Challenging the Metallothionein (MT) Gene of Biomphalaria glabrata: Unexpected Response Patterns Due to Cadmium Exposure and Temperature Stress.

PubMed

Niederwanger, Michael; Dvorak, Martin; Schnegg, Raimund; Pedrini-Martha, Veronika; Bacher, Katharina; Bidoli, Massimo; Dallinger, Reinhard

2017-08-11

Metallothioneins (MTs) are low-molecular-mass, cysteine-rich, metal binding proteins. In most animal species, they are involved in metal homeostasis and detoxification, and provide protection from oxidative stress. Gastropod MTs are highly diversified, exhibiting unique features and adaptations like metal specificity and multiplications of their metal binding domains. Here, we show that the MT gene of Biomphalaria glabrata , one of the largest MT genes identified so far, is composed in a unique way. The encoding for an MT protein has a three-domain structure and a C-terminal, Cys-rich extension. Using a bioinformatic approach involving structural and in silico analysis of putative transcription factor binding sites (TFBs), we found that this MT gene consists of five exons and four introns. It exhibits a regulatory promoter region containing three metal-responsive elements (MREs) and several TFBs with putative involvement in environmental stress response, and regulation of gene expression. Quantitative real-time polymerase chain reaction (qRT-PCR) data indicate that the MT gene is not inducible by cadmium (Cd) nor by temperature challenges (heat and cold), despite significant Cd uptake within the midgut gland and the high Cd tolerance of metal-exposed snails.

Challenging the Metallothionein (MT) Gene of Biomphalaria glabrata: Unexpected Response Patterns Due to Cadmium Exposure and Temperature Stress

PubMed Central

Dvorak, Martin; Schnegg, Raimund; Pedrini-Martha, Veronika; Bacher, Katharina; Bidoli, Massimo; Dallinger, Reinhard

2017-01-01

Metallothioneins (MTs) are low-molecular-mass, cysteine-rich, metal binding proteins. In most animal species, they are involved in metal homeostasis and detoxification, and provide protection from oxidative stress. Gastropod MTs are highly diversified, exhibiting unique features and adaptations like metal specificity and multiplications of their metal binding domains. Here, we show that the MT gene of Biomphalaria glabrata, one of the largest MT genes identified so far, is composed in a unique way. The encoding for an MT protein has a three-domain structure and a C-terminal, Cys-rich extension. Using a bioinformatic approach involving structural and in silico analysis of putative transcription factor binding sites (TFBs), we found that this MT gene consists of five exons and four introns. It exhibits a regulatory promoter region containing three metal-responsive elements (MREs) and several TFBs with putative involvement in environmental stress response, and regulation of gene expression. Quantitative real-time polymerase chain reaction (qRT-PCR) data indicate that the MT gene is not inducible by cadmium (Cd) nor by temperature challenges (heat and cold), despite significant Cd uptake within the midgut gland and the high Cd tolerance of metal-exposed snails. PMID:28800079

Tick Haller's Organ, a New Paradigm for Arthropod Olfaction: How Ticks Differ from Insects.

PubMed

Carr, Ann L; Mitchell, Robert D; Dhammi, Anirudh; Bissinger, Brooke W; Sonenshine, Daniel E; Roe, R Michael

2017-07-18

Ticks are the vector of many human and animal diseases; and host detection is critical to this process. Ticks have a unique sensory structure located exclusively on the 1st pairs of legs; the fore-tarsal Haller's organ, not found in any other animals, presumed to function like the insect antennae in chemosensation but morphologically very different. The mechanism of tick chemoreception is unknown. Utilizing next-generation sequencing and comparative transcriptomics between the 1st and 4th legs (the latter without the Haller's organ), we characterized 1st leg specific and putative Haller's organ specific transcripts from adult American dog ticks, Dermacentor variabilis . The analysis suggested that the Haller's organ is involved in olfaction, not gustation. No known odorant binding proteins like those found in insects, chemosensory lipocalins or typical insect olfactory mechanisms were identified; with the transcriptomic data only supporting a possible olfactory G-protein coupled receptor (GPCR) signal cascade unique to the Haller's organ. Each component of the olfactory GPCR signal cascade was identified and characterized. The expression of GPCR, G αo and β-arrestin transcripts identified exclusively in the 1st leg transcriptome, and putatively Haller's organ specific, were examined in unfed and blood-fed adult female and male D. variabilis . Blood feeding to repletion in adult females down-regulated the expression of all three chemosensory transcripts in females but not in males; consistent with differences in post-feeding tick behavior between sexes and an expected reduced chemosensory function in females as they leave the host. Data are presented for the first time of the potential hormonal regulation of tick chemosensation; behavioral assays confirmed the role of the Haller's organ in N , N -diethyl-meta-toluamide (DEET) repellency but showed no role for the Haller's organ in host attachment. Further research is needed to understand the potential role of the GPCR cascade in olfaction.

Tick Haller’s Organ, a New Paradigm for Arthropod Olfaction: How Ticks Differ from Insects

PubMed Central

Carr, Ann L.; Mitchell III, Robert D.; Dhammi, Anirudh; Bissinger, Brooke W.; Sonenshine, Daniel E.; Roe, R. Michael

2017-01-01

Ticks are the vector of many human and animal diseases; and host detection is critical to this process. Ticks have a unique sensory structure located exclusively on the 1st pairs of legs; the fore-tarsal Haller’s organ, not found in any other animals, presumed to function like the insect antennae in chemosensation but morphologically very different. The mechanism of tick chemoreception is unknown. Utilizing next-generation sequencing and comparative transcriptomics between the 1st and 4th legs (the latter without the Haller’s organ), we characterized 1st leg specific and putative Haller’s organ specific transcripts from adult American dog ticks, Dermacentor variabilis. The analysis suggested that the Haller’s organ is involved in olfaction, not gustation. No known odorant binding proteins like those found in insects, chemosensory lipocalins or typical insect olfactory mechanisms were identified; with the transcriptomic data only supporting a possible olfactory G-protein coupled receptor (GPCR) signal cascade unique to the Haller’s organ. Each component of the olfactory GPCR signal cascade was identified and characterized. The expression of GPCR, Gαo and β-arrestin transcripts identified exclusively in the 1st leg transcriptome, and putatively Haller’s organ specific, were examined in unfed and blood-fed adult female and male D. variabilis. Blood feeding to repletion in adult females down-regulated the expression of all three chemosensory transcripts in females but not in males; consistent with differences in post-feeding tick behavior between sexes and an expected reduced chemosensory function in females as they leave the host. Data are presented for the first time of the potential hormonal regulation of tick chemosensation; behavioral assays confirmed the role of the Haller’s organ in N,N-diethyl-meta-toluamide (DEET) repellency but showed no role for the Haller’s organ in host attachment. Further research is needed to understand the potential role of the GPCR cascade in olfaction. PMID:28718821

Regulation of H3K4me3 at Transcriptional Enhancers Characterizes Acquisition of Virus-Specific CD8+ T Cell-Lineage-Specific Function.

PubMed

Russ, Brendan E; Olshansky, Moshe; Li, Jasmine; Nguyen, Michelle L T; Gearing, Linden J; Nguyen, Thi H O; Olson, Matthew R; McQuilton, Hayley A; Nüssing, Simone; Khoury, Georges; Purcell, Damian F J; Hertzog, Paul J; Rao, Sudha; Turner, Stephen J

2017-12-19

Infection triggers large-scale changes in the phenotype and function of T cells that are critical for immune clearance, yet the gene regulatory mechanisms that control these changes are largely unknown. Using ChIP-seq for specific histone post-translational modifications (PTMs), we mapped the dynamics of ∼25,000 putative CD8 + T cell transcriptional enhancers (TEs) differentially utilized during virus-specific T cell differentiation. Interestingly, we identified a subset of dynamically regulated TEs that exhibited acquisition of a non-canonical (H3K4me3 + ) chromatin signature upon differentiation. This unique TE subset exhibited characteristics of poised enhancers in the naive CD8 + T cell subset and demonstrated enrichment for transcription factor binding motifs known to be important for virus-specific CD8 + T cell differentiation. These data provide insights into the establishment and maintenance of the gene transcription profiles that define each stage of virus-specific T cell differentiation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Extracellular calcium triggers unique transcriptional programs and modulates staurosporine-induced cell death in Neurospora crassa

PubMed Central

Gonçalves, A. P.; Monteiro, João; Lucchi, Chiara; Kowbel, David J.; Cordeiro, J. M.; Correia-de-Sá, Paulo; Rigden, Daniel J.; Glass, N. L.; Videira, Arnaldo

2014-01-01

Alterations in the intracellular levels of calcium are a common response to cell death stimuli in animals and fungi and, particularly, in the Neurospora crassa response to staurosporine. We highlight the importance of the extracellular availability of Ca2+ for this response. Limitation of the ion in the culture medium further sensitizes cells to the drug and results in increased accumulation of reactive oxygen species (ROS). Conversely, an approximately 30-fold excess of external Ca2+ leads to increased drug tolerance and lower ROS generation. In line with this, distinct staurosporine-induced cytosolic Ca2+ signaling profiles were observed in the absence or presence of excessive external Ca2+. High-throughput RNA sequencing revealed that different concentrations of extracellular Ca2+ define distinct transcriptional programs. Our transcriptional profiling also pointed to two putative novel Ca2+-binding proteins, encoded by the NCU08524 and NCU06607 genes, and provides a reference dataset for future investigations on the role of Ca2+ in fungal biology. PMID:28357255

Identification of estrogen-responsive genes using a genome-wide analysis of promoter elements for transcription factor binding sites.

PubMed

Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T

2005-06-03

We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.

The midgut transcriptome of Phlebotomus (Larroussius) perniciosus, a vector of Leishmania infantum: comparison of sugar fed and blood fed sand flies.

PubMed

Dostálová, Anna; Votýpka, Jan; Favreau, Amanda J; Barbian, Kent D; Volf, Petr; Valenzuela, Jesus G; Jochim, Ryan C

2011-05-10

Parasite-vector interactions are fundamental in the transmission of vector-borne diseases such as leishmaniasis. Leishmania development in the vector sand fly is confined to the digestive tract, where sand fly midgut molecules interact with the parasites. In this work we sequenced and analyzed two midgut-specific cDNA libraries from sugar fed and blood fed female Phlebotomus perniciosus and compared the transcript expression profiles. A total of 4111 high quality sequences were obtained from the two libraries and assembled into 370 contigs and 1085 singletons. Molecules with putative roles in blood meal digestion, peritrophic matrix formation, immunity and response to oxidative stress were identified, including proteins that were not previously reported in sand flies. These molecules were evaluated relative to other published sand fly transcripts. Comparative analysis of the two libraries revealed transcripts differentially expressed in response to blood feeding. Molecules up regulated by blood feeding include a putative peritrophin (PperPer1), two chymotrypsin-like proteins (PperChym1 and PperChym2), a putative trypsin (PperTryp3) and four putative microvillar proteins (PperMVP1, 2, 4 and 5). Additionally, several transcripts were more abundant in the sugar fed midgut, such as two putative trypsins (PperTryp1 and PperTryp2), a chymotrypsin (PperChym3) and a microvillar protein (PperMVP3). We performed a detailed temporal expression profile analysis of the putative trypsin transcripts using qPCR and confirmed the expression of blood-induced and blood-repressed trypsins. Trypsin expression was measured in Leishmania infantum-infected and uninfected sand flies, which identified the L. infantum-induced down regulation of PperTryp3 at 24 hours post-blood meal. This midgut tissue-specific transcriptome provides insight into the molecules expressed in the midgut of P. perniciosus, an important vector of visceral leishmaniasis in the Old World. Through the comparative analysis of the libraries we identified molecules differentially expressed during blood meal digestion. Additionally, this study provides a detailed comparison to transcripts of other sand flies. Moreover, our analysis of putative trypsins demonstrated that L. infantum infection can reduce the transcript abundance of trypsin PperTryp3 in the midgut of P. perniciosus.

Differential Sox10 Genomic Occupancy in Myelinating Glia

PubMed Central

Lopez-Anido, Camila; Sun, Guannan; Koenning, Matthias; Srinivasan, Rajini; Hung, Holly A.; Emery, Ben; Keles, Sunduz; Svaren, John

2015-01-01

Myelin is formed by specialized myelinating glia: oligodendrocytes and Schwann cells in the central and peripheral nervous systems, respectively. While there are distinct developmental aspects and regulatory pathways in these two cell types, myelination in both systems requires the transcriptional activator Sox10. Sox10 interacts with cell type-specific transcription factors at some loci to induce myelin gene expression, but it is largely unknown how Sox10 transcriptional networks globally compare between oligodendrocytes and Schwann cells. We used in vivo ChIP-Seq analysis of spinal cord and peripheral nerve (sciatic nerve) to identify unique and shared Sox10 binding sites and assess their correlation with active enhancers and transcriptional profiles in oligodendrocytes and Schwann cells. Sox10 binding sites overlap with active enhancers and critical cell type-specific regulators of myelination, such as Olig2 and Myrf in oligodendrocytes, and Egr2/Krox20 in Schwann cells. Sox10 sites also associate with genes critical for myelination in both oligodendrocytes and Schwann cells, and are found within super-enhancers previously defined in brain. In Schwann cells, Sox10 sites contain binding motifs of putative partners in the Sp/Klf, Tead, and nuclear receptor protein families. Specifically, siRNA analysis of nuclear receptors Nr2f1 and Nr2f2 revealed downregulation of myelin genes Mbp and Ndrg1 in primary Schwann cells. Our analysis highlights different mechanisms that establish cell type-specific genomic occupancy of Sox10, which reflects the unique characteristics of oligodendrocyte and Schwann cell differentiation. PMID:25974668

Transcriptomics insights into the genetic regulation of root apical meristem exhaustion and determinate primary root growth in Pachycereus pringlei (Cactaceae).

PubMed

Rodriguez-Alonso, Gustavo; Matvienko, Marta; López-Valle, Mayra L; Lázaro-Mixteco, Pedro E; Napsucialy-Mendivil, Selene; Dubrovsky, Joseph G; Shishkova, Svetlana

2018-06-04

Many Cactaceae species exhibit determinate growth of the primary root as a consequence of root apical meristem (RAM) exhaustion. The genetic regulation of this growth pattern is unknown. Here, we de novo assembled and annotated the root apex transcriptome of the Pachycereus pringlei primary root at three developmental stages, with active or exhausted RAM. The assembled transcriptome is robust and comprehensive, and was used to infer a transcriptional regulatory network of the primary root apex. Putative orthologues of Arabidopsis regulators of RAM maintenance, as well as putative lineage-specific transcripts were identified. The transcriptome revealed putative orthologues of most proteins involved in housekeeping processes, hormone signalling, and metabolic pathways. Our results suggest that specific transcriptional programs operate in the root apex at specific developmental time points. Moreover, the transcriptional state of the P. pringlei root apex as the RAM becomes exhausted is comparable to the transcriptional state of cells from the meristematic, elongation, and differentiation zones of Arabidopsis roots along the root axis. We suggest that the transcriptional program underlying the drought stress response is induced during Cactaceae root development, and that lineage-specific transcripts could contribute to RAM exhaustion in Cactaceae.

Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.

PubMed

Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki

2007-05-01

The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

Genome, transcriptome, and secretome analysis of wood decay fungus Postia placenta supports unique mechanisms of lignocellulose conversion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinez, Diego; Challacombe, Jean; Morgenstern, Ingo

2009-02-04

Brown-rot fungi such as Postia placenta are common inhabitants of forest ecosystems and are also largely responsible for the destructive decay of wooden structures. Rapid depolymerization of cellulose is a distinguishing feature of brown-rot, but the biochemical mechanisms and underlying genetics are poorly understood. Systematic examination of the P. placenta genome, transcriptome, and secretome revealed unique extracellular enzyme systems, including an unusual repertoire of extracellular glycoside hydrolases. Genes encoding exocellobiohydrolases and cellulose-binding domains, typical of cellulolytic microbes, are absent in this efficient cellulose-degrading fungus. When P. placenta was grown in media containing cellulose as sole carbon source, transcripts corresponding tomore » many hemicellulases and to a single putative β-1-4 endoglucanase were expressed at high levels relative to glucose grown cultures. These transcript profiles were confirmed by direct identification of peptides by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Also upregulated under cellulolytic culture conditions were putative iron reductases, quinone reductase, and structurally divergent oxidases potentially involved in extracellular generation of Fe(II) and H2O2. These observations are consistent with a biodegradative role for Fenton chemistry in which Fe(II) and H2O2 react to form hydroxyl radicals, highly reactive oxidants capable of depolymerizing cellulose. The P. placenta genome resources provide unparalleled opportunities for investigating such unusual mechanisms of cellulose conversion. More broadly, the genome offers insight into the diversification of lignocellulose degrading mechanisms in fungi. In particular, comparisons between P. placenta and the closely related white-rot fungus, Phanerochaete chrysosporium support an evolutionary shift from white-rot to brown-rot during which efficient depolymerization of lignin was lost.« less

Genome, transcriptome, and secretome analysis of wood decay fungus postia placenta supports unique mechanisms of lignocellulose conversion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinez, Diego; Challacombe, Jean F; Misra, Monica

2008-01-01

Brown-rot fungi such as Postia placenta are common inhabitants of forest ecosystems and are also largely responsible for the destructive decay of wooden structures. Rapid depolymerization of cellulose is a distinguishing feature of brown-rot, but the biochemical mechanisms and underlying genetics are poorly understood. Systematic examination of the P. placenta genome, transcriptome and secretome revealed unique extracellular enzyme systems, including an unusual repertoire of extracellular glycoside hydrolases. Genes encoding exocellobiohydrolases and cellulose-binding domains, typical of cellulolytic microbes, are absent in this efficient cellulose-degrading fungus. When P. placenta was grown in medium containing cellulose as sole carbon source, transcripts corresponding tomore » many hemicellulases and to a single putative {beta}-1-4 endoglucanase were expressed at high levels relative to glucose grown cultures. These transcript profiles were confirmed by direct identification of peptides by liquid chromatography-tandem mass spectrometry (LC{center_dot}MSIMS). Also upregulated during growth on cellulose medium were putative iron reductases, quinone reductase, and structurally divergent oxidases potentially involved in extracellular generation of Fe(II) and H202. These observations are consistent with a biodegradative role for Fenton chemistry in which Fe(II) and H202 react to form hydroxyl radicals, highly reactive oxidants capable of depolymerizing cellulose. The P. placenta genome resources provide unparalleled opportunities for investigating such unusual mechanisms of cellulose conversion. More broadly, the genome offers insight into the diversification of lignocellulose degrading mechanisms in fungi. Comparisons to the closely related white-rot fungus Phanerochaete chrysosporium support an evolutionary shift from white-rot to brown-rot during which the capacity for efficient depolymerization of lignin was lost.« less

Genome, transcriptome, and secretome analysis of wood decay fungus Postia placenta supports unique mechanisms of lignocellulose conversion

PubMed Central

Martinez, Diego; Challacombe, Jean; Morgenstern, Ingo; Hibbett, David; Schmoll, Monika; Kubicek, Christian P.; Ferreira, Patricia; Ruiz-Duenas, Francisco J.; Martinez, Angel T.; Kersten, Phil; Hammel, Kenneth E.; Vanden Wymelenberg, Amber; Gaskell, Jill; Lindquist, Erika; Sabat, Grzegorz; Splinter BonDurant, Sandra; Larrondo, Luis F.; Canessa, Paulo; Vicuna, Rafael; Yadav, Jagjit; Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Pisabarro, Antonio G.; Lavín, José L.; Oguiza, José A.; Master, Emma; Henrissat, Bernard; Coutinho, Pedro M.; Harris, Paul; Magnuson, Jon Karl; Baker, Scott E.; Bruno, Kenneth; Kenealy, William; Hoegger, Patrik J.; Kües, Ursula; Ramaiya, Preethi; Lucas, Susan; Salamov, Asaf; Shapiro, Harris; Tu, Hank; Chee, Christine L.; Misra, Monica; Xie, Gary; Teter, Sarah; Yaver, Debbie; James, Tim; Mokrejs, Martin; Pospisek, Martin; Grigoriev, Igor V.; Brettin, Thomas; Rokhsar, Dan; Berka, Randy; Cullen, Dan

2009-01-01

Brown-rot fungi such as Postia placenta are common inhabitants of forest ecosystems and are also largely responsible for the destructive decay of wooden structures. Rapid depolymerization of cellulose is a distinguishing feature of brown-rot, but the biochemical mechanisms and underlying genetics are poorly understood. Systematic examination of the P. placenta genome, transcriptome, and secretome revealed unique extracellular enzyme systems, including an unusual repertoire of extracellular glycoside hydrolases. Genes encoding exocellobiohydrolases and cellulose-binding domains, typical of cellulolytic microbes, are absent in this efficient cellulose-degrading fungus. When P. placenta was grown in medium containing cellulose as sole carbon source, transcripts corresponding to many hemicellulases and to a single putative β-1–4 endoglucanase were expressed at high levels relative to glucose-grown cultures. These transcript profiles were confirmed by direct identification of peptides by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Also up-regulated during growth on cellulose medium were putative iron reductases, quinone reductase, and structurally divergent oxidases potentially involved in extracellular generation of Fe(II) and H2O2. These observations are consistent with a biodegradative role for Fenton chemistry in which Fe(II) and H2O2 react to form hydroxyl radicals, highly reactive oxidants capable of depolymerizing cellulose. The P. placenta genome resources provide unparalleled opportunities for investigating such unusual mechanisms of cellulose conversion. More broadly, the genome offers insight into the diversification of lignocellulose degrading mechanisms in fungi. Comparisons with the closely related white-rot fungus Phanerochaete chrysosporium support an evolutionary shift from white-rot to brown-rot during which the capacity for efficient depolymerization of lignin was lost. PMID:19193860

DLEU2 encodes an antisense RNA for the putative bicistronic RFP2/LEU5 gene in humans and mouse.

PubMed

Corcoran, Martin M; Hammarsund, Marianne; Zhu, Chaoyong; Lerner, Mikael; Kapanadze, Bagrat; Wilson, Bill; Larsson, Catharina; Forsberg, Lars; Ibbotson, Rachel E; Einhorn, Stefan; Oscier, David G; Grandér, Dan; Sangfelt, Olle

2004-08-01

Our group previously identified two novel genes, RFP2/LEU5 and DLEU2, within a 13q14.3 genomic region of loss seen in various malignancies. However, no specific inactivating mutations were found in these or other genes in the vicinity of the deletion, suggesting that a nonclassical tumor-suppressor mechanism may be involved. Here, we present data showing that the DLEU2 gene encodes a putative noncoding antisense RNA, with one exon directly overlapping the first exon of the RFP2/LEU5 gene in the opposite orientation. In addition, the RFP2/LEU5 transcript can be alternatively spliced to produce either several monocistronic transcripts or a putative bicistronic transcript encoding two separate open-reading frames, adding to the complexity of the locus. The finding that these gene structures are conserved in the mouse, including the putative bicistronic RFP2/LEU5 transcript as well as the antisense relationship with DLEU2, further underlines the significance of this unusual organization and suggests a biological function for DLEU2 in the regulation of RFP2/LEU5. Copyright 2004 Wiley-Liss, Inc.

Kid-1, a putative renal transcription factor: regulation during ontogeny and in response to ischemia and toxic injury.

PubMed Central

Witzgall, R; O'Leary, E; Gessner, R; Ouellette, A J; Bonventre, J V

1993-01-01

We have identified a new putative transcription factor from the rat kidney, termed Kid-1 (for kidney, ischemia and developmentally regulated gene 1). Kid-1 belongs to the C2H2 class of zinc finger genes. Its mRNA accumulates with age in postnatal renal development and is detected predominantly in the kidney. Kid-1 mRNA levels decline after renal injury secondary to ischemia or folic acid administration, two insults which result in epithelial cell dedifferentiation, followed by regenerative hyperplasia and differentiation. The low expression of Kid-1 early in postnatal development, and when renal tissue is recovering after injury, suggests that the gene product is involved in establishment of a differentiated phenotype and/or regulation of the proliferative response. The deduced protein contains 13 C2H2 zinc fingers at the COOH end in groups of 4 and 9 separated by a 32-amino-acid spacer. There are consensus sites for phosphorylation in the NH2 terminus non-zinc finger region as well as in the spacer region between zinc fingers 4 and 5. A region of the deduced protein shares extensive homology with a catalytic region of Raf kinases, a feature shared only with TFIIE among transcription factors. To determine whether Kid-1 can modulate transcription, a chimeric construct encoding the Kid-1 non-zinc finger region (sense or antisense) and the DNA-binding region of GAL4 was transfected into COS and LLC-PK1 cells together with a chloramphenicol acetyltransferase (CAT) reporter plasmid containing GAL4 binding sites, driven by either a minimal promoter or a simian virus 40 enhancer. CAT activity was markedly inhibited in cells transfected with the sense construct compared with the activity in cells transfected with the antisense construct. To our knowledge, this pattern of developmental regulation, kidney expression, and regulation of transcription is unique among the C2H2 class of zinc finger-containing DNA-binding proteins. Images PMID:8382778

Identification of the Operon for the Sorbitol (Glucitol) Phosphoenolpyruvate:Sugar Phosphotransferase System in Streptococcus mutans

PubMed Central

Boyd, David A.; Thevenot, Tracy; Gumbmann, Markus; Honeyman, Allen L.; Hamilton, Ian R.

2000-01-01

Transposon mutagenesis and marker rescue were used to isolate and identify an 8.5-kb contiguous region containing six open reading frames constituting the operon for the sorbitol P-enolpyruvate phosphotransferase transport system (PTS) of Streptococcus mutans LT11. The first gene, srlD, codes for sorbitol-6-phosphate dehydrogenase, followed downstream by srlR, coding for a transcriptional regulator; srlM, coding for a putative activator; and the srlA, srlE, and srlB genes, coding for the EIIC, EIIBC, and EIIA components of the sorbitol PTS, respectively. Among all sorbitol PTS operons characterized to date, the srlD gene is found after the genes coding for the EII components; thus, the location of the gene in S. mutans is unique. The SrlR protein is similar to several transcriptional regulators found in Bacillus spp. that contain PTS regulator domains (J. Stülke, M. Arnaud, G. Rapoport, and I. Martin-Verstraete, Mol. Microbiol. 28:865–874, 1998), and its gene overlaps the srlM gene by 1 bp. The arrangement of these two regulatory genes is unique, having not been reported for other bacteria. PMID:10639465

Soybean SAT1 (Symbiotic Ammonium Transporter 1) encodes a bHLH transcription factor involved in nodule growth and NH4+ transport

PubMed Central

Chiasson, David M.; Loughlin, Patrick C.; Mazurkiewicz, Danielle; Mohammadidehcheshmeh, Manijeh; Fedorova, Elena E.; Okamoto, Mamoru; McLean, Elizabeth; Glass, Anthony D. M.; Smith, Sally E.; Bisseling, Ton; Tyerman, Stephen D.; Day, David A.; Kaiser, Brent N.

2014-01-01

Glycine max symbiotic ammonium transporter 1 was first documented as a putative ammonium (NH4+) channel localized to the symbiosome membrane of soybean root nodules. We show that Glycine max symbiotic ammonium transporter 1 is actually a membrane-localized basic helix–loop–helix (bHLH) DNA-binding transcription factor now renamed Glycine max bHLH membrane 1 (GmbHLHm1). In yeast, GmbHLHm1 enters the nucleus and transcriptionally activates a unique plasma membrane NH4+ channel Saccharomyces cerevisiae ammonium facilitator 1. Ammonium facilitator 1 homologs are present in soybean and other plant species, where they often share chromosomal microsynteny with bHLHm1 loci. GmbHLHm1 is important to the soybean rhizobium symbiosis because loss of activity results in a reduction of nodule fitness and growth. Transcriptional changes in nodules highlight downstream signaling pathways involving circadian clock regulation, nutrient transport, hormone signaling, and cell wall modification. Collectively, these results show that GmbHLHm1 influences nodule development and activity and is linked to a novel mechanism for NH4+ transport common to both yeast and plants. PMID:24707045

Soybean SAT1 (Symbiotic Ammonium Transporter 1) encodes a bHLH transcription factor involved in nodule growth and NH4+ transport.

PubMed

Chiasson, David M; Loughlin, Patrick C; Mazurkiewicz, Danielle; Mohammadidehcheshmeh, Manijeh; Fedorova, Elena E; Okamoto, Mamoru; McLean, Elizabeth; Glass, Anthony D M; Smith, Sally E; Bisseling, Ton; Tyerman, Stephen D; Day, David A; Kaiser, Brent N

2014-04-01

Glycine max symbiotic ammonium transporter 1 was first documented as a putative ammonium (NH4(+)) channel localized to the symbiosome membrane of soybean root nodules. We show that Glycine max symbiotic ammonium transporter 1 is actually a membrane-localized basic helix-loop-helix (bHLH) DNA-binding transcription factor now renamed Glycine max bHLH membrane 1 (GmbHLHm1). In yeast, GmbHLHm1 enters the nucleus and transcriptionally activates a unique plasma membrane NH4(+) channel Saccharomyces cerevisiae ammonium facilitator 1. Ammonium facilitator 1 homologs are present in soybean and other plant species, where they often share chromosomal microsynteny with bHLHm1 loci. GmbHLHm1 is important to the soybean rhizobium symbiosis because loss of activity results in a reduction of nodule fitness and growth. Transcriptional changes in nodules highlight downstream signaling pathways involving circadian clock regulation, nutrient transport, hormone signaling, and cell wall modification. Collectively, these results show that GmbHLHm1 influences nodule development and activity and is linked to a novel mechanism for NH4(+) transport common to both yeast and plants.

Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

1994-04-01

The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

A resource for characterizing genome-wide binding and putative target genes of transcription factors expressed during secondary growth and wood formation in Populus.

PubMed

Liu, Lijun; Ramsay, Trevor; Zinkgraf, Matthew; Sundell, David; Street, Nathaniel Robert; Filkov, Vladimir; Groover, Andrew

2015-06-01

Identifying transcription factor target genes is essential for modeling the transcriptional networks underlying developmental processes. Here we report a chromatin immunoprecipitation sequencing (ChIP-seq) resource consisting of genome-wide binding regions and associated putative target genes for four Populus homeodomain transcription factors expressed during secondary growth and wood formation. Software code (programs and scripts) for processing the Populus ChIP-seq data are provided within a publically available iPlant image, including tools for ChIP-seq data quality control and evaluation adapted from the human Encyclopedia of DNA Elements (ENCODE) project. Basic information for each transcription factor (including members of Class I KNOX, Class III HD ZIP, BEL1-like families) binding are summarized, including the number and location of binding regions, distribution of binding regions relative to gene features, associated putative target genes, and enriched functional categories of putative target genes. These ChIP-seq data have been integrated within the Populus Genome Integrative Explorer (PopGenIE) where they can be analyzed using a variety of web-based tools. We present an example analysis that shows preferential binding of transcription factor ARBORKNOX1 to the nearest neighbor genes in a pre-calculated co-expression network module, and enrichment for meristem-related genes within this module including multiple orthologs of Arabidopsis KNOTTED-like Arabidopsis 2/6. © 2015 Society for Experimental Biology and John Wiley & Sons Ltd This article has been contributed to by US Government employees and their work is in the public domain in the USA.

Phylogenetic and comparative gene expression analysis of barley (Hordeum vulgare)WRKY transcription factor family reveals putatively retained functions betweenmonocots and dicots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mangelsen, Elke; Kilian, Joachim; Berendzen, Kenneth W.

2008-02-01

WRKY proteins belong to the WRKY-GCM1 superfamily of zinc finger transcription factors that have been subject to a large plant-specific diversification. For the cereal crop barley (Hordeum vulgare), three different WRKY proteins have been characterized so far, as regulators in sucrose signaling, in pathogen defense, and in response to cold and drought, respectively. However, their phylogenetic relationship remained unresolved. In this study, we used the available sequence information to identify a minimum number of 45 barley WRKY transcription factor (HvWRKY) genes. According to their structural features the HvWRKY factors were classified into the previously defined polyphyletic WRKY subgroups 1 tomore » 3. Furthermore, we could assign putative orthologs of the HvWRKY proteins in Arabidopsis and rice. While in most cases clades of orthologous proteins were formed within each group or subgroup, other clades were composed of paralogous proteins for the grasses and Arabidopsis only, which is indicative of specific gene radiation events. To gain insight into their putative functions, we examined expression profiles of WRKY genes from publicly available microarray data resources and found group specific expression patterns. While putative orthologs of the HvWRKY transcription factors have been inferred from phylogenetic sequence analysis, we performed a comparative expression analysis of WRKY genes in Arabidopsis and barley. Indeed, highly correlative expression profiles were found between some of the putative orthologs. HvWRKY genes have not only undergone radiation in monocot or dicot species, but exhibit evolutionary traits specific to grasses. HvWRKY proteins exhibited not only sequence similarities between orthologs with Arabidopsis, but also relatedness in their expression patterns. This correlative expression is indicative for a putative conserved function of related WRKY proteins in mono- and dicot species.« less

Characterization of the venom from the Australian scorpion Urodacus yaschenkoi: Molecular mass analysis of components, cDNA sequences and peptides with antimicrobial activity.

PubMed

Luna-Ramírez, Karen; Quintero-Hernández, Veronica; Vargas-Jaimes, Leonel; Batista, Cesar V F; Winkel, Kenneth D; Possani, Lourival D

2013-03-01

The Urodacidae scorpions are the most widely distributed of the four families in Australia and represent half of the species in the continent, yet their venoms remain largely unstudied. This communication reports the first results of a proteome analysis of the venom of the scorpion Urodacus yaschenkoi performed by mass fingerprinting, after high performance liquid chromatography (HPLC) separation. A total of 74 fractions were obtained by HPLC separation allowing the identification of approximately 274 different molecular masses with molecular weights varying from 287 to 43,437 Da. The most abundant peptides were those from 1 K Da and 4-5 K Da representing antimicrobial peptides and putative potassium channel toxins, respectively. Three such peptides were chemically synthesized and tested against Gram-positive and Gram-negative bacteria showing minimum inhibitory concentration in the low micromolar range, but with moderate hemolytic activity. It also reports a transcriptome analysis of the venom glands of the same scorpion species, undertaken by constructing a cDNA library and conducting random sequencing screening of the transcripts. From the resultant cDNA library 172 expressed sequence tags (ESTs) were analyzed. These transcripts were further clustered into 120 unique sequences (23 contigs and 97 singlets). The identified putative proteins can be assorted in several groups, such as those implicated in common cellular processes, putative neurotoxins and antimicrobial peptides. The scorpion U. yaschenkoi is not known to be dangerous to humans and its venom contains peptides similar to those of Opisthacanthus cayaporum (antibacterial), Scorpio maurus palmatus (maurocalcin), Opistophthalmus carinatus (opistoporines) and Hadrurus gerstchi (scorpine-like molecules), amongst others. Copyright © 2012 Elsevier Ltd. All rights reserved.

The molecular dimension of microbial species: 1. Ecological distinctions among, and homogeneity within, putative ecotypes of Synechococcus inhabiting the cyanobacterial mat of Mushroom Spring, Yellowstone National Park

PubMed Central

Becraft, Eric D.; Wood, Jason M.; Rusch, Douglas B.; Kühl, Michael; Jensen, Sheila I.; Bryant, Donald A.; Roberts, David W.; Cohan, Frederick M.; Ward, David M.

2015-01-01

Based on the Stable Ecotype Model, evolution leads to the divergence of ecologically distinct populations (e.g., with different niches and/or behaviors) of ecologically interchangeable membership. In this study, pyrosequencing was used to provide deep sequence coverage of Synechococcus psaA genes and transcripts over a large number of habitat types in the Mushroom Spring microbial mat. Putative ecological species [putative ecotypes (PEs)], which were predicted by an evolutionary simulation based on the Stable Ecotype Model (Ecotype Simulation), exhibited distinct distributions relative to temperature-defined positions in the effluent channel and vertical position in the upper 1 mm-thick mat layer. Importantly, in most cases variants predicted to belong to the same PE formed unique clusters relative to temperature and depth in the mat in canonical correspondence analysis, supporting the hypothesis that while the PEs are ecologically distinct, the members of each ecotype are ecologically homogeneous. PEs responded differently to experimental perturbations of temperature and light, but the genetic variation within each PE was maintained as the relative abundances of PEs changed, further indicating that each population responded as a set of ecologically interchangeable individuals. Compared to PEs that predominate deeper within the mat photic zone, the timing of transcript abundances for selected genes differed for PEs that predominate in microenvironments closer to upper surface of the mat with spatiotemporal differences in light and O2 concentration. All of these findings are consistent with the hypotheses that Synechococcus species in hot spring mats are sets of ecologically interchangeable individuals that are differently adapted, that these adaptations control their distributions, and that the resulting distributions constrain the activities of the species in space and time. PMID:26157420

Glucocorticoid Regulation of the Vitamin D Receptor

PubMed Central

Hidalgo, Alejandro A.; Trump, Donald L.; Johnson, Candace S.

2010-01-01

Many studies indicate calcitriol has potent anti-tumor activity in different types of cancers. However, high levels of vitamin D can produce hypercalcemia in some patients. Glucocorticoids are used to ameliorate hypercalcemia and to enhance calcitriol anti-tumor activity. Calcitriol in combination with the glucocorticoid dexamethasone (Dex) increased vitamin D receptor (VDR) protein levels and ligand binding in squamous cell carcinoma VII (SCC). In this study we found that both calcitriol and Dex induce VDR- and glucocorticoid receptor (GR)-mediated transcription respectively, indicating both hormone receptors are active in SCC. Pre-treatment with Dex increases VDR-mediated transcription at the human CYP24A1 promoter. Whereas, pre-treatment with other steroid hormones, including dihydrotestosterone and R1881, has no effect on VDR-mediated transcription. Real-time PCR indicates treatment with Dex increases Vdr transcripts in a time-dependent manner, suggesting Dex may directly regulate expression of Vdr. Numerous putative glucocorticoid response elements (GREs) were found in the Vdr gene. Chromatin immunoprecipitation (ChIP) assay demonstrated GR binding at several putative GREs located within the mouse Vdr gene. However, none of the putative GREs studied increase GR-mediated transcription in luciferase reporter assays. In an attempt to identify the response element responsible for Vdr transcript regulation, future studies will continue to analyze newly identified GREs more distal from the Vdr gene promoter. PMID:20398752

Localization and expression of putative circadian clock transcripts in the brain of the nudibranch Melibe leonina.

PubMed

Duback, Victoria E; Sabrina Pankey, M; Thomas, Rachel I; Huyck, Taylor L; Mbarani, Izhar M; Bernier, Kyle R; Cook, Geoffrey M; O'Dowd, Colleen A; Newcomb, James M; Watson, Winsor H

2018-09-01

The nudibranch, Melibe leonina, expresses a circadian rhythm of locomotion, and we recently determined the sequences of multiple circadian clock transcripts that may play a role in controlling these daily patterns of behavior. In this study, we used these genomic data to help us: 1) identify putative clock neurons using fluorescent in situ hybridization (FISH); and 2) determine if there is a daily rhythm of expression of clock transcripts in the M. leonina brain, using quantitative PCR. FISH indicated the presence of the clock-related transcripts clock, period, and photoreceptive and non-photoreceptive cryptochrome (pcry and npcry, respectively) in two bilateral neurons in each cerebropleural ganglion and a group of <10 neurons in the anterolateral region of each pedal ganglion. Double-label experiments confirmed colocalization of all four clock transcripts with each other. Quantitative PCR demonstrated that the genes clock, period, pcry and npcry exhibited significant differences in expression levels over 24 h. These data suggest that the putative circadian clock network in M. leonina consists of a small number of identifiable neurons that express circadian genes with a daily rhythm. Copyright © 2018 Elsevier Inc. All rights reserved.

A transcriptome resource for the koala (Phascolarctos cinereus): insights into koala retrovirus transcription and sequence diversity.

PubMed

Hobbs, Matthew; Pavasovic, Ana; King, Andrew G; Prentis, Peter J; Eldridge, Mark D B; Chen, Zhiliang; Colgan, Donald J; Polkinghorne, Adam; Wilkins, Marc R; Flanagan, Cheyne; Gillett, Amber; Hanger, Jon; Johnson, Rebecca N; Timms, Peter

2014-09-11

The koala, Phascolarctos cinereus, is a biologically unique and evolutionarily distinct Australian arboreal marsupial. The goal of this study was to sequence the transcriptome from several tissues of two geographically separate koalas, and to create the first comprehensive catalog of annotated transcripts for this species, enabling detailed analysis of the unique attributes of this threatened native marsupial, including infection by the koala retrovirus. RNA-Seq data was generated from a range of tissues from one male and one female koala and assembled de novo into transcripts using Velvet-Oases. Transcript abundance in each tissue was estimated. Transcripts were searched for likely protein-coding regions and a non-redundant set of 117,563 putative protein sequences was produced. In similarity searches there were 84,907 (72%) sequences that aligned to at least one sequence in the NCBI nr protein database. The best alignments were to sequences from other marsupials. After applying a reciprocal best hit requirement of koala sequences to those from tammar wallaby, Tasmanian devil and the gray short-tailed opossum, we estimate that our transcriptome dataset represents approximately 15,000 koala genes. The marsupial alignment information was used to look for potential gene duplications and we report evidence for copy number expansion of the alpha amylase gene, and of an aldehyde reductase gene.Koala retrovirus (KoRV) transcripts were detected in the transcriptomes. These were analysed in detail and the structure of the spliced envelope gene transcript was determined. There was appreciable sequence diversity within KoRV, with 233 sites in the KoRV genome showing small insertions/deletions or single nucleotide polymorphisms. Both koalas had sequences from the KoRV-A subtype, but the male koala transcriptome has, in addition, sequences more closely related to the KoRV-B subtype. This is the first report of a KoRV-B-like sequence in a wild population. This transcriptomic dataset is a useful resource for molecular genetic studies of the koala, for evolutionary genetic studies of marsupials, for validation and annotation of the koala genome sequence, and for investigation of koala retrovirus. Annotated transcripts can be browsed and queried at http://koalagenome.org.

Resistant and susceptible responses in alfalfa (Medicago sativa) to bacterial stem blight caused by Pseudomonas syringae pv. syringae.

PubMed

Nemchinov, Lev G; Shao, Jonathan; Lee, Maya N; Postnikova, Olga A; Samac, Deborah A

2017-01-01

Bacterial stem blight caused by Pseudomonas syringae pv. syringae is a common disease of alfalfa (Medicago sativa L). Little is known about host-pathogen interactions and host defense mechanisms. Here, individual resistant and susceptible plants were selected from cultivars Maverick and ZG9830 and used for transcript profiling at 24 and 72 hours after inoculation (hai) with the isolate PssALF3. Bioinformatic analysis revealed a number of differentially expressed genes (DEGs) in resistant and susceptible genotypes. Although resistant plants from each cultivar produced a hypersensitive response, transcriptome analyses indicated that they respond differently at the molecular level. The number of DEGs was higher in resistant plants of ZG9830 at 24 hai than in Maverick, suggesting that ZG9830 plants had a more rapid effector triggered immune response. Unique up-regulated genes in resistant ZG9830 plants included genes encoding putative nematode resistance HSPRO2-like proteins, orthologs for the rice Xa21 and soybean Rpg1-b resistance genes, and TIR-containing R genes lacking both NBS and LRR domains. The suite of R genes up-regulated in resistant Maverick plants had an over-representation of R genes in the CC-NBS-LRR family including two genes for atypical CCR domains and a putative ortholog of the Arabidopsis RPM1 gene. Resistance in both cultivars appears to be mediated primarily by WRKY family transcription factors and expression of genes involved in protein phosphorylation, regulation of transcription, defense response including synthesis of isoflavonoids, and oxidation-reduction processes. These results will further the identification of mechanisms involved in resistance to facilitate selection of parent populations and development of commercial varieties.

Resistant and susceptible responses in alfalfa (Medicago sativa) to bacterial stem blight caused by Pseudomonas syringae pv. syringae

PubMed Central

Shao, Jonathan; Lee, Maya N.; Postnikova, Olga A.; Samac, Deborah A.

2017-01-01

Bacterial stem blight caused by Pseudomonas syringae pv. syringae is a common disease of alfalfa (Medicago sativa L). Little is known about host-pathogen interactions and host defense mechanisms. Here, individual resistant and susceptible plants were selected from cultivars Maverick and ZG9830 and used for transcript profiling at 24 and 72 hours after inoculation (hai) with the isolate PssALF3. Bioinformatic analysis revealed a number of differentially expressed genes (DEGs) in resistant and susceptible genotypes. Although resistant plants from each cultivar produced a hypersensitive response, transcriptome analyses indicated that they respond differently at the molecular level. The number of DEGs was higher in resistant plants of ZG9830 at 24 hai than in Maverick, suggesting that ZG9830 plants had a more rapid effector triggered immune response. Unique up-regulated genes in resistant ZG9830 plants included genes encoding putative nematode resistance HSPRO2-like proteins, orthologs for the rice Xa21 and soybean Rpg1-b resistance genes, and TIR-containing R genes lacking both NBS and LRR domains. The suite of R genes up-regulated in resistant Maverick plants had an over-representation of R genes in the CC-NBS-LRR family including two genes for atypical CCR domains and a putative ortholog of the Arabidopsis RPM1 gene. Resistance in both cultivars appears to be mediated primarily by WRKY family transcription factors and expression of genes involved in protein phosphorylation, regulation of transcription, defense response including synthesis of isoflavonoids, and oxidation-reduction processes. These results will further the identification of mechanisms involved in resistance to facilitate selection of parent populations and development of commercial varieties. PMID:29244864

Transcript Assembly and Quantification by RNA-Seq Reveals Differentially Expressed Genes between Soft-Endocarp and Hard-Endocarp Hawthorns

PubMed Central

Zhang, Feng; Liu, Zhongchi; Li, Xiaoming; Li, Wenran; Ma, Yue; Li, He; Liu, Yuexue; Zhang, Zhihong

2013-01-01

Hawthorn (Crataegus spp.) is an important pome with a long history as a fruit, an ornamental, and a source of medicine. Fruits of hawthorn are marked by hard stony endocarps, but a hawthorn germplasm with soft and thin endocarp was found in Liaoning province of China. To elucidate the molecular mechanism underlying the soft endocarp of hawthorn, we conducted a de novo assembly of the fruit transcriptome of Crataegus pinnatifida and compared gene expression profiles between the soft-endocarp and the hard-endocarp hawthorn varieties. De novo assembly yielded 52,673 putative unigenes, 20.4% of which are longer than 1,000 bp. Among the high-quality unique sequences, 35,979 (68.3%) had at least one significant match to an existing gene model. A total of 1,218 genes, represented 2.31% total putative unigenes, were differentially expressed between the soft-endocarp hawthorn and the hard-endocarp hawthorn. Among these differentially expressed genes, a number of lignin biosynthetic pathway genes were down-regulated while almost all the flavonoid biosynthetic pathway genes were strongly up-regulated, concomitant with the formation of soft endocarp. In addition, we have identified some MYB and NAC transcription factors that could potentially control lignin and flavonoid biosynthesis. The altered expression levels of the genes encoding lignin biosynthetic enzymes, MYB and NAC transcription factors were confirmed by quantitative RT-PCR. This is the first transcriptome analysis of Crataegus genus. The high quality ESTs generated in this study will aid future gene cloning from hawthorn. Our study provides important insights into the molecular mechanisms underlying soft endocarp formation in hawthorn. PMID:24039819

De novo sequencing analysis of the Rosa roxburghii fruit transcriptome reveals putative ascorbate biosynthetic genes and EST-SSR markers.

PubMed

Yan, Xiuqin; Zhang, Xue; Lu, Min; He, Yong; An, Huaming

2015-04-25

Rosa roxburghii Tratt. is a well-known ornamental rose species native to China. In addition, the fruits of this species are valued for their nutritional and medicinal characteristics, especially their high ascorbic acid (AsA) levels. Nevertheless, AsA biosynthesis in R. roxburghii fruit has not been explored in detail because of a lack of genomic resources for this species. High-throughput transcriptomic sequencing generating large volumes of transcript sequence data can aid in gene discovery and molecular marker development. In this study, we generated more than 53 million clean reads using Illumina paired-end sequencing technology. De novo assembly yielded 106,590 unigenes, with an average length of 343 bp. On the basis of sequence similarity to known proteins, 9301 and 2393 unigenes were classified into Gene Ontology and Clusters of Orthologous Group categories, respectively. There were 7480 unigenes assigned to 124 pathways in the Kyoto Encyclopedia of Gene and Genome pathway database. BLASTx searches identified 498 unique putative transcripts encoding various transcription factors, some known to regulate fruit development. qRT-PCR validated the expressions of most of the genes encoding the main enzymes involved in ascorbate biosynthesis. In addition, 9131 potential simple sequence repeat (SSR) loci were identified among the unigenes. One hundred and two primer pairs were synthesized and 71 pairs produced an amplification product during initial screening. Among the amplified products, 30 were polymorphic in the 16 R. roxburghii germplasms tested. Our study was the first to produce a large volume of transcriptome data from R. roxburghii. The resulting sequence collection is a valuable resource for gene discovery and marker-assisted selective breeding in this rose species. Copyright © 2015 Elsevier B.V. All rights reserved.

De novo transcriptome analysis of rose-scented geranium provides insights into the metabolic specificity of terpene and tartaric acid biosynthesis.

PubMed

Narnoliya, Lokesh K; Kaushal, Girija; Singh, Sudhir P; Sangwan, Rajender S

2017-01-13

Rose-scented geranium (Pelargonium sp.) is a perennial herb that produces a high value essential oil of fragrant significance due to the characteristic compositional blend of rose-oxide and acyclic monoterpenoids in foliage. Recently, the plant has also been shown to produce tartaric acid in leaf tissues. Rose-scented geranium represents top-tier cash crop in terms of economic returns and significance of the plant and plant products. However, there has hardly been any study on its metabolism and functional genomics, nor any genomic expression dataset resource is available in public domain. Therefore, to begin the gains in molecular understanding of specialized metabolic pathways of the plant, de novo sequencing of rose-scented geranium leaf transcriptome, transcript assembly, annotation, expression profiling as well as their validation were carried out. De novo transcriptome analysis resulted a total of 78,943 unique contigs (average length: 623 bp, and N50 length: 752 bp) from 15.44 million high quality raw reads. In silico functional annotation led to the identification of several putative genes representing terpene, ascorbic acid and tartaric acid biosynthetic pathways, hormone metabolism, and transcription factors. Additionally, a total of 6,040 simple sequence repeat (SSR) motifs were identified in 6.8% of the expressed transcripts. The highest frequency of SSR was of tri-nucleotides (50%). Further, transcriptome assembly was validated for randomly selected putative genes by standard PCR-based approach. In silico expression profile of assembled contigs were validated by real-time PCR analysis of selected transcripts. Being the first report on transcriptome analysis of rose-scented geranium the data sets and the leads and directions reflected in this investigation will serve as a foundation for pursuing and understanding molecular aspects of its biology, and specialized metabolic pathways, metabolic engineering, genetic diversity as well as molecular breeding.

A global transcriptional analysis of Plasmodium falciparum malaria reveals a novel family of telomere-associated lncRNAs

PubMed Central

2011-01-01

Background Mounting evidence suggests a major role for epigenetic feedback in Plasmodium falciparum transcriptional regulation. Long non-coding RNAs (lncRNAs) have recently emerged as a new paradigm in epigenetic remodeling. We therefore set out to investigate putative roles for lncRNAs in P. falciparum transcriptional regulation. Results We used a high-resolution DNA tiling microarray to survey transcriptional activity across 22.6% of the P. falciparum strain 3D7 genome. We identified 872 protein-coding genes and 60 putative P. falciparum lncRNAs under developmental regulation during the parasite's pathogenic human blood stage. Further characterization of lncRNA candidates led to the discovery of an intriguing family of lncRNA telomere-associated repetitive element transcripts, termed lncRNA-TARE. We have quantified lncRNA-TARE expression at 15 distinct chromosome ends and mapped putative transcriptional start and termination sites of lncRNA-TARE loci. Remarkably, we observed coordinated and stage-specific expression of lncRNA-TARE on all chromosome ends tested, and two dominant transcripts of approximately 1.5 kb and 3.1 kb transcribed towards the telomere. Conclusions We have characterized a family of 22 telomere-associated lncRNAs in P. falciparum. Homologous lncRNA-TARE loci are coordinately expressed after parasite DNA replication, and are poised to play an important role in P. falciparum telomere maintenance, virulence gene regulation, and potentially other processes of parasite chromosome end biology. Further study of lncRNA-TARE and other promising lncRNA candidates may provide mechanistic insight into P. falciparum transcriptional regulation. PMID:21689454

Comparative transcriptome analysis of differentially expressed genes in foxtail millet (Setaria italica L.) during dehydration stress.

PubMed

Lata, Charu; Sahu, Pranav Pankaj; Prasad, Manoj

2010-03-19

Dehydration stress is one of the most important abiotic stresses that adversely influence crop growth and productivity. With the aim to understand the molecular mechanisms underlying dehydration stress tolerance in foxtail millet (Setaria italica L.), a drought tolerant crop, we examined its transcriptome changes at two time points (early and late) of dehydration stress. Two suppression subtractive hybridization (SSH) forward libraries were constructed from 21-day old seedlings of tolerant cv. Prasad at 0.5 and 6h PEG-induced dehydration stress. A total of 327 unique ESTs were identified from both libraries and were classified into 11 different categories according to their putative functions. The plant response against dehydration stress was complex, representing major transcripts involved in metabolism, stress, signaling, transcription regulation, translation and proteolysis. By Reverse Northern (RN) technique we identified the differential expression pattern of 327 transcripts, 86 (about 26%) of which showed > or = 1.7-fold induction. Further the obtained results were validated by quantitative real-time PCR (qRT-PCR) to have a comparative expression profiling of randomly chosen 9 up-regulated transcripts (> or =2.5 fold induction) between cv. Prasad (tolerant) and cv. Lepakshi (sensitive) upon dehydration stress. These transcripts showed a differential expression pattern in both cultivars at different time points of stress treatment as analyzed by qRT-PCR. The possible relationship of the identified transcripts with dehydration tolerance mechanism is discussed. Copyright 2010 Elsevier Inc. All rights reserved.

Identification and characterization of microRNAs related to salt stress in broccoli, using high-throughput sequencing and bioinformatics analysis.

PubMed

Tian, Yunhong; Tian, Yunming; Luo, Xiaojun; Zhou, Tao; Huang, Zuoping; Liu, Ying; Qiu, Yihan; Hou, Bing; Sun, Dan; Deng, Hongyu; Qian, Shen; Yao, Kaitai

2014-09-03

MicroRNAs (miRNAs) are a new class of endogenous regulators of a broad range of physiological processes, which act by regulating gene expression post-transcriptionally. The brassica vegetable, broccoli (Brassica oleracea var. italica), is very popular with a wide range of consumers, but environmental stresses such as salinity are a problem worldwide in restricting its growth and yield. Little is known about the role of miRNAs in the response of broccoli to salt stress. In this study, broccoli subjected to salt stress and broccoli grown under control conditions were analyzed by high-throughput sequencing. Differential miRNA expression was confirmed by real-time reverse transcription polymerase chain reaction (RT-PCR). The prediction of miRNA targets was undertaken using the Kyoto Encyclopedia of Genes and Genomes (KEGG) Orthology (KO) database and Gene Ontology (GO)-enrichment analyses. Two libraries of small (or short) RNAs (sRNAs) were constructed and sequenced by high-throughput Solexa sequencing. A total of 24,511,963 and 21,034,728 clean reads, representing 9,861,236 (40.23%) and 8,574,665 (40.76%) unique reads, were obtained for control and salt-stressed broccoli, respectively. Furthermore, 42 putative known and 39 putative candidate miRNAs that were differentially expressed between control and salt-stressed broccoli were revealed by their read counts and confirmed by the use of stem-loop real-time RT-PCR. Amongst these, the putative conserved miRNAs, miR393 and miR855, and two putative candidate miRNAs, miR3 and miR34, were the most strongly down-regulated when broccoli was salt-stressed, whereas the putative conserved miRNA, miR396a, and the putative candidate miRNA, miR37, were the most up-regulated. Finally, analysis of the predicted gene targets of miRNAs using the GO and KO databases indicated that a range of metabolic and other cellular functions known to be associated with salt stress were up-regulated in broccoli treated with salt. A comprehensive study of broccoli miRNA in relation to salt stress has been performed. We report significant data on the miRNA profile of broccoli that will underpin further studies on stress responses in broccoli and related species. The differential regulation of miRNAs between control and salt-stressed broccoli indicates that miRNAs play an integral role in the regulation of responses to salt stress.

Molecular structure of EmbR, a response element of Ser/Thr kinase signaling in Mycobacterium tuberculosis

PubMed Central

Alderwick, Luke J.; Molle, Virginie; Kremer, Laurent; Cozzone, Alain J.; Dafforn, Timothy R.; Besra, Gurdyal S.; Fütterer, Klaus

2006-01-01

Ser/Thr phosphorylation has emerged as a critical regulatory mechanism in a number of bacteria, including Mycobacterium tuberculosis. This problematic pathogen encodes 11 eukaryotic-like Ser/Thr kinases, yet few substrates or signaling targets have been characterized. Here, we report the structure of EmbR (2.0 Å), a putative transcriptional regulator of key arabinosyltransferases (EmbC, -A, and -B), and an endogenous substrate of the Ser/Thr-kinase PknH. EmbR presents a unique domain architecture: the N-terminal winged-helix DNA-binding domain forms an extensive interface with the all-helical central bacterial transcriptional activation domain and is positioned adjacent to the regulatory C-terminal forkhead-associated (FHA) domain, which mediates binding to a Thr-phosphorylated site in PknH. The structure in complex with a phospho-peptide (1.9 Å) reveals a conserved mode of phospho-threonine recognition by the FHA domain and evidence for specific recognition of the cognate kinase. The present structures suggest hypotheses as to how EmbR might propagate the phospho-relay signal from its cognate kinase, while serving as a template for the structurally uncharacterized Streptomyces antibiotic regulatory protein family of transcription factors. PMID:16477027

Global Identification and Characterization of Transcriptionally Active Regions in the Rice Genome

PubMed Central

Stolc, Viktor; Deng, Wei; He, Hang; Korbel, Jan; Chen, Xuewei; Tongprasit, Waraporn; Ronald, Pamela; Chen, Runsheng; Gerstein, Mark; Wang Deng, Xing

2007-01-01

Genome tiling microarray studies have consistently documented rich transcriptional activity beyond the annotated genes. However, systematic characterization and transcriptional profiling of the putative novel transcripts on the genome scale are still lacking. We report here the identification of 25,352 and 27,744 transcriptionally active regions (TARs) not encoded by annotated exons in the rice (Oryza. sativa) subspecies japonica and indica, respectively. The non-exonic TARs account for approximately two thirds of the total TARs detected by tiling arrays and represent transcripts likely conserved between japonica and indica. Transcription of 21,018 (83%) japonica non-exonic TARs was verified through expression profiling in 10 tissue types using a re-array in which annotated genes and TARs were each represented by five independent probes. Subsequent analyses indicate that about 80% of the japonica TARs that were not assigned to annotated exons can be assigned to various putatively functional or structural elements of the rice genome, including splice variants, uncharacterized portions of incompletely annotated genes, antisense transcripts, duplicated gene fragments, and potential non-coding RNAs. These results provide a systematic characterization of non-exonic transcripts in rice and thus expand the current view of the complexity and dynamics of the rice transcriptome. PMID:17372628

A Glycine Riboswitch in Streptococcus pyogenes Controls Expression of a Sodium:Alanine Symporter Family Protein Gene.

PubMed

Khani, Afsaneh; Popp, Nicole; Kreikemeyer, Bernd; Patenge, Nadja

2018-01-01

Regulatory RNAs play important roles in the control of bacterial gene expression. In this study, we investigated gene expression regulation by a putative glycine riboswitch located in the 5'-untranslated region of a sodium:alanine symporter family (SAF) protein gene in the group A Streptococcus pyogenes serotype M49 strain 591. Glycine-dependent gene expression mediated by riboswitch activity was studied using a luciferase reporter gene system. Maximal reporter gene expression was observed in the absence of glycine and in the presence of low glycine concentrations. Differences in glycine-dependent gene expression were not based on differential promoter activity. Expression of the SAF protein gene and the downstream putative cation efflux protein gene was investigated in wild-type bacteria by RT-qPCR transcript analyses. During growth in the presence of glycine (≥1 mM), expression of the genes were downregulated. Northern blot analyses revealed premature transcription termination in the presence of high glycine concentrations. Growth in the presence of 0.1 mM glycine led to the production of a full-length transcript. Furthermore, stability of the SAF protein gene transcript was drastically reduced in the presence of glycine. We conclude that the putative glycine riboswitch in S. pyogenes serotype M49 strain 591 represses expression of the SAF protein gene and the downstream putative cation efflux protein gene in the presence of high glycine concentrations. Sequence and secondary structure comparisons indicated that the streptococcal riboswitch belongs to the class of tandem aptamer glycine riboswitches.

The pine Pschi4 promoter directs wound-induced transcription

Treesearch

Haiguo Wu; Charles H. Michler; Liborio LaRussa; John M. Davis

1999-01-01

Mechanical wounding stimulates the accumulation of Pschi4 transcripts (encoding a putative extracellular chitinase) in pine trees. To gain insight into the transcriptional regulatory region(s) in this gymnosperm defense gene, the 5'-flanking region of Pschi4 was fused to the uidA reporter gene encoding -...

MARINE LEECH ANTICOAGULANT DIVERSITY AND EVOLUTION.

PubMed

Tessler, Michael; Marancik, David; Champagne, Donald; Dove, Alistair; Camus, Alvin; Siddall, Mark E; Kvist, Sebastian

2018-03-16

Leeches (Annelida: Hirudinea) possess powerful salivary anticoagulants and, accordingly, are frequently employed in modern, authoritative medicine. Members of the almost exclusively marine family Piscicolidae account for 20% of leech species diversity, and feed on host groups (e.g., sharks) not encountered by their freshwater and terrestrial counterparts. Moreover, some species of Ozobranchidae feed on endangered marine turtles and have been implicated as potential vectors for the tumor-associated turtle herpesvirus. In spite of their ecological importance and unique host associations, there is a distinct paucity of data regarding the salivary transcriptomes of either of these families. Using next generation sequencing, we profiled transcribed, putative anticoagulants and other salivary bioactive compounds that have previously been linked to bloodfeeding from 7 piscicolid species (3 elasmobranch-feeders; 4 non-cartilaginous fish-feeders) and 1 ozobranchid species (2 samples). In total, 149 putative anticoagulants and bioactive loci were discovered in varying constellations throughout the different samples. The putative anticoagulants showed a broad spectrum of described antagonistic pathways, such as inhibition of factor Xa and platelet aggregation, that likely have similar bioactive roles in marine fish and turtles. A transcript with homology to ohanin, originally isolated from king cobras, was found in Cystobranchus vividus but is otherwise unknown from leeches. Estimation of selection pressures for the putative anticoagulants recovered evidence for both positive and purifying selection along several isolated branches in the gene trees and positive selection was also estimated for a few select codons in a variety of marine species. Similarly, phylogenetic analyses of the amino acid sequences for several anticoagulants indicated divergent evolution.

Differential Expression Patterns in Chemosensory and Non-Chemosensory Tissues of Putative Chemosensory Genes Identified by Transcriptome Analysis of Insect Pest the Purple Stem Borer Sesamia inferens (Walker)

PubMed Central

Zhang, Ya-Nan; Jin, Jun-Yan; Jin, Rong; Xia, Yi-Han; Zhou, Jing-Jiang; Deng, Jian-Yu; Dong, Shuang-Lin

2013-01-01

Background A large number of insect chemosensory genes from different gene subfamilies have been identified and annotated, but their functional diversity and complexity are largely unknown. A systemic examination of expression patterns in chemosensory organs could provide important information. Methodology/Principal Findings We identified 92 putative chemosensory genes by analysing the transcriptome of the antennae and female sex pheromone gland of the purple stem borer Sesamia inferens, among them 87 are novel in this species, including 24 transcripts encoding for odorant binding proteins (OBPs), 24 for chemosensory proteins (CSPs), 2 for sensory neuron membrane proteins (SNMPs), 39 for odorant receptors (ORs) and 3 for ionotropic receptors (IRs). The transcriptome analyses were validated and quantified with a detailed global expression profiling by Reverse Transcription-PCR for all 92 transcripts and by Quantitative Real Time RT-PCR for selected 16 ones. Among the chemosensory gene subfamilies, CSP transcripts are most widely and evenly expressed in different tissues and stages, OBP transcripts showed a clear antenna bias and most of OR transcripts are only detected in adult antennae. Our results also revealed that some OR transcripts, such as the transcripts of SNMP2 and 2 IRs were expressed in non-chemosensory tissues, and some CSP transcripts were antenna-biased expression. Furthermore, no chemosensory transcript is specific to female sex pheromone gland and very few are found in the heads. Conclusion Our study revealed that there are a large number of chemosensory genes expressed in S. inferens, and some of them displayed unusual expression profile in non-chemosensory tissues. The identification of a large set of putative chemosensory genes of each subfamily from a single insect species, together with their different expression profiles provide further information in understanding the functions of these chemosensory genes in S. inferens as well as other insects. PMID:23894529

Differential expression patterns in chemosensory and non-chemosensory tissues of putative chemosensory genes identified by transcriptome analysis of insect pest the purple stem borer Sesamia inferens (Walker).

PubMed

Zhang, Ya-Nan; Jin, Jun-Yan; Jin, Rong; Xia, Yi-Han; Zhou, Jing-Jiang; Deng, Jian-Yu; Dong, Shuang-Lin

2013-01-01

A large number of insect chemosensory genes from different gene subfamilies have been identified and annotated, but their functional diversity and complexity are largely unknown. A systemic examination of expression patterns in chemosensory organs could provide important information. We identified 92 putative chemosensory genes by analysing the transcriptome of the antennae and female sex pheromone gland of the purple stem borer Sesamia inferens, among them 87 are novel in this species, including 24 transcripts encoding for odorant binding proteins (OBPs), 24 for chemosensory proteins (CSPs), 2 for sensory neuron membrane proteins (SNMPs), 39 for odorant receptors (ORs) and 3 for ionotropic receptors (IRs). The transcriptome analyses were validated and quantified with a detailed global expression profiling by Reverse Transcription-PCR for all 92 transcripts and by Quantitative Real Time RT-PCR for selected 16 ones. Among the chemosensory gene subfamilies, CSP transcripts are most widely and evenly expressed in different tissues and stages, OBP transcripts showed a clear antenna bias and most of OR transcripts are only detected in adult antennae. Our results also revealed that some OR transcripts, such as the transcripts of SNMP2 and 2 IRs were expressed in non-chemosensory tissues, and some CSP transcripts were antenna-biased expression. Furthermore, no chemosensory transcript is specific to female sex pheromone gland and very few are found in the heads. Our study revealed that there are a large number of chemosensory genes expressed in S. inferens, and some of them displayed unusual expression profile in non-chemosensory tissues. The identification of a large set of putative chemosensory genes of each subfamily from a single insect species, together with their different expression profiles provide further information in understanding the functions of these chemosensory genes in S. inferens as well as other insects.

Cis-regulatory signatures of orthologous stress-associated bZIP transcription factors from rice, sorghum and Arabidopsis based on phylogenetic footprints

PubMed Central

2012-01-01

Background The potential contribution of upstream sequence variation to the unique features of orthologous genes is just beginning to be unraveled. A core subset of stress-associated bZIP transcription factors from rice (Oryza sativa) formed ten clusters of orthologous groups (COG) with genes from the monocot sorghum (Sorghum bicolor) and dicot Arabidopsis (Arabidopsis thaliana). The total cis-regulatory information content of each stress-associated COG was examined by phylogenetic footprinting to reveal ortholog-specific, lineage-specific and species-specific conservation patterns. Results The most apparent pattern observed was the occurrence of spatially conserved ‘core modules’ among the COGs but not among paralogs. These core modules are comprised of various combinations of two to four putative transcription factor binding site (TFBS) classes associated with either developmental or stress-related functions. Outside the core modules are specific stress (ABA, oxidative, abiotic, biotic) or organ-associated signals, which may be functioning as ‘regulatory fine-tuners’ and further define lineage-specific and species-specific cis-regulatory signatures. Orthologous monocot and dicot promoters have distinct TFBS classes involved in disease and oxidative-regulated expression, while the orthologous rice and sorghum promoters have distinct combinations of root-specific signals, a pattern that is not particularly conserved in Arabidopsis. Conclusions Patterns of cis-regulatory conservation imply that each ortholog has distinct signatures, further suggesting that they are potentially unique in a regulatory context despite the presumed conservation of broad biological function during speciation. Based on the observed patterns of conservation, we postulate that core modules are likely primary determinants of basal developmental programming, which may be integrated with and further elaborated by additional intrinsic or extrinsic signals in conjunction with lineage-specific or species-specific regulatory fine-tuners. This synergy may be critical for finer-scale spatio-temporal regulation, hence unique expression profiles of homologous transcription factors from different species with distinct zones of ecological adaptation such as rice, sorghum and Arabidopsis. The patterns revealed from these comparisons set the stage for further empirical validation by functional genomics. PMID:22992304

Phenotype anchoring in zebrafish reveals a potential role for matrix metalloproteinases (MMPs) in tamoxifen's effects on skin epithelium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bugel, Sean M., E-mail: Sean.Bugel@oregonstate.edu; Wehmas, Leah C., E-mail: wehmasl@onid.oregonstate.edu; La Du, Jane K., E-mail: Jane.LaDu@oregonstate.edu

The zebrafish is a powerful alternative model used to link phenotypes with molecular effects to discover drug mode of action. Using a zebrafish embryo-larval toxicity bioassay, we evaluated the effects of tamoxifen — a widely used anti-estrogen chemotherapeutic. Zebrafish exposed to ≥ 10 μM tamoxifen exhibited a unique necrotic caudal fin phenotype that was rapidly induced regardless of developmental life-stage when treatment was applied. To define tamoxifen's bioactivity resulting in this phenotype, targeted gene expression was used to evaluate 100 transcripts involved in tissue remodeling, calcium signaling, cell cycle and cell death, growth factors, angiogenesis and hypoxia. The most robustlymore » misregulated transcripts in the tail were matrix metalloproteinases mmp9 and mmp13a, induced 127 and 1145 fold, respectively. Expression of c-fos, c-jun, and ap1s1 were also moderately elevated (3–7 fold), consistent with AP-1 activity — a transcription factor that regulates MMP expression. Immunohistochemistry confirmed high levels of induction for MMP13a in affected caudal fin skin epithelial tissue. The necrotic caudal fin phenotype was significantly attenuated or prevented by three functionally unique MMP inhibitors: EDTA (metal chelator), GM 6001 (broad MMP inhibitor), and SR 11302 (AP-1 transcription factor inhibitor), suggesting MMP-dependence. SR 11302 also inhibited induction of mmp9, mmp13a, and a putative MMP target, igfbp1a. Overall, our studies suggest that tamoxifen's effect is the result of perturbation of the MMP system in the skin leading to ectopic expression, cytotoxicity, and the necrotic caudal fin phenotype. These studies help advance our understanding of tamoxifen's non-classical mode of action and implicate a possible role for MMPs in tissues such as skin. - Highlights: • Tamoxifen rapidly induced a unique necrotic caudal fin phenotype in zebrafish. • Apoptosis co-localized temporally and spatially in the necrotic tail. • The necrotic fin phenotype was p53, GPER and ER independent. • The necrotic fin phenotype was dependent on ectopic MMP induction and activity in the skin. • The necrotic fin phenotype occurred at concentrations exceeding anti-estrogenic effects.« less

Cell signaling and transcription factor genes expressed during whole body regeneration in a colonial chordate.

PubMed

Rinkevich, Yuval; Rinkevich, Baruch; Reshef, Ram

2008-10-12

The restoration of adults from fragments of blood vessels in botryllid ascidians (termed whole body regeneration [WBR]) represents an inimitable event in the chordates, which is poorly understood on the mechanistic level. To elucidate mechanisms underlying this phenomenon, a subtracted EST library for early WBR stages was previously assembled, revealing 76 putative genes belonging to major signaling pathways, including Notch/Delta, JAK/STAT, protein kinases, nuclear receptors, Ras oncogene family members, G-Protein coupled receptor (GPCR) and transforming growth factor beta (TGF-beta) signaling. RT-PCR on selected transcripts documented specific up-regulation in only regenerating fragments, pointing to a broad activation of these signaling pathways at onset of WBR. The followed-up expression pattern of seven representative transcripts from JAK/STAT signaling (Bl-STAT), the Ras oncogene family (Bl-Rap1A, Bl-Rab-33), the protein kinase family (Bl-Mnk), Bl-Cnot, Bl-Slit and Bl-Bax inhibitor, revealed systemic and site specific activations during WBR in a sub-population of circulatory cells. WBR in the non-vertebrate chordate Botrylloides leachi is a multifaceted phenomenon, presided by a complex array of cell signaling and transcription factors. Above results, provide a first insight into the whole genome molecular machinery of this unique regeneration process, and reveal the broad participation of cell signaling and transcription factors in the process. While regeneration involves the participation of specific cell populations, WBR signals are systemically expressed at the organism level.

Structural and Biological Characterization of a Capsular Polysaccharide Produced by Staphylococcus haemolyticus▿

PubMed Central

Flahaut, Sigrid; Vinogradov, Evgeny; Kelley, Kathryn A.; Brennan, Shannon; Hiramatsu, Keiichi; Lee, Jean C.

2008-01-01

The DNA sequence of the genome of Staphylococcus haemolyticus JCSC1435 revealed a putative capsule operon composed of 13 genes in tandem. The first seven genes (capABCDEFGSh) showed ≥57% similarity with the Staphylococcus aureus cap5 or cap8 locus. However, the capHIJKLMSh genes are unique to S. haemolyticus and include genes encoding a putative flippase, an aminotransferase, two glycosyltransferases, and a transcriptional regulator. Capsule-like material was readily apparent by immunoelectron microscopy on bacteria harvested in the postexponential phase of growth. Electron micrographs of a JCSC1435 mutant with a deleted cap region lacked the capsule-like material. Both strains produced small amounts of surface-associated material that reacted with antibodies to polyglutamic acid. S. haemolyticus cap genes were amplified from four of seven clinical isolates of S. haemolyticus from humans, and three of these strains produced a serologically cross-reactive capsular polysaccharide. In vitro assays demonstrated that the acapsular mutant strain showed greater biofilm formation but was more susceptible to complement-mediated opsonophagocytic killing than the parent strain. Structural characterization of capsule purified from S. haemolyticus strain JCSC1435 showed a trisaccharide repeating unit: −3-α-l-FucNAc-3-(2-NAc-4-N-Asp-2,4,6-trideoxy-β-d-Glc)-4-α-d-GlcNAc-. This structure is unique among staphylococcal polysaccharides in that its composition includes a trideoxy sugar residue with aspartic acid as an N-acyl substituent. PMID:18165309

Structural and biological characterization of a capsular polysaccharide produced by Staphylococcus haemolyticus.

PubMed

Flahaut, Sigrid; Vinogradov, Evgeny; Kelley, Kathryn A; Brennan, Shannon; Hiramatsu, Keiichi; Lee, Jean C

2008-03-01

The DNA sequence of the genome of Staphylococcus haemolyticus JCSC1435 revealed a putative capsule operon composed of 13 genes in tandem. The first seven genes (capABCDEFG(Sh)) showed > or = 57% similarity with the Staphylococcus aureus cap5 or cap8 locus. However, the capHIJKLM(Sh) genes are unique to S. haemolyticus and include genes encoding a putative flippase, an aminotransferase, two glycosyltransferases, and a transcriptional regulator. Capsule-like material was readily apparent by immunoelectron microscopy on bacteria harvested in the postexponential phase of growth. Electron micrographs of a JCSC1435 mutant with a deleted cap region lacked the capsule-like material. Both strains produced small amounts of surface-associated material that reacted with antibodies to polyglutamic acid. S. haemolyticus cap genes were amplified from four of seven clinical isolates of S. haemolyticus from humans, and three of these strains produced a serologically cross-reactive capsular polysaccharide. In vitro assays demonstrated that the acapsular mutant strain showed greater biofilm formation but was more susceptible to complement-mediated opsonophagocytic killing than the parent strain. Structural characterization of capsule purified from S. haemolyticus strain JCSC1435 showed a trisaccharide repeating unit: -3-alpha-L-FucNAc-3-(2-NAc-4-N-Asp-2,4,6-trideoxy-beta-D-Glc)-4-alpha-D-GlcNAc-. This structure is unique among staphylococcal polysaccharides in that its composition includes a trideoxy sugar residue with aspartic acid as an N-acyl substituent.

Repression of YdaS Toxin Is Mediated by Transcriptional Repressor RacR in the Cryptic rac Prophage of Escherichia coli K-12.

PubMed

Krishnamurthi, Revathy; Ghosh, Swagatha; Khedkar, Supriya; Seshasayee, Aswin Sai Narain

2017-01-01

Horizontal gene transfer is a major driving force behind the genomic diversity seen in prokaryotes. The cryptic rac prophage in Escherichia coli K-12 carries the gene for a putative transcription factor RacR, whose deletion is lethal. We have shown that the essentiality of racR in E. coli K-12 is attributed to its role in transcriptionally repressing toxin gene(s) called ydaS and ydaT , which are adjacent to and coded divergently to racR . IMPORTANCE Transcription factors in the bacterium E. coli are rarely essential, and when they are essential, they are largely toxin-antitoxin systems. While studying transcription factors encoded in horizontally acquired regions in E. coli , we realized that the protein RacR, a putative transcription factor encoded by a gene on the rac prophage, is an essential protein. Here, using genetics, biochemistry, and bioinformatics, we show that its essentiality derives from its role as a transcriptional repressor of the ydaS and ydaT genes, whose products are toxic to the cell. Unlike type II toxin-antitoxin systems in which transcriptional regulation involves complexes of the toxin and antitoxin, repression by RacR is sufficient to keep ydaS transcriptionally silent.

Divergent homologs of the predicted small RNA BpCand697 in Burkholderia spp.

NASA Astrophysics Data System (ADS)

Damiri, Nadzirah; Mohd-Padil, Hirzahida; Firdaus-Raih, Mohd

2015-09-01

The small RNA (sRNA) gene candidate, BpCand697 was previously reported to be unique to Burkholderia spp. and is encoded at 3' non-coding region of a putative AraC family transcription regulator gene. This study demonstrates the conservation of BpCand697 sequence across 32 Burkholderia spp. including B. pseudomallei, B. mallei, B. thailandensis and Burkholderia sp. by integrating both sequence homology and secondary structural analyses of BpCand697 within the dataset. The divergent sequence of BpCand697 was also used as a discriminatory power in clustering the dataset according to the potential virulence of Burkholderia spp., showing that B. thailandensis was clearly secluded from the virulent cluster of B. pseudomallei and B. mallei. Finally, the differential co-transcript expression of BpCand697 and its flanking gene, bpsl2391 was detected in Burkholderia pseudomallei D286 after grown under two different culture conditions using nutrient-rich and minimal media. It is hypothesized that the differential expression of BpCand697-bpsl2391 co-transcript between the two standard prepared media might correlate with nutrient availability in the culture media, suggesting that the physical co-localization of BpCand697 in B. pseudomallei D286 might be directly or indirectly involved with the transcript regulation of bpsl2391 under the selected in vitro culture conditions.

PPARγ regulates exocrine pancreas lipase.

PubMed

Danino, Hila; Naor, Ronny Peri-; Fogel, Chen; Ben-Harosh, Yael; Kadir, Rotem; Salem, Hagit; Birk, Ruth

2016-12-01

Pancreatic lipase (triacylglycerol lipase EC 3.1.1.3) is an essential enzyme in hydrolysis of dietary fat. Dietary fat, especially polyunsaturated fatty acids (PUFA), regulate pancreatic lipase (PNLIP); however, the molecular mechanism underlying this regulation is mostly unknown. As PUFA are known to regulate expression of proliferator-activated receptor gamma (PPARγ), and as we identified in-silico putative PPARγ binding sites within the putative PNLIP promoter sequence, we hypothesized that PUFA regulation of PNLIP might be mediated by PPARγ. We used in silico bioinformatics tools, reporter luciferase assay, PPARγ agonists and antagonists, PPARγ overexpression in exocrine pancreas AR42J and primary cells to study PPARγ regulation of PNLIP. Using in silico bioinformatics tools we mapped PPARγ binding sites (PPRE) to the putative promoter region of PNLIP. Reporter luciferase assay in AR42J rat exocrine pancreas acinar cells transfected with various constructs of the putative PNLIP promoter showed that PNLIP transcription is significantly enhanced by PPARγ dose-dependently, reaching maximal levels with multi PPRE sites. This effect was significantly augmented in the presence of PPARγ agonists and reduced by PPARγ antagonists or mutagenesis abrogating PPRE sites. Over-expression of PPARγ significantly elevated PNLIP transcript and protein levels in AR42J cells and in primary pancreas cells. Moreover, PNLIP expression was up-regulated by PPARγ agonists (pioglitazone and 15dPGJ2) and significantly down-regulated by PPARγ antagonists in non-transfected rat exocrine pancreas AR42J cell line cells. PPARγ transcriptionally regulates PNLIP gene expression. This transcript regulation resolves part of the missing link between dietary PUFA direct regulation of PNLIP. Copyright © 2016 Elsevier B.V. All rights reserved.

Directional RNA-seq reveals highly complex condition-dependent transcriptomes in E. coli K12 through accurate full-length transcripts assembling.

PubMed

Li, Shan; Dong, Xia; Su, Zhengchang

2013-07-30

Although prokaryotic gene transcription has been studied over decades, many aspects of the process remain poorly understood. Particularly, recent studies have revealed that transcriptomes in many prokaryotes are far more complex than previously thought. Genes in an operon are often alternatively and dynamically transcribed under different conditions, and a large portion of genes and intergenic regions have antisense RNA (asRNA) and non-coding RNA (ncRNA) transcripts, respectively. Ironically, similar studies have not been conducted in the model bacterium E coli K12, thus it is unknown whether or not the bacterium possesses similar complex transcriptomes. Furthermore, although RNA-seq becomes the major method for analyzing the complexity of prokaryotic transcriptome, it is still a challenging task to accurately assemble full length transcripts using short RNA-seq reads. To fill these gaps, we have profiled the transcriptomes of E. coli K12 under different culture conditions and growth phases using a highly specific directional RNA-seq technique that can capture various types of transcripts in the bacterial cells, combined with a highly accurate and robust algorithm and tool TruHMM (http://bioinfolab.uncc.edu/TruHmm_package/) for assembling full length transcripts. We found that 46.9 ~ 63.4% of expressed operons were utilized in their putative alternative forms, 72.23 ~ 89.54% genes had putative asRNA transcripts and 51.37 ~ 72.74% intergenic regions had putative ncRNA transcripts under different culture conditions and growth phases. As has been demonstrated in many other prokaryotes, E. coli K12 also has a highly complex and dynamic transcriptomes under different culture conditions and growth phases. Such complex and dynamic transcriptomes might play important roles in the physiology of the bacterium. TruHMM is a highly accurate and robust algorithm for assembling full-length transcripts in prokaryotes using directional RNA-seq short reads.

Directional RNA-seq reveals highly complex condition-dependent transcriptomes in E. coli K12 through accurate full-length transcripts assembling

PubMed Central

2013-01-01

Background Although prokaryotic gene transcription has been studied over decades, many aspects of the process remain poorly understood. Particularly, recent studies have revealed that transcriptomes in many prokaryotes are far more complex than previously thought. Genes in an operon are often alternatively and dynamically transcribed under different conditions, and a large portion of genes and intergenic regions have antisense RNA (asRNA) and non-coding RNA (ncRNA) transcripts, respectively. Ironically, similar studies have not been conducted in the model bacterium E coli K12, thus it is unknown whether or not the bacterium possesses similar complex transcriptomes. Furthermore, although RNA-seq becomes the major method for analyzing the complexity of prokaryotic transcriptome, it is still a challenging task to accurately assemble full length transcripts using short RNA-seq reads. Results To fill these gaps, we have profiled the transcriptomes of E. coli K12 under different culture conditions and growth phases using a highly specific directional RNA-seq technique that can capture various types of transcripts in the bacterial cells, combined with a highly accurate and robust algorithm and tool TruHMM (http://bioinfolab.uncc.edu/TruHmm_package/) for assembling full length transcripts. We found that 46.9 ~ 63.4% of expressed operons were utilized in their putative alternative forms, 72.23 ~ 89.54% genes had putative asRNA transcripts and 51.37 ~ 72.74% intergenic regions had putative ncRNA transcripts under different culture conditions and growth phases. Conclusions As has been demonstrated in many other prokaryotes, E. coli K12 also has a highly complex and dynamic transcriptomes under different culture conditions and growth phases. Such complex and dynamic transcriptomes might play important roles in the physiology of the bacterium. TruHMM is a highly accurate and robust algorithm for assembling full-length transcripts in prokaryotes using directional RNA-seq short reads. PMID:23899370

EGRINs (Environmental Gene Regulatory Influence Networks) in Rice That Function in the Response to Water Deficit, High Temperature, and Agricultural Environments[OPEN

PubMed Central

Hafemeister, Christoph; Nicotra, Adrienne B.; Jagadish, S.V. Krishna; Bonneau, Richard; Purugganan, Michael

2016-01-01

Environmental gene regulatory influence networks (EGRINs) coordinate the timing and rate of gene expression in response to environmental signals. EGRINs encompass many layers of regulation, which culminate in changes in accumulated transcript levels. Here, we inferred EGRINs for the response of five tropical Asian rice (Oryza sativa) cultivars to high temperatures, water deficit, and agricultural field conditions by systematically integrating time-series transcriptome data, patterns of nucleosome-free chromatin, and the occurrence of known cis-regulatory elements. First, we identified 5447 putative target genes for 445 transcription factors (TFs) by connecting TFs with genes harboring known cis-regulatory motifs in nucleosome-free regions proximal to their transcriptional start sites. We then used network component analysis to estimate the regulatory activity for each TF based on the expression of its putative target genes. Finally, we inferred an EGRIN using the estimated transcription factor activity (TFA) as the regulator. The EGRINs include regulatory interactions between 4052 target genes regulated by 113 TFs. We resolved distinct regulatory roles for members of the heat shock factor family, including a putative regulatory connection between abiotic stress and the circadian clock. TFA estimation using network component analysis is an effective way of incorporating multiple genome-scale measurements into network inference. PMID:27655842

Infection of capilloviruses requires subgenomic RNAs whose transcription is controlled by promoter-like sequences conserved among flexiviruses.

PubMed

Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou

2012-07-01

The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.

Cloning and characterization of prunus serotina AGAMOUS, a putative flower homeotic gene

Treesearch

Xiaomei Liu; Joseph Anderson; Paula Pijut

2010-01-01

Members of the AGAMOUS subfamily of MADS-box transcription factors play an important role in regulating the development of reproductive organs in flowering plants. To help understand the mechanism of floral development in black cherry (Prunus serotina), PsAG (a putative flower homeotic identity gene) was isolated...

Putative Monofunctional Type I Polyketide Synthase Units: A Dinoflagellate-Specific Feature?

PubMed Central

Eichholz, Karsten; Beszteri, Bánk; John, Uwe

2012-01-01

Marine dinoflagellates (alveolata) are microalgae of which some cause harmful algal blooms and produce a broad variety of most likely polyketide synthesis derived phycotoxins. Recently, novel polyketide synthesase (PKS) transcripts have been described from the Florida red tide dinoflagellate Karenia brevis (gymnodiniales) which are evolutionarily related to Type I PKS but were apparently expressed as monofunctional proteins, a feature typical of Type II PKS. Here, we investigated expression units of PKS I-like sequences in Alexandrium ostenfeldii (gonyaulacales) and Heterocapsa triquetra (peridiniales) at the transcript and protein level. The five full length transcripts we obtained were all characterized by polyadenylation, a 3′ UTR and the dinoflagellate specific spliced leader sequence at the 5′end. Each of the five transcripts encoded a single ketoacylsynthase (KS) domain showing high similarity to K. brevis KS sequences. The monofunctional structure was also confirmed using dinoflagellate specific KS antibodies in Western Blots. In a maximum likelihood phylogenetic analysis of KS domains from diverse PKSs, dinoflagellate KSs formed a clade placed well within the protist Type I PKS clade between apicomplexa, haptophytes and chlorophytes. These findings indicate that the atypical PKS I structure, i.e., expression as putative monofunctional units, might be a dinoflagellate specific feature. In addition, the sequenced transcripts harbored a previously unknown, apparently dinoflagellate specific conserved N-terminal domain. We discuss the implications of this novel region with regard to the putative monofunctional organization of Type I PKS in dinoflagellates. PMID:23139807

Molecular Evolution of the Non-Coding Eosinophil Granule Ontogeny Transcript

PubMed Central

Rose, Dominic; Stadler, Peter F.

2011-01-01

Eukaryotic genomes are pervasively transcribed. A large fraction of the transcriptional output consists of long, mRNA-like, non-protein-coding transcripts (mlncRNAs). The evolutionary history of mlncRNAs is still largely uncharted territory. In this contribution, we explore in detail the evolutionary traces of the eosinophil granule ontogeny transcript (EGOT), an experimentally confirmed representative of an abundant class of totally intronic non-coding transcripts (TINs). EGOT is located antisense to an intron of the ITPR1 gene. We computationally identify putative EGOT orthologs in the genomes of 32 different amniotes, including orthologs from primates, rodents, ungulates, carnivores, afrotherians, and xenarthrans, as well as putative candidates from basal amniotes, such as opossum or platypus. We investigate the EGOT gene phylogeny, analyze patterns of sequence conservation, and the evolutionary conservation of the EGOT gene structure. We show that EGO-B, the spliced isoform, may be present throughout the placental mammals, but most likely dates back even further. We demonstrate here for the first time that the whole EGOT locus is highly structured, containing several evolutionary conserved, and thermodynamic stable secondary structures. Our analyses allow us to postulate novel functional roles of a hitherto poorly understood region at the intron of EGO-B which is highly conserved at the sequence level. The region contains a novel ITPR1 exon and also conserved RNA secondary structures together with a conserved TATA-like element, which putatively acts as a promoter of an independent regulatory element. PMID:22303364

Systems analysis identifies miR-29b regulation of invasiveness in melanoma.

PubMed

Andrews, Miles C; Cursons, Joseph; Hurley, Daniel G; Anaka, Matthew; Cebon, Jonathan S; Behren, Andreas; Crampin, Edmund J

2016-11-16

In many cancers, microRNAs (miRs) contribute to metastatic progression by modulating phenotypic reprogramming processes such as epithelial-mesenchymal plasticity. This can be driven by miRs targeting multiple mRNA transcripts, inducing regulated changes across large sets of genes. The miR-target databases TargetScan and DIANA-microT predict putative relationships by examining sequence complementarity between miRs and mRNAs. However, it remains a challenge to identify which miR-mRNA interactions are active at endogenous expression levels, and of biological consequence. We developed a workflow to integrate TargetScan and DIANA-microT predictions into the analysis of data-driven associations calculated from transcript abundance (RNASeq) data, specifically the mutual information and Pearson's correlation metrics. We use this workflow to identify putative relationships of miR-mediated mRNA repression with strong support from both lines of evidence. Applying this approach systematically to a large, published collection of unique melanoma cell lines - the Ludwig Melbourne melanoma (LM-MEL) cell line panel - we identified putative miR-mRNA interactions that may contribute to invasiveness. This guided the selection of interactions of interest for further in vitro validation studies. Several miR-mRNA regulatory relationships supported by TargetScan and DIANA-microT demonstrated differential activity across cell lines of varying matrigel invasiveness. Strong negative statistical associations for these putative regulatory relationships were consistent with target mRNA inhibition by the miR, and suggest that differential activity of such miR-mRNA relationships contribute to differences in melanoma invasiveness. Many of these relationships were reflected across the skin cutaneous melanoma TCGA dataset, indicating that these observations also show graded activity across clinical samples. Several of these miRs are implicated in cancer progression (miR-211, -340, -125b, -221, and -29b). The specific role for miR-29b-3p in melanoma has not been well studied. We experimentally validated the predicted miR-29b-3p regulation of LAMC1 and PPIC and LASP1, and show that dysregulation of miR-29b-3p or these mRNA targets can influence cellular invasiveness in vitro. This analytic strategy provides a comprehensive, systems-level approach to identify miR-mRNA regulation in high-throughput cancer data, identifies novel putative interactions with functional phenotypic relevance, and can be used to direct experimental resources for subsequent experimental validation. Computational scripts are available: http://github.com/uomsystemsbiology/LMMEL-miR-miner.

Transcriptome Analysis Reveals Candidate Genes involved in Blister Blight defense in Tea (Camellia sinensis (L) Kuntze)

PubMed Central

Jayaswall, Kuldip; Mahajan, Pallavi; Singh, Gagandeep; Parmar, Rajni; Seth, Romit; Raina, Aparnashree; Swarnkar, Mohit Kumar; Singh, Anil Kumar; Shankar, Ravi; Sharma, Ram Kumar

2016-01-01

To unravel the molecular mechanism of defense against blister blight (BB) disease caused by an obligate biotrophic fungus, Exobasidium vexans, transcriptome of BB interaction with resistance and susceptible tea genotypes was analysed through RNA-seq using Illumina GAIIx at four different stages during ~20-day disease cycle. Approximately 69 million high quality reads were assembled de novo, yielding 37,790 unique transcripts with more than 55% being functionally annotated. Differentially expressed, 149 defense related transcripts/genes, namely defense related enzymes, resistance genes, multidrug resistant transporters, transcription factors, retrotransposons, metacaspases and chaperons were observed in RG, suggesting their role in defending against BB. Being present in the major hub, putative master regulators among these candidates were identified from predetermined protein-protein interaction network of Arabidopsis thaliana. Further, confirmation of abundant expression of well-known RPM1, RPS2 and RPP13 in quantitative Real Time PCR indicates salicylic acid and jasmonic acid, possibly induce synthesis of antimicrobial compounds, required to overcome the virulence of E. vexans. Compendiously, the current study provides a comprehensive gene expression and insights into the molecular mechanism of tea defense against BB to serve as a resource for unravelling the possible regulatory mechanism of immunity against various biotic stresses in tea and other crops. PMID:27465480

Transcriptome Analysis Reveals Candidate Genes involved in Blister Blight defense in Tea (Camellia sinensis (L) Kuntze)

NASA Astrophysics Data System (ADS)

Jayaswall, Kuldip; Mahajan, Pallavi; Singh, Gagandeep; Parmar, Rajni; Seth, Romit; Raina, Aparnashree; Swarnkar, Mohit Kumar; Singh, Anil Kumar; Shankar, Ravi; Sharma, Ram Kumar

2016-07-01

To unravel the molecular mechanism of defense against blister blight (BB) disease caused by an obligate biotrophic fungus, Exobasidium vexans, transcriptome of BB interaction with resistance and susceptible tea genotypes was analysed through RNA-seq using Illumina GAIIx at four different stages during ~20-day disease cycle. Approximately 69 million high quality reads were assembled de novo, yielding 37,790 unique transcripts with more than 55% being functionally annotated. Differentially expressed, 149 defense related transcripts/genes, namely defense related enzymes, resistance genes, multidrug resistant transporters, transcription factors, retrotransposons, metacaspases and chaperons were observed in RG, suggesting their role in defending against BB. Being present in the major hub, putative master regulators among these candidates were identified from predetermined protein-protein interaction network of Arabidopsis thaliana. Further, confirmation of abundant expression of well-known RPM1, RPS2 and RPP13 in quantitative Real Time PCR indicates salicylic acid and jasmonic acid, possibly induce synthesis of antimicrobial compounds, required to overcome the virulence of E. vexans. Compendiously, the current study provides a comprehensive gene expression and insights into the molecular mechanism of tea defense against BB to serve as a resource for unravelling the possible regulatory mechanism of immunity against various biotic stresses in tea and other crops.

Identification of a novel prophage-like gene cluster actively expressed in both virulent and avirulent strains of Leptospira interrogans serovar Lai.

PubMed

Qin, Jin-Hong; Zhang, Qing; Zhang, Zhi-Ming; Zhong, Yi; Yang, Yang; Hu, Bao-Yu; Zhao, Guo-Ping; Guo, Xiao-Kui

2008-06-01

DNA microarray analysis was used to compare the differential gene expression profiles between Leptospira interrogans serovar Lai type strain 56601 and its corresponding attenuated strain IPAV. A 22-kb genomic island covering a cluster of 34 genes (i.e., genes LA0186 to LA0219) was actively expressed in both strains but concomitantly upregulated in strain 56601 in contrast to that of IPAV. Reverse transcription-PCR assays proved that the gene cluster comprised five transcripts. Gene annotation of this cluster revealed characteristics of a putative prophage-like remnant with at least 8 of 34 sequences encoding prophage-like proteins, of which the LA0195 protein is probably a putative prophage CI-like regulator. The transcription initiation activities of putative promoter-regulatory sequences of transcripts I, II, and III, all proximal to the LA0195 gene, were further analyzed in the Escherichia coli promoter probe vector pKK232-8 by assaying the reporter chloramphenicol acetyltransferase (CAT) activities. The strong promoter activities of both transcripts I and II indicated by the E. coli CAT assay were well correlated with the in vitro sequence-specific binding of the recombinant LA0195 protein to the corresponding promoter probes detected by the electrophoresis mobility shift assay. On the other hand, the promoter activity of transcript III was very low in E. coli and failed to show active binding to the LA0195 protein in vitro. These results suggested that the LA0195 protein is likely involved in the transcription of transcripts I and II. However, the identical complete DNA sequences of this prophage remnant from these two strains strongly suggests that possible regulatory factors or signal transduction systems residing outside of this region within the genome may be responsible for the differential expression profiling in these two strains.

SuperSAGE analysis of the Nicotiana attenuata transcriptome after fatty acid-amino acid elicitation (FAC): identification of early mediators of insect responses

PubMed Central

2010-01-01

Background Plants trigger and tailor defense responses after perception of the oral secretions (OS) of attacking specialist lepidopteran larvae. Fatty acid-amino acid conjugates (FACs) in the OS of the Manduca sexta larvae are necessary and sufficient to elicit the herbivory-specific responses in Nicotiana attenuata, an annual wild tobacco species. How FACs are perceived and activate signal transduction mechanisms is unknown. Results We used SuperSAGE combined with 454 sequencing to quantify the early transcriptional changes elicited by the FAC N-linolenoyl-glutamic acid (18:3-Glu) and virus induced gene silencing (VIGS) to examine the function of candidate genes in the M. sexta-N. attenuata interaction. The analysis targeted mRNAs encoding regulatory components: rare transcripts with very rapid FAC-elicited kinetics (increases within 60 and declines within 120 min). From 12,744 unique Tag sequences identified (UniTags), 430 and 117 were significantly up- and down-regulated ≥ 2.5-fold, respectively, after 18:3-Glu elicitation compared to wounding. Based on gene ontology classification, more than 25% of the annotated UniTags corresponded to putative regulatory components, including 30 transcriptional regulators and 22 protein kinases. Quantitative PCR analysis was used to analyze the FAC-dependent regulation of a subset of 27 of these UniTags and for most of them a rapid and transient induction was confirmed. Six FAC-regulated genes were functionally characterized by VIGS and two, a putative lipid phosphate phosphatase (LPP) and a protein of unknown function, were identified as important mediators of the M. sexta-N. attenuata interaction. Conclusions The analysis of the early changes in the transcriptome of N. attenuata after FAC elicitation using SuperSAGE/454 has identified regulatory genes involved in insect-specific mediated responses in plants. Moreover, it has provided a foundation for the identification of additional novel regulators associated with this process. PMID:20398280

SuperSAGE analysis of the Nicotiana attenuata transcriptome after fatty acid-amino acid elicitation (FAC): identification of early mediators of insect responses.

PubMed

Gilardoni, Paola A; Schuck, Stefan; Jüngling, Ruth; Rotter, Björn; Baldwin, Ian T; Bonaventure, Gustavo

2010-04-14

Plants trigger and tailor defense responses after perception of the oral secretions (OS) of attacking specialist lepidopteran larvae. Fatty acid-amino acid conjugates (FACs) in the OS of the Manduca sexta larvae are necessary and sufficient to elicit the herbivory-specific responses in Nicotiana attenuata, an annual wild tobacco species. How FACs are perceived and activate signal transduction mechanisms is unknown. We used SuperSAGE combined with 454 sequencing to quantify the early transcriptional changes elicited by the FAC N-linolenoyl-glutamic acid (18:3-Glu) and virus induced gene silencing (VIGS) to examine the function of candidate genes in the M. sexta-N. attenuata interaction. The analysis targeted mRNAs encoding regulatory components: rare transcripts with very rapid FAC-elicited kinetics (increases within 60 and declines within 120 min). From 12,744 unique Tag sequences identified (UniTags), 430 and 117 were significantly up- and down-regulated >or= 2.5-fold, respectively, after 18:3-Glu elicitation compared to wounding. Based on gene ontology classification, more than 25% of the annotated UniTags corresponded to putative regulatory components, including 30 transcriptional regulators and 22 protein kinases. Quantitative PCR analysis was used to analyze the FAC-dependent regulation of a subset of 27 of these UniTags and for most of them a rapid and transient induction was confirmed. Six FAC-regulated genes were functionally characterized by VIGS and two, a putative lipid phosphate phosphatase (LPP) and a protein of unknown function, were identified as important mediators of the M. sexta-N. attenuata interaction. The analysis of the early changes in the transcriptome of N. attenuata after FAC elicitation using SuperSAGE/454 has identified regulatory genes involved in insect-specific mediated responses in plants. Moreover, it has provided a foundation for the identification of additional novel regulators associated with this process.

Synthetic RORγt Agonists Enhance Protective Immunity

PubMed Central

Chang, Mi Ra; Dharmarajan, Venkatasubramanian; Doebelin, Christelle; Garcia-Ordonez, Ruben D.; Novick, Scott J.; Kuruvilla, Dana S.; Kamenecka, Theodore M.; Griffin, Patrick R.

2016-01-01

The T cell specific RORγ isoform RORγt has been shown to be the key lineage-defining transcription factor to initiate the differentiation program of TH17 and Tc17 cells, cells that have demonstrated anti-tumor efficacy. RORγt controls gene networks that enhance immunity including increased IL17 production and decreased immune suppression. Both synthetic and putative endogenous agonists of RORγt have been shown to increase the basal activity of RORγt enhancing TH17 cell proliferation. Here we show that activation of RORγt using synthetic agonists drives proliferation of TH17 cells while decreasing levels of the immune checkpoint protein PD-1, a mechanism that should enhance anti-tumor immunity while blunting tumor associated adaptive immune resistance. Interestingly, putative endogenous agonists drive proliferation of TH17 cells but do not repress PD-1. These findings suggest that synthetic agonists of RORγt should activate TC17/TH17 cells (with concomitant reduction in the Tregs population), repress PD-1, and produce IL17 in situ (a factor associated with good prognosis in cancer). Enhanced immunity and blockage of immune checkpoints has transformed cancer treatment, thus such a molecule would provide a unique approach for the treatment of cancer. PMID:26785144

Maize LAZY1 mediates shoot gravitropism and inflorescence development through regulating auxin transport, auxin signaling, and light response.

PubMed

Dong, Zhaobin; Jiang, Chuan; Chen, Xiaoyang; Zhang, Tao; Ding, Lian; Song, Weibin; Luo, Hongbing; Lai, Jinsheng; Chen, Huabang; Liu, Renyi; Zhang, Xiaolan; Jin, Weiwei

2013-11-01

Auxin is a plant hormone that plays key roles in both shoot gravitropism and inflorescence development. However, these two processes appear to be parallel and to be regulated by distinct players. Here, we report that the maize (Zea mays) prostrate stem1 mutant, which is allelic to the classic mutant lazy plant1 (la1), displays prostrate growth with reduced shoot gravitropism and defective inflorescence development. Map-based cloning identified maize ZmLA1 as the functional ortholog of LAZY1 in rice (Oryza sativa) and Arabidopsis (Arabidopsis thaliana). It has a unique role in inflorescence development and displays enriched expression in reproductive organs such as tassels and ears. Transcription of ZmLA1 responds to auxin and is repressed by light. Furthermore, ZmLA1 physically interacts with a putative auxin transport regulator in the plasma membrane and a putative auxin signaling protein in the nucleus. RNA-SEQ data showed that dozens of auxin transport, auxin response, and light signaling genes were differentially expressed in la1 mutant stems. Therefore, ZmLA1 might mediate the cross talk between shoot gravitropism and inflorescence development by regulating auxin transport, auxin signaling, and probably light response in maize.

Genome-Wide Identification and Characterization of microRNAs in Developing Grains of Zea mays L.

PubMed Central

Gao, Lei; Wang, Lifang; Gao, Meijuan; Jiao, Zhujin; Qiao, Huili; Yang, Jianwei; Chen, Min; Yao, Lunguang; Liu, Renyi; Kan, Yunchao

2016-01-01

The development and maturation of maize kernel involves meticulous and fine gene regulation at transcriptional and post-transcriptional levels, and miRNAs play important roles during this process. Although a number of miRNAs have been identified in maize seed, the ones involved in the early development of grains and in different lines of maize have not been well studied. Here, we profiled four small RNA libraries, each constructed from groups of immature grains of Zea mays inbred line Chang 7–2 collected 4–6, 7–9, 12–14, and 18–23 days after pollination (DAP). A total of 40 known (containing 111 unique miRNAs) and 162 novel (containing 196 unique miRNA candidates) miRNA families were identified. For conserved and novel miRNAs with over 100 total reads, 44% had higher accumulation before the 9th DAP, especially miR166 family members. 42% of miRNAs had highest accumulation during 12–14 DAP (which is the transition stage from embryogenesis to nutrient storage). Only 14% of miRNAs had higher expression 18–23 DAP. Prediction of potential targets of all miRNAs showed that 165 miRNA families had 377 target genes. For miR164 and miR166, we showed that the transcriptional levels of their target genes were significantly decreased when co-expressed with their cognate miRNA precursors in vivo. Further analysis shows miR159, miR164, miR166, miR171, miR390, miR399, and miR529 families have putative roles in the embryogenesis of maize grain development by participating in transcriptional regulation and morphogenesis, while miR167 and miR528 families participate in metabolism process and stress response during nutrient storage. Our study is the first to present an integrated dynamic expression pattern of miRNAs during maize kernel formation and maturation. PMID:27082634

Transcriptome and proteome data reveal candidate genes for pollinator attraction in sexually deceptive orchids.

PubMed

Sedeek, Khalid E M; Qi, Weihong; Schauer, Monica A; Gupta, Alok K; Poveda, Lucy; Xu, Shuqing; Liu, Zhong-Jian; Grossniklaus, Ueli; Schiestl, Florian P; Schlüter, Philipp M

2013-01-01

Sexually deceptive orchids of the genus Ophrys mimic the mating signals of their pollinator females to attract males as pollinators. This mode of pollination is highly specific and leads to strong reproductive isolation between species. This study aims to identify candidate genes responsible for pollinator attraction and reproductive isolation between three closely related species, O. exaltata, O. sphegodes and O. garganica. Floral traits such as odour, colour and morphology are necessary for successful pollinator attraction. In particular, different odour hydrocarbon profiles have been linked to differences in specific pollinator attraction among these species. Therefore, the identification of genes involved in these traits is important for understanding the molecular basis of pollinator attraction by sexually deceptive orchids. We have created floral reference transcriptomes and proteomes for these three Ophrys species using a combination of next-generation sequencing (454 and Solexa), Sanger sequencing, and shotgun proteomics (tandem mass spectrometry). In total, 121 917 unique transcripts and 3531 proteins were identified. This represents the first orchid proteome and transcriptome from the orchid subfamily Orchidoideae. Proteome data revealed proteins corresponding to 2644 transcripts and 887 proteins not observed in the transcriptome. Candidate genes for hydrocarbon and anthocyanin biosynthesis were represented by 156 and 61 unique transcripts in 20 and 7 genes classes, respectively. Moreover, transcription factors putatively involved in the regulation of flower odour, colour and morphology were annotated, including Myb, MADS and TCP factors. Our comprehensive data set generated by combining transcriptome and proteome technologies allowed identification of candidate genes for pollinator attraction and reproductive isolation among sexually deceptive orchids. This includes genes for hydrocarbon and anthocyanin biosynthesis and regulation, and the development of floral morphology. These data will serve as an invaluable resource for research in orchid floral biology, enabling studies into the molecular mechanisms of pollinator attraction and speciation.

Transcriptome and Proteome Data Reveal Candidate Genes for Pollinator Attraction in Sexually Deceptive Orchids

PubMed Central

Sedeek, Khalid E. M.; Qi, Weihong; Schauer, Monica A.; Gupta, Alok K.; Poveda, Lucy; Xu, Shuqing; Liu, Zhong-Jian; Grossniklaus, Ueli; Schiestl, Florian P.; Schlüter, Philipp M.

2013-01-01

Background Sexually deceptive orchids of the genus Ophrys mimic the mating signals of their pollinator females to attract males as pollinators. This mode of pollination is highly specific and leads to strong reproductive isolation between species. This study aims to identify candidate genes responsible for pollinator attraction and reproductive isolation between three closely related species, O. exaltata, O. sphegodes and O. garganica. Floral traits such as odour, colour and morphology are necessary for successful pollinator attraction. In particular, different odour hydrocarbon profiles have been linked to differences in specific pollinator attraction among these species. Therefore, the identification of genes involved in these traits is important for understanding the molecular basis of pollinator attraction by sexually deceptive orchids. Results We have created floral reference transcriptomes and proteomes for these three Ophrys species using a combination of next-generation sequencing (454 and Solexa), Sanger sequencing, and shotgun proteomics (tandem mass spectrometry). In total, 121 917 unique transcripts and 3531 proteins were identified. This represents the first orchid proteome and transcriptome from the orchid subfamily Orchidoideae. Proteome data revealed proteins corresponding to 2644 transcripts and 887 proteins not observed in the transcriptome. Candidate genes for hydrocarbon and anthocyanin biosynthesis were represented by 156 and 61 unique transcripts in 20 and 7 genes classes, respectively. Moreover, transcription factors putatively involved in the regulation of flower odour, colour and morphology were annotated, including Myb, MADS and TCP factors. Conclusion Our comprehensive data set generated by combining transcriptome and proteome technologies allowed identification of candidate genes for pollinator attraction and reproductive isolation among sexually deceptive orchids. This includes genes for hydrocarbon and anthocyanin biosynthesis and regulation, and the development of floral morphology. These data will serve as an invaluable resource for research in orchid floral biology, enabling studies into the molecular mechanisms of pollinator attraction and speciation. PMID:23734209

Genome-Wide Identification and Characterization of microRNAs in Developing Grains of Zea mays L.

PubMed

Li, Dandan; Liu, Zongcai; Gao, Lei; Wang, Lifang; Gao, Meijuan; Jiao, Zhujin; Qiao, Huili; Yang, Jianwei; Chen, Min; Yao, Lunguang; Liu, Renyi; Kan, Yunchao

2016-01-01

The development and maturation of maize kernel involves meticulous and fine gene regulation at transcriptional and post-transcriptional levels, and miRNAs play important roles during this process. Although a number of miRNAs have been identified in maize seed, the ones involved in the early development of grains and in different lines of maize have not been well studied. Here, we profiled four small RNA libraries, each constructed from groups of immature grains of Zea mays inbred line Chang 7-2 collected 4-6, 7-9, 12-14, and 18-23 days after pollination (DAP). A total of 40 known (containing 111 unique miRNAs) and 162 novel (containing 196 unique miRNA candidates) miRNA families were identified. For conserved and novel miRNAs with over 100 total reads, 44% had higher accumulation before the 9th DAP, especially miR166 family members. 42% of miRNAs had highest accumulation during 12-14 DAP (which is the transition stage from embryogenesis to nutrient storage). Only 14% of miRNAs had higher expression 18-23 DAP. Prediction of potential targets of all miRNAs showed that 165 miRNA families had 377 target genes. For miR164 and miR166, we showed that the transcriptional levels of their target genes were significantly decreased when co-expressed with their cognate miRNA precursors in vivo. Further analysis shows miR159, miR164, miR166, miR171, miR390, miR399, and miR529 families have putative roles in the embryogenesis of maize grain development by participating in transcriptional regulation and morphogenesis, while miR167 and miR528 families participate in metabolism process and stress response during nutrient storage. Our study is the first to present an integrated dynamic expression pattern of miRNAs during maize kernel formation and maturation.

Trees, fungi and bacteria: tripartite metatranscriptomics of a root microbiome responding to soil contamination.

PubMed

Gonzalez, E; Pitre, F E; Pagé, A P; Marleau, J; Guidi Nissim, W; St-Arnaud, M; Labrecque, M; Joly, S; Yergeau, E; Brereton, N J B

2018-03-21

One method for rejuvenating land polluted with anthropogenic contaminants is through phytoremediation, the reclamation of land through the cultivation of specific crops. The capacity for phytoremediation crops, such as Salix spp., to tolerate and even flourish in contaminated soils relies on a highly complex and predominantly cryptic interacting community of microbial life. Here, Illumina HiSeq 2500 sequencing and de novo transcriptome assembly were used to observe gene expression in washed Salix purpurea cv. 'Fish Creek' roots from trees pot grown in petroleum hydrocarbon-contaminated or non-contaminated soil. All 189,849 assembled contigs were annotated without a priori assumption as to sequence origin and differential expression was assessed. The 839 contigs differentially expressed (DE) and annotated from S. purpurea revealed substantial increases in transcripts encoding abiotic stress response equipment, such as glutathione S-transferases, in roots of contaminated trees as well as the hallmarks of fungal interaction, such as SWEET2 (Sugars Will Eventually Be Exported Transporter). A total of 8252 DE transcripts were fungal in origin, with contamination conditions resulting in a community shift from Ascomycota to Basidiomycota genera. In response to contamination, 1745 Basidiomycota transcripts increased in abundance (the majority uniquely expressed in contaminated soil) including major monosaccharide transporter MST1, primary cell wall and lamella CAZy enzymes, and an ectomycorrhiza-upregulated exo-β-1,3-glucanase (GH5). Additionally, 639 DE polycistronic transcripts from an uncharacterised Enterobacteriaceae species were uniformly in higher abundance in contamination conditions and comprised a wide spectrum of genes cryptic under laboratory conditions but considered putatively involved in eukaryotic interaction, biofilm formation and dioxygenase hydrocarbon degradation. Fungal gene expression, representing the majority of contigs assembled, suggests out-competition of white rot Ascomycota genera (dominated by Pyronema), a sometimes ectomycorrhizal (ECM) Ascomycota (Tuber) and ECM Basidiomycota (Hebeloma) by a poorly characterised putative ECM Basidiomycota due to contamination. Root and fungal expression involved transcripts encoding carbohydrate/amino acid (C/N) dialogue whereas bacterial gene expression included the apparatus necessary for biofilm interaction and direct reduction of contamination stress, a potential bacterial currency for a role in tripartite mutualism. Unmistakable within the metatranscriptome is the degree to which the landscape of rhizospheric biology, particularly the important but predominantly uncharacterised fungal genetics, is yet to be discovered.

Cloning, localization and expression analysis of vacuolar sugar transporters in the CAM plant Ananas comosus (pineapple).

PubMed

Antony, Edna; Taybi, Tahar; Courbot, Mikaël; Mugford, Sam T; Smith, J Andrew C; Borland, Anne M

2008-01-01

In photosynthetic tissues of the CAM plant pineapple (Ananas comosus), storage of soluble sugars in the central vacuole during the daytime and their remobilization at night is required to provide carbon skeletons for nocturnal CO(2) fixation. However, soluble sugars produced photosynthetically must also be exported to support growth processes in heterotrophic tissues. To begin to address how vacuolar sugar storage and assimilate partitioning are regulated in A. comosus, degenerate PCR and cDNA library screening were used to clone three candidate sugar transporters from the leaves of this species. Subcellular localization of the three transporters was investigated via expression of YFP-fusion proteins in tobacco epidermal cells and their co-localization with subcellular markers by confocal microscopy. Using this strategy, a putative hexose transporter (AcMST1) and a putative inositol transporter (AcINT1) were identified that both localized to the tonoplast, whereas a putative sucrose transporter (AcSUT1) was found to localize to prevacuolar compartments. A cDNA (AcMST2) with high similarity to a recently characterized tonoplast hexose transporter in Arabidopsis was also identified from an A. comosus fruit EST database. Analyses of transcript abundance indicated that AcMST1 was more highly expressed in fruits compared to leaves of A. comosus, whilst transcripts of AcINT1, AcSUT1, and AcMST2 were more abundant in leaves. Transcript abundance of AcINT1, the putative inositol transporter, showed day-night changes comparable to those of other CAM-related transcripts described in Mesembryanthemum crystallinum. The results are discussed in terms of the role of vacuolar sugar transporters in regulating carbon flow during the diel cycle in CAM plants.

A repertoire of the dominant transcripts from the salivary glands of the blood-sucking bug, Triatoma dimidiata, a vector of Chagas disease

PubMed Central

Kato, Hirotomo; Jochim, Ryan C.; Gomez, Eduardo A.; Sakoda, Ryo; Iwata, Hiroyuki; Valenzuela, Jesus G.; Hashiguchi, Yoshihisa

2010-01-01

Triatoma (T.) dimidiata is a hematophagous Hemiptera and a main vector of Chagas disease. The saliva of this and other blood-sucking insects contains potent pharmacologically active components that assist them in counteracting the host hemostatic and inflammatory systems during blood feeding. To describe the repertoire of potential bioactive salivary molecules from this insect, a number of randomly selected transcripts from the salivary gland cDNA library of T. dimidiata were sequenced and analyzed. This analysis showed that 77.5% of the isolated transcripts coded for putative secreted proteins, and 89.9% of these coded for variants of the lipocalin family proteins. The most abundant transcript was a homologue of procalin, the major allergen of T. protracta saliva, and contributed more than 50% of the transcripts coding for putative secreted proteins, suggesting that it may play an important role in the blood-feeding process. Other salivary transcripts encoding lipocalin family proteins had homology to triabin (a thrombin inhibitor), triafestin (an inhibitor of kallikrein–kinin system), pallidipin (an inhibitor of collagen-induced platelet aggregation) and others with unknown function. PMID:19900580

Transcriptional landscapes of Axolotl (Ambystoma mexicanum).

PubMed

Caballero-Pérez, Juan; Espinal-Centeno, Annie; Falcon, Francisco; García-Ortega, Luis F; Curiel-Quesada, Everardo; Cruz-Hernández, Andrés; Bako, Laszlo; Chen, Xuemei; Martínez, Octavio; Alberto Arteaga-Vázquez, Mario; Herrera-Estrella, Luis; Cruz-Ramírez, Alfredo

2018-01-15

The axolotl (Ambystoma mexicanum) is the vertebrate model system with the highest regeneration capacity. Experimental tools established over the past 100 years have been fundamental to start unraveling the cellular and molecular basis of tissue and limb regeneration. In the absence of a reference genome for the Axolotl, transcriptomic analysis become fundamental to understand the genetic basis of regeneration. Here we present one of the most diverse transcriptomic data sets for Axolotl by profiling coding and non-coding RNAs from diverse tissues. We reconstructed a population of 115,906 putative protein coding mRNAs as full ORFs (including isoforms). We also identified 352 conserved miRNAs and 297 novel putative mature miRNAs. Systematic enrichment analysis of gene expression allowed us to identify tissue-specific protein-coding transcripts. We also found putative novel and conserved microRNAs which potentially target mRNAs which are reported as important disease candidates in heart and liver. Copyright © 2017 Elsevier Inc. All rights reserved.

Transcriptome Analysis of Nine Tissues to Discover Genes Involved in the Biosynthesis of Active Ingredients in Sophora flavescens.

PubMed

Han, Rongchun; Takahashi, Hiroki; Nakamura, Michimi; Bunsupa, Somnuk; Yoshimoto, Naoko; Yamamoto, Hirobumi; Suzuki, Hideyuki; Shibata, Daisuke; Yamazaki, Mami; Saito, Kazuki

2015-01-01

Sophora flavescens AITON (kurara) has long been used to treat various diseases. Although several research findings revealed the biosynthetic pathways of its characteristic chemical components as represented by matrine, insufficient analysis of transcriptome data hampered in-depth analysis of the underlying putative genes responsible for the biosynthesis of pharmaceutical chemical components. In this study, more than 200 million fastq format reads were generated by Illumina's next-generation sequencing approach using nine types of tissue from S. flavescens, followed by CLC de novo assembly, ultimately yielding 83,325 contigs in total. By mapping the reads back to the contigs, reads per kilobase of the transcript per million mapped reads values were calculated to demonstrate gene expression levels, and overrepresented gene ontology terms were evaluated using Fisher's exact test. In search of the putative genes relevant to essential metabolic pathways, all 1350 unique enzyme commission numbers were used to map pathways against the Kyoto Encyclopedia of Genes and Genomes. By analyzing expression patterns, we proposed some candidate genes involved in the biosynthesis of isoflavonoids and quinolizidine alkaloids. Adopting RNA-Seq analysis, we obtained substantially credible contigs for downstream work. The preferential expression of the gene for putative lysine/ornithine decarboxylase committed in the initial step of matrine biosynthesis in leaves and stems was confirmed in semi-quantitative polymerase chain reaction (PCR) analysis. The findings in this report may serve as a stepping-stone for further research into this promising medicinal plant.

Induction of multixenobiotic defense mechanisms in resistant Daphnia magna clones as a general cellular response to stress.

PubMed

Jordão, Rita; Campos, Bruno; Lemos, Marco F L; Soares, Amadeu M V M; Tauler, Romà; Barata, Carlos

2016-06-01

Multixenobiotic resistance mechanisms (MXR) were recently identified in Daphnia magna. Previous results characterized gene transcripts of genes encoding and efflux activities of four putative ABCB1 and ABCC transporters that were chemically induced but showed low specificity against model transporter substrates and inhibitors, thus preventing us from distinguishing between activities of different efflux transporter types. In this study we report on the specificity of induction of ABC transporters and of the stress protein hsp70 in clones selected to be genetically resistant to ABCB1 chemical substrates. Clones resistant to mitoxantrone, ivermectin and pentachlorophenol showed distinctive transcriptional responses of transporter protein coding genes and of putative transporter dye activities. Expression of hsp70 proteins also varied across resistant clones. Clones resistant to mitoxantrone and pentachlorophenol showed high constitutive levels of hsp70. Transcriptional levels of the abcb1 gene transporter and of putative dye transporter activity were also induced to a greater extent in the pentachlorophenol resistant clone. Observed higher dye transporter activities in individuals from clones resistant to mitoxantrone and ivermectin were unrelated with transcriptional levels of the studied four abcc and abcb1 transporter genes. These findings suggest that Abcb1 induction in D. magna may be a part of a general cellular stress response. Copyright © 2016 Elsevier B.V. All rights reserved.

Differences in Transcriptional Activity of Human Papillomavirus Type 6 Molecular Variants in Recurrent Respiratory Papillomatosis

PubMed Central

Measso do Bonfim, Caroline; Simão Sobrinho, João; Lacerda Nogueira, Rodrigo; Salgado Kupper, Daniel; Cardoso Pereira Valera, Fabiana; Lacerda Nogueira, Maurício; Villa, Luisa Lina; Rahal, Paula; Sichero, Laura

2015-01-01

A significant proportion of recurrent respiratory papillomatosis (RRP) is caused by human papillomavirus type 6 (HPV-6). The long control region (LCR) contains cis-elements for regulation of transcription. Our aim was to characterize LCR HPV-6 variants in RRP cases, compare promoter activity of these isolates and search for cellular transcription factors (TFs) that could explain the differences observed. The complete LCR from 13 RRP was analyzed. Transcriptional activity of 5 variants was compared using luciferase assays. Differences in putative TFs binding sites among variants were revealed using the TRANSFAC database. Chromatin immunoprecipation (CHIP) and luciferase assays were used to evaluate TF binding and impact upon transcription, respectively. Juvenile-onset RRP cases harbored exclusively HPV-6vc related variants, whereas among adult-onset cases HPV-6a variants were more prevalent. The HPV-6vc reference was more transcriptionally active than the HPV-6a reference. Active FOXA1, ELF1 and GATA1 binding sites overlap variable nucleotide positions among isolates and influenced LCR activity. Furthermore, our results support a crucial role for ELF1 on transcriptional downregulation. We identified TFs implicated in the regulation of HPV-6 early gene expression. Many of these factors are mutated in cancer or are putative cancer biomarkers, and must be further studied. PMID:26151558

Transcriptome profiling of Nasonia vitripennis testis reveals novel transcripts expressed from the selfish B chromosome, paternal sex ratio.

PubMed

Akbari, Omar S; Antoshechkin, Igor; Hay, Bruce A; Ferree, Patrick M

2013-09-04

A widespread phenomenon in nature is sex ratio distortion of arthropod populations caused by microbial and genetic parasites. Currently little is known about how these agents alter host developmental processes to favor one sex or the other. The paternal sex ratio (PSR) chromosome is a nonessential, paternally transmitted centric fragment that segregates in natural populations of the jewel wasp, Nasonia vitripennis. To persist, PSR is thought to modify the hereditary material of the developing sperm, with the result that all nuclear DNA other than the PSR chromosome is destroyed shortly after fertilization. This results in the conversion of a fertilized embryo--normally a female--into a male, thereby insuring transmission of the "selfish" PSR chromosome, and simultaneously leading to wasp populations that are male-biased. To begin to understand this system at the mechanistic level, we carried out transcriptional profiling of testis from WT and PSR-carrying males. We identified a number of transcripts that are differentially expressed between these conditions. We also discovered nine transcripts that are uniquely expressed from the PSR chromosome. Four of these PSR-specific transcripts encode putative proteins, whereas the others have very short open reading frames and no homology to known proteins, suggesting that they are long noncoding RNAs. We propose several different models for how these transcripts could facilitate PSR-dependent effects. Our analyses also revealed 15.71 MB of novel transcribed regions in the N. vitripennis genome, thus increasing the current annotation of total transcribed regions by 53.4%. Finally, we detected expression of multiple meiosis-related genes in the wasp testis, despite the lack of conventional meiosis in the male sex.

Transcriptome Profiling of Nasonia vitripennis Testis Reveals Novel Transcripts Expressed from the Selfish B Chromosome, Paternal Sex Ratio

PubMed Central

Akbari, Omar S.; Antoshechkin, Igor; Hay, Bruce A.; Ferree, Patrick M.

2013-01-01

A widespread phenomenon in nature is sex ratio distortion of arthropod populations caused by microbial and genetic parasites. Currently little is known about how these agents alter host developmental processes to favor one sex or the other. The paternal sex ratio (PSR) chromosome is a nonessential, paternally transmitted centric fragment that segregates in natural populations of the jewel wasp, Nasonia vitripennis. To persist, PSR is thought to modify the hereditary material of the developing sperm, with the result that all nuclear DNA other than the PSR chromosome is destroyed shortly after fertilization. This results in the conversion of a fertilized embryo—normally a female—into a male, thereby insuring transmission of the “selfish” PSR chromosome, and simultaneously leading to wasp populations that are male-biased. To begin to understand this system at the mechanistic level, we carried out transcriptional profiling of testis from WT and PSR-carrying males. We identified a number of transcripts that are differentially expressed between these conditions. We also discovered nine transcripts that are uniquely expressed from the PSR chromosome. Four of these PSR-specific transcripts encode putative proteins, whereas the others have very short open reading frames and no homology to known proteins, suggesting that they are long noncoding RNAs. We propose several different models for how these transcripts could facilitate PSR-dependent effects. Our analyses also revealed 15.71 MB of novel transcribed regions in the N. vitripennis genome, thus increasing the current annotation of total transcribed regions by 53.4%. Finally, we detected expression of multiple meiosis-related genes in the wasp testis, despite the lack of conventional meiosis in the male sex. PMID:23893741

LncRNAs in Secondary Hair Follicle of Cashmere Goat: Identification, Expression, and Their Regulatory Network in Wnt Signaling Pathway.

PubMed

Bai, Wen L; Zhao, Su J; Wang, Ze Y; Zhu, Yu B; Dang, Yun L; Cong, Yu Y; Xue, Hui L; Wang, Wei; Deng, Liang; Guo, Dan; Wang, Shi Q; Zhu, Yan X; Yin, Rong H

2018-07-03

Long noncoding RNAs (lncRNAs) are a novel class of eukaryotic transcripts. They are thought to act as a critical regulator of protein-coding gene expression. Herein, we identified and characterized 13 putative lncRNAs from the expressed sequence tags from secondary hair follicle of Cashmere goat. Furthermore, we investigated their transcriptional pattern in secondary hair follicle of Liaoning Cashmere goat during telogen and anagen phases. Also, we generated intracellular regulatory networks of upregulated lncRNAs at anagen in Wnt signaling pathway based on bioinformatics analysis. The relative expression of six putative lncRNAs (lncRNA-599618, -599556, -599554, -599547, -599531, and -599509) at the anagen phase is significantly higher than that at telogen. Compared with anagen, the relative expression of four putative lncRNAs (lncRNA-599528, -599518, -599511, and -599497) was found to be significantly upregulated at telogen phase. The network generated showed that a rich and complex regulatory relationship of the putative lncRNAs and related miRNAs with their target genes in Wnt signaling pathway. Our results from the present study provided a foundation for further elucidating the functional and regulatory mechanisms of these putative lncRNAs in the development of secondary hair follicle and cashmere fiber growth of Cashmere goat.

The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum

DOE PAGES

Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...

2017-06-24

In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less

Serratia marcescens Cyclic AMP Receptor Protein Controls Transcription of EepR, a Novel Regulator of Antimicrobial Secondary Metabolites.

PubMed

Stella, Nicholas A; Lahr, Roni M; Brothers, Kimberly M; Kalivoda, Eric J; Hunt, Kristin M; Kwak, Daniel H; Liu, Xinyu; Shanks, Robert M Q

2015-08-01

Serratia marcescens generates secondary metabolites and secreted enzymes, and it causes hospital infections and community-acquired ocular infections. Previous studies identified cyclic AMP (cAMP) receptor protein (CRP) as an indirect inhibitor of antimicrobial secondary metabolites. Here, we identified a putative two-component regulator that suppressed crp mutant phenotypes. Evidence supports that the putative response regulator eepR was directly transcriptionally inhibited by cAMP-CRP. EepR and the putative sensor kinase EepS were necessary for the biosynthesis of secondary metabolites, including prodigiosin- and serratamolide-dependent phenotypes, swarming motility, and hemolysis. Recombinant EepR bound to the prodigiosin and serratamolide promoters in vitro. Together, these data introduce a novel regulator of secondary metabolites that directly connects the broadly conserved metabolism regulator CRP with biosynthetic genes that may contribute to competition with other microbes. This study identifies a new transcription factor that is directly controlled by a broadly conserved transcription factor, CRP. CRP is well studied in its role to help bacteria respond to the amount of nutrients in their environment. The new transcription factor EepR is essential for the bacterium Serratia marcescens to produce two biologically active compounds, prodigiosin and serratamolide. These two compounds are antimicrobial and may allow S. marcescens to compete for limited nutrients with other microorganisms. Results from this study tie together the CRP environmental nutrient sensor with a new regulator of antimicrobial compounds. Beyond microbial ecology, prodigiosin and serratamolide have therapeutic potential; therefore, understanding their regulation is important for both applied and basic science. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Isolation of diapause-regulated transcripts by differential display from the Colorado potato beetle, and their expression in prediapausing and nondiapausing adults. GenBank. Accessions: FG591137-FG591192

USDA-ARS?s Scientific Manuscript database

Using differential display, 56 putatively diapause regulated transcripts were isolated from the Colorado potato beetle, Leptinotarsa decemlineata. The clones insert sizes range from 114 to 795 bp with mean length of 392 ± SD of 191 bp. Fourteen of the transcripts were confirmed by northern blot anal...

Transcriptomic analysis highlights epigenetic and transcriptional regulation during zygotic embryo development of Pinus pinaster.

PubMed

de Vega-Bartol, José J; Simões, Marta; Lorenz, W Walter; Rodrigues, Andreia S; Alba, Rob; Dean, Jeffrey F D; Miguel, Célia M

2013-08-30

It is during embryogenesis that the plant body plan is established and the meristems responsible for all post-embryonic growth are specified. The molecular mechanisms governing conifer embryogenesis are still largely unknown. Their elucidation may contribute valuable information to clarify if the distinct features of embryo development in angiosperms and gymnosperms result from differential gene regulation. To address this issue, we have performed the first transcriptomic analysis of zygotic embryo development in a conifer species (Pinus pinaster) focusing our study in particular on regulatory genes playing important roles during plant embryo development, namely epigenetic regulators and transcription factors. Microarray analysis of P. pinaster zygotic embryogenesis was performed at five periods of embryo development from early developing to mature embryos. Our results show that most changes in transcript levels occurred in the first and the last embryo stage-to-stage transitions, namely early to pre-cotyledonary embryo and cotyledonary to mature embryo. An analysis of functional categories for genes that were differentially expressed through embryogenesis highlighted several epigenetic regulation mechanisms. While putative orthologs of transcripts associated with mechanisms that target transposable elements and repetitive sequences were strongly expressed in early embryogenesis, PRC2-mediated repression of genes seemed more relevant during late embryogenesis. On the other hand, functions related to sRNA pathways appeared differentially regulated across all stages of embryo development with a prevalence of miRNA functions in mid to late embryogenesis. Identification of putative transcription factor genes differentially regulated between consecutive embryo stages was strongly suggestive of the relevance of auxin responses and regulation of auxin carriers during early embryogenesis. Such responses could be involved in establishing embryo patterning. Later in development, transcripts with homology to genes acting on modulation of auxin flow and determination of adaxial-abaxial polarity were up-regulated, as were putative orthologs of genes required for meristem formation and function as well as establishment of organ boundaries. Comparative analysis with A. thaliana embryogenesis also highlighted genes involved in auxin-mediated responses, as well as epigenetic regulation, indicating highly correlated transcript profiles between the two species. This is the first report of a time-course transcriptomic analysis of zygotic embryogenesis in a conifer. Taken together our results show that epigenetic regulation and transcriptional control related to auxin transport and response are critical during early to mid stages of pine embryogenesis and that important events during embryogenesis seem to be coordinated by putative orthologs of major developmental regulators in angiosperms.

Transcriptomic analysis highlights epigenetic and transcriptional regulation during zygotic embryo development of Pinus pinaster

PubMed Central

2013-01-01

Background It is during embryogenesis that the plant body plan is established and the meristems responsible for all post-embryonic growth are specified. The molecular mechanisms governing conifer embryogenesis are still largely unknown. Their elucidation may contribute valuable information to clarify if the distinct features of embryo development in angiosperms and gymnosperms result from differential gene regulation. To address this issue, we have performed the first transcriptomic analysis of zygotic embryo development in a conifer species (Pinus pinaster) focusing our study in particular on regulatory genes playing important roles during plant embryo development, namely epigenetic regulators and transcription factors. Results Microarray analysis of P. pinaster zygotic embryogenesis was performed at five periods of embryo development from early developing to mature embryos. Our results show that most changes in transcript levels occurred in the first and the last embryo stage-to-stage transitions, namely early to pre-cotyledonary embryo and cotyledonary to mature embryo. An analysis of functional categories for genes that were differentially expressed through embryogenesis highlighted several epigenetic regulation mechanisms. While putative orthologs of transcripts associated with mechanisms that target transposable elements and repetitive sequences were strongly expressed in early embryogenesis, PRC2-mediated repression of genes seemed more relevant during late embryogenesis. On the other hand, functions related to sRNA pathways appeared differentially regulated across all stages of embryo development with a prevalence of miRNA functions in mid to late embryogenesis. Identification of putative transcription factor genes differentially regulated between consecutive embryo stages was strongly suggestive of the relevance of auxin responses and regulation of auxin carriers during early embryogenesis. Such responses could be involved in establishing embryo patterning. Later in development, transcripts with homology to genes acting on modulation of auxin flow and determination of adaxial-abaxial polarity were up-regulated, as were putative orthologs of genes required for meristem formation and function as well as establishment of organ boundaries. Comparative analysis with A. thaliana embryogenesis also highlighted genes involved in auxin-mediated responses, as well as epigenetic regulation, indicating highly correlated transcript profiles between the two species. Conclusions This is the first report of a time-course transcriptomic analysis of zygotic embryogenesis in a conifer. Taken together our results show that epigenetic regulation and transcriptional control related to auxin transport and response are critical during early to mid stages of pine embryogenesis and that important events during embryogenesis seem to be coordinated by putative orthologs of major developmental regulators in angiosperms. PMID:23987738

Carotenoid composition of the flowers of Mimulus lewisii and related species: Implications regarding the prevalence and origin of two unique, allenic pigments.

PubMed

LaFountain, Amy M; Frank, Harry A; Yuan, Yao-Wu

2015-05-01

The genus Mimulus has been used as a model system in a wide range of ecological and evolutionary studies and contains many species with carotenoid pigmented flowers. However, the detailed carotenoid composition of these flowers has never been reported. In this paper the floral carotenoid composition of 11 Mimulus species are characterized using high-performance liquid chromatography, mass spectrometry and chemical methods with a particular focus on the genetic model species, Mimulus lewisii. M. lewisii flowers have five major carotenoids: antheraxanthin, violaxanthin, neoxanthin, and the unique allenic carotenoids, deepoxyneoxanthin and mimulaxanthin. This carotenoid profile is consistent with the expression levels of putative carotenoid biosynthetic genes in the M. lewisii flower. The other 10 species possess the same five carotenoids or a subset of these. Comparison of the carotenoid profiles among species in a phylogenetic context provides new insights into the biosynthesis and evolution of deepoxyneoxanthin and mimulaxanthin. This work also lays the foundation for future studies regarding transcriptional control of the carotenoid biosynthesis pathway in Mimulus flowers. Copyright © 2015 Elsevier Inc. All rights reserved.

Ucma--A novel secreted factor represents a highly specific marker for distal chondrocytes.

PubMed

Tagariello, Andreas; Luther, Julia; Streiter, Melanie; Didt-Koziel, Lydia; Wuelling, Manuela; Surmann-Schmitt, Cordula; Stock, Michael; Adam, Nadia; Vortkamp, Andrea; Winterpacht, Andreas

2008-01-01

Growth and development of most parts of the vertebrate skeleton takes place by endochondral ossification, a process during which chondrocytes undergo distinct stages of differentiation resulting in a successive replacement of the cartilage anlagen by bone. In the context of an EST project we isolated a novel transcript from a human fetal growth plate cartilage cDNA library. The transcript which we called Ucma (unique cartilage matrix-associated protein) encodes a short protein of 138 amino acids. The protein sequence is evolutionary conserved throughout vertebrates and comprises a signal peptide, a coiled-coil domain, and a putative dibasic cleavage site for proprotein convertases. Using RNA in situ hybridization and immunohistochemistry with a polyclonal anti-Ucma antibody we found high expression of Ucma uniquely in distal (resting) chondrocytes in developing long bones of wildtype mice. This restricted expression could also be observed in Ihh(-/-), Ihh(-/-); Gli3(-/-), Gli3(-/-) mice, and in mice that overexpress Ihh under the control of the Col2a1 promoter indicating that expression of Ucma is regulated independent of hedgehog signaling. During insulin-induced differentiation of ATDC5 cells we found gradual increase of Ucma expression at day 21 with a maximum at day 24 and a decrease correlating with a simultaneous increase in the expression of cartilage link protein (Crtl1), a protein with maximum expression in column-forming proliferating chondrocytes. The present data strongly suggest an important function of Ucma in the early phase of chondrocyte differentiation.

A Genomic View of the Sea Urchin Nervous System

PubMed Central

Burke, RD; Angerer, LM; Elphick, MR; Humphrey, GW; Yaguchi, S; Kiyama, T; Liang, S; Mu, X; Agca, C; Klein, WH; Brandhorst, BP; Rowe, M; Wilson, K; Churcher, AM; Taylor, JS; Chen, N; Murray, G; Wang, D; Mellott, D; Olinski, R; Hallböök, F; Thorndyke, MC

2007-01-01

The sequencing of the Strongylocentrotus purpuratus genome provides a unique opportunity to investigate the function and evolution of neural genes. The neurobiology of sea urchins is of particular interest because they have a close phylogenetic relationship with chordates, yet a distinctive pentaradiate body plan and unusual neural organization. Orthologues of transcription factors that regulate neurogenesis in other animals have been identified and several are expressed in neurogenic domains before gastrulation indicating that they may operate near the top of a conserved neural gene regulatory network. A family of genes encoding voltage-gated ion channels is present but, surprisingly, genes encoding gap junction proteins (connexins and pannexins) appear to be absent. Genes required for synapse formation and function have been identified and genes for synthesis and transport of neurotransmitters are present. There is a large family of G-protein-coupled receptors, including 874 rhodopsin-type receptors, 28 metabotropic glutamate-like receptors and a remarkably expanded group of 161 secretin receptor-like proteins. Absence of cannabinoid, lysophospholipid and melanocortin receptors indicates that this group may be unique to chordates. There are at least 37 putative G-protein coupled peptide receptors and precursors for several neuropeptides and peptide hormones have been identified, including SALMFamides, NGFFFamide, a vasotocin-like peptide, glycoprotein hormones, and insulin/insulin-like growth factors. Identification of a neurotrophin-like gene and Trk receptor in sea urchin indicates that this neural signaling system is not unique to chordates. Several hundred chemoreceptor genes have been predicted using several approaches, a number similar to that for other animals. Intriguingly, genes encoding homologues of rhodopsin, Pax6 and several other key mammalian retinal transcription factors are expressed in tube feet, suggesting tube feet function as photosensory organs. Analysis of the sea urchin genome presents a unique perspective on the evolutionary history of deuterostome nervous systems and reveals new approaches to investigate the development and neurobiology of sea urchins. PMID:16965768

Identification and Characterization of Tumor Antigens Associated With Breast Cancer

DTIC Science & Technology

1998-08-01

including mental retardation and alpha- thalassemia (9). The RNA transcript was shown to exist at high levels in B 16 melanoma cells and moderate levels in...D.R. Mutations in a putative global transcriptional regulator cause X-linked mental retardation with alpha- thalassemia (ATRX syndrome). Cell (80): 837

Identification of reproduction-related genes and SSR-markers through expressed sequence tags analysis of a monsoon breeding carp rohu, Labeo rohita (Hamilton).

PubMed

Sahu, Dinesh K; Panda, Soumya P; Panda, Sujata; Das, Paramananda; Meher, Prem K; Hazra, Rupenangshu K; Peatman, Eric; Liu, Zhanjiang J; Eknath, Ambekar E; Nandi, Samiran

2013-07-15

Labeo rohita (Ham.) also called rohu is the most important freshwater aquaculture species on the Indian sub continent. Monsoon dependent breeding restricts its seed production beyond season indicating a strong genetic control about which very limited information is available. Additionally, few genomic resources are publicly available for this species. Here we sought to identify reproduction-relevant genes from normalized cDNA libraries of the brain-pituitary-gonad-liver (BPGL-axis) tissues of adult L. rohita collected during post preparatory phase. 6161 random clones sequenced (Sanger-based) from these libraries produced 4642 (75.34%) high-quality sequences. They were assembled into 3631 (78.22%) unique sequences composed of 709 contigs and 2922 singletons. A total of 182 unique sequences were found to be associated with reproduction-related genes, mainly under the GO term categories of reproduction, neuro-peptide hormone activity, hormone and receptor binding, receptor activity, signal transduction, embryonic development, cell-cell signaling, cell death and anti-apoptosis process. Several important reproduction-related genes reported here for the first time in L. rohita are zona pellucida sperm-binding protein 3, aquaporin-12, spermine oxidase, sperm associated antigen 7, testis expressed 261, progesterone receptor membrane component, Neuropeptide Y and Pro-opiomelanocortin. Quantitative RT-PCR-based analyses of 8 known and 8 unknown transcripts during preparatory and post-spawning phase showed increased expression level of most of the transcripts during preparatory phase (except Neuropeptide Y) in comparison to post-spawning phase indicating possible roles in initiation of gonad maturation. Expression of unknown transcripts was also found in prolific breeder common carp and tilapia, but levels of expression were much higher in seasonal breeder rohu. 3631 unique sequences contained 236 (6.49%) putative microsatellites with the AG (28.16%) repeat as the most frequent motif. Twenty loci showed polymorphism in 36 unrelated individuals with allele frequency ranging from 2 to 7 per locus. The observed heterozygosity ranged from 0.096 to 0.774 whereas the expected heterozygosity ranged from 0.109 to 0.801. Identification of 182 important reproduction-related genes and expression pattern of 16 transcripts in preparatory and post-spawning phase along with 20 polymorphic EST-SSRs should be highly useful for the future reproductive molecular studies and selection program in Labeo rohita. Copyright © 2013 Elsevier B.V. All rights reserved.

Alphavirus replicon approach to promoterless analysis of IRES elements.

PubMed

Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F

2007-04-10

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.

Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements

PubMed Central

Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.

2007-01-01

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813

RhNAC2 and RhEXPA4 Are Involved in the Regulation of Dehydration Tolerance during the Expansion of Rose Petals1[C][W][OA

PubMed Central

Dai, Fanwei; Zhang, Changqing; Jiang, Xinqiang; Kang, Mei; Yin, Xia; Lü, Peitao; Zhang, Xiao; Zheng, Yi; Gao, Junping

2012-01-01

Dehydration inhibits petal expansion resulting in abnormal flower opening and results in quality loss during the marketing of cut flowers. We constructed a suppression subtractive hybridization library from rose (Rosa hybrida) flowers containing 3,513 unique expressed sequence tags and analyzed their expression profiles during cycles of dehydration. We found that 54 genes were up-regulated by the first dehydration, restored or even down-regulated by rehydration, and once again up-regulated by the second dehydration. Among them, we identified a putative NAC family transcription factor (RhNAC2). With transactivation activity of its carboxyl-terminal domain in yeast (Saccharomyces cerevisiae) cell and Arabidopsis (Arabidopsis thaliana) protoplast, RhNAC2 belongs to the NAC transcription factor clade related to plant development in Arabidopsis. A putative expansin gene named RhEXPA4 was also dramatically up-regulated by dehydration. Silencing RhNAC2 or RhEXPA4 in rose petals by virus-induced gene silencing significantly decreased the recovery of intact petals and petal discs during rehydration. Overexpression of RhNAC2 or RhEXPA4 in Arabidopsis conferred strong drought tolerance in the transgenic plants. RhEXPA4 expression was repressed in RhNAC2-silenced rose petals, and the amino-terminal binding domain of RhNAC2 bound to the RhEXPA4 promoter. Twenty cell wall-related genes, including seven expansin family members, were up-regulated in Arabidopsis plants overexpressing RhNAC2. These data indicate that RhNAC2 and RhEXPA4 are involved in the regulation of dehydration tolerance during the expansion of rose petals and that RhEXPA4 expression may be regulated by RhNAC2. PMID:23093360

Genomic characterisation of Wongabel virus reveals novel genes within the Rhabdoviridae.

PubMed

Gubala, Aneta J; Proll, David F; Barnard, Ross T; Cowled, Chris J; Crameri, Sandra G; Hyatt, Alex D; Boyle, David B

2008-06-20

Viruses belonging to the family Rhabdoviridae infect a variety of different hosts, including insects, vertebrates and plants. Currently, there are approximately 200 ICTV-recognised rhabdoviruses isolated around the world. However, the majority remain poorly characterised and only a fraction have been definitively assigned to genera. The genomic and transcriptional complexity displayed by several of the characterised rhabdoviruses indicates large diversity and complexity within this family. To enable an improved taxonomic understanding of this family, it is necessary to gain further information about the poorly characterised members of this family. Here we present the complete genome sequence and predicted transcription strategy of Wongabel virus (WONV), a previously uncharacterised rhabdovirus isolated from biting midges (Culicoides austropalpalis) collected in northern Queensland, Australia. The 13,196 nucleotide genome of WONV encodes five typical rhabdovirus genes N, P, M, G and L. In addition, the WONV genome contains three genes located between the P and M genes (U1, U2, U3) and two open reading frames overlapping with the N and G genes (U4, U5). These five additional genes and their putative protein products appear to be novel, and their functions are unknown. Predictive analysis of the U5 gene product revealed characteristics typical of viroporins, and indicated structural similarities with the alpha-1 protein (putative viroporin) of viruses in the genus Ephemerovirus. Phylogenetic analyses of the N and G proteins of WONV indicated closest similarity with the avian-associated Flanders virus; however, the genomes of these two viruses are significantly diverged. WONV displays a novel and unique genome structure that has not previously been described for any animal rhabdovirus.

Discovery of numerous novel small genes in the intergenic regions of the Escherichia coli O157:H7 Sakai genome

PubMed Central

Hücker, Sarah M.; Ardern, Zachary; Goldberg, Tatyana; Schafferhans, Andrea; Bernhofer, Michael; Vestergaard, Gisle; Nelson, Chase W.; Schloter, Michael; Rost, Burkhard; Scherer, Siegfried

2017-01-01

In the past, short protein-coding genes were often disregarded by genome annotation pipelines. Transcriptome sequencing (RNAseq) signals outside of annotated genes have usually been interpreted to indicate either ncRNA or pervasive transcription. Therefore, in addition to the transcriptome, the translatome (RIBOseq) of the enteric pathogen Escherichia coli O157:H7 strain Sakai was determined at two optimal growth conditions and a severe stress condition combining low temperature and high osmotic pressure. All intergenic open reading frames potentially encoding a protein of ≥ 30 amino acids were investigated with regard to coverage by transcription and translation signals and their translatability expressed by the ribosomal coverage value. This led to discovery of 465 unique, putative novel genes not yet annotated in this E. coli strain, which are evenly distributed over both DNA strands of the genome. For 255 of the novel genes, annotated homologs in other bacteria were found, and a machine-learning algorithm, trained on small protein-coding E. coli genes, predicted that 89% of these translated open reading frames represent bona fide genes. The remaining 210 putative novel genes without annotated homologs were compared to the 255 novel genes with homologs and to 250 short annotated genes of this E. coli strain. All three groups turned out to be similar with respect to their translatability distribution, fractions of differentially regulated genes, secondary structure composition, and the distribution of evolutionary constraint, suggesting that both novel groups represent legitimate genes. However, the machine-learning algorithm only recognized a small fraction of the 210 genes without annotated homologs. It is possible that these genes represent a novel group of genes, which have unusual features dissimilar to the genes of the machine-learning algorithm training set. PMID:28902868

Pseudomonas aeruginosa PumA acts on an endogenous phenazine to promote self-resistance.

PubMed

Sporer, Abigail J; Beierschmitt, Christopher; Bendebury, Anastasia; Zink, Katherine E; Price-Whelan, Alexa; Buzzeo, Marisa C; Sanchez, Laura M; Dietrich, Lars E P

2018-05-01

The activities of critical metabolic and regulatory proteins can be altered by exposure to natural or synthetic redox-cycling compounds. Many bacteria, therefore, possess mechanisms to transport or transform these small molecules. The opportunistic pathogen Pseudomonas aeruginosa PA14 synthesizes phenazines, redox-active antibiotics that are toxic to other organisms but have beneficial effects for their producer. Phenazines activate the redox-sensing transcription factor SoxR and thereby induce the transcription of a small regulon, including the operon mexGHI-opmD, which encodes an efflux pump that transports phenazines, and PA14_35160 (pumA), which encodes a putative monooxygenase. Here, we provide evidence that PumA contributes to phenazine resistance and normal biofilm development, particularly during exposure to or production of strongly oxidizing N-methylated phenazines. We show that phenazine resistance depends on the presence of residues that are conserved in the active sites of other putative and characterized monooxygenases found in the antibiotic producer Streptomyces coelicolor. We also show that during biofilm growth, PumA is required for the conversion of phenazine methosulfate to unique phenazine metabolites. Finally, we compare ∆mexGHI-opmD and ∆pumA strains in assays for colony biofilm morphogenesis and SoxR activation, and find that these deletions have opposing phenotypic effects. Our results suggest that, while MexGHI-OpmD-mediated efflux has the effect of making the cellular phenazine pool more reducing, PumA acts on cellular phenazines to make the pool more oxidizing. We present a model in which these two SoxR targets function simultaneously to control the biological activity of the P. aeruginosa phenazine pool.

Concordant gene regulation related to perturbations of three GDP-mannose-related genes.

PubMed

Törmä, Anssi; Pitkänen, Juha-Pekka; Huopaniemi, Laura; Mattila, Pirkko; Renkonen, Risto

2009-02-01

Glycosylation of proteins is one of the most crucial post-translational modifications. In order to access system-level and state-dependent data related to the regulation of glycosylation events, we cultivated yeast cell strains each harboring a selected conditional knockdown construct for a gene (either SEC53, VRG4 or DPM1) related to GDP-mannose synthesis or its utilization in glycan biosynthesis. In order to carry this out efficiently, we developed automated sampling from bioreactor cultivations, a collection of in silico workflows for data analysis as well as their integration into a large data warehouse. Using the above-mentioned approaches, we could show that conditional knocking down of transcripts related to GDP-mannose synthesis or transportation led to altered levels of over 300 transcripts. These transcripts and their corresponding proteins were characterized by their gene ontology (GO) annotations, and their putative transcriptional regulation was analyzed. Furthermore, novel pathways were generated indicating interactions between GO categories with common proteins, putative transcriptional regulators of such induced GO categories, and the large protein-protein interaction network among the proteins whose transcripts indicated altered expression levels. When these results are always added to an ever-expanding data warehouse as annotations, they will incrementally increase the knowledge of biological systems.

Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

PubMed

Ficarelli, A; Tassi, F; Restivo, F M

1999-03-01

We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

Transcriptome Profiling of Selectively Bred Pacific Oyster Crassostrea gigas Families that Differ in Tolerance of Heat Shock

PubMed Central

Bayne, Christopher J.; Camara, Mark D.; Cunningham, Charles; Jenny, Matthew J.; Langdon, Christopher J.

2010-01-01

Sessile inhabitants of marine intertidal environments commonly face heat stress, an important component of summer mortality syndrome in the Pacific oyster Crassostrea gigas. Marker-aided selection programs would be useful for developing oyster strains that resist summer mortality; however, there is currently a need to identify candidate genes associated with stress tolerance and to develop molecular markers associated with those genes. To identify candidate genes for further study, we used cDNA microarrays to test the hypothesis that oyster families that had high (>64%) or low (<29%) survival of heat shock (43°C, 1 h) differ in their transcriptional responses to stress. Based upon data generated by the microarray and by real-time quantitative PCR, we found that transcription after heat shock increased for genes putatively encoding heat shock proteins and genes for proteins that synthesize lipids, protect against bacterial infection, and regulate spawning, whereas transcription decreased for genes for proteins that mobilize lipids and detoxify reactive oxygen species. RNAs putatively identified as heat shock protein 27, collagen, peroxinectin, S-crystallin, and two genes with no match in Genbank had higher transcript concentrations in low-surviving families than in high-surviving families, whereas concentration of putative cystatin B mRNA was greater in high-surviving families. These ESTs should be studied further for use in marker-aided selection programs. Low survival of heat shock could result from a complex interaction of cell damage, opportunistic infection, and metabolic exhaustion. PMID:19205802

Transcriptional analysis of the bglP gene from Streptococcus mutans.

PubMed

Cote, Christopher K; Honeyman, Allen L

2006-04-21

An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.

Transcriptional analysis of the bglP gene from Streptococcus mutans

PubMed Central

Cote, Christopher K; Honeyman, Allen L

2006-01-01

Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357

A bioinformatic survey of RNA-binding proteins in Plasmodium.

PubMed

Reddy, B P Niranjan; Shrestha, Sony; Hart, Kevin J; Liang, Xiaoying; Kemirembe, Karen; Cui, Liwang; Lindner, Scott E

2015-11-02

The malaria parasites in the genus Plasmodium have a very complicated life cycle involving an invertebrate vector and a vertebrate host. RNA-binding proteins (RBPs) are critical factors involved in every aspect of the development of these parasites. However, very few RBPs have been functionally characterized to date in the human parasite Plasmodium falciparum. Using different bioinformatic methods and tools we searched P. falciparum genome to list and annotate RBPs. A representative 3D models for each of the RBD domain identified in P. falciparum was created using I-TESSAR and SWISS-MODEL. Microarray and RNAseq data analysis pertaining PfRBPs was performed using MeV software. Finally, Cytoscape was used to create protein-protein interaction network for CITH-Dozi and Caf1-CCR4-Not complexes. We report the identification of 189 putative RBP genes belonging to 13 different families in Plasmodium, which comprise 3.5% of all annotated genes. Almost 90% (169/189) of these genes belong to six prominent RBP classes, namely RNA recognition motifs, DEAD/H-box RNA helicases, K homology, Zinc finger, Puf and Alba gene families. Interestingly, almost all of the identified RNA-binding helicases and KH genes have cognate homologs in model species, suggesting their evolutionary conservation. Exploration of the existing P. falciparum blood-stage transcriptomes revealed that most RBPs have peak mRNA expression levels early during the intraerythrocytic development cycle, which taper off in later stages. Nearly 27% of RBPs have elevated expression in gametocytes, while 47 and 24% have elevated mRNA expression in ookinete and asexual stages. Comparative interactome analyses using human and Plasmodium protein-protein interaction datasets suggest extensive conservation of the PfCITH/PfDOZI and PfCaf1-CCR4-NOT complexes. The Plasmodium parasites possess a large number of putative RBPs belonging to most of RBP families identified so far, suggesting the presence of extensive post-transcriptional regulation in these parasites. Taken together, in silico identification of these putative RBPs provides a foundation for future functional studies aimed at defining a unique network of post-transcriptional regulation in P. falciparum.

Olive phenolic compounds: metabolic and transcriptional profiling during fruit development

PubMed Central

2012-01-01

Background Olive (Olea europaea L.) fruits contain numerous secondary metabolites, primarily phenolics, terpenes and sterols, some of which are particularly interesting for their nutraceutical properties. This study will attempt to provide further insight into the profile of olive phenolic compounds during fruit development and to identify the major genetic determinants of phenolic metabolism. Results The concentration of the major phenolic compounds, such as oleuropein, demethyloleuropein, 3–4 DHPEA-EDA, ligstroside, tyrosol, hydroxytyrosol, verbascoside and lignans, were measured in the developing fruits of 12 olive cultivars. The content of these compounds varied significantly among the cultivars and decreased during fruit development and maturation, with some compounds showing specificity for certain cultivars. Thirty-five olive transcripts homologous to genes involved in the pathways of the main secondary metabolites were identified from the massive sequencing data of the olive fruit transcriptome or from cDNA-AFLP analysis. Their mRNA levels were determined using RT-qPCR analysis on fruits of high- and low-phenolic varieties (Coratina and Dolce d’Andria, respectively) during three different fruit developmental stages. A strong correlation was observed between phenolic compound concentrations and transcripts putatively involved in their biosynthesis, suggesting a transcriptional regulation of the corresponding pathways. OeDXS, OeGES, OeGE10H and OeADH, encoding putative 1-deoxy-D-xylulose-5-P synthase, geraniol synthase, geraniol 10-hydroxylase and arogenate dehydrogenase, respectively, were almost exclusively present at 45 days after flowering (DAF), suggesting that these compounds might play a key role in regulating secoiridoid accumulation during fruit development. Conclusions Metabolic and transcriptional profiling led to the identification of some major players putatively involved in biosynthesis of secondary compounds in the olive tree. Our data represent the first step towards the functional characterisation of important genes for the determination of olive fruit quality. PMID:22963618

The Zur regulon of Corynebacterium glutamicum ATCC 13032

PubMed Central

2010-01-01

Background Zinc is considered as an essential element for all living organisms, but it can be toxic at large concentrations. Bacteria therefore tightly regulate zinc metabolism. The Cg2502 protein of Corynebacterium glutamicum was a candidate to control zinc metabolism in this species, since it was classified as metalloregulator of the zinc uptake regulator (Zur) subgroup of the ferric uptake regulator (Fur) family of DNA-binding transcription regulators. Results The cg2502 (zur) gene was deleted in the chromosome of C. glutamicum ATCC 13032 by an allelic exchange procedure to generate the zur-deficient mutant C. glutamicum JS2502. Whole-genome DNA microarray hybridizations and real-time RT-PCR assays comparing the gene expression in C. glutamicum JS2502 with that of the wild-type strain detected 18 genes with enhanced expression in the zur mutant. The expression data were combined with results from cross-genome comparisons of shared regulatory sites, revealing the presence of candidate Zur-binding sites in the mapped promoter regions of five transcription units encoding components of potential zinc ABC-type transporters (cg0041-cg0042/cg0043; cg2911-cg2912-cg2913), a putative secreted protein (cg0040), a putative oxidoreductase (cg0795), and a putative P-loop GTPase of the COG0523 protein family (cg0794). Enhanced transcript levels of the respective genes in C. glutamicum JS2502 were verified by real-time RT-PCR, and complementation of the mutant with a wild-type zur gene reversed the effect of differential gene expression. The zinc-dependent expression of the putative cg0042 and cg2911 operons was detected in vivo with a gfp reporter system. Moreover, the zinc-dependent binding of purified Zur protein to double-stranded 40-mer oligonucleotides containing candidate Zur-binding sites was demonstrated in vitro by DNA band shift assays. Conclusion Whole-genome expression profiling and DNA band shift assays demonstrated that Zur directly represses in a zinc-dependent manner the expression of nine genes organized in five transcription units. Accordingly, the Zur (Cg2502) protein is the key transcription regulator for genes involved in zinc homeostasis in C. glutamicum. PMID:20055984

Evolution of UCP1 Transcriptional Regulatory Elements Across the Mammalian Phylogeny

PubMed Central

Gaudry, Michael J.; Campbell, Kevin L.

2017-01-01

Uncoupling protein 1 (UCP1) permits non-shivering thermogenesis (NST) when highly expressed in brown adipose tissue (BAT) mitochondria. Exclusive to placental mammals, BAT has commonly been regarded to be advantageous for thermoregulation in hibernators, small-bodied species, and the neonates of larger species. While numerous regulatory control motifs associated with UCP1 transcription have been proposed for murid rodents, it remains unclear whether these are conserved across the eutherian mammal phylogeny and hence essential for UCP1 expression. To address this shortcoming, we conducted a broad comparative survey of putative UCP1 transcriptional regulatory elements in 139 mammals (135 eutherians). We find no evidence for presence of a UCP1 enhancer in monotremes and marsupials, supporting the hypothesis that this control region evolved in a stem eutherian ancestor. We additionally reveal that several putative promoter elements (e.g., CRE-4, CCAAT) identified in murid rodents are not conserved among BAT-expressing eutherians, and together with the putative regulatory region (PRR) and CpG island do not appear to be crucial for UCP1 expression. The specificity and importance of the upTRE, dnTRE, URE1, CRE-2, RARE-2, NBRE, BRE-1, and BRE-2 enhancer elements first described from rats and mice are moreover uncertain as these motifs differ substantially—but generally remain highly conserved—in other BAT-expressing eutherians. Other UCP1 enhancer motifs (CRE-3, PPRE, and RARE-3) as well as the TATA box are also highly conserved in nearly all eutherian lineages with an intact UCP1. While these transcriptional regulatory motifs are generally also maintained in species where this gene is pseudogenized, the loss or degeneration of key basal promoter (e.g., TATA box) and enhancer elements in other UCP1-lacking lineages make it unlikely that the enhancer region is pleiotropic (i.e., co-regulates additional genes). Importantly, differential losses of (or mutations within) putative regulatory elements among the eutherian lineages with an intact UCP1 suggests that the transcriptional control of gene expression is not highly conserved in this mammalian clade. PMID:28979209

Enriching Genomic Resources and Marker Development from Transcript Sequences of Jatropha curcas for Microgravity Studies

PubMed Central

Tian, Wenlan; Paudel, Dev

2017-01-01

Jatropha (Jatropha curcas L.) is an economically important species with a great potential for biodiesel production. To enrich the jatropha genomic databases and resources for microgravity studies, we sequenced and annotated the transcriptome of jatropha and developed SSR and SNP markers from the transcriptome sequences. In total 1,714,433 raw reads with an average length of 441.2 nucleotides were generated. De novo assembling and clustering resulted in 115,611 uniquely assembled sequences (UASs) including 21,418 full-length cDNAs and 23,264 new jatropha transcript sequences. The whole set of UASs were fully annotated, out of which 59,903 (51.81%) were assigned with gene ontology (GO) term, 12,584 (10.88%) had orthologs in Eukaryotic Orthologous Groups (KOG), and 8,822 (7.63%) were mapped to 317 pathways in six different categories in Kyoto Encyclopedia of Genes and Genome (KEGG) database, and it contained 3,588 putative transcription factors. From the UASs, 9,798 SSRs were discovered with AG/CT as the most frequent (45.8%) SSR motif type. Further 38,693 SNPs were detected and 7,584 remained after filtering. This UAS set has enriched the current jatropha genomic databases and provided a large number of genetic markers, which can facilitate jatropha genetic improvement and many other genetic and biological studies. PMID:28154822

Transcriptome Analysis of Spartina pectinata in Response to Freezing Stress

PubMed Central

Nah, Gyoungju; Lee, Moonsub; Kim, Do-Soon; Rayburn, A. Lane; Voigt, Thomas; Lee, D. K.

2016-01-01

Prairie cordgrass (Spartina pectinata), a perennial C4 grass native to the North American prairie, has several distinctive characteristics that potentially make it a model crop for production in stressful environments. However, little is known about the transcriptome dynamics of prairie cordgrass despite its unique freezing stress tolerance. Therefore, the purpose of this work was to explore the transcriptome dynamics of prairie cordgrass in response to freezing stress at -5°C for 5 min and 30 min. We used a RNA-sequencing method to assemble the S. pectinata leaf transcriptome and performed gene-expression profiling of the transcripts under freezing treatment. Six differentially expressed gene (DEG) groups were categorized from the profiling. In addition, two major consecutive orders of gene expression were observed in response to freezing; the first being the acute up-regulation of genes involved in plasma membrane modification, calcium-mediated signaling, proteasome-related proteins, and transcription regulators (e.g., MYB and WRKY). The follow-up and second response was of genes involved in encoding the putative anti-freezing protein and the previously known DNA and cell-damage-repair proteins. Moreover, we identified the genes involved in epigenetic regulation and circadian-clock expression. Our results indicate that freezing response in S. pectinata reflects dynamic changes in rapid-time duration, as well as in metabolic, transcriptional, post-translational, and epigenetic regulation. PMID:27032112

Insight into the transcriptome of Arthrobotrys conoides using high throughput sequencing.

PubMed

Ramesh, Pandit; Reena, Patel; Amitbikram, Mohapatra; Chaitanya, Joshi; Anju, Kunjadia

2015-12-01

Arthrobotrys conoides is a nematode-trapping fungus belonging to Orbiliales, Ascomycota group, and traps prey nematodes by means of adhesive network. Fungus has a potential to be used as a biocontrol agent against plant parasitic nematodes. In the present study, we characterized the transcriptome of A. conoides using high-throughput sequencing technology and characterized its virulence unigenes. Total 7,255 cDNA contigs with an average length of 425 bp were generated and 6184 (61.81%) transcripts were functionally annotated and characterized. Majority of unigenes were found analogous to the genes of plant pathogenic fungi. A total of 1749 transcripts were found to be orthologous with eukaryotic proteins of KOG database. Several carbohydrate active enzymes and peptidases were identified. We also analyzed classically and nonclassically secreted proteins and confirmed by BLASTP against fungal secretome database. A total of 916 contigs were analogous to 556 unique proteins of Pathogen Host Interaction (PHI) database. Further, we identified 91 unigenes homologous to the database of fungal virulence factor (DFVF). A total of 104 putative protein kinases coding transcripts were identified by BLASTP against KinBase database, which are major players in signaling pathways. This study provides a comprehensive look at the transcriptome of A. conoides and the identified unigenes might have a role in catching and killing prey nematodes by A. conoides. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ascl1 as a Novel Player in the Ptf1a Transcriptional Network for GABAergic Cell Specification in the Retina

PubMed Central

Parlier, Damien; Pretto, Silvia; Hamdache, Johanna; Vernier, Philippe; Locker, Morgane; Bellefroid, Eric; Perron, Muriel

2014-01-01

In contrast with the wealth of data involving bHLH and homeodomain transcription factors in retinal cell type determination, the molecular bases underlying neurotransmitter subtype specification is far less understood. Using both gain and loss of function analyses in Xenopus, we investigated the putative implication of the bHLH factor Ascl1 in this process. We found that in addition to its previously characterized proneural function, Ascl1 also contributes to the specification of the GABAergic phenotype. We showed that it is necessary for retinal GABAergic cell genesis and sufficient in overexpression experiments to bias a subset of retinal precursor cells towards a GABAergic fate. We also analysed the relationships between Ascl1 and a set of other bHLH factors using an in vivo ectopic neurogenic assay. We demonstrated that Ascl1 has unique features as a GABAergic inducer and is epistatic over factors endowed with glutamatergic potentialities such as Neurog2, NeuroD1 or Atoh7. This functional specificity is conferred by the basic DNA binding domain of Ascl1 and involves a specific genetic network, distinct from that underlying its previously demonstrated effects on catecholaminergic differentiation. Our data show that GABAergic inducing activity of Ascl1 requires the direct transcriptional regulation of Ptf1a, providing therefore a new piece of the network governing neurotransmitter subtype specification during retinogenesis. PMID:24643195

Characterization by Suppression Subtractive Hybridization of Transcripts That Are Differentially Expressed in Leaves of Anthracnose-Resistant Ramie Cultivar.

PubMed

Xuxia, Wang; Jie, Chen; Bo, Wang; Lijun, Liu; Hui, Jiang; Diluo, Tang; Dingxiang, Peng

2012-01-01

For the purpose of screening putative anthracnose resistance-related genes of ramie ( Boehmeria nivea L. Gaud), a cDNA library was constructed by suppression subtractive hybridization using anthracnose-resistant cultivar Huazhu no. 4. The cDNAs from Huazhu no. 4, which were infected with Colletotrichum gloeosporioides , were used as the tester and cDNAs from uninfected Huazhu no. 4 as the driver. Sequencing analysis and homology searching showed that these clones represented 132 single genes, which were assigned to functional categories, including 14 putative cellular functions, according to categories established for Arabidopsis . These 132 genes included 35 disease resistance and stress tolerance-related genes including putative heat-shock protein 90, metallothionein, PR-1.2 protein, catalase gene, WRKY family genes, and proteinase inhibitor-like protein. Partial disease-related genes were further analyzed by reverse transcription PCR and RNA gel blot. These expressed sequence tags are the first anthracnose resistance-related expressed sequence tags reported in ramie.

The Role of the EGF Receptor First Intron in Its Regulation in Breast Canceer.

DTIC Science & Technology

1997-08-01

of EGFR, to malignantly transform mammary glands in transgenic mice (46). Future work could determine if these putative oncogene factor binding sites...general transcription factors, and the use or overuse of one promoter could monopolize the abundance of these transcription factors within a cell. The ideal

PlantTFDB: a comprehensive plant transcription factor database

PubMed Central

Guo, An-Yuan; Chen, Xin; Gao, Ge; Zhang, He; Zhu, Qi-Hui; Liu, Xiao-Chuan; Zhong, Ying-Fu; Gu, Xiaocheng; He, Kun; Luo, Jingchu

2008-01-01

Transcription factors (TFs) play key roles in controlling gene expression. Systematic identification and annotation of TFs, followed by construction of TF databases may serve as useful resources for studying the function and evolution of transcription factors. We developed a comprehensive plant transcription factor database PlantTFDB (http://planttfdb.cbi.pku.edu.cn), which contains 26 402 TFs predicted from 22 species, including five model organisms with available whole genome sequence and 17 plants with available EST sequences. To provide comprehensive information for those putative TFs, we made extensive annotation at both family and gene levels. A brief introduction and key references were presented for each family. Functional domain information and cross-references to various well-known public databases were available for each identified TF. In addition, we predicted putative orthologs of those TFs among the 22 species. PlantTFDB has a simple interface to allow users to search the database by IDs or free texts, to make sequence similarity search against TFs of all or individual species, and to download TF sequences for local analysis. PMID:17933783

Structural and functional analysis of myostatin-2 promoter alleles from the marine fish Sparus aurata: evidence for strong muscle-specific promoter activity and post-transcriptional regulation.

PubMed

Nadjar-Boger, Elisabeth; Hinits, Yaniv; Funkenstein, Bruria

2012-09-25

Myostatin (MSTN) is a negative regulator of skeletal muscle growth. In contrast to mammals, fish possess at least two paralogs of MSTN: MSTN-1 and MSTN-2. In this study, we analyzed the structural-functional features of the four variants of Sparus aurata MSTN-2 5'-flanking region: saMSTN-2a, saMSTN-2as, saMSTN-2b and saMSTN-2c. In silico analysis revealed numerous putative cis regulatory elements including several E-boxes known as binding sites to myogenic transcription factors. Transient transfection experiments using non-muscle and muscle cell lines showed surprisingly high transcriptional activity in muscle cells, suggesting the presence of regulatory elements unique to differentiated myotubes. These observations were confirmed by in situ intramuscular injections of promoter DNA followed by reporter gene assays. Moreover, high promoter activity was found in differentiated neural cell, in agreement with MSTN-2 expression in brain. Progressive 5'-deletion analysis, using reporter gene assays, showed that the core promoter is located within the first -127 bp upstream of the ATG, and suggested the presence of regulatory elements that either repress or induce transcriptional activity. Transient transgenic zebrafish provided evidence for saMSTN-2 promoter ability to direct GFP expression to myofibers. Finally, our data shows that although no mature saMSTN-2 mRNA is observed in muscle; unspliced forms accumulate, confirming high level of transcription. In conclusion, our study shows for the first time that MSTN-2 promoter is a very robust promoter, especially in muscle cells. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Down-regulation of aminopeptidase N and ABC transporter subfamily G transcripts in Cry1Ab and Cry1Ac resistant Asian corn borer, Ostrinia furnacalis (Lepidoptera: Crambidae)

PubMed Central

Zhang, Tiantao; Coates, Brad S.; Wang, Yueqin; Wang, Yidong; Bai, Shuxiong; Wang, Zhenying; He, Kanglai

2017-01-01

The Asian corn borer (ACB), Ostrinia furnacalis (Lepidoptera: Crambidae), is a highly destructive pest of cultivated maize throughout East Asia. Bacillus thuringiensis (Bt) crystalline protein (Cry) toxins cause mortality by a mechanism involving pore formation or signal transduction following toxin binding to receptors along the midgut lumen of susceptible insects, but this mechanism and mutations therein that lead to resistance are not fully understood. In the current study, quantitative comparisons were made among midgut expressed transcripts from O. furnacalis susceptible (ACB-BtS) and laboratory selected strains resistant to Cry1Ab (ACB-AbR) and Cry1Ac toxins (ACB-AcR) when feeding on non-Bt diet. From a combined de novo transcriptome assembly of 83,370 transcripts, ORFs of ≥ 100 amino acids were predicted and annotated for 28,940 unique isoforms derived from 12,288 transcripts. Transcriptome-wide expression estimated from RNA-seq read depths predicted significant down-regulation of transcripts for previously known Bt resistance genes, aminopeptidase N1 (apn1) and apn3, as well as a putative ATP binding cassette transporter group G (abcg) gene in both ACB-AbR and -AcR (log2[fold-change] ≥ 1.36; P < 0.0001). The transcripts that were most highly differentially regulated in both ACB-AbR and -AcR compared to ACB-BtS (log2[fold-change] ≥ 2.0; P < 0.0001) included up- and down-regulation of serine proteases, storage proteins and cytochrome P450 monooxygenases, as well as up-regulation of genes with predicted transport function. This study predicted the significant down-regulation of transcripts for previously known Bt resistance genes, aminopeptidase N1 (apn1) and apn3, as well as abccg gene in both ACB-AbR and -AcR. These data are important for the understanding of systemic differences between Bt resistant and susceptible genotypes. PMID:28808417

Maize LAZY1 Mediates Shoot Gravitropism and Inflorescence Development through Regulating Auxin Transport, Auxin Signaling, and Light Response1[C][W

PubMed Central

Dong, Zhaobin; Jiang, Chuan; Chen, Xiaoyang; Zhang, Tao; Ding, Lian; Song, Weibin; Luo, Hongbing; Lai, Jinsheng; Chen, Huabang; Liu, Renyi; Zhang, Xiaolan; Jin, Weiwei

2013-01-01

Auxin is a plant hormone that plays key roles in both shoot gravitropism and inflorescence development. However, these two processes appear to be parallel and to be regulated by distinct players. Here, we report that the maize (Zea mays) prostrate stem1 mutant, which is allelic to the classic mutant lazy plant1 (la1), displays prostrate growth with reduced shoot gravitropism and defective inflorescence development. Map-based cloning identified maize ZmLA1 as the functional ortholog of LAZY1 in rice (Oryza sativa) and Arabidopsis (Arabidopsis thaliana). It has a unique role in inflorescence development and displays enriched expression in reproductive organs such as tassels and ears. Transcription of ZmLA1 responds to auxin and is repressed by light. Furthermore, ZmLA1 physically interacts with a putative auxin transport regulator in the plasma membrane and a putative auxin signaling protein in the nucleus. RNA-SEQ data showed that dozens of auxin transport, auxin response, and light signaling genes were differentially expressed in la1 mutant stems. Therefore, ZmLA1 might mediate the cross talk between shoot gravitropism and inflorescence development by regulating auxin transport, auxin signaling, and probably light response in maize. PMID:24089437

Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

PubMed Central

2010-01-01

Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense.

PubMed

Tan, Yung-Chie; Yeoh, Keat-Ai; Wong, Mui-Yun; Ho, Chai-Ling

2013-11-01

Basal stem rot (BSR) is a major disease of oil palm caused by a pathogenic fungus, Ganoderma boninense. However, the interaction between the host plant and its pathogen is not well characterized. To better understand the response of oil palm to G. boninense, transcript profiles of eleven putative defence-related genes from oil palm were measured by quantitative reverse-transcription (qRT)-PCR in the roots of oil palms treated with G. boninense from 3 to 12 weeks post infection (wpi). These transcripts encode putative Bowman-Birk serine protease inhibitors (EgBBI1 and 2), defensin (EgDFS), dehydrin (EgDHN), early methionine-labeled polypeptides (EgEMLP1 and 2), glycine-rich RNA binding protein (EgGRRBP), isoflavone reductase (EgIFR), metallothionein-like protein (EgMT), pathogenesis-related-1 protein (EgPRP), and type 2 ribosome-inactivating protein (EgT2RIP). The transcript abundance of EgBBI2 increased in G. boninense-treated roots at 3 and 6wpi compared to those of controls; while the transcript abundance of EgBBI1, EgDFS, EgEMLP1, EgMT, and EgT2RIP increased in G. boninense-treated roots at 6 or 12wpi. Meanwhile, the gene expression of EgDHN was up-regulated at all three time points in G. boninense-treated roots. The expression profiles of the eleven transcripts were also studied in leaf samples upon inoculation of G. boninense and Trichoderma harzianum to identify potential biomarkers for early detection of BSR. Two candidate genes (EgEMLP1 and EgMT) that have different profiles in G. boninense-treated leaves compared to those infected by T. harzianum may have the potential to be developed as biomarkers for early detection of G. boninense infection. Copyright © 2013 Elsevier GmbH. All rights reserved.

Structure, Regulation, and Putative Function of the Arginine Deiminase System of Streptococcus suis

PubMed Central

Gruening, Petra; Fulde, Marcus; Valentin-Weigand, Peter; Goethe, Ralph

2006-01-01

Streptococcus suis is an important cause of infectious diseases in young pigs. Little is known about the virulence factors or protective antigens of S. suis. Recently, we have identified two proteins of the arginine deiminase system (ADS) of S. suis, which were temperature induced and expressed on the streptococcal surface (N. Winterhoff, R. Goethe, P. Gruening, M. Rohde, H. Kalisz, H. E. Smith, and P. Valentin-Weigand, J. Bacteriol. 184:6768-6776, 2002). In the present study, we analyzed the complete ADS of S. suis. Due to their homologies to the recently published S. gordonii ADS genes, the genes for arginine deiminase, ornithine carbamoyl-transferase, and carbamate kinase, which were previously designated adiS, octS, and ckS, respectively, were renamed arcA, arcB, and arcC, respectively. Our data revealed that arcA, arcB, and arcC of the S. suis ADS are transcribed from an operon (arcABC operon). Additionally, putative ADS-associated genes were cloned and sequenced which, however, did not belong to the arcABC operon. These were the flpS gene upstream of the arcABC operon with homology to the flp transcription regulator of S. gordonii and the arcD, arcT, arcH, and argR genes downstream of the arcABC operon with high homologies to a putative arginine-ornithine antiporter, a putative dipeptidase of S. gordonii, a putative β-N-acetylhexosaminidase of S. pneumoniae, and a putative arginine repressor of S. gordonii, respectively. The transcriptional start point of the arcABC operon was determined, and promoter analysis provided evidence that multiple factors contribute to the regulation of the ADS. Thus, a putative binding site for a transcription regulator of the Crp/Fnr family, an ArgR-binding site, and two cis-acting catabolite response elements were identified in the promoter-operator region of the operon. Consistent with this, we could demonstrate that the ADS of S. suis is inducible by arginine and reduced O2 tension and subject to carbon catabolite repression. Furthermore, comparing an arcA knockout mutant in which expression of the three operon-encoded proteins was abolished with the parental wild-type strain showed that the arcABC operon of S. suis contributes to survival under acidic conditions. PMID:16385025

Structure, regulation, and putative function of the arginine deiminase system of Streptococcus suis.

PubMed

Gruening, Petra; Fulde, Marcus; Valentin-Weigand, Peter; Goethe, Ralph

2006-01-01

Streptococcus suis is an important cause of infectious diseases in young pigs. Little is known about the virulence factors or protective antigens of S. suis. Recently, we have identified two proteins of the arginine deiminase system (ADS) of S. suis, which were temperature induced and expressed on the streptococcal surface (N. Winterhoff, R. Goethe, P. Gruening, M. Rohde, H. Kalisz, H. E. Smith, and P. Valentin-Weigand, J. Bacteriol. 184:6768-6776, 2002). In the present study, we analyzed the complete ADS of S. suis. Due to their homologies to the recently published S. gordonii ADS genes, the genes for arginine deiminase, ornithine carbamoyl-transferase, and carbamate kinase, which were previously designated adiS, octS, and ckS, respectively, were renamed arcA, arcB, and arcC, respectively. Our data revealed that arcA, arcB, and arcC of the S. suis ADS are transcribed from an operon (arcABC operon). Additionally, putative ADS-associated genes were cloned and sequenced which, however, did not belong to the arcABC operon. These were the flpS gene upstream of the arcABC operon with homology to the flp transcription regulator of S. gordonii and the arcD, arcT, arcH, and argR genes downstream of the arcABC operon with high homologies to a putative arginine-ornithine antiporter, a putative dipeptidase of S. gordonii, a putative beta-N-acetylhexosaminidase of S. pneumoniae, and a putative arginine repressor of S. gordonii, respectively. The transcriptional start point of the arcABC operon was determined, and promoter analysis provided evidence that multiple factors contribute to the regulation of the ADS. Thus, a putative binding site for a transcription regulator of the Crp/Fnr family, an ArgR-binding site, and two cis-acting catabolite response elements were identified in the promoter-operator region of the operon. Consistent with this, we could demonstrate that the ADS of S. suis is inducible by arginine and reduced O2 tension and subject to carbon catabolite repression. Furthermore, comparing an arcA knockout mutant in which expression of the three operon-encoded proteins was abolished with the parental wild-type strain showed that the arcABC operon of S. suis contributes to survival under acidic conditions.

Regulation of Seed Germination in the Close Arabidopsis Relative Lepidium sativum: A Global Tissue-Specific Transcript Analysis1[C][W][OA

PubMed Central

Morris, Karl; Linkies, Ada; Müller, Kerstin; Oracz, Krystyna; Wang, Xiaofeng; Lynn, James R.; Leubner-Metzger, Gerhard; Finch-Savage, William E.

2011-01-01

The completion of germination in Lepidium sativum and other endospermic seeds (e.g. Arabidopsis [Arabidopsis thaliana]) is regulated by two opposing forces, the growth potential of the radicle (RAD) and the resistance to this growth from the micropylar endosperm cap (CAP) surrounding it. We show by puncture force measurement that the CAP progressively weakens during germination, and we have conducted a time-course transcript analysis of RAD and CAP tissues throughout this process. We have also used specific inhibitors to investigate the importance of transcription, translation, and posttranslation levels of regulation of endosperm weakening in isolated CAPs. Although the impact of inhibiting translation is greater, both transcription and translation are required for the completion of endosperm weakening in the whole seed population. The majority of genes expressed during this process occur in both tissues, but where they are uniquely expressed, or significantly differentially expressed between tissues, this relates to the functions of the RAD as growing tissue and the CAP as a regulator of germination through weakening. More detailed analysis showed that putative orthologs of cell wall-remodeling genes are expressed in a complex manner during CAP weakening, suggesting distinct roles in the RAD and CAP. Expression patterns are also consistent with the CAP being a receptor for environmental signals influencing germination. Inhibitors of the aspartic, serine, and cysteine proteases reduced the number of isolated CAPs in which weakening developed, and inhibition of the 26S proteasome resulted in its complete cessation. This indicates that targeted protein degradation is a major control point for endosperm weakening. PMID:21321254

Unique diversity of the venom peptides from the scorpion Androctonus bicolor revealed by transcriptomic and proteomic analysis.

PubMed

Zhang, Lei; Shi, Wanxia; Zeng, Xian-Chun; Ge, Feng; Yang, Mingkun; Nie, Yao; Bao, Aorigele; Wu, Shifen; E, Guoji

2015-10-14

Androctonus bicolor is one of the most poisonous scorpion species in the world. However, little has been known about the venom composition of the scorpion. To better understand the molecular diversity and medical significance of the venom from the scorpion, we systematically analyzed the venom components by combining transcriptomic and proteomic surveys. Random sequencing of 1000 clones from a cDNA library prepared from the venom glands of the scorpion revealed that 70% of the total transcripts code for venom peptide precursors. Our efforts led to a discovery of 103 novel putative venom peptides. These peptides include NaTx-like, KTx-like and CaTx-like peptides, putative antimicrobial peptides, defensin-like peptides, BPP-like peptides, BmKa2-like peptides, Kunitz-type toxins and some new-type venom peptides without disulfide bridges, as well as many new-type venom peptides that are cross-linked with one, two, three, five or six disulfide bridges, respectively. We also identified three peptides that are identical to known toxins from scorpions. The venom was also analyzed using a proteomic technique. The presence of a total of 16 different venom peptides was confirmed by LC-MS/MS analysis. The discovery of a wide range of new and new-type venom peptides highlights the unique diversity of the venom peptides from A. bicolor. These data also provide a series of novel templates for the development of therapeutic drugs for treating ion channel-associated diseases and infections caused by antibiotic-resistant pathogens, and offer molecular probes for the exploration of structures and functions of various ion channels. Copyright © 2015 Elsevier B.V. All rights reserved.

The putative forkhead transcription factor FOXL2 is mutated in blepharophimosis/ptosis/epicanthus inversus syndrome.

PubMed

Crisponi, L; Deiana, M; Loi, A; Chiappe, F; Uda, M; Amati, P; Bisceglia, L; Zelante, L; Nagaraja, R; Porcu, S; Ristaldi, M S; Marzella, R; Rocchi, M; Nicolino, M; Lienhardt-Roussie, A; Nivelon, A; Verloes, A; Schlessinger, D; Gasparini, P; Bonneau, D; Cao, A; Pilia, G

2001-02-01

In type I blepharophimosis/ptosis/epicanthus inversus syndrome (BPES), eyelid abnormalities are associated with ovarian failure. Type II BPES shows only the eyelid defects, but both types map to chromosome 3q23. We have positionally cloned a novel, putative winged helix/forkhead transcription factor gene, FOXL2, that is mutated to produce truncated proteins in type I families and larger proteins in type II. Consistent with an involvement in those tissues, FOXL2 is selectively expressed in the mesenchyme of developing mouse eyelids and in adult ovarian follicles; in adult humans, it appears predominantly in the ovary. FOXL2 represents a candidate gene for the polled/intersex syndrome XX sex-reversal goat.

Chimeras taking shape: Potential functions of proteins encoded by chimeric RNA transcripts

PubMed Central

Frenkel-Morgenstern, Milana; Lacroix, Vincent; Ezkurdia, Iakes; Levin, Yishai; Gabashvili, Alexandra; Prilusky, Jaime; del Pozo, Angela; Tress, Michael; Johnson, Rory; Guigo, Roderic; Valencia, Alfonso

2012-01-01

Chimeric RNAs comprise exons from two or more different genes and have the potential to encode novel proteins that alter cellular phenotypes. To date, numerous putative chimeric transcripts have been identified among the ESTs isolated from several organisms and using high throughput RNA sequencing. The few corresponding protein products that have been characterized mostly result from chromosomal translocations and are associated with cancer. Here, we systematically establish that some of the putative chimeric transcripts are genuinely expressed in human cells. Using high throughput RNA sequencing, mass spectrometry experimental data, and functional annotation, we studied 7424 putative human chimeric RNAs. We confirmed the expression of 175 chimeric RNAs in 16 human tissues, with an abundance varying from 0.06 to 17 RPKM (Reads Per Kilobase per Million mapped reads). We show that these chimeric RNAs are significantly more tissue-specific than non-chimeric transcripts. Moreover, we present evidence that chimeras tend to incorporate highly expressed genes. Despite the low expression level of most chimeric RNAs, we show that 12 novel chimeras are translated into proteins detectable in multiple shotgun mass spectrometry experiments. Furthermore, we confirm the expression of three novel chimeric proteins using targeted mass spectrometry. Finally, based on our functional annotation of exon organization and preserved domains, we discuss the potential features of chimeric proteins with illustrative examples and suggest that chimeras significantly exploit signal peptides and transmembrane domains, which can alter the cellular localization of cognate proteins. Taken together, these findings establish that some chimeric RNAs are translated into potentially functional proteins in humans. PMID:22588898

A Deeper Examination of Thorellius atrox Scorpion Venom Components with Omic Techonologies.

PubMed

Romero-Gutierrez, Teresa; Peguero-Sanchez, Esteban; Cevallos, Miguel A; Batista, Cesar V F; Ortiz, Ernesto; Possani, Lourival D

2017-12-12

This communication reports a further examination of venom gland transcripts and venom composition of the Mexican scorpion Thorellius atrox using RNA-seq and tandem mass spectrometry. The RNA-seq, which was performed with the Illumina protocol, yielded more than 20,000 assembled transcripts. Following a database search and annotation strategy, 160 transcripts were identified, potentially coding for venom components. A novel sequence was identified that potentially codes for a peptide with similarity to spider ω-agatoxins, which act on voltage-gated calcium channels, not known before to exist in scorpion venoms. Analogous transcripts were found in other scorpion species. They could represent members of a new scorpion toxin family, here named omegascorpins. The mass fingerprint by LC-MS identified 135 individual venom components, five of which matched with the theoretical masses of putative peptides translated from the transcriptome. The LC-MS/MS de novo sequencing allowed to reconstruct and identify 42 proteins encoded by assembled transcripts, thus validating the transcriptome analysis. Earlier studies conducted with this scorpion venom permitted the identification of only twenty putative venom components. The present work performed with more powerful and modern omic technologies demonstrates the capacity of accomplishing a deeper characterization of scorpion venom components and the identification of novel molecules with potential applications in biomedicine and the study of ion channel physiology.

De novo transcriptome sequence assembly and identification of AP2/ERF transcription factor related to abiotic stress in parsley (Petroselinum crispum).

PubMed

Li, Meng-Yao; Tan, Hua-Wei; Wang, Feng; Jiang, Qian; Xu, Zhi-Sheng; Tian, Chang; Xiong, Ai-Sheng

2014-01-01

Parsley is an important biennial Apiaceae species that is widely cultivated as herb, spice, and vegetable. Previous studies on parsley principally focused on its physiological and biochemical properties, including phenolic compound and volatile oil contents. However, little is known about the molecular and genetic properties of parsley. In this study, 23,686,707 high-quality reads were obtained and assembled into 81,852 transcripts and 50,161 unigenes for the first time. Functional annotation showed that 30,516 unigenes had sequence similarity to known genes. In addition, 3,244 putative simple sequence repeats were detected in curly parsley. Finally, 1,569 of the identified unigenes belonged to 58 transcription factor families. Various abiotic stresses have a strong detrimental effect on the yield and quality of parsley. AP2/ERF transcription factors have important functions in plant development, hormonal regulation, and abiotic response. A total of 88 putative AP2/ERF factors were identified from the transcriptome sequence of parsley. Seven AP2/ERF transcription factors were selected in this study to analyze the expression profiles of parsley under different abiotic stresses. Our data provide a potentially valuable resource that can be used for intensive parsley research.

De Novo Transcriptome Sequence Assembly and Identification of AP2/ERF Transcription Factor Related to Abiotic Stress in Parsley (Petroselinum crispum)

PubMed Central

Wang, Feng; Jiang, Qian; Xu, Zhi-Sheng; Tian, Chang; Xiong, Ai-Sheng

2014-01-01

Parsley is an important biennial Apiaceae species that is widely cultivated as herb, spice, and vegetable. Previous studies on parsley principally focused on its physiological and biochemical properties, including phenolic compound and volatile oil contents. However, little is known about the molecular and genetic properties of parsley. In this study, 23,686,707 high-quality reads were obtained and assembled into 81,852 transcripts and 50,161 unigenes for the first time. Functional annotation showed that 30,516 unigenes had sequence similarity to known genes. In addition, 3,244 putative simple sequence repeats were detected in curly parsley. Finally, 1,569 of the identified unigenes belonged to 58 transcription factor families. Various abiotic stresses have a strong detrimental effect on the yield and quality of parsley. AP2/ERF transcription factors have important functions in plant development, hormonal regulation, and abiotic response. A total of 88 putative AP2/ERF factors were identified from the transcriptome sequence of parsley. Seven AP2/ERF transcription factors were selected in this study to analyze the expression profiles of parsley under different abiotic stresses. Our data provide a potentially valuable resource that can be used for intensive parsley research. PMID:25268141

Unique Transcriptional Profile of Sustained Ligand-Activated Preconditioning in Pre- and Post-Ischemic Myocardium

PubMed Central

Ashton, Kevin J.; Tupicoff, Amanda; Williams-Pritchard, Grant; Kiessling, Can J.; See Hoe, Louise E.; Headrick, John P.; Peart, Jason N.

2013-01-01

Background Opioidergic SLP (sustained ligand-activated preconditioning) induced by 3–5 days of opioid receptor (OR) agonism induces persistent protection against ischemia-reperfusion (I-R) injury in young and aged hearts, and is mechanistically distinct from conventional preconditioning responses. We thus applied unbiased gene-array interrogation to identify molecular effects of SLP in pre- and post-ischemic myocardium. Methodology/Principal Findings Male C57Bl/6 mice were implanted with 75 mg morphine or placebo pellets for 5 days. Resultant SLP did not modify cardiac function, and markedly reduced dysfunction and injury in perfused hearts subjected to 25 min ischemia/45 min reperfusion. Microarray analysis identified 14 up- and 86 down-regulated genes in normoxic hearts from SLP mice (≥1.3-fold change, FDR≤5%). Induced genes encoded sarcomeric/contractile proteins (Myh7, Mybpc3,Myom2,Des), natriuretic peptides (Nppa,Nppb) and stress-signaling elements (Csda,Ptgds). Highly repressed genes primarily encoded chemokines (Ccl2,Ccl4,Ccl7,Ccl9,Ccl13,Ccl3l3,Cxcl3), cytokines (Il1b,Il6,Tnf) and other proteins involved in inflammation/immunity (C3,Cd74,Cd83, Cd86,Hla-dbq1,Hla-drb1,Saa1,Selp,Serpina3), together with endoplasmic stress proteins (known: Dnajb1,Herpud1,Socs3; putative: Il6, Gadd45g,Rcan1) and transcriptional controllers (Egr2,Egr3, Fos,Hmox1,Nfkbid). Biological themes modified thus related to inflammation/immunity, together with cellular/cardiovascular movement and development. SLP also modified the transcriptional response to I-R (46 genes uniquely altered post-ischemia), which may influence later infarction/remodeling. This included up-regulated determinants of cellular resistance to oxidant (Mgst3,Gstm1,Gstm2) and other forms of stress (Xirp1,Ankrd1,Clu), and repression of stress-response genes (Hspa1a,Hspd1,Hsp90aa,Hsph1,Serpinh1) and Txnip. Conclusions Protection via SLP is associated with transcriptional repression of inflammation/immunity, up-regulation of sarcomeric elements and natriuretic peptides, and modulation of cell stress, growth and development, while conventional protective molecules are unaltered. PMID:23991079

Retrotransposon long interspersed nucleotide element-1 (LINE-1) is activated during salamander limb regeneration

PubMed Central

Zhu, Wei; Kuo, Dwight; Nathanson, Jason; Satoh, Akira; Pao, Gerald M.; Yeo, Gene W.; Bryant, Susan V.; Voss, S. Randal; Gardiner, David M.; Hunter, Tony

2012-01-01

Salamanders possess an extraordinary capacity for tissue and organ regeneration when compared to mammals. In our effort to characterize the unique transcriptional fingerprint emerging during the early phase of salamander limb regeneration, we identified transcriptional activation of some germline-specific genes within the Mexican axolotl (Ambystoma mexicanum) that is indicative of cellular reprogramming of differentiated cells into a germline-like state. In this work, we focus on one of these genes, the long interspersed nucleotide element-1 (LINE-1) retrotransposon, which is usually active in germ cells and silent in most of the somatic tissues in other organisms. LINE-1 was found to be dramatically upregulated during regeneration. In addition, higher genomic LINE-1 content was also detected in the limb regenerate when compared to that before amputation indicating that LINE-1 retrotransposition is indeed active during regeneration. Active LINE-1 retrotransposition has been suggested to have a potentially deleterious impact on genomic integrity. Silencing of activated LINE-1 by small RNAs has been reported to be part of the machinery aiming to maintain genomic integrity. Indeed, we were able to identify putative LINE-1-related piRNAs in the limb blastema. Transposable element-related piRNAs have been identified frequently in the germline in other organisms. Thus, we present here a scenario in which a unique germline-like state is established during axolotl limb regeneration, and the re-activation of LINE-1 may serve as a marker for cellular dedifferentiation in the early-stage of limb regeneration. PMID:22913491

Complexities of gene expression patterns in natural populations of an extremophile fish (Poecilia mexicana, Poeciliidae)

PubMed Central

Passow, Courtney N.; Brown, Anthony P.; Arias-Rodriguez, Lenin; Yee, Muh-Ching; Sockell, Alexandra; Schartl, Manfred; Warren, Wesley C.; Bustamante, Carlos; Kelley, Joanna L.; Tobler, Michael

2017-01-01

Variation in gene expression can provide insights into organismal responses to environmental stress and physiological mechanisms mediating adaptation to habitats with contrasting environmental conditions. We performed an RNA-sequencing experiment to quantify gene expression patterns in fish adapted to habitats with different combinations of environmental stressors, including the presence of toxic hydrogen sulphide (H2S) and the absence of light in caves. We specifically asked how gene expression varies among populations living in different habitats, whether population differences were consistent among organs, and whether there is evidence for shared expression responses in populations exposed to the same stressors. We analysed organ-specific transcriptome-wide data from four ecotypes of Poecilia mexicana (nonsulphidic surface, sulphidic surface, nonsulphidic cave and sulphidic cave). The majority of variation in gene expression was correlated with organ type, and the presence of specific environmental stressors elicited unique expression differences among organs. Shared patterns of gene expression between populations exposed to the same environmental stressors increased with levels of organismal organization (from transcript to gene to physiological pathway). In addition, shared patterns of gene expression were more common between populations from sulphidic than populations from cave habitats, potentially indicating that physiochemical stressors with clear biochemical consequences can constrain the diversity of adaptive solutions that mitigate their adverse effects. Overall, our analyses provided insights into transcriptional variation in a unique system, in which adaptation to H2S and darkness coincide. Functional annotations of differentially expressed genes provide a springboard for investigating physiological mechanisms putatively underlying adaptation to extreme environments. PMID:28598519

Generation and analysis of expression sequence tags from haustoria of the wheat stripe rust fungus Puccinia striiformis f. sp. Tritici

PubMed Central

2009-01-01

Background Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most destructive diseases of wheat (Triticum aestivum L.) worldwide. In spite of its agricultural importance, the genomics and genetics of the pathogen are poorly characterized. Pst transcripts from urediniospores and germinated urediniospores have been examined previously, but little is known about genes expressed during host infection. Some genes involved in virulence in other rust fungi have been found to be specifically expressed in haustoria. Therefore, the objective of this study was to generate a cDNA library to characterize genes expressed in haustoria of Pst. Results A total of 5,126 EST sequences of high quality were generated from haustoria of Pst, from which 287 contigs and 847 singletons were derived. Approximately 10% and 26% of the 1,134 unique sequences were homologous to proteins with known functions and hypothetical proteins, respectively. The remaining 64% of the unique sequences had no significant similarities in GenBank. Fifteen genes were predicted to be proteins secreted from Pst haustoria. Analysis of ten genes, including six secreted protein genes, using quantitative RT-PCR revealed changes in transcript levels in different developmental and infection stages of the pathogen. Conclusions The haustorial cDNA library was useful in identifying genes of the stripe rust fungus expressed during the infection process. From the library, we identified 15 genes encoding putative secreted proteins and six genes induced during the infection process. These genes are candidates for further studies to determine their functions in wheat-Pst interactions. PMID:20028560

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

PubMed

Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

2009-11-25

To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the validated markers were associated with rainbow trout transcripts. The use of reduced representation libraries and pyrosequencing technology proved to be an effective strategy for the discovery of a high number of putative SNPs in rainbow trout; however, modifications to the technique to decrease the false discovery rate resulting from the evolutionary recent genome duplication would be desirable.

A MADS box protein interacts with a mating-type protein and is required for fruiting body development in the homothallic ascomycete Sordaria macrospora.

PubMed

Nolting, Nicole; Pöggeler, Stefanie

2006-07-01

MADS box transcription factors control diverse developmental processes in plants, metazoans, and fungi. To analyze the involvement of MADS box proteins in fruiting body development of filamentous ascomycetes, we isolated the mcm1 gene from the homothallic ascomycete Sordaria macrospora, which encodes a putative homologue of the Saccharomyces cerevisiae MADS box protein Mcm1p. Deletion of the S. macrospora mcm1 gene resulted in reduced biomass, increased hyphal branching, and reduced hyphal compartment length during vegetative growth. Furthermore, the S. macrospora Deltamcm1 strain was unable to produce fruiting bodies or ascospores during sexual development. A yeast two-hybrid analysis in conjugation with in vitro analyses demonstrated that the S. macrospora MCM1 protein can interact with the putative transcription factor SMTA-1, encoded by the S. macrospora mating-type locus. These results suggest that the S. macrospora MCM1 protein is involved in the transcriptional regulation of mating-type-specific genes as well as in fruiting body development.

Development of an oligo DNA microarray for the European sea bass and its application to expression profiling of jaw deformity

PubMed Central

2010-01-01

Background The European sea bass (Dicentrarchus labrax) is a marine fish of great importance for fisheries and aquaculture. Functional genomics offers the possibility to discover the molecular mechanisms underlying productive traits in farmed fish, and a step towards the application of marker assisted selection methods in this species. To this end, we report here on the development of an oligo DNA microarray for D. labrax. Results A database consisting of 19,048 unique transcripts was constructed, of which 12,008 (63%) could be annotated by similarity and 4,692 received a GO functional annotation. Two non-overlapping 60mer probes were designed for each unique transcript and in-situ synthesized on glass slides using Agilent SurePrint™ technology. Probe design was positively completed for 19,035 target clusters; the oligo microarray was then applied to profile gene expression in mandibles and whole-heads of fish affected by prognathism, a skeletal malformation that strongly affects sea bass production. Statistical analysis identified 242 transcripts that are significantly down-regulated in deformed individuals compared to normal fish, with a significant enrichment in genes related to nervous system development and functioning. A set of genes spanning a wide dynamic range in gene expression level were selected for quantitative RT-PCR validation. Fold change correlation between microarray and qPCR data was always significant. Conclusions The microarray platform developed for the European sea bass has a high level of flexibility, reliability, and reproducibility. Despite the well known limitations in achieving a proper functional annotation in non-model species, sufficient information was obtained to identify biological processes that are significantly enriched among differentially expressed genes. New insights were obtained on putative mechanisms involved on mandibular prognathism, suggesting that bone/nervous system development might play a role in this phenomenon. PMID:20525278

Elucidation of terpenoid metabolism in Scoparia dulcis by RNA-seq analysis.

PubMed

Yamamura, Yoshimi; Kurosaki, Fumiya; Lee, Jung-Bum

2017-03-07

Scoparia dulcis biosynthesize bioactive diterpenes, such as scopadulcic acid B (SDB), which are known for their unique molecular skeleton. Although the biosynthesis of bioactive diterpenes is catalyzed by a sequence of class II and class I diterpene synthases (diTPSs), the mechanisms underlying this process are yet to be fully identified. To elucidate these biosynthetic machinery, we performed a high-throughput RNA-seq analysis, and de novo assembly of clean reads revealed 46,332 unique transcripts and 40,503 two unigenes. We found diTPSs genes including a putative syn-copalyl diphosphate synthase (SdCPS2) and two kaurene synthase-like (SdKSLs) genes. Besides them, total 79 full-length of cytochrome P450 (CYP450) genes were also discovered. The expression analyses showed selected CYP450s associated with their expression pattern of SdCPS2 and SdKSL1, suggesting that CYP450 candidates involved diterpene modification. SdCPS2 represents the first predicted gene to produce syn-copalyl diphosphate in dicots. In addition, SdKSL1 potentially contributes to the SDB biosynthetic pathway. Therefore, these identified genes associated with diterpene biosynthesis lead to the development of genetic engineering focus on diterpene metabolism in S. dulcis.

Elucidation of terpenoid metabolism in Scoparia dulcis by RNA-seq analysis

PubMed Central

Yamamura, Yoshimi; Kurosaki, Fumiya; Lee, Jung-Bum

2017-01-01

Scoparia dulcis biosynthesize bioactive diterpenes, such as scopadulcic acid B (SDB), which are known for their unique molecular skeleton. Although the biosynthesis of bioactive diterpenes is catalyzed by a sequence of class II and class I diterpene synthases (diTPSs), the mechanisms underlying this process are yet to be fully identified. To elucidate these biosynthetic machinery, we performed a high-throughput RNA-seq analysis, and de novo assembly of clean reads revealed 46,332 unique transcripts and 40,503 two unigenes. We found diTPSs genes including a putative syn-copalyl diphosphate synthase (SdCPS2) and two kaurene synthase-like (SdKSLs) genes. Besides them, total 79 full-length of cytochrome P450 (CYP450) genes were also discovered. The expression analyses showed selected CYP450s associated with their expression pattern of SdCPS2 and SdKSL1, suggesting that CYP450 candidates involved diterpene modification. SdCPS2 represents the first predicted gene to produce syn-copalyl diphosphate in dicots. In addition, SdKSL1 potentially contributes to the SDB biosynthetic pathway. Therefore, these identified genes associated with diterpene biosynthesis lead to the development of genetic engineering focus on diterpene metabolism in S. dulcis. PMID:28266568

Identification of InuR, a new Zn(II)2Cys6 transcriptional activator involved in the regulation of inulinolytic genes in Aspergillus niger.

PubMed

Yuan, Xiao-Lian; Roubos, Johannes A; van den Hondel, Cees A M J J; Ram, Arthur F J

2008-01-01

The expression of inulinolytic genes in Aspergillus niger is co-regulated and induced by inulin and sucrose. We have identified a positive acting transcription factor InuR, which is required for the induced expression of inulinolytic genes. InuR is a member of the fungal specific class of transcription factors of the Zn(II)2Cys6 type. Involvement of InuR in inulin and sucrose metabolism was suspected because of the clustering of inuR gene with sucB, which encodes an intracellular invertase with transfructosylation activity and a putative sugar transporter encoding gene (An15g00310). Deletion of the inuR gene resulted in a strain displaying a severe reduction in growth on inulin and sucrose medium. Northern analysis revealed that expression of inulinolytic and sucrolytic genes, e.g., inuE, inuA, sucA, as well as the putative sugar transporter gene (An15g00310) is dependent on InuR. Genome-wide expression analysis revealed, three additional putative sugar transporters encoding genes (An15g04060, An15g03940 and An17g01710), which were strongly induced by sucrose in an InuR dependent way. In silico analysis of the promoter sequences of strongly InuR regulated genes suggests that InuR might bind as dimer to two CGG triplets, which are separated by eight nucleotides.

Expression profiles of defence related cDNAs in oil palm (Elaeis guineensis Jacq.) inoculated with mycorrhizae and Trichoderma harzianum Rifai T32.

PubMed

Tan, Yung-Chie; Wong, Mui-Yun; Ho, Chai-Ling

2015-11-01

Basal stem rot is one of the major diseases of oil palm (Elaies guineensis Jacq.) caused by pathogenic Ganoderma species. Trichoderma and mycorrhizae were proposed to be able to reduce the disease severity. However, their roles in improving oil palm defence system by possibly inducing defence-related genes in the host are not well characterized. To better understand that, transcript profiles of eleven putative defence-related cDNAs in the roots of oil palm inoculated with Trichoderma harzianum T32 and mycorrhizae at different time points were studied. Transcripts encoding putative Bowman-Birk protease inhibitor (EgBBI2) and defensin (EgDFS) increased more than 2 fold in mycorrhizae-treated roots at 6 weeks post inoculation (wpi) compared to those in controls. Transcripts encoding putative dehydrin (EgDHN), glycine-rich RNA binding protein (EgGRRBP), isoflavone reductase (EgIFR), type 2 ribosome inactivating protein (EgT2RIP), and EgDFS increased in the oil palm roots treated with T. harzianum at 6 and/or 12 wpi compared to those in the controls. Some of these genes were also expressed in oil palm roots treated with Ganoderma boninense. This study provides an insight of some defence-related genes induced by Trichoderma and mycorrhizae, and their roles as potential agents to boost the plant defence system. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Transcriptome Analysis of Scrippsiella trochoidea CCMP 3099 Reveals Physiological Changes Related to Nitrate Depletion

PubMed Central

Cooper, Joshua T.; Sinclair, Geoffrey A.; Wawrik, Boris

2016-01-01

Dinoflagellates are a major component of marine phytoplankton and many species are recognized for their ability to produce harmful algal blooms (HABs). Scrippsiella trochoidea is a non-toxic, marine dinoflagellate that can be found in both cold and tropic waters where it is known to produce “red tide” events. Little is known about the genomic makeup of S. trochoidea and a transcriptome study was conducted to shed light on the biochemical and physiological adaptations related to nutrient depletion. Cultures were grown under N and P limiting conditions and transcriptomes were generated via RNAseq technology. De novo assembly reconstructed 107,415 putative transcripts of which only 41% could be annotated. No significant transcriptomic response was observed in response to initial P depletion, however, a strong transcriptional response to N depletion was detected. Among the down-regulated pathways were those for glutamine/glutamate metabolism as well as urea and nitrate/nitrite transporters. Transcripts for ammonia transporters displayed both up- and down-regulation, perhaps related to a shift to higher affinity transporters. Genes for the utilization of DON compounds were up-regulated. These included transcripts for amino acids transporters, polyamine oxidase, and extracellular proteinase and peptidases. N depletion also triggered down regulation of transcripts related to the production of Photosystems I & II and related proteins. These data are consistent with a metabolic strategy that conserves N while maximizing sustained metabolism by emphasizing the relative contribution of organic N sources. Surprisingly, the transcriptome also contained transcripts potentially related to secondary metabolite production, including a homolog to the Short Isoform Saxitoxin gene (sxtA) from Alexandrium fundyense, which was significantly up-regulated under N-depletion. A total of 113 unique hits to Sxt genes, covering 17 of the 34 genes found in C. raciborskii were detected, indicating that S. trochoidea has previously unrecognized potential for the production of secondary metabolites with potential toxicity. PMID:27242681

Structure and transcriptional impact of divergent repetitive elements inserted within Phanerochaete chrysosporium strain RP-78 genes

Treesearch

Luis F. Larrondo; Paulo Canessa; Rafael Vicuna; Philip Stewart; Amber Vanden Wymelenberg; Dan Cullen

2007-01-01

We describe the structure, organization, and transcriptional impact of repetitive elements within the lignin-degrading basidiomycete, Phanerochaete chrysosporium. Searches of the P. chrysosporium genome revealed five copies of pce1, a 1,750-nt non-autonomous, class II element. Alleles encoding a putative glucosyltransferase and a cytochrome P450 harbor pce insertions...

The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

PubMed Central

Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

2010-01-01

The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.

PubMed

Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki

2014-07-01

Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.

Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum

PubMed Central

2012-01-01

Background The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Results Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. Conclusions The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly shutdown the SigH-dependent stress response after the cells have overcome the stress condition. Here we propose a model of the regulation of oxidative and heat stress response including redox homeostasis by SigH, RshA and the thioredoxin system. PMID:22943411

Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum.

PubMed

Busche, Tobias; Silar, Radoslav; Pičmanová, Martina; Pátek, Miroslav; Kalinowski, Jörn

2012-09-03

The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion strain was constructed and used for genome-wide transcription profiling with DNA microarrays. In total, 83 genes organized in 61 putative transcriptional units, including those previously detected using sigH mutant strains, exhibited increased transcript levels in the rshA deletion mutant compared to its parental strain. The genes encoding proteins related to disulphide stress response, heat stress proteins, components of the SOS-response to DNA damage and proteasome components were the most markedly upregulated gene groups. Altogether six SigH-dependent promoters upstream of the identified genes were determined by primer extension and a refined consensus promoter consisting of 45 original promoter sequences was constructed. The rshA gene codes for an anti-sigma factor controlling the function of the stress-responsive sigma factor SigH in C. glutamicum. Transcription of rshA from a SigH-dependent promoter may serve to quickly shutdown the SigH-dependent stress response after the cells have overcome the stress condition. Here we propose a model of the regulation of oxidative and heat stress response including redox homeostasis by SigH, RshA and the thioredoxin system.

Can the 'neuron theory' be complemented by a universal mechanism for generic neuronal differentiation.

PubMed

Ernsberger, Uwe

2015-01-01

With the establishment of the 'neuron theory' at the turn of the twentieth century, this remarkably powerful term was introduced to name a breathtaking diversity of cells unified by a characteristic structural compartmentalization and unique information processing and propagating features. At the beginning of the twenty-first century, developmental, stem cell and reprogramming studies converged to suggest a common mechanism involved in the generation of possibly all vertebrate, and at least a significant number of invertebrate, neurons. Sox and, in particular, SoxB and SoxC proteins as well as basic helix-loop-helix proteins play major roles, even though their precise contributions to progenitor programming, proliferation and differentiation are not fully resolved. In addition to neuronal development, these transcription factors also regulate sensory receptor and endocrine cell development, thus specifying a range of cells with regulatory and communicative functions. To what extent microRNAs contribute to the diversification of these cell types is an upcoming question. Understanding the transcriptional and post-transcriptional regulation of genes coding for cell type-specific cytoskeletal and motor proteins as well as synaptic and ion channel proteins, which mark differences but also similarities between the three communicator cell types, will provide a key to the comprehension of their diversification and the signature of 'generic neuronal' differentiation. Apart from the general scientific significance of a putative universal core instruction for neuronal development, the impact of this line of research for cell replacement therapy and brain tumor treatment will be of considerable interest.

Modeling Truncated AR Expression in a Natural Androgen Responsive Environment and Identification of RHOB as a Direct Transcriptional Target

PubMed Central

Tsai, Hui-Chi; Boucher, David L.; Martinez, Anthony; Tepper, Clifford G.; Kung, Hsing-Jien

2012-01-01

Recent studies identifying putative truncated androgen receptor isoforms with ligand-independent activity have shed new light on the acquisition of androgen depletion independent (ADI) growth of prostate cancer. In this study, we present a model system in which a C-terminally truncated variant of androgen receptor (TC-AR) is inducibly expressed in LNCaP, an androgen-dependent cell line, which expresses little truncated receptor. We observed that when TC-AR is overexpressed, the endogenous full length receptor (FL-AR) is transcriptionally downmodulated. This in essence allows us to “replace” FL-AR with TC-AR and compare their individual properties in exactly the same genetic and cellular background, which has not been performed before. We show that the TC-AR translocates to the nucleus, activates transcription of AR target genes in the absence of DHT and is sufficient to confer ADI growth to the normally androgen dependent LNCaP line. We also show that while there is significant overlap in the genes regulated by FL- and TC-AR there are also differences in the respective suites of target genes with each AR form regulating genes that the other does not. Among the genes uniquely activated by TC-AR is RHOB which is shown to be involved in the increased migration and morphological changes observed in LN/TC-AR, suggesting a role of RHOB in the regulation of androgen-independent behavior of prostate cancer cells. PMID:23209612

Cellular homeoproteins, SATB1 and CDP, bind to the unique region between the human cytomegalovirus UL127 and major immediate-early genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee Jialing; Klase, Zachary; Gao Xiaoqi

An AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (MIE) enhancer is referred to as the unique region (UR). It has been shown that the UR represses activation of transcription from the UL127 promoter and functions as a boundary between the divergent UL127 and MIE genes during human CMV infection [Angulo, A., Kerry, D., Huang, H., Borst, E.M., Razinsky, A., Wu, J., Hobom, U., Messerle, M., Ghazal, P., 2000. Identification of a boundary domain adjacent to the potent human cytomegalovirus enhancer that represses transcription of the divergent UL127 promoter. J.more » Virol. 74 (6), 2826-2839; Lundquist, C.A., Meier, J.L., Stinski, M.F., 1999. A strong negative transcriptional regulatory region between the human cytomegalovirus UL127 gene and the major immediate-early enhancer. J. Virol. 73 (11), 9039-9052]. A putative forkhead box-like (FOX-like) site, AAATCAATATT, was identified in the UR and found to play a key role in repression of the UL127 promoter in recombinant virus-infected cells [Lashmit, P.E., Lundquist, C.A., Meier, J.L., Stinski, M.F., 2004. Cellular repressor inhibits human cytomegalovirus transcription from the UL127 promoter. J. Virol. 78 (10), 5113-5123]. However, the cellular factors which associate with the UR and FOX-like region remain to be determined. We reported previously that pancreatic-duodenal homeobox factor-1 (PDX1) bound to a 45-bp element located within the UR [Chao, S.H., Harada, J.N., Hyndman, F., Gao, X., Nelson, C.G., Chanda, S.K., Caldwell, J.S., 2004. PDX1, a Cellular Homeoprotein, Binds to and Regulates the Activity of Human Cytomegalovirus Immediate Early Promoter. J. Biol. Chem. 279 (16), 16111-16120]. Here we demonstrate that two additional cellular homeoproteins, special AT-rich sequence binding protein 1 (SATB1) and CCAAT displacement protein (CDP), bind to the human CMV UR in vitro and in vivo. Furthermore, CDP is identified as a FOX-like binding protein and a repressor of the UL127 promoter, while SATB1 has no effect on UL127 expression. Since CDP is known as a transcription repressor and a nuclear matrix-associated region binding protein, CDP may have a role in the regulation of human CMV transcription.« less

Identification of Putative Precursor Genes for the Biosynthesis of Cannabinoid-Like Compound in Radula marginata

PubMed Central

Hussain, Tajammul; Plunkett, Blue; Ejaz, Mahwish; Espley, Richard V.; Kayser, Oliver

2018-01-01

The liverwort Radula marginata belongs to the bryophyte division of land plants and is a prospective alternate source of cannabinoid-like compounds. However, mechanistic insights into the molecular pathways directing the synthesis of these cannabinoid-like compounds have been hindered due to the lack of genetic information. This prompted us to do deep sequencing, de novo assembly and annotation of R. marginata transcriptome, which resulted in the identification and validation of the genes for cannabinoid biosynthetic pathway. In total, we have identified 11,421 putative genes encoding 1,554 enzymes from 145 biosynthetic pathways. Interestingly, we have identified all the upstream genes of the central precursor of cannabinoid biosynthesis, cannabigerolic acid (CBGA), including its two first intermediates, stilbene acid (SA) and geranyl diphosphate (GPP). Expression of all these genes was validated using quantitative real-time PCR. We have characterized the protein structure of stilbene synthase (STS), which is considered as a homolog of olivetolic acid in R. marginata. Moreover, the metabolomics approach enabled us to identify CBGA-analogous compounds using electrospray ionization mass spectrometry (ESI-MS/MS) and gas chromatography mass spectrometry (GC-MS). Transcriptomic analysis revealed 1085 transcription factors (TF) from 39 families. Comparative analysis showed that six TF families have been uniquely predicted in R. marginata. In addition, the bioinformatics analysis predicted a large number of simple sequence repeats (SSRs) and non-coding RNAs (ncRNAs). Our results collectively provide mechanistic insights into the putative precursor genes for the biosynthesis of cannabinoid-like compounds and a novel transcriptomic resource for R. marginata. The large-scale transcriptomic resource generated in this study would further serve as a reference transcriptome to explore the Radulaceae family.

Identification and analysis of pig chimeric mRNAs using RNA sequencing data

PubMed Central

2012-01-01

Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

Transcriptional and posttranscriptional regulation of the glycolate oxidase gene in tobacco seedlings.

PubMed

Barak, S; Nejidat, A; Heimer, Y; Volokita, M

2001-03-01

The roles of light and of the putative plastid signal in glycolate oxidase (GLO) gene expression were investigated in tobacco (Nicotiana tabacum cv. Samsun NN) seedlings during their shift from skotomorphogenic to photomorphogenic development. GLO transcript and enzyme activities were detected in etiolated seedlings. Their respective levels increased three- and six-fold during 96 h of exposure to light. The GLO transcript was almost undetectable in seedlings in which chloroplast development was impaired by photooxidation with the herbicide norflurazon. In transgenic tobacco seedlings, photooxidation inhibited the light-dependent increase in GUS activity when it was placed under the regulation of the GLO promoter P(GLO). However, even under these photooxidative conditions, a continuous increase in GUS activity was observed as compared to etiolated seedlings. When GUS expression was driven by the CaMV 35S promoter (P35S), no apparent difference was observed between etiolated, deetiolated and photooxidized seedlings. These observations indicate that the effects of the putative plastid development signal and light on GUS expression can be separated. Translational yield analysis indicated that the translation of the GUS transcript in P(GLO)::GUS seedlings was enhanced 30-fold over that of the GUS transcript in P35S::GUS seedlings. The overall picture emerging from these results is that in etiolated seedlings GLO transcript, though present at a substantial level, is translated at a low rate. Increased GLO transcription is enhanced, however, in response to signals originating from the developing plastids. GLO gene expression is further enhanced at the translational level by a yet undefined light-dependent mechanism.

Differentially expressed microRNAs associated with changes of transcript levels in detoxification pathways and DDT-resistance in the Drosophila melanogaster strain 91-R.

PubMed

Seong, Keon Mook; Coates, Brad S; Kim, Do-Hyup; Hansen, Allison K; Pittendrigh, Barry R

2018-01-01

Dichloro-diphenyl-trichloroethane (DDT) resistance among arthropod species is a model for understanding the molecular adaptations in response to insecticide exposures. Previous studies reported that DDT resistance may involve one or multiple detoxification genes, such as cytochrome P450 monooxygenases (P450s), glutathione S-transferases (GSTs), esterases, and ATP binding cassette (ABC) transporters, or changes in the voltage-sensitive sodium channel. However, the possible involvement of microRNAs (miRNAs) in the post-transcriptional regulation of genes associated with DDT resistance in the Drosophila melanogaster strain 91-R remains poorly understood. In this study, the majority of the resulting miRNAs discovered in small RNA libraries from 91-R and the susceptible control strain, 91-C, ranged from 16-25 nt, and contained 163 precursors and 256 mature forms of previously-known miRNAs along with 17 putative novel miRNAs. Quantitative analyses predicted the differential expression of ten miRNAs between 91-R and 91-C, and, based on Gene Ontology and pathway analysis, these ten miRNAs putatively target transcripts encoding proteins involved in detoxification mechanisms. RT-qPCR validated an inverse correlation between levels of differentially-expressed miRNAs and their putatively targeted transcripts, which implies a role of these miRNAs in the differential regulation of detoxification pathways in 91-R compared to 91-C. This study provides evidence associating the differential expression of miRNAs in response to multigenerational DDT selection in Drosophila melanogaster and provides important clues for understanding the possible roles of miRNAs in mediating insecticide resistance traits.

Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA.

PubMed

Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep

2016-03-01

Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.

Identification of Putative Olfactory Genes from the Oriental Fruit Moth Grapholita molesta via an Antennal Transcriptome Analysis

PubMed Central

Li, Yiping; Wu, Junxiang

2015-01-01

Background The oriental fruit moth, Grapholita molesta, is an extremely important oligophagous pest species of stone and pome fruits throughout the world. As a host-switching species, adult moths, especially females, depend on olfactory cues to a large extent in locating host plants, finding mates, and selecting oviposition sites. The identification of olfactory genes can facilitate investigation on mechanisms for chemical communications. Methodology/Principal Finding We generated transcriptome of female antennae of G.molesta using the next-generation sequencing technique, and assembled transcripts from RNA-seq reads using Trinity, SOAPdenovo-trans and Abyss-trans assemblers. We identified 124 putative olfactory genes. Among the identified olfactory genes, 118 were novel to this species, including 28 transcripts encoding for odorant binding proteins, 17 chemosensory proteins, 48 odorant receptors, four gustatory receptors, 24 ionotropic receptors, two sensory neuron membrane proteins, and one odor degrading enzyme. The identified genes were further confirmed through semi-quantitative reverse transcription PCR for transcripts coding for 26 OBPs and 17 CSPs. OBP transcripts showed an obvious antenna bias, whereas CSP transcripts were detected in different tissues. Conclusion Antennal transcriptome data derived from the oriental fruit moth constituted an abundant molecular resource for the identification of genes potentially involved in the olfaction process of the species. This study provides a foundation for future research on the molecules involved in olfactory recognition of this insect pest, and in particular, the feasibility of using semiochemicals to control this pest. PMID:26540284

Molecular analysis of the human SLC13A4 sulfate transporter gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jefferis, J.; Rakoczy, J.; School of Biomedical Sciences, University of Queensland, St. Lucia, Queensland

2013-03-29

Highlights: ► Basal promoter activity of SLC13A4 −57 to −192 nt upstream of transcription initiation site. ► Human SLC13A4 5′-flanking region has conserved motifs with other placental species. ► Putative NFY, SP1 and KLF7 motifs in SLC13A4 5′-flanking region enhance transcription. -- Abstract: The human solute linked carrier (SLC) 13A4 gene is primarily expressed in the placenta where it is proposed to mediate the transport of nutrient sulfate from mother to fetus. The molecular mechanisms involved in the regulation of SLC13A4 expression remain unknown. To investigate the regulation of SLC13A4 gene expression, we analysed the transcriptional activity of the humanmore » SLC13A4 5′-flanking region in the JEG-3 placental cell line using luciferase reporter assays. Basal transcriptional activity was identified in the region −57 to −192 nucleotides upstream of the SLC13A4 transcription initiation site. Mutational analysis of the minimal promoter region identified Nuclear factor Y (NFY), Specificity protein 1 (SP1) and Krüppel like factor 7 (KLF7) motifs which conferred positive transcriptional activity, as well as Zinc finger protein of the cerebellum 2 (ZIC2) and helix–loop–helix protein 1 (HEN1) motifs that repressed transcription. The conserved NFY, SP1, KLF7, ZIC2 and HEN1 motifs in the SLC13A4 promoter of placental species but not in non-placental species, suggests a potential role for these putative transcriptional factor binding motifs in the physiological control of SLC13A4 mRNA expression.« less

Genomic organization of the Neurospora crassa gsn gene: possible involvement of the STRE and HSE elements in the modulation of transcription during heat shock.

PubMed

Freitas, F Zanolli; Bertolini, M C

2004-12-01

Glycogen synthase, an enzyme involved in glycogen biosynthesis, is regulated by phosphorylation and by the allosteric ligand glucose-6-phosphate (G6P). In addition, enzyme levels can be regulated by changes in gene expression. We recently cloned a cDNA for glycogen synthase ( gsn) from Neurospora crassa, and showed that gsn transcription decreased when cells were exposed to heat shock (shifted from 30 degrees C to 45 degrees C). In order to understand the mechanisms that control gsn expression, we isolated the gene, including its 5' and 3' flanking regions, from the genome of N. crassa. An ORF of approximately 2.4 kb was identified, which is interrupted by four small introns (II-V). Intron I (482 bp) is located in the 5'UTR region. Three putative Transcription Initiation Sites (TISs) were mapped, one of which lies downstream of a canonical TATA-box sequence (5'-TGTATAAA-3'). Analysis of the 5'-flanking region revealed the presence of putative transcription factor-binding sites, including Heat Shock Elements (HSEs) and STress Responsive Elements (STREs). The possible involvement of these motifs in the negative regulation of gsn transcription was investigated using Electrophoretic Mobility Shift Assays (EMSA) with nuclear extracts of N. crassa mycelium obtained before and after heat shock, and DNA fragments encompassing HSE and STRE elements from the 5'-flanking region. While elements within the promoter region are involved in transcription under heat shock, elements in the 5'UTR intron may participate in transcription during vegetative growth. The results thus suggest that N. crassa possesses trans -acting elements that interact with the 5'-flanking region to regulate gsn transcription during heat shock and vegetative growth.

Dissecting the Genetic Basis for Seed Coat Mucilage Heteroxylan Biosynthesis in Plantago ovata Using Gamma Irradiation and Infrared Spectroscopy

PubMed Central

Tucker, Matthew R.; Ma, Chao; Phan, Jana; Neumann, Kylie; Shirley, Neil J.; Hahn, Michael G.; Cozzolino, Daniel; Burton, Rachel A.

2017-01-01

Seeds from the myxospermous species Plantago ovata release a polysaccharide-rich mucilage upon contact with water. This seed coat derived mucilage is composed predominantly of heteroxylan (HX) and is utilized as a gluten-free dietary fiber supplement to promote human colorectal health. In this study, a gamma-irradiated P. ovata population was generated and screened using histological stains and Fourier Transform Mid Infrared (FTMIR) spectroscopy to identify putative mutants showing defects in seed coat mucilage HX composition and/or structure. FTMIR analysis of dry seed revealed variation in regions of the IR spectra previously linked to xylan structure in Secale cereale (rye). Subsequent absorbance ratio and PCA multivariate analysis identified 22 putative mutant families with differences in the HX IR fingerprint region. Many of these showed distinct changes in the amount and subtle changes in structure of HX after mucilage extrusion, while 20% of the putative HX mutants identified by FTMIR showed no difference in staining patterns of extruded mucilage compared to wild-type. Transcriptional screening analysis of two putative reduced xylan in mucilage (rxm) mutants, rxm1 and rxm3, revealed that changes in HX levels in rxm1 correlate with reduced transcription of known and novel genes associated with xylan synthesis, possibly indicative of specific co-regulatory units within the xylan biosynthetic pathway. These results confirm that FTMIR is a suitable method for identifying putative mutants with altered mucilage HX composition in P. ovata, and therefore forms a resource to identify novel genes involved in xylan biosynthesis. PMID:28377777

Cloning and characterization of a novel stress-responsive WRKY transcription factor gene (MusaWRKY71) from Musa spp. cv. Karibale Monthan (ABB group) using transformed banana cells.

PubMed

Shekhawat, Upendra K Singh; Ganapathi, Thumballi R; Srinivas, Lingam

2011-08-01

WRKY transcription factor proteins play significant roles in plant stress responses. Here, we report the cloning and characterization of a novel WRKY gene, MusaWRKY71 isolated from an edible banana cultivar Musa spp. Karibale Monthan (ABB group). MusaWRKY71, initially identified using in silico approaches from an abiotic stress-related EST library, was later extended towards the 3' end using rapid amplification of cDNA ends technique. The 1299-bp long cDNA of MusaWRKY71 encodes a protein with 280 amino acids and contains a characteristic WRKY domain in the C-terminal half. Although MusaWRKY71 shares good similarity with other monocot WRKY proteins the substantial size difference makes it a unique member of the WRKY family in higher plants. The 918-bp long 5' proximal region determined using thermal asymmetric interlaced-polymerase chain reaction has many putative cis-acting elements and transcription factor binding motifs. Subcellular localization assay of MusaWRKY71 performed using a GFP-fusion platform confirmed its nuclear targeting in transformed banana suspension cells. Importantly, MusaWRKY71 expression in banana plantlets was up-regulated manifold by cold, dehydration, salt, ABA, H2O2, ethylene, salicylic acid and methyl jasmonate treatment indicating its involvement in response to a variety of stress conditions in banana. Further, transient overexpression of MusaWRKY71 in transformed banana cells led to the induction of several genes, homologues of which have been proven to be involved in diverse stress responses in other important plants. The present study is the first report on characterization of a banana stress-related transcription factor using transformed banana cells.

The Vigna unguiculata Gene Expression Atlas (VuGEA) from de novo assembly and quantification of RNA-seq data provides insights into seed maturation mechanisms.

PubMed

Yao, Shaolun; Jiang, Chuan; Huang, Ziyue; Torres-Jerez, Ivone; Chang, Junil; Zhang, Heng; Udvardi, Michael; Liu, Renyi; Verdier, Jerome

2016-10-01

Legume research and cultivar development are important for sustainable food production, especially of high-protein seed. Thanks to the development of deep-sequencing technologies, crop species have been taken to the front line, even without completion of their genome sequences. Black-eyed pea (Vigna unguiculata) is a legume species widely grown in semi-arid regions, which has high potential to provide stable seed protein production in a broad range of environments, including drought conditions. The black-eyed pea reference genotype has been used to generate a gene expression atlas of the major plant tissues (i.e. leaf, root, stem, flower, pod and seed), with a developmental time series for pods and seeds. From these various organs, 27 cDNA libraries were generated and sequenced, resulting in more than one billion reads. Following filtering, these reads were de novo assembled into 36 529 transcript sequences that were annotated and quantified across the different tissues. A set of 24 866 unique transcript sequences, called Unigenes, was identified. All the information related to transcript identification, annotation and quantification were stored into a gene expression atlas webserver (http://vugea.noble.org), providing a user-friendly interface and necessary tools to analyse transcript expression in black-eyed pea organs and to compare data with other legume species. Using this gene expression atlas, we inferred details of molecular processes that are active during seed development, and identified key putative regulators of seed maturation. Additionally, we found evidence for conservation of regulatory mechanisms involving miRNA in plant tissues subjected to drought and seeds undergoing desiccation. © 2016 The Authors. The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

Target gene analysis by microarrays and chromatin immunoprecipitation identifies HEY proteins as highly redundant bHLH repressors.

PubMed

Heisig, Julia; Weber, David; Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

2012-01-01

HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression.

Target Gene Analysis by Microarrays and Chromatin Immunoprecipitation Identifies HEY Proteins as Highly Redundant bHLH Repressors

PubMed Central

Englberger, Eva; Winkler, Anja; Kneitz, Susanne; Sung, Wing-Kin; Wolf, Elmar; Eilers, Martin; Wei, Chia-Lin; Gessler, Manfred

2012-01-01

HEY bHLH transcription factors have been shown to regulate multiple key steps in cardiovascular development. They can be induced by activated NOTCH receptors, but other upstream stimuli mediated by TGFß and BMP receptors may elicit a similar response. While the basic and helix-loop-helix domains exhibit strong similarity, large parts of the proteins are still unique and may serve divergent functions. The striking overlap of cardiac defects in HEY2 and combined HEY1/HEYL knockout mice suggested that all three HEY genes fulfill overlapping function in target cells. We therefore sought to identify target genes for HEY proteins by microarray expression and ChIPseq analyses in HEK293 cells, cardiomyocytes, and murine hearts. HEY proteins were found to modulate expression of their target gene to a rather limited extent, but with striking functional interchangeability between HEY factors. Chromatin immunoprecipitation revealed a much greater number of potential binding sites that again largely overlap between HEY factors. Binding sites are clustered in the proximal promoter region especially of transcriptional regulators or developmental control genes. Multiple lines of evidence suggest that HEY proteins primarily act as direct transcriptional repressors, while gene activation seems to be due to secondary or indirect effects. Mutagenesis of putative DNA binding residues supports the notion of direct DNA binding. While class B E-box sequences (CACGYG) clearly represent preferred target sequences, there must be additional and more loosely defined modes of DNA binding since many of the target promoters that are efficiently bound by HEY proteins do not contain an E-box motif. These data clearly establish the three HEY bHLH factors as highly redundant transcriptional repressors in vitro and in vivo, which explains the combinatorial action observed in different tissues with overlapping expression. PMID:22615585

A Deeper Examination of Thorellius atrox Scorpion Venom Components with Omic Techonologies

PubMed Central

Romero-Gutierrez, Teresa; Batista, Cesar V. F.

2017-01-01

This communication reports a further examination of venom gland transcripts and venom composition of the Mexican scorpion Thorellius atrox using RNA-seq and tandem mass spectrometry. The RNA-seq, which was performed with the Illumina protocol, yielded more than 20,000 assembled transcripts. Following a database search and annotation strategy, 160 transcripts were identified, potentially coding for venom components. A novel sequence was identified that potentially codes for a peptide with similarity to spider ω-agatoxins, which act on voltage-gated calcium channels, not known before to exist in scorpion venoms. Analogous transcripts were found in other scorpion species. They could represent members of a new scorpion toxin family, here named omegascorpins. The mass fingerprint by LC-MS identified 135 individual venom components, five of which matched with the theoretical masses of putative peptides translated from the transcriptome. The LC-MS/MS de novo sequencing allowed to reconstruct and identify 42 proteins encoded by assembled transcripts, thus validating the transcriptome analysis. Earlier studies conducted with this scorpion venom permitted the identification of only twenty putative venom components. The present work performed with more powerful and modern omic technologies demonstrates the capacity of accomplishing a deeper characterization of scorpion venom components and the identification of novel molecules with potential applications in biomedicine and the study of ion channel physiology. PMID:29231872

Complete Genome Sequence of Diaphorina citri-associated C virus, a Novel Putative RNA Virus of the Asian Citrus Psyllid, Diaphorina citri.

PubMed

Nouri, Shahideh; Salem, Nidà; Falk, Bryce W

2016-07-21

We present here the complete nucleotide sequence and genome organization of a novel putative RNA virus identified in field populations of the Asian citrus psyllid, Diaphorina citri, through sequencing of the transcriptome followed by reverse transcription-PCR (RT-PCR). We tentatively named this virus Diaphorina citri-associated C virus (DcACV). DcACV is an unclassified positive-sense RNA virus. Copyright © 2016 Nouri et al.

Transcriptional Response of Virus-Infected Cassava and Identification of Putative Sources of Resistance for Cassava Brown Streak Disease

PubMed Central

Maruthi, M. N.; Bouvaine, Sophie; Tufan, Hale A.; Mohammed, Ibrahim U.; Hillocks, Rory J.

2014-01-01

Cassava (Manihot esculenta) is a major food staple in sub-Saharan Africa, which is severely affected by cassava brown streak disease (CBSD). The aim of this study was to identify resistance for CBSD as well as to understand the mechanism of putative resistance for providing effective control for the disease. Three cassava varieties; Kaleso, Kiroba and Albert were inoculated with cassava brown streak viruses by grafting and also using the natural insect vector the whitefly, Bemisia tabaci. Kaleso expressed mild or no disease symptoms and supported low concentrations of viruses, which is a characteristic of resistant plants. In comparison, Kiroba expressed severe leaf but milder root symptoms, while Albert was susceptible with severe symptoms both on leaves and roots. Real-time PCR was used to estimate virus concentrations in cassava varieties. Virus quantities were higher in Kiroba and Albert compared to Kaleso. The Illumina RNA-sequencing was used to further understand the genetic basis of resistance. More than 700 genes were uniquely overexpressed in Kaleso in response to virus infection compared to Albert. Surprisingly, none of them were similar to known resistant gene orthologs. Some of the overexpressed genes, however, belonged to the hormone signalling pathways and secondary metabolites, both of which are linked to plant resistance. These genes should be further characterised before confirming their role in resistance to CBSD. PMID:24846209

Pathologic features of mycobacteriosis in naturally infected Syngnathidae and novel transcriptome assembly in association with disease.

PubMed

Fogelson, S B; Fast, M D; Leary, J; Camus, A C

2017-11-01

Syngnathidae (seahorses, seadragons and pipefish) suffer significant losses from non-tuberculous mycobacteria. However, they produce markedly different lesions in response to the disease compared to other teleost species, notably infrequent granuloma formation. This study evaluated 270 syngnathid fish, from which 92 were diagnosed with mycobacteriosis by histopathology, culture or both. Microscopic lesions variably consisted of random foci of coagulative necrosis in multiple organs, containing high numbers of free bacteria and large aggregates or sheets of macrophages with cytoplasm laden with acid-fast bacilli. Mycobacterial associated granulomas were identified in only six seahorses. Five fish had positive cultures with no observed microscopic changes. RNA-seq of the head kidney was performed to investigate the transcriptome of two infected and six non-infected lined seahorses Hippocampus erectus. Assembled and annotated putative transcripts serve to enrich the database for this species, as well as provide baseline data for understanding the pathogenesis of mycobacteriosis in seahorses. Putative components of the innate immune system (IL-1β, IL-6, TNF, NOS, Toll-like receptor 1, MHC Class I, NF-κβ, transforming growth factor beta, MyD88) were identified in the RNA-seq data set. However, a homolog for a key component in the TH1 adaptive immune response, interferon-gamma, was not identified and may underlie the unique pathologic presentation. © 2017 John Wiley & Sons Ltd.

Captodiamine, a putative antidepressant, enhances hypothalamic BDNF expression in vivo by synergistic 5-HT2c receptor antagonism and sigma-1 receptor agonism.

PubMed

Ring, Rebecca M; Regan, Ciaran M

2013-10-01

The putative antidepressant captodiamine is a 5-HT2c receptor antagonist and agonist at sigma-1 and D3 dopamine receptors, exerts an anti-immobility action in the forced swim paradigm, and enhances dopamine turnover in the frontal cortex. Captodiamine has also been found to ameliorate stress-induced anhedonia, reduce the associated elevations of hypothalamic corticotrophin-releasing factor (CRF) and restore the reductions in hypothalamic BDNF expression. Here we demonstrate chronic administration of captodiamine to have no significant effect on hypothalamic CRF expression through sigma-1 receptor agonism; however, both sigma-1 receptor agonism or 5-HT2c receptor antagonism were necessary to enhance BDNF expression. Regulation of BDNF expression by captodiamine was associated with increased phosphorylation of transcription factor CREB and mediated through sigma-1 receptor agonism but blocked by 5-HT2c receptor antagonism. The existence of two separate signalling pathways was confirmed by immunolocalisation of each receptor to distinct cell populations in the paraventricular nucleus of the hypothalamus. Increased BDNF induced by captodiamine was also associated with enhanced expression of synapsin, but not PSD-95, suggesting induction of long-term structural plasticity between hypothalamic synapses. These unique features of captodiamine may contribute to its ability to ameliorate stress-induced anhedonia as the hypothalamus plays a prominent role in regulating HPA axis activity.

Hypervariability of ribosomal DNA at multiple chromosomal sites in lake trout (Salvelinus namaycush).

PubMed

Zhuo, L; Reed, K M; Phillips, R B

1995-06-01

Variation in the intergenic spacer (IGS) of the ribosomal DNA (rDNA) of lake trout (Salvelinus namaycush) was examined. Digestion of genomic DNA with restriction enzymes showed that almost every individual had a unique combination of length variants with most of this variation occurring within rather than between populations. Sequence analysis of a 2.3 kilobase (kb) EcoRI-DraI fragment spanning the 3' end of the 28S coding region and approximately 1.8 kb of the IGS revealed two blocks of repetitive DNA. Putative transcriptional termination sites were found approximately 220 bases (b) downstream from the end of the 28S coding region. Comparison of the 2.3-kb fragments with two longer (3.1 kb) fragments showed that the major difference in length resulted from variation in the number of short (89 b) repeats located 3' to the putative terminator. Repeat units within a single nucleolus organizer region (NOR) appeared relatively homogeneous and genetic analysis found variants to be stably inherited. A comparison of the number of spacer-length variants with the number of NORs found that the number of length variants per individual was always less than the number of NORs. Examination of spacer variants in five populations showed that populations with more NORs had more spacer variants, indicating that variants are present at different rDNA sites on nonhomologous chromosomes.

The Transcriptome Analysis of Strongyloides stercoralis L3i Larvae Reveals Targets for Intervention in a Neglected Disease

PubMed Central

Marcilla, Antonio; Garg, Gagan; Bernal, Dolores; Ranganathan, Shoba; Forment, Javier; Ortiz, Javier; Muñoz-Antolí, Carla; Dominguez, M. Victoria; Pedrola, Laia; Martinez-Blanch, Juan; Sotillo, Javier; Trelis, Maria; Toledo, Rafael; Esteban, J. Guillermo

2012-01-01

Background Strongyloidiasis is one of the most neglected diseases distributed worldwide with endemic areas in developed countries, where chronic infections are life threatening. Despite its impact, very little is known about the molecular biology of the parasite involved and its interplay with its hosts. Next generation sequencing technologies now provide unique opportunities to rapidly address these questions. Principal Findings Here we present the first transcriptome of the third larval stage of S. stercoralis using 454 sequencing coupled with semi-automated bioinformatic analyses. 253,266 raw sequence reads were assembled into 11,250 contiguous sequences, most of which were novel. 8037 putative proteins were characterized based on homology, gene ontology and/or biochemical pathways. Comparison of the transcriptome of S. strongyloides with those of other nematodes, including S. ratti, revealed similarities in transcription of molecules inferred to have key roles in parasite-host interactions. Enzymatic proteins, like kinases and proteases, were abundant. 1213 putative excretory/secretory proteins were compiled using a new pipeline which included non-classical secretory proteins. Potential drug targets were also identified. Conclusions Overall, the present dataset should provide a solid foundation for future fundamental genomic, proteomic and metabolomic explorations of S. stercoralis, as well as a basis for applied outcomes, such as the development of novel methods of intervention against this neglected parasite. PMID:22389732

Long noncoding RNAs (lncRNAs) dynamics evidence immunomodulation during ISAV-Infected Atlantic salmon (Salmo salar).

PubMed

Boltaña, Sebastian; Valenzuela-Miranda, Diego; Aguilar, Andrea; Mackenzie, Simon; Gallardo-Escárate, Cristian

2016-03-04

Despite evidence for participation in the host response to infection, the roles of many long non-coding RNAs (lncRNAs) remain unknown. Therefore, the aims of this study were to identify lncRNAs in Atlantic salmon (Salmo salar) and evaluate their transcriptomic regulation during ISA virus (ISAV) infection, an Orthomyxoviridae virus associated with high mortalities in salmonid aquaculture. Using next-generation sequencing, whole-transcriptome analysis of the Salmo salar response to ISAV infection was performed, identifying 5,636 putative lncRNAs with a mean length of 695 base pairs. The transcriptional modulation evidenced a similar number of differentially expressed lncRNAs in the gills (3,294), head-kidney (3,275), and liver (3,325) over the course of the infection. Moreover, analysis of a subset of these lncRNAs showed the following: (i) Most were similarly regulated in response to ISA virus infection; (ii) The transcript subsets were uniquely modulated in each tissue (gills, liver, and head-kidney); and (iii) A subset of lncRNAs were upregulated for each tissue and time analysed, indicating potential markers for ISAV infection. These findings represent the first discovery of widespread differential expression of lncRNAs in response to virus infection in non-model species, suggesting that lncRNAs could be involved in regulating the host response during ISAV infection.

Expressed sequence tags (ESTs) from immune tissues of turbot (Scophthalmus maximus) challenged with pathogens

PubMed Central

Pardo, Belén G; Fernández, Carlos; Millán, Adrián; Bouza, Carmen; Vázquez-López, Araceli; Vera, Manuel; Alvarez-Dios, José A; Calaza, Manuel; Gómez-Tato, Antonio; Vázquez, María; Cabaleiro, Santiago; Magariños, Beatriz; Lemos, Manuel L; Leiro, José M; Martínez, Paulino

2008-01-01

Background The turbot (Scophthalmus maximus; Scophthalmidae; Pleuronectiformes) is a flatfish species of great relevance for marine aquaculture in Europe. In contrast to other cultured flatfish, very few genomic resources are available in this species. Aeromonas salmonicida and Philasterides dicentrarchi are two pathogens that affect turbot culture causing serious economic losses to the turbot industry. Little is known about the molecular mechanisms for disease resistance and host-pathogen interactions in this species. In this work, thousands of ESTs for functional genomic studies and potential markers linked to ESTs for mapping (microsatellites and single nucleotide polymorphisms (SNPs)) are provided. This information enabled us to obtain a preliminary view of regulated genes in response to these pathogens and it constitutes the basis for subsequent and more accurate microarray analysis. Results A total of 12584 cDNAs partially sequenced from three different cDNA libraries of turbot (Scophthalmus maximus) infected with Aeromonas salmonicida, Philasterides dicentrarchi and from healthy fish were analyzed. Three immune-relevant tissues (liver, spleen and head kidney) were sampled at several time points in the infection process for library construction. The sequences were processed into 9256 high-quality sequences, which constituted the source for the turbot EST database. Clustering and assembly of these sequences, revealed 3482 different putative transcripts, 1073 contigs and 2409 singletons. BLAST searches with public databases detected significant similarity (e-value ≤ 1e-5) in 1766 (50.7%) sequences and 816 of them (23.4%) could be functionally annotated. Two hundred three of these genes (24.9%), encoding for defence/immune-related proteins, were mostly identified for the first time in turbot. Some ESTs showed significant differences in the number of transcripts when comparing the three libraries, suggesting regulation in response to these pathogens. A total of 191 microsatellites, with 104 having sufficient flanking sequences for primer design, and 1158 putative SNPs were identified from these EST resources in turbot. Conclusion A collection of 9256 high-quality ESTs was generated representing 3482 unique turbot sequences. A large proportion of defence/immune-related genes were identified, many of them regulated in response to specific pathogens. Putative microsatellites and SNPs were identified. These genome resources constitute the basis to develop a microarray for functional genomics studies and marker validation for genetic linkage and QTL analysis in turbot. PMID:18817567

De novo assembly, characterization and functional annotation of pineapple fruit transcriptome through massively parallel sequencing.

PubMed

Ong, Wen Dee; Voo, Lok-Yung Christopher; Kumar, Vijay Subbiah

2012-01-01

Pineapple (Ananas comosus var. comosus), is an important tropical non-climacteric fruit with high commercial potential. Understanding the mechanism and processes underlying fruit ripening would enable scientists to enhance the improvement of quality traits such as, flavor, texture, appearance and fruit sweetness. Although, the pineapple is an important fruit, there is insufficient transcriptomic or genomic information that is available in public databases. Application of high throughput transcriptome sequencing to profile the pineapple fruit transcripts is therefore needed. To facilitate this, we have performed transcriptome sequencing of ripe yellow pineapple fruit flesh using Illumina technology. About 4.7 millions Illumina paired-end reads were generated and assembled using the Velvet de novo assembler. The assembly produced 28,728 unique transcripts with a mean length of approximately 200 bp. Sequence similarity search against non-redundant NCBI database identified a total of 16,932 unique transcripts (58.93%) with significant hits. Out of these, 15,507 unique transcripts were assigned to gene ontology terms. Functional annotation against Kyoto Encyclopedia of Genes and Genomes pathway database identified 13,598 unique transcripts (47.33%) which were mapped to 126 pathways. The assembly revealed many transcripts that were previously unknown. The unique transcripts derived from this work have rapidly increased of the number of the pineapple fruit mRNA transcripts as it is now available in public databases. This information can be further utilized in gene expression, genomics and other functional genomics studies in pineapple.

De Novo Assembly, Characterization and Functional Annotation of Pineapple Fruit Transcriptome through Massively Parallel Sequencing

PubMed Central

Ong, Wen Dee; Voo, Lok-Yung Christopher; Kumar, Vijay Subbiah

2012-01-01

Background Pineapple (Ananas comosus var. comosus), is an important tropical non-climacteric fruit with high commercial potential. Understanding the mechanism and processes underlying fruit ripening would enable scientists to enhance the improvement of quality traits such as, flavor, texture, appearance and fruit sweetness. Although, the pineapple is an important fruit, there is insufficient transcriptomic or genomic information that is available in public databases. Application of high throughput transcriptome sequencing to profile the pineapple fruit transcripts is therefore needed. Methodology/Principal Findings To facilitate this, we have performed transcriptome sequencing of ripe yellow pineapple fruit flesh using Illumina technology. About 4.7 millions Illumina paired-end reads were generated and assembled using the Velvet de novo assembler. The assembly produced 28,728 unique transcripts with a mean length of approximately 200 bp. Sequence similarity search against non-redundant NCBI database identified a total of 16,932 unique transcripts (58.93%) with significant hits. Out of these, 15,507 unique transcripts were assigned to gene ontology terms. Functional annotation against Kyoto Encyclopedia of Genes and Genomes pathway database identified 13,598 unique transcripts (47.33%) which were mapped to 126 pathways. The assembly revealed many transcripts that were previously unknown. Conclusions The unique transcripts derived from this work have rapidly increased of the number of the pineapple fruit mRNA transcripts as it is now available in public databases. This information can be further utilized in gene expression, genomics and other functional genomics studies in pineapple. PMID:23091603

A MADS Box Protein Interacts with a Mating-Type Protein and Is Required for Fruiting Body Development in the Homothallic Ascomycete Sordaria macrospora

PubMed Central

Nolting, Nicole; Pöggeler, Stefanie

2006-01-01

MADS box transcription factors control diverse developmental processes in plants, metazoans, and fungi. To analyze the involvement of MADS box proteins in fruiting body development of filamentous ascomycetes, we isolated the mcm1 gene from the homothallic ascomycete Sordaria macrospora, which encodes a putative homologue of the Saccharomyces cerevisiae MADS box protein Mcm1p. Deletion of the S. macrospora mcm1 gene resulted in reduced biomass, increased hyphal branching, and reduced hyphal compartment length during vegetative growth. Furthermore, the S. macrospora Δmcm1 strain was unable to produce fruiting bodies or ascospores during sexual development. A yeast two-hybrid analysis in conjugation with in vitro analyses demonstrated that the S. macrospora MCM1 protein can interact with the putative transcription factor SMTA-1, encoded by the S. macrospora mating-type locus. These results suggest that the S. macrospora MCM1 protein is involved in the transcriptional regulation of mating-type-specific genes as well as in fruiting body development. PMID:16835449

Sialotranscriptomics of Rhipicephalus zambeziensis reveals intricate expression profiles of secretory proteins and suggests tight temporal transcriptional regulation during blood-feeding.

PubMed

de Castro, Minique Hilda; de Klerk, Daniel; Pienaar, Ronel; Rees, D Jasper G; Mans, Ben J

2017-08-10

Ticks secrete a diverse mixture of secretory proteins into the host to evade its immune response and facilitate blood-feeding, making secretory proteins attractive targets for the production of recombinant anti-tick vaccines. The largely neglected tick species, Rhipicephalus zambeziensis, is an efficient vector of Theileria parva in southern Africa but its available sequence information is limited. Next generation sequencing has advanced sequence availability for ticks in recent years and has assisted the characterisation of secretory proteins. This study focused on the de novo assembly and annotation of the salivary gland transcriptome of R. zambeziensis and the temporal expression of secretory protein transcripts in female and male ticks, before the onset of feeding and during early and late feeding. The sialotranscriptome of R. zambeziensis yielded 23,631 transcripts from which 13,584 non-redundant proteins were predicted. Eighty-six percent of these contained a predicted start and stop codon and were estimated to be putatively full-length proteins. A fifth (2569) of the predicted proteins were annotated as putative secretory proteins and explained 52% of the expression in the transcriptome. Expression analyses revealed that 2832 transcripts were differentially expressed among feeding time points and 1209 between the tick sexes. The expression analyses further indicated that 57% of the annotated secretory protein transcripts were differentially expressed. Dynamic expression profiles of secretory protein transcripts were observed during feeding of female ticks. Whereby a number of transcripts were upregulated during early feeding, presumably for feeding site establishment and then during late feeding, 52% of these were downregulated, indicating that transcripts were required at specific feeding stages. This suggested that secretory proteins are under stringent transcriptional regulation that fine-tunes their expression in salivary glands during feeding. No open reading frames were predicted for 7947 transcripts. This class represented 17% of the differentially expressed transcripts, suggesting a potential transcriptional regulatory function of long non-coding RNA in tick blood-feeding. The assembled sialotranscriptome greatly expands the sequence availability of R. zambeziensis, assists in our understanding of the transcription of secretory proteins during blood-feeding and will be a valuable resource for future vaccine candidate selection.

Transcriptional Analysis of Resistance to Low Temperatures in Bermudagrass Crown Tissues

PubMed Central

Melmaiee, Kalpalatha; Anderson, Michael; Elavarthi, Sathya; Guenzi, Arron; Canaan, Patricia

2015-01-01

Bermudagrass (Cynodon dactylon L pers.) is one of the most geographically adapted and utilized of the warm-season grasses. However, bermudagrass adaptation to the Northern USA is limited by freeze damage and winterkill. Our study provides the first large-scale analyses of gene expression in bermudagrass regenerative crown tissues during cold acclimation. We compared gene expression patterns in crown tissues from highly cold tolerant “MSU” and susceptible “Zebra” genotypes exposed to near-freezing temperatures. Suppressive subtractive hybridization was used to isolate putative cold responsive genes Approximately, 3845 transcript sequences enriched for cold acclimation were deposited in the GenBank. A total of 4589 ESTs (3184 unigenes) including 744 ESTs associated with the bermudagrass disease spring dead spot were printed on microarrays and hybridized with cold acclimated complementary Deoxyribonucleic acid (cDNA). A total of 587 differentially expressed unigenes were identified in this study. Of these only 97 (17%) showed significant NCBI matches. The overall expression pattern revealed 40% more down- than up-regulated genes, which was particularly enhanced in MSU compared to Zebra. Among the up-regulated genes 68% were uniquely expressed in MSU (36%) or Zebra (32%). Among the down-regulated genes 40% were unique to MSU, while only 15% to Zebra. Overall expression intensity was significantly higher in MSU than in Zebra (p value ≤ 0.001) and the overall number of genes expressed at 28 days was 2.7 fold greater than at 2 days. These changes in expression patterns reflect the strong genotypic and temporal response to cold temperatures. Additionally, differentially expressed genes from this study can be utilized for developing molecular markers in bermudagrass and other warm season grasses for enhancing cold hardiness. PMID:26348040

Transcriptional Reprogramming of the Mycoparasitic Fungus Ampelomyces quisqualis During the Powdery Mildew Host-Induced Germination.

PubMed

Siozios, Stefanos; Tosi, Lorenzo; Ferrarini, Alberto; Ferrari, Alessandro; Tononi, Paola; Bellin, Diana; Maurhofer, Monika; Gessler, Cesare; Delledonne, Massimo; Pertot, Ilaria

2015-02-01

Ampelomyces quisqualis is a mycoparasite of a diverse range of phytopathogenic fungi associated with the powdery mildew disease. Among them are several Erysiphaceae species with great economic impact on high-value crops such as grape. Due to its ability to parasitize and prevent the spread of powdery mildews, A. quisqualis has received considerable attention for its biocontrol potential. However, and in sharp contrast to the extensively studied biocontrol species belonging to the genus Trichoderma, little is known about the biology of A. quisqualis at the molecular and genetic levels. We present the first genome-wide transcription profiling in A. quisqualis during host-induced germination. A total of 1,536 putative genes showed significant changes in transcription during the germination of A. quisqualis. This finding denotes an extensive transcriptional reprogramming of A. quisqualis induced by the presence of the host. Several upregulated genes were predicted to encode for putative mycoparasitism-related proteins such as secreted proteases, virulence factors, and proteins related to toxin biosynthesis. Our data provide the most comprehensive sequence resource currently available for A. quisqualis in addition to offering valuable insights into the biology of A. quisqualis and its mycoparasitic lifestyle. Eventually, this may improve the biocontrol capacity of this mycoparasite.

Causal Reasoning on Biological Networks: Interpreting Transcriptional Changes

NASA Astrophysics Data System (ADS)

Chindelevitch, Leonid; Ziemek, Daniel; Enayetallah, Ahmed; Randhawa, Ranjit; Sidders, Ben; Brockel, Christoph; Huang, Enoch

Over the past decade gene expression data sets have been generated at an increasing pace. In addition to ever increasing data generation, the biomedical literature is growing exponentially. The PubMed database (Sayers et al., 2010) comprises more than 20 million citations as of October 2010. The goal of our method is the prediction of putative upstream regulators of observed expression changes based on a set of over 400,000 causal relationships. The resulting putative regulators constitute directly testable hypotheses for follow-up.

Gravity-regulated gene expression in Arabidopsis thaliana

NASA Astrophysics Data System (ADS)

Sederoff, Heike; Brown, Christopher S.; Heber, Steffen; Kajla, Jyoti D.; Kumar, Sandeep; Lomax, Terri L.; Wheeler, Benjamin; Yalamanchili, Roopa

Plant growth and development is regulated by changes in environmental signals. Plants sense environmental changes and respond to them by modifying gene expression programs to ad-just cell growth, differentiation, and metabolism. Functional expression of genes comprises many different processes including transcription, translation, post-transcriptional and post-translational modifications, as well as the degradation of RNA and proteins. Recently, it was discovered that small RNAs (sRNA, 18-24 nucleotides long), which are heritable and systemic, are key elements in regulating gene expression in response to biotic and abiotic changes. Sev-eral different classes of sRNAs have been identified that are part of a non-cell autonomous and phloem-mobile network of regulators affecting transcript stability, translational kinetics, and DNA methylation patterns responsible for heritable transcriptional silencing (epigenetics). Our research has focused on gene expression changes in response to gravistimulation of Arabidopsis roots. Using high-throughput technologies including microarrays and 454 sequencing, we iden-tified rapid changes in transcript abundance of genes as well as differential expression of small RNA in Arabidopsis root apices after minutes of reorientation. Some of the differentially regu-lated transcripts are encoded by genes that are important for the bending response. Functional mutants of those genes respond faster to reorientation than the respective wild type plants, indicating that these proteins are repressors of differential cell elongation. We compared the gravity responsive sRNAs to the changes in transcript abundances of their putative targets and identified several potential miRNA: target pairs. Currently, we are using mutant and transgenic Arabidopsis plants to characterize the function of those miRNAs and their putative targets in gravitropic and phototropic responses in Arabidopsis.

Integrated Post-GWAS Analysis Sheds New Light on the Disease Mechanisms of Schizophrenia

PubMed Central

Lin, Jhih-Rong; Cai, Ying; Zhang, Quanwei; Zhang, Wen; Nogales-Cadenas, Rubén; Zhang, Zhengdong D.

2016-01-01

Schizophrenia is a severe mental disorder with a large genetic component. Recent genome-wide association studies (GWAS) have identified many schizophrenia-associated common variants. For most of the reported associations, however, the underlying biological mechanisms are not clear. The critical first step for their elucidation is to identify the most likely disease genes as the source of the association signals. Here, we describe a general computational framework of post-GWAS analysis for complex disease gene prioritization. We identify 132 putative schizophrenia risk genes in 76 risk regions spanning 120 schizophrenia-associated common variants, 78 of which have not been recognized as schizophrenia disease genes by previous GWAS. Even more significantly, 29 of them are outside the risk regions, likely under regulation of transcriptional regulatory elements contained therein. These putative schizophrenia risk genes are transcriptionally active in both brain and the immune system, and highly enriched among cellular pathways, consistent with leading pathophysiological hypotheses about the pathogenesis of schizophrenia. With their involvement in distinct biological processes, these putative schizophrenia risk genes, with different association strengths, show distinctive temporal expression patterns, and play specific biological roles during brain development. PMID:27754856

In vivo identification of tumor suppressive PTEN ceRNAs in an oncogenic BRAF-induced mouse model of melanoma

PubMed Central

Karreth, Florian A.; Tay, Yvonne; Perna, Daniele; Ala, Ugo; Tan, Shen Mynn; Rust, Alistair G.; DeNicola, Gina; Webster, Kaitlyn A.; Weiss, Dror; Perez-Mancera, Pedro A.; Krauthammer, Michael; Halaban, Ruth; Provero, Paolo; Adams, David J.; Tuveson, David A.; Pandolfi, Pier Paolo

2011-01-01

Summary We recently proposed that competitive endogenous RNAs (ceRNAs) sequester microRNAs to regulate mRNA transcripts containing common microRNA recognition elements (MREs). However, the functional role of ceRNAs in cancer remains unknown. Loss of PTEN, a tumor suppressor regulated by ceRNA activity, frequently occurs in melanoma. Here, we report the discovery of significant enrichment of putative PTEN ceRNAs among genes whose loss accelerates tumorigenesis following Sleeping Beauty insertional mutagenesis in a mouse model of melanoma. We validated several putative PTEN ceRNAs and further characterized one, the ZEB2 transcript. We show that ZEB2 modulates PTEN protein levels in a microRNA-dependent, protein coding-independent manner. Attenuation of ZEB2 expression activates the PI3K/AKT pathway, enhances cell transformation, and commonly occurs in human melanomas and other cancers expressing low PTEN levels. Our study genetically identifies multiple putative microRNA decoys for PTEN, validates ZEB2 mRNA as a bona fide PTEN ceRNA, and demonstrates that abrogated ZEB2 expression cooperates with BRAFV600E to promote melanomagenesis. PMID:22000016

Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

PubMed

Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

2013-10-01

Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

The De Novo Transcriptome and Its Functional Annotation in the Seed Beetle Callosobruchus maculatus.

PubMed

Sayadi, Ahmed; Immonen, Elina; Bayram, Helen; Arnqvist, Göran

2016-01-01

Despite their unparalleled biodiversity, the genomic resources available for beetles (Coleoptera) remain relatively scarce. We present an integrative and high quality annotated transcriptome of the beetle Callosobruchus maculatus, an important and cosmopolitan agricultural pest as well as an emerging model species in ecology and evolutionary biology. Using Illumina sequencing technology, we sequenced 492 million read pairs generated from 51 samples of different developmental stages (larvae, pupae and adults) of C. maculatus. Reads were de novo assembled using the Trinity software, into a single combined assembly as well as into three separate assemblies based on data from the different developmental stages. The combined assembly generated 218,192 transcripts and 145,883 putative genes. Putative genes were annotated with the Blast2GO software and the Trinotate pipeline. In total, 33,216 putative genes were successfully annotated using Blastx against the Nr (non-redundant) database and 13,382 were assigned to 34,100 Gene Ontology (GO) terms. We classified 5,475 putative genes into Clusters of Orthologous Groups (COG) and 116 metabolic pathways maps were predicted based on the annotation. Our analyses suggested that the transcriptional specificity increases with ontogeny. For example, out of 33,216 annotated putative genes, 51 were only expressed in larvae, 63 only in pupae and 171 only in adults. Our study illustrates the importance of including samples from several developmental stages when the aim is to provide an integrative and high quality annotated transcriptome. Our results will represent an invaluable resource for those working with the ecology, evolution and pest control of C. maculatus, as well for comparative studies of the transcriptomics and genomics of beetles more generally.

The De Novo Transcriptome and Its Functional Annotation in the Seed Beetle Callosobruchus maculatus

PubMed Central

Sayadi, Ahmed; Immonen, Elina; Bayram, Helen

2016-01-01

Despite their unparalleled biodiversity, the genomic resources available for beetles (Coleoptera) remain relatively scarce. We present an integrative and high quality annotated transcriptome of the beetle Callosobruchus maculatus, an important and cosmopolitan agricultural pest as well as an emerging model species in ecology and evolutionary biology. Using Illumina sequencing technology, we sequenced 492 million read pairs generated from 51 samples of different developmental stages (larvae, pupae and adults) of C. maculatus. Reads were de novo assembled using the Trinity software, into a single combined assembly as well as into three separate assemblies based on data from the different developmental stages. The combined assembly generated 218,192 transcripts and 145,883 putative genes. Putative genes were annotated with the Blast2GO software and the Trinotate pipeline. In total, 33,216 putative genes were successfully annotated using Blastx against the Nr (non-redundant) database and 13,382 were assigned to 34,100 Gene Ontology (GO) terms. We classified 5,475 putative genes into Clusters of Orthologous Groups (COG) and 116 metabolic pathways maps were predicted based on the annotation. Our analyses suggested that the transcriptional specificity increases with ontogeny. For example, out of 33,216 annotated putative genes, 51 were only expressed in larvae, 63 only in pupae and 171 only in adults. Our study illustrates the importance of including samples from several developmental stages when the aim is to provide an integrative and high quality annotated transcriptome. Our results will represent an invaluable resource for those working with the ecology, evolution and pest control of C. maculatus, as well for comparative studies of the transcriptomics and genomics of beetles more generally. PMID:27442123

PuTmiR: A database for extracting neighboring transcription factors of human microRNAs

PubMed Central

2010-01-01

Background Some of the recent investigations in systems biology have revealed the existence of a complex regulatory network between genes, microRNAs (miRNAs) and transcription factors (TFs). In this paper, we focus on TF to miRNA regulation and provide a novel interface for extracting the list of putative TFs for human miRNAs. A putative TF of an miRNA is considered here as those binding within the close genomic locality of that miRNA with respect to its starting or ending base pair on the chromosome. Recent studies suggest that these putative TFs are possible regulators of those miRNAs. Description The interface is built around two datasets that consist of the exhaustive lists of putative TFs binding respectively in the 10 kb upstream region (USR) and downstream region (DSR) of human miRNAs. A web server, named as PuTmiR, is designed. It provides an option for extracting the putative TFs for human miRNAs, as per the requirement of a user, based on genomic locality, i.e., any upstream or downstream region of interest less than 10 kb. The degree distributions of the number of putative TFs and miRNAs against each other for the 10 kb USR and DSR are analyzed from the data and they explore some interesting results. We also report about the finding of a significant regulatory activity of the YY1 protein over a set of oncomiRNAs related to the colon cancer. Conclusion The interface provided by the PuTmiR web server provides an important resource for analyzing the direct and indirect regulation of human miRNAs. While it is already an established fact that miRNAs are regulated by TFs binding to their USR, this database might possibly help to study whether an miRNA can also be regulated by the TFs binding to their DSR. PMID:20398296

Transcriptional Profiles of Mating-Responsive Genes from Testes and Male Accessory Glands of the Mediterranean Fruit Fly, Ceratitis capitata

PubMed Central

Scolari, Francesca; Gomulski, Ludvik M.; Ribeiro, José M. C.; Siciliano, Paolo; Meraldi, Alice; Falchetto, Marco; Bonomi, Angelica; Manni, Mosè; Gabrieli, Paolo; Malovini, Alberto; Bellazzi, Riccardo; Aksoy, Serap; Gasperi, Giuliano; Malacrida, Anna R.

2012-01-01

Background Insect seminal fluid is a complex mixture of proteins, carbohydrates and lipids, produced in the male reproductive tract. This seminal fluid is transferred together with the spermatozoa during mating and induces post-mating changes in the female. Molecular characterization of seminal fluid proteins in the Mediterranean fruit fly, Ceratitis capitata, is limited, although studies suggest that some of these proteins are biologically active. Methodology/Principal Findings We report on the functional annotation of 5914 high quality expressed sequence tags (ESTs) from the testes and male accessory glands, to identify transcripts encoding putative secreted peptides that might elicit post-mating responses in females. The ESTs were assembled into 3344 contigs, of which over 33% produced no hits against the nr database, and thus may represent novel or rapidly evolving sequences. Extraction of the coding sequences resulted in a total of 3371 putative peptides. The annotated dataset is available as a hyperlinked spreadsheet. Four hundred peptides were identified with putative secretory activity, including odorant binding proteins, protease inhibitor domain-containing peptides, antigen 5 proteins, mucins, and immunity-related sequences. Quantitative RT-PCR-based analyses of a subset of putative secretory protein-encoding transcripts from accessory glands indicated changes in their abundance after one or more copulations when compared to virgin males of the same age. These changes in abundance, particularly evident after the third mating, may be related to the requirement to replenish proteins to be transferred to the female. Conclusions/Significance We have developed the first large-scale dataset for novel studies on functions and processes associated with the reproductive biology of Ceratitis capitata. The identified genes may help study genome evolution, in light of the high adaptive potential of the medfly. In addition, studies of male recovery dynamics in terms of accessory gland gene expression profiles and correlated remating inhibition mechanisms may permit the improvement of pest management approaches. PMID:23071645

Transcript Analysis and Regulative Events during Flower Development in Olive (Olea europaea L.).

PubMed

Alagna, Fiammetta; Cirilli, Marco; Galla, Giulio; Carbone, Fabrizio; Daddiego, Loretta; Facella, Paolo; Lopez, Loredana; Colao, Chiara; Mariotti, Roberto; Cultrera, Nicolò; Rossi, Martina; Barcaccia, Gianni; Baldoni, Luciana; Muleo, Rosario; Perrotta, Gaetano

2016-01-01

The identification and characterization of transcripts involved in flower organ development, plant reproduction and metabolism represent key steps in plant phenotypic and physiological pathways, and may generate high-quality transcript variants useful for the development of functional markers. This study was aimed at obtaining an extensive characterization of the olive flower transcripts, by providing sound information on the candidate MADS-box genes related to the ABC model of flower development and on the putative genetic and molecular determinants of ovary abortion and pollen-pistil interaction. The overall sequence data, obtained by pyrosequencing of four cDNA libraries from flowers at different developmental stages of three olive varieties with distinct reproductive features (Leccino, Frantoio and Dolce Agogia), included approximately 465,000 ESTs, which gave rise to more than 14,600 contigs and approximately 92,000 singletons. As many as 56,700 unigenes were successfully annotated and provided gene ontology insights into the structural organization and putative molecular function of sequenced transcripts and deduced proteins in the context of their corresponding biological processes. Differentially expressed genes with potential regulatory roles in biosynthetic pathways and metabolic networks during flower development were identified. The gene expression studies allowed us to select the candidate genes that play well-known molecular functions in a number of biosynthetic pathways and specific biological processes that affect olive reproduction. A sound understanding of gene functions and regulatory networks that characterize the olive flower is provided.

Transcript Analysis and Regulative Events during Flower Development in Olive (Olea europaea L.)

PubMed Central

Alagna, Fiammetta; Cirilli, Marco; Galla, Giulio; Carbone, Fabrizio; Daddiego, Loretta; Facella, Paolo; Lopez, Loredana; Colao, Chiara; Mariotti, Roberto; Cultrera, Nicolò; Rossi, Martina; Barcaccia, Gianni; Baldoni, Luciana; Muleo, Rosario; Perrotta, Gaetano

2016-01-01

The identification and characterization of transcripts involved in flower organ development, plant reproduction and metabolism represent key steps in plant phenotypic and physiological pathways, and may generate high-quality transcript variants useful for the development of functional markers. This study was aimed at obtaining an extensive characterization of the olive flower transcripts, by providing sound information on the candidate MADS-box genes related to the ABC model of flower development and on the putative genetic and molecular determinants of ovary abortion and pollen-pistil interaction. The overall sequence data, obtained by pyrosequencing of four cDNA libraries from flowers at different developmental stages of three olive varieties with distinct reproductive features (Leccino, Frantoio and Dolce Agogia), included approximately 465,000 ESTs, which gave rise to more than 14,600 contigs and approximately 92,000 singletons. As many as 56,700 unigenes were successfully annotated and provided gene ontology insights into the structural organization and putative molecular function of sequenced transcripts and deduced proteins in the context of their corresponding biological processes. Differentially expressed genes with potential regulatory roles in biosynthetic pathways and metabolic networks during flower development were identified. The gene expression studies allowed us to select the candidate genes that play well-known molecular functions in a number of biosynthetic pathways and specific biological processes that affect olive reproduction. A sound understanding of gene functions and regulatory networks that characterize the olive flower is provided. PMID:27077738

The Rsb Phosphoregulatory Network Controls Availability of the Primary Sigma Factor in Chlamydia trachomatis and Influences the Kinetics of Growth and Development

PubMed Central

Thompson, Christopher C.; Griffiths, Cherry; Nicod, Sophie S.; Lowden, Nicole M.; Wigneshweraraj, Sivaramesh; Fisher, Derek J.; McClure, Myra O.

2015-01-01

Chlamydia trachomatis is an obligate intracellular human pathogen that exhibits stage-specific gene transcription throughout a biphasic developmental cycle. The mechanisms that control modulation in transcription and associated phenotypic changes are poorly understood. This study provides evidence that a switch-protein kinase regulatory network controls availability of σ66 , the main sigma subunit for transcription in Chlamydia. In vitro analysis revealed that a putative switch-protein kinase regulator, RsbW, is capable of interacting directly with σ66, as well as phosphorylating its own antagonist, RsbV1, rendering it inactive. Conversely, the putative PP2C-like phosphatase domain of chlamydial RsbU was capable of reverting RsbV1 into its active state. Recent advances in genetic manipulation of Chlamydia were employed to inactivate rsbV1, as well as to increase the expression levels of rsbW or rsbV1, in vivo. Representative σ66-dependent gene transcription was repressed in the absence of rsbV1 or upon increased expression of RsbW, and increased upon elevated expression of RsbV1. These effects on housekeeping transcription were also correlated to several measures of growth and development. A model is proposed where the relative levels of active antagonist (RsbV1) and switch-protein anti-sigma factor (RsbW) control the availability of σ66 and subsequently act as a molecular 'throttle' for Chlamydia growth and development. PMID:26313645

Temporal Dynamics of Host Molecular Responses Differentiate Symptomatic and Asymptomatic Influenza A Infection

PubMed Central

Huang, Yongsheng; Zaas, Aimee K.; Rao, Arvind; Dobigeon, Nicolas; Woolf, Peter J.; Veldman, Timothy; Øien, N. Christine; McClain, Micah T.; Varkey, Jay B.; Nicholson, Bradley; Carin, Lawrence; Kingsmore, Stephen; Woods, Christopher W.; Ginsburg, Geoffrey S.; Hero, Alfred O.

2011-01-01

Exposure to influenza viruses is necessary, but not sufficient, for healthy human hosts to develop symptomatic illness. The host response is an important determinant of disease progression. In order to delineate host molecular responses that differentiate symptomatic and asymptomatic Influenza A infection, we inoculated 17 healthy adults with live influenza (H3N2/Wisconsin) and examined changes in host peripheral blood gene expression at 16 timepoints over 132 hours. Here we present distinct transcriptional dynamics of host responses unique to asymptomatic and symptomatic infections. We show that symptomatic hosts invoke, simultaneously, multiple pattern recognition receptors-mediated antiviral and inflammatory responses that may relate to virus-induced oxidative stress. In contrast, asymptomatic subjects tightly regulate these responses and exhibit elevated expression of genes that function in antioxidant responses and cell-mediated responses. We reveal an ab initio molecular signature that strongly correlates to symptomatic clinical disease and biomarkers whose expression patterns best discriminate early from late phases of infection. Our results establish a temporal pattern of host molecular responses that differentiates symptomatic from asymptomatic infections and reveals an asymptomatic host-unique non-passive response signature, suggesting novel putative molecular targets for both prognostic assessment and ameliorative therapeutic intervention in seasonal and pandemic influenza. PMID:21901105

NAC transcription factor genes: genome-wide identification, phylogenetic, motif and cis-regulatory element analysis in pigeonpea (Cajanus cajan (L.) Millsp.).

PubMed

Satheesh, Viswanathan; Jagannadham, P Tej Kumar; Chidambaranathan, Parameswaran; Jain, P K; Srinivasan, R

2014-12-01

The NAC (NAM, ATAF and CUC) proteins are plant-specific transcription factors implicated in development and stress responses. In the present study 88 pigeonpea NAC genes were identified from the recently published draft genome of pigeonpea by using homology based and de novo prediction programmes. These sequences were further subjected to phylogenetic, motif and promoter analyses. In motif analysis, highly conserved motifs were identified in the NAC domain and also in the C-terminal region of the NAC proteins. A phylogenetic reconstruction using pigeonpea, Arabidopsis and soybean NAC genes revealed 33 putative stress-responsive pigeonpea NAC genes. Several stress-responsive cis-elements were identified through in silico analysis of the promoters of these putative stress-responsive genes. This analysis is the first report of NAC gene family in pigeonpea and will be useful for the identification and selection of candidate genes associated with stress tolerance.

Regulation of Bacteriocin Production in Streptococcus mutans by the Quorum-Sensing System Required for Development of Genetic Competence

PubMed Central

van der Ploeg, Jan R.

2005-01-01

In Streptococcus mutans, competence for genetic transformation and biofilm formation are dependent on the two-component signal transduction system ComDE together with the inducer peptide pheromone competence-stimulating peptide (CSP) (encoded by comC). Here, it is shown that the same system is also required for expression of the nlmAB genes, which encode a two-peptide nonlantibiotic bacteriocin. Expression from a transcriptional nlmAB′-lacZ fusion was highest at high cell density and was increased up to 60-fold following addition of CSP, but it was abolished when the comDE genes were interrupted. Two more genes, encoding another putative bacteriocin and a putative bacteriocin immunity protein, were also regulated by this system. The regions upstream of these genes and of two further putative bacteriocin-encoding genes and a gene encoding a putative bacteriocin immunity protein contained a conserved 9-bp repeat element just upstream of the transcription start, which suggests that expression of these genes is also dependent on the ComCDE regulatory system. Mutations in the repeat element of the nlmAB promoter region led to a decrease in CSP-dependent expression of nlmAB′-lacZ. In agreement with these results, a comDE mutant and mutants unable to synthesize or export CSP did not produce bacteriocins. It is speculated that, at high cell density, bacteriocin production is induced to liberate DNA from competing streptococci. PMID:15937160

Neuropeptide discovery in Eucyclops serrulatus (Crustacea, Copepoda): in silico prediction of the first peptidome for a member of the Cyclopoida.

PubMed

Christie, Andrew E

2015-01-15

Crustaceans of the subclass Copepoda are key components of essentially all aquatic ecosystems as they serve both as the primary consumers of phytoplankton and/or as major food sources for a wide variety of higher-level consumers. The dominant group of copepods in most freshwater ecosystems is the Cyclopoida; members of this order are routinely used as environmental indicators, and some predatory species are used for the biological control of disease-causing mosquitoes. Given their ecological and disease control importance, it is surprising that little is known about endocrine control in cyclopoids. Here, as part of an ongoing effort to identify and characterize the neurochemical signaling systems of members of the Copepoda, the extant transcriptome shotgun assembly for Eucyclops serrulatus, a member of the Cyclopoida, was mined for transcripts encoding putative peptide hormone-encoding transcripts. Via queries using known arthropod pre/preprohormone sequences, primarily ones from other copepod species, 36 E. serrulatus peptide-encoding transcripts were identified. The proteins deduced from these sequences allowed for the prediction of 160 unique mature neuropeptides, including the first copepod isoform of pigment dispersing hormone, as well as isoforms of adipokinetic hormone-corazonin-like peptide, allatostatin A, allatostatin B, allatostatin C, allatotropin, crustacean hyperglycemic hormone, diuretic hormone 31, DXXRLamide, FLRFamide, FXGGXamide, GSEFLamide, insulin-like peptide, intocin, leucokinin, myosuppressin, neuroparsin, neuropeptide F and tachykinin-related peptide. These peptides are currently the only ones known from any member of the Cyclopoida, and as such, provide a new resource for investigating peptidergic signaling in this important copepod order. Copyright © 2014 Elsevier Inc. All rights reserved.

Potassium channels in articular chondrocytes

PubMed Central

Mobasheri, Ali; Lewis, Rebecca; Ferreira-Mendes, Alexandrina; Rufino, Ana; Dart, Caroline; Barrett-Jolley, Richard

2012-01-01

Chondrocytes are the resident cells of cartilage, which synthesize and maintain the extracellular matrix. The range of known potassium channels expressed by these unique cells is continually increasing. Since chondrocytes are non-excitable, and do not need to be repolarized following action potentials, the function of potassium channels in these cells has, until recently, remained completely unknown. However, recent advances in both traditional physiology and “omic” technologies have enhanced our knowledge and understanding of the chondrocyte channelome. A large number of potassium channels have been identified and a number of putative, but credible, functions have been proposed. Members of each of the potassium channel sub-families (calcium activated, inward rectifier, voltage-gated and tandem pore) have all been identified. Mechanotransduction, cell volume regulation, apoptosis and chondrogenesis all appear to involve potassium channels. Since evidence suggests that potassium channel gene transcription is altered in osteoarthritis, future studies are needed that investigate potassium channels as potential cellular biomarkers and therapeutic targets for treatment of degenerative joint conditions. PMID:23064164

Investigating the Role of RIO Protein Kinases in Caenorhabditis elegans

PubMed Central

Raymant, Greta; Bertram, Sonja E.; Esmaillie, Reza; Nadarajan, Saravanapriah; Breugelmans, Bert; Hofmann, Andreas; Gasser, Robin B.; Colaiácovo, Monica P.; Boag, Peter R.

2015-01-01

RIO protein kinases (RIOKs) are a relatively conserved family of enzymes implicated in cell cycle control and ribosomal RNA processing. Despite their functional importance, they remain a poorly understood group of kinases in multicellular organisms. Here, we show that the C. elegans genome contains one member of each of the three RIOK sub-families and that each of the genes coding for them has a unique tissue expression pattern. Our analysis showed that the gene encoding RIOK-1 (riok-1) was broadly and strongly expressed. Interestingly, the intestinal expression of riok-1 was dependent upon two putative binding sites for the oxidative and xenobiotic stress response transcription factor SKN-1. RNA interference (RNAi)-mediated knock down of riok-1 resulted in germline defects, including defects in germ line stem cell proliferation, oocyte maturation and the production of endomitotic oocytes. Taken together, our findings indicate new functions for RIOK-1 in post mitotic tissues and in reproduction. PMID:25688864

CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats.

PubMed

Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine

2007-07-01

Clustered regularly interspaced short palindromic repeats (CRISPRs) constitute a particular family of tandem repeats found in a wide range of prokaryotic genomes (half of eubacteria and almost all archaea). They consist of a succession of highly conserved regions (DR) varying in size from 23 to 47 bp, separated by similarly sized unique sequences (spacer) of usually viral origin. A CRISPR cluster is flanked on one side by an AT-rich sequence called the leader and assumed to be a transcriptional promoter. Recent studies suggest that this structure represents a putative RNA-interference-based immune system. Here we describe CRISPRFinder, a web service offering tools to (i) detect CRISPRs including the shortest ones (one or two motifs); (ii) define DRs and extract spacers; (iii) get the flanking sequences to determine the leader; (iv) blast spacers against Genbank database and (v) check if the DR is found elsewhere in prokaryotic sequenced genomes. CRISPRFinder is freely accessible at http://crispr.u-psud.fr/Server/CRISPRfinder.php.

Films of Bacteria at Interfaces (FBI): Remodeling of Fluid Interfaces by Pseudomonas aeruginosa.

PubMed

Niepa, Tagbo H R; Vaccari, Liana; Leheny, Robert L; Goulian, Mark; Lee, Daeyeon; Stebe, Kathleen J

2017-12-19

Bacteria at fluid interfaces endure physical and chemical stresses unique to these highly asymmetric environments. The responses of Pseudomonas aeruginosa PAO1 and PA14 to a hexadecane-water interface are compared. PAO1 cells form elastic films of bacteria, excreted polysaccharides and proteins, whereas PA14 cells move actively without forming an elastic film. Studies of PAO1 mutants show that, unlike solid-supported biofilms, elastic interfacial film formation occurs in the absence of flagella, pili, or certain polysaccharides. Highly induced genes identified in transcriptional profiling include those for putative enzymes and a carbohydrate metabolism enzyme, alkB2; this latter gene is not upregulated in PA14 cells. Notably, PAO1 mutants lacking the alkB2 gene fail to form an elastic layer. Rather, they form an active film like that formed by PA14. These findings demonstrate that genetic expression is altered by interfacial confinement, and suggest that the ability to metabolize alkanes may play a role in elastic film formation at oil-water interfaces.

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

Circadian signaling in Homarus americanus: Region-specific de novo assembled transcriptomes show that both the brain and eyestalk ganglia possess the molecular components of a putative clock system.

PubMed

Christie, Andrew E; Yu, Andy; Pascual, Micah G; Roncalli, Vittoria; Cieslak, Matthew C; Warner, Amanda N; Lameyer, Tess J; Stanhope, Meredith E; Dickinson, Patsy S; Joe Hull, J

2018-04-11

Essentially all organisms exhibit recurring patterns of physiology/behavior that oscillate with a period of ~24-h and are synchronized to the solar day. Crustaceans are no exception, with robust circadian rhythms having been documented in many members of this arthropod subphylum. However, little is known about the molecular underpinnings of their circadian rhythmicity. Moreover, the location of the crustacean central clock has not been firmly established, although both the brain and eyestalk ganglia have been hypothesized as loci. The American lobster, Homarus americanus, is known to exhibit multiple circadian rhythms, and immunodetection data suggest that its central clock is located within the eyestalk ganglia rather than in the brain. Here, brain- and eyestalk ganglia-specific transcriptomes were generated and used to assess the presence/absence of transcripts encoding the commonly recognized protein components of arthropod circadian signaling systems in these two regions of the lobster central nervous system. Transcripts encoding putative homologs of the core clock proteins clock, cryptochrome 2, cycle, period and timeless were found in both the brain and eyestalk ganglia assemblies, as were transcripts encoding similar complements of putative clock-associated, clock input pathway and clock output pathway proteins. The presence and identity of transcripts encoding core clock proteins in both regions were confirmed using PCR. These findings suggest that both the brain and eyestalk ganglia possess all of the molecular components needed for the establishment of a circadian signaling system. Whether the brain and eyestalk clocks are independent of one another or represent a single timekeeping system remains to be determined. Interestingly, while most of the proteins deduced from the identified transcripts are shared by both the brain and eyestalk ganglia, assembly-specific isoforms were also identified, e.g., several period variants, suggesting the possibility of region-specific variation in clock function, especially if the brain and eyestalk clocks represent independent oscillators. Copyright © 2018 Elsevier B.V. All rights reserved.

The Complete Genomic Sequence of Pepper Yellow Leaf Curl Virus (PYLCV) and Its Implications for Our Understanding of Evolution Dynamics in the Genus Polerovirus

PubMed Central

Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel

2013-01-01

We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range. PMID:23936244

The complete genomic sequence of pepper yellow leaf curl virus (PYLCV) and its implications for our understanding of evolution dynamics in the genus polerovirus.

PubMed

Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel

2013-01-01

We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range.

Characterizing the Grape Transcriptome. Analysis of Expressed Sequence Tags from Multiple Vitis Species and Development of a Compendium of Gene Expression during Berry Development1[w

PubMed Central

Silva, Francisco Goes da; Iandolino, Alberto; Al-Kayal, Fadi; Bohlmann, Marlene C.; Cushman, Mary Ann; Lim, Hyunju; Ergul, Ali; Figueroa, Rubi; Kabuloglu, Elif K.; Osborne, Craig; Rowe, Joan; Tattersall, Elizabeth; Leslie, Anna; Xu, Jane; Baek, JongMin; Cramer, Grant R.; Cushman, John C.; Cook, Douglas R.

2005-01-01

We report the analysis and annotation of 146,075 expressed sequence tags from Vitis species. The majority of these sequences were derived from different cultivars of Vitis vinifera, comprising an estimated 25,746 unique contig and singleton sequences that survey transcription in various tissues and developmental stages and during biotic and abiotic stress. Putatively homologous proteins were identified for over 17,752 of the transcripts, with 1,962 transcripts further subdivided into one or more Gene Ontology categories. A simple structured vocabulary, with modules for plant genotype, plant development, and stress, was developed to describe the relationship between individual expressed sequence tags and cDNA libraries; the resulting vocabulary provides query terms to facilitate data mining within the context of a relational database. As a measure of the extent to which characterized metabolic pathways were encompassed by the data set, we searched for homologs of the enzymes leading from glycolysis, through the oxidative/nonoxidative pentose phosphate pathway, and into the general phenylpropanoid pathway. Homologs were identified for 65 of these 77 enzymes, with 86% of enzymatic steps represented by paralogous genes. Differentially expressed transcripts were identified by means of a stringent believability index cutoff of ≥98.4%. Correlation analysis and two-dimensional hierarchical clustering grouped these transcripts according to similarity of expression. In the broadest analysis, 665 differentially expressed transcripts were identified across 29 cDNA libraries, representing a range of developmental and stress conditions. The groupings revealed expected associations between plant developmental stages and tissue types, with the notable exception of abiotic stress treatments. A more focused analysis of flower and berry development identified 87 differentially expressed transcripts and provides the basis for a compendium that relates gene expression and annotation to previously characterized aspects of berry development and physiology. Comparison with published results for select genes, as well as correlation analysis between independent data sets, suggests that the inferred in silico patterns of expression are likely to be an accurate representation of transcript abundance for the conditions surveyed. Thus, the combined data set reveals the in silico expression patterns for hundreds of genes in V. vinifera, the majority of which have not been previously studied within this species. PMID:16219919

Identification of the genes involved in odorant reception and detection in the palm weevil Rhynchophorus ferrugineus, an important quarantine pest, by antennal transcriptome analysis.

PubMed

Antony, Binu; Soffan, Alan; Jakše, Jernej; Abdelazim, Mahmoud M; Aldosari, Saleh A; Aldawood, Abdulrahman S; Pain, Arnab

2016-01-22

The Red Palm Weevil (RPW) Rhynchophorus ferrugineus (Oliver) is one of the most damaging invasive insect species in the world. This weevil is highly specialized to thrive in adverse desert climates, and it causes major economic losses due to its effects on palm trees around the world. RPWs locate palm trees by means of plant volatile cues and use an aggregation pheromone to coordinate a mass-attack. Here we report on the high throughput sequencing of the RPW antennal transcriptome and present a description of the highly expressed chemosensory gene families. Deep sequencing and assembly of the RPW antennal transcriptome yielded 35,667 transcripts with an average length of 857 bp and identified a large number of highly expressed transcripts of odorant binding proteins (OBPs), chemosensory proteins (CSPs), odorant receptors/co-receptors (ORs/Orcos), sensory neuron membrane proteins (SNMPs), gustatory receptors (GRs) and ionotropic receptors (IRs). In total, 38 OBPs, 12 CSPs, 76 ORs, 1 Orco, 6 SNMPs, 15 GRs and 10 IRs were annotated in the R. ferrugineus antennal transcriptome. A comparative transcriptome analysis with the bark beetle showed that 25% of the blast hits were unique to R. ferrugineus, indicating a higher, more complete transcript coverage for R. ferrugineus. We categorized the RPW ORs into seven subfamilies of coleopteran ORs and predicted two new subfamilies of ORs. The OR protein sequences were compared with those of the flour beetle, the cerambycid beetle and the bark beetle, and we identified coleopteran-specific, highly conserved ORs as well as unique ORs that are putatively involved in RPW aggregation pheromone detection. We identified 26 Minus-C OBPs and 8 Plus-C OBPs and grouped R. ferrugineus OBPs into different OBP-subfamilies according to phylogeny, which indicated significant species-specific expansion and divergence in R. ferrugineus. We also identified a diverse family of CSP proteins, as well as a coleopteran-specific CSP lineage that diverged from Diptera and Lepidoptera. We identified several extremely diverged IR orthologues as well as highly conserved insect IR co-receptor orthologous transcripts in R. ferrugineus. Notably, GR orthologous transcripts for CO2-sensing and sweet tastants were identified in R. ferrugineus, and we found a great diversity of GRs within the coleopteran family. With respect to SNMP-1 and SNMP-2 orthologous transcripts, one SNMP-1 orthologue was found to be strikingly highly expressed in the R. ferrugineus antennal transcriptome. Our study presents the first comprehensive catalogue of olfactory gene families involved in pheromone and general odorant detection in R. ferrugineus, which are potential novel targets for pest control strategies.

Transcription of the Streptococcus pyogenes Hyaluronic Acid Capsule Biosynthesis Operon Is Regulated by Previously Unknown Upstream Elements

PubMed Central

Falaleeva, Marina; Zurek, Oliwia W.; Watkins, Robert L.; Reed, Robert W.; Ali, Hadeel; Sumby, Paul; Voyich, Jovanka M.

2014-01-01

The important human pathogen Streptococcus pyogenes (group A Streptococcus [GAS]) produces a hyaluronic acid (HA) capsule that plays critical roles in immune evasion. Previous studies showed that the hasABC operon encoding the capsule biosynthesis enzymes is under the control of a single promoter, P1, which is negatively regulated by the two-component regulatory system CovR/S. In this work, we characterize the sequence upstream of P1 and identify a novel regulatory region controlling transcription of the capsule biosynthesis operon in the M1 serotype strain MGAS2221. This region consists of a promoter, P2, which initiates transcription of a novel small RNA, HasS, an intrinsic transcriptional terminator that inefficiently terminates HasS, permitting read-through transcription of hasABC, and a putative promoter which lies upstream of P2. Electrophoretic mobility shift assays, quantitative reverse transcription-PCR, and transcriptional reporter data identified CovR as a negative regulator of P2. We found that the P1 and P2 promoters are completely repressed by CovR, and capsule expression is regulated by the putative promoter upstream of P2. Deletion of hasS or of the terminator eliminates CovR-binding sequences, relieving repression and increasing read-through, hasA transcription, and capsule production. Sequence analysis of 44 GAS genomes revealed a high level of polymorphism in the HasS sequence region. Most of the HasS variations were located in the terminator sequences, suggesting that this region is under strong selective pressure. We discovered that the terminator deletion mutant is highly resistant to neutrophil-mediated killing and is significantly more virulent in a mouse model of GAS invasive disease than the wild-type strain. Together, these results are consistent with the naturally occurring mutations in this region modulating GAS virulence. PMID:25287924

MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

2004-10-28

We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

The AICD interacting protein DAB1 is up-regulated in Alzheimer frontal cortex brain samples and causes deregulation of proteins involved in gene expression changes.

PubMed

Müller, T; Loosse, C; Schrötter, A; Schnabel, A; Helling, S; Egensperger, R; Marcus, K

2011-08-01

AICD is the intracellular subdomain of the amyloid precursor protein thought to play a pivotal role as a potential transcription factor that might be of relevance for the pathophysiology of Alzheimer's disease. For its signal transduction potential AICD requires interacting proteins like FE65 and TIP60. However, many other proteins were described being able to bind to AICD. Here, we studied mRNA levels of AICD interacting proteins and found one of them (DAB1) strongly up-regulated in human post-mortem frontal cortex brain samples of AD patients. Subsequent cell culture experiments revealed that elevated DAB1 level results in the deregulation of the cellular proteome. We found the proliferation associated protein 2G4 as well as the guanine monophosphate synthetase (GMPS) significantly up-regulated in DAB1 over-expressing cells. Both proteins can be involved in cellular transcription processes supporting the hypothesis that DAB1 acts via modification of the AICD-dependent transcriptionally active complex. Of note, expression of the three components of the putative transcription complex (AICD, FE65, and TIP60 (AFT)) also revealed deregulation of the GMPS protein in an opposite fashion. Our results point to a putative relevance of AICD-dependent mechanisms in AD, caused by protein abundance changes of AICD interacting proteins, as shown for DAB1 in this work.

Overexpression of a cotton gene that encodes a putative transcription factor of AP2/EREBP family in Arabidopsis affects growth and development of transgenic plants.

PubMed

Zhou, Ying; Xia, Hui; Li, Xiao-Jie; Hu, Rong; Chen, Yun; Li, Xue-Bao

2013-01-01

In the study, a gene encoding a putative ethylene response factor of AP2/EREBP family was isolated from cotton (Gossypium hirsutum) and designated as GhERF12. Sequence alignment showed that GhERF12 protein contains a central AP2/ERF domain (58 amino acids) with two functional conserved amino acid residues (ala14 and asp19). Transactivation assay indicated that GhERF12 displayed strong transcription activation activity in yeast cells, suggesting that this protein may be a transcriptional activator in cotton. Quantitative RT-PCR analysis showed that GhERF12 expression in cotton was induced by ACC and IAA. Overexpression of GhERF12 in Arabidopsis affected seedling growth and development. The GhERF12 transgenic plants grew slowly, and displayed a dwarf phenotype. The mean bolting time of the transgenic plants was delayed for about 10 days, compared with that of wild type. Further study revealed that some ethylene-related and auxin-related genes were dramatically up-regulated in the transgenic plants, compared with those of wild type. Collectively, we speculated that GhERF12, as a transcription factor, may be involved in regulation of plant growth and development by activating the constitutive ethylene response likely related to auxin biosynthesis and/or signaling.

NSR-seq transcriptional profiling enables identification of a gene signature of Plasmodium falciparum parasites infecting children.

PubMed

Vignali, Marissa; Armour, Christopher D; Chen, Jingyang; Morrison, Robert; Castle, John C; Biery, Matthew C; Bouzek, Heather; Moon, Wonjong; Babak, Tomas; Fried, Michal; Raymond, Christopher K; Duffy, Patrick E

2011-03-01

Malaria caused by Plasmodium falciparum results in approximately 1 million annual deaths worldwide, with young children and pregnant mothers at highest risk. Disease severity might be related to parasite virulence factors, but expression profiling studies of parasites to test this hypothesis have been hindered by extensive sequence variation in putative virulence genes and a preponderance of host RNA in clinical samples. We report here the application of RNA sequencing to clinical isolates of P. falciparum, using not-so-random (NSR) primers to successfully exclude human ribosomal RNA and globin transcripts and enrich for parasite transcripts. Using NSR-seq, we confirmed earlier microarray studies showing upregulation of a distinct subset of genes in parasites infecting pregnant women, including that encoding the well-established pregnancy malaria vaccine candidate var2csa. We also describe a subset of parasite transcripts that distinguished parasites infecting children from those infecting pregnant women and confirmed this observation using quantitative real-time PCR and mass spectrometry proteomic analyses. Based on their putative functional properties, we propose that these proteins could have a role in childhood malaria pathogenesis. Our study provides proof of principle that NSR-seq represents an approach that can be used to study clinical isolates of parasites causing severe malaria syndromes as well other blood-borne pathogens and blood-related diseases.

Overexpression of a Cotton Gene That Encodes a Putative Transcription Factor of AP2/EREBP Family in Arabidopsis Affects Growth and Development of Transgenic Plants

PubMed Central

Li, Xiao-Jie; Hu, Rong; Chen, Yun; Li, Xue-Bao

2013-01-01

In the study, a gene encoding a putative ethylene response factor of AP2/EREBP family was isolated from cotton (Gossypium hirsutum) and designated as GhERF12. Sequence alignment showed that GhERF12 protein contains a central AP2/ERF domain (58 amino acids) with two functional conserved amino acid residues (ala14 and asp19). Transactivation assay indicated that GhERF12 displayed strong transcription activation activity in yeast cells, suggesting that this protein may be a transcriptional activator in cotton. Quantitative RT-PCR analysis showed that GhERF12 expression in cotton was induced by ACC and IAA. Overexpression of GhERF12 in Arabidopsis affected seedling growth and development. The GhERF12 transgenic plants grew slowly, and displayed a dwarf phenotype. The mean bolting time of the transgenic plants was delayed for about 10 days, compared with that of wild type. Further study revealed that some ethylene-related and auxin-related genes were dramatically up-regulated in the transgenic plants, compared with those of wild type. Collectively, we speculated that GhERF12, as a transcription factor, may be involved in regulation of plant growth and development by activating the constitutive ethylene response likely related to auxin biosynthesis and/or signaling. PMID:24194949

Dynamic gene expression changes precede dioxin-induced liver pathogenesis in medaka fish.

PubMed

Volz, David C; Hinton, David E; Law, J McHugh; Kullman, Seth W

2006-02-01

A major challenge for environmental genomics is linking gene expression to cellular toxicity and morphological alteration. Herein, we address complexities related to hepatic gene expression responses after a single injection of the aryl hydrocarbon receptor (AHR) agonist 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) and illustrate an initial stress response followed by cytologic and adaptive changes in the teleost fish medaka. Using a custom 175-gene array, we find that overall hepatic gene expression and histological changes are strongly dependent on dose and time. The most pronounced dioxin-induced gene expression changes occurred early and preceded morphologic alteration in the liver. Following a systematic search for putative Ah response elements (AHREs) (5'-CACGCA-3') within 2000 bp upstream of the predicted transcriptional start site, the majority (87%) of genes screened in this study did not contain an AHRE, suggesting that gene expression was not solely dependent on AHRE-mediated transcription. Moreover, in the highest dosage, we observed gene expression changes associated with adaptation that persisted for almost two weeks, including induction of a gene putatively identified as ependymin that may function in hepatic injury repair. These data suggest that the cellular response to dioxin involves both AHRE- and non-AHRE-mediated transcription, and that coupling gene expression profiling with analysis of morphologic pathogenesis is essential for establishing temporal relationships between transcriptional changes, toxicity, and adaptation to hepatic injury.

NSR-seq transcriptional profiling enables identification of a gene signature of Plasmodium falciparum parasites infecting children

PubMed Central

Vignali, Marissa; Armour, Christopher D.; Chen, Jingyang; Morrison, Robert; Castle, John C.; Biery, Matthew C.; Bouzek, Heather; Moon, Wonjong; Babak, Tomas; Fried, Michal; Raymond, Christopher K.; Duffy, Patrick E.

2011-01-01

Malaria caused by Plasmodium falciparum results in approximately 1 million annual deaths worldwide, with young children and pregnant mothers at highest risk. Disease severity might be related to parasite virulence factors, but expression profiling studies of parasites to test this hypothesis have been hindered by extensive sequence variation in putative virulence genes and a preponderance of host RNA in clinical samples. We report here the application of RNA sequencing to clinical isolates of P. falciparum, using not-so-random (NSR) primers to successfully exclude human ribosomal RNA and globin transcripts and enrich for parasite transcripts. Using NSR-seq, we confirmed earlier microarray studies showing upregulation of a distinct subset of genes in parasites infecting pregnant women, including that encoding the well-established pregnancy malaria vaccine candidate var2csa. We also describe a subset of parasite transcripts that distinguished parasites infecting children from those infecting pregnant women and confirmed this observation using quantitative real-time PCR and mass spectrometry proteomic analyses. Based on their putative functional properties, we propose that these proteins could have a role in childhood malaria pathogenesis. Our study provides proof of principle that NSR-seq represents an approach that can be used to study clinical isolates of parasites causing severe malaria syndromes as well other blood-borne pathogens and blood-related diseases. PMID:21317536

Transcriptome and gene expression analysis during flower blooming in Rosa chinensis 'Pallida'.

PubMed

Yan, Huijun; Zhang, Hao; Chen, Min; Jian, Hongying; Baudino, Sylvie; Caissard, Jean-Claude; Bendahmane, Mohammed; Li, Shubin; Zhang, Ting; Zhou, Ningning; Qiu, Xianqin; Wang, Qigang; Tang, Kaixue

2014-04-25

Rosa chinensis 'Pallida' (Rosa L.) is one of the most important ancient rose cultivars originating from China. It contributed the 'tea scent' trait to modern roses. However, little information is available on the gene regulatory networks involved in scent biosynthesis and metabolism in Rosa. In this study, the transcriptome of R. chinensis 'Pallida' petals at different developmental stages, from flower buds to senescent flowers, was investigated using Illumina sequencing technology. De novo assembly generated 89,614 clusters with an average length of 428bp. Based on sequence similarity search with known proteins, 62.9% of total clusters were annotated. Out of these annotated transcripts, 25,705 and 37,159 sequences were assigned to gene ontology and clusters of orthologous groups, respectively. The dataset provides information on transcripts putatively associated with known scent metabolic pathways. Digital gene expression (DGE) was obtained using RNA samples from flower bud, open flower and senescent flower stages. Comparative DGE and quantitative real time PCR permitted the identification of five transcripts encoding proteins putatively associated with scent biosynthesis in roses. The study provides a foundation for scent-related gene discovery in roses. Copyright © 2014. Published by Elsevier B.V.

White collar 2, a partner in blue-light signal transduction, controlling expression of light-regulated genes in Neurospora crassa.

PubMed Central

Linden, H; Macino, G

1997-01-01

A saturating genetic dissection of 'blind' mutants in Neurospora crassa has identified a total of two non-redundant loci (wc-1 and wc-2) each of which is required for blue-light perception/signal transduction. Previously, we demonstrated that WC1 is a putative zinc finger transcription factor able to bind specifically to a light-regulated promoter. Here, we present the cloning and characterization of the wc-2 gene. We demonstrate using mutation analysis and in vitro DNA-binding assays that WC2, the second partner of this light signal transduction system, encodes a functional zinc finger DNA-binding protein with putative PAS dimerization and transcription activation domains. This molecular genetic dissection of the second of two components of this light signal transduction system has enabled us to devise a model whereby WC1 and WC2 are proposed to interact via homologous PAS domains, bind to promoters of light-regulated genes and activate transcription. As such, this study provides the first insight into two co-operating partners in blue-light signal transduction in any organism and describes the molecular tools with which to dissect this enigmatic process. PMID:9009271

Identification of Candidate Transcription Factor Binding Sites in the Cattle Genome

PubMed Central

Bickhart, Derek M.; Liu, George E.

2013-01-01

A resource that provides candidate transcription factor binding sites (TFBSs) does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future omics studies to develop transcriptional regulation hypotheses. In order to generate this resource, we employed a phylogenetic footprinting approach—using sequence conservation across cattle, human and dog—and position-specific scoring matrices to identify 379,333 putative TFBSs upstream of nearly 8000 Mammalian Gene Collection (MGC) annotated genes within the cattle genome. Comparisons of our predictions to known binding site loci within the PCK1, ACTA1 and G6PC promoter regions revealed 75% sensitivity for our method of discovery. Additionally, we intersected our predictions with known cattle SNP variants in dbSNP and on the Illumina BovineHD 770k and Bos 1 SNP chips, finding 7534, 444 and 346 overlaps, respectively. Due to our stringent filtering criteria, these results represent high quality predictions of putative TFBSs within the cattle genome. All binding site predictions are freely available at http://bfgl.anri.barc.usda.gov/BovineTFBS/ or http://199.133.54.77/BovineTFBS. PMID:23433959

Genomic dissection of conserved transcriptional regulation in intestinal epithelial cells

PubMed Central

Camp, J. Gray; Weiser, Matthew; Cocchiaro, Jordan L.; Kingsley, David M.; Furey, Terrence S.; Sheikh, Shehzad Z.; Rawls, John F.

2017-01-01

The intestinal epithelium serves critical physiologic functions that are shared among all vertebrates. However, it is unknown how the transcriptional regulatory mechanisms underlying these functions have changed over the course of vertebrate evolution. We generated genome-wide mRNA and accessible chromatin data from adult intestinal epithelial cells (IECs) in zebrafish, stickleback, mouse, and human species to determine if conserved IEC functions are achieved through common transcriptional regulation. We found evidence for substantial common regulation and conservation of gene expression regionally along the length of the intestine from fish to mammals and identified a core set of genes comprising a vertebrate IEC signature. We also identified transcriptional start sites and other putative regulatory regions that are differentially accessible in IECs in all 4 species. Although these sites rarely showed sequence conservation from fish to mammals, surprisingly, they drove highly conserved IEC expression in a zebrafish reporter assay. Common putative transcription factor binding sites (TFBS) found at these sites in multiple species indicate that sequence conservation alone is insufficient to identify much of the functionally conserved IEC regulatory information. Among the rare, highly sequence-conserved, IEC-specific regulatory regions, we discovered an ancient enhancer upstream from her6/HES1 that is active in a distinct population of Notch-positive cells in the intestinal epithelium. Together, these results show how combining accessible chromatin and mRNA datasets with TFBS prediction and in vivo reporter assays can reveal tissue-specific regulatory information conserved across 420 million years of vertebrate evolution. We define an IEC transcriptional regulatory network that is shared between fish and mammals and establish an experimental platform for studying how evolutionarily distilled regulatory information commonly controls IEC development and physiology. PMID:28850571

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

PubMed Central

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

Evidence for triclosan-induced activation of human and rodent xenobiotic nuclear receptors

EPA Science Inventory

The bacteriostat triclosan (2,4,40-trichloro-20-hydroxydiphenylether) (TCS) decreases rat serum thyroxine via putative nuclear receptor (NR) interaction(s) and subsequent transcriptional up-regulation of hepatic catabolism and clearance. However, due to the evolutionary divergenc...

Cloning and characterization of the ONAC106 gene from Oryza sativa cultivar Kuku Belang

NASA Astrophysics Data System (ADS)

Basri, Khairunnisa; Sukiran, Noor Liyana; Zainal, Zamri

2016-11-01

Plants possess different mechanisms in stress response, where induction of stress-responsive genes provides tolerance to unfavorable conditions. Stress-responsive genes are characterized for functional and regulatory genes that help in overcoming stress by molecular, biochemical and morphological adaptations. NAC transcription factors are one of the regulatory proteins that involved in stress signaling pathway. A putative NAC transcription factor, ONAC016 was identified from drought transcriptomic data. Our data suggested that ONAC106 was induced by drought, but its function in abiotic stress is still unclear. In silico analysis of ONAC106 showed that this gene encodes 334 amino acids, and its protein consists of NAM (No Apical Meristem) domain. The orthologue of ONAC106 was present in several Poaceae family members, suggesting that ONAC106 is unique to monocot plants only. We found that ONAC106 was induced by salt and cold stresses, indicating that this gene involves in abiotic stress response. In addition, we also found that ONAC106 might function in defense response to pathogen invasion. The ABRE (Abscisic Acid Regulatory Element) cis-element was identified in the promoter region of ONAC106, suggesting that it may involve in the abscisic acid (ABA)-dependent signaling pathway. Based on this preliminary result, we hypothesize that ONAC106 may play a role in abiotic stress response by regulating ABA-responsive genes.

miRvestigator: web application to identify miRNAs responsible for co-regulated gene expression patterns discovered through transcriptome profiling.

PubMed

Plaisier, Christopher L; Bare, J Christopher; Baliga, Nitin S

2011-07-01

Transcriptome profiling studies have produced staggering numbers of gene co-expression signatures for a variety of biological systems. A significant fraction of these signatures will be partially or fully explained by miRNA-mediated targeted transcript degradation. miRvestigator takes as input lists of co-expressed genes from Caenorhabditis elegans, Drosophila melanogaster, G. gallus, Homo sapiens, Mus musculus or Rattus norvegicus and identifies the specific miRNAs that are likely to bind to 3' un-translated region (UTR) sequences to mediate the observed co-regulation. The novelty of our approach is the miRvestigator hidden Markov model (HMM) algorithm which systematically computes a similarity P-value for each unique miRNA seed sequence from the miRNA database miRBase to an overrepresented sequence motif identified within the 3'-UTR of the query genes. We have made this miRNA discovery tool accessible to the community by integrating our HMM algorithm with a proven algorithm for de novo discovery of miRNA seed sequences and wrapping these algorithms into a user-friendly interface. Additionally, the miRvestigator web server also produces a list of putative miRNA binding sites within 3'-UTRs of the query transcripts to facilitate the design of validation experiments. The miRvestigator is freely available at http://mirvestigator.systemsbiology.net.

Molecular cloning and tissue-specific transcriptional regulation of the first peroxidase family member, Udp1, in stinging nettle (Urtica dioica).

PubMed

Douroupi, Triantafyllia G; Papassideri, Issidora S; Stravopodis, Dimitrios J; Margaritis, Lukas H

2005-12-05

A full-length cDNA clone, designated Udp1, was isolated from Urtica dioica (stinging nettle), using a polymerase chain reaction based strategy. The putative Udp1 protein is characterized by a cleavable N-terminal signal sequence, likely responsible for the rough endoplasmic reticulum entry and a 310 amino acids mature protein, containing all the important residues, which are evolutionary conserved among different members of the plant peroxidase family. A unique structural feature of the Udp1 peroxidase is defined into the short carboxyl-terminal extension, which could be associated with the vacuolar targeting process. Udp1 peroxidase is differentially regulated at the transcriptional level and is specifically expressed in the roots. Interestingly, wounding and ultraviolet radiation stress cause an ectopic induction of the Udp1 gene expression in the aerial parts of the plant. A genomic DNA fragment encoding the Udp1 peroxidase was also cloned and fully sequenced, revealing a structural organization of three exons and two introns. The phylogenetic relationships of the Udp1 protein to the Arabidopsis thaliana peroxidase family members were also examined and, in combination with the homology modelling approach, dictated the presence of distinct structural elements, which could be specifically involved in the determination of substrate recognition and subcellular localization of the Udp1 peroxidase.

Response of Desulfovibrio vulgaris to Alkaline Stress▿ †

PubMed Central

Stolyar, Sergey; He, Qiang; Joachimiak, Marcin P.; He, Zhili; Yang, Zamin Koo; Borglin, Sharon E.; Joyner, Dominique C.; Huang, Katherine; Alm, Eric; Hazen, Terry C.; Zhou, Jizhong; Wall, Judy D.; Arkin, Adam P.; Stahl, David A.

2007-01-01

The response of exponentially growing Desulfovibrio vulgaris Hildenborough to pH 10 stress was studied using oligonucleotide microarrays and a study set of mutants with genes suggested by microarray data to be involved in the alkaline stress response deleted. The data showed that the response of D. vulgaris to increased pH is generally similar to that of Escherichia coli but is apparently controlled by unique regulatory circuits since the alternative sigma factors (sigma S and sigma E) contributing to this stress response in E. coli appear to be absent in D. vulgaris. Genes previously reported to be up-regulated in E. coli were up-regulated in D. vulgaris; these genes included three ATPase genes and a tryptophan synthase gene. Transcription of chaperone and protease genes (encoding ATP-dependent Clp and La proteases and DnaK) was also elevated in D. vulgaris. As in E. coli, genes involved in flagellum synthesis were down-regulated. The transcriptional data also identified regulators, distinct from sigma S and sigma E, that are likely part of a D. vulgaris Hildenborough-specific stress response system. Characterization of a study set of mutants with genes implicated in alkaline stress response deleted confirmed that there was protective involvement of the sodium/proton antiporter NhaC-2, tryptophanase A, and two putative regulators/histidine kinases (DVU0331 and DVU2580). PMID:17921288

Long noncoding RNAs (lncRNAs) dynamics evidence immunomodulation during ISAV-Infected Atlantic salmon (Salmo salar)

PubMed Central

Boltaña, Sebastian; Valenzuela-Miranda, Diego; Aguilar, Andrea; Mackenzie, Simon; Gallardo-Escárate, Cristian

2016-01-01

Despite evidence for participation in the host response to infection, the roles of many long non-coding RNAs (lncRNAs) remain unknown. Therefore, the aims of this study were to identify lncRNAs in Atlantic salmon (Salmo salar) and evaluate their transcriptomic regulation during ISA virus (ISAV) infection, an Orthomyxoviridae virus associated with high mortalities in salmonid aquaculture. Using next-generation sequencing, whole-transcriptome analysis of the Salmo salar response to ISAV infection was performed, identifying 5,636 putative lncRNAs with a mean length of 695 base pairs. The transcriptional modulation evidenced a similar number of differentially expressed lncRNAs in the gills (3,294), head-kidney (3,275), and liver (3,325) over the course of the infection. Moreover, analysis of a subset of these lncRNAs showed the following: (i) Most were similarly regulated in response to ISA virus infection; (ii) The transcript subsets were uniquely modulated in each tissue (gills, liver, and head-kidney); and (iii) A subset of lncRNAs were upregulated for each tissue and time analysed, indicating potential markers for ISAV infection. These findings represent the first discovery of widespread differential expression of lncRNAs in response to virus infection in non-model species, suggesting that lncRNAs could be involved in regulating the host response during ISAV infection. PMID:26939752

Amblyomma maculatum SECIS binding protein 2 and putative selenoprotein P are indispensable for pathogen replication and tick fecundity.

PubMed

Budachetri, Khemraj; Crispell, Gary; Karim, Shahid

2017-09-01

Selenium, a vital trace element, is incorporated into selenoproteins to produce selenocysteine. Our previous studies have revealed an adaptive co-evolutionary process that has enabled the spotted fever-causing tick-borne pathogen Rickettsia parkeri to survive by manipulating an antioxidant defense system associated with selenium, which includes a full set of selenoproteins and other antioxidants in ticks. Here, we conducted a systemic investigation of SECIS binding protein 2 (SBP2) and putative selenoprotein P (SELENOP) by transcript silencing in adult female Gulf-coast ticks (Amblyomma maculatum). Knockdown of the SBP2 and SELENOP genes depleted the respective transcript levels of these tick selenogenes, and caused differential regulation of other antioxidants. Importantly, the selenium level in the immature and mature tick stages increased significantly after a blood meal, but the selenium level decreased in ticks after the SBP2 and SELENOP knockdowns. Moreover, the SBP2 knockdown significantly impaired both transovarial transmission of R. parkeri to tick eggs and egg hatching. Overall, our data offer new insight into the relationship between the SBP2 selenoprotein synthesis gene and the putative tick SELENOP gene. It also augments our understanding of selenoprotein synthesis, selenium maintenance and utilization, and bacterial colonization of a tick vector. Copyright © 2017 Elsevier Ltd. All rights reserved.

Pea3 transcription factor promotes neurite outgrowth

PubMed Central

Kandemir, Basak; Caglayan, Berrak; Hausott, Barbara; Erdogan, Burcu; Dag, Ugur; Demir, Ozlem; Sogut, Melis S.; Klimaschewski, Lars; Kurnaz, Isil A.

2014-01-01

Pea3 subfamily of E–twenty six transcription factors consist of three major -exhibit branching morphogenesis, the function of Pea3 family in nervous system development and regeneration is only beginning to unfold. In this study, we provide evidence that Pea3 can directs neurite extension and axonal outgrowth in different model systems, and that Serine 90 is important for this function. We have also identified neurofilament-L and neurofilament-M as two putative novel targets for Pea3. PMID:25018694

Identification of transcriptional networks involved in peroxisome proliferator chemical-induced hepatocyte proliferation

EPA Science Inventory

Peroxisome proliferator chemical (PPC) exposure leads to increases in rodent liver tumors through a non-genotoxic mode of action (MOA). The PPC MOA includes increased oxidative stress, hepatocyte proliferation and decreased apoptosis. We investigated the putative genetic regulato...

High-throughput sequencing and analysis of the gill tissue transcriptome from the deep-sea hydrothermal vent mussel Bathymodiolus azoricus

PubMed Central

2010-01-01

Background Bathymodiolus azoricus is a deep-sea hydrothermal vent mussel found in association with large faunal communities living in chemosynthetic environments at the bottom of the sea floor near the Azores Islands. Investigation of the exceptional physiological reactions that vent mussels have adopted in their habitat, including responses to environmental microbes, remains a difficult challenge for deep-sea biologists. In an attempt to reveal genes potentially involved in the deep-sea mussel innate immunity we carried out a high-throughput sequence analysis of freshly collected B. azoricus transcriptome using gills tissues as the primary source of immune transcripts given its strategic role in filtering the surrounding waterborne potentially infectious microorganisms. Additionally, a substantial EST data set was produced and from which a comprehensive collection of genes coding for putative proteins was organized in a dedicated database, "DeepSeaVent" the first deep-sea vent animal transcriptome database based on the 454 pyrosequencing technology. Results A normalized cDNA library from gills tissue was sequenced in a full 454 GS-FLX run, producing 778,996 sequencing reads. Assembly of the high quality reads resulted in 75,407 contigs of which 3,071 were singletons. A total of 39,425 transcripts were conceptually translated into amino-sequences of which 22,023 matched known proteins in the NCBI non-redundant protein database, 15,839 revealed conserved protein domains through InterPro functional classification and 9,584 were assigned with Gene Ontology terms. Queries conducted within the database enabled the identification of genes putatively involved in immune and inflammatory reactions which had not been previously evidenced in the vent mussel. Their physical counterpart was confirmed by semi-quantitative quantitative Reverse-Transcription-Polymerase Chain Reactions (RT-PCR) and their RNA transcription level by quantitative PCR (qPCR) experiments. Conclusions We have established the first tissue transcriptional analysis of a deep-sea hydrothermal vent animal and generated a searchable catalog of genes that provides a direct method of identifying and retrieving vast numbers of novel coding sequences which can be applied in gene expression profiling experiments from a non-conventional model organism. This provides the most comprehensive sequence resource for identifying novel genes currently available for a deep-sea vent organism, in particular, genes putatively involved in immune and inflammatory reactions in vent mussels. The characterization of the B. azoricus transcriptome will facilitate research into biological processes underlying physiological adaptations to hydrothermal vent environments and will provide a basis for expanding our understanding of genes putatively involved in adaptations processes during post-capture long term acclimatization experiments, at "sea-level" conditions, using B. azoricus as a model organism. PMID:20937131

De Novo Sequencing and Characterization of the Floral Transcriptome of Dendrocalamus latiflorus (Poaceae: Bambusoideae)

PubMed Central

Li, De-Zhu; Guo, Zhen-Hua

2012-01-01

Background Transcriptome sequencing can be used to determine gene sequences and transcript abundance in non-model species, and the advent of next-generation sequencing (NGS) technologies has greatly decreased the cost and time required for this process. Transcriptome data are especially desirable in bamboo species, as certain members constitute an economically and culturally important group of mostly semelparous plants with remarkable flowering features, yet little bamboo genomic research has been performed. Here we present, for the first time, extensive sequence and transcript abundance data for the floral transcriptome of a key bamboo species, Dendrocalamus latiflorus, obtained using the Illumina GAII sequencing platform. Our further goal was to identify patterns of gene expression during bamboo flower development. Results Approximately 96 million sequencing reads were generated and assembled de novo, yielding 146,395 high quality unigenes with an average length of 461 bp. Of these, 80,418 were identified as putative homologs of annotated sequences in the public protein databases, of which 290 were associated with the floral transition and 47 were related to flower development. Digital abundance analysis identified 26,529 transcripts differentially enriched between two developmental stages, young flower buds and older developing flowers. Unigenes found at each stage were categorized according to their putative functional categories. These sequence and putative function data comprise a resource for future investigation of the floral transition and flower development in bamboo species. Conclusions Our results present the first broad survey of a bamboo floral transcriptome. Although it will be necessary to validate the functions carried out by these genes, these results represent a starting point for future functional research on D. latiflorus and related species. PMID:22916120

Molecular Characterization of a Novel Temperate Sinorhizobium Bacteriophage, ФLM21, Encoding DNA Methyltransferase with CcrM-Like Specificity

PubMed Central

Dziewit, Lukasz; Oscik, Karolina; Bartosik, Dariusz

2014-01-01

ABSTRACT ΦLM21 is a temperate phage isolated from Sinorhizobium sp. strain LM21 (Alphaproteobacteria). Genomic analysis and electron microscopy suggested that ΦLM21 is a member of the family Siphoviridae. The phage has an isometric head and a long noncontractile tail. The genome of ΦLM21 has 50,827 bp of linear double-stranded DNA encoding 72 putative proteins, including proteins responsible for the assembly of the phage particles, DNA packaging, transcription, replication, and lysis. Virion proteins were characterized using mass spectrometry, leading to the identification of the major capsid and tail components, tape measure, and a putative portal protein. We have confirmed the activity of two gene products, a lytic enzyme (a putative chitinase) and a DNA methyltransferase, sharing sequence specificity with the cell cycle-regulating methyltransferase (CcrM) of the bacterial host. Interestingly, the genome of Sinorhizobium phage ΦLM21 shows very limited similarity to other known phage genome sequences and is thus considered unique. IMPORTANCE Prophages are known to play an important role in the genomic diversification of bacteria via horizontal gene transfer. The influence of prophages on pathogenic bacteria is very well documented. However, our knowledge of the overall impact of prophages on the survival of their lysogenic, nonpathogenic bacterial hosts is still limited. In particular, information on prophages of the agronomically important Sinorhizobium species is scarce. In this study, we describe the isolation and molecular characterization of a novel temperate bacteriophage, ΦLM21, of Sinorhizobium sp. LM21. Since we have not found any similar sequences, we propose that this bacteriophage is a novel species. We conducted a functional analysis of selected proteins. We have demonstrated that the phage DNA methyltransferase has the same sequence specificity as the cell cycle-regulating methyltransferase CcrM of its host. We point out that this phenomenon of mimicking the host regulatory mechanisms by viruses is quite common in bacteriophages. PMID:25187538

Regulation of gene expression mediating indeterminate muscle growth in teleosts.

PubMed

Ahammad, A K Shakur; Asaduzzaman, Md; Asakawa, Shuichi; Watabe, Shugo; Kinoshita, Shigeharu

2015-08-01

Teleosts are unique among vertebrates due to their indeterminate muscle growth, i.e., continued production of neonatal muscle fibers until death. However, the molecular mechanism(s) underlying this property is unknown. Here, we focused on the torafugu (Takifugu rubripes) myosin heavy chain gene, MYHM2528-1, which is specifically expressed in neonatal muscle fibers produced by indeterminate muscle growth. We examined the flanking region of MYHM2528-1 through an in vivo reporter assay using zebrafish (Danio rerio) and identified a 2100 bp 5'-flanking sequence that contained sufficient promoter activity to allow specific gene expression. The effects of enhanced promoter activity were observed at the outer region of the fast muscle and the dorsal edge of slow muscle in zebrafish larvae. At the juvenile stage, the promoter was specifically activated in small diameter muscle fibers scattered throughout fast muscle and in slow muscle near the septum separating slow and fast muscles. This spatio-temporal promoter activity overlapped with known myogenic zones involved in teleost indeterminate muscle growth. A deletion mutant analysis revealed that the -2100 to -600 bp 5'flanking sequence of MYHM2528-1 is essential for promoter activity. This region contains putative binding sites for several representative myogenesis-related transcription factors and nuclear factor of activated T-cell (NFAT), a transcription activator involved in regeneration of mammalian adult skeletal muscle. A significant reduction in the promoter activity of the MYHM2528-1 deletion constructs was observed in accordance with a reduction in the number of these binding sites, suggesting the involvement of specific transcription factors in indeterminate muscle growth. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

In silico predicted reproductive endocrine transcriptional regulatory networks during zebrafish (Danio rerio) development.

PubMed

Hala, D

2017-03-21

The interconnected topology of transcriptional regulatory networks (TRNs) readily lends to mathematical (or in silico) representation and analysis as a stoichiometric matrix. Such a matrix can be 'solved' using the mathematical method of extreme pathway (ExPa) analysis, which identifies uniquely activated genes subject to transcription factor (TF) availability. In this manuscript, in silico multi-tissue TRN models of brain, liver and gonad were used to study reproductive endocrine developmental programming in zebrafish (Danio rerio) from 0.25h post fertilization (hpf; zygote) to 90 days post fertilization (dpf; adult life stage). First, properties of TRN models were studied by sequentially activating all genes in multi-tissue models. This analysis showed the brain to exhibit lowest proportion of co-regulated genes (19%) relative to liver (23%) and gonad (32%). This was surprising given that the brain comprised 75% and 25% more TFs than liver and gonad respectively. Such 'hierarchy' of co-regulatory capability (brain

Comparative transcript profiling of fertile and sterile flower buds from multiple-allele-inherited male sterility in Chinese cabbage (Brassica campestris L. ssp. pekinensis).

PubMed

Zhou, Xue; Liu, Zhiyong; Ji, Ruiqin; Feng, Hui

2017-10-01

We studied the underlying causes of multiple-allele-inherited male sterility in Chinese cabbage (Brassica campestris L. ssp. pekinensis) by identifying differentially expressed genes (DEGs) related to pollen sterility between fertile and sterile flower buds. In this work, we verified the stages of sterility microscopically and then performed transcriptome analysis of mRNA isolated from fertile and sterile buds using Illumina HiSeq 2000 platform sequencing. Approximately 80% of ~229 million high-quality paired-end reads were uniquely mapped to the reference genome. In sterile buds, 699 genes were significantly up-regulated and 4096 genes were down-regulated. Among the DEGs, 28 pollen cell wall-related genes, 54 transcription factor genes, 45 phytohormone-related genes, 20 anther and pollen-related genes, 212 specifically expressed transcripts, and 417 DEGs located on linkage group A07 were identified. Six transcription factor genes BrAMS, BrMS1, BrbHLH089, BrbHLH091, BrAtMYB103, and BrANAC025 were identified as putative sterility-related genes. The weak auxin signal that is regulated by BrABP1 may be one of the key factors causing pollen sterility observed here. Moreover, several significantly enriched GO terms such as "cell wall organization or biogenesis" (GO:0071554), "intrinsic to membrane" (GO:0031224), "integral to membrane" (GO:0016021), "hydrolase activity, acting on ester bonds" (GO:0016788), and one significantly enriched pathway "starch and sucrose metabolism" (ath00500) were identified in this work. qRT-PCR, PCR, and in situ hybridization experiments validated our RNA-seq transcriptome analysis as accurate and reliable. This study will lay the foundation for elucidating the molecular mechanism(s) that underly sterility and provide valuable information for studying multiple-allele-inherited male sterility in the Chinese cabbage line 'AB01'.

Expression of a maize Myb transcription factor driven by a putative silk-specific promoter significantly enhances resistance to Helicoverpa zea in transgenic maize.

PubMed

Johnson, Eric T; Berhow, Mark A; Dowd, Patrick F

2007-04-18

Hi II maize (Zea mays) plants were engineered to express maize p1 cDNA, a Myb transcription factor, controlled by a putative silk specific promoter, for secondary metabolite production and corn earworm resistance. Transgene expression did not enhance silk color, but about half of the transformed plant silks displayed browning when cut, which indicated the presence of p1-produced secondary metabolites. Levels of maysin, a secondary metabolite with insect toxicity, were highest in newly emerged browning silks. The insect resistance of transgenic silks was also highest at emergence, regardless of maysin levels, which suggests that other unidentified p1-induced molecules likely contributed to larval mortality. Mean survivor weights of corn earworm larvae fed mature browning transgenic silks were significantly lower than weights of those fed mature nonbrowning transgenic silks. Some transgenic pericarps browned with drying and contained similar molecules found in pericarps expressing a dominant p1 allele, suggesting that the promoter may not be silk-specific.

A transferrin gene associated with development and 2-tridecanone tolerance in Helicoverpa armigera

PubMed Central

Zhang, L; Shang, Q; Lu, Y; Zhao, Q; Gao, X

2015-01-01

The full-length cDNA (2320 bp) encoding a putative iron-binding transferrin protein from Helicoverpa armigera was cloned and named HaTrf. The putative HaTrf sequence included 670 amino acids with a molecular mass of approximately 76 kDa. Quantitative PCR results demonstrated that the transcriptional level of HaTrf was significantly higher in the sixth instar and pupa stages as compared with other developmental stages. HaTrf transcripts were more abundant in fat bodies and in the epidermis than in malpighian tubules. Compared with the control, the expression of HaTrf increased dramatically 24 h after treatment with 2-tridecanone. Apparent growth inhibition with a dramatic body weight decrease was observed in larvae fed with HaTrf double-stranded RNA (dsRNA), as compared with those fed with green fluorescent protein dsRNA. RNA interference of HaTrf also significantly increased the susceptibility of larvae to 2-tridecanone. These results indicate the possible involvement of HaTrf in tolerance to plant secondary chemicals. PMID:25430818

An operon from Lactobacillus helveticus composed of a proline iminopeptidase gene (pepI) and two genes coding for putative members of the ABC transporter family of proteins.

PubMed

Varmanen, P; Rantanen, T; Palva, A

1996-12-01

A proline iminopeptidase gene (pepI) of an industrial Lactobacillus helveticus strain was cloned and found to be organized in an operon-like structure of three open reading frames (ORF1, ORF2 and ORF3). ORF1 was preceded by a typical prokaryotic promoter region, and a putative transcription terminator was found downstream of ORF3, identified as the pepI gene. Using primer-extension analyses, only one transcription start site, upstream of ORF1, was identifiable in the predicted operon. Although the size of mRNA could not be judged by Northern analysis either with ORF1-, ORF2- or pepI-specific probes, reverse transcription-PCR analyses further supported the operon structure of the three genes. ORF1, ORF2 and ORF3 had coding capacities for 50.7, 24.5 and 33.8 kDa proteins, respectively. The ORF3-encoded PepI protein showed 65% identity with the PepI proteins from Lactobacillus delbrueckii subsp. bulgaricus and Lactobacillus delbrueckii subsp. lactis. The ORF1-encoded protein had significant homology with several members of the ABC transporter family but, with two distinct putative ATP-binding sites, it would represent an unusual type among the bacterial ABC transporters. ORF2 encoded a putative integral membrane protein also characteristic of the ABC transporter family. The pepI gene was overexpressed in Escherichia coli. Purified PepI hydrolysed only di and tripeptides with proline in the first position. Optimum PepI activity was observed at pH 7.5 and 40 degrees C. A gel filtration analysis indicated that PepI is a dimer of M(r) 53,000. PepI was shown to be a metal-independent serine peptidase having thiol groups at or near the active site. Kinetic studies with proline-p-nitroanilide as substrate revealed Km and Vmax values of 0.8 mM and 350 mmol min-1 mg-1, respectively, and a very high turnover number of 135,000 s-1.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi

Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, butmore » little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.« less

Discrimination of Pathogenic vs. Nonpathogenic Francisella tularensis and Burkholderia pseudomallei Using Proteomics Mass Spectrometry

DTIC Science & Technology

2011-03-01

GroEL AhpC/TSA family protein hypothetical protein FTL0617 heat shock protein DnaK succinyl-CoA synthetase subunit beta hypothetical protein...lipoprotein chaperonin GroEL co-chaperonin GroES DNA-directed RNA polymerase subunit beta intracellular growth locus, subunit C 3.2 Differentiation...thailandensis E264 Unique Proteins Whole Cell Lysates OMPs putative lipoprotein glucan 1,4-a-glucosidase glycosy hydrolase family protein putative

Comparative transcriptomics of Entelegyne spiders (Araneae, Entelegynae), with emphasis on molecular evolution of orphan genes.

PubMed

Carlson, David E; Hedin, Marshal

2017-01-01

Next-generation sequencing technology is rapidly transforming the landscape of evolutionary biology, and has become a cost-effective and efficient means of collecting exome information for non-model organisms. Due to their taxonomic diversity, production of interesting venom and silk proteins, and the relative scarcity of existing genomic resources, spiders in particular are excellent targets for next-generation sequencing (NGS) methods. In this study, the transcriptomes of six entelegyne spider species from three genera (Cicurina travisae, C. vibora, Habronattus signatus, H. ustulatus, Nesticus bishopi, and N. cooperi) were sequenced and de novo assembled. Each assembly was assessed for quality and completeness and functionally annotated using gene ontology information. Approximately 100 transcripts with evidence of homology to venom proteins were discovered. After identifying more than 3,000 putatively orthologous genes across all six taxa, we used comparative analyses to identify 24 instances of positively selected genes. In addition, between ~ 550 and 1,100 unique orphan genes were found in each genus. These unique, uncharacterized genes exhibited elevated rates of amino acid substitution, potentially consistent with lineage-specific adaptive evolution. The data generated for this study represent a valuable resource for future phylogenetic and molecular evolutionary research, and our results provide new insight into the forces driving genome evolution in taxa that span the root of entelegyne spider phylogeny.

Prevalence of transcription promoters within archaeal operons and coding sequences

PubMed Central

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of ∼64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein–DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3′ ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes—events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements. PMID:19536208

Prevalence of transcription promoters within archaeal operons and coding sequences.

PubMed

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

Identification and expression analysis of a putative fatty acidbinding protein gene in the Asian honeybee, Apis cerana cerana.

PubMed

Yu, Xiaoli; Kang, Mingjiang; Liu, Li; Guo, Xingqi; Xu, Baohua

2013-01-01

Fatty acid-binding proteins (FABPs) play pivotal roles in cellular signaling, gene transcription, and lipid metabolism in vertebrates and invertebrates. In this study, a putative FABP gene, referred to as AccFABP, was isolated from the Asian honeybee, Apis cerana cerana Fabricius (Hymenoptera: Apidae). The full-length cDNA consisted of 725 bp, and encoded a protein of 204 amino acids. Homology and phylogenetic analysis indicated that AccFABP was a member of the FABP multifamily. The genomic structure of this gene, which was common among FABP multifamily members, spanned 1,900 bp, and included four exons and three introns. Gene expression analysis revealed that AccFABP was highly expressed in the dark-pigmented phase of pupal development, with peak expression observed in the fat bodies of the dark-pigmented phase pupae. The AccFABP transcripts in the fat body were upregulated by exposure to dietary fatty acids such as conjugated linoleic acid, docosahexaenoic acid, and arachidonic acid. Transcription factor binding sites for Caudal-Related Homeobox and functional CCAAT/enhancer binding site, which were respectively associated with tissue expression and lipid metabolism, were detected in the 5' promoter sequence. The evidence provided in the present study suggests that AccFABP may regulate insect growth and development, and lipid metabolism.

A Catalogue of Putative cis-Regulatory Interactions Between Long Non-coding RNAs and Proximal Coding Genes Based on Correlative Analysis Across Diverse Human Tumors.

PubMed

Basu, Swaraj; Larsson, Erik

2018-05-31

Antisense transcripts and other long non-coding RNAs are pervasive in mammalian cells, and some of these molecules have been proposed to regulate proximal protein-coding genes in cis For example, non-coding transcription can contribute to inactivation of tumor suppressor genes in cancer, and antisense transcripts have been implicated in the epigenetic inactivation of imprinted genes. However, our knowledge is still limited and more such regulatory interactions likely await discovery. Here, we make use of available gene expression data from a large compendium of human tumors to generate hypotheses regarding non-coding-to-coding cis -regulatory relationships with emphasis on negative associations, as these are less likely to arise for reasons other than cis -regulation. We document a large number of possible regulatory interactions, including 193 coding/non-coding pairs that show expression patterns compatible with negative cis -regulation. Importantly, by this approach we capture several known cases, and many of the involved coding genes have known roles in cancer. Our study provides a large catalog of putative non-coding/coding cis -regulatory pairs that may serve as a basis for further experimental validation and characterization. Copyright © 2018 Basu and Larsson.

Molecular dissection of transcriptional reprogramming of steviol glycosides synthesis in leaf tissue during developmental phase transitions in Stevia rebaudiana Bert.

PubMed

Singh, Gopal; Singh, Gagandeep; Singh, Pradeep; Parmar, Rajni; Paul, Navgeet; Vashist, Radhika; Swarnkar, Mohit Kumar; Kumar, Ashok; Singh, Sanatsujat; Singh, Anil Kumar; Kumar, Sanjay; Sharma, Ram Kumar

2017-09-19

Stevia is a natural source of commercially important steviol glycosides (SGs), which share biosynthesis route with gibberellic acids (GAs) through plastidal MEP and cytosolic MVA pathways. Ontogeny-dependent deviation in SGs biosynthesis is one of the key factor for global cultivation of Stevia, has not been studied at transcriptional level. To dissect underlying molecular mechanism, we followed a global transcriptome sequencing approach and generated more than 100 million reads. Annotation of 41,262 de novo assembled transcripts identified all the genes required for SGs and GAs biosynthesis. Differential gene expression and quantitative analysis of important pathway genes (DXS, HMGR, KA13H) and gene regulators (WRKY, MYB, NAC TFs) indicated developmental phase dependent utilization of metabolic flux between SGs and GAs synthesis. Further, identification of 124 CYPs and 45 UGTs enrich the genomic resources, and their PPI network analysis with SGs/GAs biosynthesis proteins identifies putative candidates involved in metabolic changes, as supported by their developmental phase-dependent expression. These putative targets can expedite molecular breeding and genetic engineering efforts to enhance SGs content, biomass and yield. Futuristically, the generated dataset will be a useful resource for development of functional molecular markers for diversity characterization, genome mapping and evolutionary studies in Stevia.

Synchronization of developmental processes and defense signaling by growth regulating transcription factors.

PubMed

Liu, Jinyi; Rice, J Hollis; Chen, Nana; Baum, Thomas J; Hewezi, Tarek

2014-01-01

Growth regulating factors (GRFs) are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.

Effects of different dietary conditions on the expression of trypsin- and chymotrypsin-like protease genes in the digestive system of the migratory locust, Locusta migratoria.

PubMed

Spit, Jornt; Zels, Sven; Dillen, Senne; Holtof, Michiel; Wynant, Niels; Vanden Broeck, Jozef

2014-05-01

While technological advancements have recently led to a steep increase in genomic and transcriptomic data, and large numbers of protease sequences are being discovered in diverse insect species, little information is available about the expression of digestive enzymes in Orthoptera. Here we describe the identification of Locusta migratoria serine protease transcripts (cDNAs) involved in digestion, which might serve as possible targets for pest control management. A total of 5 putative trypsin and 15 putative chymotrypsin gene sequences were characterized. Phylogenetic analysis revealed that these are distributed among 3 evolutionary conserved clusters. In addition, we have determined the relative gene expression levels of representative members in the gut under different feeding conditions. This study demonstrated that the transcript levels for all measured serine proteases were strongly reduced after starvation. On the other hand, larvae of L. migratoria displayed compensatory effects to the presence of Soybean Bowman Birk (SBBI) and Soybean Trypsin (SBTI) inhibitors in their diet by differential upregulation of multiple proteases. A rapid initial upregulation was observed for all tested serine protease transcripts, while only for members belonging to class I, the transcript levels remained elevated after prolonged exposure. In full agreement with these results, we also observed an increase in proteolytic activity in midgut secretions of locusts that were accustomed to the presence of protease inhibitors in their diet, while no change in sensitivity to these inhibitors was observed. Taken together, this paper is the first comprehensive study on dietary dependent transcript levels of proteolytic enzymes in Orthoptera. Our data suggest that compensatory response mechanisms to protease inhibitor ingestion may have appeared early in insect evolution. Copyright © 2014 Elsevier Ltd. All rights reserved.

Transcriptome changes associated with delayed flower senescence on transgenic petunia by inducing expression of etr1-1, a mutant ethylene receptor.

PubMed

Wang, Hong; Stier, Genevieve; Lin, Jing; Liu, Gang; Zhang, Zhen; Chang, Youhong; Reid, Michael S; Jiang, Cai-Zhong

2013-01-01

Flowers of ethylene-sensitive ornamental plants transformed with ethylene-insensitive 1-1(etr1-1), a mutant ethylene receptor first isolated from Arabidopsis, are known to have longer shelf lives. We have generated petunia plants in which the etr1-1 gene was over-expressed under the control of a chemically-inducible promoter, which would allow expression of etr1-1 to be initiated at the desired time and stage of development. Here, we showed that transgenic plants grew and developed normally without a chemical inducer. Semi-quantitative RT-PCR demonstrated that the abundance of transcripts of Arabidopsis etr1-1 gene was substantially induced in flowers with 30 μM dexamethasone (DEX). Consequently, t he life of the flowers was almost doubled and the peak of ethylene production was delayed. We compared gene expression changes of petals with DEX to those without DEX at 24 h and 48 h by microarray. Our results indicated that transcripts of many putative genes encoding transcription factors were down-regulated by etr1-1 induced expression at the early stage. In addition, putative genes involved in gibberellin biosynthesis, response to jasmonic acid/gibberellins stimulus, cell wall modification, ethylene biosynthesis, and cell death were down-regulated associating with etr1-1 induced expression. We investigated time-course gene expression profiles and found two profiles which displayed totally opposite expression patterns under these two treatments. In these profiles, 'the regulation of transcription' was predominant in GO categories. Taking all results together, we concluded those transcription factors down-regulated at early stage might exert a major role in regulating the senescence process which were consequently characterized by cell wall modification and cell death.

RegA, an AraC-like protein, is a global transcriptional regulator that controls virulence gene expression in Citrobacter rodentium.

PubMed

Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J; Frankel, Gad; Hartland, Elizabeth L; Robins-Browne, Roy M

2008-11-01

Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5alpha, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization.

RegA, an AraC-Like Protein, Is a Global Transcriptional Regulator That Controls Virulence Gene Expression in Citrobacter rodentium▿

PubMed Central

Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J.; Frankel, Gad; Hartland, Elizabeth L.; Robins-Browne, Roy M.

2008-01-01

Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5α, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization. PMID:18765720

The use of high-throughput small RNA sequencing reveals differentially expressed microRNAs in response to aster yellows phytoplasma-infection in Vitis vinifera cv. ‘Chardonnay’

PubMed Central

Solofoharivelo, Marie-Chrystine; Souza-Richards, Rose; Stephan, Dirk; Murray, Shane; Burger, Johan T.

2017-01-01

Phytoplasmas are cell wall-less plant pathogenic bacteria responsible for major crop losses throughout the world. In grapevine they cause grapevine yellows, a detrimental disease associated with a variety of symptoms. The high economic impact of this disease has sparked considerable interest among researchers to understand molecular mechanisms related to pathogenesis. Increasing evidence exist that a class of small non-coding endogenous RNAs, known as microRNAs (miRNAs), play an important role in post-transcriptional gene regulation during plant development and responses to biotic and abiotic stresses. Thus, we aimed to dissect complex high-throughput small RNA sequencing data for the genome-wide identification of known and novel differentially expressed miRNAs, using read libraries constructed from healthy and phytoplasma-infected Chardonnay leaf material. Furthermore, we utilised computational resources to predict putative miRNA targets to explore the involvement of possible pathogen response pathways. We identified multiple known miRNA sequence variants (isomiRs), likely generated through post-transcriptional modifications. Sequences of 13 known, canonical miRNAs were shown to be differentially expressed. A total of 175 novel miRNA precursor sequences, each derived from a unique genomic location, were predicted, of which 23 were differentially expressed. A homology search revealed that some of these novel miRNAs shared high sequence similarity with conserved miRNAs from other plant species, as well as known grapevine miRNAs. The relative expression of randomly selected known and novel miRNAs was determined with real-time RT-qPCR analysis, thereby validating the trend of expression seen in the normalised small RNA sequencing read count data. Among the putative miRNA targets, we identified genes involved in plant morphology, hormone signalling, nutrient homeostasis, as well as plant stress. Our results may assist in understanding the role that miRNA pathways play during plant pathogenesis, and may be crucial in understanding disease symptom development in aster yellows phytoplasma-infected grapevines. PMID:28813447

Proteomic profiling of tandem affinity purified 14-3-3 protein complexes in Arabidopsis thaliana

PubMed Central

Chang, Ing-Feng; Curran, Amy; Woolsey, Rebekah; Quilici, David; Cushman, John; Mittler, Ron; Harmon, Alice; Harper, Jeffrey

2014-01-01

In eukaryotes, 14-3-3 dimers regulate hundreds of functionally diverse proteins (clients), typically in phosphorylation-dependent interactions. To uncover new clients, a 14-3-3 omega (At1g78300) from Arabidopsis was engineered with a “tandem affinity purification” (TAP) tag and expressed in transgenic plants. Purified complexes were analyzed by tandem mass spectrometry. Results indicate that 14-3-3 omega can dimerize with at least 10 of the 12 14-3-3 isoforms expressed in Arabidopsis. The identification here of 121 putative clients provides support for in vivo 14-3-3 interactions with a diverse array of proteins, including those involved in: (1) Ion transport, such as a K+ channel (GORK), a Cl− channel (CLCg), Ca2+ channels belonging to the glutamate receptor family (GLRs 1.2, 2.1, 2.9, 3.4, 3.7); (2) hormone signaling, such as ACC synthase (isoforms ACS-6, 7 and 8 involved in ethylene synthesis) and the brassinolide receptors BRI1 and BAK1; (3) transcription, such as 7 WRKY family transcription factors; (4) metabolism, such as phosphoenol pyruvate (PEP) carboxylase; and (5) lipid signaling, such as phospholipase D (β, and γ). More than 80% (101) of these putative clients represent previously unidentified 14-3-3 interactors. These results raise the number of putative 14-3-3 clients identified in plants to over 300. PMID:19452453

Proteomic profiling of tandem affinity purified 14-3-3 protein complexes in Arabidopsis thaliana.

PubMed

Chang, Ing-Feng; Curran, Amy; Woolsey, Rebekah; Quilici, David; Cushman, John C; Mittler, Ron; Harmon, Alice; Harper, Jeffrey F

2009-06-01

In eukaryotes, 14-3-3 dimers regulate hundreds of functionally diverse proteins (clients), typically in phosphorylation-dependent interactions. To uncover new clients, 14-3-3 omega (At1g78300) from Arabidopsis was engineered with a "tandem affinity purification" tag and expressed in transgenic plants. Purified complexes were analyzed by tandem MS. Results indicate that 14-3-3 omega can dimerize with at least 10 of the 12 14-3-3 isoforms expressed in Arabidopsis. The identification here of 121 putative clients provides support for in vivo 14-3-3 interactions with a diverse array of proteins, including those involved in: (i) Ion transport, such as a K(+) channel (GORK), a Cl(-) channel (CLCg), Ca(2+) channels belonging to the glutamate receptor family (1.2, 2.1, 2.9, 3.4, 3.7); (ii) hormone signaling, such as ACC synthase (isoforms ACS-6, -7 and -8 involved in ethylene synthesis) and the brassinolide receptors BRI1 and BAK1; (iii) transcription, such as 7 WRKY family transcription factors; (iv) metabolism, such as phosphoenol pyruvate carboxylase; and (v) lipid signaling, such as phospholipase D (beta and gamma). More than 80% (101) of these putative clients represent previously unidentified 14-3-3 interactors. These results raise the number of putative 14-3-3 clients identified in plants to over 300.

Auxin-Mediated Transcriptional System with a Minimal Set of Components Is Critical for Morphogenesis through the Life Cycle in Marchantia polymorpha

PubMed Central

Kato, Hirotaka; Ishizaki, Kimitsune; Kouno, Masaru; Shirakawa, Makoto; Bowman, John L.; Nishihama, Ryuichi; Kohchi, Takayuki

2015-01-01

The plant hormone auxin regulates many aspects of plant growth and development. Recent progress in Arabidopsis provided a scheme that auxin receptors, TIR1/AFBs, target transcriptional co-repressors, AUX/IAAs, for degradation, allowing ARFs to regulate transcription of auxin responsive genes. The mechanism of auxin-mediated transcriptional regulation is considered to have evolved around the time plants adapted to land. However, little is known about the role of auxin-mediated transcription in basal land plant lineages. We focused on the liverwort Marchantia polymorpha, which belongs to the earliest diverging lineage of land plants. M. polymorpha has only a single TIR1/AFB (MpTIR1), a single AUX/IAA (MpIAA), and three ARFs (MpARF1, MpARF2, and MpARF3) in the genome. Expression of a dominant allele of MpIAA with mutations in its putative degron sequence conferred an auxin resistant phenotype and repressed auxin-dependent expression of the auxin response reporter proGH3:GUS. We next established a system for DEX-inducible auxin-response repression by expressing the putatively stabilized MpIAA protein fused with the glucocorticoid receptor domain (MpIAAmDII-GR). Repression of auxin responses in proMpIAA:MpIAAmDII-GR plants caused severe defects in various developmental processes, including gemmaling development, dorsiventrality, organogenesis, and tropic responses. Transient transactivation assays showed that the three MpARFs had different transcriptional activities, each corresponding to their phylogenetic classifications. Moreover, MpIAA and MpARF proteins interacted with each other with different affinities. This study provides evidence that pleiotropic auxin responses can be achieved by a minimal set of auxin signaling factors and suggests that the transcriptional regulation mediated by TIR1/AFB, AUX/IAA, and three types of ARFs might have been a key invention to establish body plans of land plants. We propose that M. polymorpha is a good model to investigate the principles and the evolution of auxin-mediated transcriptional regulation and its roles in land plant morphogenesis. PMID:26020919

Auxin-Mediated Transcriptional System with a Minimal Set of Components Is Critical for Morphogenesis through the Life Cycle in Marchantia polymorpha.

PubMed

Kato, Hirotaka; Ishizaki, Kimitsune; Kouno, Masaru; Shirakawa, Makoto; Bowman, John L; Nishihama, Ryuichi; Kohchi, Takayuki

2015-05-01

The plant hormone auxin regulates many aspects of plant growth and development. Recent progress in Arabidopsis provided a scheme that auxin receptors, TIR1/AFBs, target transcriptional co-repressors, AUX/IAAs, for degradation, allowing ARFs to regulate transcription of auxin responsive genes. The mechanism of auxin-mediated transcriptional regulation is considered to have evolved around the time plants adapted to land. However, little is known about the role of auxin-mediated transcription in basal land plant lineages. We focused on the liverwort Marchantia polymorpha, which belongs to the earliest diverging lineage of land plants. M. polymorpha has only a single TIR1/AFB (MpTIR1), a single AUX/IAA (MpIAA), and three ARFs (MpARF1, MpARF2, and MpARF3) in the genome. Expression of a dominant allele of MpIAA with mutations in its putative degron sequence conferred an auxin resistant phenotype and repressed auxin-dependent expression of the auxin response reporter proGH3:GUS. We next established a system for DEX-inducible auxin-response repression by expressing the putatively stabilized MpIAA protein fused with the glucocorticoid receptor domain (MpIAA(mDII)-GR). Repression of auxin responses in (pro)MpIAA:MpIAA(mDII)-GR plants caused severe defects in various developmental processes, including gemmaling development, dorsiventrality, organogenesis, and tropic responses. Transient transactivation assays showed that the three MpARFs had different transcriptional activities, each corresponding to their phylogenetic classifications. Moreover, MpIAA and MpARF proteins interacted with each other with different affinities. This study provides evidence that pleiotropic auxin responses can be achieved by a minimal set of auxin signaling factors and suggests that the transcriptional regulation mediated by TIR1/AFB, AUX/IAA, and three types of ARFs might have been a key invention to establish body plans of land plants. We propose that M. polymorpha is a good model to investigate the principles and the evolution of auxin-mediated transcriptional regulation and its roles in land plant morphogenesis.

Analysis of gene expression provides insights into the mechanism of cadmium tolerance in Acidithiobacillus ferrooxidans.

PubMed

Chen, Minjie; Li, Yanjun; Zhang, Li; Wang, Jianying; Zheng, Chunli; Zhang, Xuefeng

2015-02-01

Acidithiobacillus ferrooxidans plays a critical role in metal solubilization in the biomining industry, and occupies an ecological niche characterized by high acidity and high concentrations of toxic heavy metal ions. In order to investigate the possible metal resistance mechanism, the cellular distribution of cadmium was tested. The result indicated that Cd(2+) entered the cells upon initial exposure resulting in increased intracellular concentrations, followed by its excretion from the cells during subsequent growth and adaptation. Sequence homology analyses were used to identify 10 genes predicted to participate in heavy metal homeostasis, and the expression of these genes was investigated in cells cultured in the presence of increasing concentrations of toxic divalent cadmium (Cd(2+)). The results suggested that one gene (cmtR A.f ) encoded a putative Cd(2+)/Pb(2+)-responsive transcriptional regulator; four genes (czcA1 A.f , czcA2 A.f , czcB1 A.f ; and czcC1 A.f ) encoded heavy metal efflux proteins for Cd(2+); two genes (cadA1 A.f and cadB1 A.f ) encoded putative cation channel proteins related to the transport of Cd(2+). No significant enhancement of gene expression was observed at low concentrations of Cd(2+) (5 mM) and most of the putative metal resistance genes were up-regulated except cmtR A.f , cadB3 A.f ; and czcB1 A.f at higher concentrations (15 and 30 mM) according to real-time polymerase chain reaction. A model was developed for the mechanism of resistance to cadmium ions based on homology analyses of the predicted genes, the transcription of putative Cd(2+) resistance genes, and previous work.

RNA-seq analysis of Drosophila clock and non-clock neurons reveals neuron-specific cycling and novel candidate neuropeptides.

PubMed

Abruzzi, Katharine C; Zadina, Abigail; Luo, Weifei; Wiyanto, Evelyn; Rahman, Reazur; Guo, Fang; Shafer, Orie; Rosbash, Michael

2017-02-01

Locomotor activity rhythms are controlled by a network of ~150 circadian neurons within the adult Drosophila brain. They are subdivided based on their anatomical locations and properties. We profiled transcripts "around the clock" from three key groups of circadian neurons with different functions. We also profiled a non-circadian outgroup, dopaminergic (TH) neurons. They have cycling transcripts but fewer than clock neurons as well as low expression and poor cycling of clock gene transcripts. This suggests that TH neurons do not have a canonical circadian clock and that their gene expression cycling is driven by brain systemic cues. The three circadian groups are surprisingly diverse in their cycling transcripts and overall gene expression patterns, which include known and putative novel neuropeptides. Even the overall phase distributions of cycling transcripts are distinct, indicating that different regulatory principles govern transcript oscillations. This surprising cell-type diversity parallels the functional heterogeneity of the different neurons.

A long natural-antisense RNA is accumulated in the conidia of Aspergillus oryzae.

PubMed

Tsujii, Masaru; Okuda, Satoshi; Ishi, Kazutomo; Madokoro, Kana; Takeuchi, Michio; Yamagata, Youhei

2016-01-01

Analysis of expressed sequence tag libraries from various culture conditions revealed the existence of conidia-specific transcripts assembled to putative conidiation-specific reductase gene (csrA) in Aspergillus oryzae. However, the all transcripts were transcribed with opposite direction to the gene csrA. The sequence analysis of the transcript revealed that the RNA overlapped mRNA of csrA with 3'-end, and did not code protein longer than 60 amino acid residues. We designated the transcript Conidia Specific Long Natural-antisense RNA (CSLNR). The real-time PCR analysis demonstrated that the CSLNR is conidia-specific transcript, which cannot be transcribed in the absence of brlA, and the amount of CSLNR was much more than that of the transcript from csrA in conidia. Furthermore, the csrA deletion, also lacking coding region of CSLNR in A. oryzae reduced the number of conidia. Overexpression of CsrA demonstrated the inhibition of growth and conidiation, while CSLNR did not affect conidiation.

In vivo binding of hot pepper bZIP transcription factor CabZIP1 to the G-box region of pathogenesis-related protein 1 promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Boo-Ja; Park, Chang-Jin; Kim, Sung-Kyu

2006-05-26

We find that salicylic acid and ethephon treatment in hot pepper increases the expression of a putative basic/leucine zipper (bZIP) transcription factor gene, CabZIP1. CabZIP1 mRNA is expressed ubiquitously in various organs. The green fluorescent protein-fused transcription factor, CabZIP1::GFP, can be specifically localized to the nucleus, an action that is consistent with the presence of a nuclear localization signal in its protein sequence. Transient overexpression of the CabZIP1 transcription factor results in an increase in PR-1 transcripts level in Nicotiana benthamiana leaves. Using chromatin immunoprecipitation, we demonstrate that CabZIP1 binds to the G-box elements in native promoter of the hotmore » pepper pathogenesis-related protein 1 (CaPR-1) gene in vivo. Taken together, our results suggest that CabZIP1 plays a role as a transcriptional regulator of the CaPR-1 gene.« less

Network perturbation by recurrent regulatory variants in cancer

PubMed Central

Cho, Ara; Lee, Insuk; Choi, Jung Kyoon

2017-01-01

Cancer driving genes have been identified as recurrently affected by variants that alter protein-coding sequences. However, a majority of cancer variants arise in noncoding regions, and some of them are thought to play a critical role through transcriptional perturbation. Here we identified putative transcriptional driver genes based on combinatorial variant recurrence in cis-regulatory regions. The identified genes showed high connectivity in the cancer type-specific transcription regulatory network, with high outdegree and many downstream genes, highlighting their causative role during tumorigenesis. In the protein interactome, the identified transcriptional drivers were not as highly connected as coding driver genes but appeared to form a network module centered on the coding drivers. The coding and regulatory variants associated via these interactions between the coding and transcriptional drivers showed exclusive and complementary occurrence patterns across tumor samples. Transcriptional cancer drivers may act through an extensive perturbation of the regulatory network and by altering protein network modules through interactions with coding driver genes. PMID:28333928

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less

A high-throughput venom-gland transcriptome for the Eastern Diamondback Rattlesnake (Crotalus adamanteus) and evidence for pervasive positive selection across toxin classes.

PubMed

Rokyta, Darin R; Wray, Kenneth P; Lemmon, Alan R; Lemmon, Emily Moriarty; Caudle, S Brian

2011-04-01

Despite causing considerable human mortality and morbidity, animal toxins represent a valuable source of pharmacologically active macromolecules, a unique system for studying molecular adaptation, and a powerful framework for examining structure-function relationships in proteins. Snake venoms are particularly useful in the latter regard as they consist primarily of a moderate number of proteins and peptides that have been found to belong to just a handful of protein families. As these proteins and peptides are produced in dedicated glands, transcriptome sequencing has proven to be an effective approach to identifying the expressed toxin genes. We generated a venom-gland transcriptome for the Eastern Diamondback Rattlesnake (Crotalus adamanteus) using Roche 454 sequencing technology. In the current work, we focus on transcripts encoding toxins. We identified 40 unique toxin transcripts, 30 of which have full-length coding sequences, and 10 have only partial coding sequences. These toxins account for 24% of the total sequencing reads. We found toxins from 11 previously described families of snake-venom toxins and have discovered two putative, previously undescribed toxin classes. The most diverse and highly expressed toxin classes in the C. adamanteus venom-gland transcriptome are the serine proteinases, metalloproteinases, and C-type lectins. The serine proteinases are the most abundant class, accounting for 35% of the toxin sequencing reads. Metalloproteinases are the most diverse; 11 different forms have been identified. Using our sequences and those available in public databases, we detected positive selection in seven of the eight toxin families for which sufficient sequences were available for the analysis. We find that the vast majority of the genes that contribute directly to this vertebrate trait show evidence for a role for positive selection in their evolutionary history. Copyright © 2011 Elsevier Ltd. All rights reserved.

A Retentive Memory of Tetrachloroethene Respiration in Sulfurospirillum halorespirans - involved Proteins and a possible link to Acetylation of a Two-Component Regulatory System.

PubMed

Türkowsky, Dominique; Esken, Jens; Goris, Tobias; Schubert, Torsten; Diekert, Gabriele; Jehmlich, Nico; von Bergen, Martin

2018-06-15

Organohalide respiration (OHR), comprising the reductive dehalogenation of halogenated organic compounds, is subject to a unique memory effect and long-term transcriptional downregulation of the involved genes in Sulfurospirillum multivorans. Gene expression ceases slowly over approximately 100 generations in the absence of tetrachloroethene (PCE). However, the molecular mechanisms of this regulation process are not understood. We show here that Sulfurospirillum halorespirans undergoes the same type of regulation when cultivated without chlorinated ethenes for a long period of time. In addition, we compared the proteomes of S. halorespirans cells cultivated in the presence of PCE with those of cells long- and short-term cultivated with nitrate as the sole electron acceptor. Important OHR-related proteins previously unidentified in S. multivorans include a histidine kinase, a putative quinol dehydrogenase membrane protein, and a PCE-induced porin. Since for some regulatory proteins a posttranslational regulation of activity by lysine acetylations is known, we also analyzed the acetylome of S. halorespirans, revealing that 32% of the proteome was acetylated in at least one condition. The data indicate that the response regulator and the histidine kinase of a two-component system most probably involved in induction of PCE respiration are highly acetylated during short-term cultivation with nitrate in the absence of PCE. The so far unique long-term downregulation of organohalide respiration is now identified in a second species suggesting a broader distribution of this regulatory phenomenon. An improved protein extraction method allowed the identification of proteins most probably involved in transcriptional regulation of OHR in Sulfurospirillum spp. Our data indicate that acetylations of regulatory proteins are involved in this extreme, sustained standby-mode of metabolic enzymes in the absence of a substrate. This first published acetylome of Epsilonproteobacteria might help to study other ecologically or medically important species of this clade. Copyright © 2018 Elsevier B.V. All rights reserved.

Complete Genome Sequence of the Broad-Host-Range Vibriophage KVP40: Comparative Genomics of a T4-Related Bacteriophage

PubMed Central

Miller, Eric S.; Heidelberg, John F.; Eisen, Jonathan A.; Nelson, William C.; Durkin, A. Scott; Ciecko, Ann; Feldblyum, Tamara V.; White, Owen; Paulsen, Ian T.; Nierman, William C.; Lee, Jong; Szczypinski, Bridget; Fraser, Claire M.

2003-01-01

The complete genome sequence of the T4-like, broad-host-range vibriophage KVP40 has been determined. The genome sequence is 244,835 bp, with an overall G+C content of 42.6%. It encodes 386 putative protein-encoding open reading frames (CDSs), 30 tRNAs, 33 T4-like late promoters, and 57 potential rho-independent terminators. Overall, 92.1% of the KVP40 genome is coding, with an average CDS size of 587 bp. While 65% of the CDSs were unique to KVP40 and had no known function, the genome sequence and organization show specific regions of extensive conservation with phage T4. At least 99 KVP40 CDSs have homologs in the T4 genome (Blast alignments of 45 to 68% amino acid similarity). The shared CDSs represent 36% of all T4 CDSs but only 26% of those from KVP40. There is extensive representation of the DNA replication, recombination, and repair enzymes as well as the viral capsid and tail structural genes. KVP40 lacks several T4 enzymes involved in host DNA degradation, appears not to synthesize the modified cytosine (hydroxymethyl glucose) present in T-even phages, and lacks group I introns. KVP40 likely utilizes the T4-type sigma-55 late transcription apparatus, but features of early- or middle-mode transcription were not identified. There are 26 CDSs that have no viral homolog, and many did not necessarily originate from Vibrio spp., suggesting an even broader host range for KVP40. From these latter CDSs, an NAD salvage pathway was inferred that appears to be unique among bacteriophages. Features of the KVP40 genome that distinguish it from T4 are presented, as well as those, such as the replication and virion gene clusters, that are substantially conserved. PMID:12923095

Changes in regulation of a transcription factor lead to autogamy in cultivated tomatoes.

PubMed

Chen, Kai-Yi; Cong, Bin; Wing, Rod; Vrebalov, Julia; Tanksley, Steven D

2007-10-26

We report the cloning of Style2.1, the major quantitative trait locus responsible for a key floral attribute (style length) associated with the evolution of self-pollination in cultivated tomatoes. The gene encodes a putative transcription factor that regulates cell elongation in developing styles. The transition from cross-pollination to self-pollination was accompanied, not by a change in the STYLE2.1 protein, but rather by a mutation in the Style2.1 promoter that results in a down-regulation of Style2.1 expression during flower development.

Metagenomic insights into the carbohydrate-active enzymes carried by the microorganisms adhering to solid digesta in the rumen of cows.

PubMed

Wang, Lingling; Hatem, Ayat; Catalyurek, Umit V; Morrison, Mark; Yu, Zhongtang

2013-01-01

The ruminal microbial community is a unique source of enzymes that underpin the conversion of cellulosic biomass. In this study, the microbial consortia adherent on solid digesta in the rumen of Jersey cattle were subjected to an activity-based metagenomic study to explore the genetic diversity of carbohydrolytic enzymes in Jersey cows, with a particular focus on cellulases and xylanases. Pyrosequencing and bioinformatic analyses of 120 carbohydrate-active fosmids identified genes encoding 575 putative Carbohydrate-Active Enzymes (CAZymes) and proteins putatively related to transcriptional regulation, transporters, and signal transduction coupled with polysaccharide degradation and metabolism. Most of these genes shared little similarity to sequences archived in databases. Genes that were predicted to encode glycoside hydrolases (GH) involved in xylan and cellulose hydrolysis (e.g., GH3, 5, 9, 10, 39 and 43) were well represented. A new subfamily (S-8) of GH5 was identified from contigs assigned to Firmicutes. These subfamilies of GH5 proteins also showed significant phylum-dependent distribution. A number of polysaccharide utilization loci (PULs) were found, and two of them contained genes encoding Sus-like proteins and cellulases that have not been reported in previous metagenomic studies of samples from the rumens of cows or other herbivores. Comparison with the large metagenomic datasets previously reported of other ruminant species (or cattle breeds) and wallabies showed that the rumen microbiome of Jersey cows might contain differing CAZymes. Future studies are needed to further explore how host genetics and diets affect the diversity and distribution of CAZymes and utilization of plant cell wall materials.

Gut transcription in Helicoverpa zea is dynamically altered in response to baculovirus infection

USDA-ARS?s Scientific Manuscript database

The Helicoverpa zea transcriptome was analyzed 24 hours after H. zea larvae fed on artificial diet laced with Helicoverpa zea single nucleopolyhedrovirus (HzSNPV). Significant differential regulation of 1,139 putative genes (P<0.05 T-test with Benjamini and Hochberg False Discovery Rate) was detect...

Venom gland transcriptomic and venom proteomic analyses of the scorpion Megacormus gertschi Díaz-Najera, 1966 (Scorpiones: Euscorpiidae: Megacorminae).

PubMed

Santibáñez-López, Carlos E; Cid-Uribe, Jimena I; Zamudio, Fernando Z; Batista, Cesar V F; Ortiz, Ernesto; Possani, Lourival D

2017-07-01

The soluble venom from the Mexican scorpion Megacormus gertschi of the family Euscorpiidae was obtained and its biological effects were tested in several animal models. This venom is not toxic to mice at doses of 100 μg per 20 g of mouse weight, while being lethal to arthropods (insects and crustaceans), at doses of 20 μg (for crickets) and 100 μg (for shrimps) per animal. Samples of the venom were separated by high performance liquid chromatography and circa 80 distinct chromatographic fractions were obtained from which 67 components have had their molecular weights determined by mass spectrometry analysis. The N-terminal amino acid sequence of seven protein/peptides were obtained by Edman degradation and are reported. Among the high molecular weight components there are enzymes with experimentally-confirmed phospholipase activity. A pair of telsons from this scorpion species was dissected, from which total RNA was extracted and used for cDNA library construction. Massive sequencing by the Illumina protocol, followed by de novo assembly, resulted in a total of 110,528 transcripts. From those, we were able to annotate 182, which putatively code for peptides/proteins with sequence similarity to previously-reported venom components available from different protein databases. Transcripts seemingly coding for enzymes showed the richest diversity, with 52 sequences putatively coding for proteases, 20 for phospholipases, 8 for lipases and 5 for hyaluronidases. The number of different transcripts potentially coding for peptides with sequence similarity to those that affect ion channels was 19, for putative antimicrobial peptides 19, and for protease inhibitor-like peptides, 18. Transcripts seemingly coding for other venom components were identified and described. The LC/MS analysis of a trypsin-digested venom aliquot resulted in 23 matches with the translated transcriptome database, which validates the transcriptome. The proteomic and transcriptomic analyses reported here constitute the first approach to study the venom components from a scorpion species belonging to the family Euscorpiidae. The data certainly show that this venom is different from all the ones described thus far in the literature. Copyright © 2017 Elsevier Ltd. All rights reserved.

Structure and transcriptional regulation of the major intrinsic protein gene family in grapevine.

PubMed

Wong, Darren Chern Jan; Zhang, Li; Merlin, Isabelle; Castellarin, Simone D; Gambetta, Gregory A

2018-04-11

The major intrinsic protein (MIP) family is a family of proteins, including aquaporins, which facilitate water and small molecule transport across plasma membranes. In plants, MIPs function in a huge variety of processes including water transport, growth, stress response, and fruit development. In this study, we characterize the structure and transcriptional regulation of the MIP family in grapevine, describing the putative genome duplication events leading to the family structure and characterizing the family's tissue and developmental specific expression patterns across numerous preexisting microarray and RNAseq datasets. Gene co-expression network (GCN) analyses were carried out across these datasets and the promoters of each family member were analyzed for cis-regulatory element structure in order to provide insight into their transcriptional regulation. A total of 29 Vitis vinifera MIP family members (excluding putative pseudogenes) were identified of which all but two were mapped onto Vitis vinifera chromosomes. In this study, segmental duplication events were identified for five plasma membrane intrinsic protein (PIP) and four tonoplast intrinsic protein (TIP) genes, contributing to the expansion of PIPs and TIPs in grapevine. Grapevine MIP family members have distinct tissue and developmental expression patterns and hierarchical clustering revealed two primary groups regardless of the datasets analyzed. Composite microarray and RNA-seq gene co-expression networks (GCNs) highlighted the relationships between MIP genes and functional categories involved in cell wall modification and transport, as well as with other MIPs revealing a strong co-regulation within the family itself. Some duplicated MIP family members have undergone sub-functionalization and exhibit distinct expression patterns and GCNs. Cis-regulatory element (CRE) analyses of the MIP promoters and their associated GCN members revealed enrichment for numerous CREs including AP2/ERFs and NACs. Combining phylogenetic analyses, gene expression profiling, gene co-expression network analyses, and cis-regulatory element enrichment, this study provides a comprehensive overview of the structure and transcriptional regulation of the grapevine MIP family. The study highlights the duplication and sub-functionalization of the family, its strong coordinated expression with genes involved in growth and transport, and the putative classes of TFs responsible for its regulation.

Exploring the Genes of Yerba Mate (Ilex paraguariensis A. St.-Hil.) by NGS and De Novo Transcriptome Assembly

PubMed Central

Aguilera, Patricia M.; Bubillo, Rosana E.; Otegui, Mónica B.; Ducasse, Daniel A.; Zapata, Pedro D.; Marti, Dardo A.

2014-01-01

Yerba mate (Ilex paraguariensis A. St.-Hil.) is an important subtropical tree crop cultivated on 326,000 ha in Argentina, Brazil and Paraguay, with a total yield production of more than 1,000,000 t. Yerba mate presents a strong limitation regarding sequence information. The NCBI GenBank lacks an EST database of yerba mate and depicts only 80 DNA sequences, mostly uncharacterized. In this scenario, in order to elucidate the yerba mate gene landscape by means of NGS, we explored and discovered a vast collection of I. paraguariensis transcripts. Total RNA from I. paraguariensis was sequenced by Illumina HiSeq-2000 obtaining 72,031,388 pair-end 100 bp sequences. High quality reads were de novo assembled into 44,907 transcripts encompassing 40 million bases with an estimated coverage of 180X. Multiple sequence analysis allowed us to predict that yerba mate contains ∼32,355 genes and 12,551 gene variants or isoforms. We identified and categorized members of more than 100 metabolic pathways. Overall, we have identified ∼1,000 putative transcription factors, genes involved in heat and oxidative stress, pathogen response, as well as disease resistance and hormone response. We have also identified, based in sequence homology searches, novel transcripts related to osmotic, drought, salinity and cold stress, senescence and early flowering. We have also pinpointed several members of the gene silencing pathway, and characterized the silencing effector Argonaute1. We predicted a diverse supply of putative microRNA precursors involved in developmental processes. We present here the first draft of the transcribed genomes of the yerba mate chloroplast and mitochondrion. The putative sequence and predicted structure of the caffeine synthase of yerba mate is presented. Moreover, we provide a collection of over 10,800 SSR accessible to the scientific community interested in yerba mate genetic improvement. This contribution broadly expands the limited knowledge of yerba mate genes, and is presented as the first genomic resource of this important crop. PMID:25330175

Identification and Molecular Characterization of a Chitin Deacetylase from Bombyx mori Peritrophic Membrane

PubMed Central

Zhong, Xiao-Wu; Wang, Xiao-Huan; Tan, Xiang; Xia, Qing-You; Xiang, Zhong-Huai; Zhao, Ping

2014-01-01

The insect midgut epithelium is generally lined with a unique chitin and protein structure, the peritrophic membrane (PM), which facilitates food digestion and protects the gut epithelium. PM proteins are important determinants for PM structure and formation. In this study, the silkworm Bombyx mori midgut PM protein BmCDA7 was identified by proteomic tools. The full-length BmCDA7 cDNA is 1357 bp; the deduced protein is composed of 379 amino acid residues and includes a 16 amino acid residue signal peptide, a putative polysaccharide deacetylase-like domain and 15 cysteine residues present in three clusters. The heterologously expressed proteins of the BmCDA7 gene in yeast displayed chitin deacetylase activity. Expression of B. mori BmCDA7 was detected in the midgut at both the transcriptional and translational levels. The BmCDA7 gene was expressed by the newly hatched silkworm larvae until day seven of the fifth instar and was expressed at a high level in the newly exuviated larvae of different instars. The functions and regulatory mechanism of BmCDA7, however, need further investigation. PMID:24473143

Insights into a divergent phenazine biosynthetic pathway governed by a plasmid-born esmeraldin gene cluster.

PubMed

Rui, Zhe; Ye, Min; Wang, Shuoguo; Fujikawa, Kaori; Akerele, Bankole; Aung, May; Floss, Heinz G; Zhang, Wenjun; Yu, Tin-Wein

2012-09-21

Phenazine-type metabolites arise from either phenazine-1-carboxylic acid (PCA) or phenazine-1,6-dicarboxylic acid (PDC). Although the biosynthesis of PCA has been studied extensively, PDC assembly remains unclear. Esmeraldins and saphenamycin, the PDC originated products, are antimicrobial and antitumor metabolites isolated from Streptomyces antibioticus Tü 2706. Herein, the esmeraldin biosynthetic gene cluster was identified on a dispensable giant plasmid. Twenty-four putative esm genes were characterized by bioinformatics, mutagenesis, genetic complementation, and functional protein expressions. Unlike enzymes involved in PCA biosynthesis, EsmA1 and EsmA2 together decisively promoted the PDC yield. The resulting PDC underwent a series of conversions to give 6-acetylphenazine-1-carboxylic acid, saphenic acid, and saphenamycin through a unique one-carbon extension by EsmB1-B5, a keto reduction by EsmC, and an esterification by EsmD1-D3, the atypical polyketide sythases, respectively. Two transcriptional regulators, EsmT1 and EsmT2, are required for esmeraldin production. Copyright © 2012 Elsevier Ltd. All rights reserved.

A multifunctional desaturase involved in the biosynthesis of the processionary moth sex pheromone

PubMed Central

Serra, Montserrat; Piña, Benjamin; Abad, José Luis; Camps, Francisco; Fabriàs, Gemma

2007-01-01

The sex pheromone of the female processionary moth, Thaumetopoea pityocampa, is a unique C16 enyne acetate that is biosynthesized from palmitic acid. Three consecutive desaturation reactions transform this saturated precursor into the triunsaturated fatty acyl intermediate: formation of (Z)-11-hexadecenoic acid, acetylenation to 11-hexadecynoic acid, and final Δ13 desaturation to (Z)-13-hexadecen-11-ynoic acid. By using degenerate primers common to all reported insect desaturases, a single cDNA sequence was isolated from total RNA of T. pityocampa female pheromone glands. The full-length transcript of this putative desaturase was expressed in elo1Δ/ole1Δ yeast mutants (both elongase 1 and Δ9 desaturase-deficient) for functional assays. The construct fully rescued the Δole1 yeast phenotype, confirming its desaturase activity. Analysis of the unsaturated products from transformed yeast extracts demonstrated that the cloned enzyme showed Δ11 desaturase, Δ11 acetylenase, and Δ13 desaturase activities. Therefore, this single desaturase may account for the three desaturation steps involved in the sex pheromone biosynthetic pathway of the processionary moth. PMID:17921252

Molecular characterization of Quercus suber MYB1, a transcription factor up-regulated in cork tissues.

PubMed

Almeida, Tânia; Menéndez, Esther; Capote, Tiago; Ribeiro, Teresa; Santos, Conceição; Gonçalves, Sónia

2013-01-15

The molecular processes associated with cork development in Quercus suber L. are poorly understood. A previous molecular approach identified a list of genes potentially important for cork formation and differentiation, providing a new basis for further molecular studies. This report is the first molecular characterization of one of these candidate genes, QsMYB1, coding for an R2R3-MYB transcription factor. The R2R3-MYB gene sub-family has been described as being involved in the phenylpropanoid and lignin pathways, both involved in cork biosynthesis. The results showed that the expression of QsMYB1 is putatively mediated by an alternative splicing (AS) mechanism that originates two different transcripts (QsMYB1.1 and QsMYB1.2), differing only in the 5'-untranslated region, due to retention of the first intron in one of the variants. Moreover, within the retained intron, a simple sequence repeat (SSR) was identified. The upstream regulatory region of QsMYB1 was extended by a genome walking approach, which allowed the identification of the putative gene promoter region. The relative expression pattern of QsMYB1 transcripts determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR) revealed that both transcripts were up-regulated in cork tissues; the detected expression was several times higher in newly formed cork harvested from trees producing virgin, second or reproduction cork when compared with wood. Moreover, the expression analysis of QsMYB1 in several Q. suber organs showed very low expression in young branches and roots, whereas in leaves, immature acorns or male flowers, no expression was detected. These preliminary results suggest that QsMYB1 may be related to secondary growth and, in particular, with the cork biosynthesis process with a possible alternative splicing mechanism associated with its regulatory function. Copyright © 2012 Elsevier GmbH. All rights reserved.

Integrative analysis of the Caenorhabditis elegans genome by the modENCODE project.

PubMed

Gerstein, Mark B; Lu, Zhi John; Van Nostrand, Eric L; Cheng, Chao; Arshinoff, Bradley I; Liu, Tao; Yip, Kevin Y; Robilotto, Rebecca; Rechtsteiner, Andreas; Ikegami, Kohta; Alves, Pedro; Chateigner, Aurelien; Perry, Marc; Morris, Mitzi; Auerbach, Raymond K; Feng, Xin; Leng, Jing; Vielle, Anne; Niu, Wei; Rhrissorrakrai, Kahn; Agarwal, Ashish; Alexander, Roger P; Barber, Galt; Brdlik, Cathleen M; Brennan, Jennifer; Brouillet, Jeremy Jean; Carr, Adrian; Cheung, Ming-Sin; Clawson, Hiram; Contrino, Sergio; Dannenberg, Luke O; Dernburg, Abby F; Desai, Arshad; Dick, Lindsay; Dosé, Andréa C; Du, Jiang; Egelhofer, Thea; Ercan, Sevinc; Euskirchen, Ghia; Ewing, Brent; Feingold, Elise A; Gassmann, Reto; Good, Peter J; Green, Phil; Gullier, Francois; Gutwein, Michelle; Guyer, Mark S; Habegger, Lukas; Han, Ting; Henikoff, Jorja G; Henz, Stefan R; Hinrichs, Angie; Holster, Heather; Hyman, Tony; Iniguez, A Leo; Janette, Judith; Jensen, Morten; Kato, Masaomi; Kent, W James; Kephart, Ellen; Khivansara, Vishal; Khurana, Ekta; Kim, John K; Kolasinska-Zwierz, Paulina; Lai, Eric C; Latorre, Isabel; Leahey, Amber; Lewis, Suzanna; Lloyd, Paul; Lochovsky, Lucas; Lowdon, Rebecca F; Lubling, Yaniv; Lyne, Rachel; MacCoss, Michael; Mackowiak, Sebastian D; Mangone, Marco; McKay, Sheldon; Mecenas, Desirea; Merrihew, Gennifer; Miller, David M; Muroyama, Andrew; Murray, John I; Ooi, Siew-Loon; Pham, Hoang; Phippen, Taryn; Preston, Elicia A; Rajewsky, Nikolaus; Rätsch, Gunnar; Rosenbaum, Heidi; Rozowsky, Joel; Rutherford, Kim; Ruzanov, Peter; Sarov, Mihail; Sasidharan, Rajkumar; Sboner, Andrea; Scheid, Paul; Segal, Eran; Shin, Hyunjin; Shou, Chong; Slack, Frank J; Slightam, Cindie; Smith, Richard; Spencer, William C; Stinson, E O; Taing, Scott; Takasaki, Teruaki; Vafeados, Dionne; Voronina, Ksenia; Wang, Guilin; Washington, Nicole L; Whittle, Christina M; Wu, Beijing; Yan, Koon-Kiu; Zeller, Georg; Zha, Zheng; Zhong, Mei; Zhou, Xingliang; Ahringer, Julie; Strome, Susan; Gunsalus, Kristin C; Micklem, Gos; Liu, X Shirley; Reinke, Valerie; Kim, Stuart K; Hillier, LaDeana W; Henikoff, Steven; Piano, Fabio; Snyder, Michael; Stein, Lincoln; Lieb, Jason D; Waterston, Robert H

2010-12-24

We systematically generated large-scale data sets to improve genome annotation for the nematode Caenorhabditis elegans, a key model organism. These data sets include transcriptome profiling across a developmental time course, genome-wide identification of transcription factor-binding sites, and maps of chromatin organization. From this, we created more complete and accurate gene models, including alternative splice forms and candidate noncoding RNAs. We constructed hierarchical networks of transcription factor-binding and microRNA interactions and discovered chromosomal locations bound by an unusually large number of transcription factors. Different patterns of chromatin composition and histone modification were revealed between chromosome arms and centers, with similarly prominent differences between autosomes and the X chromosome. Integrating data types, we built statistical models relating chromatin, transcription factor binding, and gene expression. Overall, our analyses ascribed putative functions to most of the conserved genome.

Marek's disease is a natural model for lymphomas overexpressing Hodgkin's disease antigen (CD30)

PubMed Central

Burgess, S. C.; Young, J. R.; Baaten, B. J. G.; Hunt, L.; Ross, L. N. J.; Parcells, M. S.; Kumar, P. M.; Tregaskes, C. A.; Lee, L. F.; Davison, T. F.

2004-01-01

Animal models are essential for elucidating the molecular mechanisms of carcinogenesis. Hodgkin's and many diverse non-Hodgkin's lymphomas overexpress the Hodgkin's disease antigen CD30 (CD30hi), a tumor necrosis factor receptor II family member. Here we show that chicken Marek's disease (MD) lymphoma cells are also CD30hi and are a unique natural model for CD30hi lymphoma. Chicken CD30 resembles an ancestral form, and we identify a previously undescribed potential cytoplasmic signaling domain conserved in chicken, human, and mouse CD30. Our phylogeneic analysis defines a relationship between the structures of human and mouse CD30 and confirms that mouse CD30 represents the ancestral mammalian gene structure. CD30 expression by MD virus (MDV)-transformed lymphocytes correlates with expression of the MDV Meq putative oncogene (a c-Jun homologue) in vivo. The chicken CD30 promoter has 15 predicted high-stringency Meq-binding transcription factor recognition motifs, and Meq enhances transcription from the CD30 promoter in vitro. Plasma proteomics identified a soluble form of CD30. CD30 overexpression is evolutionarily conserved and defines one class of neoplastic transformation events, regardless of etiology. We propose that CD30 is a component of a critical intracellular signaling pathway perturbed in neoplastic transformation. Specific anti-CD30 Igs occurred after infection of genetically MD-resistant chickens with oncogenic MDV, suggesting immunity to CD30 could play a role in MD lymphoma regression. PMID:15356338

The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus

USGS Publications Warehouse

Morzunov , Sergey P.; Winton, James R.; Nichol, Stuart T.

1995-01-01

Infectious hematopoietic necrosis virus (IHNV), a member of the family Rhabdoviridae, causes a severe disease with high mortality in salmonid fish. The nucleotide sequence (11, 131 bases) of the entire genome was determined for the pathogenic WRAC strain of IHNV from southern Idaho. This allowed detailed analysis of all 6 genes, the deduced amino acid sequences of their encoded proteins, and important control motifs including leader, trailer and gene junction regions. Sequence analysis revealed that the 6 virus genes are located along the genome in the 3′ to 5′ order: nucleocapsid (N), polymerase-associated phosphoprotein (P or M1), matrix protein (M or M2), surface glycoprotein (G), a unique non-virion protein (NV) and virus polymerase (L). The IHNV genome RNA was found to have highly complementary termini (15 of 16 nucleotides). The gene junction regions display the highly conserved sequence UCURUC(U)7RCCGUG(N)4CACR (in the vRNA sense), which includes the typical rhabdovirus transcription termination/polyadenylation signal and a novel putative transcription initiation signal. Phylogenetic analysis of M, G and L protein sequences allowed insights into the evolutionary and taxonomic relationship of rhabdoviruses of fish relative to those of insects or mammals, and a broader sense of the relationship of non-segmented negative-strand RNA viruses. Based on these data, a new genus, piscivirus, is proposed which will initially contain IHNV, viral hemorrhagic septicemia virus and Hirame rhabdovirus.

Defining Transcriptional Regulatory Mechanisms for Primary let-7 miRNAs

PubMed Central

Gaeta, Xavier; Le, Luat; Lin, Ying; Xie, Yuan; Lowry, William E.

2017-01-01

The let-7 family of miRNAs have been shown to control developmental timing in organisms from C. elegans to humans; their function in several essential cell processes throughout development is also well conserved. Numerous studies have defined several steps of post-transcriptional regulation of let-7 production; from pri-miRNA through pre-miRNA, to the mature miRNA that targets endogenous mRNAs for degradation or translational inhibition. Less-well defined are modes of transcriptional regulation of the pri-miRNAs for let-7. let-7 pri-miRNAs are expressed in polycistronic fashion, in long transcripts newly annotated based on chromatin-associated RNA-sequencing. Upon differentiation, we found that some let-7 pri-miRNAs are regulated at the transcriptional level, while others appear to be constitutively transcribed. Using the Epigenetic Roadmap database, we further annotated regulatory elements of each polycistron identified putative promoters and enhancers. Probing these regulatory elements for transcription factor binding sites identified factors that regulate transcription of let-7 in both promoter and enhancer regions, and identified novel regulatory mechanisms for this important class of miRNAs. PMID:28052101

[Isolation of ABA-regulated genes in Oryza sativa through fluorescent differential display PCR (FDD-PCR)].

PubMed

Xu, Shou Ling; Shen, Si Shi; Xu, Zhi Hong; Xue, Hong Wei

2002-12-01

Abscisic acid (ABA) was critical in plant seed development and response to environmental factors such as stress situations. To study the possible ABA related signaling transduction pathways, we tried to isolate the ABA-regulated genes through fluorescent differential display PCR (FDD-PCR) technology using rice seedling as materials (treated with ABA for 2, 4, 8 and 12h). In the 17 fragments isolated, 14 and 3 clones were up-and down-regulated respectively. Sequence analyses revealed that the encoded proteins were involved in photosynthesis (7 fragments), signal transduction (1 fragments), transcription (2 fragments), metabolism and resistance (6 fragments), and unknown protein (1 fragments). 3 clones, encoding putative alpha/beta hydrolase fold, putative vacuolar H+ -ATPase B subunit, putative tyrosine phosphatase, were confirmed to be regulated under ABA treatment by RT-PCR and northern blot analysis. FDD-PCR and possible functional mechanisms of ABA were discussed.

CalA, a Cyanobacterial AbrB Protein, Interacts with the Upstream Region of hypC and Acts as a Repressor of Its Transcription in the Cyanobacterium Nostoc sp. Strain PCC 7120▿ †

PubMed Central

Agervald, Åsa; Zhang, Xiaohui; Stensjö, Karin; Devine, Ellenor; Lindblad, Peter

2010-01-01

The filamentous, heterocystous, nitrogen-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain, depending on growth conditions, up to two hydrogenases directly involved in hydrogen metabolism. HypC is one out of at least seven auxiliary gene products required for synthesis of a functional hydrogenase, specifically involved in the maturation of the large subunit. In this study we present a protein, CalA (Alr0946 in the genome), belonging to the transcription regulator family AbrB, which in protein-DNA assays was found to interact with the upstream region of hypC. Transcriptional investigations showed that calA is cotranscribed with the downstream gene alr0947, which encodes a putative protease from the abortive infection superfamily, Abi. CalA was shown to interact specifically not only with the upstream region of hypC but also with its own upstream region, acting as a repressor on hypC. The bidirectional hydrogenase activity was significantly downregulated when CalA was overexpressed, demonstrating a correlation with the transcription factor, either direct or indirect. In silico studies showed that homologues to both CalA and Alr0947 are highly conserved proteins within cyanobacteria with very similar physical organizations of the corresponding structural genes. Possible functions of the cotranscribed downstream protein Alr0947 are presented. In addition, we present a three-dimensional (3D) model of the DNA binding domain of CalA and putative DNA binding mechanisms are discussed. PMID:20023111

Comparative genomics reveals candidate carotenoid pathway regulators of ripening watermelon fruit.

PubMed

Grassi, Stefania; Piro, Gabriella; Lee, Je Min; Zheng, Yi; Fei, Zhangjun; Dalessandro, Giuseppe; Giovannoni, James J; Lenucci, Marcello S

2013-11-12

Many fruits, including watermelon, are proficient in carotenoid accumulation during ripening. While most genes encoding steps in the carotenoid biosynthetic pathway have been cloned, few transcriptional regulators of these genes have been defined to date. Here we describe the identification of a set of putative carotenoid-related transcription factors resulting from fresh watermelon carotenoid and transcriptome analysis during fruit development and ripening. Our goal is to both clarify the expression profiles of carotenoid pathway genes and to identify candidate regulators and molecular targets for crop improvement. Total carotenoids progressively increased during fruit ripening up to ~55 μg g(-1) fw in red-ripe fruits. Trans-lycopene was the carotenoid that contributed most to this increase. Many of the genes related to carotenoid metabolism displayed changing expression levels during fruit ripening generating a metabolic flux toward carotenoid synthesis. Constitutive low expression of lycopene cyclase genes resulted in lycopene accumulation. RNA-seq expression profiling of watermelon fruit development yielded a set of transcription factors whose expression was correlated with ripening and carotenoid accumulation. Nineteen putative transcription factor genes from watermelon and homologous to tomato carotenoid-associated genes were identified. Among these, six were differentially expressed in the flesh of both species during fruit development and ripening. Taken together the data suggest that, while the regulation of a common set of metabolic genes likely influences carotenoid synthesis and accumulation in watermelon and tomato fruits during development and ripening, specific and limiting regulators may differ between climacteric and non-climacteric fruits, possibly related to their differential susceptibility to and use of ethylene during ripening.

Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

PubMed Central

Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

2016-01-01

A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

Genome-Wide Identification and Expression Analysis of Homeodomain Leucine Zipper Subfamily IV (HDZ IV) Gene Family from Musa accuminata

PubMed Central

Pandey, Ashutosh; Misra, Prashant; Alok, Anshu; Kaur, Navneet; Sharma, Shivani; Lakhwani, Deepika; Asif, Mehar H.; Tiwari, Siddharth; Trivedi, Prabodh K.

2016-01-01

The homeodomain zipper family (HD-ZIP) of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV) has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV encoding genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana, and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV encoding genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV encoding genes and for their possible use in the banana improvement programs. PMID:26870050

Comparative genomics reveals candidate carotenoid pathway regulators of ripening watermelon fruit

PubMed Central

2013-01-01

Background Many fruits, including watermelon, are proficient in carotenoid accumulation during ripening. While most genes encoding steps in the carotenoid biosynthetic pathway have been cloned, few transcriptional regulators of these genes have been defined to date. Here we describe the identification of a set of putative carotenoid-related transcription factors resulting from fresh watermelon carotenoid and transcriptome analysis during fruit development and ripening. Our goal is to both clarify the expression profiles of carotenoid pathway genes and to identify candidate regulators and molecular targets for crop improvement. Results Total carotenoids progressively increased during fruit ripening up to ~55 μg g-1 fw in red-ripe fruits. Trans-lycopene was the carotenoid that contributed most to this increase. Many of the genes related to carotenoid metabolism displayed changing expression levels during fruit ripening generating a metabolic flux toward carotenoid synthesis. Constitutive low expression of lycopene cyclase genes resulted in lycopene accumulation. RNA-seq expression profiling of watermelon fruit development yielded a set of transcription factors whose expression was correlated with ripening and carotenoid accumulation. Nineteen putative transcription factor genes from watermelon and homologous to tomato carotenoid-associated genes were identified. Among these, six were differentially expressed in the flesh of both species during fruit development and ripening. Conclusions Taken together the data suggest that, while the regulation of a common set of metabolic genes likely influences carotenoid synthesis and accumulation in watermelon and tomato fruits during development and ripening, specific and limiting regulators may differ between climacteric and non-climacteric fruits, possibly related to their differential susceptibility to and use of ethylene during ripening. PMID:24219562

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

Comparative analyses of putative toxin gene homologs from an Old World viper, Daboia russelii

PubMed Central

Krishnan, Neeraja M.

2017-01-01

Availability of snake genome sequences has opened up exciting areas of research on comparative genomics and gene diversity. One of the challenges in studying snake genomes is the acquisition of biological material from live animals, especially from the venomous ones, making the process cumbersome and time-consuming. Here, we report comparative sequence analyses of putative toxin gene homologs from Russell’s viper (Daboia russelii) using whole-genome sequencing data obtained from shed skin. When compared with the major venom proteins in Russell’s viper studied previously, we found 45–100% sequence similarity between the venom proteins and their putative homologs in the skin. Additionally, comparative analyses of 20 putative toxin gene family homologs provided evidence of unique sequence motifs in nerve growth factor (NGF), platelet derived growth factor (PDGF), Kunitz/Bovine pancreatic trypsin inhibitor (Kunitz BPTI), cysteine-rich secretory proteins, antigen 5, andpathogenesis-related1 proteins (CAP) and cysteine-rich secretory protein (CRISP). In those derived proteins, we identified V11 and T35 in the NGF domain; F23 and A29 in the PDGF domain; N69, K2 and A5 in the CAP domain; and Q17 in the CRISP domain to be responsible for differences in the largest pockets across the protein domain structures in crotalines, viperines and elapids from the in silico structure-based analysis. Similarly, residues F10, Y11 and E20 appear to play an important role in the protein structures across the kunitz protein domain of viperids and elapids. Our study highlights the usefulness of shed skin in obtaining good quality high-molecular weight DNA for comparative genomic studies, and provides evidence towards the unique features and evolution of putative venom gene homologs in vipers. PMID:29230357

Characterization of the cork oak transcriptome dynamics during acorn development.

PubMed

Miguel, Andreia; de Vega-Bartol, José; Marum, Liliana; Chaves, Inês; Santo, Tatiana; Leitão, José; Varela, Maria Carolina; Miguel, Célia M

2015-06-25

Cork oak (Quercus suber L.) has a natural distribution across western Mediterranean regions and is a keystone forest tree species in these ecosystems. The fruiting phase is especially critical for its regeneration but the molecular mechanisms underlying the biochemical and physiological changes during cork oak acorn development are poorly understood. In this study, the transcriptome of the cork oak acorn, including the seed, was characterized in five stages of development, from early development to acorn maturation, to identify the dominant processes in each stage and reveal transcripts with important functions in gene expression regulation and response to water. A total of 80,357 expressed sequence tags (ESTs) were de novo assembled from RNA-Seq libraries representative of the several acorn developmental stages. Approximately 7.6 % of the total number of transcripts present in Q. suber transcriptome was identified as acorn specific. The analysis of expression profiles during development returned 2,285 differentially expressed (DE) transcripts, which were clustered into six groups. The stage of development corresponding to the mature acorn exhibited an expression profile markedly different from other stages. Approximately 22 % of the DE transcripts putatively code for transcription factors (TF) or transcriptional regulators, and were found almost equally distributed among the several expression profile clusters, highlighting their major roles in controlling the whole developmental process. On the other hand, carbohydrate metabolism, the biological pathway most represented during acorn development, was especially prevalent in mid to late stages as evidenced by enrichment analysis. We further show that genes related to response to water, water deprivation and transport were mostly represented during the early (S2) and the last stage (S8) of acorn development, when tolerance to water desiccation is possibly critical for acorn viability. To our knowledge this work represents the first report of acorn development transcriptomics in oaks. The obtained results provide novel insights into the developmental biology of cork oak acorns, highlighting transcripts putatively involved in the regulation of the gene expression program and in specific processes likely essential for adaptation. It is expected that this knowledge can be transferred to other oak species of great ecological value.

An evolutionarily conserved RNase-based mechanism for repression of transcriptional positive autoregulation

PubMed Central

Wurtmann, Elisabeth J.; Ratushny, Alexander V.; Pan, Min; Beer, Karlyn D.; Aitchison, John D.; Baliga, Nitin S.

2014-01-01

Summary It is known that environmental context influences the degree of regulation at the transcriptional and post-transcriptional levels. However, the principles governing the differential usage and interplay of regulation at these two levels are not clear. Here, we show that the integration of transcriptional and post-transcriptional regulatory mechanisms in a characteristic network motif drives efficient environment-dependent state transitions. Through phenotypic screening, systems analysis, and rigorous experimental validation, we discovered an RNase (VNG2099C) in Halobacterium salinarum that is transcriptionally co-regulated with genes of the aerobic physiologic state but acts on transcripts of the anaerobic state. Through modeling and experimentation we show that this arrangement generates an efficient state-transition switch, within which RNase-repression of a transcriptional positive autoregulation (RPAR) loop is critical for shutting down ATP-consuming active potassium uptake to reserve energy required for salinity adaptation under aerobic, high potassium, or dark conditions. Subsequently, we discovered that many Escherichia coli operons with energy-associated functions are also putatively controlled by RPAR indicating that this network motif may have evolved independently in phylogenetically distant organisms. Thus, our data suggest that interplay of transcriptional and post-transcriptional regulation in the RPAR motifis a generalized principle for efficient environment-dependent state transitions across prokaryotes. PMID:24612392

Use of omics methods to determine the mode of action of natural phytotoxins

USDA-ARS?s Scientific Manuscript database

Technology has greatly increased the power of omics methods to profile transcription, protein, and metabolite responses to phytotoxins. These methods hold promise as a tool for providing clues to the modes of action of such compounds. However, to date, only two putative modes of action have been fou...

GLOBAL TRANSCRIPTION PROFILING REVEALS DIFFERENTIAL RESPONSES TO CHRONIC NITROGEN STRESS AND PUTATIVE NITROGEN REGULATORY COMPONENTS IN ARABIDOPSIS

EPA Science Inventory

Background: A large quantity of nitrogen (N) fertilizer is used for crop production to achieve high yields at a significant economic and environmental cost. Efforts have been directed to understanding the molecular basis of plant responses to N and to identifying N-responsive gen...

Negative regulation of P element excision by the somatic product and terminal sequences of P in drosophila melanogaster

USDA-ARS?s Scientific Manuscript database

A transient in vivo P element excision assay was used to test the regulatory properties of putative repressor-encoding plasmids in Drosophila melanogaster embryos. The somatic expression of an unmodified transposase transcription unit under the control of a heat shock gene promoter (phsn) effectivel...

A putative role for GnRH-II and its receptor in spermatogenic function of boars

USDA-ARS?s Scientific Manuscript database

Unlike the classical gonadotropin-releasing hormone (GnRH-I), the second mammalian isoform of GnRH (GnRH-II) is ubiquitously expressed with the most abundant transcript levels found in tissues outside of the hypothalamus. Moreover, GnRH-II is only an inefficient stimulator of gonadotropin release. I...

The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains

PubMed Central

Romero, Lisa C; Nguyen, Thanh V; Deville, Benoit; Ogunjumo, Oluwasanmi; James, Anthony A

2004-01-01

Background Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. Results Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. Conclusions The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development. PMID:15222903

Transcriptional activation of a geranylgeranyl diphosphate synthase gene, GGPPS2, isolated from Scoparia dulcis by treatment with methyl jasmonate and yeast extract.

PubMed

Yamamura, Y; Mizuguchi, Y; Taura, F; Kurosaki, F

2014-10-01

A cDNA clone, designated SdGGPPS2, was isolated from young seedlings of Scoparia dulcis. The putative amino acid sequence of the translate of the gene showed high homology with geranylgeranyl diphosphate synthase (GGPPS) from various plant sources, and the N-terminal residues exhibited the characteristics of chloroplast targeting sequence. An appreciable increase in the transcriptional level of SdGGPPS2 was observed by exposure of the leaf tissues of S. dulcis to methyl jasmonate, yeast extract or Ca(2+) ionophore A23187. In contrast, SdGGPPS1, a homologous GGPPS gene of the plant, showed no or only negligible change in the expression level upon treatment with these stimuli. The truncated protein heterologously expressed in Escherichia coli in which the putative targeting domain was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to liberate geranylgeranyl diphosphate. These results suggested that SdGGPPS2 plays physiological roles in methyl jasmonate and yeast extract-induced metabolism in the chloroplast of S. dulcis cells.

Identification of regulatory targets for the bacterial Nus factor complex.

PubMed

Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T

2017-12-11

Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.

Inactivation of a putative efflux pump (LmrB) in Streptococcus mutans results in altered biofilm structure and increased exopolysaccharide synthesis: implications for biofilm resistance.

PubMed

Liu, Jia; Zhang, Jianying; Guo, Lihong; Zhao, Wei; Hu, Xiaoli; Wei, Xi

2017-07-01

Efflux pumps are a mechanism associated with biofilm formation and resistance. There is limited information regarding efflux pumps in Streptococcus mutans, a major pathogen in dental caries. The aim of this study was to investigate potential roles of a putative efflux pump (LmrB) in S. mutans biofilm formation and susceptibility. Upon lmrB inactivation and antimicrobial exposure, the biofilm structure and expression of other efflux pumps were examined using confocal laser scanning microscopy (CLSM) and qRT-PCR. lmrB inactivation resulted in biofilm structural changes, increased EPS formation and EPS-related gene transcription (p < 0.05), but no improvement in susceptibility was observed. The expression of most efflux pump genes increased upon lmrB inactivation when exposed to antimicrobials (p < 0.05), suggesting a feedback mechanism that activated the transcription of other efflux pumps to compensate for the loss of lmrB. These observations imply that sole inactivation of lmrB is not an effective solution to control biofilms.

Carotenoid biosynthesis in bacteria: In vitro studies of a crt/bch transcription factor from Rhodobacter capsulatus and carotenoid enzymes from Erwinia herbicola

DOE Office of Scientific and Technical Information (OSTI.GOV)

O'Brien, D.A.

1992-11-01

A putative transcription factor in Rhodobactor capsulatus which binds upstream of the crt and bch pigment biosynthesis operons and appears to play a role in the adaptation of the organism from the aerobic to the anaerobic-photosynthetic growth mode was characterized. Chapter 2 describes the identification of this factor through an in vitro mobility shift assay, as well as the determination of its binding properties and sequence specificity. Chapter 3 focuses on the isolation of this factor. Biochemistry of later carotenoid biosynthesis enzymes derived from the non-photosynthetic bacterium, Erwinia herbicola. Chapter 4 describes the separate overexpression and in vitro analysis ofmore » two enzymes involved in the main sequence of the carotenoid biosynthesis pathway, lycopene cyclase and 5-carotene hydroxylase. Chapter 5 examines the overexpression and enzymology of functionally active zeaxanthin glucosyltransferase, an enzyme which carries out a more unusual transformation, converting a carotenoid into its more hydrophilic mono- and diglucoside derivatives. In addition, amino acid homology with other glucosyltransferases suggests a putative binding site for the UDP-activated glucose substrate.« less

Phylogeny of fungal hemoglobins and expression analysis of the Aspergillus oryzae flavohemoglobin gene fhbA during hyphal growth.

PubMed

te Biesebeke, Rob; Levasseur, Anthony; Boussier, Amandine; Record, Eric; van den Hondel, Cees A M J J; Punt, Peter J

2010-01-01

The fhbA genes encoding putative flavohemoglobins (FHb) from Aspergillus niger and Aspergillus oryzae were isolated. Comparison of the deduced amino acid sequence of the A. niger fhbA gene and other putative filamentous fungal FHb-encoding genes to that of Ralstonia eutropha shows an overall conserved gene structure and completely conserved catalytic amino acids. Several yeasts and filamentous fungi, including both Aspergillus species have been found to contain a small FHb gene family mostly consisting of two family members. Based on these sequences the evolutionary history of the fungal FHb family was reconstructed. The isolated fhbA genes from A. oryzae and A. niger belong to a phylogenetic group, which exclusively contains Aspergillus genes. Different experimental approaches show that fhbA transcript levels appear during active hyphal growth. Moreover, in a pclA-disrupted strain with a hyperbranching growth phenotype, the transcript levels of the fhbA gene were 2–5 times higher compared to the wild-type. These results suggest that FHb from filamentous fungi have a function that is correlated to the hyphal growth phenotype.

Physiological Responses and Gene Co-Expression Network of Mycorrhizal Roots under K+ Deprivation1[OPEN

PubMed Central

Roy, Sushmita

2017-01-01

Arbuscular mycorrhizal (AM) associations enhance the phosphorous and nitrogen nutrition of host plants, but little is known about their role in potassium (K+) nutrition. Medicago truncatula plants were cocultured with the AM fungus Rhizophagus irregularis under high and low K+ regimes for 6 weeks. We determined how K+ deprivation affects plant development and mineral acquisition and how these negative effects are tempered by the AM colonization. The transcriptional response of AM roots under K+ deficiency was analyzed by whole-genome RNA sequencing. K+ deprivation decreased root biomass and external K+ uptake and modulated oxidative stress gene expression in M. truncatula roots. AM colonization induced specific transcriptional responses to K+ deprivation that seem to temper these negative effects. A gene network analysis revealed putative key regulators of these responses. This study confirmed that AM associations provide some tolerance to K+ deprivation to host plants, revealed that AM symbiosis modulates the expression of specific root genes to cope with this nutrient stress, and identified putative regulators participating in these tolerance mechanisms. PMID:28159827

Eucalypt NADP-Dependent Isocitrate Dehydrogenase1

PubMed Central

Boiffin, Vincent; Hodges, Michael; Gálvez, Susana; Balestrini, Raffaella; Bonfante, Paola; Gadal, Pierre; Martin, Francis

1998-01-01

NADP-dependent isocitrate dehydrogenase (NADP-ICDH) activity is increased in roots of Eucalyptus globulus subsp. bicostata ex Maiden Kirkp. during colonization by the ectomycorrhizal fungus Pisolithus tinctorius Coker and Couch. To investigate the regulation of the enzyme expression, a cDNA (EgIcdh) encoding the NADP-ICDH was isolated from a cDNA library of E. globulus-P. tinctorius ectomycorrhizae. The putative polypeptide sequence of EgIcdh showed a high amino acid similarity with plant NADP-ICDHs. Because the deduced EgICDH protein lacks an amino-terminal targeting sequence and shows highest similarity to plant cytosolic ICDHs, it probably represents a cytoplasmic isoform. RNA analysis showed that the steady-state level of EgIcdh transcripts was enhanced nearly 2-fold in ectomycorrhizal roots compared with nonmycorrhizal roots. Increased accumulation of NADP-ICDH transcripts occurred as early as 2 d after contact and likely led to the observed increased enzyme activity. Indirect immunofluorescence microscopy indicated that NADP-ICDH was preferentially accumulated in the epidermis and stele parenchyma of nonmycorrhizal and ectomycorrhizal lateral roots. The putative role of cytosolic NADP-ICDH in ectomycorrhizae is discussed. PMID:9662536

Conserved small mRNA with an unique, extended Shine-Dalgarno sequence

PubMed Central

Hahn, Julia; Migur, Anzhela; von Boeselager, Raphael Freiherr; Kubatova, Nina; Kubareva, Elena; Schwalbe, Harald

2017-01-01

ABSTRACT Up to now, very small protein-coding genes have remained unrecognized in sequenced genomes. We identified an mRNA of 165 nucleotides (nt), which is conserved in Bradyrhizobiaceae and encodes a polypeptide with 14 amino acid residues (aa). The small mRNA harboring a unique Shine-Dalgarno sequence (SD) with a length of 17 nt was localized predominantly in the ribosome-containing P100 fraction of Bradyrhizobium japonicum USDA 110. Strong interaction between the mRNA and 30S ribosomal subunits was demonstrated by their co-sedimentation in sucrose density gradient. Using translational fusions with egfp, we detected weak translation and found that it is impeded by both the extended SD and the GTG start codon (instead of ATG). Biophysical characterization (CD- and NMR-spectroscopy) showed that synthesized polypeptide remained unstructured in physiological puffer. Replacement of the start codon by a stop codon increased the stability of the transcript, strongly suggesting additional posttranscriptional regulation at the ribosome. Therefore, the small gene was named rreB (ribosome-regulated expression in Bradyrhizobiaceae). Assuming that the unique ribosome binding site (RBS) is a hallmark of rreB homologs or similarly regulated genes, we looked for similar putative RBS in bacterial genomes and detected regions with at least 16 nt complementarity to the 3′-end of 16S rRNA upstream of sORFs in Caulobacterales, Rhizobiales, Rhodobacterales and Rhodospirillales. In the Rhodobacter/Roseobacter lineage of α-proteobacteria the corresponding gene (rreR) is conserved and encodes an 18 aa protein. This shows how specific RBS features can be used to identify new genes with presumably similar control of expression at the RNA level. PMID:27834614

Regulation of Sulfur Assimilation Pathways in Burkholderia cenocepacia through Control of Genes by the SsuR Transcription Factor▿

PubMed Central

Łochowska, Anna; Iwanicka-Nowicka, Roksana; Zielak, Agata; Modelewska, Anna; Thomas, Mark S.; Hryniewicz, Monika M.

2011-01-01

The genome of Burkholderia cenocepacia contains two genes encoding closely related LysR-type transcriptional regulators, CysB and SsuR, involved in control of sulfur assimilation processes. In this study we show that the function of SsuR is essential for the utilization of a number of organic sulfur sources of either environmental or human origin. Among the genes upregulated by SsuR identified here are the tauABC operon encoding a predicted taurine transporter, three tauD-type genes encoding putative taurine dioxygenases, and atsA encoding a putative arylsulfatase. The role of SsuR in expression of these genes/operons was characterized through (i) construction of transcriptional reporter fusions to candidate promoter regions and analysis of their expression in the presence/absence of SsuR and (ii) testing the ability of SsuR to bind SsuR-responsive promoter regions. We also demonstrate that expression of SsuR-activated genes is not repressed in the presence of inorganic sulfate. A more detailed analysis of four SsuR-responsive promoter regions indicated that ∼44 bp of the DNA sequence preceding and/or overlapping the predicted −35 element of such promoters is sufficient for SsuR binding. The DNA sequence homology among SsuR “recognition motifs” at different responsive promoters appears to be limited. PMID:21317335

Gene expression changes during short day induced terminal bud formation in Norway spruce.

PubMed

Asante, Daniel K A; Yakovlev, Igor A; Fossdal, Carl Gunnar; Holefors, Anna; Opseth, Lars; Olsen, Jorunn E; Junttila, Olavi; Johnsen, Øystein

2011-02-01

The molecular basis for terminal bud formation in autumn is not well understood in conifers. By combining suppression subtractive hybridization and monitoring of gene expression by qRT-PCR analysis, we aimed to identify genes involved in photoperiodic control of growth cessation and bud set in Norway spruce. Close to 1400 ESTs were generated and their functional distribution differed between short day (SD-12 h photoperiod) and long day (LD-24 h photoperiod) libraries. Many genes with putative roles in protection against stress appeared differentially regulated under SD and LD, and also differed in transcript levels between 6 and 20 SDs. Of these, PaTFL1(TERMINAL FLOWER LIKE 1) showed strongly increased transcript levels at 6 SDs. PaCCCH(CCCH-TYPE ZINC FINGER) and PaCBF2&3(C-REPEAT BINDING FACTOR 2&3) showed a later response at 20 SDs, with increased and decreased transcript levels, respectively. For rhythmically expressed genes such as CBFs, such differences might represent a phase shift in peak expression, but might also suggest a putative role in response to SD. Multivariate analyses revealed strong differences in gene expression between LD, 6 SD and 20 SD. The robustness of the gene expression patterns was verified in 6 families differing in bud-set timing under natural light with gradually decreasing photoperiod. © 2010 Blackwell Publishing Ltd.

Enhanced cellulase production from Trichoderma reesei Rut-C30 by engineering with an artificial zinc finger protein library.

PubMed

Zhang, Fei; Bai, Fengwu; Zhao, Xinqing

2016-10-01

Trichoderma reesei Rut-C30 is a well-known cellulase producer, and improvement of its cellulase production is of great interest. An artificial zinc finger protein (AZFP) library is constructed for expression in T. reesei Rut-C30, and a mutant strain T. reesei U3 is selected based on its enhanced cellulase production. The U3 mutant shows a 55% rise in filter paper activity and 8.1-fold increased β-glucosidase activity, when compared to the native strain T. reesei Rut-C30. It is demonstrated that enhanced β-glucosidase activity was due to elevated transcription level of β-glucosidase gene in the U3 mutant. Moreover, significant elevation in transcription levels of several putative Azfp-U3 target genes is detected in the U3 mutant, including genes encoding hypothetical transcription factors and a putative glycoside hydrolase. Furthermore, U3 cellulase shows 115% higher glucose yield from pretreated corn stover, when compared to the cellulase of T. reesei Rut-C30. These results demonstrate that AZFP can be used to improve cellulase production in T. reesei Rut-C30. Our current work offers the establishment of an alternative strategy to develop fungal cell factories for improved production of high value industrial products. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Villard, L.; Lossi, A.M.; Fontes, M.

We have previously reported the isolation of a gene from Xq13 that codes for a putative regulator of transcription (XNP) and has now been shown to be the gene involved in the X-linked {alpha}-thalassemia with mental retardation (ATR-X) syndrome. The widespread expression and numerous domains present in the putative protein suggest that this gene could be involved in other phenotypes. The predominant expression of the gene in the developing brain, as well as its association with neuron differentiation, indicates that mutations of this gene might result in a mental retardation (MR) phenotype. In this paper we present a family withmore » a splice junction mutation in XNP that results in the skipping of an exon and in the introduction of a stop codon in the middle of the XNP-coding sequence. Only the abnormal transcript is expressed in two first cousins presenting the classic ATR-X phenotype (with {alpha}-thalassemia and HbH inclusions). In a distant cousin presenting a similar dysmorphic MR phenotype but not having thalassemia, {approximately}30% of the XNP transcripts are normal. These data demonstrate that the mode of action of the XNP gene product on globin expression is distinct from its mode of action in brain development and facial morphogenesis and suggest that other dysmorphic mental retardation phenotypes, such as Juberg-Marsidi or some sporadic cases of Coffin-Lowry, could be due to mutations in XNP. 20 refs., 5 figs., 2 tabs.« less

Candidate gene database and transcript map for peach, a model species for fruit trees.

PubMed

Horn, Renate; Lecouls, Anne-Claire; Callahan, Ann; Dandekar, Abhaya; Garay, Lilibeth; McCord, Per; Howad, Werner; Chan, Helen; Verde, Ignazio; Main, Doreen; Jung, Sook; Georgi, Laura; Forrest, Sam; Mook, Jennifer; Zhebentyayeva, Tatyana; Yu, Yeisoo; Kim, Hye Ran; Jesudurai, Christopher; Sosinski, Bryon; Arús, Pere; Baird, Vance; Parfitt, Dan; Reighard, Gregory; Scorza, Ralph; Tomkins, Jeffrey; Wing, Rod; Abbott, Albert Glenn

2005-05-01

Peach (Prunus persica) is a model species for the Rosaceae, which includes a number of economically important fruit tree species. To develop an extensive Prunus expressed sequence tag (EST) database for identifying and cloning the genes important to fruit and tree development, we generated 9,984 high-quality ESTs from a peach cDNA library of developing fruit mesocarp. After assembly and annotation, a putative peach unigene set consisting of 3,842 ESTs was defined. Gene ontology (GO) classification was assigned based on the annotation of the single "best hit" match against the Swiss-Prot database. No significant homology could be found in the GenBank nr databases for 24.3% of the sequences. Using core markers from the general Prunus genetic map, we anchored bacterial artificial chromosome (BAC) clones on the genetic map, thereby providing a framework for the construction of a physical and transcript map. A transcript map was developed by hybridizing 1,236 ESTs from the putative peach unigene set and an additional 68 peach cDNA clones against the peach BAC library. Hybridizing ESTs to genetically anchored BACs immediately localized 11.2% of the ESTs on the genetic map. ESTs showed a clustering of expressed genes in defined regions of the linkage groups. [The data were built into a regularly updated Genome Database for Rosaceae (GDR), available at (http://www.genome.clemson.edu/gdr/).].

Identification of Primary Transcriptional Regulation of Cell Cycle-Regulated Genes upon DNA Damage

PubMed Central

Zhou, Tong; Chou, Jeff; Mullen, Thomas E.; Elkon, Rani; Zhou, Yingchun; Simpson, Dennis A.; Bushel, Pierre R.; Paules, Richard S.; Lobenhofer, Edward K.; Hurban, Patrick; Kaufmann, William K.

2007-01-01

The changes in global gene expression in response to DNA damage may derive from either direct induction or repression by transcriptional regulation or indirectly by synchronization of cells to specific cell cycle phases, such as G1 or G2. We developed a model that successfully estimated the expression levels of >400 cell cycle-regulated genes in normal human fibroblasts based on the proportions of cells in each phase of the cell cycle. By isolating effects on the gene expression associated with the cell cycle phase redistribution after genotoxin treatment, the direct transcriptional target genes were distinguished from genes for which expression changed secondary to cell synchronization. Application of this model to ionizing radiation (IR)-treated normal human fibroblasts identified 150 of 406 cycle-regulated genes as putative direct transcriptional targets of IR-induced DNA damage. Changes in expression of these genes after IR treatment derived from both direct transcriptional regulation and cell cycle synchronization. PMID:17404513

G =  MAT: linking transcription factor expression and DNA binding data.

PubMed

Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak

2011-01-31

Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/.

G = MAT: Linking Transcription Factor Expression and DNA Binding Data

PubMed Central

Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak

2011-01-01

Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/. PMID:21297945

Evidence for a hierarchical transcriptional circuit in Drosophila male germline involving testis-specific TAF and two gene-specific transcription factors, Mod and Acj6.

PubMed

Jiang, Mei; Gao, Zhengliang; Wang, Jian; Nurminsky, Dmitry I

2018-01-01

To analyze transcription factors involved in gene regulation by testis-specific TAF (tTAF), tTAF-dependent promoters were mapped and analyzed in silico. Core promoters show decreased AT content, paucity of classical promoter motifs, and enrichment with translation control element CAAAATTY. Scanning of putative regulatory regions for known position frequency matrices identified 19 transcription regulators possibly contributing to tTAF-driven gene expression. Decreased male fertility associated with mutation in one of the regulators, Acj6, indicates its involvement in male reproduction. Transcriptome study of testes from male mutants for tTAF, Acj6, and previously characterized tTAF-interacting factor Modulo implies the existence of a regulatory hierarchy of tTAF, Modulo and Acj6, in which Modulo and/or Acj6 regulate one-third of tTAF-dependent genes. © 2017 Federation of European Biochemical Societies.

MicroRNA biogenesis pathway from the salmon louse (Caligus rogercresseyi): emerging role in delousing drug response.

PubMed

Valenzuela-Miranda, Diego; Nuñez-Acuña, Gustavo; Valenzuela-Muñoz, Valentina; Asgari, Sassan; Gallardo-Escárate, Cristian

2015-01-25

Despite the increasing evidence of the importance of microRNAs (miRNAs) in the regulation of multiple biological processes, the molecular bases supporting this regulation are still barely understood in crustaceans. Therefore, the molecular characterization and transcriptome modulation of the miRNA biogenesis pathway were evaluated in the salmon louse Caligus rogercresseyi, an ectoparasite that constitutes one of the biggest concerns for salmonid aquaculture industry. Hence, RNA-Seq analysis was conducted from six different developmental stages, and also after bioassays with delousing drugs Deltamethrin and Azamethiphos using adult individuals. In silico analysis evidenced 24 putative genes involved in the miRNA pathway such as biogenesis, transport, maturation and miRNA-target interaction. Moreover, 243 putative single nucleotide polymorphisms (SNPs) were identified, 15 of which showed non-synonym mutations. RNA-Seq analysis revealed that CCR4-Not complex subunit 3 (CNOT3) was upregulated at earlier developmental stages (nauplius I-II and copepodid), and also after the exposure to Azamethiphos, but not to Deltamethrin. In contrast, the subunit 7 (CNOT7) showed an inverse expression pattern. Different Argonaute transcripts were associated to chalimus and adult stages, revealing specific expression patterns in response to antiparasitic drugs. Our results suggest novel insights into the regulatory network of the post-transcriptional gene regulation in C. rogercresseyi mediated by miRNAs, evidencing a putative role during the ontogeny and drug response. Copyright © 2014 Elsevier B.V. All rights reserved.

Inhibition of Bombyx mori nuclear polyhedrosis virus (NPV) replication by the putative DNA helicase gene of Autographa californica NPV.

PubMed Central

Kamita, S G; Maeda, S

1993-01-01

Coinfection of Bombyx mori nuclear polyhedrosis virus (BmNPV) with Autographa californica NPV (AcNPV) in the BmNPV-permissive BmN cell line resulted in the complete inhibition of BmNPV replication. Coinfected BmN cells exhibited an atypical cytopathic effect (CPE) and synthesis of viral and host proteins was dramatically attenuated by 5 h postinfection (p.i.) and nearly completely blocked by 24 h p.i. Viral transcription, however, appeared to occur normally during both early (5-h-p.i.) and late (24-h-p.i.) stages of infection. Superinfection of BmN cells with AcNPV at 5 and 12 h post-BmNPV infection resulted in limited inhibition of BmNPV replication. BmN cells singly infected with AcNPV also showed similar CPE, premature inhibition of viral and host protein synthesis, and apparently normal viral transcription. BmNPV replication occurred normally following coinfection of BmNPV and eh2-AcNPV, an AcNPV mutant identical to AcNPV except for a 572-bp region in its putative DNA helicase gene originating from BmNPV (S. Maeda, S. G. Kamita, and A. Kondo, J. Virol. 67:6234-6238, 1993). Furthermore, atypical CPE and premature attenuation of host and viral protein synthesis were not observed. These results indicated that the inhibition of BmNPV replication was caused either directly or indirectly at the translational level by the putative AcNPV DNA helicase gene. Images PMID:7690422

Transcriptional response of Medicago truncatula sulphate transporters to arbuscular mycorrhizal symbiosis with and without sulphur stress.

PubMed

Casieri, Leonardo; Gallardo, Karine; Wipf, Daniel

2012-06-01

Sulphur is an essential macronutrient for plant growth, development and response to various abiotic and biotic stresses due to its key role in the biosynthesis of many S-containing compounds. Sulphate represents a very small portion of soil S pull and it is the only form that plant roots can uptake and mobilize through H(+)-dependent co-transport processes implying sulphate transporters. Unlike the other organically bound forms of S, sulphate is normally leached from soils due to its solubility in water, thus reducing its availability to plants. Although our knowledge of plant sulphate transporters has been growing significantly in the past decades, little is still known about the effect of the arbuscular mycorrhiza interaction on sulphur uptake. Carbon, nitrogen and sulphur measurements in plant parts and expression analysis of genes encoding putative Medicago sulphate transporters (MtSULTRs) were performed to better understand the beneficial effects of mycorrhizal interaction on Medicago truncatula plants colonized by Glomus intraradices at different sulphate concentrations. Mycorrhization significantly promoted plant growth and sulphur content, suggesting increased sulphate absorption. In silico analyses allowed identifying eight putative MtSULTRs phylogenetically distributed over the four sulphate transporter groups. Some putative MtSULTRs were transcribed differentially in roots and leaves and affected by sulphate concentration, while others were more constitutively transcribed. Mycorrhizal-inducible and -repressed MtSULTRs transcripts were identified allowing to shed light on the role of mycorrhizal interaction in sulphate uptake.

Discovery and Annotation of Plant Endogenous Target Mimicry Sequences from Public Transcriptome Libraries: A Case Study of Prunus persica.

PubMed

Karakülah, Gökhan

2017-06-28

Novel transcript discovery through RNA sequencing has substantially improved our understanding of the transcriptome dynamics of biological systems. Endogenous target mimicry (eTM) transcripts, a novel class of regulatory molecules, bind to their target microRNAs (miRNAs) by base pairing and block their biological activity. The objective of this study was to provide a computational analysis framework for the prediction of putative eTM sequences in plants, and as an example, to discover previously un-annotated eTMs in Prunus persica (peach) transcriptome. Therefore, two public peach transcriptome libraries downloaded from Sequence Read Archive (SRA) and a previously published set of long non-coding RNAs (lncRNAs) were investigated with multi-step analysis pipeline, and 44 putative eTMs were found. Additionally, an eTM-miRNA-mRNA regulatory network module associated with peach fruit organ development was built via integration of the miRNA target information and predicted eTM-miRNA interactions. My findings suggest that one of the most widely expressed miRNA families among diverse plant species, miR156, might be potentially sponged by seven putative eTMs. Besides, the study indicates eTMs potentially play roles in the regulation of development processes in peach fruit via targeting specific miRNAs. In conclusion, by following the step-by step instructions provided in this study, novel eTMs can be identified and annotated effectively in public plant transcriptome libraries.

A unique H2A histone variant occupies the transcriptional start site of active genes.

PubMed

Soboleva, Tatiana A; Nekrasov, Maxim; Pahwa, Anuj; Williams, Rohan; Huttley, Gavin A; Tremethick, David J

2011-12-04

Transcriptional activation is controlled by chromatin, which needs to be unfolded and remodeled to ensure access to the transcription start site (TSS). However, the mechanisms that yield such an 'open' chromatin structure, and how these processes are coordinately regulated during differentiation, are poorly understood. We identify the mouse (Mus musculus) H2A histone variant H2A.Lap1 as a previously undescribed component of the TSS of active genes expressed during specific stages of spermatogenesis. This unique chromatin landscape also includes a second histone variant, H2A.Z. In the later stages of round spermatid development, H2A.Lap1 dynamically loads onto the inactive X chromosome, enabling the transcriptional activation of previously repressed genes. Mechanistically, we show that H2A.Lap1 imparts unique unfolding properties to chromatin. We therefore propose that H2A.Lap1 coordinately regulates gene expression by directly opening the chromatin structure of the TSS at genes regulated during spermatogenesis.

The Putative C2H2 Transcription Factor MtfA Is a Novel Regulator of Secondary Metabolism and Morphogenesis in Aspergillus nidulans

PubMed Central

Ramamoorthy, Vellaisamy; Dhingra, Sourabh; Kincaid, Alexander; Shantappa, Sourabha; Feng, Xuehuan; Calvo, Ana M.

2013-01-01

Secondary metabolism in the model fungus Aspergillus nidulans is controlled by the conserved global regulator VeA, which also governs morphological differentiation. Among the secondary metabolites regulated by VeA is the mycotoxin sterigmatocystin (ST). The presence of VeA is necessary for the biosynthesis of this carcinogenic compound. We identified a revertant mutant able to synthesize ST intermediates in the absence of VeA. The point mutation occurred at the coding region of a gene encoding a novel putative C2H2 zinc finger domain transcription factor that we denominated mtfA. The A. nidulans mtfA gene product localizes at nuclei independently of the illumination regime. Deletion of the mtfA gene restores mycotoxin biosynthesis in the absence of veA, but drastically reduced mycotoxin production when mtfA gene expression was altered, by deletion or overexpression, in A. nidulans strains with a veA wild-type allele. Our study revealed that mtfA regulates ST production by affecting the expression of the specific ST gene cluster activator aflR. Importantly, mtfA is also a regulator of other secondary metabolism gene clusters, such as genes responsible for the synthesis of terrequinone and penicillin. As in the case of ST, deletion or overexpression of mtfA was also detrimental for the expression of terrequinone genes. Deletion of mtfA also decreased the expression of the genes in the penicillin gene cluster, reducing penicillin production. However, in this case, over-expression of mtfA enhanced the transcription of penicillin genes, increasing penicillin production more than 5 fold with respect to the control. Importantly, in addition to its effect on secondary metabolism, mtfA also affects asexual and sexual development in A. nidulans. Deletion of mtfA results in a reduction of conidiation and sexual stage. We found mtfA putative orthologs conserved in other fungal species. PMID:24066102

A comparative genomics perspective on the genetic content of the alkaliphilic haloarchaeon Natrialba magadii ATCC 43099T

PubMed Central

2012-01-01

Background Natrialba magadii is an aerobic chemoorganotrophic member of the Euryarchaeota and is a dual extremophile requiring alkaline conditions and hypersalinity for optimal growth. The genome sequence of Nab. magadii type strain ATCC 43099 was deciphered to obtain a comprehensive insight into the genetic content of this haloarchaeon and to understand the basis of some of the cellular functions necessary for its survival. Results The genome of Nab. magadii consists of four replicons with a total sequence of 4,443,643 bp and encodes 4,212 putative proteins, some of which contain peptide repeats of various lengths. Comparative genome analyses facilitated the identification of genes encoding putative proteins involved in adaptation to hypersalinity, stress response, glycosylation, and polysaccharide biosynthesis. A proton-driven ATP synthase and a variety of putative cytochromes and other proteins supporting aerobic respiration and electron transfer were encoded by one or more of Nab. magadii replicons. The genome encodes a number of putative proteases/peptidases as well as protein secretion functions. Genes encoding putative transcriptional regulators, basal transcription factors, signal perception/transduction proteins, and chemotaxis/phototaxis proteins were abundant in the genome. Pathways for the biosynthesis of thiamine, riboflavin, heme, cobalamin, coenzyme F420 and other essential co-factors were deduced by in depth sequence analyses. However, approximately 36% of Nab. magadii protein coding genes could not be assigned a function based on Blast analysis and have been annotated as encoding hypothetical or conserved hypothetical proteins. Furthermore, despite extensive comparative genomic analyses, genes necessary for survival in alkaline conditions could not be identified in Nab. magadii. Conclusions Based on genomic analyses, Nab. magadii is predicted to be metabolically versatile and it could use different carbon and energy sources to sustain growth. Nab. magadii has the genetic potential to adapt to its milieu by intracellular accumulation of inorganic cations and/or neutral organic compounds. The identification of Nab. magadii genes involved in coenzyme biosynthesis is a necessary step toward further reconstruction of the metabolic pathways in halophilic archaea and other extremophiles. The knowledge gained from the genome sequence of this haloalkaliphilic archaeon is highly valuable in advancing the applications of extremophiles and their enzymes. PMID:22559199

PIWI proteins and PIWI-interacting RNAs function in Hydra somatic stem cells

PubMed Central

Juliano, Celina E.; Reich, Adrian; Liu, Na; Götzfried, Jessica; Zhong, Mei; Uman, Selen; Reenan, Robert A.; Wessel, Gary M.; Steele, Robert E.; Lin, Haifan

2014-01-01

PIWI proteins and their bound PIWI-interacting RNAs (piRNAs) are found in animal germlines and are essential for fertility, but their functions outside of the gonad are not well understood. The cnidarian Hydra is a simple metazoan with well-characterized stem/progenitor cells that provides a unique model for analysis of PIWI function. Here we report that Hydra has two PIWI proteins, Hydra PIWI (Hywi) and Hydra PIWI-like (Hyli), both of which are expressed in all Hydra stem/progenitor cells, but not in terminally differentiated cells. We identified ∼15 million piRNAs associated with Hywi and/or Hyli and found that they exhibit the ping-pong signature of piRNA biogenesis. Hydra PIWI proteins are strictly cytoplasmic and thus likely act as posttranscriptional regulators. To explore this function, we generated a Hydra transcriptome for piRNA mapping. piRNAs map to transposons with a 25- to 35-fold enrichment compared with the abundance of transposon transcripts. By sequencing the small RNAs specific to the interstitial, ectodermal, and endodermal lineages, we found that the targeting of transposons appears to be largely restricted to the interstitial lineage. We also identified putative nontransposon targets of the pathway unique to each lineage. Finally we demonstrate that hywi function is essential in the somatic epithelial lineages. This comprehensive analysis of the PIWI–piRNA pathway in the somatic stem/progenitor cells of a nonbilaterian animal suggests that this pathway originated with broader stem cell functionality. PMID:24367095

PIWI proteins and PIWI-interacting RNAs function in Hydra somatic stem cells.

PubMed

Juliano, Celina E; Reich, Adrian; Liu, Na; Götzfried, Jessica; Zhong, Mei; Uman, Selen; Reenan, Robert A; Wessel, Gary M; Steele, Robert E; Lin, Haifan

2014-01-07

PIWI proteins and their bound PIWI-interacting RNAs (piRNAs) are found in animal germlines and are essential for fertility, but their functions outside of the gonad are not well understood. The cnidarian Hydra is a simple metazoan with well-characterized stem/progenitor cells that provides a unique model for analysis of PIWI function. Here we report that Hydra has two PIWI proteins, Hydra PIWI (Hywi) and Hydra PIWI-like (Hyli), both of which are expressed in all Hydra stem/progenitor cells, but not in terminally differentiated cells. We identified ∼15 million piRNAs associated with Hywi and/or Hyli and found that they exhibit the ping-pong signature of piRNA biogenesis. Hydra PIWI proteins are strictly cytoplasmic and thus likely act as posttranscriptional regulators. To explore this function, we generated a Hydra transcriptome for piRNA mapping. piRNAs map to transposons with a 25- to 35-fold enrichment compared with the abundance of transposon transcripts. By sequencing the small RNAs specific to the interstitial, ectodermal, and endodermal lineages, we found that the targeting of transposons appears to be largely restricted to the interstitial lineage. We also identified putative nontransposon targets of the pathway unique to each lineage. Finally we demonstrate that hywi function is essential in the somatic epithelial lineages. This comprehensive analysis of the PIWI-piRNA pathway in the somatic stem/progenitor cells of a nonbilaterian animal suggests that this pathway originated with broader stem cell functionality.

The Nostoc punctiforme Genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

John C. Meeks

2001-12-31

Nostoc punctiforme is a filamentous cyanobacterium with extensive phenotypic characteristics and a relatively large genome, approaching 10 Mb. The phenotypic characteristics include a photoautotrophic, diazotrophic mode of growth, but N. punctiforme is also facultatively heterotrophic; its vegetative cells have multiple development alternatives, including terminal differentiation into nitrogen-fixing heterocysts and transient differentiation into spore-like akinetes or motile filaments called hormogonia; and N. punctiforme has broad symbiotic competence with fungi and terrestrial plants, including bryophytes, gymnosperms and an angiosperm. The shotgun-sequencing phase of the N. punctiforme strain ATCC 29133 genome has been completed by the Joint Genome Institute. Annotation of an 8.9more » Mb database yielded 7432 open reading frames, 45% of which encode proteins with known or probable known function and 29% of which are unique to N. punctiforme. Comparative analysis of the sequence indicates a genome that is highly plastic and in a state of flux, with numerous insertion sequences and multilocus repeats, as well as genes encoding transposases and DNA modification enzymes. The sequence also reveals the presence of genes encoding putative proteins that collectively define almost all characteristics of cyanobacteria as a group. N. punctiforme has an extensive potential to sense and respond to environmental signals as reflected by the presence of more than 400 genes encoding sensor protein kinases, response regulators and other transcriptional factors. The signal transduction systems and any of the large number of unique genes may play essential roles in the cell differentiation and symbiotic interaction properties of N. punctiforme.« less

A Novel Heat Shock Element (HSE) in Entamoeba histolytica that Regulates the Transcriptional Activation of the EhPgp5 Gene in the Presence of Emetine Drug.

PubMed

Nieto, Alma; Pérez Ishiwara, David G; Orozco, Esther; Sánchez Monroy, Virginia; Gómez García, Consuelo

2017-01-01

Transcriptional regulation of the multidrug resistance EhPgp5 gene in Entamoeba histolytica is induced by emetine stress. EhPgp5 overexpression alters the chloride-dependent currents that cause trophozoite swelling, diminishing induced programmed cell death (PCD) susceptibility. In contrast, antisense inhibition of P-glycoprotein (PGP) expression produces synchronous death of trophozoites and the enhancement of the biochemical and morphological characteristics of PCD induced by G418. Transcriptional gene regulation analysis identified a 59 bp region at position -170 to -111 bp promoter as putative emetine response elements (EREs). However, insights into transcription factors controlling EhPgp5 gene transcription are missing; to fill this knowledge gap, we used deletion studies and transient CAT activity assays. Our findings suggested an activating motif (-151 to -136 bp) that corresponds to a heat shock element (HSE). Gel-shift assays, UV-crosslinking, binding protein purification, and western blotting assays revealed proteins of 94, 66, 62, and 51 kDa binding to the EhPgp5 HSE that could be heat shock-like transcription factors that regulate the transcriptional activation of the EhPgp5 gene in the presence of emetine drug.

Characterization of two homeodomain transcription factors with critical but distinct roles in virulence in the vascular pathogen Verticillium dahliae

USDA-ARS?s Scientific Manuscript database

Vascular wilt caused by Verticillium dahliae is a destructive disease that represents a chronic economic problem for crop production worldwide. In this work, we characterized two new regulators of pathogenicity in this species. Vph1 (VDAG_06555) was identified in a candidate gene approach as a putat...

Identification, cloning, and expression analysis of three putative Lymantria dispar nuclear polyhedrosis virus immediate early genes

Treesearch

James M. Slavicek; Nancy Hayes-Plazolles

1991-01-01

Viral immediate early gene products are usually regulatory proteins that control expression of other viral genes at the transcriptional level or are proteins that are part of the viral DNA replication complex. The identification and functional characterization of the immediate early gene products of Lymantria dispar nuclear polyhedrosis virus (LdNPV...

Characterization of cDNAs encoding serine proteases and their transcriptional responses to Cry1Ab protoxin in the gut of Ostrinia nubilalis larvae

USDA-ARS?s Scientific Manuscript database

Serine proteases, such as trypsin and chymotrypsin, are the primary digestive enzymes in lepidopteran larvae, and are also involved in Bacillus thuringiensis (Bt) protoxin activation and protoxin/toxin degradation. We isolated and sequenced 34 cDNAs putatively encoding trypsins, chymotrypsins and th...

Transcription of the cottontail rabbit papillomavirus early region and identification of two E6 polypeptides in COS-7 cells.

PubMed Central

Barbosa, M S; Wettstein, F O

1987-01-01

Cottontail rabbit papillomavirus (CRPV) early proteins are present at very low levels in virus-induced tumors and cannot be detected by immunological methods. Furthermore, cells in culture are not readily transformed by the virus. To overcome these difficulties in identifying and characterizing the putative transforming protein(s) coded by the E6 open reading frame, the early cottontail rabbit papillomavirus region was expressed under the control of the late simian virus 40 promoter. Mapping of the transcripts in transiently transfected COS-7 cells indicated that transcription was initiated in the late region of simian virus 40. Two E6-coded polypeptides were identified, representing translation products initiated at the first and second AUG codons. Images PMID:3039182

Robust dynamics in minimal hybrid models of genetic networks

PubMed Central

Perkins, Theodore J.; Wilds, Roy; Glass, Leon

2010-01-01

Many gene-regulatory networks necessarily display robust dynamics that are insensitive to noise and stable under evolution. We propose that a class of hybrid systems can be used to relate the structure of these networks to their dynamics and provide insight into the origin of robustness. In these systems, the genes are represented by logical functions, and the controlling transcription factor protein molecules are real variables, which are produced and destroyed. As the transcription factor concentrations cross thresholds, they control the production of other transcription factors. We discuss mathematical analysis of these systems and show how the concepts of robustness and minimality can be used to generate putative logical organizations based on observed symbolic sequences. We apply the methods to control of the cell cycle in yeast. PMID:20921006

Robust dynamics in minimal hybrid models of genetic networks.

PubMed

Perkins, Theodore J; Wilds, Roy; Glass, Leon

2010-11-13

Many gene-regulatory networks necessarily display robust dynamics that are insensitive to noise and stable under evolution. We propose that a class of hybrid systems can be used to relate the structure of these networks to their dynamics and provide insight into the origin of robustness. In these systems, the genes are represented by logical functions, and the controlling transcription factor protein molecules are real variables, which are produced and destroyed. As the transcription factor concentrations cross thresholds, they control the production of other transcription factors. We discuss mathematical analysis of these systems and show how the concepts of robustness and minimality can be used to generate putative logical organizations based on observed symbolic sequences. We apply the methods to control of the cell cycle in yeast.

Cell envelope stress in mycobacteria is regulated by the novel signal transduction ATPase IniR in response to trehalose

PubMed Central

van Winden, Vincent J. C.; Sparrius, Marion; van de Weerd, Robert; Speer, Alexander; Ummels, Roy; Sherman, David R.

2017-01-01

The cell envelope of mycobacteria is a highly unique and complex structure that is functionally equivalent to that of Gram-negative bacteria to protect the bacterial cell. Defects in the integrity or assembly of this cell envelope must be sensed to allow the induction of stress response systems. The promoter that is specifically and most strongly induced upon exposure to ethambutol and isoniazid, first line drugs that affect cell envelope biogenesis, is the iniBAC promoter. In this study, we set out to identify the regulator of the iniBAC operon in Mycobacterium marinum using an unbiased transposon mutagenesis screen in a constitutively iniBAC-expressing mutant background. We obtained multiple mutants in the mce1 locus as well as mutants in an uncharacterized putative transcriptional regulator (MMAR_0612). This latter gene was shown to function as the iniBAC regulator, as overexpression resulted in constitutive iniBAC induction, whereas a knockout mutant was unable to respond to the presence of ethambutol and isoniazid. Experiments with the M. tuberculosis homologue (Rv0339c) showed identical results. RNAseq experiments showed that this regulatory gene was exclusively involved in the regulation of the iniBAC operon. We therefore propose to name this dedicated regulator iniBAC Regulator (IniR). IniR belongs to the family of signal transduction ATPases with numerous domains, including a putative sugar-binding domain. Upon testing different sugars, we identified trehalose as an activator and metabolic cue for iniBAC activation, which could also explain the effect of the mce1 mutations. In conclusion, cell envelope stress in mycobacteria is regulated by IniR in a cascade that includes trehalose. PMID:29281637

Revisiting venom of the sea anemone Stichodactyla haddoni: Omics techniques reveal the complete toxin arsenal of a well-studied sea anemone genus.

PubMed

Madio, Bruno; Undheim, Eivind A B; King, Glenn F

2017-08-23

More than a century of research on sea anemone venoms has shown that they contain a diversity of biologically active proteins and peptides. However, recent omics studies have revealed that much of the venom proteome remains unexplored. We used, for the first time, a combination of proteomic and transcriptomic techniques to obtain a holistic overview of the venom arsenal of the well-studied sea anemone Stichodactyla haddoni. A purely search-based approach to identify putative toxins in a transcriptome from tentacles regenerating after venom extraction identified 508 unique toxin-like transcripts grouped into 63 families. However, proteomic analysis of venom revealed that 52 of these toxin families are likely false positives. In contrast, the combination of transcriptomic and proteomic data enabled positive identification of 23 families of putative toxins, 12 of which have no homology known proteins or peptides. Our data highlight the importance of using proteomics of milked venom to correctly identify venom proteins/peptides, both known and novel, while minimizing false positive identifications from non-toxin homologues identified in transcriptomes of venom-producing tissues. This work lays the foundation for uncovering the role of individual toxins in sea anemone venom and how they contribute to the envenomation of prey, predators, and competitors. Proteomic analysis of milked venom combined with analysis of a tentacle transcriptome revealed the full extent of the venom arsenal of the sea anemone Stichodactyla haddoni. This combined approach led to the discovery of 12 entirely new families of disulfide-rich peptides and proteins in a genus of anemones that have been studied for over a century. Copyright © 2017 Elsevier B.V. All rights reserved.

Large-scale transcriptome analysis in chickpea (Cicer arietinum L.), an orphan legume crop of the semi-arid tropics of Asia and Africa.

PubMed

Hiremath, Pavana J; Farmer, Andrew; Cannon, Steven B; Woodward, Jimmy; Kudapa, Himabindu; Tuteja, Reetu; Kumar, Ashish; Bhanuprakash, Amindala; Mulaosmanovic, Benjamin; Gujaria, Neha; Krishnamurthy, Laxmanan; Gaur, Pooran M; Kavikishor, Polavarapu B; Shah, Trushar; Srinivasan, Ramamurthy; Lohse, Marc; Xiao, Yongli; Town, Christopher D; Cook, Douglas R; May, Gregory D; Varshney, Rajeev K

2011-10-01

Chickpea (Cicer arietinum L.) is an important legume crop in the semi-arid regions of Asia and Africa. Gains in crop productivity have been low however, particularly because of biotic and abiotic stresses. To help enhance crop productivity using molecular breeding techniques, next generation sequencing technologies such as Roche/454 and Illumina/Solexa were used to determine the sequence of most gene transcripts and to identify drought-responsive genes and gene-based molecular markers. A total of 103,215 tentative unique sequences (TUSs) have been produced from 435,018 Roche/454 reads and 21,491 Sanger expressed sequence tags (ESTs). Putative functions were determined for 49,437 (47.8%) of the TUSs, and gene ontology assignments were determined for 20,634 (41.7%) of the TUSs. Comparison of the chickpea TUSs with the Medicago truncatula genome assembly (Mt 3.5.1 build) resulted in 42,141 aligned TUSs with putative gene structures (including 39,281 predicted intron/splice junctions). Alignment of ∼37 million Illumina/Solexa tags generated from drought-challenged root tissues of two chickpea genotypes against the TUSs identified 44,639 differentially expressed TUSs. The TUSs were also used to identify a diverse set of markers, including 728 simple sequence repeats (SSRs), 495 single nucleotide polymorphisms (SNPs), 387 conserved orthologous sequence (COS) markers, and 2088 intron-spanning region (ISR) markers. This resource will be useful for basic and applied research for genome analysis and crop improvement in chickpea. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd. No claim to original US government works.

FmLC5, a putative galactose-binding C-type lectin with two QPD motifs from the hemocytes of Fenneropenaeus merguiensis participates in shrimp immune defense.

PubMed

Senghoi, Wilaiwan; Runsaeng, Phanthipha; Utarabhand, Prapaporn

2017-11-01

Crustaceans are deficient in adaptive immune system. They depend completely on an innate immunity to protect themselves from invading microorganisms. One kind of pattern recognition receptors that contribute roles in the innate immunity is lectin. A new C-type lectin gene designated as FmLC5 was isolated from Fenneropenaeus merguiensis. Its full-length cDNA is composed of 1526bp and one open reading frame of 852bp encoding a peptide of 284 amino acids. The deduced amino acid sequence of FmLC5 comprises a signal peptide of 20 contiguous amino acids with a molecular mass of 31.47kDa and an isoelectric point of 4.35. The primary structure of FmLC5 consists of two similar carbohydrate recognition domains (CRDs), each CRD contains a Ca 2+ binding site-2 and a QPD motif specific for galactose-binding. The FmLC5 transcripts were detected only in the hemocytes analyzed by RT-PCR and in situ hybridization. The FmLC5 expression was significantly up-regulated after challenge with Vibrio harveyi, white spot syndrome virus (WSSV) or lipopolysaccharide. RNAi-based silencing with co-injection by V. harveyi or WSSV resulted in critical suppression of the FmLC5 expression, increasing in mortality and reduction of the median lethal time. These results conclude that FmLC5 is unique putative galactose-binding C-type lectin in F. merguiensis that may contribute as receptor molecule in the immune response to defend the shrimp from pathogenic bacteria and viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

Global Transcriptional Response to Organic Hydroperoxide and the Role of OhrR in the Control of Virulence Traits in Chromobacterium violaceum.

PubMed

Previato-Mello, Maristela; Meireles, Diogo de Abreu; Netto, Luis Eduardo Soares; da Silva Neto, José Freire

2017-08-01

A major pathway for the detoxification of organic hydroperoxides, such as cumene hydroperoxide (CHP), involves the MarR family transcriptional regulator OhrR and the peroxidase OhrA. However, the effect of these peroxides on the global transcriptome and the contribution of the OhrA/OhrR system to bacterial virulence remain poorly explored. Here, we analyzed the transcriptome profiles of Chromobacterium violaceum exposed to CHP and after the deletion of ohrR , and we show that OhrR controls the virulence of this human opportunistic pathogen. DNA microarray and Northern blot analyses of CHP-treated cells revealed the upregulation of genes related to the detoxification of peroxides (antioxidant enzymes and thiol-reducing systems), the degradation of the aromatic moiety of CHP (oxygenases), and protection against other secondary stresses (DNA repair, heat shock, iron limitation, and nitrogen starvation responses). Furthermore, we identified two upregulated genes ( ohrA and a putative diguanylate cyclase with a GGDEF domain for cyclic di-GMP [c-di-GMP] synthesis) and three downregulated genes (hemolysin, chitinase, and collagenase) in the ohrR mutant by transcriptome analysis. Importantly, we show that OhrR directly repressed the expression of the putative diguanylate cyclase. Using a mouse infection model, we demonstrate that the ohrR mutant was attenuated for virulence and showed a decreased bacterial burden in the liver. Moreover, an ohrR -diguanylate cyclase double mutant displayed the same virulence as the wild-type strain. In conclusion, we have defined the transcriptional response to CHP, identified potential virulence factors such as diguanylate cyclase as members of the OhrR regulon, and shown that C. violaceum uses the transcriptional regulator OhrR to modulate its virulence. Copyright © 2017 American Society for Microbiology.

Global Transcriptional Response to Organic Hydroperoxide and the Role of OhrR in the Control of Virulence Traits in Chromobacterium violaceum

PubMed Central

Previato-Mello, Maristela; Meireles, Diogo de Abreu; Netto, Luis Eduardo Soares

2017-01-01

ABSTRACT A major pathway for the detoxification of organic hydroperoxides, such as cumene hydroperoxide (CHP), involves the MarR family transcriptional regulator OhrR and the peroxidase OhrA. However, the effect of these peroxides on the global transcriptome and the contribution of the OhrA/OhrR system to bacterial virulence remain poorly explored. Here, we analyzed the transcriptome profiles of Chromobacterium violaceum exposed to CHP and after the deletion of ohrR, and we show that OhrR controls the virulence of this human opportunistic pathogen. DNA microarray and Northern blot analyses of CHP-treated cells revealed the upregulation of genes related to the detoxification of peroxides (antioxidant enzymes and thiol-reducing systems), the degradation of the aromatic moiety of CHP (oxygenases), and protection against other secondary stresses (DNA repair, heat shock, iron limitation, and nitrogen starvation responses). Furthermore, we identified two upregulated genes (ohrA and a putative diguanylate cyclase with a GGDEF domain for cyclic di-GMP [c-di-GMP] synthesis) and three downregulated genes (hemolysin, chitinase, and collagenase) in the ohrR mutant by transcriptome analysis. Importantly, we show that OhrR directly repressed the expression of the putative diguanylate cyclase. Using a mouse infection model, we demonstrate that the ohrR mutant was attenuated for virulence and showed a decreased bacterial burden in the liver. Moreover, an ohrR-diguanylate cyclase double mutant displayed the same virulence as the wild-type strain. In conclusion, we have defined the transcriptional response to CHP, identified potential virulence factors such as diguanylate cyclase as members of the OhrR regulon, and shown that C. violaceum uses the transcriptional regulator OhrR to modulate its virulence. PMID:28507067

Improved annotation with de novo transcriptome assembly in four social amoeba species.

PubMed

Singh, Reema; Lawal, Hajara M; Schilde, Christina; Glöckner, Gernot; Barton, Geoffrey J; Schaap, Pauline; Cole, Christian

2017-01-31

Annotation of gene models and transcripts is a fundamental step in genome sequencing projects. Often this is performed with automated prediction pipelines, which can miss complex and atypical genes or transcripts. RNA sequencing (RNA-seq) data can aid the annotation with empirical data. Here we present de novo transcriptome assemblies generated from RNA-seq data in four Dictyostelid species: D. discoideum, P. pallidum, D. fasciculatum and D. lacteum. The assemblies were incorporated with existing gene models to determine corrections and improvement on a whole-genome scale. This is the first time this has been performed in these eukaryotic species. An initial de novo transcriptome assembly was generated by Trinity for each species and then refined with Program to Assemble Spliced Alignments (PASA). The completeness and quality were assessed with the Benchmarking Universal Single-Copy Orthologs (BUSCO) and Transrate tools at each stage of the assemblies. The final datasets of 11,315-12,849 transcripts contained 5,610-7,712 updates and corrections to >50% of existing gene models including changes to hundreds or thousands of protein products. Putative novel genes are also identified and alternative splice isoforms were observed for the first time in P. pallidum, D. lacteum and D. fasciculatum. In taking a whole transcriptome approach to genome annotation with empirical data we have been able to enrich the annotations of four existing genome sequencing projects. In doing so we have identified updates to the majority of the gene annotations across all four species under study and found putative novel genes and transcripts which could be worthy for follow-up. The new transcriptome data we present here will be a valuable resource for genome curators in the Dictyostelia and we propose this effective methodology for use in other genome annotation projects.

Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat

PubMed Central

Brandt, Stephanie L.; Ke, Wujian; Reid, Tara B.; Molini, Barbara J.; Iverson-Cabral, Stefanie; Ciccarese, Giulia; Drago, Francesco; Lukehart, Sheila A.; Centurion-Lara, Arturo

2015-01-01

An effective mechanism for introduction of phenotypic diversity within a bacterial population exploits changes in the length of repetitive DNA elements located within gene promoters. This phenomenon, known as phase variation, causes rapid activation or silencing of gene expression and fosters bacterial adaptation to new or changing environments. Phase variation often occurs in surface-exposed proteins, and in Treponema pallidum subsp. pallidum, the syphilis agent, it was reported to affect transcription of three putative outer membrane protein (OMP)-encoding genes. When the T. pallidum subsp. pallidum Nichols strain genome was initially annotated, the TP0126 open reading frame was predicted to include a poly(G) tract and did not appear to have a predicted signal sequence that might suggest the possibility of its being an OMP. Here we show that the initial annotation was incorrect, that this poly(G) is instead located within the TP0126 promoter, and that it varies in length in vivo during experimental syphilis. Additionally, we show that TP0126 transcription is affected by changes in the poly(G) length consistent with regulation by phase variation. In silico analysis of the TP0126 open reading frame based on the experimentally identified transcriptional start site shortens this hypothetical protein by 69 amino acids, reveals a predicted cleavable signal peptide, and suggests structural homology with the OmpW family of porins. Circular dichroism of recombinant TP0126 supports structural homology to OmpW. Together with the evidence that TP0126 is fully conserved among T. pallidum subspecies and strains, these data suggest an important role for TP0126 in T. pallidum biology and syphilis pathogenesis. PMID:25802057

Characterization of two homeodomain transcription factors with critical but distinct roles in virulence in the vascular pathogen Verticillium dahliae.

PubMed

Sarmiento-Villamil, Jorge L; Prieto, Pilar; Klosterman, Steven J; García-Pedrajas, María D

2018-04-01

Vascular wilt caused by Verticillium dahliae is a destructive disease that represents a chronic economic problem for crop production worldwide. In this work, we characterized two new regulators of pathogenicity in this species. Vph1 (VDAG_06555) was identified in a candidate gene approach as a putative homologue of the transcription factor Ste12. Vhb1 (VDAG_08786), identified in a forward genetics approach, is similar to the homeobox transcription factor Htf1, reported as a regulator of conidiogenesis in several fungi. Deletion of vph1 did not affect vegetative growth, whereas deletion of vhb1 greatly reduced sporulation rates in liquid medium. Both mutants failed to induce Verticillium wilt symptoms. However, unlike Δvph1, Δvhb1 could be re-isolated from the vascular system of some asymptomatic plants. Confocal microscopy further indicated that Δvph1 and Δvhb1 differed in their behaviour in planta; Δvph1 could not penetrate the root cortex, whereas Δvhb1 was impaired in its ability to colonize the xylem. In agreement with these observations, only Δvhb1 could penetrate cellophane paper. On cellophane, wild-type and Δvhb1 strains produced numerous short branches with swollen tips, resembling the hyphopodia formed on root surfaces, contrasting with Δvph1, which generated unbranched long filaments without swollen tips. A microarray analysis showed that these differences in growth were associated with differences in global transcription patterns, and allowed us to identify a large set of novel genes potentially involved in virulence in V. dahliae. Ste12 homologues are known regulators of invasive growth, but Vhb1 is the first putative Htf1 homologue identified with a critical role in virulence. © 2017 BSPP AND JOHN WILEY & SONS LTD.

Use of transcriptome sequencing to understand the pistillate flowering in hickory (Carya cathayensis Sarg.).

PubMed

Huang, You-Jun; Liu, Li-Li; Huang, Jian-Qin; Wang, Zheng-Jia; Chen, Fang-Fang; Zhang, Qi-Xiang; Zheng, Bing-Song; Chen, Ming

2013-10-10

Different from herbaceous plants, the woody plants undergo a long-period vegetative stage to achieve floral transition. They then turn into seasonal plants, flowering annually. In this study, a preliminary model of gene regulations for seasonal pistillate flowering in hickory (Carya cathayensis) was proposed. The genome-wide dynamic transcriptome was characterized via the joint-approach of RNA sequencing and microarray analysis. Differential transcript abundance analysis uncovered the dynamic transcript abundance patterns of flowering correlated genes and their major functions based on Gene Ontology (GO) analysis. To explore pistillate flowering mechanism in hickory, a comprehensive flowering gene regulatory network based on Arabidopsis thaliana was constructed by additional literature mining. A total of 114 putative flowering or floral genes including 31 with differential transcript abundance were identified in hickory. The locations, functions and dynamic transcript abundances were analyzed in the gene regulatory networks. A genome-wide co-expression network for the putative flowering or floral genes shows three flowering regulatory modules corresponding to response to light abiotic stimulus, cold stress, and reproductive development process, respectively. Totally 27 potential flowering or floral genes were recruited which are meaningful to understand the hickory specific seasonal flowering mechanism better. Flowering event of pistillate flower bud in hickory is triggered by several pathways synchronously including the photoperiod, autonomous, vernalization, gibberellin, and sucrose pathway. Totally 27 potential flowering or floral genes were recruited from the genome-wide co-expression network function module analysis. Moreover, the analysis provides a potential FLC-like gene based vernalization pathway and an 'AC' model for pistillate flower development in hickory. This work provides an available framework for pistillate flower development in hickory, which is significant for insight into regulation of flowering and floral development of woody plants.

Use of transcriptome sequencing to understand the pistillate flowering in hickory (Carya cathayensis Sarg.)

PubMed Central

2013-01-01

Background Different from herbaceous plants, the woody plants undergo a long-period vegetative stage to achieve floral transition. They then turn into seasonal plants, flowering annually. In this study, a preliminary model of gene regulations for seasonal pistillate flowering in hickory (Carya cathayensis) was proposed. The genome-wide dynamic transcriptome was characterized via the joint-approach of RNA sequencing and microarray analysis. Results Differential transcript abundance analysis uncovered the dynamic transcript abundance patterns of flowering correlated genes and their major functions based on Gene Ontology (GO) analysis. To explore pistillate flowering mechanism in hickory, a comprehensive flowering gene regulatory network based on Arabidopsis thaliana was constructed by additional literature mining. A total of 114 putative flowering or floral genes including 31 with differential transcript abundance were identified in hickory. The locations, functions and dynamic transcript abundances were analyzed in the gene regulatory networks. A genome-wide co-expression network for the putative flowering or floral genes shows three flowering regulatory modules corresponding to response to light abiotic stimulus, cold stress, and reproductive development process, respectively. Totally 27 potential flowering or floral genes were recruited which are meaningful to understand the hickory specific seasonal flowering mechanism better. Conclusions Flowering event of pistillate flower bud in hickory is triggered by several pathways synchronously including the photoperiod, autonomous, vernalization, gibberellin, and sucrose pathway. Totally 27 potential flowering or floral genes were recruited from the genome-wide co-expression network function module analysis. Moreover, the analysis provides a potential FLC-like gene based vernalization pathway and an 'AC’ model for pistillate flower development in hickory. This work provides an available framework for pistillate flower development in hickory, which is significant for insight into regulation of flowering and floral development of woody plants. PMID:24106755

LBH Gene Transcription Regulation by the Interplay of an Enhancer Risk Allele and DNA Methylation in Rheumatoid Arthritis.

PubMed

Hammaker, Deepa; Whitaker, John W; Maeshima, Keisuke; Boyle, David L; Ekwall, Anna-Karin H; Wang, Wei; Firestein, Gary S

2016-11-01

To identify nonobvious therapeutic targets for rheumatoid arthritis (RA), we performed an integrative analysis incorporating multiple "omics" data and the Encyclopedia of DNA Elements (ENCODE) database for potential regulatory regions. This analysis identified the limb bud and heart development (LBH) gene, which has risk alleles associated with RA/celiac disease and lupus, and can regulate cell proliferation in RA. We identified a novel LBH transcription enhancer with an RA risk allele (rs906868 G [Ref]/T) 6 kb upstream of the LBH gene with a differentially methylated locus. The confluence of 3 regulatory elements, rs906868, an RA differentially methylated locus, and a putative enhancer, led us to investigate their effects on LBH regulation in fibroblast-like synoviocytes (FLS). We cloned the 1.4-kb putative enhancer with either the rs906868 Ref allele or single-nucleotide polymorphism (SNP) variant into reporter constructs. The constructs were methylated in vitro and transfected into cultured FLS by nucleofection. We found that both variants increased transcription, thereby confirming the region's enhancer function. Unexpectedly, the transcriptional activity of the Ref risk allele was significantly lower than that of the SNP variant and is consistent with low LBH levels as a risk factor for aggressive FLS behavior. Using RA FLS lines with a homozygous Ref or SNP allele, we confirmed that homozygous Ref lines expressed lower LBH messenger RNA levels than did the SNP lines. Methylation significantly reduced enhancer activity for both alleles, indicating that enhancer function is dependent on its methylation status. This study shows how the interplay between genetics and epigenetics can affect expression of LBH in RA. © 2016, American College of Rheumatology.

Metatranscriptomic Analyses of Plant Cell Wall Polysaccharide Degradation by Microorganisms in the Cow Rumen

PubMed Central

Dai, Xin; Tian, Yan; Li, Jinting; Su, Xiaoyun; Wang, Xuewei; Zhao, Shengguo; Liu, Li; Luo, Yingfeng; Liu, Di; Zheng, Huajun; Wang, Jiaqi; Dong, Zhiyang

2014-01-01

The bovine rumen represents a highly specialized bioreactor where plant cell wall polysaccharides (PCWPs) are efficiently deconstructed via numerous enzymes produced by resident microorganisms. Although a large number of fibrolytic genes from rumen microorganisms have been identified, it remains unclear how they are expressed in a coordinated manner to efficiently degrade PCWPs. In this study, we performed a metatranscriptomic analysis of the rumen microbiomes of adult Holstein cows fed a fiber diet and obtained a total of 1,107,083 high-quality non-rRNA reads with an average length of 483 nucleotides. Transcripts encoding glycoside hydrolases (GHs) and carbohydrate binding modules (CBMs) accounted for ∼1% and ∼0.1% of the total non-rRNAs, respectively. The majority (∼98%) of the putative cellulases belonged to four GH families (i.e., GH5, GH9, GH45, and GH48) and were primarily synthesized by Ruminococcus and Fibrobacter. Notably, transcripts for GH48 cellobiohydrolases were relatively abundant compared to the abundance of transcripts for other cellulases. Two-thirds of the putative hemicellulases were of the GH10, GH11, and GH26 types and were produced by members of the genera Ruminococcus, Prevotella, and Fibrobacter. Most (∼82%) predicted oligosaccharide-degrading enzymes were GH1, GH2, GH3, and GH43 proteins and were from a diverse group of microorganisms. Transcripts for CBM10 and dockerin, key components of the cellulosome, were also relatively abundant. Our results provide metatranscriptomic evidence in support of the notion that members of the genera Ruminococcus, Fibrobacter, and Prevotella are predominant PCWP degraders and point to the significant contribution of GH48 cellobiohydrolases and cellulosome-like structures to efficient PCWP degradation in the cow rumen. PMID:25501482

Analyzing the soybean transcriptome during autoregulation of mycorrhization identifies the transcription factors GmNF-YA1a/b as positive regulators of arbuscular mycorrhization.

PubMed

Schaarschmidt, Sara; Gresshoff, Peter M; Hause, Bettina

2013-06-18

Similarly to the legume-rhizobia symbiosis, the arbuscular mycorrhiza interaction is controlled by autoregulation representing a feedback inhibition involving the CLAVATA1-like receptor kinase NARK in shoots. However, little is known about signals and targets down-stream of NARK. To find NARK-related transcriptional changes in mycorrhizal soybean (Glycine max) plants, we analyzed wild-type and two nark mutant lines interacting with the arbuscular mycorrhiza fungus Rhizophagus irregularis. Affymetrix GeneChip analysis of non-inoculated and partially inoculated plants in a split-root system identified genes with potential regulation by arbuscular mycorrhiza or NARK. Most transcriptional changes occur locally during arbuscular mycorrhiza symbiosis and independently of NARK. RT-qPCR analysis verified nine genes as NARK-dependently regulated. Most of them have lower expression in roots or shoots of wild type compared to nark mutants, including genes encoding the receptor kinase GmSIK1, proteins with putative function as ornithine acetyl transferase, and a DEAD box RNA helicase. A predicted annexin named GmAnnx1a is differentially regulated by NARK and arbuscular mycorrhiza in distinct plant organs. Two putative CCAAT-binding transcription factor genes named GmNF-YA1a and GmNF-YA1b are down-regulated NARK-dependently in non-infected roots of mycorrhizal wild-type plants and functional gene analysis confirmed a positive role for these genes in the development of an arbuscular mycorrhiza symbiosis. Our results indicate GmNF-YA1a/b as positive regulators in arbuscular mycorrhiza establishment, whose expression is down-regulated by NARK in the autoregulated root tissue thereby diminishing subsequent infections. Genes regulated independently of arbuscular mycorrhization by NARK support an additional function of NARK in symbioses-independent mechanisms.

Repression of Ccr9 transcription in mouse T lymphocyte progenitors by the Notch signaling pathway.

PubMed

Krishnamoorthy, Veena; Carr, Tiffany; de Pooter, Renee F; Emanuelle, Akinola Olumide; Akinola, Emanuelle Olumide; Gounari, Fotini; Kee, Barbara L

2015-04-01

The chemokine receptor CCR9 controls the immigration of multipotent hematopoietic progenitor cells into the thymus to sustain T cell development. Postimmigration, thymocytes downregulate CCR9 and migrate toward the subcapsular zone where they recombine their TCR β-chain and γ-chain gene loci. CCR9 is subsequently upregulated and participates in the localization of thymocytes during their selection for self-tolerant receptor specificities. Although the dynamic regulation of CCR9 is essential for early T cell development, the mechanisms controlling CCR9 expression have not been determined. In this article, we show that key regulators of T cell development, Notch1 and the E protein transcription factors E2A and HEB, coordinately control the expression of Ccr9. E2A and HEB bind at two putative enhancers upstream of Ccr9 and positively regulate CCR9 expression at multiple stages of T cell development. In contrast, the canonical Notch signaling pathway prevents the recruitment of p300 to the putative Ccr9 enhancers, resulting in decreased acetylation of histone H3 and a failure to recruit RNA polymerase II to the Ccr9 promoter. Although Notch signaling modestly modulates the binding of E proteins to one of the two Ccr9 enhancers, we found that Notch signaling represses Ccr9 in T cell lymphoma lines in which Ccr9 transcription is independent of E protein function. Our data support the hypothesis that activation of Notch1 has a dominant-negative effect on Ccr9 transcription and that Notch1 and E proteins control the dynamic expression of Ccr9 during T cell development. Copyright © 2015 by The American Association of Immunologists, Inc.

The LIM-homeodomain transcription factor LMX1B regulates expression of NF-kappa B target genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rascle, Anne; Neumann, Tanja; Raschta, Anne-Sarah

2009-01-01

LMX1B is a LIM-homeodomain transcription factor essential for development. Putative LMX1B target genes have been identified through mouse gene targeting studies, but their identity as direct LMX1B targets remains hypothetical. We describe here the first molecular characterization of LMX1B target gene regulation. Microarray analysis using a tetracycline-inducible LMX1B expression system in HeLa cells revealed that a subset of NF-{kappa}B target genes, including IL-6 and IL-8, are upregulated in LMX1B-expressing cells. Inhibition of NF-{kappa}B activity by short interfering RNA-mediated knock-down of p65 impairs, while activation of NF-{kappa}B activity by TNF-{alpha} synergizes induction of NF-{kappa}B target genes by LMX1B. Chromatin immunoprecipitation demonstratedmore » that LMX1B binds to the proximal promoter of IL-6 and IL-8 in vivo, in the vicinity of the characterized {kappa}B site, and that LMX1B recruitment correlates with increased NF-{kappa}B DNA association. IL-6 promoter-reporter assays showed that the {kappa}B site and an adjacent putative LMX1B binding motif are both involved in LMX1B-mediated transcription. Expression of NF-{kappa}B target genes is affected in the kidney of Lmx1b{sup -/-} knock-out mice, thus supporting the biological relevance of our findings. Together, these data demonstrate for the first time that LMX1B directly regulates transcription of a subset of NF-{kappa}B target genes in cooperation with nuclear p50/p65 NF-{kappa}B.« less

Overexpression of a partial fragment of the salt-responsive gene OsNUC1 enhances salt adaptation in transgenic Arabidopsis thaliana and rice (Oryza sativa L.) during salt stress.

PubMed

Sripinyowanich, Siriporn; Chamnanmanoontham, Nontalee; Udomchalothorn, Thanikarn; Maneeprasopsuk, Somporn; Santawee, Panudda; Buaboocha, Teerapong; Qu, Li-Jia; Gu, Hongya; Chadchawan, Supachitra

2013-12-01

The rice (Oryza sativa L.) nucleolin gene, OsNUC1, transcripts were expressed in rice leaves, flowers, seeds and roots but differentially expressed within and between two pairs of salt-sensitive and salt-resistant rice lines when subjected to salt stress. Salt-resistant lines exhibited higher OsNUC1 transcript expression levels than salt-sensitive lines during 0.5% (w/v) NaCl salt stress for 6d. Two sizes of OsNUC1 full-length cDNA were found in the rice genome database and northern blot analysis confirmed their existence in rice tissues. The longer transcript (OsNUC1-L) putatively encodes for a protein with a serine rich N-terminal, RNA recognition motifs in the central domain and a glycine- and arginine-rich repeat in the C-terminal domain, while the shorter one (OsNUC1-S) putatively encodes for the similar protein without the N-terminus. Without salt stress, OsNUC1-L expressing Arabidopsis thaliana Atnuc1-L1 plants displayed a substantial but incomplete revertant phenotype, whereas OsNUC1-S expression only induced a weak effect. However, under 0.5% (w/v) NaCl salt stress they displayed a higher relative growth rate, longer root length and a lower H2O2 level than the wild type plants, suggesting a higher salt resistance. Moreover, they displayed elevated AtSOS1 and AtP5CS1 transcript levels. We propose that OsNUC1-S plays an important role in salt resistance during salt stress, a new role for nucleolin in plants. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Transcriptome Changes Associated with Delayed Flower Senescence on Transgenic Petunia by Inducing Expression of etr1-1, a Mutant Ethylene Receptor

PubMed Central

Lin, Jing; Liu, Gang; Zhang, Zhen; Chang, Youhong; Reid, Michael S.; Jiang, Cai-Zhong

2013-01-01

Flowers of ethylene-sensitive ornamental plants transformed with ethylene-insensitive 1-1(etr1-1), a mutant ethylene receptor first isolated from Arabidopsis, are known to have longer shelf lives. We have generated petunia plants in which the etr1-1 gene was over-expressed under the control of a chemically-inducible promoter, which would allow expression of etr1-1 to be initiated at the desired time and stage of development. Here, we showed that transgenic plants grew and developed normally without a chemical inducer. Semi-quantitative RT-PCR demonstrated that the abundance of transcripts of Arabidopsis etr1-1 gene was substantially induced in flowers with 30 μM dexamethasone (DEX). Consequently, t he life of the flowers was almost doubled and the peak of ethylene production was delayed. We compared gene expression changes of petals with DEX to those without DEX at 24 h and 48 h by microarray. Our results indicated that transcripts of many putative genes encoding transcription factors were down-regulated by etr1-1 induced expression at the early stage. In addition, putative genes involved in gibberellin biosynthesis, response to jasmonic acid/gibberellins stimulus, cell wall modification, ethylene biosynthesis, and cell death were down-regulated associating with etr1-1 induced expression. We investigated time-course gene expression profiles and found two profiles which displayed totally opposite expression patterns under these two treatments. In these profiles, ‘the regulation of transcription’ was predominant in GO categories. Taking all results together, we concluded those transcription factors down-regulated at early stage might exert a major role in regulating the senescence process which were consequently characterized by cell wall modification and cell death. PMID:23874385

A short region of the promoter of the breast cancer associated PLU-1 gene can regulate transcription in vitro and in vivo.

PubMed

Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce

2004-07-01

The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.

Two alternatively spliced GPR39 transcripts in seabream: molecular cloning, genomic organization, and regulation of gene expression by metabolic signals.

PubMed

Zhang, Yong; Liu, Yun; Huang, Xigui; Liu, Xiaochun; Jiao, Baowei; Meng, Zining; Zhu, Pei; Li, Shuisheng; Lin, Haoran; Cheng, Christopher H K

2008-12-01

Two GPR39 transcripts, designated as sbGPR39-1a and sbGPR39-1b, were identified in black seabream (Acanthopagrus schlegeli). The deduced amino acid (aa) sequence of sbGPR39-1a contains 423 residues with seven putative transmembrane (TM) domains. On the other hand, sbGPR39-1b contains 284 aa residues with only five putative TM domains. Northern blot analysis confirmed the presence of two GPR39 transcripts in the seabream intestine, stomach, and liver. Apart from seabream, the presence of two GPR39 transcripts was also found to exist in a number of teleosts (zebrafish and pufferfish) and mammals (human and mouse). Analysis of the GPR39 gene structure in different species suggests that the two GPR39 transcripts are generated by alternative splicing. When the seabream receptors were expressed in cultured HEK293 cells, Zn(2)(+) could trigger sbGPR39-1a signaling through the serum response element pathway, but no such functionality could be detected for the sbGPR39-1b receptor. The two receptors were found to be differentially expressed in seabream tissues. sbGPR39-1a is predominantly expressed in the gastrointestinal tract. On the other hand, sbGPR39-1b is widely expressed in most central and peripheral tissues except muscle and ovary. The expression of sbGPR39-1a in the intestine and the expression of sbGPR39-1b in the hypothalamus were decreased significantly during food deprivation in seabream. On the contrary, the expression of the GH secretagogue receptors (sbGHSR-1a and sbGHSR-1b) was significantly increased in the hypothalamus of the food-deprived seabream. The reciprocal regulatory patterns of expression of these two genes suggest that both of them are involved in controlling the physiological response of the organism during starvation.

Transcriptomic Analysis of the Underground Renewal Buds during Dormancy Transition and Release in ‘Hangbaishao’ Peony (Paeonia lactiflora)

PubMed Central

Zhang, Jiaping; Wang, Guanqun; Li, Xin; Xia, Yiping

2015-01-01

Paeonia lactiflora is one of the most famous species of herbaceous peonies with gorgeous flowers. Bud dormancy is a crucial developmental process that allows P. lactiflora to survive unfavorable environmental conditions. However, little information is available on the molecular mechanism of the bud dormancy in P. lactiflora. We performed de novo transcriptome sequencing using the Illumina RNA sequencing platform for the underground renewal buds of P. lactiflora ‘Hangbaishao’ to study the molecular mechanism underlying its bud dormancy transition (the period from endodormancy to ecodormancy) and release (the period from ecodormancy to bud elongation and sprouting). Approximately 300 million high-quality clean reads were generated and assembled into 207,827 (mean length = 828 bp) and 51,481 (mean length = 1250 bp) unigenes using two assembly methods named “Trinity” and “Trinity+PRICE”, respectively. Based on the data obtained by the latter method, 32,316 unigenes were annotated by BLAST against various databases. Approximately 1,251 putative transcription factors were obtained, of which the largest number of unique transcripts belonged to the basic helix-loop-helix protein (bHLH) transcription factor family, and five of the top ten highly expressed transcripts were annotated as dehydrin (DHN). A total of 17,705 simple sequence repeat (SSR) motifs distributed in 13,797 sequences were obtained. The budbreak morphology, levels of indole-3-acetic acid (IAA) and abscisic acid (ABA), and activities of guaiacol peroxidase (POD) and catalase (CAT) were observed. The expression of 20 interested unigenes, which annotated as DHN, heat shock protein (HSP), histone, late elongated hypocotyl (LHY), and phytochrome (PHY), and so on, were also analyzed. These studies were based on morphological, physiological, biochemical, and molecular levels and provide comprehensive insight into the mechanism of dormancy transition and release in P. lactiflora. Transcriptome dataset can be highly valuable for future investigation on gene expression networks in P. lactiflora as well as research on dormancy in other non-model perennial horticultural crops of commercial significance. PMID:25790307

Systematic discovery of novel eukaryotic transcriptional regulators using sequence homology independent prediction.

PubMed

Bossi, Flavia; Fan, Jue; Xiao, Jun; Chandra, Lilyana; Shen, Max; Dorone, Yanniv; Wagner, Doris; Rhee, Seung Y

2017-06-26

The molecular function of a gene is most commonly inferred by sequence similarity. Therefore, genes that lack sufficient sequence similarity to characterized genes (such as certain classes of transcriptional regulators) are difficult to classify using most function prediction algorithms and have remained uncharacterized. To identify novel transcriptional regulators systematically, we used a feature-based pipeline to screen protein families of unknown function. This method predicted 43 transcriptional regulator families in Arabidopsis thaliana, 7 families in Drosophila melanogaster, and 9 families in Homo sapiens. Literature curation validated 12 of the predicted families to be involved in transcriptional regulation. We tested 33 out of the 195 Arabidopsis putative transcriptional regulators for their ability to activate transcription of a reporter gene in planta and found twelve coactivators, five of which had no prior literature support. To investigate mechanisms of action in which the predicted regulators might work, we looked for interactors of an Arabidopsis candidate that did not show transactivation activity in planta and found that it might work with other members of its own family and a subunit of the Polycomb Repressive Complex 2 to regulate transcription. Our results demonstrate the feasibility of assigning molecular function to proteins of unknown function without depending on sequence similarity. In particular, we identified novel transcriptional regulators using biological features enriched in transcription factors. The predictions reported here should accelerate the characterization of novel regulators.

Chitinase Expression in Listeria monocytogenes Is Influenced by lmo0327, Which Encodes an Internalin-Like Protein.

PubMed

Paspaliari, Dafni Katerina; Kastbjerg, Vicky Gaedt; Ingmer, Hanne; Popowska, Magdalena; Larsen, Marianne Halberg

2017-11-15

The chitinolytic system of Listeria monocytogenes thus far comprises two chitinases, ChiA and ChiB, and a lytic polysaccharide monooxygenase, Lmo2467. The role of the system in the bacterium appears to be pleiotropic, as besides mediating the hydrolysis of chitin, the second most ubiquitous carbohydrate in nature, the chitinases have been deemed important for the colonization of unicellular molds, as well as mammalian hosts. To identify additional components of the chitinolytic system, we screened a transposon mutant library for mutants exhibiting impaired chitin hydrolysis. The screening yielded a mutant with a transposon insertion in a locus corresponding to lmo0327 of the EGD-e strain. lmo0327 encodes a large (1,349 amino acids [aa]) cell wall-associated protein that has been proposed to possess murein hydrolase activity. The single inactivation of lmo0327 , as well as of lmo0325 that codes for a putative transcriptional regulator functionally related to lmo0327 , led to an almost complete abolishment of chitinolytic activity. The effect could be traced at the transcriptional level, as both chiA and chiB transcripts were dramatically decreased in the lmo0327 mutant. In accordance with that, we could barely detect ChiA and ChiB in the culture supernatants of the mutant strain. Our results provide new information regarding the function of the lmo0325-lmo0327 locus in L. monocytogenes and link it to the expression of chitinolytic activity. IMPORTANCE Many bacteria from terrestrial and marine environments express chitinase activities enabling them to utilize chitin as the sole source of carbon and nitrogen. Interestingly, several bacterial chitinases may also be involved in host pathogenesis. For example, in the important foodborne pathogen Listeria monocytogenes , the chitinases ChiA and ChiB and the lytic polysaccharide monooxygenase Lmo2467 are implicated in chitin assimilation but also act as virulence factors during the infection of mammalian hosts. Therefore, it is important to identify their regulators and induction cues to understand how the different roles of the chitinolytic system are controlled and mediated. Here, we provide evidence for the importance of lmo0327 and lmo0325 , encoding a putative internalin/autolysin and a putative transcriptional activator, respectively, in the efficient expression of chitinase activity in L. monocytogenes and thereby provide new information regarding the function of the lmo0325-lmo0327 locus. Copyright © 2017 Paspaliari et al.

Transcriptome Analysis of Blunt Snout Bream (Megalobrama amblycephala) Reveals Putative Differential Expression Genes Related to Growth and Hypoxia

PubMed Central

Li, Fu-Gui; Chen, Jie; Jiang, Xia-Yun; Zou, Shu-Ming

2015-01-01

The blunt snout bream (Megalobrama amblycephala) is an important freshwater aquaculture species, but it is sensitive to hypoxia. No transcriptome data related to growth and hypoxia response are available for this species. In this study, we performed de novo transcriptome sequencing for the liver and gills of the fast-growth family and slow-growth family derived from ‘Pujiang No.1’ F10 blunt snout bream that were under hypoxic stress and normoxia, respectively. The fish were divided into the following 4 groups: fast-growth family under hypoxic stress, FH; slow-growth family under hypoxic stress, SH; fast-growth family under normoxia, FN; and slow-growth family under normoxia, SN. A total of 185 million high-quality reads were obtained from the normalized cDNA of the pooled samples, which were assembled into 465,582 contigs and 237,172 transcripts. A total of 31,338 transcripts from the same locus (unigenes) were annotated and assigned to 104 functional groups, and 23,103 unigenes were classified into seven main categories, including 45 secondary KEGG pathways. A total of 22,255 (71%) known putative unigenes were found to be shared across the genomes of five model fish species and mammals, and a substantial number (9.4%) of potentially novel genes were identified. When 6,639 unigenes were used in the analysis of differential expression (DE) genes, the number of putative DE genes related to growth pathways in FH, SH, SN and FN was 159, 118, 92 and 65 in both the liver and gills, respectively, and the number of DE genes related to hypoxic response was 57, 33, 23 and 21 in FH, FN, SH and SN, respectively. Our results suggest that growth performance of the fast-growth family should be due to complex mutual gene regulatory mechanisms of these putative DE genes between growth and hypoxia. PMID:26554582

Sequence of a cDNA and expression of the gene encoding a putative epidermal chitin synthase of Manduca sexta.

PubMed

Zhu, Yu-Cheng; Specht, Charles A; Dittmer, Neal T; Muthukrishnan, Subbaratnam; Kanost, Michael R; Kramer, Karl J

2002-11-01

Glycosyltransferases are enzymes that synthesize oligosaccharides, polysaccharides and glycoconjugates. One type of glycosyltransferase is chitin synthase, a very important enzyme in biology, which is utilized by insects, fungi, and other invertebrates to produce chitin, a polysaccharide of beta-1,4-linked N-acetylglucosamine. Chitin is an important component of the insect's exoskeletal cuticle and gut lining. To identify and characterize a chitin synthase gene of the tobacco hornworm, Manduca sexta, degenerate primers were designed from two highly conserved regions in fungal and nematode chitin synthase protein sequences and then used to amplify a similar region from Manduca cDNA. A full-length cDNA of 5152 nucleotides was assembled for the putative Manduca chitin synthase gene, MsCHS1, and sequencing of genomic DNA verified the contiguity of the sequence. The MsCHS1 cDNA has an ORF of 4692 nucleotides that encodes a transmembrane protein of 1564 amino acid residues with a mass of approximately 179 kDa (GenBank no. AY062175). It is most similar, over its entire length of protein sequence, to putative chitin synthases from other insects and nematodes, with 68% identity to enzymes from both the blow fly, Lucilia cuprina, and the fruit fly, Drosophila melanogaster. The similarity with fungal chitin synthases is restricted to the putative catalytic domain, and the MsCHS1 protein has, at equivalent positions, several amino acids that are essential for activity as revealed by mutagenesis of the fungal enzymes. A 5.3-kb transcript of MsCHS1 was identified by northern blot hybridization of RNA from larval epidermis, suggesting that the enzyme functions to make chitin deposited in the cuticle. Further examination by RT-PCR showed that MsCHS1 expression is regulated in the epidermis, with the amount of transcript increasing during phases of cuticle deposition.

Swinger RNAs with sharp switches between regular transcription and transcription systematically exchanging ribonucleotides: Case studies.

PubMed

Seligmann, Hervé

2015-09-01

During RNA transcription, DNA nucleotides A,C,G, T are usually matched by ribonucleotides A, C, G and U. However occasionally, this rule does not apply: transcript-DNA homologies are detectable only assuming systematic exchanges between ribonucleotides. Nine symmetric (X ↔ Y, e.g. A ↔ C) and fourteen asymmetric (X ↔ Y ↔ Z, e.g. A ↔ C ↔ G) exchanges exist, called swinger transcriptions. Putatively, polymerases occasionally stabilize in unspecified swinger conformations, possibly similar to transient conformations causing punctual misinsertions. This predicts chimeric transcripts, part regular, part swinger-transformed, reflecting polymerases switching to swinger polymerization conformation(s). Four chimeric Genbank transcripts (three from human mitochondrion and one murine cytosolic) are described here: (a) the 5' and 3' extremities reflect regular polymerization, the intervening sequence exchanges systematically between ribonucleotides (swinger rule G ↔ U, transcript (1), with sharp switches between regular and swinger sequences; (b) the 5' half is 'normal', the 3' half systematically exchanges ribonucleotides (swinger rule C ↔ G, transcript (2), with an intercalated sequence lacking homology; (c) the 3' extremity fits A ↔ G exchanges (10% of transcript length), the 5' half follows regular transcription; the intervening region seems a mix of regular and A ↔ G transcriptions (transcript 3); (d) murine cytosolic transcript 4 switches to A ↔ U + C ↔ G, and is fused with A ↔ U + C ↔ G swinger transformed precursor rRNA. In (c), each concomitant transcript 5' and 3' extremities match opposite genome strands. Transcripts 3 and 4 combine transcript fusions with partial swinger transcriptions. Occasional (usually sharp) switches between regular and swinger transcriptions reveal greater coding potential than detected until now, suggest stable polymerase swinger conformations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Dynamic regulation of VEGF-inducible genes by an ERK/ERG/p300 transcriptional network.

PubMed

Fish, Jason E; Cantu Gutierrez, Manuel; Dang, Lan T; Khyzha, Nadiya; Chen, Zhiqi; Veitch, Shawn; Cheng, Henry S; Khor, Melvin; Antounians, Lina; Njock, Makon-Sébastien; Boudreau, Emilie; Herman, Alexander M; Rhyner, Alexander M; Ruiz, Oscar E; Eisenhoffer, George T; Medina-Rivera, Alejandra; Wilson, Michael D; Wythe, Joshua D

2017-07-01

The transcriptional pathways activated downstream of vascular endothelial growth factor (VEGF) signaling during angiogenesis remain incompletely characterized. By assessing the signals responsible for induction of the Notch ligand delta-like 4 (DLL4) in endothelial cells, we find that activation of the MAPK/ERK pathway mirrors the rapid and dynamic induction of DLL4 transcription and that this pathway is required for DLL4 expression. Furthermore, VEGF/ERK signaling induces phosphorylation and activation of the ETS transcription factor ERG, a prerequisite for DLL4 induction. Transcription of DLL4 coincides with dynamic ERG-dependent recruitment of the transcriptional co-activator p300. Genome-wide gene expression profiling identified a network of VEGF-responsive and ERG-dependent genes, and ERG chromatin immunoprecipitation (ChIP)-seq revealed the presence of conserved ERG-bound putative enhancer elements near these target genes. Functional experiments performed in vitro and in vivo confirm that this network of genes requires ERK, ERG and p300 activity. Finally, genome-editing and transgenic approaches demonstrate that a highly conserved ERG-bound enhancer located upstream of HLX (which encodes a transcription factor implicated in sprouting angiogenesis) is required for its VEGF-mediated induction. Collectively, these findings elucidate a novel transcriptional pathway contributing to VEGF-dependent angiogenesis. © 2017. Published by The Company of Biologists Ltd.

IpsA, a novel LacI-type regulator, is required for inositol-derived lipid formation in Corynebacteria and Mycobacteria.

PubMed

Baumgart, Meike; Luder, Kerstin; Grover, Shipra; Gätgens, Cornelia; Besra, Gurdyal S; Frunzke, Julia

2013-12-30

The development of new drugs against tuberculosis and diphtheria is focused on disrupting the biogenesis of the cell wall, the unique architecture of which confers resistance against current therapies. The enzymatic pathways involved in the synthesis of the cell wall by these pathogens are well understood, but the underlying regulatory mechanisms are largely unknown. Here, we characterize IpsA, a LacI-type transcriptional regulator conserved among Mycobacteria and Corynebacteria that plays a role in the regulation of cell wall biogenesis. IpsA triggers myo-inositol formation by activating ino1, which encodes inositol phosphate synthase. An ipsA deletion mutant of Corynebacterium glutamicum cultured on glucose displayed significantly impaired growth and presented an elongated cell morphology. Further studies revealed the absence of inositol-derived lipids in the cell wall and a complete loss of mycothiol biosynthesis. The phenotype of the C. glutamicum ipsA deletion mutant was complemented to different extend by homologs from Corynebacterium diphtheriae (dip1969) and Mycobacterium tuberculosis (rv3575), indicating the conserved function of IpsA in the pathogenic species. Additional targets of IpsA with putative functions in cell wall biogenesis were identified and IpsA was shown to bind to a conserved palindromic motif within the corresponding promoter regions. Myo-inositol was identified as an effector of IpsA, causing the dissociation of the IpsA-DNA complex in vitro. This characterization of IpsA function and of its regulon sheds light on the complex transcriptional control of cell wall biogenesis in the mycolata taxon and generates novel targets for drug development.

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome

PubMed Central

Gunewardena, Sumedha S.; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D.; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome. PMID:26496202

Evolution of multicomponent pheromone signals in small ermine moths involves a single fatty-acyl reductase gene

PubMed Central

Liénard, Marjorie A.; Hagström, Åsa K.; Lassance, Jean-Marc; Löfstedt, Christer

2010-01-01

Fatty-acyl CoA reductases (FAR) convert fatty acids into fatty alcohols in pro- and eukaryotic organisms. In the Lepidoptera, members of the FAR gene family serve in the biosynthesis of sex pheromones involved in mate communication. We used a group of closely related species, the small ermine moths (Lepidoptera: Yponomeutidae) as a model to investigate the role of FARs in the biosynthesis of complex pheromone blends. Homology-based molecular cloning in three Yponomeuta species led to the identification of multiple putative FAR transcripts homologous to FAR genes from the Bombyx mori genome. The expression of one transcript was restricted to the female pheromone-gland tissue, suggesting a role in pheromone biosynthesis, and the encoded protein belonged to a recently identified Lepidoptera-specific pgFAR gene subfamily. The Yponomeuta evonymellus pgFAR mRNA was up-regulated in sexually mature females and exhibited a 24-h cyclic fluctuation pattern peaking in the pheromone production period. Heterologous expression confirmed that the Yponomeuta pgFAR orthologs in all three species investigated [Y. evonymellus (L.), Yponomeuta padellus (L.), and Yponomeuta rorellus (Hübner)] encode a functional FAR with a broad substrate range that efficiently promoted accumulation of primary alcohols in recombinant yeast supplied with a series of biologically relevant C14- or C16-acyl precursors. Taken together, our data evidence that a single alcohol-producing pgFAR played a critical function in the production of the multicomponent pheromones of yponomeutids and support the hypothesis of moth pheromone-biosynthetic FARs belonging to a FAR gene subfamily unique to Lepidoptera. PMID:20534481

Genes differentially expressed in Theobroma cacao associated with resistance to witches' broom disease caused by Crinipellis perniciosa.

PubMed

Leal, Gildemberg Amorim; Albuquerque, Paulo S B; Figueira, Antonio

2007-05-01

SUMMARY The basidiomycete Crinipellis perniciosa is the causal agent of witches' broom disease of Theobroma cacao (cocoa). Hypertrophic growth of infected buds ('brooms') is the most dramatic symptom, but the main economic losses derive from pod infection. To identify cocoa genes differentially expressed during the early stages of infection, two cDNA libraries were constructed using the suppression subtractive hybridization (SSH) approach. Subtraction hybridization was conducted between cDNAs from infected shoot-tips of the susceptible genotype 'ICS 39' and the resistant 'CAB 214', in both directions. A total of 187 unique sequences were obtained, with 83 from the library enriched for the susceptible 'ICS 39' sequences, and 104 for the resistant 'CAB 214'. By homology search and ontology analyses, the identified sequences were mainly putatively categorized as belonging to 'signal transduction', 'response to biotic and abiotic stress', 'metabolism', 'RNA and DNA metabolism', 'protein metabolism' and 'cellular maintenance' classes. Quantitative reverse transcription amplification (RT-qPCR) of 23 transcripts identified as differentially expressed between genotypes revealed distinct kinetics of gene up-regulation at the asymptomatic stage of the disease. Expression induction in the susceptible 'ICS 39' in response to C. perniciosa was delayed and limited, while in 'CAB 214' there was a quicker and more intense reaction, with two peaks of gene induction at 48 and 120 h after inoculation, corresponding to morphological and biochemical changes previously described during colonization. Similar differences in gene induction were validated for another resistant genotype ('CAB 208') in an independent experiment. Validation of these genes corroborated similar hypothetical mechanisms of resistance described in other pathosystems.

Floral Meristem Identity Genes Are Expressed during Tendril Development in Grapevine1

PubMed Central

Calonje, Myriam; Cubas, Pilar; Martínez-Zapater, José M.; Carmona, María José

2004-01-01

To study the early steps of flower initiation and development in grapevine (Vitis vinifera), we have isolated two MADS-box genes, VFUL-L and VAP1, the putative FUL-like and AP1 grapevine orthologs, and analyzed their expression patterns during vegetative and reproductive development. Both genes are expressed in lateral meristems that, in grapevine, can give rise to either inflorescences or tendrils. They are also coexpressed in inflorescence and flower meristems. During flower development, VFUL-L transcripts are restricted to the central part of young flower meristems and, later, to the prospective carpel-forming region, which is consistent with a role of this gene in floral transition and carpel and fruit development. Expression pattern of VAP1 suggests that it may play a role in flowering transition and flower development. However, its lack of expression in sepal primordia, does not support its role as an A-function gene in grapevine. Neither VFUL-L nor VAP1 expression was detected in vegetative organs such as leaves or roots. In contrast, they are expressed throughout tendril development. Transcription of both genes in tendrils of very young plants that have not undergone flowering transition indicates that this expression is independent of the flowering process. These unique expression patterns of genes typically involved in reproductive development have implications on our understanding of flower induction and initiation in grapevine, on the origin of grapevine tendrils and on the functional roles of AP1-and FUL-like genes in plant development. These results also provide molecular support to the hypothesis that Vitis tendrils are modified reproductive organs adapted to climb. PMID:15247405

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

PubMed

Gunewardena, Sumedha S; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

Characterization of a Viral Synergism in the Monocot Brachypodium distachyon Reveals Distinctly Altered Host Molecular Processes Associated with Disease1[C][W][OA

PubMed Central

Mandadi, Kranthi K.; Scholthof, Karen-Beth G.

2012-01-01

Panicum mosaic virus (PMV) and its satellite virus (SPMV) together infect several small grain crops, biofuel, and forage and turf grasses. Here, we establish the emerging monocot model Brachypodium (Brachypodium distachyon) as an alternate host to study PMV- and SPMV-host interactions and viral synergism. Infection of Brachypodium with PMV+SPMV induced chlorosis and necrosis of leaves, reduced seed set, caused stunting, and lowered biomass, more than PMV alone. Toward gaining a molecular understanding of PMV- and SPMV-affected host processes, we used a custom-designed microarray and analyzed global changes in gene expression of PMV- and PMV+SPMV-infected plants. PMV infection by itself modulated expression of putative genes functioning in carbon metabolism, photosynthesis, metabolite transport, protein modification, cell wall remodeling, and cell death. Many of these genes were additively altered in a coinfection with PMV+SPMV and correlated to the exacerbated symptoms of PMV+SPMV coinfected plants. PMV+SPMV coinfection also uniquely altered expression of certain genes, including transcription and splicing factors. Among the host defenses commonly affected in PMV and PMV+SPMV coinfections, expression of an antiviral RNA silencing component, SILENCING DEFECTIVE3, was suppressed. Several salicylic acid signaling components, such as pathogenesis-related genes and WRKY transcription factors, were up-regulated. By contrast, several genes in jasmonic acid and ethylene responses were down-regulated. Strikingly, numerous protein kinases, including several classes of receptor-like kinases, were misexpressed. Taken together, our results identified distinctly altered immune responses in monocot antiviral defenses and provide insights into monocot viral synergism. PMID:22961132

Two pheromone precursor genes are transcriptionally expressed in the homothallic ascomycete Sordaria macrospora.

PubMed

Pöggeler, S

2000-06-01

In order to analyze the involvement of pheromones in cell recognition and mating in a homothallic fungus, two putative pheromone precursor genes, named ppg1 and ppg2, were isolated from a genomic library of Sordaria macrospora. The ppg1 gene is predicted to encode a precursor pheromone that is processed by a Kex2-like protease to yield a pheromone that is structurally similar to the alpha-factor of the yeast Saccharomyces cerevisiae. The ppg2 gene encodes a 24-amino-acid polypeptide that contains a putative farnesylated and carboxy methylated C-terminal cysteine residue. The sequences of the predicted pheromones display strong structural similarity to those encoded by putative pheromones of heterothallic filamentous ascomycetes. Both genes are expressed during the life cycle of S. macrospora. This is the first description of pheromone precursor genes encoded by a homothallic fungus. Southern-hybridization experiments indicated that ppg1 and ppg2 homologues are also present in other homothallic ascomycetes.

A Fruit-Specific Putative Dihydroflavonol 4-Reductase Gene Is Differentially Expressed in Strawberry during the Ripening Process1

PubMed Central

Moyano, Enriqueta; Portero-Robles, Ignacio; Medina-Escobar, Nieves; Valpuesta, Victoriano; Muñoz-Blanco, Juan; Luis Caballero, José

1998-01-01

A cDNA clone encoding a putative dihydroflavonol 4-reductase gene has been isolated from a strawberry (Fragaria × ananassa cv Chandler) DNA subtractive library. Northern analysis showed that the corresponding gene is predominantly expressed in fruit, where it is first detected during elongation (green stages) and then declines and sharply increases when the initial fruit ripening events occur, at the time of initiation of anthocyanin accumulation. The transcript can be induced in unripe green fruit by removing the achenes, and this induction can be partially inhibited by treatment of de-achened fruit with naphthylacetic acid, indicating that the expression of this gene is under hormonal control. We propose that the putative dihydroflavonol 4-reductase gene in strawberry plays a main role in the biosynthesis of anthocyanin during color development at the late stages of fruit ripening; during the first stages the expression of this gene could be related to the accumulation of condensed tannins. PMID:9625725

Reverse Transcription of a Self-Primed Retrotransposon Requires an RNA Structure Similar to the U5-IR Stem-Loop of Retroviruses

PubMed Central

Lin, Jia-Hwei; Levin, Henry L.

1998-01-01

An inverted repeat (IR) within the U5 region of the Rous sarcoma virus (RSV) mRNA forms a structure composed of a 7-bp stem and a 5-nucleotide (nt) loop. This U5-IR structure has been shown to be required for the initiation of reverse transcription. The mRNA of Tf1, long terminal repeat-containing retrotransposon from fission yeast (Schizosaccharomyces pombe) contains nucleotides with the potential to form a U5-IR stem-loop that is strikingly similar to that of RSV. The putative U5-IR stem-loop of Tf1 consists of a 7-bp stem and a 25-nt loop. Results from mutagenesis studies indicate that the U5-IR stem-loop in the mRNA of Tf1 does form and that it is required for Tf1 transposition. Although the loop is required for transposition, we were surprised that the specific sequence of the nucleotides within the loop was unimportant for function. Additional investigation indicates that the loss of transposition activity due to a reduction in the loop size to 6 nt could be rescued by increasing the GC content of the stem. This result indicates that the large loop in the Tf1 mRNA relative to that of the RSV allows the formation of the relatively weak U5-IR stem. The levels of Tf1 proteins expressed and the amounts of Tf1 RNA packaged into the virus-like particles were not affected by mutations in the U5-IR structure. However, all of the mutations in the U5-IR structure that caused defects in transposition produced low amounts of reverse transcripts. A unique feature in the initiation of Tf1 reverse transcription is that, instead of a tRNA, the first 11 nt of the Tf1 mRNA serve as the minus-strand primer. Analysis of the 5′ end of Tf1 mRNA revealed that the mutations in the U5-IR stem-loop that resulted in defects in reverse transcription caused a reduction in the cleavage activity required to generate the Tf1 primer. Our results indicate that the U5-IR stems of Tf1 and RSV are conserved in size, position, and function. PMID:9774699

Molecular Genetic Analysis of Activation-tagged Transcription Factors Thought to be Involved in Photomorphogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neff, Michael

2011-06-23

Plants utilize light as a source of information via families of photoreceptors such as the red/far-red absorbing phytochromes (PHY) and the blue/UVA absorbing cryptochromes (CRY). The main goal of the Neff lab is to use molecular-genetic mutant screens to elucidate signaling components downstream of these photoreceptors. Activation-tagging mutagenesis led to the identification of two putative transcription factors that may be involved in both photomorphogenesis and hormone signaling pathways. sob1-D (suppressor of phyB-dominant) mutant phenotypes are caused by the over-expression of a Dof transcription factor previously named OBP3. Our previous studies indicate that OBP3 is a negative regulator of light-mediated cotyledonmore » expansion and may be involved in modulating responsiveness to the growth-regulating hormone auxin. The sob2-D mutant uncovers a role for LEP, a putative AP2/EREBP-like transcription factor, in seed germination, hypocotyl elongation and responsiveness to the hormone abscisic acid. Based on photobiological and genetic analysis of OBP3-knockdown and LEP-null mutations, we hypothesize that these transcription factors are involved in both light-mediated seedling development and hormone signaling. To examine the role that these genes play in photomorphogenesis we will: 1) Further explore the genetic role of OBP3 in cotyledon/leaf expansion and other photomorphogenic processes as well as examine potential physical interactions between OBP3 and CRY1 or other signaling components that genetically interact with this transcription factor 2) Test the hypothesis that OBP3 is genetically involved in auxin signaling and root development as well as examine the affects of this hormone and light on OBP3 protein accumulation. 3) Test the hypothesis that LEP is involved in seed germination, seedling photomorphogenesis and hormone signaling. Together these experiments will lead to a greater understanding of the complexity of interactions between photoreceptors and DNA-interacting proteins during photomorphogenesis. These studies also address the roles OBP3 and LEP may play as points of intersection between hormone signaling and photomorphogenesis. In the future, phenotypes caused by altered expression of these genes may generate useful traits for improving crop yield.« less

Epigenetic regulation of the expression of WRKY75 transcription factor in response to biotic and abiotic stresses in Solanaceae plants.

PubMed

López-Galiano, María José; González-Hernández, Ana I; Crespo-Salvador, Oscar; Rausell, Carolina; Real, M Dolores; Escamilla, Mónica; Camañes, Gemma; García-Agustín, Pilar; González-Bosch, Carmen; García-Robles, Inmaculada

2018-01-01

SlyWRKY75: gene expression was induced in response to biotic stresses, especially in Botrytis cinerea-infected tomato plants, in which Sly-miR1127-3p is a putative SlyWRKY75 regulator and epigenetic marks were detected. WRKY75 transcription factor involved in Pi homeostasis was recently found also induced in defense against necrotrophic pathogens. In this study, we analyzed by RT-qPCR the expression of SlyWRKY75 gene in tomato plants in response to abiotic stresses (drought or heat) and biotic stresses (Colorado potato beetle larvae infestation, Pseudomonas syringae or Botrytis cinerea infection) being only differentially expressed following biotic stresses, especially upon B. cinerea infection (55-fold induction). JA and JA-Ile levels were significantly increased in tomato plants under biotic stresses compared with control plants, indicating that SlyWRKY75 might be a transcriptional regulator of the JA pathway. The contribution of miRNAs and epigenetic molecular mechanisms to the regulation of this gene in B. cinerea-infected tomato plants was explored. We identified a putative Sly-miR1127-3p miRNA predicted to bind the intronic region of the SlyWRKY75 genomic sequence. Sly-miR1127-3p miRNA was repressed in infected plants (0.4-fold) supporting that it might act as an epigenetic regulation factor of SlyWRKY75 gene expression rather than via the post-transcriptional mechanisms of canonical miRNAs. It has been proposed that certain miRNAs can mediate DNA methylation in the plant nucleus broadening miRNA functions with transcriptional gene silencing by targeting intron-containing pre-mRNAs. Histone modifications analysis by chromatin immunoprecipitation (ChIP) demonstrated the presence of the activator histone modification H3K4me3 on SlyWRKY75 transcription start site and gene body. The induction of this gene in response to B. cinerea correlates with the presence of an activator mark. Thus, miRNAs and chromatin modifications might cooperate as epigenetic factors to modulate SlyWRKY75 gene expression.

Ginger and turmeric expressed sequence tags identify signature genes for rhizome identity and development and the biosynthesis of curcuminoids, gingerols and terpenoids

PubMed Central

2013-01-01

Background Ginger (Zingiber officinale) and turmeric (Curcuma longa) accumulate important pharmacologically active metabolites at high levels in their rhizomes. Despite their importance, relatively little is known regarding gene expression in the rhizomes of ginger and turmeric. Results In order to identify rhizome-enriched genes and genes encoding specialized metabolism enzymes and pathway regulators, we evaluated an assembled collection of expressed sequence tags (ESTs) from eight different ginger and turmeric tissues. Comparisons to publicly available sorghum rhizome ESTs revealed a total of 777 gene transcripts expressed in ginger/turmeric and sorghum rhizomes but apparently absent from other tissues. The list of rhizome-specific transcripts was enriched for genes associated with regulation of tissue growth, development, and transcription. In particular, transcripts for ethylene response factors and AUX/IAA proteins appeared to accumulate in patterns mirroring results from previous studies regarding rhizome growth responses to exogenous applications of auxin and ethylene. Thus, these genes may play important roles in defining rhizome growth and development. Additional associations were made for ginger and turmeric rhizome-enriched MADS box transcription factors, their putative rhizome-enriched homologs in sorghum, and rhizomatous QTLs in rice. Additionally, analysis of both primary and specialized metabolism genes indicates that ginger and turmeric rhizomes are primarily devoted to the utilization of leaf supplied sucrose for the production and/or storage of specialized metabolites associated with the phenylpropanoid pathway and putative type III polyketide synthase gene products. This finding reinforces earlier hypotheses predicting roles of this enzyme class in the production of curcuminoids and gingerols. Conclusion A significant set of genes were found to be exclusively or preferentially expressed in the rhizome of ginger and turmeric. Specific transcription factors and other regulatory genes were found that were common to the two species and that are excellent candidates for involvement in rhizome growth, differentiation and development. Large classes of enzymes involved in specialized metabolism were also found to have apparent tissue-specific expression, suggesting that gene expression itself may play an important role in regulating metabolite production in these plants. PMID:23410187

Arabidopsis transcriptional response to extracellular Ca2+ depletion involves a transient rise in cytosolic Ca2+.

PubMed

Wang, Jing; Tergel, Tergel; Chen, Jianhua; Yang, Ju; Kang, Yan; Qi, Zhi

2015-02-01

Ecological evidence indicates a worldwide trend of dramatically decreased soil Ca(2+) levels caused by increased acid deposition and massive timber harvesting. Little is known about the genetic and cellular mechanism of plants' responses to Ca(2+) depletion. In this study, transcriptional profiling analysis helped identify multiple extracellular Ca(2+) ([Ca(2+) ]ext ) depletion-responsive genes in Arabidopsis thaliana L., many of which are involved in response to other environmental stresses. Interestingly, a group of genes encoding putative cytosolic Ca(2+) ([Ca(2+) ]cyt ) sensors were significantly upregulated, implying that [Ca(2+) ]cyt has a role in sensing [Ca(2+) ]ext depletion. Consistent with this observation, [Ca(2+) ]ext depletion stimulated a transient rise in [Ca(2+) ]cyt that was negatively influenced by [K(+) ]ext , suggesting the involvement of a membrane potential-sensitive component. The [Ca(2+) ]cyt response to [Ca(2+) ]ext depletion was significantly desensitized after the initial treatment, which is typical of a receptor-mediated signaling event. The response was insensitive to an animal Ca(2+) sensor antagonist, but was suppressed by neomycin, an inhibitor of phospholipase C. Gd(3+) , an inhibitor of Ca(2+) channels, suppressed the [Ca(2+) ]ext -triggered rise in [Ca(2+) ]cyt and downstream changes in gene expression. Taken together, this study demonstrates that [Ca(2+) ]cyt plays an important role in the putative receptor-mediated cellular and transcriptional response to [Ca(2+) ]ext depletion of plant cells. © 2014 Institute of Botany, Chinese Academy of Sciences.

A putative APSES transcription factor is necessary for normal growth and development of Aspergillus nidulans.

PubMed

Lee, Ji-Yeon; Kim, Lee-Han; Kim, Ha-Eun; Park, Jae-Sin; Han, Kap-Hoon; Han, Dong-Min

2013-12-01

The nsdD gene encoding a GATA type transcription factor positively controls sexual development in Aspergillus nidulans. According to microarray data, 20 genes that were upregulated by deleting nsdD during various life cycle stages were randomly selected and deleted for functional analysis. None of the mutants showed apparent changes in growth or development compared with those of the wild-type except the AN3154 gene that encodes a putative APSES transcription factor and is an ortholog of Saccharomyces cerevisiae swi4. Deleting AN3154 resulted in retarded growth and development, and the gene was named rgdA (retared growth and development). The rgdA deletion mutant developed a reduced number of conidia even under favorable conditions for asexual development. The retarded growth and development was partially suppressed by the veA1 mutation. The conidial heads of the mutant aborted, showing reduced and irregular shaped phialides. Fruiting body development was delayed compared with that in the wild-type. The mutant did not respond to various nutritional or environmental factors that affected the development patterns. The rgdA gene was expressed at low levels throughout the life cycle and was not significantly affected by several regulators of sexual and asexual development such as nsdD, veA, stuA, or brlA. However, the rgdA gene affected brlA and abaA expression, which function as key regulators of asexual sporulation, suggesting that rgdA functions upstream of those genes.

Transcriptome Analysis of Leaves, Flowers and Fruits Perisperm of Coffea arabica L. Reveals the Differential Expression of Genes Involved in Raffinose Biosynthesis

PubMed Central

dos Santos, Tiago Benedito; de Oliveira, Fernanda Freitas; Pot, David; Leroy, Thierry; Vieira, Luiz Gonzaga Esteves; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães

2017-01-01

Coffea arabica L. is an important crop in several developing countries. Despite its economic importance, minimal transcriptome data are available for fruit tissues, especially during fruit development where several compounds related to coffee quality are produced. To understand the molecular aspects related to coffee fruit and grain development, we report a large-scale transcriptome analysis of leaf, flower and perisperm fruit tissue development. Illumina sequencing yielded 41,881,572 high-quality filtered reads. De novo assembly generated 65,364 unigenes with an average length of 1,264 bp. A total of 24,548 unigenes were annotated as protein coding genes, including 12,560 full-length sequences. In the annotation process, we identified nine candidate genes related to the biosynthesis of raffinose family oligossacarides (RFOs). These sugars confer osmoprotection and are accumulated during initial fruit development. Four genes from this pathway had their transcriptional pattern validated by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Furthermore, we identified ~24,000 putative target sites for microRNAs (miRNAs) and 134 putative transcriptionally active transposable elements (TE) sequences in our dataset. This C. arabica transcriptomic atlas provides an important step for identifying candidate genes related to several coffee metabolic pathways, especially those related to fruit chemical composition and therefore beverage quality. Our results are the starting point for enhancing our knowledge about the coffee genes that are transcribed during the flowering and initial fruit development stages. PMID:28068432

Transcriptome Analysis of Leaves, Flowers and Fruits Perisperm of Coffea arabica L. Reveals the Differential Expression of Genes Involved in Raffinose Biosynthesis.

PubMed

Ivamoto, Suzana Tiemi; Reis, Osvaldo; Domingues, Douglas Silva; Dos Santos, Tiago Benedito; de Oliveira, Fernanda Freitas; Pot, David; Leroy, Thierry; Vieira, Luiz Gonzaga Esteves; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães; Pereira, Luiz Filipe Protasio

2017-01-01

Coffea arabica L. is an important crop in several developing countries. Despite its economic importance, minimal transcriptome data are available for fruit tissues, especially during fruit development where several compounds related to coffee quality are produced. To understand the molecular aspects related to coffee fruit and grain development, we report a large-scale transcriptome analysis of leaf, flower and perisperm fruit tissue development. Illumina sequencing yielded 41,881,572 high-quality filtered reads. De novo assembly generated 65,364 unigenes with an average length of 1,264 bp. A total of 24,548 unigenes were annotated as protein coding genes, including 12,560 full-length sequences. In the annotation process, we identified nine candidate genes related to the biosynthesis of raffinose family oligossacarides (RFOs). These sugars confer osmoprotection and are accumulated during initial fruit development. Four genes from this pathway had their transcriptional pattern validated by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Furthermore, we identified ~24,000 putative target sites for microRNAs (miRNAs) and 134 putative transcriptionally active transposable elements (TE) sequences in our dataset. This C. arabica transcriptomic atlas provides an important step for identifying candidate genes related to several coffee metabolic pathways, especially those related to fruit chemical composition and therefore beverage quality. Our results are the starting point for enhancing our knowledge about the coffee genes that are transcribed during the flowering and initial fruit development stages.

Characterization of sequences in human TWIST required for nuclear localization

PubMed Central

Singh, Shalini; Gramolini, Anthony O

2009-01-01

Background Twist is a transcription factor that plays an important role in proliferation and tumorigenesis. Twist is a nuclear protein that regulates a variety of cellular functions controlled by protein-protein interactions and gene transcription events. The focus of this study was to characterize putative nuclear localization signals (NLSs) 37RKRR40 and 73KRGKK77 in the human TWIST (H-TWIST) protein. Results Using site-specific mutagenesis and immunofluorescences, we observed that altered TWISTNLS1 K38R, TWISTNLS2 K73R and K77R constructs inhibit nuclear accumulation of H-TWIST in mammalian cells, while TWISTNLS2 K76R expression was un-affected and retained to the nucleus. Subsequently, co-transfection of TWIST mutants K38R, K73R and K77R with E12 formed heterodimers and restored nuclear localization despite the NLSs mutations. Using a yeast-two-hybrid assay, we identified a novel TWIST-interacting candidate TCF-4, a basic helix-loop-helix transcription factor. The interaction of TWIST with TCF-4 confirmed using NLS rescue assays, where nuclear expression of mutant TWISTNLS1 with co-transfixed TCF-4 was observed. The interaction of TWIST with TCF-4 was also seen using standard immunoprecipitation assays. Conclusion Our study demonstrates the presence of two putative NLS motifs in H-TWIST and suggests that these NLS sequences are functional. Furthermore, we identified and confirmed the interaction of TWIST with a novel protein candidate TCF-4. PMID:19534813

Constitutive expression of a putative high-affinity nitrate transporter in Nicotiana plumbaginifolia: evidence for post-transcriptional regulation by a reduced nitrogen source.

PubMed

Fraisier, V; Gojon, A; Tillard, P; Daniel-Vedele, F

2000-08-01

The NpNRT2.1 gene encodes a putative inducible component of the high-affinity nitrate (NO3-) uptake system in Nicotiana plumbaginifolia. Here we report functional and physiological analyses of transgenic plants expressing the NpNRT2.1 coding sequence fused to the CaMV 35S or rolD promoters. Irrespective of the level of NO3- supplied, NO3- contents were found to be remarkably similar in wild-type and transgenic plants. Under specific conditions (growth on 10 mM NO3-), the steady-state NpNRT2. 1 mRNA level resulting from the deregulated transgene expression was accompanied by an increase in 15NO3- influx measured in the low concentration range. This demonstrates for the first time that the NRT2.1 sequence codes a limiting element of the inducible high-affinity transport system. Both 15NO3- influx and mRNA levels decreased in the wild type after exposure to ammonium, in agreement with previous results from many species. Surprisingly, however, influx was also markedly decreased in transgenic plants, despite stable levels of transgene expression in independent transformants after ammonium addition. We conclude that the conditions associated with the supply of a reduced nitrogen source such as ammonium, or with the generation of a further downstream metabolite, probably exert a repressive effect on NO3- influx at both transcriptional and post-transcriptional levels.

Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

PubMed

Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

2013-10-15

CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

PubMed Central

Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

2013-01-01

CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

De Novo Assembly of a Transcriptome for Calanus finmarchicus (Crustacea, Copepoda) – The Dominant Zooplankter of the North Atlantic Ocean

PubMed Central

Lenz, Petra H.; Roncalli, Vittoria; Hassett, R. Patrick; Wu, Le-Shin; Cieslak, Matthew C.; Hartline, Daniel K.; Christie, Andrew E.

2014-01-01

Assessing the impact of global warming on the food web of the North Atlantic will require difficult-to-obtain physiological data on a key copepod crustacean, Calanus finmarchicus. The de novo transcriptome presented here represents a new resource for acquiring such data. It was produced from multiplexed gene libraries using RNA collected from six developmental stages: embryo, early nauplius (NI-II), late nauplius (NV-VI), early copepodite (CI-II), late copepodite (CV) and adult (CVI) female. Over 400,000,000 paired-end reads (100 base-pairs long) were sequenced on an Illumina instrument, and assembled into 206,041 contigs using Trinity software. Coverage was estimated to be at least 65%. A reference transcriptome comprising 96,090 unique components (“comps”) was annotated using Blast2GO. 40% of the comps had significant blast hits. 11% of the comps were successfully annotated with gene ontology (GO) terms. Expression of many comps was found to be near zero in one or more developmental stages suggesting that 35 to 48% of the transcriptome is “silent” at any given life stage. Transcripts involved in lipid biosynthesis pathways, critical for the C. finmarchicus life cycle, were identified and their expression pattern during development was examined. Relative expression of three transcripts suggests wax ester biosynthesis in late copepodites, but triacylglyceride biosynthesis in adult females. Two of these transcripts may be involved in the preparatory phase of diapause. A key environmental challenge for C. finmarchicus is the seasonal exposure to the dinoflagellate Alexandrium fundyense with high concentrations of saxitoxins, neurotoxins that block voltage-gated sodium channels. Multiple contigs encoding putative voltage-gated sodium channels were identified. They appeared to be the result of both alternate splicing and gene duplication. This is the first report of multiple NaV1 genes in a protostome. These data provide new insights into the transcriptome and physiology of this environmentally important zooplankter. PMID:24586345

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID:25611823

Transcription Factor SOX5 Promotes the Migration and Invasion of Fibroblast-Like Synoviocytes in Part by Regulating MMP-9 Expression in Collagen-Induced Arthritis.

PubMed

Shi, Yumeng; Wu, Qin; Xuan, Wenhua; Feng, Xiaoke; Wang, Fang; Tsao, Betty P; Zhang, Miaojia; Tan, Wenfeng

2018-01-01

Fibroblast-like synoviocytes (FLS) exhibit a unique aggressive phenotype in rheumatoid arthritis (RA). Increased FLS migration and subsequent invasion of the extracellular matrix are essential to joint destruction in RA. Our previous research reported that transcription factor SOX5 was highly expressed in RA-FLS. Here, the effects of SOX5 in RA-FLS migration and invasion will be investigated. The migration and invasion of RA-FLS were evaluated using a transwell chamber assay. The expression of several potential SOX5-targeted genes, including matrix metalloproteinases (MMP-1, 2, 3 and 9), chemokines (CCL4, CCL2, CCR5 and CCR2), and pro-inflammatory cytokines (TNF-α and IL-6), were examined in RA-FLS using SOX5 gain- and loss-of-function study. The molecular mechanisms of SOX5-mediated MMP-9 expressions were assayed by luciferase reporter gene and chromatin immunoprecipitation (ChIP) studies. The in vivo effect of SOX5 on FLS migration and invasion was examined using collagen-induced arthritis (CIA) in DBA/1J mice. Knockdown SOX5 decreased lamellipodium formation, migration, and invasion of RA-FLS. The expression of MMP-9 was the only gene tested to be concomitantly affected by silencing or overexpressing SOX5. ChIP assay revealed that SOX5 was bound to the MMP-9 promoter in RA-FLS. The overexpression of SOX5 markedly enhanced the MMP-9 promoter activity, and specific deletion of a putative SOX5-binding site in MMP-9 promoter diminished this promoter-driven transcription in FLS. Locally knocked down SOX5 inhibited MMP-9 expression in the joint tissue and reduced pannus migration and invasion into the cartilage in CIA mice. SOX5 plays a novel role in mediating migration and invasion of FLS in part by regulating MMP-9 expression in RA.

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Repressive LTR Nucleosome Positioning by the BAF Complex Is Required for HIV Latency

PubMed Central

Hakre, Shweta; Moshkin, Yuri; Verdin, Eric; Mahmoudi, Tokameh

2011-01-01

Persistence of a reservoir of latently infected memory T cells provides a barrier to HIV eradication in treated patients. Several reports have implicated the involvement of SWI/SNF chromatin remodeling complexes in restricting early steps in HIV infection, in coupling the processes of integration and remodeling, and in promoter/LTR transcription activation and repression. However, the mechanism behind the seemingly contradictory involvement of SWI/SNF in the HIV life cycle remains unclear. Here we addressed the role of SWI/SNF in regulation of the latent HIV LTR before and after transcriptional activation. We determined the predicted nucleosome affinity of the LTR sequence and found a striking reverse correlation when compared to the strictly positioned in vivo LTR nucleosomal structure; sequences encompassing the DNase hypersensitive regions displayed the highest nucleosome affinity, while the strictly positioned nucleosomes displayed lower affinity for nucleosome formation. To examine the mechanism behind this reverse correlation, we used a combinatorial approach to determine DNA accessibility, histone occupancy, and the unique recruitment and requirement of BAF and PBAF, two functionally distinct subclasses of SWI/SNF at the LTR of HIV-infected cells before and after activation. We find that establishment and maintenance of HIV latency requires BAF, which removes a preferred nucleosome from DHS1 to position the repressive nucleosome-1 over energetically sub-optimal sequences. Depletion of BAF resulted in de-repression of HIV latency concomitant with a dramatic alteration in the LTR nucleosome profile as determined by high resolution MNase nucleosomal mapping. Upon activation, BAF was lost from the HIV promoter, while PBAF was selectively recruited by acetylated Tat to facilitate LTR transcription. Thus BAF and PBAF, recruited during different stages of the HIV life cycle, display opposing function on the HIV promoter. Our data point to the ATP-dependent BRG1 component of BAF as a putative therapeutic target to deplete the latent reservoir in patients. PMID:22140357

Repressive LTR nucleosome positioning by the BAF complex is required for HIV latency.

PubMed

Rafati, Haleh; Parra, Maribel; Hakre, Shweta; Moshkin, Yuri; Verdin, Eric; Mahmoudi, Tokameh

2011-11-01

Persistence of a reservoir of latently infected memory T cells provides a barrier to HIV eradication in treated patients. Several reports have implicated the involvement of SWI/SNF chromatin remodeling complexes in restricting early steps in HIV infection, in coupling the processes of integration and remodeling, and in promoter/LTR transcription activation and repression. However, the mechanism behind the seemingly contradictory involvement of SWI/SNF in the HIV life cycle remains unclear. Here we addressed the role of SWI/SNF in regulation of the latent HIV LTR before and after transcriptional activation. We determined the predicted nucleosome affinity of the LTR sequence and found a striking reverse correlation when compared to the strictly positioned in vivo LTR nucleosomal structure; sequences encompassing the DNase hypersensitive regions displayed the highest nucleosome affinity, while the strictly positioned nucleosomes displayed lower affinity for nucleosome formation. To examine the mechanism behind this reverse correlation, we used a combinatorial approach to determine DNA accessibility, histone occupancy, and the unique recruitment and requirement of BAF and PBAF, two functionally distinct subclasses of SWI/SNF at the LTR of HIV-infected cells before and after activation. We find that establishment and maintenance of HIV latency requires BAF, which removes a preferred nucleosome from DHS1 to position the repressive nucleosome-1 over energetically sub-optimal sequences. Depletion of BAF resulted in de-repression of HIV latency concomitant with a dramatic alteration in the LTR nucleosome profile as determined by high resolution MNase nucleosomal mapping. Upon activation, BAF was lost from the HIV promoter, while PBAF was selectively recruited by acetylated Tat to facilitate LTR transcription. Thus BAF and PBAF, recruited during different stages of the HIV life cycle, display opposing function on the HIV promoter. Our data point to the ATP-dependent BRG1 component of BAF as a putative therapeutic target to deplete the latent reservoir in patients.

AT-rich sequence elements promote nascent transcript cleavage leading to RNA polymerase II termination

PubMed Central

White, Eleanor; Kamieniarz-Gdula, Kinga; Dye, Michael J.; Proudfoot, Nick J.

2013-01-01

RNA Polymerase II (Pol II) termination is dependent on RNA processing signals as well as specific terminator elements located downstream of the poly(A) site. One of the two major terminator classes described so far is the Co-Transcriptional Cleavage (CoTC) element. We show that homopolymer A/T tracts within the human β-globin CoTC-mediated terminator element play a critical role in Pol II termination. These short A/T tracts, dispersed within seemingly random sequences, are strong terminator elements, and bioinformatics analysis confirms the presence of such sequences in 70% of the putative terminator regions (PTRs) genome-wide. PMID:23258704

5' diversity of human hepatic PXR (NR1I2) transcripts and identification of the major transcription initiation site.

PubMed

Kurose, Kouichi; Koyano, Satoru; Ikeda, Shinobu; Tohkin, Masahiro; Hasegawa, Ryuichi; Sawada, Jun-Ichi

2005-05-01

The human pregnane X receptor (PXR) is a crucial regulator of the genes encoding several major cytochrome P450 enzymes and transporters, such as CYP3A4 and MDR1, but its own transcriptional regulation remains unclear. To elucidate the transcriptional mechanisms of human PXR gene, we first endeavored to identify the transcription initiation site of human PXR using 5'-RACE. Five types of 5'-variable transcripts (a, b, c, d, and e) with common exon 2 sequence were found, and comparison of these sequences with the genomic sequence suggested that their 5' diversity is derived from initiation by alternative promoters and alternative splicing. None of the exons found in our study contain any new in-frame coding regions. Newly identified introns IVS-a and IVS-b were found to have CT-AC splice sites that do not follow the GT-AG rule of conventional donor and acceptor splice sites. Of the five types of 5' variable transcripts identified, RT-PCR showed that type-a was the major transcript type. Four transcription initiation sites (A-D) for type-a transcript were identified by 5'-RACE using GeneRacer RACE Ready cDNA (human liver) constructed by the oligo-capping method. Putative TATA boxes were located approximately 30 bp upstream from the transcriptional start sites of the major transcript (C) and the longest minor transcript (A) expressed in the human liver. These results indicate that the initiation of transcription of human PXR is more complex than previously reported.

Report on the development of putative functional SSR and SNP markers in passion fruits.

PubMed

da Costa, Zirlane Portugal; Munhoz, Carla de Freitas; Vieira, Maria Lucia Carneiro

2017-09-06

Passionflowers Passiflora edulis and Passiflora alata are diploid, outcrossing and understudied fruit bearing species. In Brazil, passion fruit cultivation began relatively recently and has earned the country an outstanding position as the world's top producer of passion fruit. The fruit's main economic value lies in the production of juice, an essential exotic ingredient in juice blends. Currently, crop improvement strategies, including those for underexploited tropical species, tend to incorporate molecular genetic approaches. In this study, we examined a set of P. edulis transcripts expressed in response to infection by Xanthomonas axonopodis, (the passion fruit's main bacterial pathogen that attacks the vines), aiming at the development of putative functional markers, i.e. SSRs (simple sequence repeats) and SNPs (single nucleotide polymorphisms). A total of 210 microsatellites were found in 998 sequences, and trinucleotide repeats were found to be the most frequent (31.4%). Of the sequences selected for designing primers, 80.9% could be used to develop SSR markers, and 60.6% SNP markers for P. alata. SNPs were all biallelic and found within 15 gene fragments of P. alata. Overall, gene fragments generated 10,003 bp. SNP frequency was estimated as one SNP every 294 bp. Polymorphism rates revealed by SSR and SNP loci were 29.4 and 53.6%, respectively. Passiflora edulis transcripts were useful for the development of putative functional markers for P. alata, suggesting a certain level of sequence conservation between these cultivated species. The markers developed herein could be used for genetic mapping purposes and also in diversity studies.

Revealing the transcriptomic complexity of switchgrass by PacBio long-read sequencing.

PubMed

Zuo, Chunman; Blow, Matthew; Sreedasyam, Avinash; Kuo, Rita C; Ramamoorthy, Govindarajan Kunde; Torres-Jerez, Ivone; Li, Guifen; Wang, Mei; Dilworth, David; Barry, Kerrie; Udvardi, Michael; Schmutz, Jeremy; Tang, Yuhong; Xu, Ying

2018-01-01

Switchgrass ( Panicum virgatum L.) is an important bioenergy crop widely used for lignocellulosic research. While extensive transcriptomic analyses have been conducted on this species using short read-based sequencing techniques, very little has been reliably derived regarding alternatively spliced (AS) transcripts. We present an analysis of transcriptomes of six switchgrass tissue types pooled together, sequenced using Pacific Biosciences (PacBio) single-molecular long-read technology. Our analysis identified 105,419 unique transcripts covering 43,570 known genes and 8795 previously unknown genes. 45,168 are novel transcripts of known genes. A total of 60,096 AS transcripts are identified, 45,628 being novel. We have also predicted 1549 transcripts of genes involved in cell wall construction and remodeling, 639 being novel transcripts of known cell wall genes. Most of the predicted transcripts are validated against Illumina-based short reads. Specifically, 96% of the splice junction sites in all the unique transcripts are validated by at least five Illumina reads. Comparisons between genes derived from our identified transcripts and the current genome annotation revealed that among the gene set predicted by both analyses, 16,640 have different exon-intron structures. Overall, substantial amount of new information is derived from the PacBio RNA data regarding both the transcriptome and the genome of switchgrass.

Ketamine and Imipramine Reverse Transcriptional Signatures of Susceptibility and Induce Resilience-Specific Gene Expression Profiles.

PubMed

Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Vialou, Vincent; Heller, Elizabeth A; Yieh, Lynn; LaBonté, Benoit; Peña, Catherine J; Shen, Li; Wittenberg, Gayle M; Nestler, Eric J

2017-02-15

Examining transcriptional regulation by antidepressants in key neural circuits implicated in depression and understanding the relation to transcriptional mechanisms of susceptibility and natural resilience may help in the search for new therapeutic agents. Given the heterogeneity of treatment response in human populations, examining both treatment response and nonresponse is critical. We compared the effects of a conventional monoamine-based tricyclic antidepressant, imipramine, and a rapidly acting, non-monoamine-based antidepressant, ketamine, in mice subjected to chronic social defeat stress, a validated depression model, and used RNA sequencing to analyze transcriptional profiles associated with susceptibility, resilience, and antidepressant response and nonresponse in the prefrontal cortex (PFC), nucleus accumbens, hippocampus, and amygdala. We identified similar numbers of responders and nonresponders after ketamine or imipramine treatment. Ketamine induced more expression changes in the hippocampus; imipramine induced more expression changes in the nucleus accumbens and amygdala. Transcriptional profiles in treatment responders were most similar in the PFC. Nonresponse reflected both the lack of response-associated gene expression changes and unique gene regulation. In responders, both drugs reversed susceptibility-associated transcriptional changes and induced resilience-associated transcription in the PFC. We generated a uniquely large resource of gene expression data in four interconnected limbic brain regions implicated in depression and its treatment with imipramine or ketamine. Our analyses highlight the PFC as a key site of common transcriptional regulation by antidepressant drugs and in both reversing susceptibility- and inducing resilience-associated molecular adaptations. In addition, we found region-specific effects of each drug, suggesting both common and unique effects of imipramine versus ketamine. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Gramene 2013: comparative plant genomics resources.

PubMed

Monaco, Marcela K; Stein, Joshua; Naithani, Sushma; Wei, Sharon; Dharmawardhana, Palitha; Kumari, Sunita; Amarasinghe, Vindhya; Youens-Clark, Ken; Thomason, James; Preece, Justin; Pasternak, Shiran; Olson, Andrew; Jiao, Yinping; Lu, Zhenyuan; Bolser, Dan; Kerhornou, Arnaud; Staines, Dan; Walts, Brandon; Wu, Guanming; D'Eustachio, Peter; Haw, Robin; Croft, David; Kersey, Paul J; Stein, Lincoln; Jaiswal, Pankaj; Ware, Doreen

2014-01-01

Gramene (http://www.gramene.org) is a curated online resource for comparative functional genomics in crops and model plant species, currently hosting 27 fully and 10 partially sequenced reference genomes in its build number 38. Its strength derives from the application of a phylogenetic framework for genome comparison and the use of ontologies to integrate structural and functional annotation data. Whole-genome alignments complemented by phylogenetic gene family trees help infer syntenic and orthologous relationships. Genetic variation data, sequences and genome mappings available for 10 species, including Arabidopsis, rice and maize, help infer putative variant effects on genes and transcripts. The pathways section also hosts 10 species-specific metabolic pathways databases developed in-house or by our collaborators using Pathway Tools software, which facilitates searches for pathway, reaction and metabolite annotations, and allows analyses of user-defined expression datasets. Recently, we released a Plant Reactome portal featuring 133 curated rice pathways. This portal will be expanded for Arabidopsis, maize and other plant species. We continue to provide genetic and QTL maps and marker datasets developed by crop researchers. The project provides a unique community platform to support scientific research in plant genomics including studies in evolution, genetics, plant breeding, molecular biology, biochemistry and systems biology.

The genomes and comparative genomics of Lactobacillus delbrueckii phages.

PubMed

Riipinen, Katja-Anneli; Forsman, Päivi; Alatossava, Tapani

2011-07-01

Lactobacillus delbrueckii phages are a great source of genetic diversity. Here, the genome sequences of Lb. delbrueckii phages LL-Ku, c5 and JCL1032 were analyzed in detail, and the genetic diversity of Lb. delbrueckii phages belonging to different taxonomic groups was explored. The lytic isometric group b phages LL-Ku (31,080 bp) and c5 (31,841 bp) showed a minimum nucleotide sequence identity of 90% over about three-fourths of their genomes. The genomic locations of their lysis modules were unique, and the genomes featured several putative overlapping transcription units of genes. LL-Ku and c5 virions displayed peptidoglycan hydrolytic activity associated with a ~36-kDa protein similar in size to the endolysin. Unexpectedly, the 49,433-bp genome of the prolate phage JCL1032 (temperate, group c) revealed a conserved gene order within its structural genes. Lb. delbrueckii phages representing groups a (a phage LL-H), b and c possessed only limited protein sequence homology. Genomic comparison of LL-Ku and c5 suggested that diversification of Lb. delbrueckii phages is mainly due to insertions, deletions and recombination. For the first time, the complete genome sequences of group b and c Lb. delbrueckii phages are reported.

Expressed sequence tags from the plant trypanosomatid Phytomonas serpens.

PubMed

Pappas, Georgios J; Benabdellah, Karim; Zingales, Bianca; González, Antonio

2005-08-01

We have generated 2190 expressed sequence tags (ESTs) from a cDNA library of the plant trypanosomatid Phytomonas serpens. Upon processing and clustering the set of 1893 accepted sequences was reduced to 697 clusters consisting of 452 singletons and 245 contigs. Functional categories were assigned based on BLAST searches against a database of the eukaryotic orthologous groups of proteins (KOG). Thirty six percent of the generated sequences showed no hits against the KOG database and 39.6% presented similarity to the KOG classes corresponding to translation, ribosomal structure and biogenesis. The most populated cluster contained 45 ESTs homologous to members of the glucose transporter family. This fact can be immediately correlated to the reported Phytomonas dependence on anaerobic glycolytic ATP production due to the lack of cytochrome-mediated respiratory chain. In this context, not only a number of enzymes of the glycolytic pathway were identified but also of the Krebs cycle as well as specific components of the respiratory chain. The data here reported, including a few hundred unique sequences and the description of tandemly repeated motifs and putative transcript stability motifs at untranslated mRNA ends, represent an initial approach to overcome the lack of information on the molecular biology of this organism.

Quo Vadis Venomics? A Roadmap to Neglected Venomous Invertebrates

PubMed Central

von Reumont, Bjoern Marcus; Campbell, Lahcen I.; Jenner, Ronald A.

2014-01-01

Venomics research is being revolutionized by the increased use of sensitive -omics techniques to identify venom toxins and their transcripts in both well studied and neglected venomous taxa. The study of neglected venomous taxa is necessary both for understanding the full diversity of venom systems that have evolved in the animal kingdom, and to robustly answer fundamental questions about the biology and evolution of venoms without the distorting effect that can result from the current bias introduced by some heavily studied taxa. In this review we draw the outlines of a roadmap into the diversity of poorly studied and understood venomous and putatively venomous invertebrates, which together represent tens of thousands of unique venoms. The main groups we discuss are crustaceans, flies, centipedes, non-spider and non-scorpion arachnids, annelids, molluscs, platyhelminths, nemerteans, and echinoderms. We review what is known about the morphology of the venom systems in these groups, the composition of their venoms, and the bioactivities of the venoms to provide researchers with an entry into a large and scattered literature. We conclude with a short discussion of some important methodological aspects that have come to light with the recent use of new -omics techniques in the study of venoms. PMID:25533518

Expression of putative pathogenicity-related genes in Xylella fastidiosa grown at low and high cell density conditions in vitro.

PubMed

Scarpari, Leandra M; Lambais, Marcio R; Silva, Denise S; Carraro, Dirce M; Carrer, Helaine

2003-05-16

Xylella fastidiosa is the causal agent of economically important plant diseases, including citrus variegated chlorosis and Pierce's disease. Hitherto, there has been no information on the molecular mechanisms controlling X. fastidiosa-plant interactions. To determine whether predicted open reading frames (ORFs) encoding putative pathogenicity-related factors were expressed by X. fastidiosa 9a5c cells grown at low (LCD) and high cell density (HCD) conditions in liquid modified PW medium, reverse Northern blot hybridization and reverse transcription-polymerase chain reaction (RT-PCR) experiments were performed. Our results indicated that ORFs XF2344, XF2369, XF1851 and XF0125, encoding putative Fur, GumC, a serine-protease and RsmA, respectively, were significantly suppressed at HCD conditions. In contrast, ORF XF1115, encoding putative RpfF, was significantly induced at HCD conditions. Expressions of ORFs XF2367, XF2362 and XF0290, encoding putative GumD, GumJ and RpfA, respectively, were detected only at HCD conditions, whereas expression of ORF XF0287, encoding putative RpfB was detected only at LCD conditions. Bioassays with an Agrobacterium traG::lacZ reporter system indicated that X. fastidiosa does not synthesize N-acyl-homoserine lactones, whereas bioassays with a diffusible signal factor (DSF)-responsive Xanthomonas campestris pv. campestris mutant indicate that X. fastidiosa synthesizes a molecule similar to DSF in modified PW medium. Our data also suggest that the synthesis of the DSF-like molecule and fastidian gum by X. fastidiosa is affected by cell density in vitro.

Transcriptional regulators transforming growth factor-beta 1 and estrogen-related receptor-alpha identified as putative mediators of calf rumen epithelial tissue development and function during weaning

USDA-ARS?s Scientific Manuscript database

Molecular mechanisms controlling rumen epithelial development at weaning remain largely unknown. To identify gene networks and regulatory factors responsive to concentrate versus forage feeding at weaning, Holstein bull calves (n = 18) were fed commercial milk replacer only (MRO) until 42 d of age. ...

rtfA, a putative RNA-Pol II transcription elongation factor gene, is necessary for normal morphological and chemical development in Aspergillus flavus

USDA-ARS?s Scientific Manuscript database

The filamentous fungus Aspergillus flavus is an agriculturally important opportunistic plant pathogen that produces potent carcinogenic compounds called aflatoxins. We identified the A. flavus rtfA gene, the ortholog of rtf1 in S. cerevisiae and rtfA in A. nidulans. Interestingly, rtfA has multiple ...

YeATS- a tool suite for analyzing RNA-seq derived transcriptome identifies a highly transcribed putative extensin in heartwood/sapwood transition zone in black walnut

USDA-ARS?s Scientific Manuscript database

The transcriptome provides a functional footprint of the genome by enumerating the molecular components of cells and tissues. The field of transcript discovery has been revolutionized through high-throughput mRNA sequencing (RNA-seq). Here, we present a methodology that replicates and improves exist...

Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

PubMed

Hempel, Niels; Görisch, Helmut; Mern, Demissew S

2013-09-01

Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

Gene ercA, Encoding a Putative Iron-Containing Alcohol Dehydrogenase, Is Involved in Regulation of Ethanol Utilization in Pseudomonas aeruginosa

PubMed Central

Hempel, Niels; Görisch, Helmut

2013-01-01

Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported. PMID:23813731

Localization of a putative transcriptional regulator (ATRX) at pericentromeric heterochromatin and the short arms of acrocentric chromosomes.

PubMed

McDowell, T L; Gibbons, R J; Sutherland, H; O'Rourke, D M; Bickmore, W A; Pombo, A; Turley, H; Gatter, K; Picketts, D J; Buckle, V J; Chapman, L; Rhodes, D; Higgs, D R

1999-11-23

ATRX is a member of the SNF2 family of helicase/ATPases that is thought to regulate gene expression via an effect on chromatin structure and/or function. Mutations in the hATRX gene cause severe syndromal mental retardation associated with alpha-thalassemia. Using indirect immunofluorescence and confocal microscopy we have shown that ATRX protein is associated with pericentromeric heterochromatin during interphase and mitosis. By coimmunofluorescence, ATRX localizes with a mouse homologue of the Drosophila heterochromatic protein HP1 in vivo, consistent with a previous two-hybrid screen identifying this interaction. From the analysis of a trap assay for nuclear proteins, we have shown that the localization of ATRX to heterochromatin is encoded by its N-terminal region, which contains a conserved plant homeodomain-like finger and a coiled-coil domain. In addition to its association with heterochromatin, at metaphase ATRX clearly binds to the short arms of human acrocentric chromosomes, where the arrays of ribosomal DNA are located. The unexpected association of a putative transcriptional regulator with highly repetitive DNA provides a potential explanation for the variability in phenotype of patients with identical mutations in the ATRX gene.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

NASA Astrophysics Data System (ADS)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Regulation of melanin biosynthesis via the dihydroxynaphthalene pathway is dependent on sexual development in the ascomycete Sordaria macrospora.

PubMed

Engh, Ines; Nowrousian, Minou; Kück, Ulrich

2007-10-01

The filamentous ascomycete Sordaria macrospora accumulates melanin during sexual development. The four melanin biosynthesis genes pks, teh, sdh and tih were isolated and their homology to genes involved in 1,8 dihydroxynaphthalene (DHN) melanin biosynthesis was shown. The presence of DHN melanin in S. macrospora was further confirmed by disrupting the pks gene encoding a putative polyketide synthase and by RNA interference-mediated silencing of the sdh gene encoding a putative scytalone dehydratase. Because melanin occurs in fruiting bodies that develop through several intermediate stages within 7 days of growth, a Northern analysis of a developmental time-course was conducted. These data revealed a time-dependent regulation of teh and sdh transcript levels. Comparing the transcriptional expression by real-time PCR of melanin biosynthesis genes in the wild type under conditions allowing or repressing sexual development, a significant downregulation during vegetative growth was detected. Quantitative real-time PCR and Northern blot analysis of melanin biosynthesis gene expression in different developmental mutants confirmed that melanin biosynthesis is linked to fruiting body development and is under the control of specific regulatory genes that participate in sexual differentiation.

Genetic variation in the MITF promoter affects skin colour and transcriptional activity in black-boned chickens.

PubMed

Wang, G; Liao, J; Tang, M; Yu, S

2018-02-01

1. Microphthalmia-associated transcription factor (MITF) plays a pivotal role in melanocyte development by regulating the transcription of major pigmentation enzymes (e.g. TYR, TYRP1 and DCT). A single-nucleotide polymorphism (SNP), c.-638T>C, was identified in the MITF promoter, and genotyping of a population (n = 426) revealed that SNP c.-638T>C was associated with skin colour in black-boned chickens. 2. Individuals with genotypes CC and TC exhibited greater MTIF expression than those with genotype TT. Luciferase assays also revealed that genotype CC and TC promoters had higher activity levels than genotype TT. Expression of melanogenesis-related gene (TYR) was higher in the skin of chickens with the CC and CT genotype compared to TT chickens (P < 0.05). 3. Transcription factor-binding site analyses showed that the c.-638C allele contains a putative binding site for transcription factor sterol regulatory element-binding transcription factor 2, aryl hydrocarbon receptor nuclear translocator, transcription factor binding to IGHM enhancer 3 and upstream transcription factor 2. In contrast, the c.-638T allele contains binding sites for Sp3 transcription factor and Krüppel-like factor 1. 4. It was concluded that MITF promoter polymorphisms affected chicken skin colour. SNP c.-638T>C could be used for the marker-assisted selection of skin colour in black-boned chicken breeding.

Dexamethasone Enhances 1α,25-Dihydroxyvitamin D3 Effects by Increasing Vitamin D Receptor Transcription*

PubMed Central

Hidalgo, Alejandro A.; Deeb, Kristin K.; Pike, J. Wesley; Johnson, Candace S.; Trump, Donald L.

2011-01-01

Calcitriol, the active form of vitamin D, in combination with the glucocorticoid dexamethasone (Dex) has been shown to increase the antitumor effects of calcitriol in squamous cell carcinoma. In this study we found that pretreatment with Dex potentiates calcitriol effects by inhibiting cell growth and increasing vitamin D receptor (VDR) and VDR-mediated transcription. Treatment with actinomycin D inhibits Vdr mRNA synthesis, indicating that Dex regulates VDR expression at transcriptional level. Real time PCR shows that treatment with Dex increases Vdr transcripts in a time- and a dose-dependent manner, indicating that Dex directly regulates expression of Vdr. RU486, an inhibitor of glucocorticoids, inhibits Dex-induced Vdr expression. In addition, the silencing of glucocorticoid receptor (GR) abolishes the induction of Vdr by Dex, indicating that Dex increases Vdr transcripts in a GR-dependent manner. A fragment located 5.2 kb upstream of Vdr transcription start site containing two putative glucocorticoid response elements (GREs) was evaluated using a luciferase-based reporter assay. Treatment with 100 nm Dex induces transcription of luciferase driven by the fragment. Deletion of the GRE distal to transcription start site was sufficient to abolish Dex induction of luciferase. Also, chromatin immunoprecipitation reveals recruitment of GR to distal GRE with Dex treatment. We conclude that Dex increases VDR and vitamin D effects by increasing Vdr de novo transcription in a GR-dependent manner. PMID:21868377

Identification and expression profiles of the WRKY transcription factor family in Ricinus communis.

PubMed

Li, Hui-Liang; Zhang, Liang-Bo; Guo, Dong; Li, Chang-Zhu; Peng, Shi-Qing

2012-07-25

In plants, WRKY proteins constitute a large family of transcription factors. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. A large number of WRKY transcription factors have been reported from Arabidopsis, rice, and other higher plants. The recent publication of the draft genome sequence of castor bean (Ricinus communis) has allowed a genome-wide search for R. communis WRKY (RcWRKY) transcription factors and the comparison of these positively identified proteins with their homologs in model plants. A total of 47 WRKY genes were identified in the castor bean genome. According to the structural features of the WRKY domain, the RcWRKY are classified into seven main phylogenetic groups. Furthermore, putative orthologs of RcWRKY proteins in Arabidopsis and rice could now be assigned. An analysis of expression profiles of RcWRKY genes indicates that 47 WRKY genes display differential expressions either in their transcript abundance or expression patterns under normal growth conditions. Copyright © 2012 Elsevier B.V. All rights reserved.

Transcriptional analysis of exopolysaccharides biosynthesis gene clusters in Lactobacillus plantarum.

PubMed

Vastano, Valeria; Perrone, Filomena; Marasco, Rosangela; Sacco, Margherita; Muscariello, Lidia

2016-04-01

Exopolysaccharides (EPS) from lactic acid bacteria contribute to specific rheology and texture of fermented milk products and find applications also in non-dairy foods and in therapeutics. Recently, four clusters of genes (cps) associated with surface polysaccharide production have been identified in Lactobacillus plantarum WCFS1, a probiotic and food-associated lactobacillus. These clusters are involved in cell surface architecture and probably in release and/or exposure of immunomodulating bacterial molecules. Here we show a transcriptional analysis of these clusters. Indeed, RT-PCR experiments revealed that the cps loci are organized in five operons. Moreover, by reverse transcription-qPCR analysis performed on L. plantarum WCFS1 (wild type) and WCFS1-2 (ΔccpA), we demonstrated that expression of three cps clusters is under the control of the global regulator CcpA. These results, together with the identification of putative CcpA target sequences (catabolite responsive element CRE) in the regulatory region of four out of five transcriptional units, strongly suggest for the first time a role of the master regulator CcpA in EPS gene transcription among lactobacilli.

The G-quadruplex DNA stabilizing drug pyridostatin promotes DNA damage and downregulates transcription of Brca1 in neurons.

PubMed

Moruno-Manchon, Jose F; Koellhoffer, Edward C; Gopakumar, Jayakrishnan; Hambarde, Shashank; Kim, Nayun; McCullough, Louise D; Tsvetkov, Andrey S

2017-09-12

The G-quadruplex is a non-canonical DNA secondary structure formed by four DNA strands containing multiple runs of guanines. G-quadruplexes play important roles in DNA recombination, replication, telomere maintenance, and regulation of transcription. Small molecules that stabilize the G-quadruplexes alter gene expression in cancer cells. Here, we hypothesized that the G-quadruplexes regulate transcription in neurons. We discovered that pyridostatin, a small molecule that specifically stabilizes G-quadruplex DNA complexes, induced neurotoxicity and promoted the formation of DNA double-strand breaks (DSBs) in cultured neurons. We also found that pyridostatin downregulated transcription of the Brca1 gene, a gene that is critical for DSB repair. Importantly, in an in vitro gel shift assay, we discovered that an antibody specific to the G-quadruplex structure binds to a synthetic oligonucleotide, which corresponds to the first putative G-quadruplex in the Brca1 gene promoter. Our results suggest that the G-quadruplex complexes regulate transcription in neurons. Studying the G-quadruplexes could represent a new avenue for neurodegeneration and brain aging research.

Transcriptional regulation of dimethyl sulfoxide respiration in a haloarchaeon, Haloferax volcanii.

PubMed

Qi, Qiuzi; Ito, Yoshiyasu; Yoshimatsu, Katsuhiko; Fujiwara, Taketomo

2016-01-01

The halophilic euryarchaeon Haloferax volcanii can grow anaerobically by DMSO respiration. DMSO reductase was induced by DMSO respiration not only under anaerobic growth conditions but also in denitrifying cells of H. volcanii. Deletion of the dmsR gene, encoding a putative regulator for the DMSO reductase, resulted in the loss of anaerobic growth by DMSO respiration. Reporter experiments revealed that only the anaerobic condition was essential for transcription of the dmsEABCD genes encoding DMSO reductase and that transcription was enhanced threefold by supplementation of DMSO. In the ∆dmsR mutant, transcription of the dmsEABCD genes induced by the anaerobic condition was not enhanced by DMSO, suggesting that DmsR is a DMSO-responsive regulator. Transcriptions of the dmsR and mgd genes for Mo-bisMGD biosynthesis were regulated in the same manner as the dmsEABCD genes. These results suggest that the genetic regulation of DMSO respiration in H. volcanii is controlled by at least two systems: one is the DMSO-responsive DmsR, and the other is an unknown anaerobic regulator.

Differentially expressed regulatory genes in honey bee caste development

NASA Astrophysics Data System (ADS)

Hepperle, C.; Hartfelder, K.

2001-03-01

In the honey bee, an eminently fertile queen with up to 200 ovarioles per ovary monopolizes colony level reproduction. In contrast, worker bees have only few ovarioles and are essentially sterile. This phenotype divergence is a result of caste-specifically modulated juvenile hormone and ecdysteroid titers in larval development. In this study we employed a differential-display reverse transcription (DDRT)-PCR protocol to detect ecdysteroid-regulated gene expression during a critical phase of caste development. We identified a Ftz-F1 homolog and a Cut-like transcript. Ftz-F1 could be a putative element of the metamorphic ecdysone response cascade of bees, whereas Cut-like proteins are described as transcription factors involved in maintaining cellular differentiation states. The downregulation of both factors can be interpreted as steps in the metamorphic degradation of ovarioles in worker-bee ovaries.

Carbon repression of cellobiose dehydrogenase production in the white rot fungus Trametes versicolor is mediated at the level of gene transcription.

PubMed

Stapleton, P C; Dobson, A D W

2003-04-25

Cellobiose dehydrogenase (CDH) production in Trametes versicolor is induced in the presence of cellulose, but decreases when additional carbon sources such as glucose and maltose are added to the fungal cultures. Using T. versicolor-specific cdh primers in a reverse transcription-polymerase chain reaction-based approach, it appears that this repression in CDH production is being mediated at the level of gene transcription. When a 1.6-kb upstream region of the T. versicolor cdh gene was cloned and sequenced, a number of putative CreA-like binding sites were observed. We propose that these sites may be involved in mediating this repressive effect, based on their similarity to the consensus [5'-SYGGRGG-3'] site for binding of the CreA and Cre1 repressor proteins.

Interplay between cardiac transcription factors and non-coding RNAs in predisposing to atrial fibrillation.

PubMed

Mikhailov, Alexander T; Torrado, Mario

2018-05-12

There is growing evidence that putative gene regulatory networks including cardio-enriched transcription factors, such as PITX2, TBX5, ZFHX3, and SHOX2, and their effector/target genes along with downstream non-coding RNAs can play a potentially important role in the process of adaptive and maladaptive atrial rhythm remodeling. In turn, expression of atrial fibrillation-associated transcription factors is under the control of upstream regulatory non-coding RNAs. This review broadly explores gene regulatory mechanisms associated with susceptibility to atrial fibrillation-with key examples from both animal models and patients-within the context of both cardiac transcription factors and non-coding RNAs. These two systems appear to have multiple levels of cross-regulation and act coordinately to achieve effective control of atrial rhythm effector gene expression. Perturbations of a dynamic expression balance between transcription factors and corresponding non-coding RNAs can provoke the development or promote the progression of atrial fibrillation. We also outline deficiencies in current models and discuss ongoing studies to clarify remaining mechanistic questions. An understanding of the function of transcription factors and non-coding RNAs in gene regulatory networks associated with atrial fibrillation risk will enable the development of innovative therapeutic strategies.

In vitro transcription activities of Pol IV, Pol V and RDR2 reveal coupling of Pol IV and RDR2 for dsRNA synthesis in plant RNA silencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haag, Jeremy R.; Ream, Thomas S.; Marasco, Michelle

2012-12-14

In Arabidopsis, RNA-dependent DNA methylation and transcriptional silencing involves three nuclear RNA polymerases that are biochemically undefined: the presumptive DNA-dependent RNA polymerases, Pol IV and Pol V and the putative RNA-dependent RNA polymerase, RDR2. Here, we demonstrate their RNA polymerase activities in vitro. Unlike Pol II, Pols IV and V require an RNA primer, are insensitive to alpha-amanitin and differ in their ability to displace non-template DNA during transcription. Biogenesis of 24 nt small interfering RNAs (siRNAs) requires both Pol IV and RDR2, which physically associate in vivo. Pol IV does not require RDR2 for activity, but RDR2 is nonfunctionalmore » in the absence of associated Pol IV, suggesting that their coupling explains the channeling of Pol IV transcripts into double-stranded RNAs that are then diced into 24 nt siRNAs.« less

Genomic identification of direct target genes of LEAFY

PubMed Central

William, Dilusha A.; Su, Yanhui; Smith, Michael R.; Lu, Meina; Baldwin, Don A.; Wagner, Doris

2004-01-01

The switch from vegetative to reproductive development in plants necessitates a switch in the developmental program of the descendents of the stem cells in the shoot apical meristem. Genetic and molecular investigations have demonstrated that the plant-specific transcription factor and meristem identity regulator LEAFY (LFY) controls this developmental transition by inducing expression of a second transcription factor, APETALA1, and by regulating the expression of additional, as yet unknown, genes. Here we show that the additional LFY targets include the APETALA1-related factor, CAULI-FLOWER, as well as three transcription factors and two putative signal transduction pathway components. These genes are up-regulated by LFY even when protein synthesis is inhibited and, hence, appear to be direct targets of LFY. Supporting this conclusion, cis-regulatory regions upstream of these genes are bound by LFY in vivo. The newly identified LFY targets likely initiate the transcriptional changes that are required for the switch from vegetative to reproductive development in Arabidopsis. PMID:14736918

Identification of the WBSCR9 gene, encoding a novel transcriptional regulator, in the Williams-Beuren syndrome deletion at 7q11.23.

PubMed

Peoples, R J; Cisco, M J; Kaplan, P; Francke, U

1998-01-01

We have identified a novel gene (WBSCR9) within the common Williams-Beuren syndrome (WBS) deletion by interspecies sequence conservation. The WBSCR9 gene encodes a roughly 7-kb transcript with an open reading frame of 1483 amino acids and a predicted protein product size of 170.8 kDa. WBSCR9 is comprised of at least 20 exons extending over 60 kb. The transcript is expressed ubiquitously throughout development and is subject to alternative splicing. Functional motifs identified by sequence homology searches include a bromodomain; a PHD, or C4HC3, finger; several putative nuclear localization signals; four nuclear receptor binding motifs; a polyglutamate stretch and two PEST sequences. Bromodomains, PHD motifs and nuclear receptor binding motifs are cardinal features of proteins that are involved in chromatin remodeling and modulation of transcription. Haploinsufficiency for WBSCR9 gene products may contribute to the complex phenotype of WBS by interacting with tissue-specific regulatory factors during development.

Direct transcriptional activation of BT genes by NLP transcription factors is a key component of the nitrate response in Arabidopsis.

PubMed

Sato, Takeo; Maekawa, Shugo; Konishi, Mineko; Yoshioka, Nozomi; Sasaki, Yuki; Maeda, Haruna; Ishida, Tetsuya; Kato, Yuki; Yamaguchi, Junji; Yanagisawa, Shuichi

2017-01-29

Nitrate modulates growth and development, functioning as a nutrient signal in plants. Although many changes in physiological processes in response to nitrate have been well characterized as nitrate responses, the molecular mechanisms underlying the nitrate response are not yet fully understood. Here, we show that NLP transcription factors, which are key regulators of the nitrate response, directly activate the nitrate-inducible expression of BT1 and BT2 encoding putative scaffold proteins with a plant-specific domain structure in Arabidopsis. Interestingly, the 35S promoter-driven expression of BT2 partially rescued growth inhibition caused by reductions in NLP activity in Arabidopsis. Furthermore, simultaneous disruption of BT1 and BT2 affected nitrate-dependent lateral root development. These results suggest that direct activation of BT1 and BT2 by NLP transcriptional activators is a key component of the molecular mechanism underlying the nitrate response in Arabidopsis. Copyright © 2016 Elsevier Inc. All rights reserved.

Potential Regulators Driving the Transition in Nonalcoholic Fatty Liver Disease: a Stage-Based View.

PubMed

Lou, Yi; Chen, Yi-Dan; Sun, Fu-Rong; Shi, Jun-Ping; Song, Yu; Yang, Jin

2017-01-01

The incidence of nonalcoholic fatty liver disease (NAFLD), ranging from mild steatosis to hepatocellular injury and inflammation, increases with the rise of obesity. However, the implications of transcription factors network in progressive NAFLD remain to be determined. A co-regulatory network approach by combining gene expression and transcription influence was utilized to dissect transcriptional regulators in different NAFLD stages. In vivo, mice models of NAFLD were used to investigate whether dysregulated expression be undertaken by transcriptional regulators. Through constructing a large-scale co-regulatory network, sample-specific regulator activity was estimated. The combinations of active regulators that drive the progression of NAFLD were identified. Next, top regulators in each stage of NAFLD were determined, and the results were validated using the different experiments and bariatric surgical samples. In particular, Adipocyte enhancer-binding protein 1 (AEBP1) showed increased transcription activity in nonalcoholic steatohepatitis (NASH). Further characterization of the AEBP1 related transcription program defined its co-regulators, targeted genes, and functional organization. The dynamics of AEBP1 and its potential targets were verified in an animal model of NAFLD. This study identifies putative functions for several transcription factors in the pathogenesis of NAFLD and may thus point to potential targets for therapeutic interventions. © 2017 The Author(s) Published by S. Karger AG, Basel.

Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

PubMed

Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

2014-01-29

We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

Alternate promoter selection within a human cytomegalovirus immediate-early and early transcription unit (UL119-115) defines true late transcripts containing open reading frames for putative viral glycoproteins.

PubMed Central

Leatham, M P; Witte, P R; Stinski, M F

1991-01-01

The human cytomegalovirus open reading frames (ORFs) UL119 through UL115 (UL119-115) are located downstream of the immediate-early 1 and 2 transcription units. The promoter upstream of UL119 is active at all times after infection and drives the synthesis of a spliced 3.1-kb mRNA. The viral mRNA initiates in UL119, contains UL119-117 and UL116, and terminates just downstream of UL115. True late transcripts that are detected only after viral DNA synthesis originate from this transcription unit. True late mRNAs of 2.1 kb, containing ORFs UL116 and UL115, and 1.2 kb, containing ORF UL115 only, are synthesized. The true late viral mRNAs are 3' coterminal with the 3.1-kb mRNA. This transcription unit is an example of late promoters nested within an immediate-early-early transcription unit. The gene products of UL119-117, UL116, and UL115 are predicted to be glycoproteins. Efficient expression of the downstream ORFs at late times after infection may be related to alternate promoter usage and downstream cap site selection. Images PMID:1717716

A Novel Heat Shock Element (HSE) in Entamoeba histolytica that Regulates the Transcriptional Activation of the EhPgp5 Gene in the Presence of Emetine Drug

PubMed Central

Nieto, Alma; Pérez Ishiwara, David G.; Orozco, Esther; Sánchez Monroy, Virginia; Gómez García, Consuelo

2017-01-01

Transcriptional regulation of the multidrug resistance EhPgp5 gene in Entamoeba histolytica is induced by emetine stress. EhPgp5 overexpression alters the chloride-dependent currents that cause trophozoite swelling, diminishing induced programmed cell death (PCD) susceptibility. In contrast, antisense inhibition of P-glycoprotein (PGP) expression produces synchronous death of trophozoites and the enhancement of the biochemical and morphological characteristics of PCD induced by G418. Transcriptional gene regulation analysis identified a 59 bp region at position −170 to −111 bp promoter as putative emetine response elements (EREs). However, insights into transcription factors controlling EhPgp5 gene transcription are missing; to fill this knowledge gap, we used deletion studies and transient CAT activity assays. Our findings suggested an activating motif (−151 to −136 bp) that corresponds to a heat shock element (HSE). Gel-shift assays, UV-crosslinking, binding protein purification, and western blotting assays revealed proteins of 94, 66, 62, and 51 kDa binding to the EhPgp5 HSE that could be heat shock-like transcription factors that regulate the transcriptional activation of the EhPgp5 gene in the presence of emetine drug. PMID:29238701

RNA-seq Transcriptome Analysis of Panax japonicus, and Its Comparison with Other Panax Species to Identify Potential Genes Involved in the Saponins Biosynthesis

PubMed Central

Rai, Amit; Yamazaki, Mami; Takahashi, Hiroki; Nakamura, Michimi; Kojoma, Mareshige; Suzuki, Hideyuki; Saito, Kazuki

2016-01-01

The Panax genus has been a source of natural medicine, benefitting human health over the ages, among which the Panax japonicus represents an important species. Our understanding of several key pathways and enzymes involved in the biosynthesis of ginsenosides, a pharmacologically active class of metabolites and a major chemical constituents of the rhizome extracts from the Panax species, are limited. Limited genomic information, and lack of studies on comparative transcriptomics across the Panax species have restricted our understanding of the biosynthetic mechanisms of these and many other important classes of phytochemicals. Herein, we describe Illumina based RNA sequencing analysis to characterize the transcriptome and expression profiles of genes expressed in the five tissues of P. japonicus, and its comparison with other Panax species. RNA sequencing and de novo transcriptome assembly for P. japonicus resulted in a total of 135,235 unigenes with 78,794 (58.24%) unigenes being annotated using NCBI-nr database. Transcriptome profiling, and gene ontology enrichment analysis for five tissues of P. japonicus showed that although overall processes were evenly conserved across all tissues. However, each tissue was characterized by several unique unigenes with the leaves showing the most unique unigenes among the tissues studied. A comparative analysis of the P. japonicus transcriptome assembly with publically available transcripts from other Panax species, namely, P. ginseng, P. notoginseng, and P. quinquefolius also displayed high sequence similarity across all Panax species, with P. japonicus showing highest similarity with P. ginseng. Annotation of P. japonicus transcriptome resulted in the identification of putative genes encoding all enzymes from the triterpene backbone biosynthetic pathways, and identified 24 and 48 unigenes annotated as cytochrome P450 (CYP) and glycosyltransferases (GT), respectively. These CYPs and GTs annotated unigenes were conserved across all Panax species and co-expressed with other the transcripts involved in the triterpenoid backbone biosynthesis pathways. Unigenes identified in this study represent strong candidates for being involved in the triterpenoid saponins biosynthesis, and can serve as a basis for future validation studies. PMID:27148308

Identification of Putative Geographically Isolated Wetlands of the Conterminous United States

EPA Science Inventory

Geographically isolated wetlands (GIWs) are unique landscape features, defined as wetlands completely surrounded by uplands. Densely occurring in certain parts of the North America, GIWs include wetland types such as Prairie Potholes, Delmarva Ponds, West Coast or California Vern...

Putative subunits of the rat mesangial KATP: a type 2B sulfonylurea receptor and an inwardly rectifying K+ channel.

PubMed

Szamosfalvi, Balázs; Cortes, Pedro; Alviani, Rebecca; Asano, Kenichiro; Riser, Bruce L; Zasuwa, Gary; Yee, Jerry

2002-05-01

Sulfonylurea agents exert their physiological effects in many cell types via binding to specific sulfonylurea receptors (SUR). SUR couple to inwardly-rectifying K+ channel (Kir6.x) to form tetradimeric ATP-sensitive K+ channels (KATP). The SUR subunits confer ATP-sensitivity on KATP and also provide the binding sites for sulfonylureas and other pharmacological agents. Our previous work demonstrated that the exposure of mesangial cells (MC) to sulfonylureas generated profound effects on MC glucose uptake and matrix metabolism and induced heightened cell contractility in association with Ca2+ transients. Because these responses likely resulted from the binding of sulfonylurea to a mesangial SUR2, we subsequently documented [3H]-glibenclamide binding to MC and the gene expression of several mesangial SUR2 transcripts. From these data, we inferred that MC expressed the components of a mesangial KATP and sought to establish their presence in primary MC. To obtain mesangial SUR2 cDNA sequences, rapid amplification of cDNA ends (RACE) was utilized. DNA sequences were established by the fluorescent dye termination method. Gene expression of mesangial SUR2 and Kir6.1/2 was examined by reverse transcription polymerase chain reaction (RT-PCR) and Northern analysis. SUR2 proteins were identified by immunoblotting of mesangial proteins from membrane-enriched fractions with polyclonal antiserum directed against SUR2. RACE cloning yielded two mesangial SUR2 cDNAs of 4.8 and 6.7 kbp whose open reading frames translated proteins of 964 and 1535 aa, respectively. Using probes specific to each cDNA, the presence of a unique, 5.5 kbp serum-regulated mesangial SUR2 splice variant was established. The sequence of this mesangial SUR2 (mcSUR2B) shares identity with the recently cloned rat SUR2B (rSUR2B), but, in comparison to rSUR2B, is truncated by 12 exons at the N-terminus where it contains a unique insert of 16 aa. Immunoblotting studies with anti-SUR2 antiserum demonstrated SUR2 proteins of 108 and 170 kD in membrane-enriched fractions of MC protein extracts. Complementary studies showed abundant gene expression of Kir6.1, thereby establishing gene expression of both components of KATP. Based upon analogy to vascular smooth muscle cells (VSMC), there are at least two putative mesangial KATP that most likely represent hetero-octamers, comprised of either rSUR2B or mcSUR2 in complex with Kir6.1. Our results define the mesangial SUR2B as the possible first link in a chain of cellular events that culminates in MC contraction and altered extracellular matrix metabolism following exposure to sulfonylureas. In addition, our results serve as the basis for the future elucidation of the electrophysiologic characteristics of the mesangial KATP and the study of endogenous regulators of mesangial cell contractility.

Systematic discovery of novel eukaryotic transcriptional regulators using sequence homology independent prediction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bossi, Flavia; Fan, Jue; Xiao, Jun

Here, the molecular function of a gene is most commonly inferred by sequence similarity. Therefore, genes that lack sufficient sequence similarity to characterized genes (such as certain classes of transcriptional regulators) are difficult to classify using most function prediction algorithms and have remained uncharacterized. As a result, to identify novel transcriptional regulators systematically, we used a feature-based pipeline to screen protein families of unknown function. This method predicted 43 transcriptional regulator families in Arabidopsis thaliana, 7 families in Drosophila melanogaster, and 9 families in Homo sapiens. Literature curation validated 12 of the predicted families to be involved in transcriptional regulation.more » We tested 33 out of the 195 Arabidopsis putative transcriptional regulators for their ability to activate transcription of a reporter gene in planta and found twelve coactivators, five of which had no prior literature support. To investigate mechanisms of action in which the predicted regulators might work, we looked for interactors of an Arabidopsis candidate that did not show transactivation activity in planta and found that it might work with other members of its own family and a subunit of the Polycomb Repressive Complex 2 to regulate transcription. Our results demonstrate the feasibility of assigning molecular function to proteins of unknown function without depending on sequence similarity. In particular, we identified novel transcriptional regulators using biological features enriched in transcription factors. The predictions reported here should accelerate the characterization of novel regulators.« less

Systematic discovery of novel eukaryotic transcriptional regulators using sequence homology independent prediction

DOE PAGES

Bossi, Flavia; Fan, Jue; Xiao, Jun; ...

2017-06-26

Here, the molecular function of a gene is most commonly inferred by sequence similarity. Therefore, genes that lack sufficient sequence similarity to characterized genes (such as certain classes of transcriptional regulators) are difficult to classify using most function prediction algorithms and have remained uncharacterized. As a result, to identify novel transcriptional regulators systematically, we used a feature-based pipeline to screen protein families of unknown function. This method predicted 43 transcriptional regulator families in Arabidopsis thaliana, 7 families in Drosophila melanogaster, and 9 families in Homo sapiens. Literature curation validated 12 of the predicted families to be involved in transcriptional regulation.more » We tested 33 out of the 195 Arabidopsis putative transcriptional regulators for their ability to activate transcription of a reporter gene in planta and found twelve coactivators, five of which had no prior literature support. To investigate mechanisms of action in which the predicted regulators might work, we looked for interactors of an Arabidopsis candidate that did not show transactivation activity in planta and found that it might work with other members of its own family and a subunit of the Polycomb Repressive Complex 2 to regulate transcription. Our results demonstrate the feasibility of assigning molecular function to proteins of unknown function without depending on sequence similarity. In particular, we identified novel transcriptional regulators using biological features enriched in transcription factors. The predictions reported here should accelerate the characterization of novel regulators.« less

Open chromatin encoded in DNA sequence is the signature of ‘master’ replication origins in human cells

PubMed Central

Audit, Benjamin; Zaghloul, Lamia; Vaillant, Cédric; Chevereau, Guillaume; d'Aubenton-Carafa, Yves; Thermes, Claude; Arneodo, Alain

2009-01-01

For years, progress in elucidating the mechanisms underlying replication initiation and its coupling to transcriptional activities and to local chromatin structure has been hampered by the small number (approximately 30) of well-established origins in the human genome and more generally in mammalian genomes. Recent in silico studies of compositional strand asymmetries revealed a high level of organization of human genes around 1000 putative replication origins. Here, by comparing with recently experimentally identified replication origins, we provide further support that these putative origins are active in vivo. We show that regions ∼300-kb wide surrounding most of these putative replication origins that replicate early in the S phase are hypersensitive to DNase I cleavage, hypomethylated and present a significant enrichment in genomic energy barriers that impair nucleosome formation (nucleosome-free regions). This suggests that these putative replication origins are specified by an open chromatin structure favored by the DNA sequence. We discuss how this distinctive attribute makes these origins, further qualified as ‘master’ replication origins, priviledged loci for future research to decipher the human spatio-temporal replication program. Finally, we argue that these ‘master’ origins are likely to play a key role in genome dynamics during evolution and in pathological situations. PMID:19671527

Investigating the Relatedness of Enteroinvasive Escherichia coli to Other E. coli and Shigella Isolates by Using Comparative Genomics

PubMed Central

Hazen, Tracy H.; Leonard, Susan R.; Lampel, Keith A.; Lacher, David W.

2016-01-01

Enteroinvasive Escherichia coli (EIEC) is a unique pathovar that has a pathogenic mechanism nearly indistinguishable from that of Shigella species. In contrast to isolates of the four Shigella species, which are widespread and can be frequent causes of human illness, EIEC causes far fewer reported illnesses each year. In this study, we analyzed the genome sequences of 20 EIEC isolates, including 14 first described in this study. Phylogenomic analysis of the EIEC genomes demonstrated that 17 of the isolates are present in three distinct lineages that contained only EIEC genomes, compared to reference genomes from each of the E. coli pathovars and Shigella species. Comparative genomic analysis identified genes that were unique to each of the three identified EIEC lineages. While many of the EIEC lineage-specific genes have unknown functions, those with predicted functions included a colicin and putative proteins involved in transcriptional regulation or carbohydrate metabolism. In silico detection of the Shigella virulence plasmid (pINV), which is essential for the invasion of host cells, demonstrated that a form of pINV was present in nearly all EIEC genomes, but the Mxi-Spa-Ipa region of the plasmid that encodes the invasion-associated proteins was absent from several of the EIEC isolates. The comparative genomic findings in this study support the hypothesis that multiple EIEC lineages have evolved independently from multiple distinct lineages of E. coli via the acquisition of the Shigella virulence plasmid and, in some cases, the Shigella pathogenicity islands. PMID:27271741

Investigating the Relatedness of Enteroinvasive Escherichia coli to Other E. coli and Shigella Isolates by Using Comparative Genomics.

PubMed

Hazen, Tracy H; Leonard, Susan R; Lampel, Keith A; Lacher, David W; Maurelli, Anthony T; Rasko, David A

2016-08-01

Enteroinvasive Escherichia coli (EIEC) is a unique pathovar that has a pathogenic mechanism nearly indistinguishable from that of Shigella species. In contrast to isolates of the four Shigella species, which are widespread and can be frequent causes of human illness, EIEC causes far fewer reported illnesses each year. In this study, we analyzed the genome sequences of 20 EIEC isolates, including 14 first described in this study. Phylogenomic analysis of the EIEC genomes demonstrated that 17 of the isolates are present in three distinct lineages that contained only EIEC genomes, compared to reference genomes from each of the E. coli pathovars and Shigella species. Comparative genomic analysis identified genes that were unique to each of the three identified EIEC lineages. While many of the EIEC lineage-specific genes have unknown functions, those with predicted functions included a colicin and putative proteins involved in transcriptional regulation or carbohydrate metabolism. In silico detection of the Shigella virulence plasmid (pINV), which is essential for the invasion of host cells, demonstrated that a form of pINV was present in nearly all EIEC genomes, but the Mxi-Spa-Ipa region of the plasmid that encodes the invasion-associated proteins was absent from several of the EIEC isolates. The comparative genomic findings in this study support the hypothesis that multiple EIEC lineages have evolved independently from multiple distinct lineages of E. coli via the acquisition of the Shigella virulence plasmid and, in some cases, the Shigella pathogenicity islands. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

PigZ, a TetR/AcrR family repressor, modulates secondary metabolism via the expression of a putative four-component resistance-nodulation-cell-division efflux pump, ZrpADBC, in Serratia sp. ATCC 39006.

PubMed

Gristwood, Tamzin; Fineran, Peter C; Everson, Lee; Salmond, George P C

2008-07-01

The Gram-negative enterobacterium, Serratia sp. ATCC 39006 synthesizes several secondary metabolites, including prodigiosin (Pig) and a carbapenem antibiotic (Car). A complex hierarchical network of regulatory proteins control Pig and Car production. In this study we characterize a TetR family regulator, PigZ, which represses transcription of a divergently transcribed putative resistance-nodulation-cell-division (RND) efflux pump, encoded by zrp (PigZ repressed pump) ADBC, via direct binding to the zrpA-pigZ intergenic region. Unusually, this putative RND pump contains two predicted membrane fusion proteins (MFPs), ZrpA and ZrpD. A mutation in pigZ resulted in multiple phenotypic changes, including exoenzyme production, motility and differential regulation of Pig and Car production. A polar suppressor mutation, within zrpA, restored all tested phenotypes to parental strain levels, indicating that the changes observed are due to the increase in expression of ZrpADBC in the absence of the repressor, PigZ. Genomic deletions of zrpA and zrpD indicate that the MFP ZrpD, but not ZrpA, is essential for activity of the putative pump. Bioinformatic analysis revealed that putative RND efflux pumps encoding two MFP components are not uncommon, particularly among plant-associated, Gram-negative bacteria. In addition, based on phylogenetic analysis, we propose that these pairs of MFPs consist of two distinct subtypes.

Putative Porin of Bradyrhizobium sp. (Lupinus) Bacteroids Induced by Glyphosate▿

PubMed Central

de María, Nuria; Guevara, Ángeles; Serra, M. Teresa; García-Luque, Isabel; González-Sama, Alfonso; de Lacoba, Mario García; de Felipe, M. Rosario; Fernández-Pascual, Mercedes

2007-01-01

Application of glyphosate (N-[phosphonomethyl] glycine) to Bradyrhizobium sp. (Lupinus)-nodulated lupin plants caused modifications in the protein pattern of bacteroids. The most significant change was the presence of a 44-kDa polypeptide in bacteroids from plants treated with the higher doses of glyphosate employed (5 and 10 mM). The polypeptide has been characterized by the amino acid sequencing of its N terminus and the isolation and nucleic acid sequencing of its encoding gene. It is putatively encoded by a single gene, and the protein has been identified as a putative porin. Protein modeling revealed the existence of several domains sharing similarity to different porins, such as a transmembrane beta-barrel. The protein has been designated BLpp, for Bradyrhizobium sp. (Lupinus) putative porin, and would be the first porin described in Bradyrhizobium sp. (Lupinus). In addition, a putative conserved domain of porins has been identified which consists of 87 amino acids, located in the BLpp sequence 30 amino acids downstream of the N-terminal region. In bacteroids, mRNA of the BLpp gene shows a basal constitutive expression that increases under glyphosate treatment, and the expression of the gene is seemingly regulated at the transcriptional level. By contrast, in free-living bacteria glyphosate treatment leads to an inhibition of BLpp mRNA accumulation, indicating a different effect of glyphosate on BLpp gene expression in bacteroids and free-living bacteria. The possible role of BLpp in a metabolite interchange between Bradyrhizobium and lupin is discussed. PMID:17557843

Identification of a functionally distinct truncated BDNF mRNA splice variant and protein in Trachemys scripta elegans.

PubMed

Ambigapathy, Ganesh; Zheng, Zhaoqing; Li, Wei; Keifer, Joyce

2013-01-01

Brain-derived neurotrophic factor (BDNF) has a diverse functional role and complex pattern of gene expression. Alternative splicing of mRNA transcripts leads to further diversity of mRNAs and protein isoforms. Here, we describe the regulation of BDNF mRNA transcripts in an in vitro model of eyeblink classical conditioning and a unique transcript that forms a functionally distinct truncated BDNF protein isoform. Nine different mRNA transcripts from the BDNF gene of the pond turtle Trachemys scripta elegans (tBDNF) are selectively regulated during classical conditioning: exon I mRNA transcripts show no change, exon II transcripts are downregulated, while exon III transcripts are upregulated. One unique transcript that codes from exon II, tBDNF2a, contains a 40 base pair deletion in the protein coding exon that generates a truncated tBDNF protein. The truncated transcript and protein are expressed in the naïve untrained state and are fully repressed during conditioning when full-length mature tBDNF is expressed, thereby having an alternate pattern of expression in conditioning. Truncated BDNF is not restricted to turtles as a truncated mRNA splice variant has been described for the human BDNF gene. Further studies are required to determine the ubiquity of truncated BDNF alternative splice variants across species and the mechanisms of regulation and function of this newly recognized BDNF protein.

Identification of a Functionally Distinct Truncated BDNF mRNA Splice Variant and Protein in Trachemys scripta elegans

PubMed Central

Ambigapathy, Ganesh; Zheng, Zhaoqing; Li, Wei; Keifer, Joyce

2013-01-01

Brain-derived neurotrophic factor (BDNF) has a diverse functional role and complex pattern of gene expression. Alternative splicing of mRNA transcripts leads to further diversity of mRNAs and protein isoforms. Here, we describe the regulation of BDNF mRNA transcripts in an in vitro model of eyeblink classical conditioning and a unique transcript that forms a functionally distinct truncated BDNF protein isoform. Nine different mRNA transcripts from the BDNF gene of the pond turtle Trachemys scripta elegans (tBDNF) are selectively regulated during classical conditioning: exon I mRNA transcripts show no change, exon II transcripts are downregulated, while exon III transcripts are upregulated. One unique transcript that codes from exon II, tBDNF2a, contains a 40 base pair deletion in the protein coding exon that generates a truncated tBDNF protein. The truncated transcript and protein are expressed in the naïve untrained state and are fully repressed during conditioning when full-length mature tBDNF is expressed, thereby having an alternate pattern of expression in conditioning. Truncated BDNF is not restricted to turtles as a truncated mRNA splice variant has been described for the human BDNF gene. Further studies are required to determine the ubiquity of truncated BDNF alternative splice variants across species and the mechanisms of regulation and function of this newly recognized BDNF protein. PMID:23825634

DNase I nick translation in situ on meiotic chromosomes of the mouse, Mus musculus.

PubMed

Raman, R; Singh, A P; Nanda, I

1988-08-01

DNase-I-sensitive sites have been located on the meiotic chromosomes of the mouse, Mus musculus, by the in situ DNase I nick-translation method. We find that: (1) of all the cell types studied, pachytene nuclei are the most sensitive to DNase I; (2) in diplotene the nicks occur preferentially in the vicinity of chiasmata; (3) the sex chromosomes are also sensitive to the enzyme despite their transcriptional quiescence; and (4) in the sex bivalent the nicks are primarily observed in the putative region of recombination. We conclude that, in addition to discriminating between the transcriptionally active and inactive states of chromatin, DNase I identifies recombination-specific chromatin changes in meiotic prophase.

Putative SF2 helicases of the early-branching eukaryote Giardia lamblia are involved in antigenic variation and parasite differentiation into cysts

PubMed Central

2012-01-01

Background Regulation of surface antigenic variation in Giardia lamblia is controlled post-transcriptionally by an RNA-interference (RNAi) pathway that includes a Dicer-like bidentate RNase III (gDicer). This enzyme, however, lacks the RNA helicase domain present in Dicer enzymes from higher eukaryotes. The participation of several RNA helicases in practically all organisms in which RNAi was studied suggests that RNA helicases are potentially involved in antigenic variation, as well as during Giardia differentiation into cysts. Results An extensive in silico analysis of the Giardia genome identified 32 putative Super Family 2 RNA helicases that contain almost all the conserved RNA helicase motifs. Phylogenetic studies and sequence analysis separated them into 22 DEAD-box, 6 DEAH-box and 4 Ski2p-box RNA helicases, some of which are homologs of well-characterized helicases from higher organisms. No Giardia putative helicase was found to have significant homology to the RNA helicase domain of Dicer enzymes. Additionally a series of up- and down-regulated putative RNA helicases were found during encystation and antigenic variation by qPCR experiments. Finally, we were able to recognize 14 additional putative helicases from three different families (RecQ family, Swi2/Snf2 and Rad3 family) that could be considered DNA helicases. Conclusions This is the first comprehensive analysis of the Super Family 2 helicases from the human intestinal parasite G. lamblia. The relative and variable expression of particular RNA helicases during both antigenic variation and encystation agrees with the proposed participation of these enzymes during both adaptive processes. The putatives RNA and DNA helicases identified in this early-branching eukaryote provide initial information regarding the biological role of these enzymes in cell adaptation and differentiation. PMID:23190735

Identification and Characterization of Long Non-Coding RNAs Related to Mouse Embryonic Brain Development from Available Transcriptomic Data

PubMed Central

He, Hongjuan; Xiu, Youcheng; Guo, Jing; Liu, Hui; Liu, Qi; Zeng, Tiebo; Chen, Yan; Zhang, Yan; Wu, Qiong

2013-01-01

Long non-coding RNAs (lncRNAs) as a key group of non-coding RNAs have gained widely attention. Though lncRNAs have been functionally annotated and systematic explored in higher mammals, few are under systematical identification and annotation. Owing to the expression specificity, known lncRNAs expressed in embryonic brain tissues remain still limited. Considering a large number of lncRNAs are only transcribed in brain tissues, studies of lncRNAs in developmental brain are therefore of special interest. Here, publicly available RNA-sequencing (RNA-seq) data in embryonic brain are integrated to identify thousands of embryonic brain lncRNAs by a customized pipeline. A significant proportion of novel transcripts have not been annotated by available genomic resources. The putative embryonic brain lncRNAs are shorter in length, less spliced and show less conservation than known genes. The expression of putative lncRNAs is in one tenth on average of known coding genes, while comparable with known lncRNAs. From chromatin data, putative embryonic brain lncRNAs are associated with active chromatin marks, comparable with known lncRNAs. Embryonic brain expressed lncRNAs are also indicated to have expression though not evident in adult brain. Gene Ontology analysis of putative embryonic brain lncRNAs suggests that they are associated with brain development. The putative lncRNAs are shown to be related to possible cis-regulatory roles in imprinting even themselves are deemed to be imprinted lncRNAs. Re-analysis of one knockdown data suggests that four regulators are associated with lncRNAs. Taken together, the identification and systematic analysis of putative lncRNAs would provide novel insights into uncharacterized mouse non-coding regions and the relationships with mammalian embryonic brain development. PMID:23967161

Epigenetics, chromatin and genome organization: recent advances from the ENCODE project.

PubMed

Siggens, L; Ekwall, K

2014-09-01

The organization of the genome into functional units, such as enhancers and active or repressed promoters, is associated with distinct patterns of DNA and histone modifications. The Encyclopedia of DNA Elements (ENCODE) project has advanced our understanding of the principles of genome, epigenome and chromatin organization, identifying hundreds of thousands of potential regulatory regions and transcription factor binding sites. Part of the ENCODE consortium, GENCODE, has annotated the human genome with novel transcripts including new noncoding RNAs and pseudogenes, highlighting transcriptional complexity. Many disease variants identified in genome-wide association studies are located within putative enhancer regions defined by the ENCODE project. Understanding the principles of chromatin and epigenome organization will help to identify new disease mechanisms, biomarkers and drug targets, particularly as ongoing epigenome mapping projects generate data for primary human cell types that play important roles in disease. © 2014 The Association for the Publication of the Journal of Internal Medicine.

Sugar regulation of SUGAR TRANSPORTER PROTEIN 1 (STP1) expression in Arabidopsis thaliana

PubMed Central

Cordoba, Elizabeth; Aceves-Zamudio, Denise Lizeth; Hernández-Bernal, Alma Fabiola; Ramos-Vega, Maricela; León, Patricia

2015-01-01

Sugars regulate the expression of many genes at the transcriptional level. In Arabidopsis thaliana, sugars induce or repress the expression of >1800 genes, including the STP1 (SUGAR TRANSPORTER PROTEIN 1) gene, which encodes an H+/monosaccharide cotransporter. STP1 transcript levels decrease more rapidly after the addition of low concentrations of sugars than the levels of other repressed genes, such as DIN6 (DARK-INDUCED 6). We found that this regulation is exerted at the transcriptional level and is initiated by phosphorylatable sugars. Interestingly, the sugar signal that modulates STP1 expression is transmitted through a HEXOKINASE 1-independent signalling pathway. Finally, analysis of the STP1 5′ regulatory region allowed us to delimit a region of 309bp that contains the cis elements implicated in the glucose regulation of STP1 expression. Putative cis-acting elements involved in this response were identified. PMID:25281700

Fluconazole Resistance Associated with Drug Efflux and Increased Transcription of a Drug Transporter Gene, PDH1, in Candida glabrata

PubMed Central

Miyazaki, Haruko; Miyazaki, Yoshitsugu; Geber, Antonia; Parkinson, Tanya; Hitchcock, Christopher; Falconer, Derek J.; Ward, Douglas J.; Marsden, Katherine; Bennett, John E.

1998-01-01

Sequential Candida glabrata isolates were obtained from the mouth of a patient infected with human immunodeficiency virus type 1 who was receiving high doses of fluconazole for oropharyngeal thrush. Fluconazole-susceptible colonies were replaced by resistant colonies that exhibited both increased fluconazole efflux and increased transcripts of a gene which codes for a protein with 72.5% identity to Pdr5p, an ABC multidrug transporter in Saccharomyces cerevisiae. The deduced protein had a molecular mass of 175 kDa and was composed of two homologous halves, each with six putative transmembrane domains and highly conserved sequences of ATP-binding domains. When the earliest and most azole-susceptible isolate of C. glabrata from this patient was exposed to fluconazole, increased transcripts of the PDR5 homolog appeared, linking azole exposure to regulation of this gene. PMID:9661006

RNA-Seq Transcriptome Profiling of Upland Cotton (Gossypium hirsutum L.) Root Tissue under Water-Deficit Stress

PubMed Central

Bowman, Megan J.; Park, Wonkeun; Bauer, Philip J.; Udall, Joshua A.; Page, Justin T.; Raney, Joshua; Scheffler, Brian E.; Jones, Don. C.; Campbell, B. Todd

2013-01-01

An RNA-Seq experiment was performed using field grown well-watered and naturally rain fed cotton plants to identify differentially expressed transcripts under water-deficit stress. Our work constitutes the first application of the newly published diploid D5 Gossypium raimondii sequence in the study of tetraploid AD1 upland cotton RNA-seq transcriptome analysis. A total of 1,530 transcripts were differentially expressed between well-watered and water-deficit stressed root tissues, in patterns that confirm the accuracy of this technique for future studies in cotton genomics. Additionally, putative sequence based genome localization of differentially expressed transcripts detected A2 genome specific gene expression under water-deficit stress. These data will facilitate efforts to understand the complex responses governing transcriptomic regulatory mechanisms and to identify candidate genes that may benefit applied plant breeding programs. PMID:24324815

Metatranscriptomic analysis of a high-sulfide aquatic spring reveals insights into sulfur cycling and unexpected aerobic metabolism

PubMed Central

Elshahed, Mostafa S.; Najar, Fares Z.; Krumholz, Lee R.

2015-01-01

Zodletone spring is a sulfide-rich spring in southwestern Oklahoma characterized by shallow, microoxic, light-exposed spring water overlaying anoxic sediments. Previously, culture-independent 16S rRNA gene based diversity surveys have revealed that Zodletone spring source sediments harbor a highly diverse microbial community, with multiple lineages putatively involved in various sulfur-cycling processes. Here, we conducted a metatranscriptomic survey of microbial populations in Zodletone spring source sediments to characterize the relative prevalence and importance of putative phototrophic, chemolithotrophic, and heterotrophic microorganisms in the sulfur cycle, the identity of lineages actively involved in various sulfur cycling processes, and the interaction between sulfur cycling and other geochemical processes at the spring source. Sediment samples at the spring’s source were taken at three different times within a 24-h period for geochemical analyses and RNA sequencing. In depth mining of datasets for sulfur cycling transcripts revealed major sulfur cycling pathways and taxa involved, including an unexpected potential role of Actinobacteria in sulfide oxidation and thiosulfate transformation. Surprisingly, transcripts coding for the cyanobacterial Photosystem II D1 protein, methane monooxygenase, and terminal cytochrome oxidases were encountered, indicating that genes for oxygen production and aerobic modes of metabolism are actively being transcribed, despite below-detectable levels (<1 µM) of oxygen in source sediment. Results highlight transcripts involved in sulfur, methane, and oxygen cycles, propose that oxygenic photosynthesis could support aerobic methane and sulfide oxidation in anoxic sediments exposed to sunlight, and provide a viewpoint of microbial metabolic lifestyles under conditions similar to those seen during late Archaean and Proterozoic eons. PMID:26417542

Genome-wide organization and expression profiling of the NAC transcription factor family in potato (Solanum tuberosum L.).

PubMed

Singh, Anil Kumar; Sharma, Vishal; Pal, Awadhesh Kumar; Acharya, Vishal; Ahuja, Paramvir Singh

2013-08-01

NAC [no apical meristem (NAM), Arabidopsis thaliana transcription activation factor [ATAF1/2] and cup-shaped cotyledon (CUC2)] proteins belong to one of the largest plant-specific transcription factor (TF) families and play important roles in plant development processes, response to biotic and abiotic cues and hormone signalling. Our genome-wide analysis identified 110 StNAC genes in potato encoding for 136 proteins, including 14 membrane-bound TFs. The physical map positions of StNAC genes on 12 potato chromosomes were non-random, and 40 genes were found to be distributed in 16 clusters. The StNAC proteins were phylogenetically clustered into 12 subgroups. Phylogenetic analysis of StNACs along with their Arabidopsis and rice counterparts divided these proteins into 18 subgroups. Our comparative analysis has also identified 36 putative TNAC proteins, which appear to be restricted to Solanaceae family. In silico expression analysis, using Illumina RNA-seq transcriptome data, revealed tissue-specific, biotic, abiotic stress and hormone-responsive expression profile of StNAC genes. Several StNAC genes, including StNAC072 and StNAC101that are orthologs of known stress-responsive Arabidopsis RESPONSIVE TO DEHYDRATION 26 (RD26) were identified as highly abiotic stress responsive. Quantitative real-time polymerase chain reaction analysis largely corroborated the expression profile of StNAC genes as revealed by the RNA-seq data. Taken together, this analysis indicates towards putative functions of several StNAC TFs, which will provide blue-print for their functional characterization and utilization in potato improvement.

Mapping and mutagenesis of the amino-terminal transcriptional repression domain of the Drosophila Krüppel protein.

PubMed Central

Licht, J D; Hanna-Rose, W; Reddy, J C; English, M A; Ro, M; Grossel, M; Shaknovich, R; Hansen, U

1994-01-01

We previously demonstrated that the Drosophila Krüppel protein is a transcriptional repressor with separable DNA-binding and transcriptional repression activities. In this study, the minimal amino (N)-terminal repression region of the Krüppel protein was defined by transferring regions of the Krüppel protein to a heterologous DNA-binding protein, the lacI protein. Fusion of a predicted alpha-helical region from amino acids 62 to 92 in the N terminus of the Krüppel protein was sufficient to transfer repression activity. This putative alpha-helix has several hydrophobic surfaces, as well as a glutamine-rich surface. Mutants containing multiple amino acid substitutions of the glutamine residues demonstrated that this putative alpha-helical region is essential for repression activity of a Krüppel protein containing the entire N-terminal and DNA-binding regions. Furthermore, one point mutant with only a single glutamine on this surface altered to lysine abolished the ability of the Krüppel protein to repress, indicating the importance of the amino acid at residue 86 for repression. The N terminus also contained an adjacent activation region localized between amino acids 86 and 117. Finally, in accordance with predictions from primary amino acid sequence similarity, a repression region from the Drosophila even-skipped protein, which was six times more potent than that of the Krüppel protein in the mammalian cells, was characterized. This segment included a hydrophobic stretch of 11 consecutive alanine residues and a proline-rich region. Images PMID:8196644

Identification and Analyses of AUX-IAA target genes controlling multiple pathways in developing fiber cells of Gossypium hirsutum L

PubMed Central

Nigam, Deepti; Sawant, Samir V

2013-01-01

Technological development led to an increased interest in systems biological approaches in plants to characterize developmental mechanism and candidate genes relevant to specific tissue or cell morphology. AUX-IAA proteins are important plant-specific putative transcription factors. There are several reports on physiological response of this family in Arabidopsis but in cotton fiber the transcriptional network through which AUX-IAA regulated its target genes is still unknown. in-silico modelling of cotton fiber development specific gene expression data (108 microarrays and 22,737 genes) using Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNe) reveals 3690 putative AUX-IAA target genes of which 139 genes were known to be AUX-IAA co-regulated within Arabidopsis. Further AUX-IAA targeted gene regulatory network (GRN) had substantial impact on the transcriptional dynamics of cotton fiber, as showed by, altered TF networks, and Gene Ontology (GO) biological processes and metabolic pathway associated with its target genes. Analysis of the AUX-IAA-correlated gene network reveals multiple functions for AUX-IAA target genes such as unidimensional cell growth, cellular nitrogen compound metabolic process, nucleosome organization, DNA-protein complex and process related to cell wall. These candidate networks/pathways have a variety of profound impacts on such cellular functions as stress response, cell proliferation, and cell differentiation. While these functions are fairly broad, their underlying TF networks may provide a global view of AUX-IAA regulated gene expression and a GRN that guides future studies in understanding role of AUX-IAA box protein and its targets regulating fiber development. PMID:24497725

Gene silencing reveals multiple functions of Na+/K+-ATPase in the salmon louse (Lepeophtheirus salmonis).

PubMed

Komisarczuk, Anna Z; Kongshaug, Heidi; Nilsen, Frank

2018-02-01

Na + /K + -ATPase has a key function in a variety of physiological processes including membrane excitability, osmoregulation, regulation of cell volume, and transport of nutrients. While knowledge about Na + /K + -ATPase function in osmoregulation in crustaceans is extensive, the role of this enzyme in other physiological and developmental processes is scarce. Here, we report characterization, transcriptional distribution and likely functions of the newly identified L. salmonis Na + /K + -ATPase (LsalNa + /K + -ATPase) α subunit in various developmental stages. The complete mRNA sequence was identified, with 3003 bp open reading frame encoding a putative protein of 1001 amino acids. Putative protein sequence of LsalNa + /K + -ATPase revealed all typical features of Na + /K + -ATPase and demonstrated high sequence identity to other invertebrate and vertebrate species. Quantitative RT-PCR analysis revealed higher LsalNa + /K + -ATPase transcript level in free-living stages in comparison to parasitic stages. In situ hybridization analysis of copepodids and adult lice revealed LsalNa + /K + -ATPase transcript localization in a wide variety of tissues such as nervous system, intestine, reproductive system, and subcuticular and glandular tissue. RNAi mediated knock-down of LsalNa + /K + -ATPase caused locomotion impairment, and affected reproduction and feeding. Morphological analysis of dsRNA treated animals revealed muscle degeneration in larval stages, severe changes in the oocyte formation and maturation in females and abnormalities in tegmental glands. Thus, the study represents an important foundation for further functional investigation and identification of physiological pathways in which Na + /K + -ATPase is directly or indirectly involved. Copyright © 2018 Elsevier Inc. All rights reserved.

Global Microarray Analysis of Carbohydrate Use in Alkaliphilic Hemicellulolytic Bacterium Bacillus sp. N16-5

PubMed Central

Song, Yajian; Xue, Yanfen; Ma, Yanhe

2013-01-01

The alkaliphilic hemicellulolytic bacterium Bacillus sp. N16-5 has a broad substrate spectrum and exhibits the capacity to utilize complex carbohydrates such as galactomannan, xylan, and pectin. In the monosaccharide mixture, sequential utilization by Bacillus sp. N16-5 was observed. Glucose appeared to be its preferential monosaccharide, followed by fructose, mannose, arabinose, xylose, and galactose. Global transcription profiles of the strain were determined separately for growth on six monosaccharides (glucose, fructose, mannose, galactose, arabinose, and xylose) and four polysaccharides (galactomannan, xylan, pectin, and sodium carboxymethylcellulose) using one-color microarrays. Numerous genes potentially related to polysaccharide degradation, sugar transport, and monosaccharide metabolism were found to respond to a specific substrate. Putative gene clusters for different carbohydrates were identified according to transcriptional patterns and genome annotation. Identification and analysis of these gene clusters contributed to pathway reconstruction for carbohydrate utilization in Bacillus sp. N16-5. Several genes encoding putative sugar transporters were highly expressed during growth on specific sugars, suggesting their functional roles. Two phosphoenolpyruvate-dependent phosphotransferase systems were identified as candidate transporters for mannose and fructose, and a major facilitator superfamily transporter was identified as a candidate transporter for arabinose and xylose. Five carbohydrate uptake transporter 1 family ATP-binding cassette transporters were predicted to participate in the uptake of hemicellulose and pectin degradation products. Collectively, microarray data improved the pathway reconstruction involved in carbohydrate utilization of Bacillus sp. N16-5 and revealed that the organism precisely regulates gene transcription in response to fluctuations in energy resources. PMID:23326578

Multilocus analysis of extracellular putative virulence proteins made by group A Streptococcus: population genetics, human serologic response, and gene transcription.

PubMed

Reid, S D; Green, N M; Buss, J K; Lei, B; Musser, J M

2001-06-19

Species of pathogenic microbes are composed of an array of evolutionarily distinct chromosomal genotypes characterized by diversity in gene content and sequence (allelic variation). The occurrence of substantial genetic diversity has hindered progress in developing a comprehensive understanding of the molecular basis of virulence and new therapeutics such as vaccines. To provide new information that bears on these issues, 11 genes encoding extracellular proteins in the human bacterial pathogen group A Streptococcus identified by analysis of four genomes were studied. Eight of the 11 genes encode proteins with a LPXTG(L) motif that covalently links Gram-positive virulence factors to the bacterial cell surface. Sequence analysis of the 11 genes in 37 geographically and phylogenetically diverse group A Streptococcus strains cultured from patients with different infection types found that recent horizontal gene transfer has contributed substantially to chromosomal diversity. Regions of the inferred proteins likely to interact with the host were identified by molecular population genetic analysis, and Western immunoblot analysis with sera from infected patients confirmed that they were antigenic. Real-time reverse transcriptase-PCR (TaqMan) assays found that transcription of six of the 11 genes was substantially up-regulated in the stationary phase. In addition, transcription of many genes was influenced by the covR and mga trans-acting gene regulatory loci. Multilocus investigation of putative virulence genes by the integrated approach described herein provides an important strategy to aid microbial pathogenesis research and rapidly identify new targets for therapeutics research.

Metatranscriptomic analysis of a high-sulfide aquatic spring reveals insights into sulfur cycling and unexpected aerobic metabolism.

PubMed

Spain, Anne M; Elshahed, Mostafa S; Najar, Fares Z; Krumholz, Lee R

2015-01-01

Zodletone spring is a sulfide-rich spring in southwestern Oklahoma characterized by shallow, microoxic, light-exposed spring water overlaying anoxic sediments. Previously, culture-independent 16S rRNA gene based diversity surveys have revealed that Zodletone spring source sediments harbor a highly diverse microbial community, with multiple lineages putatively involved in various sulfur-cycling processes. Here, we conducted a metatranscriptomic survey of microbial populations in Zodletone spring source sediments to characterize the relative prevalence and importance of putative phototrophic, chemolithotrophic, and heterotrophic microorganisms in the sulfur cycle, the identity of lineages actively involved in various sulfur cycling processes, and the interaction between sulfur cycling and other geochemical processes at the spring source. Sediment samples at the spring's source were taken at three different times within a 24-h period for geochemical analyses and RNA sequencing. In depth mining of datasets for sulfur cycling transcripts revealed major sulfur cycling pathways and taxa involved, including an unexpected potential role of Actinobacteria in sulfide oxidation and thiosulfate transformation. Surprisingly, transcripts coding for the cyanobacterial Photosystem II D1 protein, methane monooxygenase, and terminal cytochrome oxidases were encountered, indicating that genes for oxygen production and aerobic modes of metabolism are actively being transcribed, despite below-detectable levels (<1 µM) of oxygen in source sediment. Results highlight transcripts involved in sulfur, methane, and oxygen cycles, propose that oxygenic photosynthesis could support aerobic methane and sulfide oxidation in anoxic sediments exposed to sunlight, and provide a viewpoint of microbial metabolic lifestyles under conditions similar to those seen during late Archaean and Proterozoic eons.

Dendritic Cytoskeletal Architecture Is Modulated by Combinatorial Transcriptional Regulation in Drosophila melanogaster.

PubMed

Das, Ravi; Bhattacharjee, Shatabdi; Patel, Atit A; Harris, Jenna M; Bhattacharya, Surajit; Letcher, Jamin M; Clark, Sarah G; Nanda, Sumit; Iyer, Eswar Prasad R; Ascoli, Giorgio A; Cox, Daniel N

2017-12-01

Transcription factors (TFs) have emerged as essential cell autonomous mediators of subtype specific dendritogenesis; however, the downstream effectors of these TFs remain largely unknown, as are the cellular events that TFs control to direct morphological change. As dendritic morphology is largely dictated by the organization of the actin and microtubule (MT) cytoskeletons, elucidating TF-mediated cytoskeletal regulatory programs is key to understanding molecular control of diverse dendritic morphologies. Previous studies in Drosophila melanogaster have demonstrated that the conserved TFs Cut and Knot exert combinatorial control over aspects of dendritic cytoskeleton development, promoting actin and MT-based arbor morphology, respectively. To investigate transcriptional targets of Cut and/or Knot regulation, we conducted systematic neurogenomic studies, coupled with in vivo genetic screens utilizing multi-fluor cytoskeletal and membrane marker reporters. These analyses identified a host of putative Cut and/or Knot effector molecules, and a subset of these putative TF targets converge on modulating dendritic cytoskeletal architecture, which are grouped into three major phenotypic categories, based upon neuromorphometric analyses: complexity enhancer, complexity shifter, and complexity suppressor. Complexity enhancer genes normally function to promote higher order dendritic growth and branching with variable effects on MT stabilization and F-actin organization, whereas complexity shifter and complexity suppressor genes normally function in regulating proximal-distal branching distribution or in restricting higher order branching complexity, respectively, with spatially restricted impacts on the dendritic cytoskeleton. Collectively, we implicate novel genes and cellular programs by which TFs distinctly and combinatorially govern dendritogenesis via cytoskeletal modulation. Copyright © 2017 by the Genetics Society of America.

Novel insights into the response of Atlantic salmon (Salmo salar) to Piscirickettsia salmonis: Interplay of coding genes and lncRNAs during bacterial infection.

PubMed

Valenzuela-Miranda, Diego; Gallardo-Escárate, Cristian

2016-12-01

Despite the high prevalence and impact to Chilean salmon aquaculture of the intracellular bacterium Piscirickettsia salmonis, the molecular underpinnings of host-pathogen interactions remain unclear. Herein, the interplay of coding and non-coding transcripts has been proposed as a key mechanism involved in immune response. Therefore, the aim of this study was to evidence how coding and non-coding transcripts are modulated during the infection process of Atlantic salmon with P. salmonis. For this, RNA-seq was conducted in brain, spleen, and head kidney samples, revealing different transcriptional profiles according to bacterial load. Additionally, while most of the regulated genes annotated for diverse biological processes during infection, a common response associated with clathrin-mediated endocytosis and iron homeostasis was present in all tissues. Interestingly, while endocytosis-promoting factors and clathrin inductions were upregulated, endocytic receptors were mainly downregulated. Furthermore, the regulation of genes related to iron homeostasis suggested an intracellular accumulation of iron, a process in which heme biosynthesis/degradation pathways might play an important role. Regarding the non-coding response, 918 putative long non-coding RNAs were identified, where 425 were newly characterized for S. salar. Finally, co-localization and co-expression analyses revealed a strong correlation between the modulations of long non-coding RNAs and genes associated with endocytosis and iron homeostasis. These results represent the first comprehensive study of putative interplaying mechanisms of coding and non-coding RNAs during bacterial infection in salmonids. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification of aryl hydrocarbon receptor binding targets in mouse hepatic tissue treated with 2,3,7,8-tetrachlorodibenzo-p-dioxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lo, Raymond; Celius, Trine; Forgacs, Agnes L.

2011-11-15

Genome-wide, promoter-focused ChIP-chip analysis of hepatic aryl hydrocarbon receptor (AHR) binding sites was conducted in 8-week old female C57BL/6 treated with 30 {mu}g/kg/body weight 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) for 2 h and 24 h. These studies identified 1642 and 508 AHR-bound regions at 2 h and 24 h, respectively. A total of 430 AHR-bound regions were common between the two time points, corresponding to 403 unique genes. Comparison with previous AHR ChIP-chip studies in mouse hepatoma cells revealed that only 62 of the putative target genes overlapped with the 2 h AHR-bound regions in vivo. Transcription factor binding site analysis revealed anmore » over-representation of aryl hydrocarbon response elements (AHREs) in AHR-bound regions with 53% (2 h) and 68% (24 h) of them containing at least one AHRE. In addition to AHREs, E2f-Myc activator motifs previously implicated in AHR function, as well as a number of other motifs, including Sp1, nuclear receptor subfamily 2 factor, and early growth response factor motifs were also identified. Expression microarray studies identified 133 unique genes differentially regulated after 4 h treatment with TCDD. Of which, 39 were identified as AHR-bound genes at 2 h. Ingenuity Pathway Analysis on the 39 AHR-bound TCDD responsive genes identified potential perturbation in biological processes such as lipid metabolism, drug metabolism, and endocrine system development as a result of TCDD-mediated AHR activation. Our findings identify direct AHR target genes in vivo, highlight in vitro and in vivo differences in AHR signaling and show that AHR recruitment does not necessarily result in changes in target gene expression. -- Highlights: Black-Right-Pointing-Pointer ChIP-chip analysis of hepatic AHR binding after 2 h and 24 h of TCDD. Black-Right-Pointing-Pointer We identified 1642 and 508 AHR-bound regions at 2 h and 24 h. Black-Right-Pointing-Pointer 430 regions were common to both time points and highly enriched with AHREs. Black-Right-Pointing-Pointer Only 62 putative target regions overlapped AHR-bound regions in hepatoma cells. Black-Right-Pointing-Pointer Microarrays identified 133 TCDD-regulated genes; of which 39 were also bound by AHR.« less

Transcriptome landscape of Lactococcus lactis reveals many novel RNAs including a small regulatory RNA involved in carbon uptake and metabolism.

PubMed

van der Meulen, Sjoerd B; de Jong, Anne; Kok, Jan

2016-01-01

RNA sequencing has revolutionized genome-wide transcriptome analyses, and the identification of non-coding regulatory RNAs in bacteria has thus increased concurrently. Here we reveal the transcriptome map of the lactic acid bacterial paradigm Lactococcus lactis MG1363 by employing differential RNA sequencing (dRNA-seq) and a combination of manual and automated transcriptome mining. This resulted in a high-resolution genome annotation of L. lactis and the identification of 60 cis-encoded antisense RNAs (asRNAs), 186 trans-encoded putative regulatory RNAs (sRNAs) and 134 novel small ORFs. Based on the putative targets of asRNAs, a novel classification is proposed. Several transcription factor DNA binding motifs were identified in the promoter sequences of (a)sRNAs, providing insight in the interplay between lactococcal regulatory RNAs and transcription factors. The presence and lengths of 14 putative sRNAs were experimentally confirmed by differential Northern hybridization, including the abundant RNA 6S that is differentially expressed depending on the available carbon source. For another sRNA, LLMGnc_147, functional analysis revealed that it is involved in carbon uptake and metabolism. L. lactis contains 13% leaderless mRNAs (lmRNAs) that, from an analysis of overrepresentation in GO classes, seem predominantly involved in nucleotide metabolism and DNA/RNA binding. Moreover, an A-rich sequence motif immediately following the start codon was uncovered, which could provide novel insight in the translation of lmRNAs. Altogether, this first experimental genome-wide assessment of the transcriptome landscape of L. lactis and subsequent sRNA studies provide an extensive basis for the investigation of regulatory RNAs in L. lactis and related lactococcal species.

Genome-wide identification of heat stress-responsive small RNAs in tall fescue (Festuca arundinacea) by high-throughput sequencing.

PubMed

Li, Huiying; Hu, Tao; Amombo, Erick; Fu, Jinmin

2017-06-01

MicroRNAs (miRNAs) play vital roles in the adaptive response of plants to various abiotic and biotic stresses. Tall fescue (Festuca arundinacea Schreb.) is a major cool-season forage and turf grass species which is severely influenced by heat stress. To unravel possible heat stress-responsive miRNAs, high-throughput sequencing was employed for heat-tolerant PI578718 and heat-sensitive PI234881 genotypes growing in presence and absence of heat stress (40°C for 36h). By searching against the miRBase database, among 1421 reference monocotyledon miRNAs, more than 850 were identified in all samples. Among these miRNAs, 1.46% and 2.29% were differentially expressed in PI234881 and PI578718 under heat stress, respectively, and most of them were down-regulated. In addition, a total of 170 novel miRNAs belonging to 145 miRNA families were identified. Furthermore, putative targets of differentially expressed miRNAs were predicted. The regulation of selected miRNAs by heat stress was revalidated through quantitative reverse transcription PCR (qRT-PCR) analysis. Most of these miRNAs shared similar expression patterns; however, some showed distinct expression patterns under heat stress, with their putative targets displaying different transcription levels. This is the first genome-wide miRNA identification in tall fescue. miRNAs specific to PI578718, or those that exhibited differential expression profiles between the two genotypes under high temperature, were probably associated with the variation in thermotolerance of tall fescue. The differentially expressed miRNAs between these two tall fescue genotypes and their putative targeted genes will provide essential information for further study on miRNAs mediating heat response and facilitate to improve turf grass breeding. Copyright © 2017. Published by Elsevier GmbH.

A genome-wide survey of maternal and embryonic transcripts during Xenopus tropicalis development.

PubMed

Paranjpe, Sarita S; Jacobi, Ulrike G; van Heeringen, Simon J; Veenstra, Gert Jan C

2013-11-06

Dynamics of polyadenylation vs. deadenylation determine the fate of several developmentally regulated genes. Decay of a subset of maternal mRNAs and new transcription define the maternal-to-zygotic transition, but the full complement of polyadenylated and deadenylated coding and non-coding transcripts has not yet been assessed in Xenopus embryos. To analyze the dynamics and diversity of coding and non-coding transcripts during development, both polyadenylated mRNA and ribosomal RNA-depleted total RNA were harvested across six developmental stages and subjected to high throughput sequencing. The maternally loaded transcriptome is highly diverse and consists of both polyadenylated and deadenylated transcripts. Many maternal genes show peak expression in the oocyte and include genes which are known to be the key regulators of events like oocyte maturation and fertilization. Of all the transcripts that increase in abundance between early blastula and larval stages, about 30% of the embryonic genes are induced by fourfold or more by the late blastula stage and another 35% by late gastrulation. Using a gene model validation and discovery pipeline, we identified novel transcripts and putative long non-coding RNAs (lncRNA). These lncRNA transcripts were stringently selected as spliced transcripts generated from independent promoters, with limited coding potential and a codon bias characteristic of noncoding sequences. Many lncRNAs are conserved and expressed in a developmental stage-specific fashion. These data reveal dynamics of transcriptome polyadenylation and abundance and provides a high-confidence catalogue of novel and long non-coding RNAs.

Genomics of an emerging clone of Salmonella serovar Typhimurium ST313 from Nigeria and the Democratic Republic of Congo.

PubMed

Leekitcharoenphon, Pimlapas; Friis, Carsten; Zankari, Ea; Svendsen, Christina Aaby; Price, Lance B; Rahmani, Maral; Herrero-Fresno, Ana; Fashae, Kayode; Vandenberg, Olivier; Aarestrup, Frank M; Hendriksen, Rene S

2013-10-15

Salmonella enterica serovar Typhimurium ST313 is an invasive and phylogenetically distinct lineage present in sub-Saharan Africa. We report the presence of S. Typhimurium ST313 from patients in the Democratic Republic of Congo and Nigeria. Eighteen S. Typhimurium ST313 isolates were characterized by antimicrobial susceptibility testing, pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). Additionally, six of the isolates were characterized by whole genome sequence typing (WGST). The presence of a putative virulence determinant was examined in 177 Salmonella isolates belonging to 57 different serovars. All S. Typhimurium ST313 isolates harbored resistant genes encoded by blaTEM1b, catA1, strA/B, sul1, and dfrA1. Additionally, aac(6')1aa gene was detected. Phylogenetic analyses revealed close genetic relationships among Congolese and Nigerian isolates from both blood and stool. Comparative genomic analyses identified a putative virulence fragment (ST313-TD) unique to S. Typhimurium ST313 and S. Dublin. We showed in a limited number of isolates that S. Typhimurium ST313 is a prevalent sequence-type causing gastrointestinal diseases and septicemia in patients from Nigeria and DRC. We found three distinct phylogenetic clusters based on the origin of isolation suggesting some spatial evolution. Comparative genomics showed an interesting putative virulence fragment (ST313-TD) unique to S. Typhimurium ST313 and invasive S. Dublin.

Identification and Characterization of microRNA319a and Its Putative Target Gene, PvPCF5, in the Bioenergy Grass Switchgrass (Panicum virgatum).

PubMed

Xie, Qi; Liu, Xue; Zhang, Yinbing; Tang, Jinfu; Yin, Dedong; Fan, Bo; Zhu, Lihuang; Han, Liebao; Song, Guilong; Li, Dayong

2017-01-01

Due to its high biomass yield, low environmental impact, and widespread adaptability to poor soils and harsh conditions, switchgrass ( Panicum virgatum L.), a warm-region perennial herbaceous plant, has attracted much attention in recent years. However, little is known about microRNAs (miRNAs) and their functions in this bioenergy grass. Here, we identified and characterized a miRNA gene, Pvi-MIR319a , encoding microRNA319a in switchgrass. Transgenic rice lines generated by overexpressing the Pvi-MIR319a precursor gene exhibited broader leaves and delayed flowering compared with the control. Gene expression analysis indicated at least four putative target genes were downregulated. Additionally, we cloned a putative target gene ( PvPCF5 ) of Pvi-MIR319a from switchgrass. PvPCF5, a TCP transcription factor, is a nuclear-localized protein with transactivation activity and control the development of leaf. Our results suggest that Pvi-MIR319a and its target genes may be used as potential genetic regulators for future switchgrass genetic improvement.

Genome sequence of Plasmopara viticola and insight into the pathogenic mechanism

PubMed Central

Yin, Ling; An, Yunhe; Qu, Junjie; Li, Xinlong; Zhang, Yali; Dry, Ian; Wu, Huijuan; Lu, Jiang

2017-01-01

Plasmopara viticola causes downy mildew disease of grapevine which is one of the most devastating diseases of viticulture worldwide. Here we report a 101.3 Mb whole genome sequence of P. viticola isolate ‘JL-7-2’ obtained by a combination of Illumina and PacBio sequencing technologies. The P. viticola genome contains 17,014 putative protein-coding genes and has ~26% repetitive sequences. A total of 1,301 putative secreted proteins, including 100 putative RXLR effectors and 90 CRN effectors were identified in this genome. In the secretome, 261 potential pathogenicity genes and 95 carbohydrate-active enzymes were predicted. Transcriptional analysis revealed that most of the RXLR effectors, pathogenicity genes and carbohydrate-active enzymes were significantly up-regulated during infection. Comparative genomic analysis revealed that P. viticola evolved independently from the Arabidopsis downy mildew pathogen Hyaloperonospora arabidopsidis. The availability of the P. viticola genome provides a valuable resource not only for comparative genomic analysis and evolutionary studies among oomycetes, but also enhance our knowledge on the mechanism of interactions between this biotrophic pathogen and its host. PMID:28417959

Fetal alcohol syndrome and secondary schizophrenia: a unique neuropathologic study.

PubMed

Stoos, Catherine; Nelsen, Laura; Schissler, Kathryn A; Elliott, Amy J; Kinney, Hannah C

2015-04-01

We report the unique neuropathologic study of an adult brain of a patient with fetal alcohol syndrome who developed the well-recognized complication of schizophrenia in adolescence. The major finding was asymmetric formation of the lateral temporal lobes, with marked enlargement of the right superior temporal gyrus, suggesting that alcohol is preferentially toxic to temporal lobe patterning during gestation. Critical maturational changes unique to adolescence can unmask psychotic symptomatology mediated by temporal lobe pathology that has been clinically dormant since birth. Elucidating the neuropathologic basis of the secondary psychiatric disorders in fetal alcohol syndrome can help provide insight into their putative developmental origins. © The Author(s) 2014.

Non-coding RNA networks in cancer.

PubMed

Anastasiadou, Eleni; Jacob, Leni S; Slack, Frank J

2018-01-01

Thousands of unique non-coding RNA (ncRNA) sequences exist within cells. Work from the past decade has altered our perception of ncRNAs from 'junk' transcriptional products to functional regulatory molecules that mediate cellular processes including chromatin remodelling, transcription, post-transcriptional modifications and signal transduction. The networks in which ncRNAs engage can influence numerous molecular targets to drive specific cell biological responses and fates. Consequently, ncRNAs act as key regulators of physiological programmes in developmental and disease contexts. Particularly relevant in cancer, ncRNAs have been identified as oncogenic drivers and tumour suppressors in every major cancer type. Thus, a deeper understanding of the complex networks of interactions that ncRNAs coordinate would provide a unique opportunity to design better therapeutic interventions.

Upregulation of the PatAB Transporter Confers Fluoroquinolone Resistance to Streptococcus pseudopneumoniae

PubMed Central

Alvarado, María; Martín-Galiano, Antonio J.; Ferrándiz, María J.; Zaballos, Ángel; de la Campa, Adela G.

2017-01-01

We characterized the mechanism of fluoroquinolone-resistance in two isolates of Streptococcus pseudopneumoniae having fluoroquinolone-efflux as unique mechanism of resistance. Whole genome sequencing and genetic transformation experiments were performed together with phenotypic determinations of the efflux mechanism. The PatAB pump was identified as responsible for efflux of ciprofloxacin (MIC of 4 μg/ml), ethidium bromide (MICs of 8–16 μg/ml) and acriflavine (MICs of 4–8 μg/ml) in both isolates. These MICs were at least 8-fold lower in the presence of the efflux inhibitor reserpine. Complete genome sequencing indicated that the sequence located between the promoter of the patAB operon and the initiation codon of patA, which putatively forms an RNA stem-loop structure, may be responsible for the efflux phenotype. RT-qPCR determinations performed on RNAs of cultures treated or not treated with subinhibitory ciprofloxacin concentrations were performed. While no significant changes were observed in wild-type Streptococcus pneumoniae R6 strain, increases in transcription were detected in the ciprofloxacin-efflux transformants obtained with DNA from efflux-positive isolates, in the ranges of 1.4 to 3.4-fold (patA) and 2.1 to 2.9-fold (patB). Ciprofloxacin-induction was related with a lower predicted free energy for the stem-loop structure in the RNA of S. pseudopneumoniae isolates (−13.81 and −8.58) than for R6 (−15.32 kcal/mol), which may ease transcription. The presence of these regulatory variations in commensal S. pseudopneumoniae isolates, and the possibility of its transfer to Streptococcus pneumoniae by genetic transformation, could increase fluoroquinolone resistance in this important pathogen. PMID:29123510

IpsA, a novel LacI-type regulator, is required for inositol-derived lipid formation in Corynebacteria and Mycobacteria

PubMed Central

2013-01-01

Background The development of new drugs against tuberculosis and diphtheria is focused on disrupting the biogenesis of the cell wall, the unique architecture of which confers resistance against current therapies. The enzymatic pathways involved in the synthesis of the cell wall by these pathogens are well understood, but the underlying regulatory mechanisms are largely unknown. Results Here, we characterize IpsA, a LacI-type transcriptional regulator conserved among Mycobacteria and Corynebacteria that plays a role in the regulation of cell wall biogenesis. IpsA triggers myo-inositol formation by activating ino1, which encodes inositol phosphate synthase. An ipsA deletion mutant of Corynebacterium glutamicum cultured on glucose displayed significantly impaired growth and presented an elongated cell morphology. Further studies revealed the absence of inositol-derived lipids in the cell wall and a complete loss of mycothiol biosynthesis. The phenotype of the C. glutamicum ipsA deletion mutant was complemented to different extend by homologs from Corynebacterium diphtheriae (dip1969) and Mycobacterium tuberculosis (rv3575), indicating the conserved function of IpsA in the pathogenic species. Additional targets of IpsA with putative functions in cell wall biogenesis were identified and IpsA was shown to bind to a conserved palindromic motif within the corresponding promoter regions. Myo-inositol was identified as an effector of IpsA, causing the dissociation of the IpsA-DNA complex in vitro. Conclusions This characterization of IpsA function and of its regulon sheds light on the complex transcriptional control of cell wall biogenesis in the mycolata taxon and generates novel targets for drug development. PMID:24377418

ocsESTdb: a database of oil crop seed EST sequences for comparative analysis and investigation of a global metabolic network and oil accumulation metabolism.

PubMed

Ke, Tao; Yu, Jingyin; Dong, Caihua; Mao, Han; Hua, Wei; Liu, Shengyi

2015-01-21

Oil crop seeds are important sources of fatty acids (FAs) for human and animal nutrition. Despite their importance, there is a lack of an essential bioinformatics resource on gene transcription of oil crops from a comparative perspective. In this study, we developed ocsESTdb, the first database of expressed sequence tag (EST) information on seeds of four large-scale oil crops with an emphasis on global metabolic networks and oil accumulation metabolism that target the involved unigenes. A total of 248,522 ESTs and 106,835 unigenes were collected from the cDNA libraries of rapeseed (Brassica napus), soybean (Glycine max), sesame (Sesamum indicum) and peanut (Arachis hypogaea). These unigenes were annotated by a sequence similarity search against databases including TAIR, NR protein database, Gene Ontology, COG, Swiss-Prot, TrEMBL and Kyoto Encyclopedia of Genes and Genomes (KEGG). Five genome-scale metabolic networks that contain different numbers of metabolites and gene-enzyme reaction-association entries were analysed and constructed using Cytoscape and yEd programs. Details of unigene entries, deduced amino acid sequences and putative annotation are available from our database to browse, search and download. Intuitive and graphical representations of EST/unigene sequences, functional annotations, metabolic pathways and metabolic networks are also available. ocsESTdb will be updated regularly and can be freely accessed at http://ocri-genomics.org/ocsESTdb/ . ocsESTdb may serve as a valuable and unique resource for comparative analysis of acyl lipid synthesis and metabolism in oilseed plants. It also may provide vital insights into improving oil content in seeds of oil crop species by transcriptional reconstruction of the metabolic network.

Expression of an Intestine-Specific Transcription Factor (CDX1) in Intestinal Metaplasia and in Subsequently Developed Intestinal Type of Cholangiocarcinoma in Rat Liver

PubMed Central

Ren, Ping; Silberg, Debra G.; Sirica, Alphonse E.

2000-01-01

CDX1 is a caudal-type homeobox intestine-specific transcription factor that has been shown to be selectively expressed in epithelial cells in intestinal metaplasia of the human stomach and esophagus and variably expressed in human gastric and esophageal adenocarcinomas (Silberg DG, Furth EE, Taylor JK, Schuck T, Chiou T, Traber PG: Gastroenterology 1997, 113: 478–486). Through the use of immunohistochemistry and Western blotting, we investigated whether CDX1 is also uniquely associated with the intestinal metaplasia associated with putative precancerous cholangiofibrosis induced in rat liver during furan cholangiocarcinogenesis, as well as expressed in neoplastic glands in a subsequently developed intestinal type of cholangiocarcinoma. In normal, control adult rat small intestine, specific nuclear immunoreactivity for CDX1 was most prominent in enterocytes lining the crypts. In comparison, epithelium from intestinal metaplastic glands within furan-induced hepatic cholangiofibrosis and neoplastic epithelium from later developed primary intestinal-type cholangiocarcinoma each demonstrated strong nuclear immunoreactivity for CDX1. CDX1-positive cells were detected in hepatic cholangiofibrotic tissue as early as 3 weeks after the start of chronic furan treatment. We further determined that the percentages of CDX1-positive neoplastic glands and glandular nuclei are significantly higher in primary tumors than in a derived, transplantable cholangiocarcinoma serially-propagated in vivo. Western blotting confirmed our immunohistochemical results, and no CDX1 immunoreactivity was detected in normal adult rat liver or in hyperplastic biliary epithelial cells. These findings indicate that CDX1 is specifically associated with early intestinal metaplasia and a later developed intestinal-type of cholangiocarcinoma induced in the liver of furan-treated rats. PMID:10666391

Expression of an intestine-specific transcription factor (CDX1) in intestinal metaplasia and in subsequently developed intestinal type of cholangiocarcinoma in rat liver.

PubMed

Ren, P; Silberg, D G; Sirica, A E

2000-02-01

CDX1 is a caudal-type homeobox intestine-specific transcription factor that has been shown to be selectively expressed in epithelial cells in intestinal metaplasia of the human stomach and esophagus and variably expressed in human gastric and esophageal adenocarcinomas (Silberg DG, Furth EE, Taylor JK, Schuck T, Chiou T, Traber PG: Gastroenterology 1997, 113: 478-486). Through the use of immunohistochemistry and Western blotting, we investigated whether CDX1 is also uniquely associated with the intestinal metaplasia associated with putative precancerous cholangiofibrosis induced in rat liver during furan cholangiocarcinogenesis, as well as expressed in neoplastic glands in a subsequently developed intestinal type of cholangiocarcinoma. In normal, control adult rat small intestine, specific nuclear immunoreactivity for CDX1 was most prominent in enterocytes lining the crypts. In comparison, epithelium from intestinal metaplastic glands within furan-induced hepatic cholangiofibrosis and neoplastic epithelium from later developed primary intestinal-type cholangiocarcinoma each demonstrated strong nuclear immunoreactivity for CDX1. CDX1-positive cells were detected in hepatic cholangiofibrotic tissue as early as 3 weeks after the start of chronic furan treatment. We further determined that the percentages of CDX1-positive neoplastic glands and glandular nuclei are significantly higher in primary tumors than in a derived, transplantable cholangiocarcinoma serially-propagated in vivo. Western blotting confirmed our immunohistochemical results, and no CDX1 immunoreactivity was detected in normal adult rat liver or in hyperplastic biliary epithelial cells. These findings indicate that CDX1 is specifically associated with early intestinal metaplasia and a later developed intestinal-type of cholangiocarcinoma induced in the liver of furan-treated rats.

Bisphenol A-Associated Alterations in the Expression and Epigenetic Regulation of Genes Encoding Xenobiotic Metabolizing Enzymes in Human Fetal Liver

PubMed Central

Nahar, Muna S.; Kim, Jung H.; Sartor, Maureen A.; Dolinoy, Dana C.

2014-01-01

Alterations in xenobiotic metabolizing enzyme (XME) expression across the life course, along with genetic, nutritional, and environmental regulation, can influence how organisms respond to toxic insults. In this study, we investigated the hypothesis that in utero exposure to the endocrine active compound, bisphenol A (BPA), influences expression and epigenetic regulation of phase I and II XME genes during development. Using healthy 1st to 2nd trimester human fetal liver specimens quantified for internal BPA levels, we examined XME gene expression using PCR Array (n =8) and RNA-sequencing (n =12) platforms. Of the greater than 160 XME genes assayed, 2 phase I and 12 phase II genes exhibited significantly reduced expression with higher BPA levels, including isoforms from the carboxylesterase, catechol O-methyltransferase, glutathione S-transferase, sulfotransferase, and UDP-glucuronosyltransferase families. When the promoters of these candidate genes were evaluated in silico, putative binding sites for the E-twenty-six (ETS) and activator protein1 (AP1) related transcription factor families were identified and unique to 97% of all candidate transcripts. Interestingly, many ETS binding sites contain cytosine-guanine dinucleotides (CpGs) within their consensus sequences. Thus, quantitative analysis of CpG methylation of three candidate genes was conducted across n =50 samples. Higher BPA levels were associated with increased site-specific methylation at COMT (P <0.005) and increased average methylation at SULT2A1 (P <0.020) promoters. While toxicological studies have traditionally focused on high-dose effects and hormonal receptor mediated regulation, our findings suggest the importance of low-dose effects and nonclassical mechanisms of endocrine disruption during development. PMID:24214726

A comparative genomic analysis of the oxidative enzymes potentially involved in lignin degradation by Agaricus bisporus.

PubMed

Doddapaneni, Harshavardhan; Subramanian, Venkataramanan; Fu, Bolei; Cullen, Dan

2013-06-01

The oxidative enzymatic machinery for degradation of organic substrates in Agaricus bisporus (Ab) is at the core of the carbon recycling mechanisms in this fungus. To date, 156 genes have been tentatively identified as part of this oxidative enzymatic machinery, which includes 26 peroxidase encoding genes, nine copper radical oxidase [including three putative glyoxal oxidase-encoding genes (GLXs)], 12 laccases sensu stricto and 109 cytochrome P450 monooxygenases. Comparative analyses of these enzymes in Ab with those of the white-rot fungus, Phanerochaete chrysosporium, the brown-rot fungus, Postia placenta, the coprophilic litter fungus, Coprinopsis cinerea and the ectomychorizal fungus, Laccaria bicolor, revealed enzyme diversity consistent with adaptation to substrates rich in humic substances and partially degraded plant material. For instance, relative to wood decay fungi, Ab cytochrome P450 genes were less numerous (109 gene models), distributed among distinctive families, and lacked extensive duplication and clustering. Viewed together with P450 transcript accumulation patterns in three tested growth conditions, these observations were consistent with the unique Ab lifestyle. Based on tandem gene arrangements, a certain degree of gene duplication seems to have occurred in this fungus in the copper radical oxidase (CRO) and the laccase gene families. In Ab, high transcript levels and regulation of the heme-thiolate peroxidases, two manganese peroxidases and the three GLX-like genes are likely in response to complex natural substrates, including lignocellulose and its derivatives, thereby suggesting an important role in lignin degradation. On the other hand, the expression patterns of the related CROs suggest a developmental role in this fungus. Based on these observations, a brief comparative genomic overview of the Ab oxidative enzyme machinery is presented. Copyright © 2013 Elsevier Inc. All rights reserved.

Genes associated with lignin degradation in the polyphagous white-rot pathogen Heterobasidion irregulare show substrate-specific regulation.

PubMed

Yakovlev, Igor A; Hietala, Ari M; Courty, Pierre-Emmanuel; Lundell, Taina; Solheim, Halvor; Fossdal, Carl Gunnar

2013-07-01

The pathogenic white-rot basidiomycete Heterobasidion irregulare is able to remove lignin and hemicellulose prior to cellulose during the colonization of root and stem xylem of conifer and broadleaf trees. We identified and followed the regulation of expression of genes belonging to families encoding ligninolytic enzymes. In comparison with typical white-rot fungi, the H. irregulare genome has exclusively the short-manganese peroxidase type encoding genes (6 short-MnPs) and thereby a slight contraction in the pool of class II heme-containing peroxidases, but an expansion of the MCO laccases with 17 gene models. Furthermore, the genome shows a versatile set of other oxidoreductase genes putatively involved in lignin oxidation and conversion, including 5 glyoxal oxidases, 19 quinone-oxidoreductases and 12 aryl-alcohol oxidases. Their genetic multiplicity and gene-specific regulation patterns on cultures based on defined lignin, cellulose or Norway spruce lignocellulose substrates suggest divergent specificities and physiological roles for these enzymes. While the short-MnP encoding genes showed similar transcript levels upon fungal growth on heartwood and reaction zone (RZ), a xylem defense tissue rich in phenolic compounds unique to trees, a subset of laccases showed higher gene expression in the RZ cultures. In contrast, other oxidoreductases depending on initial MnP activity showed generally lower transcript levels on RZ than on heartwood. These data suggest that the rate of fungal oxidative conversion of xylem lignin differs between spruce RZ and heartwood. It is conceivable that in RZ part of the oxidoreductase activities of laccases are related to the detoxification of phenolic compounds involved in host-defense. Expression of the several short-MnP enzymes indicated an important role for these enzymes in effective delignification of wood by H. irregulare. Copyright © 2013 Elsevier Inc. All rights reserved.

Grouping and characterization of putative glycosyltransferase genes from Panax ginseng Meyer.

PubMed

Khorolragchaa, Altanzul; Kim, Yu-Jin; Rahimi, Shadi; Sukweenadhi, Johan; Jang, Moon-Gi; Yang, Deok-Chun

2014-02-15

Glycosyltransferases are members of the multigene family of plants that can transfer single or multiple activated sugars to a range of plant molecules, resulting in the glycosylation of plant compounds. Although the activities of many glycosyltransferases and their products have been recognized for a long time, only in recent years were some glycosyltransferase genes identified and few have been functionally characterized in detail. Korean ginseng (Panax ginseng Meyer), belonging to Araliaceae, has been well known as a popular mysterious medicinal herb in East Asia for over 2,000 years. A total of 704 glycosyltransferase unique sequences have been found from a ginseng expressed sequence tag (EST) library, and these sequences encode enzymes responsible for the secondary metabolite biosynthesis. Finally, twelve UDP glycosyltransferases (UGTs) were selected as the candidates most likely to be involved in triterpenoid synthesis. In this study, we classified the candidate P. ginseng UGTs (PgUGTs) into proper families and groups, which resulted in eight UGT families and six UGT groups. We also investigated those gene candidates encoding for glycosyltransferases by analysis of gene expression in methyl jasmonate (MeJA)-treated ginseng adventitious roots and different tissues from four-year-old ginseng using quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). For organ-specific expression, most of PgUGT transcription levels were higher in leaves and roots compared with flower buds and stems. The transcription of PgUGTs in adventitious roots treated with MeJA increased as compared with the control. PgUGT1 and PgUGT2, which belong to the UGT71 family genes expressed in MeJA-treated adventitious roots, were especially sensitive, showing 33.32 and 38.88-fold expression increases upon 24h post-treatments, respectively. © 2013 Elsevier B.V. All rights reserved.

Virus-Induced Silencing of Key Genes Leads to Differential Impact on Withanolide Biosynthesis in the Medicinal Plant, Withania somnifera.

PubMed

Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar

2018-02-01

Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.

Genome-scale transcriptional study of hybrid effects and regulatory divergence in an F1 hybrid Ruellia (Wild Petunias: Acanthaceae) and its parents.

PubMed

Zhuang, Yongbin; Tripp, Erin A

2017-01-17

New combinations of divergent genomes can give rise to novel genetic functions in resulting hybrid progeny. Such functions may yield opportunities for ecological divergence, contributing ultimately to reproductive isolation and evolutionary longevity of nascent hybrid lineages. In plants, the degree to which transgressive genotypes contribute to floral novelty remains a question of key interest. Here, we generated an F 1 hybrid plant between the red-flowered Ruellia elegans and yellow flowered R. speciosa. RNA-seq technology was used to explore differential gene expression between the hybrid and its two parents, with emphasis on genetic elements involved in the production of floral anthocyanin pigments. The hybrid was purple flowered and produced novel floral delphinidin pigments not manufactured by either parent. We found that nearly a fifth of all 86,475 unigenes expressed were unique to the hybrid. The majority of hybrid unigenes (80.97%) showed a pattern of complete dominance to one parent or the other although this ratio was uneven, suggesting asymmetrical influence of parental genomes on the progeny transcriptome. However, 8.87% of all transcripts within the hybrid were expressed at significantly higher or lower mean levels than observed for either parent. A total of 28 unigenes coding putatively for eight core enzymes in the anthocyanin pathway were recovered, along with three candidate MYBs involved in anthocyanin regulation. Our results suggest that models of gene evolution that explain phenotypic novelty and hybrid establishment in plants may need to include transgressive effects. Additionally, our results lend insight into the potential for floral novelty that derives from unions of divergent genomes. These findings serve as a starting point to further investigate molecular mechanisms involved in flower color transitions in Ruellia.

Characterization of expressed sequence tags (ESTs) of pigeonpea (Cajanus cajan L.) and functional validation of selected genes for abiotic stress tolerance in Arabidopsis thaliana.

PubMed

Priyanka, B; Sekhar, K; Sunita, T; Reddy, V D; Rao, Khareedu Venkateswara

2010-03-01

Pigeonpea, a major grain legume crop with remarkable drought tolerance traits, has been used for the isolation of stress-responsive genes. Herein, we report generation of ESTs, transcript profiles of selected genes and validation of candidate genes obtained from the subtracted cDNA libraries of pigeonpea plants subjected to PEG/water-deficit stress conditions. Cluster analysis of 124 selected ESTs yielded 75 high-quality ESTs. Homology searches disclosed that 55 ESTs share significant similarity with the known/putative proteins or ESTs available in the databases. These ESTs were characterized and genes relevant to the specific physiological processes were identified. Of the 75 ESTs obtained from the cDNA libraries of drought-stressed plants, 20 ESTs proved to be unique to the pigeonpea. These sequences are envisaged to serve as a potential source of stress-inducible genes of the drought stress-response transcriptome, and hence may be used for deciphering the mechanism of drought tolerance of the pigeonpea. Expression profiles of selected genes revealed increased levels of m-RNA transcripts in pigeonpea plants subjected to different abiotic stresses. Transgenic Arabidopsis lines, expressing Cajanus cajan hybrid-proline-rich protein (CcHyPRP), C. cajan cyclophilin (CcCYP) and C. cajan cold and drought regulatory (CcCDR) genes, exhibited marked tolerance, increased plant biomass and enhanced photosynthetic rates under PEG/NaCl/cold/heat stress conditions. This study represents the first report dealing with the isolation of drought-specific ESTs, transcriptome analysis and functional validation of drought-responsive genes of the pigeonpea. These genes, as such, hold promise for engineering crop plants bestowed with tolerance to major abiotic stresses.

Consequences of exchanging carbohydrates for proteins in the cholesterol metabolism of mice fed a high-fat diet.

PubMed

Raymond, Frédéric; Wang, Long; Moser, Mireille; Metairon, Sylviane; Mansourian, Robert; Zwahlen, Marie-Camille; Kussmann, Martin; Fuerholz, Andreas; Macé, Katherine; Chou, Chieh Jason

2012-01-01

Consumption of low-carbohydrate, high-protein, high-fat diets lead to rapid weight loss but the cardioprotective effects of these diets have been questioned. We examined the impact of high-protein and high-fat diets on cholesterol metabolism by comparing the plasma cholesterol and the expression of cholesterol biosynthesis genes in the liver of mice fed a high-fat (HF) diet that has a high (H) or a low (L) protein-to-carbohydrate (P/C) ratio. H-P/C-HF feeding, compared with L-P/C-HF feeding, decreased plasma total cholesterol and increased HDL cholesterol concentrations at 4-wk. Interestingly, the expression of genes involved in hepatic steroid biosynthesis responded to an increased dietary P/C ratio by first down-regulation (2-d) followed by later up-regulation at 4-wk, and the temporal gene expression patterns were connected to the putative activity of SREBF1 and 2. In contrast, Cyp7a1, the gene responsible for the conversion of cholesterol to bile acids, was consistently up-regulated in the H-P/C-HF liver regardless of feeding duration. Over expression of Cyp7a1 after 2-d and 4-wk H-P/C-HF feeding was connected to two unique sets of transcription regulators. At both time points, up-regulation of the Cyp7a1 gene could be explained by enhanced activations and reduced suppressions of multiple transcription regulators. In conclusion, we demonstrated that the hypocholesterolemic effect of H-P/C-HF feeding coincided with orchestrated changes of gene expressions in lipid metabolic pathways in the liver of mice. Based on these results, we hypothesize that the cholesterol lowering effect of high-protein feeding is associated with enhanced bile acid production but clinical validation is warranted. (246 words).

Transcriptional profiles of Arabidopsis stomataless mutants reveal developmental and physiological features of life in the absence of stomata

PubMed Central

de Marcos, Alberto; Triviño, Magdalena; Pérez-Bueno, María Luisa; Ballesteros, Isabel; Barón, Matilde; Mena, Montaña; Fenoll, Carmen

2015-01-01

Loss of function of the positive stomata development regulators SPCH or MUTE in Arabidopsis thaliana renders stomataless plants; spch-3 and mute-3 mutants are extreme dwarfs, but produce cotyledons and tiny leaves, providing a system to interrogate plant life in the absence of stomata. To this end, we compared their cotyledon transcriptomes with that of wild-type plants. K-means clustering of differentially expressed genes generated four clusters: clusters 1 and 2 grouped genes commonly regulated in the mutants, while clusters 3 and 4 contained genes distinctively regulated in mute-3. Classification in functional categories and metabolic pathways of genes in clusters 1 and 2 suggested that both mutants had depressed secondary, nitrogen and sulfur metabolisms, while only a few photosynthesis-related genes were down-regulated. In situ quenching analysis of chlorophyll fluorescence revealed limited inhibition of photosynthesis. This and other fluorescence measurements matched the mutant transcriptomic features. Differential transcriptomes of both mutants were enriched in growth-related genes, including known stomata development regulators, which paralleled their epidermal phenotypes. Analysis of cluster 3 was not informative for developmental aspects of mute-3. Cluster 4 comprised genes differentially up−regulated in mute−3, 35% of which were direct targets for SPCH and may relate to the unique cell types of mute−3. A screen of T-DNA insertion lines in genes differentially expressed in the mutants identified a gene putatively involved in stomata development. A collection of lines for conditional overexpression of transcription factors differentially expressed in the mutants rendered distinct epidermal phenotypes, suggesting that these proteins may be novel stomatal development regulators. Thus, our transcriptome analysis represents a useful source of new genes for the study of stomata development and for characterizing physiology and growth in the absence of stomata. PMID:26157447

Nitrogen transporter and assimilation genes exhibit developmental stage-selective expression in maize (Zea mays L.) associated with distinct cis-acting promoter motifs.

PubMed

Liseron-Monfils, Christophe; Bi, Yong-Mei; Downs, Gregory S; Wu, Wenqing; Signorelli, Tara; Lu, Guangwen; Chen, Xi; Bondo, Eddie; Zhu, Tong; Lukens, Lewis N; Colasanti, Joseph; Rothstein, Steven J; Raizada, Manish N

2013-10-01

Nitrogen is considered the most limiting nutrient for maize (Zea mays L.), but there is limited understanding of the regulation of nitrogen-related genes during maize development. An Affymetrix 82K maize array was used to analyze the expression of ≤ 46 unique nitrogen uptake and assimilation probes in 50 maize tissues from seedling emergence to 31 d after pollination. Four nitrogen-related expression clusters were identified in roots and shoots corresponding to, or overlapping, juvenile, adult, and reproductive phases of development. Quantitative real time PCR data was consistent with the existence of these distinct expression clusters. Promoters corresponding to each cluster were screened for over-represented cis-acting elements. The 8-bp distal motif of the Arabidopsis 43-bp nitrogen response element (NRE) was over-represented in nitrogen-related maize gene promoters. This conserved motif, referred to here as NRE43-d8, was previously shown to be critical for nitrate-activated transcription of nitrate reductase (NIA1) and nitrite reductase (NIR1) by the NIN-LIKE PROTEIN 6 (NLP6) in Arabidopsis. Here, NRE43-d8 was over-represented in the promoters of maize nitrate and ammonium transporter genes, specifically those that showed peak expression during early-stage vegetative development. This result predicts an expansion of the NRE-NLP6 regulon and suggests that it may have a developmental component in maize. We also report leaf expression of putative orthologs of nitrite transporters (NiTR1), a transporter not previously reported in maize. We conclude by discussing how each of the four transcriptional modules may be responsible for the different nitrogen uptake and assimilation requirements of leaves and roots at different stages of maize development.

Genome-wide analysis of coordinated transcript abundance during seed development in different Brassica rapa morphotypes.

PubMed

Basnet, Ram Kumar; Moreno-Pachon, Natalia; Lin, Ke; Bucher, Johan; Visser, Richard G F; Maliepaard, Chris; Bonnema, Guusje

2013-12-01

Brassica seeds are important as basic units of plant growth and sources of vegetable oil. Seed development is regulated by many dynamic metabolic processes controlled by complex networks of spatially and temporally expressed genes. We conducted a global microarray gene co-expression analysis by measuring transcript abundance of developing seeds from two diverse B. rapa morphotypes: a pak choi (leafy-type) and a yellow sarson (oil-type), and two of their doubled haploid (DH) progenies, (1) to study the timing of metabolic processes in developing seeds, (2) to explore the major transcriptional differences in developing seeds of the two morphotypes, and (3) to identify the optimum stage for a genetical genomics study in B. rapa seed. Seed developmental stages were similar in developing seeds of pak choi and yellow sarson of B. rapa; however, the colour of embryo and seed coat differed among these two morphotypes. In this study, most transcriptional changes occurred between 25 and 35 DAP, which shows that the timing of seed developmental processes in B. rapa is at later developmental stages than in the related species B. napus. Using a Weighted Gene Co-expression Network Analysis (WGCNA), we identified 47 "gene modules", of which 27 showed a significant association with temporal and/or genotypic variation. An additional hierarchical cluster analysis identified broad spectra of gene expression patterns during seed development. The predominant variation in gene expression was according to developmental stages rather than morphotype differences. Since lipids are the major storage compounds of Brassica seeds, we investigated in more detail the regulation of lipid metabolism. Four co-regulated gene clusters were identified with 17 putative cis-regulatory elements predicted in their 1000 bp upstream region, either specific or common to different lipid metabolic pathways. This is the first study of genome-wide profiling of transcript abundance during seed development in B. rapa. The identification of key physiological events, major expression patterns, and putative cis-regulatory elements provides useful information to construct gene regulatory networks in B. rapa developing seeds and provides a starting point for a genetical genomics study of seed quality traits.

Evidence of accelerated evolution and ectodermal-specific expression of presumptive BDS toxin cDNAs from Anemonia viridis.

PubMed

Nicosia, Aldo; Maggio, Teresa; Mazzola, Salvatore; Cuttitta, Angela

2013-10-30

Anemonia viridis is a widespread and extensively studied Mediterranean species of sea anemone from which a large number of polypeptide toxins, such as blood depressing substances (BDS) peptides, have been isolated. The first members of this class, BDS-1 and BDS-2, are polypeptides belonging to the β-defensin fold family and were initially described for their antihypertensive and antiviral activities. BDS-1 and BDS-2 are 43 amino acid peptides characterised by three disulfide bonds that act as neurotoxins affecting Kv3.1, Kv3.2 and Kv3.4 channel gating kinetics. In addition, BDS-1 inactivates the Nav1.7 and Nav1.3 channels. The development of a large dataset of A. viridis expressed sequence tags (ESTs) and the identification of 13 putative BDS-like cDNA sequences has attracted interest, especially as scientific and diagnostic tools. A comparison of BDS cDNA sequences showed that the untranslated regions are more conserved than the protein-coding regions. Moreover, the KA/KS ratios calculated for all pairwise comparisons showed values greater than 1, suggesting mechanisms of accelerated evolution. The structures of the BDS homologs were predicted by molecular modelling. All toxins possess similar 3D structures that consist of a triple-stranded antiparallel β-sheet and an additional small antiparallel β-sheet located downstream of the cleavage/maturation site; however, the orientation of the triple-stranded β-sheet appears to differ among the toxins. To characterise the spatial expression profile of the putative BDS cDNA sequences, tissue-specific cDNA libraries, enriched for BDS transcripts, were constructed. In addition, the proper amplification of ectodermal or endodermal markers ensured the tissue specificity of each library. Sequencing randomly selected clones from each library revealed ectodermal-specific expression of ten BDS transcripts, while transcripts of BDS-8, BDS-13, BDS-14 and BDS-15 failed to be retrieved, likely due to under-representation in our cDNA libraries. The calculation of the relative abundance of BDS transcripts in the cDNA libraries revealed that BDS-1, BDS-3, BDS-4, BDS-5 and BDS-6 are the most represented transcripts.

Phylogenetic factorization of compositional data yields lineage-level associations in microbiome datasets.

PubMed

Washburne, Alex D; Silverman, Justin D; Leff, Jonathan W; Bennett, Dominic J; Darcy, John L; Mukherjee, Sayan; Fierer, Noah; David, Lawrence A

2017-01-01

Marker gene sequencing of microbial communities has generated big datasets of microbial relative abundances varying across environmental conditions, sample sites and treatments. These data often come with putative phylogenies, providing unique opportunities to investigate how shared evolutionary history affects microbial abundance patterns. Here, we present a method to identify the phylogenetic factors driving patterns in microbial community composition. We use the method, "phylofactorization," to re-analyze datasets from the human body and soil microbial communities, demonstrating how phylofactorization is a dimensionality-reducing tool, an ordination-visualization tool, and an inferential tool for identifying edges in the phylogeny along which putative functional ecological traits may have arisen.

Transcriptome analysis of thermogenic Arum concinnatum reveals the molecular components of floral scent production

PubMed Central

Onda, Yoshihiko; Mochida, Keiichi; Yoshida, Takuhiro; Sakurai, Tetsuya; Seymour, Roger S.; Umekawa, Yui; Pirintsos, Stergios Arg; Shinozaki, Kazuo; Ito, Kikukatsu

2015-01-01

Several plant species can generate enough heat to increase their internal floral temperature above ambient temperature. Among thermogenic plants, Arum concinnatum shows the highest respiration activity during thermogenesis. However, an overall understanding of the genes related to plant thermogenesis has not yet been achieved. In this study, we performed de novo transcriptome analysis of flower organs in A. concinnatum. The de novo transcriptome assembly represented, in total, 158,490 non-redundant transcripts, and 53,315 of those showed significant homology with known genes. To explore genes associated with thermogenesis, we filtered 1266 transcripts that showed a significant correlation between expression pattern and the temperature trend of each sample. We confirmed five putative alternative oxidase transcripts were included in filtered transcripts as expected. An enrichment analysis of the Gene Ontology terms for the filtered transcripts suggested over-representation of genes involved in 1-deoxy-d-xylulose-5-phosphate synthase (DXS) activity. The expression profiles of DXS transcripts in the methyl-d-erythritol 4-phosphate (MEP) pathway were significantly correlated with thermogenic levels. Our results suggest that the MEP pathway is the main biosynthesis route for producing scent monoterpenes. To our knowledge, this is the first report describing the candidate pathway and the key enzyme for floral scent production in thermogenic plants. PMID:25736477

SOX2 as a New Regulator of HPV16 Transcription.

PubMed

Martínez-Ramírez, Imelda; Del-Castillo-Falconi, Víctor; Mitre-Aguilar, Irma B; Amador-Molina, Alfredo; Carrillo-García, Adela; Langley, Elizabeth; Zentella-Dehesa, Alejandro; Soto-Reyes, Ernesto; García-Carrancá, Alejandro; Herrera, Luis A; Lizano, Marcela

2017-07-05

Persistent infections with high-risk human papillomavirus (HPV) constitute the main risk factor for cervical cancer development. HPV16 is the most frequent type associated to squamous cell carcinomas (SCC), followed by HPV18. The long control region (LCR) in the HPV genome contains the replication origin and sequences recognized by cellular transcription factors (TFs) controlling viral transcription. Altered expression of E6 and E7 viral oncogenes, modulated by the LCR, causes modifications in cellular pathways such as proliferation, leading to malignant transformation. The aim of this study was to identify specific TFs that could contribute to the modulation of high-risk HPV transcriptional activity, related to the cellular histological origin. We identified sex determining region Y (SRY)-box 2 (SOX2) response elements present in HPV16-LCR. SOX2 binding to the LCR was demonstrated by in vivo and in vitro assays. The overexpression of this TF repressed HPV16-LCR transcriptional activity, as shown through reporter plasmid assays and by the down-regulation of endogenous HPV oncogenes. Site-directed mutagenesis revealed that three putative SOX2 binding sites are involved in the repression of the LCR activity. We propose that SOX2 acts as a transcriptional repressor of HPV16-LCR, decreasing the expression of E6 and E7 oncogenes in a SCC context.

Isolation of a promoter region in mouse cytochrome P450 3A (Cyp3A16) gene and its transcriptional control.

PubMed

Itoh, S; Abe, Y; Kubo, A; Okuda, M; Shimoji, M; Nakayama, K; Kamataki, T

1997-02-07

An 11.5 kb fragment of the mouse Cyp3a16 gene containing the 5' flanking region was isolated from the lambda DASHII mouse genomic library. A part of the 5' flanking region and the first exon of Cyp3a16 gene were sequenced. S1 mapping analysis showed the presence of two transcriptional initiation sites. The first exon was completely identical to Cyp3a16 cDNA. The identity of 5' flanking sequences between Cyp3a16 and Cyp3a11 genes was about 69%. A typical TATA box and a basic transcription element (BTE) were found as seen with other CYP3A genes from various animal species Moreover, some putative transcriptional regulatory elements were also found in addition to the sequence motif seen for the formation of Z-type DNA. To examine the transcriptional activity of Cyp3a11 gene, DNA fragments in the 5'-flanking region of the gene were inserted front of the luciferase structural gene, and the constructs were transfected in primary hepatocytes. The analysis of the luciferase activity indicated that the region between -146 and -56 was necessary for the transcription of CYP3a16 gene.

Chromatin-associated HMG-17 is a major regulator of homeodomain transcription factor activity modulated by Wnt/β-catenin signaling

PubMed Central

Amen, Melanie; Espinoza, Herbert M.; Cox, Carol; Liang, Xiaowen; Wang, Jianbo; Link, Todd M. E.; Brennan, Richard G.; Martin, James F.; Amendt, Brad A.

2008-01-01

Homeodomain (HD) transcriptional activities are tightly regulated during embryogenesis and require protein interactions for their spatial and temporal activation. The chromatin-associated high mobility group protein (HMG-17) is associated with transcriptionally active chromatin, however its role in regulating gene expression is unclear. This report reveals a unique strategy in which, HMG-17 acts as a molecular switch regulating HD transcriptional activity. The switch utilizes the Wnt/β-catenin signaling pathway and adds to the diverse functions of β-catenin. A high-affinity HMG-17 interaction with the PITX2 HD protein inhibits PITX2 DNA-binding activity. The HMG-17/PITX2 inactive complex is concentrated to specific nuclear regions primed for active transcription. β-Catenin forms a ternary complex with PITX2/HMG-17 to switch it from a repressor to an activator complex. Without β-catenin, HMG-17 can physically remove PITX2 from DNA to inhibit its transcriptional activity. The PITX2/HMG-17 regulatory complex acts independently of promoter targets and is a general mechanism for the control of HD transcriptional activity. HMG-17 is developmentally regulated and its unique role during embryogenesis is revealed by the early embryonic lethality of HMG-17 homozygous mice. This mechanism provides a new role for canonical Wnt/β-catenin signaling in regulating HD transcriptional activity during development using HMG-17 as a molecular switch. PMID:18045789

Dynamic phosphorylation of RelA on Ser42 and Ser45 in response to TNFα stimulation regulates DNA binding and transcription.

PubMed

Lanucara, Francesco; Lam, Connie; Mann, Jelena; Monie, Tom P; Colombo, Stefano A P; Holman, Stephen W; Boyd, James; Dange, Manohar C; Mann, Derek A; White, Michael R H; Eyers, Claire E

2016-07-01

The NF-κB signalling module controls transcription through a network of protein kinases such as the IKKs, as well as inhibitory proteins (IκBs) and transcription factors including RelA/p65. Phosphorylation of the NF-κB subunits is critical for dictating system dynamics. Using both non-targeted discovery and quantitative selected reaction monitoring-targeted proteomics, we show that the cytokine TNFα induces dynamic multisite phosphorylation of RelA at a number of previously unidentified residues. Putative roles for many of these phosphorylation sites on RelA were predicted by modelling of various crystal structures. Stoichiometry of phosphorylation determination of Ser45 and Ser42 revealed preferential early phosphorylation of Ser45 in response to TNFα. Quantitative analyses subsequently confirmed differential roles for pSer42 and pSer45 in promoter-specific DNA binding and a role for both of these phosphosites in regulating transcription from the IL-6 promoter. These temporal dynamics suggest that RelA-mediated transcription is likely to be controlled by functionally distinct NF-κB proteoforms carrying different combinations of modifications, rather than a simple 'one modification, one effect' system. © 2016 The Authors.

Inference of Expanded Lrp-Like Feast/Famine Transcription Factor Targets in a Non-Model Organism Using Protein Structure-Based Prediction

PubMed Central

Ashworth, Justin; Plaisier, Christopher L.; Lo, Fang Yin; Reiss, David J.; Baliga, Nitin S.

2014-01-01

Widespread microbial genome sequencing presents an opportunity to understand the gene regulatory networks of non-model organisms. This requires knowledge of the binding sites for transcription factors whose DNA-binding properties are unknown or difficult to infer. We adapted a protein structure-based method to predict the specificities and putative regulons of homologous transcription factors across diverse species. As a proof-of-concept we predicted the specificities and transcriptional target genes of divergent archaeal feast/famine regulatory proteins, several of which are encoded in the genome of Halobacterium salinarum. This was validated by comparison to experimentally determined specificities for transcription factors in distantly related extremophiles, chromatin immunoprecipitation experiments, and cis-regulatory sequence conservation across eighteen related species of halobacteria. Through this analysis we were able to infer that Halobacterium salinarum employs a divergent local trans-regulatory strategy to regulate genes (carA and carB) involved in arginine and pyrimidine metabolism, whereas Escherichia coli employs an operon. The prediction of gene regulatory binding sites using structure-based methods is useful for the inference of gene regulatory relationships in new species that are otherwise difficult to infer. PMID:25255272

Inference of expanded Lrp-like feast/famine transcription factor targets in a non-model organism using protein structure-based prediction.

PubMed

Ashworth, Justin; Plaisier, Christopher L; Lo, Fang Yin; Reiss, David J; Baliga, Nitin S

2014-01-01

Widespread microbial genome sequencing presents an opportunity to understand the gene regulatory networks of non-model organisms. This requires knowledge of the binding sites for transcription factors whose DNA-binding properties are unknown or difficult to infer. We adapted a protein structure-based method to predict the specificities and putative regulons of homologous transcription factors across diverse species. As a proof-of-concept we predicted the specificities and transcriptional target genes of divergent archaeal feast/famine regulatory proteins, several of which are encoded in the genome of Halobacterium salinarum. This was validated by comparison to experimentally determined specificities for transcription factors in distantly related extremophiles, chromatin immunoprecipitation experiments, and cis-regulatory sequence conservation across eighteen related species of halobacteria. Through this analysis we were able to infer that Halobacterium salinarum employs a divergent local trans-regulatory strategy to regulate genes (carA and carB) involved in arginine and pyrimidine metabolism, whereas Escherichia coli employs an operon. The prediction of gene regulatory binding sites using structure-based methods is useful for the inference of gene regulatory relationships in new species that are otherwise difficult to infer.

A Third Approach to Gene Prediction Suggests Thousands of Additional Human Transcribed Regions

PubMed Central

Glusman, Gustavo; Qin, Shizhen; El-Gewely, M. Raafat; Siegel, Andrew F; Roach, Jared C; Hood, Leroy; Smit, Arian F. A

2006-01-01

The identification and characterization of the complete ensemble of genes is a main goal of deciphering the digital information stored in the human genome. Many algorithms for computational gene prediction have been described, ultimately derived from two basic concepts: (1) modeling gene structure and (2) recognizing sequence similarity. Successful hybrid methods combining these two concepts have also been developed. We present a third orthogonal approach to gene prediction, based on detecting the genomic signatures of transcription, accumulated over evolutionary time. We discuss four algorithms based on this third concept: Greens and CHOWDER, which quantify mutational strand biases caused by transcription-coupled DNA repair, and ROAST and PASTA, which are based on strand-specific selection against polyadenylation signals. We combined these algorithms into an integrated method called FEAST, which we used to predict the location and orientation of thousands of putative transcription units not overlapping known genes. Many of the newly predicted transcriptional units do not appear to code for proteins. The new algorithms are particularly apt at detecting genes with long introns and lacking sequence conservation. They therefore complement existing gene prediction methods and will help identify functional transcripts within many apparent “genomic deserts.” PMID:16543943

Transcription through the eye of a needle: daily and annual cyclic gene expression variation in Douglas-fir needles.

PubMed

Cronn, Richard; Dolan, Peter C; Jogdeo, Sanjuro; Wegrzyn, Jill L; Neale, David B; St Clair, J Bradley; Denver, Dee R

2017-07-24

Perennial growth in plants is the product of interdependent cycles of daily and annual stimuli that induce cycles of growth and dormancy. In conifers, needles are the key perennial organ that integrates daily and seasonal signals from light, temperature, and water availability. To understand the relationship between seasonal cycles and seasonal gene expression responses in conifers, we examined diurnal and circannual needle mRNA accumulation in Douglas-fir (Pseudotsuga menziesii) needles at diurnal and circannual scales. Using mRNA sequencing, we sampled 6.1 × 10 9 reads from 19 trees and constructed a de novo pan-transcriptome reference that includes 173,882 tree-derived transcripts. Using this reference, we mapped RNA-Seq reads from 179 samples that capture daily and annual variation. We identified 12,042 diurnally-cyclic transcripts, 9299 of which showed homology to annotated genes from other plant genomes, including angiosperm core clock genes. Annual analysis revealed 21,225 circannual transcripts, 17,335 of which showed homology to annotated genes from other plant genomes. The timing of maximum gene expression is associated with light intensity at diurnal scales and photoperiod at annual scales, with approximately half of transcripts reaching maximum expression +/- 2 h from sunrise and sunset, and +/- 20 days from winter and summer solstices. Comparisons with published studies from other conifers shows congruent behavior in clock genes with Japanese cedar (Cryptomeria), and a significant preservation of gene expression patterns for 2278 putative orthologs from Douglas-fir during the summer growing season, and 760 putative orthologs from spruce (Picea) during the transition from fall to winter. Our study highlight the extensive diurnal and circannual transcriptome variability demonstrated in conifer needles. At these temporal scales, 29% of expressed transcripts show a significant diurnal cycle, and 58.7% show a significant circannual cycle. Remarkably, thousands of genes reach their annual peak activity during winter dormancy. Our study establishes the fine-scale timing of daily and annual maximum gene expression for diverse needle genes in Douglas-fir, and it highlights the potential for using this information for evaluating hypotheses concerning the daily or seasonal timing of gene activity in temperate-zone conifers, and for identifying cyclic transcriptome components in other conifer species.

Role of an Iron-Dependent Transcriptional Regulator in the Pathogenesis and Host Response to Infection with Streptococcus pneumoniae

PubMed Central

Gupta, Radha; Bhatty, Minny; Swiatlo, Edwin; Nanduri, Bindu

2013-01-01

Iron is a critical cofactor for many enzymes and is known to regulate gene expression in many bacterial pathogens. Streptococcus pneumoniae normally inhabits the upper respiratory mucosa but can also invade and replicate in lungs and blood. These anatomic sites vary considerably in both the quantity and form of available iron. The genome of serotype 4 pneumococcal strain TIGR4 encodes a putative iron-dependent transcriptional regulator (IDTR). A mutant deleted at idtr (Δidtr) exhibited growth kinetics similar to parent strain TIGR4 in vitro and in mouse blood for up to 48 hours following infection. However, Δidtr was significantly attenuated in a murine model of sepsis. IDTR down-regulates the expression of ten characterized and putative virulence genes in nasopharyngeal colonization and pneumonia. The host cytokine response was significantly suppressed in sepsis with Δidtr. Since an exaggerated inflammatory response is associated with a poor prognosis in sepsis, the decreased inflammatory response could explain the increased survival with Δidtr. Our results suggest that IDTR, which is dispensable for pneumococcal growth in vitro, is associated with regulation of pneumococcal virulence in specific host environments. Additionally, IDTR ultimately modulates the host cytokine response and systemic inflammation that contributes to morbidity and mortality of invasive pneumococcal disease. PMID:23437050

Venom Gland Transcriptomic and Proteomic Analyses of the Enigmatic Scorpion Superstitionia donensis (Scorpiones: Superstitioniidae), with Insights on the Evolution of Its Venom Components.

PubMed

Santibáñez-López, Carlos E; Cid-Uribe, Jimena I; Batista, Cesar V F; Ortiz, Ernesto; Possani, Lourival D

2016-12-09

Venom gland transcriptomic and proteomic analyses have improved our knowledge on the diversity of the heterogeneous components present in scorpion venoms. However, most of these studies have focused on species from the family Buthidae. To gain insights into the molecular diversity of the venom components of scorpions belonging to the family Superstitioniidae, one of the neglected scorpion families, we performed a transcriptomic and proteomic analyses for the species Superstitionia donensis . The total mRNA extracted from the venom glands of two specimens was subjected to massive sequencing by the Illumina protocol, and a total of 219,073 transcripts were generated. We annotated 135 transcripts putatively coding for peptides with identity to known venom components available from different protein databases. Fresh venom collected by electrostimulation was analyzed by LC-MS/MS allowing the identification of 26 distinct components with sequences matching counterparts from the transcriptomic analysis. In addition, the phylogenetic affinities of the found putative calcins, scorpines, La1-like peptides and potassium channel κ toxins were analyzed. The first three components are often reported as ubiquitous in the venom of different families of scorpions. Our results suggest that, at least calcins and scorpines, could be used as molecular markers in phylogenetic studies of scorpion venoms.

The transcriptome recipe for the venom cocktail of Tityus bahiensis scorpion.

PubMed

de Oliveira, Ursula Castro; Candido, Denise Maria; Dorce, Valquíria Abrão Coronado; Junqueira-de-Azevedo, Inácio de Loiola Meirelles

2015-03-01

Scorpion venom is a mixture of peptides, including antimicrobial, bradykinin-potentiating and anionic peptides and small to medium proteins, such as ion channel toxins, metalloproteinases and phospholipases that together cause severe clinical manifestation. Tityus bahiensis is the second most medically important scorpion species in Brazil and it is widely distributed in the country with the exception of the North Region. Here we sequenced and analyzed the transcripts from the venom glands of T. bahiensis, aiming at identifying and annotating venom gland expressed genes. A total of 116,027 long reads were generated by pyrosequencing and assembled in 2891 isotigs. An annotation process identified transcripts by similarity to known toxins, revealing that putative venom components represent 7.4% of gene expression. The major toxins identified are potassium and sodium channel toxins, whereas metalloproteinases showed an unexpected high abundance. Phylogenetic analysis of deduced metalloproteinases from T. bahiensis and other scorpions revealed a pattern of ancient and intraspecific gene expansions. Other venom molecules identified include antimicrobial, anionic and bradykinin-potentiating peptides, besides several putative new venom components. This report provides the first attempt to massively identify the venom components of this species and constitutes one of the few transcriptomic efforts on the genus Tityus. Copyright © 2015 Elsevier Ltd. All rights reserved.

Venom Gland Transcriptomic and Proteomic Analyses of the Enigmatic Scorpion Superstitionia donensis (Scorpiones: Superstitioniidae), with Insights on the Evolution of Its Venom Components

PubMed Central

Santibáñez-López, Carlos E.; Cid-Uribe, Jimena I.; Batista, Cesar V. F.; Ortiz, Ernesto; Possani, Lourival D.

2016-01-01

Venom gland transcriptomic and proteomic analyses have improved our knowledge on the diversity of the heterogeneous components present in scorpion venoms. However, most of these studies have focused on species from the family Buthidae. To gain insights into the molecular diversity of the venom components of scorpions belonging to the family Superstitioniidae, one of the neglected scorpion families, we performed a transcriptomic and proteomic analyses for the species Superstitionia donensis. The total mRNA extracted from the venom glands of two specimens was subjected to massive sequencing by the Illumina protocol, and a total of 219,073 transcripts were generated. We annotated 135 transcripts putatively coding for peptides with identity to known venom components available from different protein databases. Fresh venom collected by electrostimulation was analyzed by LC-MS/MS allowing the identification of 26 distinct components with sequences matching counterparts from the transcriptomic analysis. In addition, the phylogenetic affinities of the found putative calcins, scorpines, La1-like peptides and potassium channel κ toxins were analyzed. The first three components are often reported as ubiquitous in the venom of different families of scorpions. Our results suggest that, at least calcins and scorpines, could be used as molecular markers in phylogenetic studies of scorpion venoms. PMID:27941686