.3%) was found. Palmoplantar hyperkeratosis appeared to be a cardinal feature. In patients with type IV PRP, skin lesions in areas other than the elbows/knees and palms/soles were common. Treatment with systemic acitretin in 6 patients failed to effect a dose- or time-dependent improvement. In contrast with other studies, two thirds of our patients with type III and IV juvenile PRP had a protracted course lasting more than 3 years. This study was a retrospective review. Patient compliance with treatment was frequently poor. Type IV juvenile PRP predominated but our cases showed a wider distribution of skin lesions than is typically described. When children present with an acute onset of diffuse palmoplantar hyperkeratosis, a diagnosis of juvenile PRP should be considered. Because of the divergent clinical manifestations of juvenile PRP in different populations, there is a need to modify and re-evaluate classification systems based on regional differences.

  20. Alternative Neisseria spp. type IV pilin glycosylation with a glyceramido acetamido trideoxyhexose residue

    PubMed Central

    Chamot-Rooke, Julia; Rousseau, Benoit; Lanternier, Fanny; Mikaty, Guillain; Mairey, Emilie; Malosse, Christian; Bouchoux, Guy; Pelicic, Vladimir; Camoin, Luc; Nassif, Xavier; Duménil, Guillaume

    2007-01-01

    The importance of protein glycosylation in the interaction of pathogenic bacteria with their host is becoming increasingly clear. Neisseria meningitidis, the etiological agent of cerebrospinal meningitis, crosses cellular barriers after adhering to host cells through type IV pili. Pilin glycosylation genes (pgl) are responsible for the glycosylation of PilE, the major subunit of type IV pili, with the 2,4-diacetamido-2,4,6-trideoxyhexose residue. Nearly half of the clinical isolates, however, display an insertion in the pglBCD operon, which is anticipated to lead to a different, unidentified glycosylation. Here the structure of pilin glycosylation was determined in such a strain by “top-down” MS approaches. MALDI-TOF, nanoelectrospray ionization Fourier transform ion cyclotron resonance, and nanoelectrospray ionization quadrupole TOF MS analysis of purified pili preparations originating from N. meningitidis strains, either wild type or deficient for pilin glycosylation, revealed a glycan mass inconsistent with 2,4-diacetamido-2,4,6-trideoxyhexose or any sugar in the databases. This unusual modification was determined by in-source dissociation of the sugar from the protein followed by tandem MS analysis with collision-induced fragmentation to be a hexose modified with a glyceramido and an acetamido group. We further show genetically that the nature of the sugar present on the pilin is determined by the carboxyl-terminal region of the pglB gene modified by the insertion in the pglBCD locus. We thus report a previously undiscovered monosaccharide involved in posttranslational modification of type IV pilin subunits by a MS-based approach and determine the molecular basis of its biosynthesis. PMID:17804791

  1. HaploReg v4: systematic mining of putative causal variants, cell types, regulators and target genes for human complex traits and disease.

    PubMed

    Ward, Lucas D; Kellis, Manolis

    2016-01-04

    More than 90% of common variants associated with complex traits do not affect proteins directly, but instead the circuits that control gene expression. This has increased the urgency of understanding the regulatory genome as a key component for translating genetic results into mechanistic insights and ultimately therapeutics. To address this challenge, we developed HaploReg (http://compbio.mit.edu/HaploReg) to aid the functional dissection of genome-wide association study (GWAS) results, the prediction of putative causal variants in haplotype blocks, the prediction of likely cell types of action, and the prediction of candidate target genes by systematic mining of comparative, epigenomic and regulatory annotations. Since first launching the website in 2011, we have greatly expanded HaploReg, increasing the number of chromatin state maps to 127 reference epigenomes from ENCODE 2012 and Roadmap Epigenomics, incorporating regulator binding data, expanding regulatory motif disruption annotations, and integrating expression quantitative trait locus (eQTL) variants and their tissue-specific target genes from GTEx, Geuvadis, and other recent studies. We present these updates as HaploReg v4, and illustrate a use case of HaploReg for attention deficit hyperactivity disorder (ADHD)-associated SNPs with putative brain regulatory mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Inactivation of vimF, a Putative Glycosyltransferase Gene Downstream of vimE, Alters Glycosylation and Activation of the Gingipains in Porphyromonas gingivalis W83

    PubMed Central

    Vanterpool, Elaine; Roy, Francis; Fletcher, Hansel M.

    2005-01-01

    Regulation/activation of the Porphyromonas gingivalis gingipains is poorly understood. A 1.2-kb open reading frame, a putative glycosyltransferase, downstream of vimE, was cloned, insertionally inactivated using the ermF-ermAM antibiotic resistance cassette, and used to create a defective mutant by allelic exchange. In contrast to the wild-type W83 strain, this mutant, designated P. gingivalis FLL95, was nonpigmented and nonhemolytic when plated on Brucella blood agar. Arginine- and lysine-specific gingipain activities were reduced by approximately 97% and 96%, respectively, relative to that of the parent strain. These activities were unaffected by the growth phase, in contrast to the vimA-defective mutant P. gingivalis FLL92. Expression of the rgpA, rgpB, and kgp gingipain genes was unaffected in P. gingivalis FLL95 in comparison to the wild-type strain. In nonactive gingipain extracellular protein fractions, multiple high-molecular-weight proteins immunoreacted with gingipain-specific antibodies. The specific gingipain-associated sugar moiety recognized by monoclonal antibody 1B5 was absent in FLL95. Taken together, these results suggest that the vimE downstream gene, designated vimF (virulence modulating gene F), which is a putative glycosyltransferase group 1, is involved in the regulation of the major virulence factors of P. gingivalis. PMID:15972484

  3. Mitochondrial phylogeny of grey mullets (Acanthopterygii: Mugilidae) suggests high proportion of cryptic species.

    PubMed

    Durand, Jean-Dominique; Borsa, Philippe

    2015-04-01

    The low level of morphometric variability and the poor phylogenetic information borne by the morpho-anatomical characters used thus far in the systematics of grey mullets (Mugilidae) emphasize the utility of molecular systematics in this family. A recent mitochondrial phylogeny of grey mullets has uncovered multiple deep lineages within several species, flagging putative cryptic species. Here, we considered that several of the deeply divergent lineages represent separate species based on either the tree topology, independent data from nuclear markers, geographic distributions, or a combination of the foregoing. By analogy with these well-documented cases, we considered other deep lineages in seven genera we focused on to represent putative cryptic species. Up to two cryptic species were thus potentially detected in the genus Chelon, three in Crenimugil (including two within the single Crenimugil seheli), two in Dajaus, one in Ellochelon, 16 in Mugil (including 13 within the single M. cephalus), two in Osteomugil, and 10 in Planiliza. Wherever possible, we kept the current species epithets to designate those lineages that unambiguously correspond to the type material, based on type locality, and we assigned arbitrary letters (sp. A, B, etc.) to the other lineages. We present a molecular diagnosis for 24 of the species analysed in this work, as well as for 25 putative cryptic species. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  4. A Putative Type III Secretion System Effector Encoded by the MA20_12780 Gene in Bradyrhizobium japonicum Is-34 Causes Incompatibility with Rj4 Genotype Soybeans

    PubMed Central

    Hashimoto, Syougo; Okizaki, Kouhei; Kanesaki, Yu; Yoshikawa, Hirofumi; Yamakawa, Takeo

    2015-01-01

    The nodulation of Bradyrhizobium japonicum Is-34 is restricted by Rj4 genotype soybeans (Glycine max). To identify the genes responsible for this incompatibility, Tn5 mutants of B. japonicum Is-34 that were able to overcome this nodulation restriction were obtained. Analysis of the Tn5 mutants revealed that Tn5 was inserted into a region containing the MA20_12780 gene. In addition, direct disruption of this gene using marker exchange overcame the nodulation restriction by Rj4 genotype soybeans. The MA20_12780 gene has a tts box motif in its upstream region, indicating a possibility that this gene encodes a type III secretion system (T3SS) effector protein. Bioinformatic characterization revealed that the MA20_12780 protein contains the small ubiquitin-like modifier (SUMO) protease domain of the C48 peptidase (ubiquitin-like protease 1 [Ulp1]) family. The results of the present study indicate that a putative T3SS effector encoded by the MA20_12780 gene causes the incompatibility with Rj4 genotype soybeans, and they suggest the possibility that the nodulation restriction of B. japonicum Is-34 may be due to Rj4 genotype soybeans recognizing the putative T3SS effector (MA20_12780 protein) as a virulence factor. PMID:26092458

  5. A Putative Type III Secretion System Effector Encoded by the MA20_12780 Gene in Bradyrhizobium japonicum Is-34 Causes Incompatibility with Rj4 Genotype Soybeans.

    PubMed

    Tsurumaru, Hirohito; Hashimoto, Syougo; Okizaki, Kouhei; Kanesaki, Yu; Yoshikawa, Hirofumi; Yamakawa, Takeo

    2015-09-01

    The nodulation of Bradyrhizobium japonicum Is-34 is restricted by Rj4 genotype soybeans (Glycine max). To identify the genes responsible for this incompatibility, Tn5 mutants of B. japonicum Is-34 that were able to overcome this nodulation restriction were obtained. Analysis of the Tn5 mutants revealed that Tn5 was inserted into a region containing the MA20_12780 gene. In addition, direct disruption of this gene using marker exchange overcame the nodulation restriction by Rj4 genotype soybeans. The MA20_12780 gene has a tts box motif in its upstream region, indicating a possibility that this gene encodes a type III secretion system (T3SS) effector protein. Bioinformatic characterization revealed that the MA20_12780 protein contains the small ubiquitin-like modifier (SUMO) protease domain of the C48 peptidase (ubiquitin-like protease 1 [Ulp1]) family. The results of the present study indicate that a putative T3SS effector encoded by the MA20_12780 gene causes the incompatibility with Rj4 genotype soybeans, and they suggest the possibility that the nodulation restriction of B. japonicum Is-34 may be due to Rj4 genotype soybeans recognizing the putative T3SS effector (MA20_12780 protein) as a virulence factor. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. Failure mechanisms and closed reduction of a constrained tripolar acetabular liner.

    PubMed

    Robertson, William J; Mattern, Christopher J; Hur, John; Su, Edwin P; Pellicci, Paul M

    2009-02-01

    Unlike traditional bipolar constrained liners, the Osteonics Omnifit constrained acetabular insert is a tripolar device, consisting of an inner bipolar bearing articulating within an outer, true liner. Every reported failure of the Omnifit tripolar implant has been by failure at the shell-bone interface (Type I failure), failure at the shell-liner interface (Type II failure), or failure of the locking mechanism resulting in dislocation of the bipolar-liner interface (Type III failure). In this report we present two cases of failure of the Omnifit tripolar at the bipolar-femoral head interface. To our knowledge, these are the first reported cases of failure at the bipolar-femoral head interface (Type IV failure). In addition, we described the first successful closed reduction of a Type IV failure.

  7. Whole-genome comparison of meticillin-resistant Staphylococcus aureus CC22 SCCmecIV from people and their in-contact pets.

    PubMed

    Loeffler, Anette; McCarthy, Alex; Lloyd, David H; Musilová, Eva; Pfeiffer, Dirk U; Lindsay, Jodi A

    2013-10-01

    Meticillin-resistant Staphylococcus aureus (MRSA) infections remain important medical and veterinary challenges. The MRSA isolated from dogs and cats typically belong to dominant hospital-associated clones, in the UK mostly EMRSA-15 (CC22 SCCmecIV), suggesting original human-to-animal transmission. Nevertheless, little is known about host-specific genetic variation within the same S. aureus lineage. To identify host-specific variation amongst MRSA CC22 SCCmecIV by comparing isolates from pets with those from in-contact humans using whole-genome microarray. Six pairs of MRSA CC22 SCCmecIV from human carriers (owners and veterinary staff) and their respective infected in-contact pets were compared using a 62-strain whole-genome S. aureus microarray (SAM-62). The presence of putative host-specific genes was subsequently determined in a larger number of human (n = 47) and pet isolates (n = 93) by PCR screening. Variation in mobile genetic elements (MGEs) occurred frequently and appeared largely independent of host and in-contact pair. A plasmid (SAP078A) encoding heavy-metal resistance genes (arsR, arsA, cadA, cadC, mco and copB) was found in three of six human and none of six animal isolates. However, only two of four resistance genes were associated with human hosts (P = 0.015 for arsA and cadA). The variation found amongst MGEs highlights that genetic adaptation in MRSA continues. However, host-specific MGEs were not detected, which supports the hypothesis that pets may not be natural hosts of MRSA CC22 and emphasizes that rigorous hygiene measures are critical to prevent contamination and infection of dogs and cats. The host specificity of individual heavy-metal resistance genes warrants further investigation into different selection pressures in humans and animals. © 2013 ESVD and ACVD.

  8. Tentacle Transcriptome and Venom Proteome of the Pacific Sea Nettle, Chrysaora fuscescens (Cnidaria: Scyphozoa)

    PubMed Central

    Ponce, Dalia; Brinkman, Diane L.; Potriquet, Jeremy; Mulvenna, Jason

    2016-01-01

    Jellyfish venoms are rich sources of toxins designed to capture prey or deter predators, but they can also elicit harmful effects in humans. In this study, an integrated transcriptomic and proteomic approach was used to identify putative toxins and their potential role in the venom of the scyphozoan jellyfish Chrysaora fuscescens. A de novo tentacle transcriptome, containing more than 23,000 contigs, was constructed and used in proteomic analysis of C. fuscescens venom to identify potential toxins. From a total of 163 proteins identified in the venom proteome, 27 were classified as putative toxins and grouped into six protein families: proteinases, venom allergens, C-type lectins, pore-forming toxins, glycoside hydrolases and enzyme inhibitors. Other putative toxins identified in the transcriptome, but not the proteome, included additional proteinases as well as lipases and deoxyribonucleases. Sequence analysis also revealed the presence of ShKT domains in two putative venom proteins from the proteome and an additional 15 from the transcriptome, suggesting potential ion channel blockade or modulatory activities. Comparison of these potential toxins to those from other cnidarians provided insight into their possible roles in C. fuscescens venom and an overview of the diversity of potential toxin families in cnidarian venoms. PMID:27058558

  9. Intravenous S-Ketamine Does Not Inhibit Alveolar Fluid Clearance in a Septic Rat Model

    PubMed Central

    Weber, Nina C.; van der Sluijs, Koen; Hackl, Florian; Hotz, Lorenz; Dahan, Albert; Hollmann, Markus W.; Berger, Marc M.

    2014-01-01

    We previously demonstrated that intratracheally administered S-ketamine inhibits alveolar fluid clearance (AFC), whereas an intravenous (IV) bolus injection had no effect. The aim of the present study was to characterize whether continuous IV infusion of S-ketamine, yielding clinically relevant plasma concentrations, inhibits AFC and whether its effect is enhanced in acute lung injury (ALI) which might favor the appearance of IV S-ketamine at the alveolar surface. AFC was measured in fluid-instilled rat lungs. S-ketamine was administered IV over 6 h (loading dose: 20 mg/kg, followed by 20 mg/kg/h), or intratracheally by addition to the instillate (75 µg/ml). ALI was induced by IV lipopolysaccharide (LPS; 7 mg/kg). Interleukin (IL)-6 and cytokine-induced neutrophil chemoattractant (CINC)-3 were measured by ELISA in plasma and bronchoalveolar lavage fluid. Isolated rat alveolar type-II cells were exposed to S-ketamine (75 µg/ml) and/or LPS (1 mg/ml) for 6 h, and transepithelial ion transport was measured as short circuit current (ISC). AFC was 27±5% (mean±SD) over 60 min in control rats and was unaffected by IV S-ketamine. Tracheal S-ketamine reduced AFC to 18±9%. In LPS-treated rats, AFC decreased to 16±6%. This effect was not enhanced by IV S-ketamine. LPS increased IL-6 and CINC-3 in plasma and bronchoalveolar lavage fluid. In alveolar type-II cells, S-ketamine reduced ISC by 37% via a decrease in amiloride-inhibitable sodium transport. Continuous administration of IV S-ketamine does not affect rat AFC even in endotoxin-induced ALI. Tracheal application with direct exposure of alveolar epithelial cells to S-ketamine decreases AFC by inhibition of amiloride-inhibitable sodium transport. PMID:25386677

  10. Two-View Gravity Stress Imaging Protocol for Nondisplaced Type II Supination External Rotation Ankle Fractures: Introducing the Gravity Stress Cross-Table Lateral View.

    PubMed

    Boffeli, Troy J; Collier, Rachel C; Gervais, Samuel J

    Assessing ankle stability in nondisplaced Lauge-Hansen supination external rotation type II injuries requires stress imaging. Gravity stress mortise imaging is routinely used as an alternative to manual stress imaging to assess deltoid integrity with the goal of differentiating type II from type IV injuries in cases without a posterior or medial fracture. A type II injury with a nondisplaced fibula fracture is typically treated with cast immobilization, and a type IV injury is considered unstable and often requires operative repair. The present case series (two patients) highlights a standardized 2-view gravity stress imaging protocol and introduces the gravity stress cross-table lateral view. The gravity stress cross-table lateral view provides a more thorough evaluation of the posterior malleolus owing to the slight external rotation and posteriorly directed stress. External rotation also creates less bony overlap between the tibia and fibula, allowing for better visualization of the fibula fracture. Gravity stress imaging confirmed medial-sided injury in both cases, confirming the presence of supination external rotation type IV or bimalleolar equivalent fractures. Open reduction and internal fixation was performed, and both patients achieved radiographic union. No further treatment was required at 21 and 33 months postoperatively. Copyright © 2017 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

  11. Fine typing of methicillin-resistant Staphylococcus aureus isolates using direct repeat unit and staphylococcal interspersed repeat unit typing methods.

    PubMed

    Ho, Cheng-Mao; Ho, Mao-Wang; Li, Chi-Yuan; Lu, Jang-Jih

    2015-08-01

    Methicillin-resistant Staphylococcus aureus (MRSA) typing is an important epidemiologic tool for monitoring trends and preventing outbreaks. However, the efficiency of various MRSA typing methods for each SCCmec MRSA isolate is rarely evaluated. A total of 157 MRSA isolates from four different regions in Taiwan were typed with five different molecular methods, including SCCmec typing, multilocus sequence typing (MLST), spa typing, mec-associated direct repeat unit (dru) copy number determination, and staphylococcal interspersed repeat unit (SIRU) profiling. There were four SCCmec types, eight MLST types, 15 spa types, 11 dru types, and 31 SIRU profiles. The most common type determined by each molecular typing method was SCCmec III (115 isolates, 73.2%), ST239 (99 isolates, 63.1%), t037 (107 isolates, 68.2%), 14 dru copies (76 isolates, 48.4%), and SIRU profile 3013722 (102 isolates, 65%), respectively. When using the combination of MLST, spa typing, and dru copy number, ST5-t002-4 (n = 8), ST239-t037-14 (n = 68), ST59-t437-9 (n = 9), and ST59-t437-11 (n = 6) were found to be the most common types of SCCmec types II (n = 9), III (n = 115), IV (n = 21), and VT (n = 11) isolates, respectively. SCCmec type III isolates were further classified into 11 dru types. Of the 21 SCCmec type IV isolates, 14 SIRU profiles were found. Seven SIRU patterns were observed in the 11 SCCmec type VT isolates. Different typing methods showed a similar Hunter-Gaston discrimination index among the 157 MRSA isolates. However, dru and SIRU typing methods had a better discriminatory power for SCCmec type III and SCCmec types IV and VT isolates, respectively, suggesting that dru and SIRU can be used to further type these isolates. Copyright © 2013. Published by Elsevier B.V.

  12. Malleolar fractures and their ligamentous injury equivalents have similar outcomes in supination-external rotation type IV fractures of the ankle treated by anatomical internal fixation.

    PubMed

    Berkes, M B; Little, M T M; Lazaro, L E; Sculco, P K; Cymerman, R M; Daigl, M; Helfet, D L; Lorich, D G

    2012-11-01

    It has previously been suggested that among unstable ankle fractures, the presence of a malleolar fracture is associated with a worse outcome than a corresponding ligamentous injury. However, previous studies have included heterogeneous groups of injury. The purpose of this study was to determine whether any specific pattern of bony and/or ligamentous injury among a series of supination-external rotation type IV (SER IV) ankle fractures treated with anatomical fixation was associated with a worse outcome. We analysed a prospective cohort of 108 SER IV ankle fractures with a follow-up of one year. Pre-operative radiographs and MRIs were undertaken to characterise precisely the pattern of injury. Operative treatment included fixation of all malleolar fractures. Post-operative CT was used to assess reduction. The primary and secondary outcome measures were the Foot and Ankle Outcome Score (FAOS) and the range of movement of the ankle. There were no clinically relevant differences between the four possible SER IV fracture pattern groups with regard to the FAOS or range of movement. In this population of strictly defined SER IV ankle injuries, the presence of a malleolar fracture was not associated with a significantly worse clinical outcome than its ligamentous injury counterpart. Other factors inherent to the injury and treatment may play a more important role in predicting outcome.

  13. Genetics of Lesch's typology of alcoholism.

    PubMed

    Samochowiec, Jerzy; Kucharska-Mazur, Jolanta; Grzywacz, Anna; Pelka-Wysiecka, Justyna; Mak, Monika; Samochowiec, Agnieszka; Bienkowski, Przemyslaw

    2008-02-15

    It is widely accepted that dopamine and serotonin (5-HT) neurotransmission can be critically involved in the development of alcohol abuse and alcohol dependence. Lesch's typology of alcoholism has been gaining increasing popularity as it qualitatively differentiates patients into different treatment response subgroups. The aim of the present study was to evaluate a possible genetic background of Lesch's typology with special emphasis placed on dopamine- and serotonin-related genes. 122 alcoholics (the mean age: 35+/-9 years) were investigated. According to Lesch's typology, 58 patients were of type I, 36 patients of type II, 11 patients of type III, and 17 patients of type IV. Alcohol drinking and family history was assessed by means of a structured interview, based on the Semi-Structured Assessment for the Genetics of Alcoholism. 150 control subjects without psychiatric disorders were also recruited. The control group was ethnically-, age- and gender-matched to the patients. The DRD2 TaqIA, exon 8, and promoter -141C ins/del polymorphisms as well as COMT Val158Met, 5HTT 44 bp del in promoter, and DAT 40 bp VNTR polymorphisms were detected by means of PCR. No significant differences were observed when the whole group of alcoholics and the controls were compared. Similarly, there were no differences between either the Lesch type I or type II alcoholics and the control subjects. No significant differences were observed between type I and type II alcoholics. Alleles frequencies were not calculated for the Lesch type III and type IV alcoholics since the number of patients was too small. The present results argue against any major role of the investigated polymorphisms in either Lesch type I or type II alcoholism. More comprehensive studies are needed to define the role of the investigated polymorphisms in Lesch type III and type IV alcoholism.

  14. Mechanisms and implications of a type IV functional response for short-term intake rate of dry matter in large mammalian herbivores.

    PubMed

    Mezzalira, Jean C; Bonnet, Olivier J F; Carvalho, Paulo C de F; Fonseca, Lidiane; Bremm, Carolina; Mezzalira, Carlos C; Laca, Emilio A

    2017-09-01

    The functional response (i.e. the relationship between consumers' intake rate and resource density) is central in plant-herbivore interactions. Its shape and the biological processes leading to it have significant implications for both foraging theory and ecology of grazing systems. A type IV functional response (i.e. dome-shaped relationship) of short-term intake rate of dry matter (intake while grazing) has rarely been reported for large herbivores and the conditions that can lead to it are poorly understood. We report a type IV functional response observed in heifers grazing monocultures of Cynodon sp. and Avena strigosa. The mechanisms and consequences of this type of functional response for grazed system dynamics are discussed. Intake rate was higher at intermediate than at short or tall sward heights in both grass species. The type IV functional response resulted from changes in bite mass instead of a longer time needed to encounter and process bites. Thus, the decrease of intake rate of dry matter in tall swards is not explained by a shift from process 3 (potential bites are concentrated and apparent) to process 2 (potential bites are apparent but dispersed, Spalinger & Hobbs 1992). Bite mass was smaller in tall than in intermediate swards due to a reduction of bite volume possibly caused by the greater proportion of stem and sheath acting as a physical barrier to bite formation. It is generally accepted that potential bites are abundant and apparent in most grassland and meadow systems, as they were in the present experiments. Therefore, a type IV response of intake rate not directly related to digestive constraints may determine the dynamics of intake and defoliation under a much larger set of conditions than previously thought. These results have implications for foraging theory and stability of grazing systems. For example, if animals prefer patches of intermediate stature that yield the highest intake rate, grazing should lead to the widely observed bimodal distribution of plant mass per unit area, even when tall patches are not of significantly lower digestive quality than the pasture average. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.

  15. Slope Stability of Geosynthetic Clay Liner Test Plots

    EPA Science Inventory

    Fourteen full-scale field test plots containing five types of geosynthetic clay liners (GCLs) were constructed on 2H:IV and 3H:IV slopes for the purpose of assessing slope stability. The test plots were designed to simulate typical final cover systems for landfill. Slides occurr...

  16. [Effects of the monosaccharide derivative 8RN-DAGal on the putative P-type calcium channel expressed in Xenopus oocytes].

    PubMed

    Fournier, F; Charpentier, G; Lahyani, A; Bruner, J; Czternasty, G; Marlot, D; Ronco, G; Villa, P; Brule, G

    1993-01-01

    P-type calcium channels are expressed in Xenopus oocytes after injection of rat cerebellar mRNA. The FTX and omega-Aga-IVa toxins extracted from Agelenopsis aperta venom are known to inhibit the activity of this channel. The present results demonstrate that 8RN-DAGal is also a antagonist of P-type calcium channels. The inhibition of the current, obtained with Ba2+, as charge carrier, is voltage dependent.

  17. Mirror neuron activity associated with social impairments but not age in autism spectrum disorder.

    PubMed

    Enticott, Peter G; Kennedy, Hayley A; Rinehart, Nicole J; Tonge, Bruce J; Bradshaw, John L; Taffe, John R; Daskalakis, Zafiris J; Fitzgerald, Paul B

    2012-03-01

    The neurobiology of autism spectrum disorder (ASD) is not particularly well understood, and biomedical treatment approaches are therefore extremely limited. A prominent explanatory model suggests that social-relating symptoms may arise from dysfunction within the mirror neuron system, while a recent neuroimaging study suggests that these impairments in ASD might reduce with age. Participants with autism spectrum disorder (i.e., DSM-IV autistic disorder or Asperger's disorder) (n = 34) and matched control subjects (n = 36) completed a transcranial magnetic stimulation study in which corticospinal excitability was assessed during the observation of hand gestures. Regression analyses revealed that the ASD group presented with significantly reduced corticospinal excitability during the observation of a transitive hand gesture (relative to observation of a static hand) (p < .05), which indicates reduced putative mirror neuron system activity within ventral premotor cortex/inferior frontal gyrus. Among the ASD group, there was also a negative association between putative mirror neuron activity and self-reported social-relating impairments, but there was no indication that mirror neuron impairments in ASD decrease with age. These data provide general support for the mirror neuron hypothesis of autism; researchers now must clarify the precise functional significance of mirror neurons to truly understand their role in the neuropathophysiology of ASD and to determine whether they should be used as targets for the treatment of ASD.

  18. Crystallization and X-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase.

    PubMed

    Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; Stojanoff, Vivian; Rodríguez-Sanoja, Romina; Rudiño-Piñera, Enrique; Sánchez, Sergio

    2015-09-01

    Labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg(2+) (LrdC-Mg(2+)) and in complex with inorganic pyrophosphate (PPi) (LrdC-Mg(2+)-PPi). Crystals of native LrdC-Mg(2+) diffracted to 2.50 Å resolution and belonged to the trigonal space group P3221, with unit-cell parameters a = b = 107.1, c = 89.2 Å. Crystals of the LrdC-Mg(2+)-PPi complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3221. Crystals of the LrdC-Mg(2+)-PPi complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P21, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.

  19. A novel GBE1 gene variant in a child with glycogen storage disease type IV.

    PubMed

    Said, Samar M; Murphree, Marine I; Mounajjed, Taofic; El-Youssef, Mounif; Zhang, Lizhi

    2016-08-01

    Glycogen storage disease type IV is an autosomal recessive disorder of carbohydrates caused by deficiency of amylo-1-4-glycanoglycosyltransferase, which leads to accumulation of amylopectin-like polysaccharides in tissues including liver, heart and neuromuscular system. More than 40 different mutations in the glycogen branching enzyme gene (GBE1) have been described. In this study, we report a 2-year-old boy who presented with developmental delay and muscle weakness. He subsequently was diagnosed with glycogen storage disease type IV based on a liver biopsy histology and electron microscopy. Glycogen branching enzyme activity was in the low range. Genetic analysis demonstrated a novel heterozygous variant (c.760A>G; p.Thr254Ala) in exon 6 of the GBE1 gene, which is believed to be pathogenic. This variant was inherited from the patient's mother who was asymptomatic with normal glycogen branching enzyme activity. Whole-exome sequencing failed to reveal additional variations in the GBE1 gene. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.

    PubMed

    Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R

    2002-06-01

    Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.

  1. Diagnostic efficiency of amylase and type IV collagen in predicting chronic pancreatitis.

    PubMed

    Das, Subir Kumar; Varadhan, Sowmya; Dhanya, L; Mukherjee, Sukhes; Mohana, S; Balakrishnan, V; Vasudevan, D M

    2009-01-01

    Chronic pancreatitis, an irreversible inflammatory disease of the pancreas, is associated with the replacement of the destroyed parenchyma by extended development of fibrosis. Despite marked progress in diagnostic tools, no consensus has been reached in diagnosis of chronic pancreatitis. In this study we examined the hematological and biochemical parameters among 40 chronic pancreatitis patients within 18 to 67 yrs. ESR level and ALP activity was elevated in 40% cases. Serum amylase activity increased in 32 patients and it showed significant correlation with ALP (r=0.458, p=0.003), CA-19.9 (r=0.556, p<0.001), and calcium level (r=-0.472, p=0.002). Type IV collagen level in chronic pancreatitis also elevated (164.4 ± 55.5 ng/ml) and showed negative significant correlation with calcium level (r= -0.505, p=0.001). However, no significant correlation was observed between amylase activity and type IV collagen (r=0.289, p= 0.07).

  2. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae

    PubMed Central

    2011-01-01

    Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA), the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (Vir)B/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail. PMID:21489243

  3. Effect of microwave disinfection on compressive and tensile strengths of dental stones.

    PubMed

    Robati Anaraki, Mahmood; Moslehifard, Elnaz; Aminifar, Soran; Ghanati, Hamed

    2013-01-01

    Although microwave irradiation has been used for disinfection of dental stone casts, there are concerns regarding mechanical damage to casts during the process. The aim of this study was to evaluate the effect of microwave irradiation on the compressive strength (CS) and diametral tensile strength (DTS) of stone casts. In this in vitro study, 80 cylindrical type III and IV stone models (20 × 40 mm) were prepared and divided into 8 groups of 10. The DTS and CS of the specimens were measured by a mechanical testing machine at a crosshead speed of 0.5 cm/min after 7 times of frequent wetting, irradiating at an energy level of 600 W for 3 minutes and cooling. Data were analyzed by Student's t-test. Microwave irradiation significantly increased DTS of type III and IV to 5.23 ± 0.64 and 8.17 ± 0.94, respectively (P < 0.01). According to the results, microwave disinfection increases DTS of type III and IV stone casts without any effects on their CS.

  4. Identification of another module involved in the horizontal transfer of the Haemophilus genomic island ICEHin1056.

    PubMed

    Juhas, Mario; Dimopoulou, Ioanna; Robinson, Esther; Elamin, Abdel; Harding, Rosalind; Hood, Derek; Crook, Derrick

    2013-09-01

    A significant part of horizontal gene transfer is facilitated by genomic islands. Haemophilus influenzae genomic island ICEHin1056 is an archetype of a genomic island that accounts for pandemic spread of antibiotics resistance. ICEHin1056 has modular structure and harbors modules involved in type IV secretion and integration. Previous studies have shown that ICEHin1056 encodes a functional type IV secretion system; however, other modules have not been characterized yet. Here we show that the module on the 5' extremity of ICEHin1056 consists of 15 genes that are well conserved in a number of related genomic islands. Furthermore by disrupting six genes of the investigated module of ICEHin1056 by site-specific mutagenesis we demonstrate that in addition to type IV secretion system module, the investigated module is also important for the successful conjugal transfer of ICEHin1056 from donor to recipient cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Exome sequencing establishes a gelsolin mutation as the cause of inherited bulbar-onset neuropathy.

    PubMed

    Caress, James B; Johnson, Janel O; Abramzon, Yevgeniya A; Hawkins, Gregory A; Gibbs, J Raphael; Sullivan, Elizabeth A; Chahal, Chamanpreet S; Traynor, Bryan J

    2017-11-01

    Progressive bulbar motor neuropathy is primarily caused by bulbar-onset ALS. Hereditary amyloidosis type IV also presents with a bulbar neuropathy that mimics motor neuron disease. The disease is prevalent in Finland only and is not commonly included in the differential diagnosis of ALS. We studied 18 members of a family in which some had bulbar motor neuropathy, and we performed exome sequencing. Five affected family members were found to have a D187Y substitution in the GSN gene known to cause hereditary amyloidosis type IV. This American family presented with progressive bulbar neuropathy due to a gelsolin mutation not found in Finland. Hereditary amyloidosis type IV presents with bulbar motor neuropathy and not with peripheral neuropathy as occurs with common forms of amyloidosis. This report demonstrates the power of exome sequencing to determine the cause of rare hereditary diseases with incomplete or atypical phenotypes. Muscle Nerve 56: 1001-1005, 2017. © 2016 Wiley Periodicals, Inc.

  6. Gluteo-vaginal sinus formation complicating posterior intravaginal slingplasty followed by successful IVS removal. A case report and review of the literature.

    PubMed

    Mikos, Themistoklis; Tsalikis, Tryfon; Papanikolaou, Alexios; Pournaropoulos, Fotios; Bontis, John N

    2008-03-01

    Posterior intravaginal slingplasty (IVS) is a technique used for the treatment of apical prolapse. Type III meshes have been mostly used with this technique. In this article, a case of bilateral gluteo-vaginal sinus tract formation that complicated a posterior vaginal slingplasty with a type III mesh is presented. At 3 months follow-up, the patient complained for bulking through the vagina, continuous offensive vaginal discharge, and constant pain at the buttocks. She had prolapse recurrence, and there was defective healing at the gluteal entry points of the posterior IVS. Ten months after the initial surgery, she underwent a laparotomic subtotal hysterectomy and sacrocervicopexy with prolene type I mesh. At the same time, the posterior mesh was removed allowing the surgeon to discover communication of the canal of the mesh extending from gluteal incisions to the vagina epithelium. The sinus tract was managed surgically with excision of the surrounding tissues. There was no recurrence or other complications at 2 months follow-up.

  7. Identification of Putative Geographically Isolated Wetlands of the Conterminous United States

    EPA Science Inventory

    Geographically isolated wetlands (GIWs) are unique landscape features, defined as wetlands completely surrounded by uplands. Densely occurring in certain parts of the North America, GIWs include wetland types such as Prairie Potholes, Delmarva Ponds, West Coast or California Vern...

  8. In vivo imaging of cortical pathology in multiple sclerosis using ultra-high field MRI

    PubMed Central

    Mainero, C; Benner, T; Radding, A; van der Kouwe, A; Jensen, R; Rosen, B R.; Kinkel, R P.

    2009-01-01

    Objective: We used ultra-high field MRI to visualize cortical lesion types described by neuropathology in 16 patients with multiple sclerosis (MS) compared with 8 age-matched controls; to characterize the contrast properties of cortical lesions including T2*, T2, T1, and phase images; and to investigate the relationship between cortical lesion types and clinical data. Methods: We collected, on a 7-T scanner, 2-dimensional fast low-angle shot (FLASH)-T2*-weighted spoiled gradient-echo, T2-weighted turbo spin-echo (TSE) images (0.33 × 033 × 1 mm3), and a 3-dimensional magnetization-prepared rapid gradient echo. Results: Overall, 199 cortical lesions were detected in patients on both FLASH-T2* and T2-TSE scans. Seven-tesla MRI allowed for characterization of cortical plaques into type I (leukocortical), type II (intracortical), and type III/IV (subpial extending partly or completely through the cortical width) lesions as described histopathologically. Types III and IV were the most frequent type of cortical plaques (50.2%), followed by type I (36.2%) and type II (13.6%) lesions. Each lesion type was more frequent in secondary progressive than in relapsing–remitting MS. This difference, however, was significant only for type III/IV lesions. T2*-weighted images showed the highest, while phase images showed the lowest, contrast-to-noise ratio for all cortical lesion types. In patients, the number of type III/IV lesions was associated with greater disability (p < 0.02 by Spearman test) and older age (p < 0.04 by Spearman test). Conclusions: Seven-tesla MRI detected different histologic cortical lesion types in our small multiple sclerosis (MS) sample, suggesting, if validated in a larger population, that it may prove a valuable tool to assess the contribution of cortical MS pathology to clinical disability. GLOSSARY ANOVA = analysis of variance; BN = background noise; CNR = contrast-to-noise ratio; DIR = double-inversion recovery; EDSS = Expanded Disability Status Scale; FLAIR = fluid-attenuated inversion recovery; FLASH = fast low-angle shot; GM = gray matter; MPRAGE = magnetization-prepared rapid gradient echo; MR = magnetic resonance; MS = multiple sclerosis; NACGM = normal-appearing cortical gray matter; RF = radiofrequency; ROI = region of interest; RRMS = relapsing–remitting multiple sclerosis; SNR = signal-to-noise ratio; SPMS = secondary progressive multiple sclerosis; TA = time of acquisition; TE = echo time; TR = repetition time; TSE = turbo spin-echo; WM = white matter. PMID:19641168

  9. Dissecting the Genetic Basis for Seed Coat Mucilage Heteroxylan Biosynthesis in Plantago ovata Using Gamma Irradiation and Infrared Spectroscopy

    PubMed Central

    Tucker, Matthew R.; Ma, Chao; Phan, Jana; Neumann, Kylie; Shirley, Neil J.; Hahn, Michael G.; Cozzolino, Daniel; Burton, Rachel A.

    2017-01-01

    Seeds from the myxospermous species Plantago ovata release a polysaccharide-rich mucilage upon contact with water. This seed coat derived mucilage is composed predominantly of heteroxylan (HX) and is utilized as a gluten-free dietary fiber supplement to promote human colorectal health. In this study, a gamma-irradiated P. ovata population was generated and screened using histological stains and Fourier Transform Mid Infrared (FTMIR) spectroscopy to identify putative mutants showing defects in seed coat mucilage HX composition and/or structure. FTMIR analysis of dry seed revealed variation in regions of the IR spectra previously linked to xylan structure in Secale cereale (rye). Subsequent absorbance ratio and PCA multivariate analysis identified 22 putative mutant families with differences in the HX IR fingerprint region. Many of these showed distinct changes in the amount and subtle changes in structure of HX after mucilage extrusion, while 20% of the putative HX mutants identified by FTMIR showed no difference in staining patterns of extruded mucilage compared to wild-type. Transcriptional screening analysis of two putative reduced xylan in mucilage (rxm) mutants, rxm1 and rxm3, revealed that changes in HX levels in rxm1 correlate with reduced transcription of known and novel genes associated with xylan synthesis, possibly indicative of specific co-regulatory units within the xylan biosynthetic pathway. These results confirm that FTMIR is a suitable method for identifying putative mutants with altered mucilage HX composition in P. ovata, and therefore forms a resource to identify novel genes involved in xylan biosynthesis. PMID:28377777

  10. Transarterial treatment with Onyx of Cognard type IV anterior cranial fossa dural arteriovenous fistulas.

    PubMed

    Li, Chuanhui; Wu, Zhongxue; Yang, Xinjian; Li, Youxiang; Jiang, Chuhan; He, Hongwei

    2014-03-01

    Cognard type IV anterior cranial fossa dural arteriovenous fistulas (DAVFs) are rare lesions with a high risk of intracranial hemorrhage. We present our experience with the use of Onyx via the arterial route in these aggressive lesions. Between October 2009 and October 2011, six consecutive patients diagnosed with Cognard type IV anterior cranial fossa DAVFs were treated transarterially with Onyx in our department. All patients were male; mean age was 55 years (range 38-68). Four patients presented with intracranial hemorrhage as the initial manifestation; one patient presented with seizures at the time of diagnosis and experienced intracranial hemorrhage during the antiepileptic therapy; and the other patient was asymptomatic. In five patients, complete obliteration was achieved with transarterial Onyx injection in a single treatment session; in the remaining patient, subtotal occlusion was achieved and gamma knife treatment was followed. The average time of injection was 19 min (range 5-28) for every pedicle catheterized and the average amount of Onyx was 3.2 ml (range 0.4-6.3) for each lesion. All patients recovered uneventfully after embolization. No mortality or permanent morbidity was observed in this series. Follow-up digital subtraction or MR angiography confirmed durable obliteration of the fistulas in five cured cases. No patients suffered intracranial hemorrhage during the follow-up period. In this small series, our experience with the use of Onyx for arterial embolization of Cognard type IV DAVFs is encouraging, with durable complete cure in most lesions without severe complications.

  11. CT-based radiomics signature for differentiating Borrmann type IV gastric cancer from primary gastric lymphoma.

    PubMed

    Ma, Zelan; Fang, Mengjie; Huang, Yanqi; He, Lan; Chen, Xin; Liang, Cuishan; Huang, Xiaomei; Cheng, Zixuan; Dong, Di; Liang, Changhong; Xie, Jiajun; Tian, Jie; Liu, Zaiyi

    2017-06-01

    To evaluate the value of CT-based radiomics signature for differentiating Borrmann type IV gastric cancer (GC) from primary gastric lymphoma (PGL). 40 patients with Borrmann type IV GC and 30 patients with PGL were retrospectively recruited. 485 radiomics features were extracted and selected from the portal venous CT images to build a radiomics signature. Subjective CT findings, including gastric wall peristalsis, perigastric fat infiltration, lymphadenopathy below the renal hila and enhancement pattern, were assessed to construct a subjective findings model. The radiomics signature, subjective CT findings, age and gender were integrated into a combined model by multivariate analysis. The diagnostic performance of these three models was assessed with receiver operating characteristics curves (ROC) and were compared using DeLong test. The subjective findings model, the radiomics signature and the combined model showed a diagnostic accuracy of 81.43% (AUC [area under the curve], 0.806; 95% CI [confidence interval]: 0.696-0.917; sensitivity, 63.33%; specificity, 95.00%), 84.29% (AUC, 0.886 [95% CI: 0.809-0.963]; sensitivity, 86.67%; specificity, 82.50%), 87.14% (AUC, 0.903 [95%CI: 0.831-0.975]; sensitivity, 70.00%; specificity, 100%), respectively. There were no significant differences in AUC among these three models (P=0.051-0.422). Radiomics analysis has the potential to accurately differentiate Borrmann type IV GC from PGL. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Trypanosoma sp. diversity in Amazonian bats (Chiroptera; Mammalia) from Acre State, Brazil.

    PubMed

    Dos Santos, Francisco C B; Lisboa, Cristiane V; Xavier, Samanta C C; Dario, Maria A; Verde, Rair de S; Calouro, Armando M; Roque, André Luiz R; Jansen, Ana M

    2017-11-16

    Bats are ancient hosts of Trypanosoma species and their flying ability, longevity and adaptability to distinct environments indicate that they are efficient dispersers of parasites. Bats from Acre state (Amazon Biome) were collected in four expeditions conducted in an urban forest (Parque Zoobotânico) and one relatively more preserved area (Seringal Cahoeira) in Rio Branco and Xapuri municipalities. Trypanosoma sp. infection was detected by hemoculture and fresh blood examination. Isolated parasite species were identified by the similarity of the obtained DNA sequence from 18S rDNA polymerase chain reaction and reference strains. Overall, 367 bats from 23 genera and 32 species were examined. Chiropterofauna composition was specific to each municipality, although Artibeus sp. and Carollia sp. prevailed throughout. Trypanosoma sp. infection was detected in 85 bats (23·2%). The most widely distributed and prevalent genotypes were (in order) Trypanosoma cruzi TcI, T. cruzi marinkellei, Trypanosoma dionisii, T. cruzi TcIV and Trypanosoma rangeli. At least one still-undescribed Trypanosoma species was also detected in this study. The detection of T. cruzi TcI and TcIV (the ones associated with Chagas disease in Amazon biome) demonstrates the putative importance of these mammal hosts in the epidemiology of the disease in the Acre State.

  13. Identification of a cluster IV pleiotropic drug resistance transporter gene expressed in the style of Nicotiana plumbaginifolia.

    PubMed

    Trombik, Tomasz; Jasinski, Michal; Crouzet, Jérome; Boutry, Marc

    2008-01-01

    ATP-binding cassette transporters of the pleiotropic drug resistance (PDR) subfamily are composed of five clusters. We have cloned a gene, NpPDR2, belonging to the still uncharacterized cluster IV from Nicotiana plumbaginifolia. NpPDR2 transcripts were found in the roots and mature flowers. In the latter, NpPDR2 expression was restricted to the style and only after pollination. A 1.5-kb genomic sequence containing the putative NpPDR2 transcription promoter was fused to the beta-glucuronidase reporter gene. The GUS expression pattern confirmed the RT-PCR results that NpPDR2 was expressed in roots and the flower style and showed that it was localized around the conductive tissues. Unlike other PDR genes, NpPDR2 expression was not induced in leaf tissues by none of the hormones typically involved in biotic and abiotic stress response. Moreover, unlike NpPDR1 known to be involved in biotic stress response, NpPDR2 expression was not induced in the style upon Botrytis cinerea infection. In N. plumbaginifolia plants in which NpPDR2 expression was prevented by RNA interference, no unusual phenotype was observed, including at the flowering stage, which suggests that NpPDR2 is not essential in the reproductive process under the tested conditions.

  14. 43 CFR 10005.19 - Decision factors.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

  15. 43 CFR 10005.19 - Decision factors.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

  16. 43 CFR 10005.19 - Decision factors.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

  17. 43 CFR 10005.19 - Decision factors.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

  18. Standard-Cell, Open-Architecture Power Conversion Systems

    DTIC Science & Technology

    2005-10-01

    TLmax Maximum junction temperature 423 OK Table 5. 9. PEBB average model description in VTB. Terminal Type Name - 4 -, A Power DC Bus + B Power AC Pole...5 A. Switching models ........................................................................................ 5 B. Average ...11-6 IV. Average Modeling of PEBB-Based Converters...................................................... 11-10 0 IV. 1.Voltage

  19. Vorinostat and Azacitidine in Treating Patients With Locally Recurrent or Metastatic Nasopharyngeal Cancer or Nasal Natural Killer T-Cell Lymphoma

    ClinicalTrials.gov

    2018-04-20

    Adult Nasal Type Extranodal NK/T-Cell Lymphoma; Recurrent Nasopharyngeal Keratinizing Squamous Cell Carcinoma; Recurrent Nasopharyngeal Undifferentiated Carcinoma; Stage IV Nasopharyngeal Keratinizing Squamous Cell Carcinoma AJCC v7; Stage IV Nasopharyngeal Undifferentiated Carcinoma AJCC v7

  20. Effects of intravenous delivery systems on infused red blood cells.

    PubMed

    Gibson, J S; Leff, R D; Roberts, R J

    1984-03-01

    The effects of various intravenous delivery systems on the integrity of infused red blood cells (RBCs) were studied. Using a factorial design, whole blood and packed RBCs were infused through i.v. delivery systems employing various combinations of i.v. tubing diameter and length, needle gauge, infusion rate (5 and 50 ml/hr), type of infusion pump (piston, diaphragm, or peristaltic operation), and type of blood product. The age and temperature of the blood filter used were held constant. A 5-ml sample of the blood product obtained during each experimental run was analyzed for plasma free-hemoglobin to assess the degree of hemolysis. Osmotic fragility of the RBCs was evaluated by measuring the percentage of hemolysis in the blood products in various concentrations of sodium chloride solution. Type of blood product and i.v. pump were the only variables significantly influencing RBC hemolysis. In both blood products, a greater degree of hemolysis occurred with the peristaltic-type pump than with the other types of pumps. In packed RBCs, the diaphragm-type pump produced greater hemolysis than the piston-type pump, but hemolysis was similar in whole-blood samples. Regardless of the type of pump, more hemolysis occurred in whole blood at the 5-ml/hr infusion rate than at the 50-ml/hr rate, but the converse was true in packed RBCs. Samples of both blood products were less osmotically fragile than their respective controls at sodium chloride concentrations ranging from 0.30 to 0.50%.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Renal tubular acidosis type IV in hyperkalaemic patients--a fairy tale or reality?

    PubMed

    Haas, Christian S; Pohlenz, Inga; Lindner, Ulrich; Muck, Philip M; Arand, Jovana; Suefke, Sven; Lehnert, Hendrik

    2013-05-01

    Hyperkalaemia is a common feature in hospitalized patients and often attributed to drugs antagonizing the renin-angiotensin-aldosterone system (RAAS) and/or acute kidney injury (AKI), despite significantly preserved glomerular filtration rate (GFR). The objective of this study was to determine the prevalence and role of renal tubular acidosis type IV (RTA IV) in the development of significant hyperkalaemia. A single-centre retrospective study. Patients admitted to a University Hospital over 12 months. Patients with a potassium value > 6·0 mm were identified. Clinical and laboratory data were revisited, and patients with a normal anion gap metabolic acidosis were evaluated for the existence of RTA IV. A total of 57 patients having significant hyperkalaemia (>6·0 mm) were identified. Twelve patients had end-stage renal disease, while 21 patients had solely AKI or progressive chronic renal failure. RTA IV was present in 24 patients (42%), of whom 71% had pre-existing renal insufficiency because of diabetic nephropathy or tubulointerstitial nephritis. All hyperkalaemic patients with urinary/serum electrolytes suggestive of RTA IV had evidence of AKI, but creatinine levels were significantly lower (P < 0·05), while the number of drugs antagonizing the RAAS was comparable. We demonstrated that RTA IV (i) is very common in patients with hyperkalaemia; (ii) should always be suspected in hyperkalaemic patients with only moderately impaired GFR; and (iii) may result in significant hyperkalaemia in the presence of both AKI and drugs antagonizing the RAAS. © 2012 Blackwell Publishing Ltd.

  2. A Comprehensive Functional Analysis of NTRK1 Missense Mutations Causing Hereditary Sensory and Autonomic Neuropathy Type IV (HSAN IV).

    PubMed

    Shaikh, Samiha S; Chen, Ya-Chun; Halsall, Sally-Anne; Nahorski, Michael S; Omoto, Kiyoyuki; Young, Gareth T; Phelan, Anne; Woods, Christopher Geoffrey

    2017-01-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV) is an autosomal recessive disorder characterized by a complete lack of pain perception and anhidrosis. Here, we studied a cohort of seven patients with HSAN IV and describe a comprehensive functional analysis of seven novel NTRK1 missense mutations, c.1550G >A, c.1565G >A, c.1970T >C, c.2096T >C, c.2254T >A, c.2288G >C, and c.2311C >T, corresponding to p.G517E, p.G522E, p.L657P, p.I699T, p.C752S, p.C763S, and p.R771C, all of which were predicted pathogenic by in silico analysis. The results allowed us to assess the pathogenicity of each mutation and to gain novel insights into tropomyosin receptor kinase A (TRKA) downstream signaling. Each mutation was systematically analyzed for TRKA glycosylation states, intracellular and cell membrane expression patterns, nerve growth factor stimulated TRKA autophosphorylation, TRKA-Y496 phosphorylation, PLCγ activity, and neurite outgrowth. We showed a diverse range of functional effects: one mutation appeared fully functional, another had partial activity in all assays, one mutation affected only the PLCγ pathway and four mutations were proved null in all assays. Thus, we conclude that complete abolition of TRKA kinase activity is not the only pathogenic mechanism underlying HSAN IV. By corollary, the assessment of the clinical pathogenicity of HSAN IV mutations is more complex than initially predicted and requires a multifaceted approach. © 2016 WILEY PERIODICALS, INC.

  3. NG2/CSPG4-collagen type VI interplays putatively involved in the microenvironmental control of tumour engraftment and local expansion.

    PubMed

    Cattaruzza, Sabrina; Nicolosi, Pier Andrea; Braghetta, Paola; Pazzaglia, Laura; Benassi, Maria Serena; Picci, Piero; Lacrima, Katia; Zanocco, Daniela; Rizzo, Erika; Stallcup, William B; Colombatti, Alfonso; Perris, Roberto

    2013-06-01

    In soft-tissue sarcoma patients, enhanced expression of NG2/CSPG4 proteoglycan in pre-surgical primary tumours predicts post-surgical metastasis formation and thereby stratifies patients into disease-free survivors and patients destined to succumb to the disease. Both primary and secondary sarcoma lesions also up-regulate collagen type VI, a putative extracellular matrix ligand of NG2, and this matrix alteration potentiates the prognostic impact of NG2. Enhanced constitutive levels of the proteoglycan in isolated sarcoma cells closely correlate with a superior engraftment capability and local growth in xenogenic settings. This apparent NG2-associated malignancy was also corroborated by the diverse tumorigenic behaviour in vitro and in vivo of immunoselected NG2-expressing and NG2-deficient cell subsets, by RNAi-mediated knock down of endogenous NG2, and by ectopic transduction of full-length or deletion constructs of NG2. Cells with modified expression of NG2 diverged in their interaction with purified Col VI, matrices supplemented with Col VI, and cell-free matrices isolated from wild-type and Col VI null fibroblasts. The combined use of dominant-negative NG2 mutant cells and purified domain fragments of the collagen allowed us to pinpoint the reciprocal binding sites within the two molecules and to assert the importance of this molecular interaction in the control of sarcoma cell adhesion and motility. The NG2-mediated binding to Col VI triggered activation of convergent cell survival- and cell adhesion/migration-promoting signal transduction pathways, implicating PI-3K as a common denominator. Thus, the findings point to an NG2-Col VI interplay as putatively involved in the regulation of the cancer cell-host microenvironment interactions sustaining sarcoma progression.

  4. Predicting DPP-IV inhibitors with machine learning approaches

    NASA Astrophysics Data System (ADS)

    Cai, Jie; Li, Chanjuan; Liu, Zhihong; Du, Jiewen; Ye, Jiming; Gu, Qiong; Xu, Jun

    2017-04-01

    Dipeptidyl peptidase IV (DPP-IV) is a promising Type 2 diabetes mellitus (T2DM) drug target. DPP-IV inhibitors prolong the action of glucagon-like peptide-1 (GLP-1) and gastric inhibitory peptide (GIP), improve glucose homeostasis without weight gain, edema, and hypoglycemia. However, the marketed DPP-IV inhibitors have adverse effects such as nasopharyngitis, headache, nausea, hypersensitivity, skin reactions and pancreatitis. Therefore, it is still expected for novel DPP-IV inhibitors with minimal adverse effects. The scaffolds of existing DPP-IV inhibitors are structurally diversified. This makes it difficult to build virtual screening models based upon the known DPP-IV inhibitor libraries using conventional QSAR approaches. In this paper, we report a new strategy to predict DPP-IV inhibitors with machine learning approaches involving naïve Bayesian (NB) and recursive partitioning (RP) methods. We built 247 machine learning models based on 1307 known DPP-IV inhibitors with optimized molecular properties and topological fingerprints as descriptors. The overall predictive accuracies of the optimized models were greater than 80%. An external test set, composed of 65 recently reported compounds, was employed to validate the optimized models. The results demonstrated that both NB and RP models have a good predictive ability based on different combinations of descriptors. Twenty "good" and twenty "bad" structural fragments for DPP-IV inhibitors can also be derived from these models for inspiring the new DPP-IV inhibitor scaffold design.

  5. Alport syndrome and thin glomerular basement membrane nephropathy: a practical approach to diagnosis.

    PubMed

    Haas, Mark

    2009-02-01

    Alport syndrome and thin glomerular basement membrane nephropathy (TBMN) are genetically heterogeneous conditions characterized by structural abnormalities in the glomerular basement membrane and an initial presentation that usually involves hematuria. Approximately 40% of patients with TBMN are heterozygous carriers for autosomal recessive Alport syndrome, with mutations at the genetic locus encoding type IV collagen alpha(3) [alpha(3)(IV)] and alpha(4) chains. However, although the clinical course of TBMN is usually benign, Alport syndrome, particularly the X-linked form with mutations in the locus encoding the alpha(5) chain of type IV collagen [alpha(5)(IV)], typically results in end-stage renal disease. Electron microscopy is essential to diagnosis of TBMN and Alport syndrome on renal biopsy, although electron microscopy alone is of limited value in distinguishing between TBMN, the heterozygous carrier state of X-linked Alport syndrome, autosomal recessive Alport syndrome, and even early stages of X-linked Alport syndrome. To review diagnostic pathologic features of each of the above conditions, emphasizing the need for immunohistology for alpha(3)(IV) and alpha(5)(IV) in addition to electron microscopy to resolve this differential diagnosis on a renal biopsy. The diagnostic value of immunofluorescence studies for alpha(5)(IV) on a skin biopsy in family members of patients with Alport syndrome also is reviewed. Original and comprehensive review articles on the diagnosis of Alport syndrome and TBMN from the past 35 years, primarily the past 2 decades, and experience in our own renal pathology laboratory. Although Alport syndrome variants and TBMN do not show characteristic light microscopic findings and can be difficult to differentiate from each other even by electron microscopy, using a combination of electron microscopy and immunohistology for alpha(3)(IV) and alpha(5)(IV) enables pathologists to definitively diagnose these disorders on renal biopsy in most cases.

  6. Clinical outcome in women with HER2-positive de novo or recurring stage IV breast cancer receiving trastuzumab-based therapy.

    PubMed

    Rossi, Valentina; Nolè, Franco; Redana, Stefania; Adamoli, Laura; Martinello, Rossella; Aurilio, Gaetano; Verri, Elena; Sapino, Anna; Viale, Giuseppe; Aglietta, Massimo; Montemurro, Filippo

    2014-02-01

    Five to 10% of women with newly diagnosed breast cancer have synchronous metastases (de novo stage IV). A further 20% will develop metastases during follow-up (recurring stage IV). We compared the clinical outcomes of women with HER2-positive metastatic breast cancer (MBC) receiving first-line trastuzumab-based therapy according to type of metastatic presentation. Retrospective analysis of 331 MBC patients receiving first-line trastuzumab-based treatment. Response rates (RR) were compared by the chi-square test. Time-to progression (TTP) and overall survival (OS) curves were compared by the log-rank test. Cox-proportional hazards models were used to study predictors of PFS and OS, including the type of metastatic presentation. Seventy-seven patients (23%) had de novo stage IV disease. Forty-six of these patients underwent surgery of the primary ("de novo/surgery"). Response rates to first-line trastuzumab-based therapy and median progression-free survival did not differ in patients with "recurring", "de novo/surgery" and "de novo" without surgery ("de novo/no surgery) stage IV breast cancer. However, women with "de novo/surgery" stage IV breast cancer had the longest median OS (60 months), and those with "de novo/no surgery" stage IV breast cancer the shortest (26 months). For women with recurring metastatic breast cancer median OS was 40 months (overall log-rank test, p < 0.01). Multivariate analysis confirmed these findings. Our analysis shows that response rates and PFS to first-line trastuzumab-based therapy do not differ significantly between de novo and recurring stage IV, HER2 positive breast cancer. The observed difference in OS favoring women with de novo stage IV disease submitted to surgery of the primary tumor could be the result of a selection bias. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. The PhytoClust tool for metabolic gene clusters discovery in plant genomes

    PubMed Central

    Fuchs, Lisa-Maria

    2017-01-01

    Abstract The existence of Metabolic Gene Clusters (MGCs) in plant genomes has recently raised increased interest. Thus far, MGCs were commonly identified for pathways of specialized metabolism, mostly those associated with terpene type products. For efficient identification of novel MGCs, computational approaches are essential. Here, we present PhytoClust; a tool for the detection of candidate MGCs in plant genomes. The algorithm employs a collection of enzyme families related to plant specialized metabolism, translated into hidden Markov models, to mine given genome sequences for physically co-localized metabolic enzymes. Our tool accurately identifies previously characterized plant MGCs. An exhaustive search of 31 plant genomes detected 1232 and 5531 putative gene cluster types and candidates, respectively. Clustering analysis of putative MGCs types by species reflected plant taxonomy. Furthermore, enrichment analysis revealed taxa- and species-specific enrichment of certain enzyme families in MGCs. When operating through our web-interface, PhytoClust users can mine a genome either based on a list of known cluster types or by defining new cluster rules. Moreover, for selected plant species, the output can be complemented by co-expression analysis. Altogether, we envisage PhytoClust to enhance novel MGCs discovery which will in turn impact the exploration of plant metabolism. PMID:28486689

  8. The PhytoClust tool for metabolic gene clusters discovery in plant genomes.

    PubMed

    Töpfer, Nadine; Fuchs, Lisa-Maria; Aharoni, Asaph

    2017-07-07

    The existence of Metabolic Gene Clusters (MGCs) in plant genomes has recently raised increased interest. Thus far, MGCs were commonly identified for pathways of specialized metabolism, mostly those associated with terpene type products. For efficient identification of novel MGCs, computational approaches are essential. Here, we present PhytoClust; a tool for the detection of candidate MGCs in plant genomes. The algorithm employs a collection of enzyme families related to plant specialized metabolism, translated into hidden Markov models, to mine given genome sequences for physically co-localized metabolic enzymes. Our tool accurately identifies previously characterized plant MGCs. An exhaustive search of 31 plant genomes detected 1232 and 5531 putative gene cluster types and candidates, respectively. Clustering analysis of putative MGCs types by species reflected plant taxonomy. Furthermore, enrichment analysis revealed taxa- and species-specific enrichment of certain enzyme families in MGCs. When operating through our web-interface, PhytoClust users can mine a genome either based on a list of known cluster types or by defining new cluster rules. Moreover, for selected plant species, the output can be complemented by co-expression analysis. Altogether, we envisage PhytoClust to enhance novel MGCs discovery which will in turn impact the exploration of plant metabolism. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Genome-Enabled Studies of Anaerobic, Nitrate-Dependent Iron Oxidation in the Chemolithoautotrophic Bacterium Thiobacillus denitrificans

    NASA Astrophysics Data System (ADS)

    Beller, H. R.; Zhou, P.; Legler, T. C.; Chakicherla, A.; O'Day, P. A.

    2013-12-01

    Thiobacillus denitrificans is a chemolithoautotrophic bacterium capable of anaerobic, nitrate-dependent U(IV) and Fe(II) oxidation, both of which can strongly influence the long-term efficacy of in situ reductive immobilization of uranium in contaminated aquifers. We previously identified two c-type cytochromes involved in nitrate-dependent U(IV) oxidation in T. denitrificans and hypothesized that c-type cytochromes would also catalyze Fe(II) oxidation, as they have been found to play this role in anaerobic phototrophic Fe(II)-oxidizing bacteria. Here we report on efforts to identify genes associated with nitrate-dependent Fe(II) oxidation, namely (a) whole-genome transcriptional studies [using FeCO3, Fe2+, and U(IV) oxides as electron donors under denitrifying conditions], (b) Fe(II) oxidation assays performed with knockout mutants targeting primarily highly expressed or upregulated c-type cytochromes, and (c) random transposon-mutagenesis studies with screening for Fe(II) oxidation. Assays of mutants for 26 target genes, most of which were c-type cytochromes, indicated that none of the mutants tested were significantly defective in nitrate-dependent Fe(II) oxidation. The non-defective mutants included the c1-cytochrome subunit of the cytochrome bc1 complex (complex III), which has relevance to a previously proposed role for this complex in nitrate-dependent Fe(II) oxidation and to current concepts of reverse electron transfer. Of the transposon mutants defective in Fe(II) oxidation, one mutant with a disrupted gene associated with NADH:ubiquinone oxidoreductase (complex I) was ~35% defective relative to the wild-type strain; this strain was similarly defective in nitrate reduction with thiosulfate as the electron donor. Overall, our results indicate that nitrate-dependent Fe(II) oxidation in T. denitrificans is not catalyzed by the same c-type cytochromes involved in U(IV) oxidation, nor have other c-type cytochromes yet been implicated in the process.

  10. Genome-enabled studies of anaerobic, nitrate-dependent iron oxidation in the chemolithoautotrophic bacterium Thiobacillus denitrificans

    PubMed Central

    Beller, Harry R.; Zhou, Peng; Legler, Tina C.; Chakicherla, Anu; Kane, Staci; Letain, Tracy E.; A. O’Day, Peggy

    2013-01-01

    Thiobacillus denitrificans is a chemolithoautotrophic bacterium capable of anaerobic, nitrate-dependent U(IV) and Fe(II) oxidation, both of which can strongly influence the long-term efficacy of in situ reductive immobilization of uranium in contaminated aquifers. We previously identified two c-type cytochromes involved in nitrate-dependent U(IV) oxidation in T. denitrificans and hypothesized that c-type cytochromes would also catalyze Fe(II) oxidation, as they have been found to play this role in anaerobic phototrophic Fe(II)-oxidizing bacteria. Here we report on efforts to identify genes associated with nitrate-dependent Fe(II) oxidation, namely (a) whole-genome transcriptional studies [using FeCO3, Fe2+, and U(IV) oxides as electron donors under denitrifying conditions], (b) Fe(II) oxidation assays performed with knockout mutants targeting primarily highly expressed or upregulated c-type cytochromes, and (c) random transposon-mutagenesis studies with screening for Fe(II) oxidation. Assays of mutants for 26 target genes, most of which were c-type cytochromes, indicated that none of the mutants tested were significantly defective in nitrate-dependent Fe(II) oxidation. The non-defective mutants included the c1-cytochrome subunit of the cytochrome bc1 complex (complex III), which has relevance to a previously proposed role for this complex in nitrate-dependent Fe(II) oxidation and to current concepts of reverse electron transfer. A transposon mutant with a disrupted gene associated with NADH:ubiquinone oxidoreductase (complex I) was ~35% defective relative to the wild-type strain; this strain was similarly defective in nitrate reduction with thiosulfate as the electron donor. Overall, our results indicate that nitrate-dependent Fe(II) oxidation in T. denitrificans is not catalyzed by the same c-type cytochromes involved in U(IV) oxidation, nor have other c-type cytochromes yet been implicated in the process. PMID:24065960

  11. Rib Cage Deformities Alter Respiratory Muscle Action and Chest Wall Function in Patients with Severe Osteogenesis Imperfecta

    PubMed Central

    LoMauro, Antonella; Pochintesta, Simona; Romei, Marianna; D'Angelo, Maria Grazia; Pedotti, Antonio; Turconi, Anna Carla; Aliverti, Andrea

    2012-01-01

    Background Osteogenesis imperfecta (OI) is an inherited connective tissue disorder characterized by bone fragility, multiple fractures and significant chest wall deformities. Cardiopulmonary insufficiency is the leading cause of death in these patients. Methods Seven patients with severe OI type III, 15 with moderate OI type IV and 26 healthy subjects were studied. In addition to standard spirometry, rib cage geometry, breathing pattern and regional chest wall volume changes at rest in seated and supine position were assessed by opto-electronic plethysmography to investigate if structural modifications of the rib cage in OI have consequences on ventilatory pattern. One-way or two-way analysis of variance was performed to compare the results between the three groups and the two postures. Results Both OI type III and IV patients showed reduced FVC and FEV1 compared to predicted values, on condition that updated reference equations are considered. In both positions, ventilation was lower in OI patients than control because of lower tidal volume (p<0.01). In contrast to OI type IV patients, whose chest wall geometry and function was normal, OI type III patients were characterized by reduced (p<0.01) angle at the sternum (pectus carinatum), paradoxical inspiratory inward motion of the pulmonary rib cage, significant thoraco-abdominal asynchronies and rib cage distortions in supine position (p<0.001). Conclusions In conclusion, the restrictive respiratory pattern of Osteogenesis Imperfecta is closely related to the severity of the disease and to the sternal deformities. Pectus carinatum characterizes OI type III patients and alters respiratory muscles coordination, leading to chest wall and rib cage distortions and an inefficient ventilator pattern. OI type IV is characterized by lower alterations in the respiratory function. These findings suggest that functional assessment and treatment of OI should be differentiated in these two forms of the disease. PMID:22558284

  12. Transarterial Onyx embolization of intracranial dural arteriovenous fistulas: a single center experience.

    PubMed

    Luo, Chao-Bao; Chang, Feng-Chi; Mu-Huo Teng, Michael; Lin, Chung-Jung; Wu, Hsiu-Mei; Guo, Wan-Yuo; Chang, Cheng-Yen

    2014-04-01

    Transarterial embolization of intracranial dural arteriovenous fistulas (DAVFs) is usually associated with inadequate embolization. The purpose of this study was to report our experience of transarterial Onyx embolization of intracranial DAVFs with an emphasis on treatment outcome with this new embolic agent in different types of DAVFs. In the past 3 years, a total of 14 intracranial DAVFs have been treated by transarterial Onyx embolization. Among these, there were nine males and five females, aged from 30 years to 82 years (mean = 62 years). We retrospectively analyzed the injection volume and time of Onyx embolization as well as outcomes in different types of DAVFs. The locations of the DAVFs were sigmoid sinus (n = 6), tentorium (n = 3), sinus confluence (n = 2), transverse-sigmoid sinus (n = 1), sigmoid sinus-jugular bulb (n = 1) and the superior petrous sinus (n = 1). The mean volume and time of Onyx injection were 3.4 mL and 28 minutes, respectively (Cognard type I: 4.9 mL, 40 minutes; type II: 4.5 mL, 34 minutes; type III: 2.2 mL, 21 minutes; type IV: 2 mL, 22 minutes). Total fistula occlusion was achieved in six out of seven patients of type III and type IV DAVFs, and in four out of seven patients of type I and type II DAVFs. Nine patients had total resolution of their symptoms, whereas partial regression occurred in five patients. No significant periprocedural complication was found. Mean clinical follow-up period was 16 months. Transarterial Onyx embolization of intracranial DAVFs is safe and effective. This technique is particularly useful in type III and type IV DAVFs with a high cure rate, and lower volume of Onyx as well as a short injection time. Copyright © 2014. Published by Elsevier B.V.

  13. Analysis of Phoenix Anomalies and IV & V Findings Applied to the GRAIL Mission

    NASA Technical Reports Server (NTRS)

    Larson, Steve

    2012-01-01

    NASA IV&V was established in 1993 to improve safety and cost-effectiveness of mission critical software. Since its inception the tools and strategies employed by IV&V have evolved. This paper examines how lessons learned from the Phoenix project were developed and applied to the GRAIL project. Shortly after selection, the GRAIL project initiated a review of the issues documented by IV&V for Phoenix. The motivation was twofold: the learn as much as possible about the types of issues that arose from the flight software product line slated for use on GRAIL, and to identify opportunities for improving the effectiveness of IV&V on GRAIL. The IV&V Facility provided a database dump containing 893 issues. These were categorized into 16 bins, and then analyzed according to whether the project responded by changing the affected artifacts or using as-is. The results of this analysis were compared to a similar assessment of post-launch anomalies documented by the project. Results of the analysis were discussed with the IV&V team assigned to GRAIL. These discussions led to changes in the way both the project and IV&V approached the IV&V task, and improved the efficiency of the activity.

  14. Contribution of alpha3(IV)alpha4(IV)alpha5(IV) Collagen IV to the Mechanical Properties of the Glomerular Basement Membrane

    NASA Astrophysics Data System (ADS)

    Gyoneva, Lazarina

    The glomerular basement membrane (GBM) is a vital part of the blood-urine filtration barrier in the kidneys. In healthy GBMs, the main tension-resisting component is alpha3(IV)alpha4(IV)alpha5(IV) type IV collagen, but in some diseases it is replaced by other collagen IV isoforms. As a result, the GBM becomes leaky and disorganized, ultimately resulting in kidney failure. Our goal is to understanding the biomechanical aspects of the alpha3(IV)alpha4(IV)alpha5(IV) chains and how their absence could be responsible for (1) the initial injury to the GBM and (2) progression to kidney failure. A combination of experiments and computational models were designed for that purpose. A model basement membrane was used to compare experimentally the distensibility of tissues with the alpha3(IV)alpha4(IV)alpha5(IV) chains present and missing. The experiments showed basement membranes containing alpha3(IV)alpha4(IV)alpha5(IV) chains were less distensible. It has been postulated that the higher level of lateral cross-linking (supercoiling) in the alpha3(IV)alpha4(IV)alpha5(IV) networks contributes additional strength/stability to basement membranes. In a computational model of supercoiled networks, we found that supercoiling greatly increased the stiffness of collagen IV networks but only minimally decreased the permeability, which is well suited for the needs of the GBM. It is also known that the alpha3(IV)alpha4(IV)alpha5(IV) networks are more protected from enzymatic degradation, and we explored their significance in GBM remodeling. Our simulations showed that the more protected network was needed to prevent the system from entering a dangerous feedback cycle due to autoregulation mechanisms in the kidneys. Overall, the work adds to the evidence of biomechanical differences between the alpha3(IV)alpha4(IV)alpha5(IV) networks and other collagen IV networks, points to supercoiling as the main source of biomechanical differences, discusses the suitability of alpha3(IV)alpha4(IV)alpha5(IV) networks to meet the mechanics and permeability needs of the GBM, and explores the role of biomechanics and enzymatic digestion in GBM remodeling.

  15. A Morphological Analysis of Gamma-Ray Burst Early-optical Afterglows

    NASA Astrophysics Data System (ADS)

    Gao, He; Wang, Xiang-Gao; Mészáros, Peter; Zhang, Bing

    2015-09-01

    Within the framework of the external shock model of gamma-ray burst (GRB) afterglows, we perform a morphological analysis of the early-optical light curves to directly constrain model parameters. We define four morphological types, i.e., the reverse shock-dominated cases with/without the emergence of the forward shock peak (Type I/Type II), and the forward shock-dominated cases without/with νm crossing the band (Type III/IV). We systematically investigate all of the Swift GRBs that have optical detection earlier than 500 s and find 3/63 Type I bursts (4.8%), 12/63 Type II bursts (19.0%), 30/63 Type III bursts (47.6%), 8/63 Type IV bursts (12.7%), and 10/63 Type III/IV bursts (15.9%). We perform Monte Carlo simulations to constrain model parameters in order to reproduce the observations. We find that the favored value of the magnetic equipartition parameter in the forward shock ({ɛ }B{{f}}) ranges from 10-6 to 10-2, and the reverse-to-forward ratio of ɛB ({{R}}B) is about 100. The preferred electron equipartition parameter {ɛ }{{e}}{{r},{{f}}} value is 0.01, which is smaller than the commonly assumed value, e.g., 0.1. This could mitigate the so-called “efficiency problem” for the internal shock model, if ɛe during the prompt emission phase (in the internal shocks) is large (say, ˜0.1). The preferred {{R}}B value is in agreement with the results in previous works that indicate a moderately magnetized baryonic jet for GRBs.

  16. The Pseudomonas aeruginosa ribbon-helix-helix DNA-binding protein AlgZ (AmrZ) controls twitching motility and biogenesis of type IV pili.

    PubMed

    Baynham, Patricia J; Ramsey, Deborah M; Gvozdyev, Borys V; Cordonnier, Ellen M; Wozniak, Daniel J

    2006-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen that is commonly found in water and soil. In order to colonize surfaces with low water content, P. aeruginosa utilizes a flagellum-independent form of locomotion called twitching motility, which is dependent upon the extension and retraction of type IV pili. This study demonstrates that AlgZ, previously identified as a DNA-binding protein absolutely required for transcription of the alginate biosynthetic operon, is required for twitching motility. AlgZ may be required for the biogenesis or function of type IV pili in twitching motility. Transmission electron microscopy analysis of an algZ deletion in nonmucoid PAO1 failed to detect surface pili. To examine expression and localization of PilA (the major pilin subunit), whole-cell extracts and cell surface pilin preparations were analyzed by Western blotting. While the PilA levels present in whole-cell extracts were similar for wild-type P. aeruginosa and P. aeruginosa with the algZ deletion, the amount of PilA on the surface of the cells was drastically reduced in the algZ mutant. Analysis of algZ and algD mutants indicates that the DNA-binding activity of AlgZ is essential for the regulation of twitching motility and that this is independent of the role of AlgZ in alginate expression. These data show that AlgZ DNA-binding activity is required for twitching motility independently of its role in alginate production and that this involves the surface localization of type IV pili. Given this new role in twitching motility, we propose that algZ (PA3385) be designated amrZ (alginate and motility regulator Z).

  17. Diagnostic accuracy study of anorectal manometry for diagnosis of dyssynergic defaecation

    PubMed Central

    Grossi, Ugo; Carrington, Emma V; Bharucha, Adil E; Horrocks, Emma J; Scott, S Mark; Knowles, Charles H

    2015-01-01

    Objective The diagnostic accuracy of anorectal manometry (AM), which is necessary to diagnose functional defaecatory disorders (FDD), is unknown. Using blinded analysis and standardised reporting of diagnostic accuracy (STARD), we evaluated whether AM could discriminate between asymptomatic controls and patients with functional constipation (FC). Design Derived line-plots of anorectal pressure profiles during simulated defaecation were independently analysed in random order by 3 expert observers blinded to health status in 85 women with FC and 85 age-matched asymptomatic healthy volunteers (HV). Using accepted criteria, these pressure profiles were characterized as normal (i.e. increased rectal pressure coordinated with anal relaxation) or types I-IV dyssynergia. Inter-observer agreement and diagnostic accuracy were determined. Results Blinded consensus-based assessment disclosed a normal pattern in 16/170 (9%) of all participants and only 11/85 (13%) HV. The combined frequency of dyssynergic patterns (I-IV) was very similar in FC (80/85 [94%]) and HV (74/85 [87%]). Type I dyssynergia (‘paradoxical’ contraction) was less prevalent in FC (17/85 [20%] than HV (31/85 [36.5%], p=0.03). After statistical correction, only type IV dyssynergia was moderately useful for discriminating between FC (39/85 [46%] and HV 17/85 [20%], p=0.001, PPV=70.0%, positive LR=2.3). Inter-observer agreement was substantial or moderate for identifying a normal pattern, dyssynergia types I and IV, and FDD, and fair for types II and III. Conclusions While the interpretation of AM patterns is reproducible, nearly 90% of HV have a pattern that is currently regarded as “abnormal” by AM. Hence AM is of limited utility for distinguishing between FC and HV. PMID:25765461

  18. Does microvascularization of the footprint play a role in rotator cuff healing of the shoulder?

    PubMed

    Bonnevialle, Nicolas; Bayle, Xavier; Faruch, Marie; Wargny, Matthieu; Gomez-Brouchet, Anne; Mansat, Pierre

    2015-08-01

    The aim of the study was to evaluate the relationship between bone microvascularization of the footprint and tendon integrity after rotator cuff repair of the shoulder. Forty-eight patients (mean age, 59 years; ±7.9) with a chronic rotator cuff tear underwent a tendon repair with a single-row technique and were studied prospectively. A core obtained from the footprint during the procedure allowed determination of the bone's microvascularization with an immunohistochemistry technique using anti-CD34 antibodies. Clinical evaluation was performed at a minimum of 12-month follow-up, and rotator cuff integrity was assessed with ultrasound according to Sugaya's classification. At a mean follow-up of 13 months, the Constant score improved from 40 to 75 points; American Shoulder and Elbow Surgeons score, from 59 to 89 points; and subjective shoulder value, from 38% to 83% (P < .001). Ultrasound identified 18 patients with Sugaya type I healing, 27 patients with type II, and 3 patients with type IV. No patients showed Sugaya type III or V repairs. The rate of microvascularization of the footprint was 15.6%, 13.9%, and 4.2% for type I, II, and IV tendon integrity, respectively (I vs. II, P = .22; II vs. IV, P = .02; I vs. IV, P = .0022). Patients with a history of corticosteroid injection had a lower rate of microvascularization than the others (10.3% vs. 16.2%; P = .03). Even if overall satisfactory clinical outcomes are achieved after a rotator cuff repair, bone microvascularization of the footprint plays a role in rotator cuff healing. A lower rate of microvessels decreases the tendon integrity and healing potential after repair. Copyright © 2015 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  19. The putative drug efflux systems of the Bacillus cereus group

    PubMed Central

    Elbourne, Liam D. H.; Vörös, Aniko; Kroeger, Jasmin K.; Simm, Roger; Tourasse, Nicolas J.; Finke, Sarah; Henderson, Peter J. F.; Økstad, Ole Andreas; Paulsen, Ian T.; Kolstø, Anne-Brit

    2017-01-01

    The Bacillus cereus group of bacteria includes seven closely related species, three of which, B. anthracis, B. cereus and B. thuringiensis, are pathogens of humans, animals and/or insects. Preliminary investigations into the transport capabilities of different bacterial lineages suggested that genes encoding putative efflux systems were unusually abundant in the B. cereus group compared to other bacteria. To explore the drug efflux potential of the B. cereus group all putative efflux systems were identified in the genomes of prototypical strains of B. cereus, B. anthracis and B. thuringiensis using our Transporter Automated Annotation Pipeline. More than 90 putative drug efflux systems were found within each of these strains, accounting for up to 2.7% of their protein coding potential. Comparative analyses demonstrated that the efflux systems are highly conserved between these species; 70–80% of the putative efflux pumps were shared between all three strains studied. Furthermore, 82% of the putative efflux system proteins encoded by the prototypical B. cereus strain ATCC 14579 (type strain) were found to be conserved in at least 80% of 169 B. cereus group strains that have high quality genome sequences available. However, only a handful of these efflux pumps have been functionally characterized. Deletion of individual efflux pump genes from B. cereus typically had little impact to drug resistance phenotypes or the general fitness of the strains, possibly because of the large numbers of alternative efflux systems that may have overlapping substrate specificities. Therefore, to gain insight into the possible transport functions of efflux systems in B. cereus, we undertook large-scale qRT-PCR analyses of efflux pump gene expression following drug shocks and other stress treatments. Clustering of gene expression changes identified several groups of similarly regulated systems that may have overlapping drug resistance functions. In this article we review current knowledge of the small molecule efflux pumps encoded by the B. cereus group and suggest the likely functions of numerous uncharacterised pumps. PMID:28472044

  20. A case of mild phenotype Alport syndrome caused by COL4A3 mutations.

    PubMed

    Kamijo, Masafumi; Kitamura, Mineaki; Muta, Kumiko; Uramatsu, Tadashi; Obata, Yoko; Nozu, Kandai; Kaito, Hiroshi; Iijima, Kazumoto; Mukae, Hiroshi; Nishino, Tomoya

    2017-11-01

    In a case of 41-year-old man with mild nephropathy, Alport syndrome (AS) was diagnosed from the renal biopsy. However, the α5 chain of type IV collagen expressed in the glomerular basement membrane, which was the atypical staining pattern of AS. Genetic testing suggested autosomal recessive AS from heterozygous mutations at two positions in the type IV collagen α3 chain. These two gene mutations represented a new pattern of mutation and was suggested the association with an atypical α5 chain expression and mild phenotype.

Top