Predictive value of preoperative electrocardiography for perioperative cardiovascular outcomes in patients undergoing noncardiac, nonvascular surgery.

PubMed

Biteker, Murat; Duman, Dursun; Tekkeşin, Ahmet Ilker

2012-08-01

The utility of routine preoperative electrocardiography (ECG) for assessing perioperative cardiovascular risk in patients undergoing noncardiac, nonvascular surgery (NCNVS) is unclear. There would be an association between preoperative ECG and perioperative cardiovascular outcomes in patients undergoing NCNVS. A total of 660 patients undergoing NCNVS were prospectively evaluated. Patients age >18 years who underwent an elective, nonday case, open surgical procedure were enrolled. Troponin I concentrations and 12-lead ECG were evaluated the day before surgery, immediately after surgery, and on the first 5 postoperative days. Preoperative ECG showing atrial fibrillation, left or right bundle branch block, left ventricular hypertrophy, frequent premature ventricular complexes, pacemaker rhythm, Q-wave, ST-segment changes, or sinus tachycardia or bradycardia were classified as abnormal. The patients were followed up during hospitalization and were evaluated for the presence of perioperative cardiovascular events (PCE). Eighty patients (12.1%) experienced PCE. Patients with abnormal ECG findings had a greater incidence of PCE than those with normal ECG results (16% vs 6.4%; P < 0.001). Mean QTc interval was significantly longer in the patients who had PCE (436.6 ± 31.4 vs 413.3 ± 16.7 ms; P < 0.001). Univariate analysis showed a significant association between preoperative atrial fibrillation, pacemaker rhythm, ST-segment changes, QTc prolongation, and in-hospital PCE. However, only QTc prolongation (odds ratio: 1.15, 95% confidence interval: 1.06-1.2, P < 0.001) was an independent predictor of PCE according to the multivariate analysis. Every 10-ms increase in QTc interval was related to a 13% increase for PCE. Prolongation of the QTc interval on the preoperative ECG was related with PCE in patients undergoing NCNVS. © 2011 Wiley Periodicals, Inc.

Role of mixed ion channel effects in the cardiovascular safety assessment of the novel anti-MRSA fluoroquinolone JNJ-Q2.

PubMed

Eichenbaum, G; Pugsley, M K; Gallacher, D J; Towart, R; McIntyre, G; Shukla, U; Davenport, J M; Lu, H R; Rohrbacher, J; Hillsamer, V

2012-07-01

JNJ-Q2, a novel broad-spectrum fluoroquinolone with anti-methicillin-resistant Staphylococcus aureus activity, was evaluated in a comprehensive set of non-clinical and clinical cardiovascular safety studies. The effect of JNJ-Q2 on different cardiovascular parameters was compared with that of moxifloxacin, sparfloxacin and ofloxacin. Through comparisons with these well-known fluoroquinolones, the importance of effects on compensatory ion channels to the cardiovascular safety of JNJ-Q2 was investigated. JNJ-Q2 and comparator fluoroquinolones were evaluated in the following models/test systems: hERG-transfected HEK293 cells sodium channel-transfected CHO cells, guinea pig right atria, arterially perfused rabbit left ventricular wedge preparations and in vivo studies in anaesthetized guinea pigs, anaesthetized and conscious telemetered dogs, and a thorough QT study in humans. The trend for effects of JNJ-Q2 on Tp-Te, QT, QRS and PR intervals in the non-clinical models and the plateau in QTc with increasing plasma concentration in humans are consistent with offsetting sodium and calcium channel activities that were observed in the non-clinical studies. These mixed ion channel activities result in the less pronounced or comparable increase in QTc interval for JNJ-Q2 compared with moxifloxacin and sparfloxacin despite its greater in vitro inhibition of I(Kr). Based on the non-clinical and clinical cardiovascular safety assessment, JNJ-Q2 has a safe cardiovascular profile for administration in humans with comparable or reduced potential to prolong QT intervals, compared with moxifloxacin. The results demonstrate the importance of compensatory sodium and calcium channel activity in offsetting potassium channel activity for compounds with a fluoroquinolone core. © 2012 Janssen Pharmaceutical Companies of Johnson & Johnson. British Journal of Pharmacology © 2012 The British Pharmacological Society.

Effects of 4-aminopyridine on cardiac repolarization, PR interval, and heart rate in patients with spinal cord injury.

PubMed

Isoda, Wakana C; Segal, Jack L

2003-02-01

To determine the effects of 4-aminopyridine (4-AP) on heart rate and PR, QT, and QTc intervals in patients with longstanding spinal cord injury (SCI). Randomized, active-treatment-controlled, dose level-blinded study, with allocation concealed. University-affiliated, tertiary care medical center. Sixty otherwise healthy male and female outpatients with traumatic SCI of more than 1 year's duration. Intervention. Oral administration and dose titration to tolerance of an immediate-release formulation of 4-AP. The PR interval, heart rate, QT interval, and QTc interval obtained from standard 12-lead electrocardiograms (ECGs) at baseline (before administration of 4-AP) and after 1 month of treatment were compared. The QTc intervals were derived by using Bazett's formula (equation) incorporated into standard computerized analyses of 12-lead ECG printouts. The paired t test was performed to test for the significance of differences between means and variances. No statistically significant differences were noted in heart rate or between ECG time intervals measured at baseline and after 1 month of treatment with 4-AP among all patients with SCI or between subgroups stratified by injury level (tetraplegia, paraplegia) or sex. During the 1-month period that 4-AP was administered, the heart rate and PR, QT, and QTc intervals all remained unchanged and stayed well within normal range in comparison to literature-derived control values. 4-Aminopyridine does not appear to influence the length of cardiac time intervals or heart rate and, hence, is unlikely to cause potentially life-threatening ventricular dysrrhythmias when administered long-term and taken orally in dosages of up to 30 mg/day. Specifically, cardiac repolarization (QTc interval) is unaffected in patients with SCI who continuously receive 4-AP for up to 1 month.

Underestimated and unreported prolonged QTc by automated ECG analysis in patients on methadone: can we rely on computer reading?

PubMed

Talebi, Soheila; Azhir, Alaleh; Zuber, Sam; Soman, Sandeep; Visco, Ferdinand; Totouom-Tangho, Holly; Kalantar, Hossein; Worku Hassen, Getaw

2015-04-01

Recognition of prolonged corrected QT (QTc) interval is of particular importance, especially when using medications known to prolong QTc interval. Methadone can prolong the QTc interval and has the potential to induce torsades de pointes. The objective of this study is to investigate the accuracy of computerized ECG analysis in correctly identifying and reporting QTc interval in patients on methadone. We conducted a retrospective review of ECGs in the Muse electronic database of patients on methadone who are above 18 years old between January 2012 and December 2013 at an urban community hospital. ECGs were analyzed by the Marquette 12SL ECG Analysis Program (GE'Healthcare) reviewed by a cardiologist. A total of 826 ECGs of patients on methadone were examined manually for the QTc interval, of which 625 (75.7%) had QTc less than 470 ms, 149 (18%) had QTc between 470-499 ms and 52 (6.3%) had QTc more than 499 ms. QTc between 470-499 ms was underestimated by machine in 19 (12.8%) ECGs and QTc more than 499 ms was underestimated in 10 (19.6%) when compared to manually calculated QTc. QTc prolongation was underreported in 63 ECGs (48.5%) of those whose QTc between 470-499 ms and in 1 ECG (2.4%) of those whose QTc was more than 499 ms. QTc can be underestimated or unreported by the computer analysis. Physicians not only should calculate QTc manually but also examine the actual QTc value displayed on the report before concluding that this parameter is normal, especially in patients who are at risk of QTc prolongation.

Effect of Age and Sex on the QTc Interval in Children and Adolescents With Type 1 and 2 Long-QT Syndrome.

PubMed

Vink, Arja S; Clur, Sally-Ann B; Geskus, Ronald B; Blank, Andreas C; De Kezel, Charlotte C A; Yoshinaga, Masao; Hofman, Nynke; Wilde, Arthur A M; Blom, Nico A

2017-04-01

In congenital long-QT syndrome, age, sex, and genotype have been associated with cardiac events, but their effect on the trend in QTc interval has never been established. We, therefore, aimed to assess the effect of age and sex on the QTc interval in children and adolescents with type 1 (LQT1) and type 2 (LQT2) long-QT syndrome. QTc intervals of 12-lead resting electrocardiograms were determined, and trends over time were analyzed using a linear mixed-effects model. The study included 278 patients with a median follow-up of 4 years (interquartile range, 1-9) and a median number of 6 (interquartile range, 2-10) electrocardiograms per patient. Both LQT1 and LQT2 male patients showed QTc interval shortening after the onset of puberty. In LQT2 male patients, this was preceded by a progressive QTc interval prolongation. In LQT1, after the age of 12 years, male patients had a significantly shorter QTc interval than female patients. In LQT2, during the first years of life and from 14 to 26 years, male patients had a significantly shorter QTc interval than female patients. On the contrary, between 5 and 14 years, LQT2 male patients had significantly longer QTc interval than LQT2 female patients. There is a significant effect of age and sex on the QTc interval in long-QT syndrome, with a unique pattern per genotype. The age of 12 to 14 years is an important transitional period. In the risk stratification and management of long-QT syndrome patients, clinicians should be aware of these age-, sex-, and genotype-related trends in QTc interval and especially the important role of the onset of puberty. © 2017 American Heart Association, Inc.

Prevalence, Risk Factors and In-hospital Outcomes of QTc Interval Prolongation in Liver Cirrhosis.

PubMed

Zhao, Jiancheng; Qi, Xingshun; Hou, Feifei; Ning, Zheng; Zhang, Xintong; Deng, Han; Peng, Ying; Li, Jing; Wang, Xiaoxi; Li, Hongyu; Guo, Xiaozhong

2016-09-01

QTc interval prolongation is an electrocardiographic abnormality in liver cirrhosis. The objective of this study was to evaluate the prevalence, risk factors and in-hospital outcomes of QTc interval prolongation in Chinese patients with liver cirrhosis. This was a retrospective analysis of a total of 1,268 patients with liver cirrhosis who were consecutively admitted to our hospital between January 2011 and June 2014. QTc interval data were collected from the medical records. QTc interval prolongation was defined as QTc interval > 440 milliseconds. The prevalence of QTc interval prolongation was 38.2% (485 of 1268). In the entire cohort, the risk factors for QTc interval prolongation included an older age, a higher proportion of alcohol abuse and ascites, higher bilirubin, blood urea nitrogen, creatinine, prothrombin time, international normalized ratio, Child-Pugh score and model for end-stage liver diseases score, and lower red blood cell (RBC), hemoglobin (Hb), albumin (ALB), alanine aminotransferase and calcium. The in-hospital mortality was not significantly different between patients with and without QTc interval prolongation (2.1% versus 1.3%, P = 0.276). In the subgroup analyses of patients with hepatitis B virus or alcohol alone-related liver cirrhosis, the risk factors included higher bilirubin, creatinine, prothrombin time, international normalized ratio, Child-Pugh score and model for end-stage liver diseases score, and lower RBC, Hb and ALB. In the subgroups analyses of patients with acute upper gastrointestinal bleeding or ascites, the risk factors included lower RBC, Hb and ALB. QTc interval prolongation was frequent in liver cirrhosis. Although QTc interval prolongation was positively associated with alcohol-related liver cirrhosis and more severe liver dysfunction, it did not significantly influence the in-hospital mortality. Copyright © 2016 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

No effect on QT intervals of mipomersen, a 2'-O-methoxyethyl modified antisense oligonucleotide targeting ApoB-100 mRNA, in a phase I dose escalation placebo-controlled study, and confirmed by a thorough QT (tQT) study, in healthy subjects.

PubMed

Yu, Rosie Z; Gunawan, Rudy; Li, Zhaoyang; Mittleman, Robert S; Mahmood, Asif; Grundy, John S; Singleton, Walter; Geary, Richard; Wang, Yanfeng

2016-03-01

The aim of this study to evaluate the effect of mipomersen on QT intervals in a phase I dose escalation, placebo-controlled study, and a thorough QT (tQT) study in healthy subjects. In the initial phase I study, 29 healthy subjects received either single or multiple (for 4 weeks) ascending doses of mipomersen (50-400 mg) administered subcutaneously (SC) or via a 2-h intravenous (IV) infusion, and 7 subjects received placebo. In the confirmative tQT study, 58 healthy subjects received placebo, 400 mg IV moxifloxacin, 200 mg SC, or 200 mg IV of mipomersen in a double-blind, 4-way crossover design with a minimum 5-day washout between treatments. ECG measurements were performed at baseline and selected time points (including Tmax). The correlation between QTcF intervals corrected for baseline and time-matched placebo when available with PK plasma exposure was evaluated by linear regression analysis. In the phase I study, no positive correlation between the PK exposure and ∆QTcF or ∆∆QTcF was observed within the wide dose or exposure range tested. Similar results were observed in the tQT study, where the predicted ΔΔQTcF and its upper bound of the 90% CI at Cmax of therapeutic and supratherapeutic dose were approximately -1.7 and 2.9 ms, respectively. Mipomersen showed no effect on QT intervals in both the phase I dose escalation study and the tQT study. These results support the proposal that QT assessment can be made in a phase I dose escalation study, and no tQT study may be necessary if the phase I dose escalation study showed a negative QT effect.

Automated Algorithm for J-Tpeak and Tpeak-Tend Assessment of Drug-Induced Proarrhythmia Risk

DOE PAGES

Johannesen, Lars; Vicente, Jose; Hosseini, Meisam; ...

2016-12-30

Prolongation of the heart rate corrected QT (QTc) interval is a sensitive marker of torsade de pointes risk; however it is not specific as QTc prolonging drugs that block inward currents are often not associated with torsade. Recent work demonstrated that separate analysis of the heart rate corrected J-T peakc (J-T peakc) and T peak-T end intervals can identify QTc prolonging drugs with inward current block and is being proposed as a part of a new cardiac safety paradigm for new drugs (the “CiPA” initiative). In this work, we describe an automated measurement methodology for assessment of the J-T peakcmore » and T peak-T end intervals using the vector magnitude lead. The automated measurement methodology was developed using data from one clinical trial and was evaluated using independent data from a second clinical trial. Comparison between the automated and the prior semi-automated measurements shows that the automated algorithm reproduces the semi-automated measurements with a mean difference of single-deltas <1 ms and no difference in intra-time point variability (p for all > 0.39). In addition, the time-profile of the baseline and placebo-adjusted changes are within 1 ms for 63% of the time-points (86% within 2 ms). Importantly, the automated results lead to the same conclusions about the electrophysiological mechanisms of the studied drugs. We have developed an automated algorithm for assessment of J-T peakc and T peak-T end intervals that can be applied in clinical drug trials. Under the CiPA initiative this ECG assessment would determine if there are unexpected ion channel effects in humans compared to preclinical studies. In conclusion, the algorithm is being released as open-source software.« less

Automated Algorithm for J-Tpeak and Tpeak-Tend Assessment of Drug-Induced Proarrhythmia Risk

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johannesen, Lars; Vicente, Jose; Hosseini, Meisam

Prolongation of the heart rate corrected QT (QTc) interval is a sensitive marker of torsade de pointes risk; however it is not specific as QTc prolonging drugs that block inward currents are often not associated with torsade. Recent work demonstrated that separate analysis of the heart rate corrected J-T peakc (J-T peakc) and T peak-T end intervals can identify QTc prolonging drugs with inward current block and is being proposed as a part of a new cardiac safety paradigm for new drugs (the “CiPA” initiative). In this work, we describe an automated measurement methodology for assessment of the J-T peakcmore » and T peak-T end intervals using the vector magnitude lead. The automated measurement methodology was developed using data from one clinical trial and was evaluated using independent data from a second clinical trial. Comparison between the automated and the prior semi-automated measurements shows that the automated algorithm reproduces the semi-automated measurements with a mean difference of single-deltas <1 ms and no difference in intra-time point variability (p for all > 0.39). In addition, the time-profile of the baseline and placebo-adjusted changes are within 1 ms for 63% of the time-points (86% within 2 ms). Importantly, the automated results lead to the same conclusions about the electrophysiological mechanisms of the studied drugs. We have developed an automated algorithm for assessment of J-T peakc and T peak-T end intervals that can be applied in clinical drug trials. Under the CiPA initiative this ECG assessment would determine if there are unexpected ion channel effects in humans compared to preclinical studies. In conclusion, the algorithm is being released as open-source software.« less

Short-Duration Spaceflight Does Not Prolong QTc Intervals in Male Astronauts

NASA Technical Reports Server (NTRS)

Mitchell, Brett M.; Meck, Janice V.

2004-01-01

Although ventricular dysrhythmias are not increased during, and QTc intervals are not prolonged after, short-duration (5 to 16 days) spaceflights, QTc intervals have not previously been reported during these shorter flights. Holter monitor recordings, obtained in 11 male astronauts who flew on shuttle missions ranging from 5 to 10 days, showed that QTc intervals did not change significantly 10 days before launch, on 2 separate days of spaceflight, and 2 days after landing. Taken together, these data and our previous report show that QTc interval prolongation occurs sometime between the 9th and 30th days of spaceflight.

Xenon does not increase heart rate-corrected cardiac QT interval in volunteers and in patients free of cardiovascular disease.

PubMed

Neukirchen, Martin; Schaefer, Maximilian S; Kern, Carolin; Brett, Sarah; Werdehausen, Robert; Rellecke, Philipp; Reyle-Hahn, Matthias; Kienbaum, Peter

2015-09-01

Impaired cardiac repolarization, indicated by prolonged QT interval, may cause critical ventricular arrhythmias. Many anesthetics increase the QT interval by blockade of rapidly acting potassium rectifier channels. Although xenon does not affect these channels in isolated cardiomyocytes, the authors hypothesized that xenon increases the QT interval by direct and/or indirect sympathomimetic effects. Thus, the authors tested the hypothesis that xenon alters the heart rate-corrected cardiac QT (QTc) interval in anesthetic concentrations. The effect of xenon on the QTc interval was evaluated in eight healthy volunteers and in 35 patients undergoing abdominal or trauma surgery. The QTc interval was recorded on subjects in awake state, after their denitrogenation, and during xenon monoanesthesia (FetXe > 0.65). In patients, the QTc interval was recorded while awake, after anesthesia induction with propofol and remifentanil, and during steady state of xenon/remifentanil anesthesia (FetXe > 0.65). The QTc interval was determined from three consecutive cardiac intervals on electrocardiogram printouts in a blinded manner and corrected with Bazett formula. In healthy volunteers, xenon did not alter the QTc interval (mean difference: +0.11 ms [95% CI, -22.4 to 22.7]). In patients, after anesthesia induction with propofol/remifentanil, no alteration of QTc interval was noted. After propofol was replaced with xenon, the QTc interval remained unaffected (417 ± 32 ms vs. awake: 414 ± 25 ms) with a mean difference of 4.4 ms (95% CI, -4.6 to 13.5). Xenon monoanesthesia in healthy volunteers and xenon/remifentanil anesthesia in patients without clinically relevant cardiovascular disease do not increase QTc interval.

Paced QT interval as a risk factor for new-onset left ventricular systolic dysfunction and cardiac death after permanent pacemaker implantation.

PubMed

Cho, Eun Jeong; Park, Seung-Jung; Park, Kyoung Min; On, Young Keun; Kim, June Soo

2016-01-15

Prolongation of corrected QT (QTc) interval reflects an increased risk of fatal arrhythmia and cardiac death in various populations. However, it is not clear whether the paced-QTc (p-QTc) interval is associated with new-onset left ventricular systolic dysfunction (new-LVSD) or cardiac death. In 491 consecutive patients (64 ± 14 years) with preserved LV ejection fraction (64 ± 7%), the p-QTc interval was measured within 2 weeks after PPM implantation. We assessed the rates of new-LVSD and cardiac death based on the degree of p-QTc interval. During the follow-up period (78 ± 51 months), new-LVSD and cardiac death were identified in 53 (10.8%) and 26 (5.3%) patients, respectively. Patients with new-LVSD had more frequent atrioventricular block (P=0.041), a higher percentage of ventricular pacing (P=0.005), a longer p-QRS duration (P<0.001), and more prolonged p-QTc interval (P<0.001) compared to those without new-LVSD. There was a graded increase in the rates of new-LVSD (P<0.001) and cardiac death (P=0.001) from the patients in the lowest to those in the highest tertile of the p-QTc interval. Additionally, the incidence of cardiac death was significantly elevated especially in the patients with new-LVSD and wider p-QTc interval. In Cox regression analyses, the p-QTc interval was independently associated with new-LVSD and cardiac death even after adjusted with various relevant confounding factors. Prolonged p-QTc interval was closely associated with new-LVSD and cardiac death after PPM implantation in patients with preserved LV systolic function. The rate of cardiac death significantly increased especially in patients who showed more p-QTc widening along with new-LVSD. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Palbociclib has no clinically relevant effect on the QTc interval in patients with advanced breast cancer.

PubMed

Durairaj, Chandrasekar; Ruiz-Garcia, Ana; Gauthier, Eric R; Huang, Xin; Lu, Dongrui R; Hoffman, Justin T; Finn, Richard S; Joy, Anil A; Ettl, Johannes; Rugo, Hope S; Zheng, Jenny; Wilner, Keith D; Wang, Diane D

2018-03-01

The aim of this study was to assess the potential effects of palbociclib in combination with letrozole on QTc. PALOMA-2, a phase 3, randomized, double-blind, placebo-controlled trial, compared palbociclib plus letrozole with placebo plus letrozole in postmenopausal women with estrogen receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer. The study included a QTc evaluation substudy carried out as a definitive QT interval prolongation assessment for palbociclib. Time-matched triplicate ECGs were performed at 0, 2, 4, 6, and 8 h at baseline (Day 0) and on Cycle 1 Day 14. Additional ECGs were collected from all patients for safety monitoring. The QT interval was corrected for heart rate using Fridericia's correction (QTcF), Bazett's correction (QTcB), and a study-specific correction factor (QTcS). In total, 666 patients were randomized 2 : 1 to palbociclib plus letrozole or placebo plus letrozole. Of these, 125 patients were enrolled in the QTc evaluation substudy. No patients in the palbociclib plus letrozole arm of the substudy (N=77) had a maximum postbaseline QTcS or QTcF value of ≥ 480 ms, or a maximum increase from clock time-matched baseline for QTcS or QTcF values of ≥ 60 ms. The upper bounds of the one-sided 95% confidence interval for the mean change from time-matched baseline for QTcS, QTcF, and QTcB at all time points and at steady-state Cmax following repeated administration of 125 mg palbociclib were less than 10 ms. Palbociclib, when administered with letrozole at the recommended therapeutic dosing regimen, did not prolong the QT interval to a clinically relevant extent.

QT interval correction for drug-induced changes in body temperature during integrated cardiovascular safety assessment in regulatory toxicology studies in dogs: A case study.

PubMed

El Amrani, Abdel-Ilah; El Amrani-Callens, Francine; Loriot, Stéphane; Singh, Pramila; Forster, Roy

2016-01-01

Cardiovascular safety assessment requires accurate evaluation of QT interval, which depends on the length of the cardiac cycle and also on core body temperature (BT). Increases in QT interval duration have been shown to be associated with decreases in BT in dogs. An example of altered QT interval duration associated with changes in body temperature observed during a 4-week regulatory toxicology study in dogs is presented. Four groups of Beagle dogs received the vehicle or test item once on Day 1, followed by a 4-week observation period. Electrocardiogram (ECG) parameters were continuously recorded on Days 1 and 26 by jacketed external telemetry (JET). Core body temperature (BT) was measured with a conventional rectal thermometer at appropriate time-points during the Day 1 recording period. Decreased BT was observed approximately 2h after treatment on Day 1, along with increased QT interval duration corrected according to the Van de Water formula (QTcV), but the effect was no longer observed after correction for changes in BT [QTcVcT=QTcV-14(37.5-BT)] according to the Van der Linde formula. No significant changes in QTcV were reported at the end of the observation period, on Day 26. The present study demonstrates that core body (rectal) temperature can easily be monitored at appropriate time-points during JET recording in regulatory toxicology studies in dogs, in order to correct QT interval duration values for treatment-related changes in BT. The successful application of the Van der Linde formula to correct QTc prolongation for changes in BT was demonstrated. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Abnormal myocardial repolarisation in response to hypoxaemia and fenoterol.

PubMed Central

Kiely, D. G.; Cargill, R. I.; Grove, A.; Struthers, A. D.; Lipworth, B. J.

1995-01-01

BACKGROUND--Prolongation of the QTc interval has been associated with cardiac dysrhythmias and sudden death. QTc dispersion (interlead variability in QTc interval) has recently been proposed as being a more sensitive marker of repolarisation abnormalities and shown to be a more specific index of arrhythmia risk. Although hypoxaemia and fenoterol have previously been shown to prolong the QTc interval, this does not reflect regional myocardial repolarisation abnormalities. METHODS--Electrophysiological effects were measured at baseline and after 30 minutes steady state hypoxaemia at an arterial oxygen saturation (SaO2) of 75-80% (study 1) and at baseline then 30 minutes after inhaled fenoterol 2.4 mg (study 2). From the ECG, lead II corrected QT interval (QTc) and overall corrected QT dispersion were measured using a computer linked digitising tablet according to standard criteria. RESULTS--QTc dispersion was increased during hypoxia compared with baseline values (mean (SE) 69 (6) ms v 50 (5) ms) and after fenoterol compared with baseline (79 (13) v 46 (4) ms), respectively. There was also an increase in QTc interval and heart rate after fenoterol (493 (23) v 420 (6) ms and 98 (3) v 71 (6) bpm, respectively). The heart rate was increased during hypoxaemia compared with baseline (78 (3) v 64 (2) bpm), but no change occurred in the QTc interval. CONCLUSIONS--Both hypoxaemia and fenoterol cause myocardial repolarisation abnormalities in man in terms of increased QTc dispersion, but only fenoterol increased the QTc interval. This may be relevant in the aetiology of arrhythmias in patients with acute severe asthma where beta agonist therapy and hypoxaemia coexist. PMID:7491554

New in vitro model for proarrhythmia safety screening: IKs inhibition potentiates the QTc prolonging effect of IKr inhibitors in isolated guinea pig hearts.

PubMed

Kui, Péter; Orosz, Szabolcs; Takács, Hedvig; Sarusi, Annamária; Csík, Norbert; Rárosi, Ferenc; Csekő, Csongor; Varró, András; Papp, Julius Gy; Forster, Tamás; Farkas, Attila S; Farkas, András

2016-01-01

Preclinical in vivo QT measurement as a proarrhythmia essay is expensive and not reliable enough. The aim of the present study was to develop a sensitive, cost-effective, Langendorff perfused guinea pig heart model for proarrhythmia safety screening. Low concentrations of dofetilide and cisapride (inhibitors of the rapid delayed rectifier potassium current, IKr) were tested alone and co-perfused with HMR-1556 (inhibitor of the slow delayed rectifier potassium current, IKs) in Langendorff perfused guinea pig hearts. The electrocardiographic rate corrected QT (QTc) interval, the Tpeak-Tend interval and the beat-to-beat variability and instability (BVI) of the QT interval were determined in sinus rhythm. Dofetilide and HMR-1556 alone or co-perfused, prolonged the QTc interval by 20±2%, 10±1% and 55±10%, respectively. Similarly, cisapride and HMR-1556 alone or co-perfused, prolonged the QTc interval by 11±3%, 11±4% and 38±6%, respectively. Catecholamine-induced fast heart rate abolished the QTc prolonging effects of the IKr inhibitors, but augmented the QTc prolongation during IKs inhibition. None of the drug perfusions increased significantly the Tpeak-Tend interval and the sinus BVI of the QT interval. IKs inhibition increased the QTc prolonging effect of IKr inhibitors in a super-additive (synergistic) manner, and the QTc interval was superior to other proarrhythmia biomarkers measured in sinus rhythm in isolated guinea pig hearts. The effect of catecholamines on the QTc facilitated differentiation between IKr and IKs inhibitors. Thus, QTc measurement in Langendorff perfused guinea pig hearts with pharmacologically attenuated repolarization reserve and periodic catecholamine perfusion seems to be suitable for preclinical proarrhythmia screening. Copyright © 2016 Elsevier Inc. All rights reserved.

Prevalence of QT interval prolongation in patients admitted to cardiac care units and frequency of subsequent administration of QT interval-prolonging drugs: a prospective, observational study in a large urban academic medical center in the US.

PubMed

Tisdale, James E; Wroblewski, Heather A; Overholser, Brian R; Kingery, Joanna R; Trujillo, Tate N; Kovacs, Richard J

2012-06-01

Cardiac arrest due to torsades de pointes (TdP) is a rare but catastrophic event in hospitals. Patients admitted to cardiac units are at higher risk of drug-induced QT interval prolongation and TdP, due to a preponderance of risk factors. Few data exist regarding the prevalence of QT interval prolongation in patients admitted to cardiac units or the frequency of administering QT interval-prolonging drugs to patients presenting with QT interval prolongation. The aim of this study was to determine the prevalence of Bazett's-corrected QT (QT(c)) interval prolongation upon admission to cardiac units and the proportion of patients presenting with QT(c) interval prolongation who are subsequently administered QT interval-prolonging drugs during hospitalization. This was a prospective, observational study conducted over a 1-year period (October 2008-October 2009) in 1159 consecutive patients admitted to two cardiac units in a large urban academic medical centre located in Indianapolis, IN, USA. Patients were enrolled into the study at the time of admission to the hospital and were followed daily during hospitalization. Exclusion criteria were age <18 years, ECG rhythm of complete ventricular pacing, and patient designation as 'outpatient' in a bed and/or duration of stay <24 hours. Data collected included demographic information, past medical history, daily progress notes, medication administration records, laboratory data, ECGs, telemetry monitoring strips and diagnostic reports. All patients underwent continuous cardiac telemetry monitoring and/or had a baseline 12-lead ECG obtained within 4 hours of admission. QT intervals were determined manually from lead II of 12-lead ECGs or from continuous lead II telemetry monitoring strips. QT(c) interval prolongation was defined as ≥470 ms for males and ≥480 ms for females. In both males and females, QT(c) interval >500 ms was considered abnormally high. A medication was classified as QT interval-prolonging if there were published data indicating that the drug causes QT interval prolongation and/or TdP. Study endpoints were (i) prevalence of QT(c) interval prolongation upon admission to the Cardiac Medical Critical Care Unit (CMCCU) or an Advanced Heart Care Unit (AHCU); (ii) proportion of patients admitted to the CMCCU/AHCU with QT(c) interval prolongation who subsequently were administered QT interval-prolonging drugs during hospitalization; (iii) the proportion of these higher-risk patients in whom TdP risk factor monitoring was performed; (iv) proportion of patients with QT(c) interval prolongation who subsequently received QT-prolonging drugs and who experienced further QT(c) interval prolongation. Of 1159 patients enrolled, 259 patients met exclusion criteria, resulting in a final sample size of 900 patients. mean (± SD) age, 65 ± 15 years; female, 47%; Caucasian, 70%. Admitting diagnoses: heart failure (22%), myocardial infarction (16%), atrial fibrillation (9%), sudden cardiac arrest (3%). QT(c) interval prolongation was present in 27.9% of patients on admission; 18.2% had QT(c) interval >500 ms. Of 251 patients admitted with QT(c) interval prolongation, 87 (34.7%) were subsequently administered QT interval-prolonging drugs. Of 166 patients admitted with QT(c) interval >500 ms, 70 (42.2%) were subsequently administered QT interval-prolonging drugs; additional QT(c) interval prolongation ≥60 ms occurred in 57.1% of these patients. QT(c) interval prolongation is common among patients admitted to cardiac units. QT interval-prolonging drugs are commonly prescribed to patients presenting with QT(c) interval prolongation.

QT-RR relationships and suitable QT correction formulas for halothane-anesthetized dogs.

PubMed

Tabo, Mitsuyasu; Nakamura, Mikiko; Kimura, Kazuya; Ito, Shigeo

2006-10-01

Several QT correction (QTc) formulas have been used for assessing the QT liability of drugs. However, they are known to under- and over-correct the QT interval and tend to be specific to species and experimental conditions. The purpose of this study was to determine a suitable formula for halothane-anesthetized dogs highly sensitive to drug-induced QT interval prolongation. Twenty dogs were anesthetized with 1.5% halothane and the relationship between the QT and RR intervals were obtained by changing the heart rate under atrial pacing conditions. The QT interval was corrected for the RR interval by applying 4 published formulas (Bazett, Fridericia, Van de Water, and Matsunaga); Fridericia's formula (QTcF = QT/RR(0.33)) showed the least slope and lowest R(2) value for the linear regression of QTc intervals against RR intervals, indicating that it dissociated changes in heart rate most effectively. An optimized formula (QTcX = QT/RR(0.3879)) is defined by analysis of covariance and represents a correction algorithm superior to Fridericia's formula. For both Fridericia's and the optimized formula, QT-prolonging drugs (d,l-sotalol, astemizole) showed QTc interval prolongation. A non-QT-prolonging drug (d,l-propranolol) failed to prolong the QTc interval. In addition, drug-induced changes in QTcF and QTcX intervals were highly correlated with those of the QT interval paced at a cycle length of 500 msec. These findings suggest that Fridericia's and the optimized formula, although the optimized is a little bit better, are suitable for correcting the QT interval in halothane-anesthetized dogs and help to evaluate the potential QT prolongation of drugs with high accuracy.

Food and Insulin Effect on QT/QTC Interval of ECG

ClinicalTrials.gov

2014-08-19

Effects of Different Meals on the QT/QTc Interval; Insulin and Oral Hypoglycemic [Antidiabetic] Drugs Causing Adverse Effects in Therapeutic Use; C-Peptide Effects on the QT/QTc Interval; Moxifloxacin ECG Profile in Fed and Fasted State; Japanese vs. Caucasian TQT Comparison

Evaluation of Electrocardiographic T-peak to T-end Interval in Subjects with Increased Epicardial Fat Tissue Thickness.

PubMed

Kaplan, Ozgur; Kurtoglu, Ertugrul; Nar, Gokay; Yasar, Erdogan; Gozubuyuk, Gokhan; Dogan, Cem; Boz, Ahmet Ugur; Hidayet, Sıho; Pekdemir, Hasan

2015-12-01

The association between periatrial adiposity and atrial arrhythmias has been shown in previous studies. However, there are not enough available data on the association between epicardial fat tissue (EFT) thickness and parameters of ventricular repolarization. Thus, we aimed to evaluate the association of EFT thickness with indices of ventricular repolarization by using T-peak to T-end (Tp-e) interval and Tp-e/QT ratio. The present study included 50 patients whose EFT thickness ≥ 9 mm (group 1) and 40 control subjects with EFT thickness < 9 mm (group 2). Transthoracic echocardiographic examination was performed in all participants. QT parameters, Tp-e intervals and Tp-e/QT ratio were measured from the 12-lead electrocardiogram. QTd (41.1 ± 2.5 vs 38.6 ± 3.2, p < 0.001) and corrected QTd (46.7 ± 4.7 vs 43.7 ± 4, p = 0.002) were significantly higher in group 1 when compared to group 2. The Tp-e interval (76.5 ± 6.3, 70.3 ± 6.8, p < 0.001), cTp-e interval (83.1 ± 4.3 vs. 76±4.9, p < 0.001), Tp-e/QT (0.20 ± 0.02 vs. 0.2 ± 0.02, p < 0.001) and Tp-e/QTc ratios (0.2 ± 0.01 vs. 0.18 ± 0.01, p < 0.001) were increased in group 1 in comparison to group 2. Significant positive correlations were found between EFT thickness and Tp-e interval (r = 0.548, p < 0.001), cTp-e interval (r = 0.259, p = 0.01), and Tp-e/QT (r = 0.662, p < 0.001) and Tp-e/QTc ratios (r = 0.560, p < 0.001). The present study shows that Tp-e and cTp-e interval, Tp-e/QT and Tp-e/QTc ratios were increased in subjects with increased EFT, which may suggest an increased risk of ventricular arrhythmia.

Predictive Analytics for Identification of Patients at Risk for QT Interval Prolongation - A Systematic Review.

PubMed

Tomaselli Muensterman, Elena; Tisdale, James E

2018-06-08

Prolongation of the heart rate-corrected QT (QTc) interval increases the risk for torsades de pointes (TdP), a potentially fatal arrhythmia. The likelihood of TdP is higher in patients with risk factors, which include female sex, older age, heart failure with reduced ejection fraction, hypokalemia, hypomagnesemia, concomitant administration of ≥ 2 QTc interval-prolonging medications, among others. Assessment and quantification of risk factors may facilitate prediction of patients at highest risk for developing QTc interval prolongation and TdP. Investigators have utilized the field of predictive analytics, which generates predictions using techniques including data mining, modeling, machine learning, and others, to develop methods of risk quantification and prediction of QTc interval prolongation. Predictive analytics have also been incorporated into clinical decision support (CDS) tools to alert clinicians regarding patients at increased risk of developing QTc interval prolongation. The objectives of this paper are to assess the effectiveness of predictive analytics for identification of patients at risk of drug-induced QTc interval prolongation, and to discuss the efficacy of incorporation of predictive analytics into CDS tools in clinical practice. A systematic review of English language articles (human subjects only) was performed, yielding 57 articles, with an additional 4 articles identified from other sources; a total of 10 articles were included in this review. Risk scores for QTc interval prolongation have been developed in various patient populations including those in cardiac intensive care units (ICUs) and in broader populations of hospitalized or health system patients. One group developed a risk score that includes information regarding genetic polymorphisms; this score significantly predicted TdP. Development of QTc interval prolongation risk prediction models and incorporation of these models into CDS tools reduces the risk of QTc interval prolongation in cardiac ICUs and identifies health-system patients at increased risk for mortality. The impact of these QTc interval prolongation predictive analytics on overall patient safety outcomes, such as TdP and sudden cardiac death relative to the cost of development and implementation, requires further study. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

ELECTROCARDIOGRAPHIC ABNORMALITIES AMONG MEXICAN AMERICANS: CORRELATIONS WITH DIABETES, OBESITY, AND THE METABOLIC SYNDROME.

PubMed

Queen, Saulette R; Smulevitz, Beverly; Rentfro, Anne R; Vatcheva, Kristina P; Kim, Hyunggun; McPherson, David D; Hanis, Craig L; Fisher-Hoch, Susan P; McCormick, Joseph B; Laing, Susan T

2012-04-01

Resting ischemic electrocardiographic abnormalities have been associated with cardiovascular mortality. Simple markers of abnormal autonomic tone have also been associated with diabetes, obesity, and the metabolic syndrome in some populations. Data on these electrocardiographic abnormalities and correlations with coronary risk factors are lacking among Mexican Americans wherein these conditions are prevalent. This study aimed to evaluate the prevalent resting electrocardiographic abnormalities among community-dwelling Mexican Americans, and correlate these findings with coronary risk factors, particularly diabetes, obesity, and the metabolic syndrome. Study subjects (n=1280) were drawn from the Cameron County Hispanic Cohort comprised of community-dwelling Mexican Americans living in Brownsville, Texas at the United States-Mexico border. Ischemic electrocardiographic abnormalities were defined as presence of ST/T wave abnormalities suggestive of ischemia, abnormal Q waves, and left bundle branch block. Parameters that reflect autonomic tone, such as heart rate-corrected QT interval and resting heart rate, were also measured. Ischemic electrocardiographic abnormalities were more prevalent among older persons and those with hypertension, diabetes, obesity, and the metabolic syndrome. Subjects in the highest quartiles of QTc interval and resting heart rate were also more likely to be diabetic, hypertensive, obese, or have the metabolic syndrome. Among Mexican Americans, persons with diabetes, obesity, and the metabolic syndrome were more likely to have ischemic electrocardiographic abnormalities, longer QTc intervals, and higher resting heart rates. A resting electrocardiogram can play a complementary role in the comprehensive evaluation of cardiovascular risk in this minority population.

Magnitude of increase in QTc interval after initiation of dofetilide in patients with persistent atrial fibrillation is associated with increased rates of pharmacological cardioversion and long-term freedom from recurrent atrial fibrillation.

PubMed

Huang, Henry D; Waks, Jonathan W; Steinhaus, Daniel A; Zimetbaum, Peter

2016-07-01

Dofetilide is a class III antiarrhythmic drug approved for the treatment of atrial fibrillation (AF). Dofetilide-induced corrected QT (QTc) interval prolongation is a surrogate for the degree of drug effect, but the relationships between drug-induced QTc interval prolongation, pharmacological cardioversion (PCV), and freedom from recurrent AF are unclear. The purpose of this study was to assess associations between QTc interval change during dofetilide initiation and PCV and long-term AF recurrence. We performed retrospective analyses of a prospective cohort of patients with AF admitted for dofetilide initiation between 2001 and 2014. Clinical characteristics and electrocardiographic variables were assessed. We evaluated outcomes of successful PCV in patients with persistent AF and time to recurrence of AF in patients with paroxysmal and persistent AF. During the study, 243 patients with persistent AF and 176 patients with paroxysmal AF initiated dofetilide. PCV occurred in 93/243 (41.7%) patients with persistent AF. After multivariable adjustment, QTc interval change was associated with PCV (adjusted odds ratio 1.21; P = .003 per 10-ms QTc increase). Inhospital QTc interval change was associated with long-term freedom from AF in patients with persistent AF (adjusted hazard ratio 0.92; P = .011 at 4 years per 10-ms QTc increase), but not in patients with paroxysmal AF. In patients with persistent AF, PCV was also associated with long-term freedom from recurrent AF (adjusted hazard ratio 0.62; P = .009 at 4 years). The magnitude of QTc interval prolongation during dofetilide initiation is an independent predictor of successful PCV and long-term freedom from arrhythmia in patients with persistent AF. QTc interval change had no association with AF recurrence in patients with paroxysmal AF, suggesting that different mechanisms of arrhythmogenesis may be operant in different AF types. Copyright © 2016 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

Venetoclax does not prolong the QT interval in patients with hematological malignancies: an exposure-response analysis.

PubMed

Freise, Kevin J; Dunbar, Martin; Jones, Aksana K; Hoffman, David; Enschede, Sari L Heitner; Wong, Shekman; Salem, Ahmed Hamed

2016-10-01

Venetoclax (ABT-199/GDC-0199) is a selective first-in-class B cell lymphoma-2 inhibitor being developed for the treatment of hematological malignancies. The aim of this study was to determine the potential of venetoclax to prolong the corrected QT (QTc) interval and to evaluate the relationship between systemic venetoclax concentration and QTc interval. The study population included 176 male and female patients with relapsed or refractory chronic lymphocytic leukemia/small lymphocytic lymphoma (n = 105) or non-Hodgkin's lymphoma (n = 71) enrolled in a phase 1 safety, pharmacokinetic, and efficacy study. Electrocardiograms were collected in triplicate at time-matched points (2, 4, 6, and 8 h) prior to the first venetoclax administration and after repeated venetoclax administration to achieve steady state conditions. Venetoclax doses ranged from 100 to 1200 mg daily. Plasma venetoclax samples were collected after steady state electrocardiogram measurements. The mean and upper bound of the 2-sided 90 % confidence interval (CI) QTc change from baseline were <5 and <10 ms, respectively, at all time points and doses (<400, 400, and >400 mg). Three subjects had single QTc values >500 ms and/or ΔQTc > 60 ms. The effect of venetoclax concentration on both ΔQTc and QTc was not statistically significant (P > 0.05). At the mean maximum concentrations achieved with therapeutic (400 mg) and supra-therapeutic (1200 mg) venetoclax doses, the estimated drug effects on QTc were 0.137 (90 % CI [-1.01 to 1.28]) and 0.263 (90 % CI [-1.92 to 2.45]) ms, respectively. Venetoclax does not prolong QTc interval even at supra-therapeutic doses, and there is no relationship between venetoclax concentrations and QTc interval.

KCNQ1 p.L353L affects splicing and modifies the phenotype in a founder population with long QT syndrome type 1

PubMed Central

Kapplinger, Jamie D; Erickson, Anders; Asuri, Sirisha; Tester, David J; McIntosh, Sarah; Kerr, Charles R; Morrison, Julie; Tang, Anthony; Sanatani, Shubhayan; Arbour, Laura; Ackerman, Michael J

2017-01-01

Background Variable expressivity and incomplete penetrance between individuals with identical long QT syndrome (LQTS) causative mutations largely remain unexplained. Founder populations provide a unique opportunity to explore modifying genetic effects. We examined the role of a novel synonymous KCNQ1 p.L353L variant on the splicing of exon 8 and on heart rate corrected QT interval (QTc) in a population known to have a pathogenic LQTS type 1 (LQTS1) causative mutation, p.V205M, in KCNQ1-encoded Kv7.1. Methods 419 adults were genotyped for p.V205M, p.L353L and a previously described QTc modifier (KCNH2-p.K897T). Adjusted linear regression determined the effect of each variant on QTc, alone and in combination. In addition, peripheral blood RNA was extracted from three controls and three p.L353L-positive individuals. The mutant transcript levels were assessed via qPCR and normalised to overall KCNQ1 transcript levels to assess the effect on splicing. Results For women and men, respectively, p.L353L alone conferred a 10.0 (p=0.064) ms and 14.0 (p=0.014) ms increase in QTc and in men only a significant interaction effect in combination with the p.V205M (34.6 ms, p=0.003) resulting in a QTc of ∼500 ms. The mechanism of p.L353L's effect was attributed to approximately threefold increase in exon 8 exclusion resulting in ∼25% mutant transcripts of the total KCNQ1 transcript levels. Conclusions Our results provide the first evidence that synonymous variants outside the canonical splice sites in KCNQ1 can alter splicing and clinically impact phenotype. Through this mechanism, we identified that p.L353L can precipitate QT prolongation by itself and produce a clinically relevant interactive effect in conjunction with other LQTS variants. PMID:28264985

Prolonged corrected QT interval is predictive of future stroke events even in subjects without ECG-diagnosed left ventricular hypertrophy.

PubMed

Ishikawa, Joji; Ishikawa, Shizukiyo; Kario, Kazuomi

2015-03-01

We attempted to evaluate whether subjects who exhibit prolonged corrected QT (QTc) interval (≥440 ms in men and ≥460 ms in women) on ECG, with and without ECG-diagnosed left ventricular hypertrophy (ECG-LVH; Cornell product, ≥244 mV×ms), are at increased risk of stroke. Among the 10 643 subjects, there were a total of 375 stroke events during the follow-up period (128.7±28.1 months; 114 142 person-years). The subjects with prolonged QTc interval (hazard ratio, 2.13; 95% confidence interval, 1.22-3.73) had an increased risk of stroke even after adjustment for ECG-LVH (hazard ratio, 1.71; 95% confidence interval, 1.22-2.40). When we stratified the subjects into those with neither a prolonged QTc interval nor ECG-LVH, those with a prolonged QTc interval but without ECG-LVH, and those with ECG-LVH, multivariate-adjusted Cox proportional hazards analysis demonstrated that the subjects with prolonged QTc intervals but not ECG-LVH (1.2% of all subjects; incidence, 10.7%; hazard ratio, 2.70, 95% confidence interval, 1.48-4.94) and those with ECG-LVH (incidence, 7.9%; hazard ratio, 1.83; 95% confidence interval, 1.31-2.57) had an increased risk of stroke events, compared with those with neither a prolonged QTc interval nor ECG-LVH. In conclusion, prolonged QTc interval was associated with stroke risk even among patients without ECG-LVH in the general population. © 2014 American Heart Association, Inc.

Drug-Induced QTc Interval Prolongation: A Multicenter Study to Detect Drugs and Clinical Factors Involved in Every Day Practice.

PubMed

Keller, Guillermo A; Alvarez, Paulino A; Ponte, Marcelo L; Belloso, Waldo H; Bagnes, Claudia; Sparanochia, Cecilia; Gonzalez, Claudio D; Villa Etchegoyen, M Cecilia; Diez, Roberto A; Di Girolamo, Guillermo

2016-01-01

The actual prevalence of drug induced QTc prolongation in clinical practice is unknown. Our objective was to determine the occurrence and characteristics of drug-induced QT prolongation in several common clinical practices. Additionally, a subgroup of patients treated with dextropropoxyphene of particular interest for the regulatory authority was analysed. Medical history and comorbidities predisposing to QT interval prolongation were registered for 1270 patient requiring medical assistance that involved drug administration. Three ionograms and ECGs were performed: baseline, intra- and after treatment; QT interval was corrected with Bazzet formula. Among patients, 9.9% presented QTc >450/470 ms, 3% QTc > 500 ms, 12.7% ΔQTc >30 ms and 5.2% ΔQTc >60 ms. QTc prolongation associated with congestive heart failure, ischemic cardiopathy, diabetes, renal failure, arrhythmias, hypothyroidism, and bradycardia. At univariate analysis, clarithromycin, haloperidol, tramadol, amiodarone, glyceryl trinitrate, amoxicillin + clavulanic acid, amoxicillin + sulbactam, ampicillin + sulbactam, fentanyl, piperacillin + tazobactam, and diazepam prolonged QTc. Prolongation remained significantly associated with furosemide, clarithromycin, glyceryl trinitrate and betalactamase inhibitors after multivariate analysis. QT interval prolongation in everyday practice is frequent, in association to clinical factors and drugs that can be easily identified for monitoring and prevention strategies.

Association between the physical activity and heart rate corrected-QT interval in older adults.

PubMed

Michishita, Ryoma; Fukae, Chika; Mihara, Rikako; Ikenaga, Masahiro; Morimura, Kazuhiro; Takeda, Noriko; Yamada, Yosuke; Higaki, Yasuki; Tanaka, Hiroaki; Kiyonaga, Akira

2015-07-01

Increased physical activity can reduce the incidence of cardiovascular disease and the mortality rate. In contrast, a prolonged heart rate corrected-QT (QTc) interval is associated with an increased risk of arrhythmias, sudden cardiac death and coronary artery disease. The present cross-sectional study was designed to clarify the association between the physical activity level and the QTc interval in older adults. The participants included 586 older adults (267 men and 319 women, age 71.2 ± 4.7 years) without a history of cardiovascular disease, who were taking cardioactive drugs. Electrocardiography was recorded with a standard resting 12-lead electrocardiograph, while the QTc interval was calculated according to Hodges' formula. The physical activity level was assessed using a triaxial accelerometer. The participants were divided into four categories, which were defined equally quartile distributions of the QTc interval. After adjusting for age, body mass index, waist circumference and the number of steps, the time spent in inactivity was higher and the time spent in light physical activity was significantly lower in the longest QTc interval group than in the shortest QTc interval group in both sexes (P < 0.05, respectively). However, there were no significant differences in the time spent in moderate and vigorous physical activities among the four groups in either sex. These results suggest that a decreased physical activity level, especially inactivity and light intensity physical activity, were associated with QTc interval in older adults. © 2014 Japan Geriatrics Society.

Sex Differences in the Effect of Atomoxetine on the QT Interval in Adult Patients With Attention-Deficit Hyperactivity Disorder.

PubMed

Suzuki, Yutaro; Tajiri, Misuzu; Sugimoto, Atsunori; Orime, Naoki; Hayashi, Taketsugu; Egawa, Jun; Sugai, Takuro; Inoue, Yoshimasa; Someya, Toshiyuki

2017-02-01

The effects of atomoxetine on QT in adults remain unclear. In this study, we examined whether the use of atomoxetine to treat attention-deficit hyperactivity disorder in adults is associated with QT prolongation. Forty-one subjects with attention-deficit hyperactivity disorder were enrolled in this study. Participants were administered 40, 80, or 120 mg atomoxetine daily and were maintained on their respective dose for at least 2 weeks. We conducted electrocardiographic measurements and blood tests, measuring plasma atomoxetine concentrations after treatment. Electrocardiograms of 24 of the patients were also obtained before atomoxetine treatment. The QT interval was corrected using Bazett (QTcB) and Fridericia (QTcF) correction formulas. In these 24 patients, only the female patients had prolonged QTcB (P = 0.039) after atomoxetine treatment. There was no correlation between plasma atomoxetine concentrations and the corrected QT interval (QTc), or between atomoxetine dosage and the QTc. However, in female patients, there was a significant positive correlation between atomoxetine dosage and the QTcB (r = 0.631, P = 0.012), and there was a marginally significant positive correlation between atomoxetine dosage and the QTcF (r = 0.504, P = 0.055). In male patients, there was no correlation between atomoxetine dosage and the QTcB or QTcF intervals. There was no correlation between plasma atomoxetine concentrations and the QTc in either female or male patients. Clinicians should exhibit caution when prescribing atomoxetine, particularly for female patients.

A single-dose, crossover, placebo- and moxifloxacin-controlled study to assess the effects of neratinib (HKI-272) on cardiac repolarization in healthy adult subjects.

PubMed

Hug, Bruce; Abbas, Richat; Leister, Cathie; Burns, Jaime; Sonnichsen, Daryl

2010-08-01

Neratinib is an orally administered, small-molecule, irreversible pan-ErbB inhibitor in development for the treatment of ErbB2-positive breast cancer. This study assessed the effects of therapeutic and supratherapeutic neratinib concentrations on cardiac repolarization, in accordance with current regulatory guidance. This was a two-part study in healthy subjects. In part 1, subjects were randomized to receive placebo, 400 mg moxifloxacin, or 240 mg neratinib (therapeutic dose) following a high-fat meal. In part 2, after a washout period, subjects received placebo plus 400 mg ketoconazole or 240 mg neratinib plus ketoconazole (supratherapeutic dose). ANOVA was used to compare the baseline-adjusted QTc interval for neratinib with that of placebo (reference), and for neratinib plus ketoconazole with that of placebo plus ketoconazole (reference). Pharmacokinetic/pharmacodynamic analyses and categorical summaries of interval data were done. Assay sensitivity was evaluated by the effect of moxifloxacin on QTc compared with placebo. Sixty healthy subjects were enrolled in this study. The upper bounds of the 90% confidence interval for baseline-adjusted QTcN (population-specific corrected QT) were 450 milliseconds or change from baseline >30 milliseconds. Moxifloxacin produced a significant increase in QTcN compared with placebo (P < 0.05). Therapeutic and supratherapeutic plasma concentrations of neratinib do not prolong the QTc interval in healthy subjects. (c) 2010 AACR.

Association of low-moderate urine arsenic and QT interval: Cross-sectional and longitudinal evidence from the Strong Heart Study.

PubMed

Moon, Katherine A; Zhang, Yiyi; Guallar, Eliseo; Francesconi, Kevin A; Goessler, Walter; Umans, Jason G; Best, Lyle G; Howard, Barbara V; Devereux, Richard B; Okin, Peter M; Navas-Acien, Ana

2018-05-21

Epidemiologic studies suggest that chronic exposure to arsenic is related to cardiovascular disease (CVD), but the pathophysiological link remains uncertain. We evaluated the association of chronic low-moderate arsenic exposure and arsenic metabolism with baseline difference and annual change in ECG measures (QT interval, JT interval, PR interval, QRS duration, and QT dispersion) using linear mixed models in the Strong Heart Study main cohort (N = 1174, median age 55 years) and family study (N = 1695 diabetes-free, median age 36 years). At baseline, arsenic exposure was measured as the sum of inorganic and methylated species in urine (ΣAs) and arsenic metabolism was measured as the relative percentage of arsenic species. Median ΣAs and Bazett heart rate-corrected QT interval (QTc) were 8.6 μg/g creatinine and 424 ms in the main cohort and 4.3 μg/g and 414 ms in the family study, respectively. In the main cohort, a comparison of the highest to lowest ΣAs quartile (>14.4 vs. <5.2 μg/g creatinine) was associated with a 5.3 (95% CI: 1.2, 9.5) ms higher mean baseline QTc interval but no difference in annual change in QTc interval. In the family study, a comparison of the highest to lowest quartile (>7.1 vs. <2.9 μg/g creatinine) was associated with a 3.2 (95% CI: 0.6, 5.7) ms higher baseline QTc interval and a 0.6 (95% CI: 0.04, 1.2) ms larger annual increase in QTc interval. Associations with JTc interval were similar but stronger in magnitude compared to QTc interval. Arsenic exposure was largely not associated with PR interval, QRS duration or QT dispersion. Similar to arsenic exposure, a pattern of lower %MMA and higher %DMA was associated with longer baseline QTc interval in both cohorts and with a larger annual change in QTc interval in the family study. Chronic low-moderate arsenic exposure and arsenic metabolism were associated with prolonged ventricular repolarization. Copyright © 2018 Elsevier Ltd. All rights reserved.

Value of the "Standing Test" in the Diagnosis and Evaluation of Beta-blocker Therapy Response in Long QT Syndrome.

PubMed

Muñoz-Esparza, Carmen; Zorio, Esther; Domingo Valero, Diana; Peñafiel-Verdú, Pablo; Sánchez-Muñoz, Juan J; García-Molina, Esperanza; Sabater, María; Navarro, Marina; San-Román, Irene; Pérez, Inmaculada; Santos, Juan J; Cabañas-Perianes, Valentín; Valdés, Mariano; Pascual, Domingo; García-Alberola, Arcadio; Gimeno Blanes, Juan R

2017-11-01

Patients with congenital long QT syndrome (LQTS) have an abnormal QT adaptation to sudden changes in heart rate provoked by standing. The present study sought to evaluate the standing test in a cohort of LQTS patients and to assess if this QT maladaptation phenomenon is ameliorated by beta-blocker therapy. Electrographic assessments were performed at baseline and immediately after standing in 36 LQTS patients (6 LQT1 [17%], 20 LQT2 [56%], 3 LQT7 [8%], 7 unidentified-genotype patients [19%]) and 41 controls. The corrected QT interval (QTc) was measured at baseline (QTc supine ) and immediately after standing (QTc standing ); the QTc change from baseline (ΔQTc) was calculated as QTc standing - QTc supine . The test was repeated in 26 patients receiving beta-blocker therapy. Both QTc standing and ΔQTc were significantly higher in the LQTS group than in controls (QTc standing , 528 ± 46ms vs 420 ± 15ms, P < .0001; ΔQTc, 78 ± 40ms vs 8 ± 13ms, P < .0001). No significant differences were noted between LQT1 and LQT2 patients. Typical ST-T wave patterns appeared after standing in LQTS patients. Receiver operating characteristic curves of QTc standing and ΔQTc showed a significant increase in diagnostic value compared with the QTc supine (area under the curve for both, 0.99 vs 0.85; P < .001). Beta-blockers attenuated the response to standing in LQTS patients (QTc standing , 440 ± 32ms, P < .0001; ΔQTc, 14 ± 16ms, P < .0001). Evaluation of the QTc after the simple maneuver of standing shows a high diagnostic performance and could be important for monitoring the effects of beta-blocker therapy in LQTS patients. Copyright © 2017 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

QT dispersion and rate-corrected QT dispersion during electroconvulsive therapy in elderly patients.

PubMed

Yamaguchi, Shigeki; Nagao, Masaru; Ikeda, Tomohisa; Fukagawa, Daigo; Kimura, Yoshiyuki; Kitajima, Toshimitsu; Minami, Junichi

2011-09-01

Electroconvulsive therapy (ECT) induces increase of QT dispersion (QTD) and the rate-corrected QTD (QTcD), which are associated with increased risk of ventricular arrhythmias and cardiovascular mortality. The effects of electrical stimulus during ECT on QTD and QTcD in elderly patients are of considerable interest. The purpose of this study was to clarify the differential effects of electrical stimulus caused by ECT on interbeat interval, QT interval, the rate-corrected QT (QTc) interval, QTD, and the QTcD under propofol anesthesia between younger and elderly patients with major depression. Twenty younger psychiatric patients (aged 30-40 years) and 20 elderly patients (aged 65-75 years) scheduled for ECT were studied under propofol anesthesia. A 12-lead electrocardiogram was monitored to measure parameters. Muscle paralysis was achieved by administering 1-mg/kg succinylcholine intravenously, and the efficacy of ECT was determined by the tourniquet technique. The mean arterial pressure in the elderly was significantly higher than that of the younger patients from immediately to 2 minutes after electrical stimulus. The interbeat interval in the elderly was significantly lower than that of the younger patients from immediately to 1 minute after electrical stimulus. There was no statistically significant difference in the QT interval between the groups. The baseline value of QTc interval was higher than the normal limits, and the QTc interval in the elderly was significantly lower than that of the younger patients from immediately to 1 minute after electrical stimulus. The baseline value of QTD was higher than the normal limits, and the QTD in the elderly was significantly higher than that of the younger patients from immediately to 7 minutes after electrical stimulus. The baseline value of QTcD was higher than the normal limits, and the QTcD in the elderly was significantly higher than that of the younger patients from immediately to 7 minutes after electrical stimulus. The QTc interval, QTD, and QTcD may be higher than the normal limits before anesthesia in patients with major depression. The QTD and QTcD in the elderly, which are associated with increased risks of ventricular arrhythmias, are higher than those of the younger patients after electrical stimulus during ECT. Electrical stimulus may induce further increased risks of cardiac events in elderly patients.

Is prolongation of corrected QT interval associated with seizures induced by electroconvulsive therapy reduced by atropine sulfate?

PubMed

Suzuki, Yoko; Miyajima, Miho; Ohta, Katsuya; Yoshida, Noriko; Omoya, Rie; Fujiwara, Mayo; Watanabe, Takafumi; Okumura, Masaki; Yamazaki, Hiroaki; Shintaku, Masayuki; Murata, Issei; Ozaki, Shigeru; Sasaki, Takeshi; Nakamura, Mitsuru; Suwa, Hiroshi; Sasano, Tetsuo; Kawara, Tokuhiro; Matsuura, Masato; Matsushima, Eisuke

2017-11-01

Electrocardiogram abnormalities have been reported during electroconvulsive therapy (ECT). A corrected QT interval (QTc) prolongation indicates delayed ventricular repolarization, which can trigger ventricular arrhythmias such as torsade de pointes (TdP). We examined the QTc changes during generalized tonic-clonic seizures induced by ECT, and the effects of atropine sulfate on these QTc changes. We analyzed heart rate, QT interval, and QTc in 32 patients with depression who underwent ECT (25 women, 67.4 ± 8.7 years of age). The QTc from -30 to 0 seconds prestimulation was used as baseline, which was compared with QTc at 20-30 seconds and 140-150 seconds poststimulus onset. QTc was significantly prolonged at 20-30 seconds poststimulus, then significantly decreased at 140-150 seconds poststimulus, compared with baseline. QTc prolongation induced by ECT was significantly decreased by atropine sulfate. These data suggest that the risk of TdP may be enhanced by ECT. Further, the risk of cardiac ventricular arrhythmias, including TdP, may be reduced by administration of atropine sulfate. © 2017 Wiley Periodicals, Inc.

The Presence or Absence of QTc Prolongation in Buprenorphine-Naloxone Among Youth with Opioid Dependence

PubMed Central

Poole, Sabrina A.; Pecoraro, Anna; Subramaniam, Geetha; Woody, George; Vetter, Victoria L

2015-01-01

Objective To evaluate buprenorphine-naloxone effects on the QTc in youth with opioid dependence. Buprenorphine is a partial agonist that is an effective treatment for opioid dependence. Compared to methadone it has a lower risk of QTc prolongation in adults but is less well studied in youth. It may also reduce the risk for torsades de pointes (TdP) an uncommon variant of polymorphic ventricular tachycardia, that can result in syncope, ventricular fibrillation, and sudden death. Methods Secondary analysis of ECG data from 95 subjects who participated in a multi-site trial for youth with opioid dependence. Subjects were randomized to a 2-week (DETOX), or a 12-week course of buprenorphine-naloxone (BUP). 12-lead ECGs were done at baseline, weeks 4 and 12, and QTc intervals were hand measured and calculated using Bazett's formula. Increases > 60 milliseconds (ms) were considered clinically significant, and readings > 450 ms (males) and 470 ms (females) indicated a prolonged QTc. Results Mean QTc intervals were higher for BUP than DETOX participants at baseline, week 4, and week 12 (p = 0.045), and females had longer mean QTc intervals than males (p < 0.0005). Variations in QTc intervals were observed in some, however none were above 500 ms, the level at which risk for TdP becomes more significant. Conclusion In this randomized trial, the mean QTc at baseline, before randomization, was higher in BUP than DETOX patients. Minimal changes in the QTc were seen at 4 and 12-weeks in a few patients in both groups. There was no evidence that buprenorphine-naloxone alone increased the QTc to a level that increased the risk for TdP. PMID:26690291

Presence or Absence of QTc Prolongation in Buprenorphine-Naloxone Among Youth With Opioid Dependence.

PubMed

Poole, Sabrina A; Pecoraro, Anna; Subramaniam, Geetha; Woody, George; Vetter, Victoria L

2016-01-01

The aim of the study was to evaluate buprenorphine-naloxone effects on the QTc in youth with opioid dependence. Buprenorphine is a partial agonist that is an effective treatment for opioid dependence. Compared with methadone, it has a lower risk of QTc prolongation in adults, but is less studied in the youth. It may also reduce the risk of torsades de pointes (TdP)--an uncommon variant of polymorphic ventricular tachycardia--that can result in syncope, ventricular fibrillation, and sudden death. Secondary analysis of the electrocardiogram data from 95 individuals who participated in a multisite trial for youth with opioid dependence. The participants were randomized to a 2-week (DETOX) or a 12-week course of buprenorphine-naloxone (BUP). At baseline, 12-lead electrocardiograms were done at weeks 4 and 12, and QTc intervals were hand-measured and calculated using Bazett formula. Increases above 60 milliseconds were considered clinically significant, and readings above 450 milliseconds (in men) and 470 milliseconds (in women) indicated a prolonged QTc. Mean QTc intervals were higher for BUP than for DETOX participants at baseline, week 4, and week 12 (P = 0.045), and women had longer mean QTc intervals than men (P < 0.0005). Variations in the QTc intervals were observed in some; however, none were above 500 milliseconds--the level at which risk for TdP becomes more significant. In this randomized trial, the mean QTc at baseline, before randomization, was higher in BUP than in DETOX patients. Minimal changes in the QTc were seen at 4 and 12 weeks in a few patients in both groups. There was no evidence that buprenorphine-naloxone alone increased the QTc to a level that increased the risk for TdP.

Prolongation of the QTc interval in African children treated for falciparum malaria.

PubMed

vn Seidlein, L; Jaffar, S; Greenwood, B

1997-05-01

Antimalarial drugs can affect the heart and trigger life-threatening arrhythmias. However, little is known about the frequency with which cardiac abnormalities occur during uncomplicated attacks of malaria. Therefore, we have studied the electrocardiograms of 139 Gambian children with uncomplicated falciparum malaria who were treated with co-artemether, pyrimethamine/sulfadoxine, or chloriquine. The QTc intervals were measured on presentation, and four and eight days after treatment. No significant differences in mean QTc or heart rate were found between children in the three treatment groups on days 0, 4, or 8. After adjustment for the type of antimalarial thearapy in an analysis of variance, the mean (SD) QTc intervals on days 0, 4, and 8 were 402 (22.6), 416 (23.1), and 405 (24.3) msec, respectively. The mean QTc on day 4 was significantly longer than the mean QTc on days 0 or 8 (P < 0.01 in both cases). A quadratic line was fitted for QTc against time for each antimalarial therapy. No significant differences were found between the quadratic lines of the three groups. A weak association was found between QTc and the degree of parasitemia (r = 0.17, P = 0.04) and temperature (r = -0.23, P = 0.01) measured on day 0. The QTcs were measured in 18 children who experienced a second episode of malaria. The changes in QTc observed during second episodes were similar to those observed during the first attack. Changes in QTc in five children who developed severe malaria were similar to those found in the remaining children who did not develop severe malaria. This study indicates that the QTc interval changes during the early phase of malaria and this change is independent of the type of antimalarial therapy given.

A thorough QT study to evaluate the QTc prolongation potential of two neuropsychiatric drugs, quetiapine and escitalopram, in healthy volunteers.

PubMed

Kim, Anhye; Lim, Kyoung Soo; Lee, Howard; Chung, Hyewon; Yoon, Seo Hyun; Yu, Kyung-Sang; Cho, Joo-Youn; Jang, In-Jin; Chung, Jae-Yong

2016-07-01

Prolongation of the QT interval on an ECG is a surrogate marker for predicting the proarrhythmic potential of a drug under development. The aim of this study was to evaluate the QTc prolongation potential of two neuropsychiatric drugs, quetiapine immediate release (IR) and escitalopram, in healthy individuals. This was a randomized, open-label, 4×4 Williams crossover study, with four single-dose treatments [placebo, 400 mg moxifloxacin (positive control), 20 mg escitalopram, and 100 mg quetiapine IR], conducted in 40 healthy volunteers. Serial blood samples for pharmacokinetics and ECG were collected. Individually, RR-corrected QTc intervals (QTcI) and placebo-adjusted changes from baseline values of QTcI (ΔΔQTcI) were evaluated. Lower-bound values of the one-sided 95% confidence interval for ΔΔQTcI of moxifloxacin with more than 5 ms confirmed the sensitivity of the assay. The maximum upper bound 95% confidence interval for the ΔΔQTcI of quetiapine IR and escitalopram was 13.7 and 10.5 ms, with mean estimates of 10.2 and 6.9 ms, respectively. Peak effects of moxifloxacin and quetiapine IR on ΔΔQTcI were observed at approximately time to maximum concentration (Tmax), whereas that of escitalopram was observed 3 h after Tmax. The concentration-ΔΔQTcI relationships of quetiapine IR and escitalopram were relatively flat, as compared with that of moxifloxacin. The results demonstrated the validity of trial methodology and that quetiapine IR and escitalopram caused QT prolongation in healthy individuals. In addition, hysteresis of escitalopram-induced QTc prolongation. These results indicate that higher doses of these drugs could lead to greater QT prolongation in a dose-response manner.

QTc prolongation after brain surgery.

PubMed

Capparelli, Federico J; Abello, Mauricio; Patricio Maskin, L; Arista, Eugenia; Hlavnicka, Alejandro; Diaz, Maria Fernanda; Varela, Daniel; Wainsztein, Nestor A

2013-03-01

Abnormalities observed in the electrocardiogram (ECG) after acute central nervous system (CNS) events have been reported. Our objective was to assess the incidence of heart rate-corrected QT interval (QTc) prolongation in patients admitted to the intensive care unit (ICU) after brain surgery. Admission standard 12-lead ECGs were analyzed blinded to patient data. The QT interval was measured and Bazzett's formula was used to obtain QTc. Prolonged QTc was defined as ≧450 ms. We included 114 patients in the study. The mean age was 49±17 years. Brain neoplasm was the surgical indication in 90% of the patients. The mean QTc was 470±42 ms. Prolonged QTc was found in 71% patients. The heart rate-corrected QT interval was between 450 ms and 500 ms in 52% and >500 ms in 19% of the patients. The heart rate and concentration of serum glucose were higher in the prolonged QTc group. Only 7·5% of all patients had hypokalemia (≤3 mEq/l). In the prolonged QTc group 9·2% had hypokalemia compared to 3·2% in normal QTc patients (P = 0·406). There were no significant associations between categories of QTc and the serum levels of creatinine, magnesium, calcium, sodium, or pH. Phenytoin and metoclopramide were not frequently used in patients with prolonged QTc. This study supports our hypothesis that prolonged QTc is frequently observed after a brain surgery. Hypokalemia, hypocalcaemia, and drugs such as metoclopramide or phenytoin could not explain the high incidence of prolonged QTc. Brain injury during a surgical procedure may be one of the primary causes of QTc prolongation after neurosurgery.

Drug-physiology interaction and its influence on the QT prolongation-mechanistic modeling study.

PubMed

Wiśniowska, Barbara; Polak, Sebastian

2018-06-01

The current study is an example of drug-disease interaction modeling where a drug induces a condition which can affect the pharmacodynamics of other concomitantly taken drugs. The electrophysiological effects of hypokaliemia and heart rate changes induced by the antiasthmatic drugs were simulated with the use of the cardiac safety simulator. Biophysically detailed model of the human cardiac physiology-ten Tusscher ventricular cardiomyocyte cell model-was employed to generate pseudo-ECG signals and QTc intervals for 44 patients from four clinical studies. Simulated and observed mean QTc values with standard deviation (SD) for each reported study point were compared and differences were analyzed with Student's t test (α = 0.05). The simulated results reflected the QTc interval changes measured in patients, as well as their clinically observed interindividual variability. The QTc interval changes were highly correlated with the change in plasma potassium both in clinical studies and in the simulations (Pearson's correlation coefficient > 0.55). The results suggest that the modeling and simulation approach could provide valuable quantitative insight into the cardiological effect of the potassium and heart rate changes caused by electrophysiologically inactive, non-cardiological drugs. This allows to simulate and predict the joint effect of several risk factors for QT prolongation, e.g., drug-dependent QT prolongation due to the ion channels inhibition and the current patient physiological conditions.

Metoprolol and diltiazem ameliorate ziprasidone-induced prolonged corrected QT interval in rats.

PubMed

Erbas, Oytun; Yilmaz, Mustafa

2015-12-01

Ziprasidone, an atypical antipsychotic agent, has been shown to increase the corrected QT (QTc) interval in some patients. The aim of this study was to reveal the effects of metoprolol and diltiazem on ziprasidone drug-induced prolonged QTc interval. A total of 24 rats were equally divided into the following four groups: the first group was used as the control and received 1 mL/kg saline; 3 mg/kg ziprasidone and saline were administered to the second group; 3 mg/kg ziprasidone and 1 mg/kg metoprolol were administered to the third group and 3 mg/kg ziprasidone and 2 mg/kg diltiazem were administered to the fourth group. Two hours following application of the drugs, the QTc was calculated by performing electrocardiography in derivation (D)I. The duration of QTc interval was compared among the four groups. The mean QTc intervals were significantly increased in the third and fourth groups compared with the second group (p < 0.0005 and p < 0.0001, respectively). The study demonstrated the effectiveness of metoprolol and diltiazem in the prevention of ziprasidone-induced elongation in the QTc interval. Both metoprolol and diltiazem may be considered in the prophylactic therapy of high-risk patients who are using ziprasidone. © The Author(s) 2013.

Evaluation of Tp-E Interval and Tp-E/QT Ratio in Patients with Aortic Stenosis.

PubMed

Yayla, Çağrı; Bilgin, Murat; Akboğa, Mehmet Kadri; Gayretli Yayla, Kadriye; Canpolat, Uğur; Dinç Asarcikli, Lale; Doğan, Mehmet; Turak, Osman; Çay, Serkan; Özeke, Özcan; Akyel, Ahmet; Yeter, Ekrem; Aydoğdu, Sinan

2016-05-01

The risk of syncope and sudden cardiac death due to ventricular arrhythmias increased in patients with aortic stenosis (AS). Recently, it was shown that Tp-e interval, Tp-e/QT, and Tp-e/QTc ratio can be novel indicators for prediction of ventricular arrhythmias and mortality. We aimed to investigate the association between AS and ventricular repolarization using Tp-e interval and Tp-e/QT ratio. Totally, 105 patients with AS and 60 control subjects were enrolled to this study. The severity of AS was defined by transthoracic echocardiographic examination. Tp-e interval, Tp-e/QT, and Tp-e/QTc ratios were measured from the 12-lead electrocardiogram. Tp-e interval, Tp-e/QT, and Tp-e/QTc ratios were significantly increased in parallel to the severity of AS (P < 0.001, P = 0.001, and P = 0.001, respectively). Also, it was shown that Tp-e/QTc ratio had significant positive correlation with mean aortic gradient (r = 0.192, P = 0.049). In multivariate logistic regression analysis, Tp-e/QTc ratio and left ventricular mass were found to be independent predictors of severe AS (P = 0.03 and P = 0.04, respectively). Our study showed that Tp-e interval, Tp-e/QT, and Tp-e/QTc ratios were increased in patients with severe AS. Tp-e/QTc ratio and left ventricular mass were found as independent predictors of severe AS. © 2015 Wiley Periodicals, Inc.

Abnormalities of the QT interval in primary disorders of autonomic failure.

PubMed

Choy, A M; Lang, C C; Roden, D M; Robertson, D; Wood, A J; Robertson, R M; Biaggioni, I

1998-10-01

Experimental evidence shows that activation of the autonomic nervous system influences ventricular repolarization and, therefore, the QT interval on the ECG. To test the hypothesis that the QT interval is abnormal in autonomic dysfunction, we examined ECGs in patients with severe primary autonomic failure and in patients with congenital dopamine beta-hydroxylase (DbetaH) deficiency who are unable to synthesize norepinephrine and epinephrine. Maximal QT and rate-corrected QT (QTc) intervals and adjusted QTc dispersion [(maximal QTc - minimum QTc on 12 lead ECG)/square root of the number of leads measured] were determined in blinded fashion from ECGs of 67 patients with primary autonomic failure (36 patients with multiple system atrophy [MSA], and 31 patients with pure autonomic failure [PAF]) and 17 age- and sex-matched healthy controls. ECGs of 5 patients with congenital DbetaH deficiency and 6 age- and sex-matched controls were also analyzed. Patients with MSA and PAF had significantly prolonged maximum QTc intervals (492+/-58 ms(1/2) and 502+/-61 ms(1/2) [mean +/- SD]), respectively, compared with controls (450+/-18 ms(1/2), P < .05 and P < .01, respectively). A similar but not significant trend was observed for QT. QTc dispersion was also increased in MSA (40+/-20 ms(1/2), P < .05 vs controls) and PAF patients (32+/-19 ms(1/2), NS) compared with controls (21+/-5 ms(1/2)). In contrast, patients with congenital DbetaH deficiency did not have significantly different RR, QT, QTc intervals, or QTc dispersion when compared with controls. Patients with primary autonomic failure who have combined parasympathetic and sympathetic failure have abnormally prolonged QT interval and increased QT dispersion. However, QT interval in patients with congenital DbetaH deficiency was not significantly different from controls. It is possible, therefore, that QT abnormalities in patients with primary autonomic failure are not solely caused by lesions of the sympathetic nervous system, and that the parasympathetic nervous system is likely to have a modulatory role in ventricular repolarization.

Effects of phenobarbital and levetiracetam on PR and QTc intervals in patients with post-stroke seizure.

PubMed

Siniscalchi, Antonio; Scaglione, Francesco; Sanzaro, Enzo; Iemolo, Francesco; Albertini, Giorgio; Quirino, Gianluca; Manes, Maria Teresa; Gratteri, Santo; Mercuri, Nicola Biagio; De Sarro, Giovambattista; Gallelli, Luca

2014-12-01

Sudden unexplained/unexpected death (SUDEP) is related to high mortality in patients with epilepsy. The prolongation of QT interval, involved in cardiac arrhythmia-related SUDEP, may be precipitated by antiepileptic drugs (AEDs). In this study, we evaluated the effects of phenobarbital and levetiracetam on PR-QTc intervals in patients with post-stroke seizures. We performed an open-label, parallel group, prospective, multicenter study between June 2009 and December 2013 in patients older than 18 years of age with a clinical diagnosis of post-stroke seizure and treated with phenobarbital or levetiracetam. In order to exclude a role of cerebral post-stroke injury on modulation of PR and QTc intervals, patients with cerebral post-stroke injury and without seizures were also enrolled as controls. Interictal electrocardiography analysis revealed no significant difference in PR interval between patients treated with an AED (n = 49) and control patients (n = 50) (181.25 ± 12.05 vs. 182.4 ± 10.3 ms; p > 0.05). In contrast, a significantly longer QTc interval was recorded in patients treated with an AED compared with control patients (441.2 ± 56.6 vs. 396.8 ± 49.3 ms; p < 0.01). Patients treated with phenobarbital showed a significantly longer QTc interval than patients treated with levetiracetam (460.0 ± 57.2 vs. 421.5 ± 50.1 ms; p < 0.05). The study reported that in patients with late post-stroke seizures, phenobarbital prolonged QTc interval more so than levetiracetam.

Comparison of corrected QT interval as measured on electroencephalography versus 12-lead electrocardiography in children with a history of syncope.

PubMed

Massey, Shavonne L; Wise, Marshall S; Madan, Nandini; Carvalho, Karen; Khurana, Divya; Legido, Agustin; Valencia, Ignacio

2011-11-01

Long QT syndrome can present with neurological manifestations, including syncope and seizure-like activity. These patients often receive an initial neurologic evaluation, including electroencephalography (EEG). Our previous retrospective study suggested an increased prevalence of prolonged corrected QT interval (QTc) measured during the EEG of patients with syncope. The aim of the current study is to assess the accuracy of the EEG QTc reading compared with the nonsimultaneous 12-lead electrocardiography (ECG) in children with syncope. Abnormal QTc was defined as ≥450 ms in boys, ≥460 ms in girls. Forty-two children were included. There was no significant correlation between QTc readings in the EEG and ECG. EEG failed to identify 2 children with prolonged QTc in the ECG and overestimated the QTc in 3 children with normal QTc in the ECG. This study suggests that interpretation of the QTc segment during an EEG is limited. Further studies with simultaneous EEG and 12-lead ECG are warranted.

In-Hospital Haloperidol Use and Perioperative Changes in QTc-Duration.

PubMed

Blom, M T; Jansen, S; de Jonghe, A; van Munster, B C; de Boer, A; de Rooij, S E; Tan, H L; van der Velde, N

2015-05-01

Haloperidol may prolong ECG QTc-duration but is often prescribed perioperatively to hip-fracture patients. We aimed to determine (1) how QTc-duration changes perioperatively, (2) whether low-dose haloperidol-use influences these changes, and (3) which clinical variables are associated with potentially dangerous perioperative QTc-prolongation (PD-QTc; increase >50 ms or to >500 ms). Prospective cohort study. Tertiary university teaching-hospital. Patients enrolled in a randomized controlled clinical trial of melatonin versus placebo on occurrence of delirium in hip-fracture patients. Data from ECGs made before and after hip surgery (1-3 days and/or 4-6 days post-surgery) were analyzed. QTc-duration was measured by hand, blinded for haloperidol and pre/post-surgery status. Clinical variables were measured at baseline. Mixed model analysis was used to estimate changes in QTc-duration. Risk-factors for PD-QTc were estimated by logistic regression analysis. We included 89 patients (mean age 84 years, 24% male); 39 were treated with haloperidol. Patients with normal pre-surgery QTc-duration (male ≤430 ms, female ≤450 ms) had a significant increase (mean 12 ms, SD 28) in QTc-duration. A significant decrease (mean 19 ms, SD 34) occurred in patients with prolonged pre-surgery QTc-duration (male >450ms, female >470 ms). Haloperidol-use did not influence the perioperative course of the QTc-interval (p=0.351). PD-QTc (n=8) was not associated with any of the measured risk-factors. QTc-duration changed differentially, increasing in patients with normal, but decreasing in patients with abnormal baseline QTc-duration. PD-QTc was not associated with haloperidol-use or other risk-factors. Low-dose oral haloperidol did not affect perioperative QTc-interval.

Abnormalities of the QT interval in primary disorders of autonomic failure

NASA Technical Reports Server (NTRS)

Choy, A. M.; Lang, C. C.; Roden, D. M.; Robertson, D.; Wood, A. J.; Robertson, R. M.; Biaggioni, I.

1998-01-01

BACKGROUND: Experimental evidence shows that activation of the autonomic nervous system influences ventricular repolarization and, therefore, the QT interval on the ECG. To test the hypothesis that the QT interval is abnormal in autonomic dysfunction, we examined ECGs in patients with severe primary autonomic failure and in patients with congenital dopamine beta-hydroxylase (DbetaH) deficiency who are unable to synthesize norepinephrine and epinephrine. SUBJECTS AND METHODS: Maximal QT and rate-corrected QT (QTc) intervals and adjusted QTc dispersion [(maximal QTc - minimum QTc on 12 lead ECG)/square root of the number of leads measured] were determined in blinded fashion from ECGs of 67 patients with primary autonomic failure (36 patients with multiple system atrophy [MSA], and 31 patients with pure autonomic failure [PAF]) and 17 age- and sex-matched healthy controls. ECGs of 5 patients with congenital DbetaH deficiency and 6 age- and sex-matched controls were also analyzed. RESULTS: Patients with MSA and PAF had significantly prolonged maximum QTc intervals (492+/-58 ms(1/2) and 502+/-61 ms(1/2) [mean +/- SD]), respectively, compared with controls (450+/-18 ms(1/2), P < .05 and P < .01, respectively). A similar but not significant trend was observed for QT. QTc dispersion was also increased in MSA (40+/-20 ms(1/2), P < .05 vs controls) and PAF patients (32+/-19 ms(1/2), NS) compared with controls (21+/-5 ms(1/2)). In contrast, patients with congenital DbetaH deficiency did not have significantly different RR, QT, QTc intervals, or QTc dispersion when compared with controls. CONCLUSIONS: Patients with primary autonomic failure who have combined parasympathetic and sympathetic failure have abnormally prolonged QT interval and increased QT dispersion. However, QT interval in patients with congenital DbetaH deficiency was not significantly different from controls. It is possible, therefore, that QT abnormalities in patients with primary autonomic failure are not solely caused by lesions of the sympathetic nervous system, and that the parasympathetic nervous system is likely to have a modulatory role in ventricular repolarization.

Lacosamide cardiac safety: a thorough QT/QTc trial in healthy volunteers.

PubMed

Kropeit, D; Johnson, M; Cawello, W; Rudd, G D; Horstmann, R

2015-11-01

To determine whether lacosamide prolongs the corrected QT interval (QTc). In this randomized, double-blind, positive- and placebo-controlled, parallel-design trial, healthy volunteers were randomized to lacosamide 400 mg/day (maximum-recommended daily dose, 6 days), lacosamide 800 mg/day (supratherapeutic dose, 6 days), placebo (6 days), or moxifloxacin 400 mg/day (3 days). Variables included maximum time-matched change from baseline in QT interval individually corrected for heart rate ([HR] QTcI), other ECG parameters, pharmacokinetics (PK), and safety/tolerability. The QTcI mean maximum difference from placebo was -4.3 ms and -6.3 ms for lacosamide 400 and 800 mg/day; upper limits of the 2-sided 90% confidence interval were below the 10 ms non-inferiority margin (-0.5 and -2.5 ms, respectively). Placebo-corrected QTcI for moxifloxacin was +10.4 ms (lower 90% confidence bound >0 [6.6 ms]), which established assay sensitivity for this trial. As lacosamide did not increase QTcI, the trial is considered a negative QTc trial. There was no dose-related or clinically relevant effect on QRS duration. HR increased from baseline by ~5 bpm with lacosamide 800 mg/day versus placebo. Placebo-subtracted mean increases in PR interval at tmax were 7.3 ms (400 mg/day) and 11.9 ms (800 mg/day). There were no findings of second-degree or higher atrioventricular block. Adverse events (AEs) were dose related and most commonly involved the nervous and gastrointestinal systems. Lacosamide (≤ 800 mg/day) did not prolong the QTc interval. Lacosamide caused a small, dose-related increase in mean PR interval that was not associated with AEs. Cardiac, overall safety, and PK profiles for lacosamide in healthy volunteers were consistent with those observed in patients with partial-onset seizures. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Levofloxacin can be used effectively as a positive control in thorough QT/QTc studies in healthy volunteers

PubMed Central

Taubel, Jorg; Naseem, Asif; Harada, Tomohiko; Wang, Duolao; Arezina, Radivoj; Lorch, Ulrike; Camm, A John

2010-01-01

AIMS To characterize the effects of levofloxacin on QT interval in healthy subjects and the most appropriate oral positive control treatments for International Conference on Harmonization (ICH) E14 QT/QTc studies. METHODS Healthy subjects received a single dose of levofloxacin (1000 or 1500 mg), moxifloxacin (400 mg) or placebo in a four-period crossover design. Digital 12-lead ECGs were recorded in triplicate. Measurement of QT interval was performed automatically with subsequent manual onscreen over-reading using electronic callipers. Blood samples were taken for determination of levofloxacin and moxifloxacin concentrations. RESULTS Mean QTcI (QT interval corrected for heart rate using a correction factor that is applicable to each individual) was prolonged in subjects receiving moxifloxacin 400 mg compared with placebo. The largest time-matched difference in QTcI for moxifloxacin compared with placebo was observed to be 13.19 ms (95% confidence interval 11.21, 15.17) at 3.5 h post dose. Prolonged mean QTcI was also observed in subjects receiving levofloxacin 1000 mg and 1500 mg compared with placebo. The largest time-matched difference in QTcI compared with placebo was observed at 3.5 h post dose for both 1000 mg and 1500 mg of levofloxacin [mean (95%) 4.42 ms (2.44, 6.39) in 1000 mg and 7.44 ms (5.47, 9.42) in 1500 mg]. A small increase in heart rate was observed with levofloxacin during the course of the study. However, moxifloxacin showed a greater increase compared with levofloxacin. CONCLUSIONS Both levofloxacin and moxifloxacin can fulfil the criteria for a positive comparator. The ICH E14 guidelines recommend a threshold of around 5 ms for a positive QT/QTc study. The largest time-matched difference in QTc for levofloxacin suggests the potential for use in more rigorous QT/QTc studies. This study has demonstrated the utility of levofloxacin on the assay in measuring mean QTc changes around 5 ms. PMID:20406223

Sodium channel blockade with QRS widening after an escitalopram overdose.

PubMed

Schreffler, Susan M; Marraffa, Jeanna M; Stork, Christine M; Mackey, Jennifer

2013-09-01

Escitalopram is rarely associated with prolongation of the QTc interval; however, there are no reported cases of QRS complex widening associated with escitalopram overdose. We report a case of a patient who presented with both QRS complex widening and QTc interval prolongation after an escitalopram overdose. A 16-year-old girl presented to the emergency department after ingestion of escitalopram, tramadol/acetaminophen, and hydrocodone/acetaminophen. Laboratory results were significant for 4-hour acetaminophen 21.1 μg/mL. Serum electrolytes including potassium, magnesium, and calcium were all normal. Initial electrocardiogram (ECG) revealed a widened QRS with an incomplete right bundle branch pattern. After administration of 100-mEq sodium bicarbonate, a repeat ECG revealed narrowing of the QRS complex and a prolonged QTc interval. Magnesium sulfate 2 g intravenous and sodium bicarbonate drip were initiated. A repeat ECG, 1 hour after the second, revealed normalization of the QRS complex and QTc interval. Prolongation of the QTc interval is an expected effect of escitalopram. Both escitalopram and citalopram are metabolized to the cardiotoxic metabolite S-didesmethylcitalopram and didesmethylcitalopram, respectively, which have been implicated in numerous cardiac abnormalities including widening of the QRS complex. Although never previously described with escitalopram, this mechanism provides a reasonable explanation for the QRS complex widening and incomplete right bundle branch block that occurred in our patient. Both QRS complex widening and QTc interval prolongation should be monitored in cases of escitalopram and citalopram overdoses.

Acute effects of Red Bull energy drink on ventricular repolarization in healthy young volunteers: a prospective study

PubMed Central

Elitok, Ali; Öz, Fahrettin; Panc, Cafer; Sarıkaya, Remzi; Sezikli, Selim; Pala, Yasin; Bugan, Övgü Sinem; Ateş, Müge; Parıldar, Hilal; Ayaz, Mustafa Buğra; Atıcı, Adem; Oflaz, Hüseyin

2016-01-01

Objective: Energy drinks (EDs) are widely consumed products of the beverage industry and are often chosen by teenagers and young adults. Several adverse cardiovascular events and malignant cardiac arrhythmias following consumption of EDs have been reported in the literature. Several studies have suggested that the interval from the peak to the end of the electrocardiographic T wave (Tp-e) may correspond to the dispersion of repolarization and that an increased Tp-e interval and Tp-e/QT ratio are associated with malignant ventricular arrhythmias. This study investigated the acute effects of Red Bull ED on ventricular repolarization as assessed by the Tp-e interval and Tp-e/QT ratio. Methods: A prospective, open-label study design was used. After an 8-h fast, 50 young, healthy subjects consumed 355 mL of Red Bull ED. The Tp-e interval, Tp-e/QTc ratio, and several other electrocardiographic parameters were measured at baseline and 2 h after ingestion of Red Bull ED. Results: No significant changes in the Tp-e interval or Tp-e/QTc ratio were observed with Red Bull ED consumption. Red Bull ED consumption led to increases in both systolic and diastolic blood pressures, which were associated with an increased heart rate. Conclusion: Although ingestion of Red Bull ED increases the heart rate and diastolic and systolic blood pressures, it does not cause alterations in ventricular repolarization as assessed by the Tp-e interval and Tp-e/QTc ratio. PMID:25868042

Acute effects of Red Bull energy drink on ventricular repolarization in healthy young volunteers: a prospective study.

PubMed

Elitok, Ali; Öz, Fahrettin; Panc, Cafer; Sarıkaya, Remzi; Sezikli, Selim; Pala, Yasin; Bugan, Övgü Sinem; Ateş, Müge; Parıldar, Hilal; Ayaz, Mustafa Buğra; Atıcı, Adem; Oflaz, Hüseyin

2015-11-01

Energy drinks (EDs) are widely consumed products of the beverage industry and are often chosen by teenagers and young adults. Several adverse cardiovascular events and malignant cardiac arrhythmias following consumption of EDs have been reported in the literature. Several studies have suggested that the interval from the peak to the end of the electrocardiographic T wave (Tp-e) may correspond to the dispersion of repolarization and that an increased Tp-e interval and Tp-e/QT ratio are associated with malignant ventricular arrhythmias. This study investigated the acute effects of Red Bull ED on ventricular repolarization as assessed by the Tp-e interval and Tp-e/QT ratio. A prospective, open-label study design was used. After an 8-h fast, 50 young, healthy subjects consumed 355 mL of Red Bull ED. The Tp-e interval, Tp-e/QTc ratio, and several other electrocardiographic parameters were measured at baseline and 2 h after ingestion of Red Bull ED. No significant changes in the Tp-e interval or Tp-e/QTc ratio were observed with Red Bull ED consumption. Red Bull ED consumption led to increases in both systolic and diastolic blood pressures, which were associated with an increased heart rate. Although ingestion of Red Bull ED increases the heart rate and diastolic and systolic blood pressures, it does not cause alterations in ventricular repolarization as assessed by the Tp-e interval and Tp-e/QTc ratio.

[Relationship between electrocardiographic and genetic mutation (MYH7-H1717Q, MYLK2-K324E and KCNQ1-R190W) phenotype in patients with hypertrophic cardiomyopathy].

PubMed

Shao, Hong; Zhang, Yanmin; Liu, Liwen; Ma, Zhiling; Zuo, Lei; Ye, Chuang; Wei, Xiaomei; Sun, Chao; Tao, Ling

2016-01-01

To explore the relationship between electrocardiographic (ECG) and genetic mutations of patients with hypertrophic cardiomyopathy (HCM), and early ECG changes in HCM patients. Clinical, 12-lead ECG and echocardiographic examination as well as genetic examinations were made in a three-generation Chinses HCM pedigree with 8 family members (4 males). The clinical characterization and ECG parameters were analyzed and their relationship with genotypes in the family was explored. Four missense mutations (MYH7-H1717Q, MYLK2-K324E, KCNQ1-R190W, TMEM70-I147T) were detected in this pedigree. The proband carried all 4 mutations and 5 members carried 2 mutations. Corrected QTc interval of KCNQ1-H1717Q carriers was significantly prolonged and was consistent with the ECG characterization of long QT syndrome. MYLK2-K324E and KCNQ1-R190W carriers presented with Q wave and(or) depressed ST segment, as well as flatted or reversed T waves in leads from anterolateral and inferior ventricular walls. ECG results showed ST segment depression, flat and inverted T wave in the gene mutation carriers with normal echocardiographic examination results. ECG and echocardiographic results were normal in TMEM70-I147T mutation carrier. The combined mutations of the genes associated with cardiac ion channels and HCM are linked with the ECG phenotype changes in this HCM pedigree. The variations in ECG parameters due to the genetic mutation appear earlier than the echocardiography and clinical manifestations. Variation in ECG may become one of the indexes for early diagnostic screening and disease progression of the HCM gene mutation carriers.

Randomized, blinded, placebo- and positive-controlled crossover study to determine the effect of multiple doses of apixaban on the QTc interval.

PubMed

Frost, Charles; Nepal, Sunil; Byon, Wonkyung; Moore, Kenneth; Reeves, Richard A; Boyd, Rebecca; LaCreta, Frank

2015-05-01

Apixaban is an oral, direct factor Xa inhibitor indicated for the prevention and treatment of thromboembolic disease. This randomized, blinded, 4-way crossover study investigated the potential effect of apixaban on the QTc interval. Forty healthy subjects (39 completers) each received 3 days of the following treatments: blinded apixaban 10 mg once daily (QD), 50 mg QD (supratherapeutic), matched apixaban placebo QD, and a single dose of open-label moxifloxacin 400 mg on Day 3, preceded by 2 days of placebo QD. Triplicate electrocardiograms obtained over 24 hours on Days -1 (baseline) and 3 were read by a blinded third party. The mean placebo-adjusted, time-matched, Fridericia-corrected change from baseline QTc (ΔΔQTcF) for apixaban and moxifloxacin was estimated at each time point. The maximum ΔΔQTcF was 1.51 milliseconds (one-sided upper 95% confidence interval [CI] 3.71 milliseconds) after apixaban 50 mg QD, 1.36 milliseconds (one-sided upper 95%CI 3.54 milliseconds) after apixaban 10 mg QD, and 10.21 milliseconds (lower 95%CI 8.07 milliseconds) after moxifloxacin. Concentration-response analysis suggested no evidence of a positive relationship between apixaban concentration and ΔQTcF. Apixaban doses up to 50 mg QD for 3 days were well tolerated and did not prolong the QTc interval in healthy subjects. © 2015, The American College of Clinical Pharmacology.

Prolongation of heart rate-corrected QT interval is a predictor of cardiac autonomic dysfunction in patients with systemic lupus erythematosus.

PubMed

Nomura, Atsushi; Kishimoto, Mitsumasa; Takahashi, Osamu; Deshpande, Gautam A; Yamaguchi, Kenichi; Okada, Masato

2014-05-01

Heart rate-corrected QT interval duration (QTc) has been shown to be related to cardiac autonomic dysfunction in patients with diabetes mellitus, although this association has not been previously described in patients with systemic lupus erythematosus (SLE). We retrospectively reviewed the medical records of 91 SLE patients and 144 non-SLE connective tissue disease patients visiting our clinic from November 2010 to April 2011. We compared ambulatory heart rate identified by pulse measured by automated machine in an outpatient waiting area versus resting heart rate identified on prior screening electrocardiogram. Heart rate differences were analyzed in relation to QTc interval and other characteristics. Ambulatory and resting heart rate differences were larger among SLE patients with QTc prolongation (QTc > 430 ms) than those without QTc prolongation (mean difference, 15.9 vs. 9.6, p = 0.001). In multivariate analysis, differences in heart rate were associated with QTc prolongation (OR 1.10, 95 % CI 1.01-1.21; p = 0.038), independent of age, duration of disease, immunosuppressant use, hydroxychloroquine use, diabetes mellitus, cardiac abnormality, anti-Ro/SS-A antibody positivity, or resting heart rate. Cardiac autonomic dysfunction is a common manifestation of SLE and may be related to QTc prolongation.

A thorough QT study to evaluate the effects of therapeutic and supratherapeutic doses of delafloxacin on cardiac repolarization.

PubMed

Litwin, Jeffrey S; Benedict, Michael S; Thorn, Michael D; Lawrence, Laura E; Cammarata, Sue K; Sun, Eugene

2015-01-01

A randomized, double-blind, placebo-controlled, 4-period crossover study was conducted in 52 healthy adults to assess the effect of delafloxacin on the corrected QT (QTc) interval. The QT interval, corrected for heart rate using Fridericia's formula (QTcF), was determined predose and at 0.5, 1, 1.25, 1.5, 1.75, 2, 2.5, 3, 4, 5, 6, 12, 18, and 24 h after dosing with delafloxacin at 300 mg intravenously (i.v.; therapeutic), delafloxacin at 900 mg i.v. (supratherapeutic), moxifloxacin at 400 mg orally (p.o.; positive control), and placebo. The pharmacokinetic profile of delafloxacin was also evaluated. At each time point after delafloxacin administration, the upper limit of the 90% confidence interval (CI) for the placebo-corrected change from the predose baseline in QTcF (ΔΔQTcF) was less than 10 ms (maximum, 3.9 ms at 18 h after dosing), indicating an absence of a clinically meaningful increase in the QTc interval. The lower limit of the 90% CI of ΔΔQTcF for moxifloxacin versus placebo was longer than 5 ms at all 5 time points selected for assay sensitivity analysis, demonstrating that the study was adequately sensitive to assess QTc prolongation. There was no positive relationship between delafloxacin plasma concentrations and ΔΔQTcF. Treatment-emergent adverse events (AEs) were more frequent among subjects receiving a single supratherapeutic dose of 900 mg delafloxacin. There were no deaths, serious AEs, or AEs leading to study discontinuation and no clinically meaningful abnormalities in laboratory values or vital signs observed at any time point after any dose of the study drug. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

The QT Scale: A Weight Scale Measuring the QTc Interval.

PubMed

Couderc, Jean-Philippe; Beshaw, Connor; Niu, Xiaodan; Serrano-Finetti, Ernesto; Casas, Oscar; Pallas-Areny, Ramon; Rosero, Spencer; Zareba, Wojciech

2017-01-01

Despite the strong evidence of the clinical utility of QTc prolongation as a surrogate marker of cardiac risk, QTc measurement is not part of clinical routine either in hospital or in physician offices. We evaluated a novel device ("the QT scale") to measure heart rate (HR) and QTc interval. The QT scale is a weight scale embedding an ECG acquisition system with four limb sensors (feet and hands: lead I, II, and III). We evaluated the reliability of QT scale in healthy subjects (cohort 1) and cardiac patients (cohorts 2 and 3) considering a learning (cohort 2) and two validation cohorts. The QT scale and the standard 12-lead recorder were compared using intraclass correlation coefficient (ICC) in cohorts 2 and 3. Absolute value of heart rate and QTc intervals between manual and automatic measurements using ECGs from the QT scale and a clinical device were compared in cohort 1. We enrolled 16 subjects in cohort 1 (8 w, 8 m; 32 ± 8 vs 34 ± 10 years, P = 0.7), 51 patients in cohort 2 (13 w, 38 m; 61 ± 16 vs 58 ± 18 years, P = 0.6), and 13 AF patients in cohort 3 (4 w, 9 m; 63 ± 10 vs 64 ± 10 years, P = 0.9). Similar automatic heart rate and QTc were delivered by the scale and the clinical device in cohort 1: paired difference in RR and QTc were -7 ± 34 milliseconds (P = 0.37) and 3.4 ± 28.6 milliseconds (P = 0.64), respectively. The measurement of stability was slightly lower in ECG from the QT scale than from the clinical device (ICC: 91% vs 80%) in cohort 3. The "QT scale device" delivers valid heart rate and QTc interval measurements. © 2016 Wiley Periodicals, Inc.

Interleukin-1β gene variants are associated with QTc interval prolongation following cardiac surgery: a prospective observational study.

PubMed

Kertai, Miklos D; Ji, Yunqi; Li, Yi-Ju; Mathew, Joseph P; Daubert, James P; Podgoreanu, Mihai V

2016-04-01

We characterized cardiac surgery-induced dynamic changes of the corrected QT (QTc) interval and tested the hypothesis that genetic factors are associated with perioperative QTc prolongation independent of clinical and procedural factors. All study subjects were ascertained from a prospective study of patients who underwent elective cardiac surgery during August 1999 to April 2002. We defined a prolonged QTc interval as > 440 msec, measured from 24-hr pre- and postoperative 12-lead electrocardiograms. The association of 37 single nucleotide polymorphisms (SNPs) in 21 candidate genes -involved in modulating arrhythmia susceptibility pathways with postoperative QTc changes- was investigated in a two-stage design with a stage I cohort (n = 497) nested within a stage II cohort (n = 957). Empirical P values (Pemp) were obtained by permutation tests with 10,000 repeats. After adjusting for clinical and procedural risk factors, we selected four SNPs (P value range, 0.03-0.1) in stage I, which we then tested in the stage II cohort. Two functional SNPs in the pro-inflammatory cytokine interleukin-1β (IL1β), rs1143633 (odds ratio [OR], 0.71; 95% confidence interval [CI], 0.53 to 0.95; Pemp = 0.02) and rs16944 (OR, 1.31; 95% CI, 1.01 to 1.70; Pemp = 0.04), remained independent predictors of postoperative QTc prolongation. The ability of a clinico-genetic model incorporating the two IL1B polymorphisms to classify patients at risk for developing prolonged postoperative QTc was superior to a clinical model alone, with a net reclassification improvement of 0.308 (P = 0.0003) and an integrated discrimination improvement of 0.02 (P = 0.000024). The results suggest a contribution of IL1β in modulating susceptibility to postoperative QTc prolongation after cardiac surgery.

QTc abnormalities in deliberate self-poisoning with moclobemide.

PubMed

Downes, M A; Whyte, I M; Isbister, G K

2005-07-01

Several medications have been found to prolong the QT interval in overdose. This can predispose to torsade de pointes-type ventricular tachycardia. To analyse the effects of moclobemide deliberate self-poisoning on the length of both QT and corrected QT (QTc) intervals. Electrocardiograms (ECG) of all patients presenting to a regional toxicology service with moclobemide ingestion were reviewed. Cases where a cardiotoxic agent was coingested were excluded. QT and QTc parameters were compared with a comparison group of patients ingesting paracetamol or benzodiazepines. Of 75 patients where ECG were available, the median ingested dose was 4.5 g (interquartile range (IQR): 2.4-7.5; range: 0.6-18 g) and the median age was 34 years (IQR: 26-44). The mean QT interval was 415 ms (standard deviation (SD): 51 ms) with a mean QTc of 459 ms (SD: 44 ms), and were prolonged compared with the comparison group. Twelve female patients had a QTc > 500 ms and in seven of these causality was established based on a pre- or post-ECG with a QTc < 500 ms. Only 10% of the moclobemide cases had a heart rate (HR) > 100 beats per minute, making overcorrection of HR by Bazett's formula an unlikely cause of the findings. No cardiac arrythmias were observed other than one case of first-degree heart block. Moclobemide prolongs the QT and QTc intervals in overdose and a 12-lead ECG should be done on all moclobemide deliberate self-poisonings. Continuous cardiac monitoring for what is otherwise a relatively benign overdose would appear to be an inappropriate use of resources but can be considered in patients with a QTc > 500 ms or with known risks for QT prolongation.

A Thorough QT Study To Evaluate the Effects of Therapeutic and Supratherapeutic Doses of Delafloxacin on Cardiac Repolarization

PubMed Central

Benedict, Michael S.; Thorn, Michael D.; Lawrence, Laura E.; Cammarata, Sue K.; Sun, Eugene

2015-01-01

A randomized, double-blind, placebo-controlled, 4-period crossover study was conducted in 52 healthy adults to assess the effect of delafloxacin on the corrected QT (QTc) interval. The QT interval, corrected for heart rate using Fridericia's formula (QTcF), was determined predose and at 0.5, 1, 1.25, 1.5, 1.75, 2, 2.5, 3, 4, 5, 6, 12, 18, and 24 h after dosing with delafloxacin at 300 mg intravenously (i.v.; therapeutic), delafloxacin at 900 mg i.v. (supratherapeutic), moxifloxacin at 400 mg orally (p.o.; positive control), and placebo. The pharmacokinetic profile of delafloxacin was also evaluated. At each time point after delafloxacin administration, the upper limit of the 90% confidence interval (CI) for the placebo-corrected change from the predose baseline in QTcF (ΔΔQTcF) was less than 10 ms (maximum, 3.9 ms at 18 h after dosing), indicating an absence of a clinically meaningful increase in the QTc interval. The lower limit of the 90% CI of ΔΔQTcF for moxifloxacin versus placebo was longer than 5 ms at all 5 time points selected for assay sensitivity analysis, demonstrating that the study was adequately sensitive to assess QTc prolongation. There was no positive relationship between delafloxacin plasma concentrations and ΔΔQTcF. Treatment-emergent adverse events (AEs) were more frequent among subjects receiving a single supratherapeutic dose of 900 mg delafloxacin. There were no deaths, serious AEs, or AEs leading to study discontinuation and no clinically meaningful abnormalities in laboratory values or vital signs observed at any time point after any dose of the study drug. PMID:25845864

A Pilot Study: Cardiac Parameters in Children Receiving New-Generation Antidepressants.

PubMed

Uchida, Mai; Spencer, Andrea E; Kenworthy, Tara; Chan, James; Fitzgerald, Maura; Rosales, Ana Maria; Kagan, Elana; Saunders, Alexandra; Biederman, Joseph

2017-06-01

Because of concerns about potential associations between high doses of citalopram and QTc prolongation in adults, this study examined whether such associations are operant in children. We hypothesized that therapeutic doses of nontricyclic antidepressant medications (non-TCAs) prescribed to children would be cardiovascularly safe. The sample consisted of 49 psychiatrically referred children and adolescents 6 to 17 years old of both sexes treated with a non-TCA (citalopram, escitalopram, fluoxetine, paroxetine, sertraline, bupropion, duloxetine, venlafaxine, mirtazapine). To standardize the doses of different antidepressants, we converted doses of individual medicines into "citalopram equivalent doses" (CEDs) based on dosing recommendation for individual antidepressants. Correlation analysis was carried out to compare the continuous and weight-based CED to variables of interest. A QTc grouping was defined as normal, borderline, or abnormal, and CED was compared across QTc groupings using linear regression. An antidepressant dosage group was defined as low or high dose, and a t test compared variables of interest across dosage groups. No significant associations were found between total or weight-corrected CEDs of any antidepressant examined and QTc or any other electrocardiogram or blood pressure parameters. In patients taking citalopram or escitalopram, a significant correlation was found between PR interval and total daily dose, which disappeared when weight-based doses were used or when corrected by age. Although limited by a relatively small sample size, these results suggest that therapeutic doses of non-TCA antidepressants when used in children do not seem to be associated with prolonged QTc interval or other adverse cardiovascular effects.

Comparison of the effects of various airway devices on hemodynamic response and QTc interval in rabbits under general anesthesia.

PubMed

Toman, Huseyin; Erbas, Mesut; Sahin, Hasan; Kiraz, Hasan Ali; Uzun, Metehan; Ovali, Mehmet Akif

2015-12-01

In this study, we aimed to compare the effects of various airway devices on QTc interval in rabbits under general anesthesia. The subjects were randomly separated into four groups: Group ETT, Group LMA, Group PLA, Group V-gel. Baseline values and hearth rate, mean arterial pressure and ECG was obtained at the 1st, 5th and 30th minutes after administration of anesthesia and placement of airway device and, QTc interval was evaluated. Difference was observed between ET group and V-gel group in the 5th minute mean arterial pressure values (p < 0.05). It was observed that QTc intervals at the 1st and 5th minute in the ET group significantly increased when compared with the other groups (p < 0.05). Again, it was observed that QTc interval of ET group at the 15th and 30th minute was longer when compared with PLA and V-gel groups (p < 0.05). It was also observed that QTc interval of LMA Group at the 5th minute after intubation significantly increased when compared with V-gel group (p < 0.05). It was observed that HR values of ETT group at the 1st, 5th and 15th minutes after intubation increased with regards to PLA and V-gel groups (p < 0.05). It was determined that the 30th minute hearth rate of ETT group was higher when compared to V-gel group (p < 0.05). In our study we observed that V-gel Rabbit affected both hemodynamic response and QT interval less than other airway devices.

The effects of apremilast on the QTc interval in healthy male volunteers: a formal, thorough QT study

PubMed Central

Palmisano, Maria; Wu, Anfan; Assaf, Mahmoud; Liu, Liangang; Park, C. Hyung; Savant, Ishani; Liu, Yong; Zhou, Simon

2016-01-01

Objective: This study was conducted to evaluate the effect of apremilast and its major metabolites on the placebo-corrected change-from-baseline QTc interval of an electrocardiogram (ECG). Materials and methods: Healthy male subjects received each of 4 treatments in a randomized, crossover manner. In the 2 active treatment periods, apremilast 30 mg (therapeutic exposure) or 50 mg (supratherapeutic exposure) was administered twice daily for 9 doses. A placebo control was used to ensure double-blind treatment of apremilast, and an open-label, single dose of moxifloxacin 400 mg was administered as a positive control. ECGs were measured using 24-hour digital Holter monitoring. Results: The two-sided 98% confidence intervals (CIs) for ΔΔQTcI of moxifloxacin completely exceeded 5 ms 2 – 4 hours postdose. For both apremilast dose studies, the least-squares mean ΔΔQTcI was < 1 ms at all time points, and the upper limit of two-sided 90% CIs was < 10 ms. There were no QT/QTc values > 480 ms or a change from baseline > 60 ms. Exploratory evaluation of pharmacokinetic/pharmacodynamic data showed no trend between the changes in QT/QTc interval and the concentration of apremilast or its major metabolites M12 and M14. Conclusions: Apremilast did not prolong the QT interval and appears to be safe and well tolerated up to doses of 50 mg twice daily. PMID:27285466

Hypoglycaemia and QT interval prolongation in type 1 diabetes--bridging the gap between clamp studies and spontaneous episodes.

PubMed

Christensen, T F; Cichosz, S L; Tarnow, L; Randløv, J; Kristensen, L E; Struijk, J J; Eldrup, E; Hejlesen, O K

2014-01-01

We propose a study design with controlled hypoglycaemia induced by subcutaneous injection of insulin and matched control episodes to bridge the gap between clamp studies and studies of spontaneous hypoglycaemia. The observed prolongation of the heart rate corrected QT interval (QTc) during hypoglycaemia varies greatly between studies. We studied ten adults with type 1 diabetes (age 41±15years) without cardiovascular disease or neuropathy. Single-blinded hypoglycaemia was induced by a subcutaneous insulin bolus followed by a control episode on two occasions separated by 4weeks. QT intervals were measured using the semi-automatic tangent approach, and QTc was derived by Bazett's (QTcB) and Fridericia's (QTcF) formulas. QTcB increased from baseline to hypoglycaemia (403±20 vs. 433±39ms, p<0.001). On the euglycaemia day, QTcB also increased (398±20 vs. 410±27ms, p<0.01), but the increase was less than during hypoglycaemia (p<0.001). The same pattern was seen for QTcF. Plasma adrenaline levels increased significantly during hypoglycaemia compared to euglycaemia (p<0.01). Serum potassium levels decreased similarly after insulin injection during both hypoglycaemia and euglycaemia. Hypoglycaemia as experienced after a subcutaneous injection of insulin may cause QTc prolongation in type 1 diabetes. However, the magnitude of prolongation is less than typically reported during glucose clamp studies, possible because of the study design with focus on minimizing unwanted study effects. Copyright © 2014 Elsevier Inc. All rights reserved.

Influence of gender and types of sports training on QT variables in young elite athletes.

PubMed

Omiya, Kazuto; Sekizuka, Hiromitsu; Kida, Keisuke; Suzuki, Kengo; Akashi, Yoshihiro J; Ohba, Haruo; Musha, Haruki

2014-01-01

Influence of gender and sports training on QT variables such as QT interval and dispersion (QT dispersion: QTD) in young elite athletes were evaluated. Subjects included 104 male and 97 female Japanese elite athletes (mean age 21.6 years). Sports included basketball, fencing, gymnastics, judo, swimming, tennis, track and field and volleyball. Age-matched healthy non-athletes (32 men and 20 women) were enrolled as controls. QT measurements were manually obtained from a 12-lead resting electrocardiogram and QTD was calculated as the difference between the longest and shortest QT intervals. A corrected QT interval (QTc) was obtained using Bazett's formula. Subjects were divided into two groups; an endurance training group and a static training group on the basis of their training types. Maximum and minimum QTc were significantly longer in female athletes than in male athletes (max: 414.2 vs. 404.5 ms, min: 375.1 vs. 359.2 ms, p<0.0001 respectively), whereas QTc dispersion (QTcD) was shorter in female athletes than in male athletes (39.2 vs. 45.3 ms, p<0.0001). QTcD was significantly shorter in female athletes than in the female control group (39.2 vs. 45.2 ms, p<0.05). However, no statistically significant difference was observed between male athletes and the male control group. Male gymnasts exhibited significantly longer QTcD than the control group (p<0.01), but female gymnasts had significantly shorter QTcD than the control group (p<0.05). Maximum QTc intervals were prolonged in the male static training group compared with non-athletes, and QTcDs in the static training group were prolonged compared with the endurance training group. However, no significant difference was observed in the female group. In conclusion, both gender and different characteristics of sports training may affect QT variables even in young elite athletes. Vigorous static exercise training may independently prolong QT variables.

Prevalence and risk factors for prolonged QT interval and QT dispersion in patients with type 2 diabetes.

PubMed

Ninkovic, Vladan M; Ninkovic, Srdjan M; Miloradovic, Vanja; Stanojevic, Dejan; Babic, Marijana; Giga, Vojislav; Dobric, Milan; Trenell, Michael I; Lalic, Nebojsa; Seferovic, Petar M; Jakovljevic, Djordje G

2016-10-01

Prolonged QT interval is associated with cardiac arrhythmias and sudden death. The present study determined the prevalence of prolonged QT interval and QT dispersion and defined their clinical and metabolic predictors in patients with type 2 diabetes. Cross-sectional study included 501 patients with type 2 diabetes. A standard 12-lead electrocardiogram was recorded. QT corrected for heart rate (QTc) >440 ms and QT dispersion (QTd) >80 ms were considered abnormally prolonged. QTc ≥ 500 ms was considered a high-risk QTc prolongation. Demographic, clinical and laboratory data were collected. Independent risk factors for prolonged QTc and QTd were assessed using logistic regression analysis. Prevalence of QTc > 440 ms and QTd > 80 ms were 44.1 and 3.6 %, respectively. Prevalence of high-risk QTc (≥500 ms) was 2 % only. Independent risk factors for QTc prolongation >440 ms were mean blood glucose (β = 2.192, p < 0.001), treatment with sulphonylurea (β = 5.198, p = 0.027), female gender (β = 8.844, p < 0.001), and coronary heart disease (β = 8.636, p = 0.001). Independent risk factors for QTc ≥ 500 ms were coronary heart disease (β = 4.134, p < 0.001) and mean blood glucose level (β = 1.735, p < 0.001). The independent risk factor for prolonged QTd was only coronary heart disease (β = 5.354, p < 0.001). Although the prevalence of prolonged QTc > 440 ms is significant, the prevalence of high-risk QTc (≥500 ms) and QTd > 80 ms is very low in patients with type 2 diabetes. Hyperglycaemia and coronary heart disease are strong predictors of high-risk QTc.

A modeling and simulation approach to characterize methadone QT prolongation using pooled data from five clinical trials in MMT patients.

PubMed

Florian, J; Garnett, C E; Nallani, S C; Rappaport, B A; Throckmorton, D C

2012-04-01

Pharmacokinetic (PK)-pharmacodynamic modeling and simulation were used to establish a link between methadone dose, concentrations, and Fridericia rate-corrected QT (QTcF) interval prolongation, and to identify a dose that was associated with increased risk of developing torsade de pointes. A linear relationship between concentration and QTcF described the data from five clinical trials in patients on methadone maintenance treatment (MMT). A previously published population PK model adequately described the concentration-time data, and this model was used for simulation. QTcF was increased by a mean (90% confidence interval (CI)) of 17 (12, 22) ms per 1,000 ng/ml of methadone. Based on this model, doses >120 mg/day would increase the QTcF interval by >20 ms. The model predicts that 1-3% of patients would have ΔQTcF >60 ms, and 0.3-2.0% of patients would have QTcF >500 ms at doses of 160-200 mg/day. Our predictions are consistent with available observational data and support the need for electrocardiogram (ECG) monitoring and arrhythmia risk factor assessment in patients receiving methadone doses >120 mg/day.

Measuring the effects of supratherapeutic doses of levofloxacin on healthy volunteers using four methods of QT correction and periodic and continuous ECG recordings.

PubMed

Noel, Gary J; Goodman, Daniel B; Chien, Shuchean; Solanki, Bhavna; Padmanabhan, Mukund; Natarajan, Jaya

2004-05-01

A clinical trial was conducted in healthy volunteers using both periodic and continuous ECG recordings to assess the effect of increasing doses of levofloxacin on the QT and QTc interval. Periodic and continuous ECGs were recorded before and after subjects were dosed with placebo and increasing doses of levofloxacin (500 mg, 1000 mg, 1500 mg) that included doses twice the maximum recommended dose of 750 mg in a double-blind, randomized, four-period, four-sequence crossover trial. Mean heart rate (HR) and the QT and QTc interval after dosing with levofloxacin and placebo were compared, and HR-QT interval relationships defined by linear regression analysis were calculated. After single doses of 1000 and 1500 mg of levofloxacin, HR increased significantly, as measured by periodic and continuous ECG recordings. This transient increase occurred at times of peak plasma concentration and was without symptoms. Mean QT intervals after placebo and mean intervals after levofloxacin were indistinguishable. Using periodic ECG recordings, single doses of 1500 mg were associated with small increases in QTc that were statistically significant. In contrast, an effect on QTc was shown only using the Bazett formula with data obtained from continuous ECG recordings. Together with the finding that levofloxacin does not influence HR-QT relationships, these findings suggest that levofloxacin has little effect on prolonging ventricular repolarization and that small increases in HR associated with high doses of levofloxacin contribute to the drug's apparent effect on QTc. Single doses of 1000 or 1500 mg of levofloxacin transiently increase HR without affecting the uncorrected QT interval. Differences in mean QTc after levofloxacin compared to placebo vary depending on the correction formula used and whether the data analyzed are from periodic or continuous ECG recordings. This work suggests that using continuous ECG recordings in assessing QT/QTc effects of drugs may be of value, particularly with drugs that might influence HR.

Utility of T-wave amplitude as a non-invasive risk marker of sudden cardiac death in hypertrophic cardiomyopathy.

PubMed

Sugrue, Alan; Killu, Ammar M; DeSimone, Christopher V; Chahal, Anwar A; Vogt, Josh C; Kremen, Vaclav; Hai, JoJo; Hodge, David O; Acker, Nancy G; Geske, Jeffrey B; Ackerman, Michael J; Ommen, Steve R; Lin, Grace; Noseworthy, Peter A; Brady, Peter A

2017-01-01

Sudden cardiac arrest (SCA) is the most devastating outcome in hypertrophic cardiomyopathy (HCM). We evaluated repolarisation features on the surface electrocardiogram (ECG) to identify the potential risk factors for SCA. Data was collected from 52 patients with HCM who underwent implantable cardioverter defibrillator (ICD) implantation. Leads V2 and V5 from the ECG closest to the time of ICD implant were utilised for measuring the Tpeak-Tend interval (Tpe), QTc, Tpe/QTc, T-wave duration and T-wave amplitude. The presence of the five traditional SCA-associated risk factors was assessed, as well as the HCM risk-SCD score. 16 (30%) patients experienced aborted cardiac arrest over 8.5±4.1 years, with 9 receiving an ICD shock and 7 receiving ATP. On univariate analysis, T-wave amplitude was associated with appropriate ICD therapy (HR per 0.1 mV 0.79, 95% CI 0.56 to 0.96, p=0.02). Aborted SCA was not associated with a greater mean QTc duration, Tpeak-Tend interval, T-wave duration, or Tpe/QT ratio. Multivariate analysis (adjusting for cardinal HCM SCA-risk factors) showed T-wave amplitude in Lead V2 was an independent predictor of risk (adjusted HR per 0.1 mV 0.74, 95% CI 0.57 to 0.97, p=0.03). Addition of T-wave amplitude in Lead V2 to the traditional risk factors resulted in significant improvement in risk stratification (C-statistic from 0.65 to 0.75) but did not improve the performance of the HCM SCD-risk score. T-wave amplitude is a novel marker of SCA in this high risk HCM population and may provide incremental predictive value to established risk factors. Further work is needed to define the role of repolarisation abnormalities in predicting SCA in HCM.

Cardiac repolarization during fingolimod treatment in patients with relapsing-remitting multiple sclerosis.

PubMed

Laiho, Aapo; Laitinen, Tiina M; Hartikainen, Päivi; Hartikainen, Juha E K; Laitinen, Tomi P; Simula, Sakari

2018-02-01

Fingolimod is a sphingosine-1-phosphate receptor modulator for the treatment of relapsing-remitting multiple sclerosis (RRMS). Despite an established effect on heart rate, the effect of fingolimod on cardiac repolarization is not completely known. Twenty-seven patients with RRMS underwent 24-hr ambulatory ECG before fingolimod (baseline), at the day of fingolimod initiation (1D) and after three-month treatment (3M). The mean values of RR-interval as well as QT-interval corrected by Bazzet's (QTcBaz) and Fridericia's (QTcFri) formula were compared between baseline, 1D, and 3M over 24-hr period as well as at daytime and nighttime. QTcBaz over 24-hr was shorter at 1D (414 ± 20 ms, p  < .001) and at 3M (414 ± 20 ms, p  < .001) than at baseline (418 ± 20 ms). In contrast, QTcFri over 24-hr was longer at 1D (410 ± 19 ms, p  < .001) but similar at 3M (406 ± 19 ms, p  = .355) compared to baseline (407 ± 19 ms). Daytime QTcBaz was shorter at 1D ( p  < .001) and at 3M ( p  = .007), whereas daytime QTcFri was longer at 1D ( p  < .05) but similar at 3M ( p  = ns) compared to baseline. During the night, changes were observed neither in QTcBaz nor in QTcFri between baseline, 1D, and 3M. Changes in cardiac repolarization after fingolimod initiation were mild and occurred at daytime. Ambiguously, QTcBaz demonstrated shortening, whereas QTcFri showed prolongation in cardiac repolarization after fingolimod initiation. The formula applied for QT-interval correction needs to be taken carefully into account as evaluating pharmacovigilance issues related to fingolimod.

Ibrutinib does not prolong the corrected QT interval in healthy subjects: results from a thorough QT study.

PubMed

de Jong, Jan; Hellemans, Peter; Jiao, James Juhui; Huang, Yuhan; Mesens, Sofie; Sukbuntherng, Juthamas; Ouellet, Daniele

2017-12-01

Ibrutinib is an orally administered, irreversible Bruton's tyrosine kinase inhibitor for treatment of B-cell malignancy. This study evaluated the effects of single-dose ibrutinib at therapeutic and supratherapeutic exposures on cardiac repolarization in healthy subjects. Part 1 used an open-label, two-period sequential design to assess the safety and pharmacokinetics of single doses of ibrutinib 840 and 1680 mg in eight subjects. Part 2 was a randomized, placebo- and positive (moxifloxacin)-controlled, double-blind, single dose, four-way cross-over study to assess the effect of ibrutinib (840 and 1680 mg) on QT/QTc interval. 64 healthy subjects were planned to be enrolled. Baseline-adjusted QT (QTc) intervals for ibrutinib and moxifloxacin (assay sensitivity) were compared to placebo using linear mixed-effect model. A concentration-QTc analysis was also conducted. No clinically relevant safety observations were noted in Part 1. During Part 2, one subject experienced Grade 4 ALT/AST elevations with ibrutinib 1680 mg, leading to study termination and limiting the enrollment to 20 subjects. Ibrutinib demonstrated dose-dependent increases in exposure. The upper bounds of the 90% CIs for the mean difference in change from baseline in QTc between ibrutinib and placebo were < 10 ms at all timepoints and at supratherapeutic C max . Moxifloxacin showed the anticipated QTc effect, confirming assay sensitivity despite the early study termination. Ibrutinib caused a concentration-dependent mild shortening of QTc and mild PR prolongation, but these effects were not considered clinically meaningful. Therapeutic and supratherapeutic concentrations of ibrutinib do not prolong the QTc interval. CLINICALTRIALS.GOV: NCT02271438.

Population Genetic-Based Pharmacokinetic Modeling of Methadone and its Relationship with the QTc Interval in Opioid-Dependent Patients.

PubMed

Csajka, Chantal; Crettol, Séverine; Guidi, Monia; Eap, Chin B

2016-12-01

Methadone is a μ-opioid agonist widely used for the treatment of pain, and for detoxification or maintenance treatment in opioid addiction. It has been shown to exhibit large pharmacokinetic variability and concentration-QTc relationships. In this study we investigated the relative influence of genetic polymorphism and other variables on the dose concentration-QTc relationship. A population model for methadone enantiomers in 251 opioid-dependent patients was developed using non-linear mixed effect modeling (NONMEM ® ). Various models were tested to characterize the pharmacokinetics of (R)- and (S)-methadone and the pharmacokinetic-pharmacodynamic relationship, while including demographics, physiological conditions, co-medications, and genetic variants as covariates. Model-based simulations were performed to assess the relative increase in QTc with dose upon stratification according to genetic polymorphisms involved in methadone disposition. A two-compartment model with first-order absorption and lag time provided the best model fit for (R)- and (S)-methadone pharmacokinetics. (S)-methadone clearance was influenced by cytochrome P450 (CYP) 2B6 activity, ABCB1 3435C>T, and α-1 acid glycoprotein level, while (R)-methadone clearance was influenced by CYP2B6 activity, POR*28, and CYP3A4*22. A linear model described the methadone concentration-QTc relationship, with a mean QTc increase of 9.9 ms and 19.2 ms per 1000 ng/ml of (R)- and (S)-methadone, respectively. Simulations with different methadone doses up to 240 mg/day showed that <8 % of patients presented with a QTc interval above 450 ms; however, this might reach 12 to 18 % for (R)- and (S)-methadone, respectively, in patients with a genetic status associated with a decreased methadone elimination at doses exceeding 240 mg/day. Risk factor assessment, electrocardiogram monitoring, and therapeutic drug monitoring are beneficial to optimize treatment in methadone patients, especially for those who have low levels despite high methadone doses, or who are at risk of overdosing.

Do Studies Evaluating QT/QTc Interval Prolongation with Dietary Supplements Meet FDA Standards: A Systematic Review.

PubMed

Nguyen, Tinh An; Kurian, Amy; Leong, Jessica; Patel, Umang M; Shah, Sachin A

2017-07-04

Dietary supplement use is continuously increasing, but the safety evaluation of these products remains partial. While dietary supplements have no mandate for assessing cardiovascular safety, all new drug entities (NDE) are required to undergo a thorough QT/corrected QT (QTc) assessment to determine their propensity to impact cardiac repolarization. Independent investigators and manufacturers of dietary supplements voluntarily initiate safety studies; however, the quality of these studies is controversial. We sought to compare studies evaluating the QT/QTc effects of dietary supplements based on the International Conference of Harmonization (ICH)-E14 recommendations for NDE. Twenty-six published dietary supplement studies assessed QT/QTc interval prolongation. Sample sizes ranged from nine subjects to 206 among the 15 crossover studies, six parallel design studies, and five observational studies. A plan to account for electrocardiogram (ECG) morphological abnormalities was included in 10 studies, and two studies reported cardiovascular adverse events. Eight studies found a significant change in QT/QTc intervals. The majority of studies included in this review contained many of the critical elements recommended by the ICH E14, which includes the U.S. Food and Drug Administration guidance document for QT/QTc interval assessment. Compared with the thorough QT (TQT) standards, studies are typically well performed but can be bolstered by some study design changes. More than 30% of the included studies showed some degree of ECG changes, suggesting the need for continued cardiovascular safety assessment of dietary supplements.

Interleukin-1β gene variants are associated with QTc interval prolongation following cardiac surgery: a prospective observational study

PubMed Central

Kertai, Miklos D.; Ji, Yunqi; Li, Yi-Ju; Mathew, Joseph P.; Daubert, James P.; Podgoreanu, Mihai V.

2016-01-01

Background We characterized cardiac surgery-induced dynamic changes of the corrected QT (QTc) interval and tested the hypothesis that genetic factors are associated with perioperative QTc prolongation independent of clinical and procedural factors. Methods All study subjects were ascertained from a prospective study of patients who underwent elective cardiac surgery during August 1999 to April 2002. We defined a prolonged QTc interval as >440 msec, measured from 24-hr pre- and postoperative 12-lead electrocardiograms. The association of 37 single nucleotide polymorphisms (SNPs) in 21 candidate genes – involved in modulating arrhythmia susceptibility pathways with postoperative QTc changes–was investigated in a two-stage design with a stage I cohort (n = 497) nested within a stage II cohort (n = 957). Empirical P values (Pemp) were obtained by permutation tests with 10,000 repeats. Results After adjusting for clinical and procedural risk factors, we selected four SNPs (P value range, 0.03-0.1) in stage I, which we then tested in the stage II cohort. Two functional SNPs in the pro-inflammatory cytokine interleukin-1β (IL1β), rs1143633 (odds ratio [OR], 0.71; 95% confidence interval [CI], 0.53 to 0.95; Pemp = 0.02) and rs16944 (OR, 1.31; 95% CI, 1.01 to 1.70; Pemp = 0.04), remained independent predictors of postoperative QTc prolongation. The ability of a clinico-genetic model incorporating the two IL1B polymorphisms to classify patients at risk for developing prolonged postoperative QTc was superior to a clinical model alone, with a net reclassification improvement of 0.308 (P = 0.0003) and an integrated discrimination improvement of 0.02 (P = 0.000024). Conclusion The results suggest a contribution of IL1β in modulating susceptibility to postoperative QTc prolongation after cardiac surgery. PMID:26858093

Substitution of (R,S)-methadone by (R)-methadone: Impact on QTc interval.

PubMed

Ansermot, Nicolas; Albayrak, Ozgür; Schläpfer, Jürg; Crettol, Séverine; Croquette-Krokar, Marina; Bourquin, Michel; Déglon, Jean-Jacques; Faouzi, Mohamed; Scherbaum, Norbert; Eap, Chin B

2010-03-22

Methadone is administered as a chiral mixture of (R,S)-methadone. The opioid effect is mainly mediated by (R)-methadone, whereas (S)-methadone blocks the human ether-à-go-go-related gene (hERG) voltage-gated potassium channel more potently, which can cause drug-induced long QT syndrome, leading to potentially lethal ventricular tachyarrhythmias. To investigate whether substitution of (R,S)-methadone by (R)-methadone could reduce the corrected QT (QTc) interval, (R,S)-methadone was replaced by (R)-methadone (half-dose) in 39 opioid-dependent patients receiving maintenance treatment for 14 days. (R)-methadone was then replaced by the initial dose of (R,S)-methadone for 14 days (n = 29). Trough (R)-methadone and (S)-methadone plasma levels and electrocardiogram measurements were taken. The Fridericia-corrected QT (QTcF) interval decreased when (R,S)-methadone was replaced by a half-dose of (R)-methadone; the median (interquartile range [IQR]) values were 423 (398-440) milliseconds (ms) and 412 (395-431) ms (P = .06) at days 0 and 14, respectively. Using a univariate mixed-effect linear model, the QTcF value decreased by a mean of -3.9 ms (95% confidence interval [CI], -7.7 to -0.2) per week (P = .04). The QTcF value increased when (R)-methadone was replaced by the initial dose of (R,S)-methadone for 14 days; median (IQR) values were 424 (398-436) ms and 424 (412-443) ms (P = .01) at days 14 and 28, respectively. The univariate model showed that the QTcF value increased by a mean of 4.7 ms (95% CI, 1.3-8.1) per week (P = .006). Substitution of (R,S)-methadone by (R)-methadone reduces the QTc interval value. A safer cardiac profile of (R)-methadone is in agreement with previous in vitro and pharmacogenetic studies. If the present results are confirmed by larger studies, (R)-methadone should be prescribed instead of (R,S)-methadone to reduce the risk of cardiac toxic effects and sudden death.

Increased risk of QT prolongation associated with atherosclerotic diseases in arseniasis-endemic area in southwestern coast of Taiwan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, C.-H.; Chen, C.-L.; Hsiao, C.K.

2009-09-15

Chronic arsenic exposure has been documented to be associated with various cardiovascular diseases. We aimed to investigate 1) the increased risk of QT prolongation in chronic arsenic exposure, and 2) the relationships of cardiac repolarization (QT interval duration) with ischemic heart disease and carotid atherosclerosis. We studied 280 men and 355 women living in the endemic area of arseniasis in southwestern Taiwan. QT intervals in electrocardiogram and carotid intima-media thickness (IMT) by ultrasonography were measured. Ischemic heart disease was diagnosed by history or abnormal electrocardiogram. Significant associations of the corrected QT interval (QTc) duration with ischemic heart disease and carotidmore » intima-medium thickness and plaque were observed after adjustment for various risk factors in the multiple linear regression analysis (all p values < 0.05). Three indices of chronic arsenic exposure were all significantly associated with the risk of QTc prolongation showing dose-response relationships (p < 0.001). Chronic arsenic exposure was dose-dependently associated with the risk of QTc prolongation. Ischemic heart disease and carotid atherosclerosis were significantly associated with QTc intervals in chronic arsenic exposure. QTc prolongation might be suggested as an early biomarker for ischemic heart disease or carotid atherosclerosis in population with previous exposure to arsenic.« less

Lack of effect of perampanel on QT interval duration: Results from a thorough QT analysis and pooled partial seizure Phase III clinical trials.

PubMed

Yang, Haichen; Laurenza, Antonio; Williams, Betsy; Patten, Anna; Hussein, Ziad; Ferry, Jim

2015-08-01

Perampanel is a selective, noncompetitive AMPA receptor antagonist approved as adjunctive treatment for partial seizures. To assess potential for delayed cardiac repolarization, a Phase I thorough QT study was performed, supplemented by plasma concentration-QT data modeled from 3 pooled Phase III studies. The Phase I thorough QT study (double-blind, combined fixed-sequence, parallel-group) quantified the effect of perampanel (6 mg once daily for 7 days, followed by dose escalation to a single 8-mg dose, a single 10-mg dose, then 12 mg once daily for 7 days), moxifloxacin positive control (single 400-mg dose on Day 16), and placebo on QT interval duration in healthy subjects (N = 261). Electrocardiograms were recorded at baseline, Day 7 (post 6 mg dose), and Day 16 (post 12 mg dose). Statistical comparisons were between the highest approved perampanel dose (12 mg) versus placebo, a "mid-therapeutic" dose (6 mg) versus placebo, and moxifloxacin versus placebo. Acknowledging that the Phase I thorough QT study could not incorporate a true "supratherapeutic" dose due to length of titration and tolerability concerns in healthy subjects, Phase III studies of perampanel included expanded electrocardiogram safety evaluations specifically intended to support concentration-QT response modeling. The lack of effect of perampanel on the QT interval is shown from pooled analysis of 3 double-blind, placebo-controlled, 19-week, Phase III studies with perampanel doses ≤ 12 mg (N = 1038, total perampanel; and N=442, placebo) in patients with partial seizures. QT measures were corrected for heart rate using Fridericia's (QTcF; the primary endpoint) and Bazett's (QTcB) formulas. In the Phase I thorough QT study, the positive control moxifloxacin caused peak time-matched, baseline-adjusted, placebo-corrected (ΔΔ) QTcF of 12.15 ms at 4h postdose, confirming a drug effect on QTc interval and study assessment sensitivity. Mean baseline-adjusted (Δ) QTcF versus nominal time curves were comparable between perampanel 12 mg and placebo, with most ΔQTcF values being slightly negative. Healthy subjects receiving perampanel 6 and 12 mg doses for 7 days showed no evidence of effects on cardiac repolarization. Peak ΔΔQTcF was 2.34 ms at 1.5h postdose for perampanel 6 mg and 3.92 ms at 0.5h postdose for perampanel 12 mg. At every time point, the upper 95% confidence limit of ΔΔQTcF for perampanel 6 and 12 mg was <10 ms. Phase III studies revealed no clinically significant difference between patients with partial seizures treated with perampanel or placebo in QTcF and QTcB values >450 ms, with no dose-dependent increases or large incremental changes from baseline of >60 ms. Regression analysis of individual plasma perampanel concentrations versus corresponding QTc interval values in Phase I thorough QT and Phase III studies demonstrated no relationship between perampanel concentrations and QT interval duration. Treatment with perampanel 6 mg and 12 mg for 7 days did not delay cardiac repolarization in healthy volunteers. In a population analysis of 1480 patients with partial seizures treated with perampanel doses ≤ 12 mg or placebo, no clinically significant trends in QT interval data were noted. Based on the thorough QT study and evaluations from pooled Phase III studies, there is no evidence of prolonged QT interval duration with perampanel treatment. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

BPC 157 counteracts QTc prolongation induced by haloperidol, fluphenazine, clozapine, olanzapine, quetiapine, sulpiride, and metoclopramide in rats.

PubMed

Strinic, Dean; Belosic Halle, Zeljka; Luetic, Kresimir; Nedic, Ana; Petrovic, Igor; Sucic, Mario; Zivanovic Posilovic, Gordana; Balenovic, Dijana; Strbe, Sanja; Udovicic, Mario; Drmic, Domagoj; Stupnisek, Mirjana; Lovric Bencic, Martina; Seiwerth, Sven; Sikiric, Predrag

2017-10-01

Commonly, neuroleptics and prokinetics induce a prolonged QTc interval. In this study, stable gastric pentadecapeptide BPC 157 counteracts the prolongation of the QTc interval in Wistar rats that underwent daily administration of dopamine neuroleptics or prokinetics. Previously, in rats and mice, BPC 157 counteracted neuroleptic-induced catalepsy and gastric ulcers. To counteract neuroleptic- or prokinetic-induced prolongation of the QTc interval, rats were given a BPC 157 regimen once daily over seven days (10μg, 10ng/kg ip) immediately after each administrations of haloperidol (0.625, 6.25, 12.5, and 25.0mg/kg ip), fluphenazine (0.5, 5.0mg/kg ip), clozapine (1.0, 10.0mg/kg ip), quetiapine (1.0, 10.0mg/kg ip), sulpiride (1.6, 16.0mg/kg ip), metoclopramide (2.5, 25.0mg/kg ip) or (1.0, 10.0mg/kg ip). Controls simultaneously received saline (5ml/kg ip). To assess the ECG presentation before and after neuroleptic/prokinetic medication, the assessment was at 1, 2, 3, 4, 5, 10, 15, 20 and 30min (first administration) as well as at 30min, 60min and 24h (first administration and subsequent administrations) and the ECG recording started prior to drug administration. Since very early, a prolonged QTc interval has been continually noted with haloperidol, fluphenazine, clozapine, olanzapine, quetiapine, sulpiride, and metoclopramide in rats as a central common effect not seen with domperidone. Consistent counteraction appears with the stable gastric pentadecapeptide BPC 157. Thus, BPC 157 rapidly and permanently counteracts the QTc prolongation induced by neuroleptics and prokinetics. Pentadecapeptide BPC 157 is suited for counteracting a prolonged QT interval. Copyright © 2017 Elsevier Inc. All rights reserved.

Effects of atomoxetine on the QT interval in healthy CYP2D6 poor metabolizers

PubMed Central

Loghin, Corina; Haber, Harry; Beasley, Charles M; Kothare, Prajakti A; Kauffman, Lynnette; April, John; Jin, Ling; Allen, Albert J; Mitchell, Malcolm I

2013-01-01

Aim The effects of atomoxetine (20 and 60 mg twice daily), 400 mg moxifloxacin and placebo on QTc in 131 healthy CYP2D6 poor metabolizer males were compared. Methods Atomoxetine doses were selected to result in plasma concentrations that approximated expected plasma concentrations at both the maximum recommended dose and at a supratherapeutic dose in CYP2D6 extensive metabolizers. Ten second electrocardiograms were obtained for time-matched baseline on days −2 and −1, three time points after dosing on day 1 for moxifloxacin and five time points on day 7 for atomoxetine and placebo. Maximum mean placebo-subtracted change from baseline model-corrected QT (QTcM) on day 7 was the primary endpoint. Results QTcM differences for atomoxetine 20 and 60 mg twice daily were 0.5 ms (upper bound of the one-sided 95% confidence interval 2.2 ms) and 4.2 ms (upper bound of the one-sided 95% confidence interval 6.0 ms), respectively. As plasma concentration of atomoxetine increased, a statistically significant increase in QTc was observed. The moxifloxacin difference from placebo met the a priori definition of non-inferiority. Maximum mean placebo-subtracted change from baseline QTcM for moxifloxacin was 4.8 ms and this difference was statistically significant. Moxifloxacin plasma concentrations were below the concentrations expected from the literature. However, the slope of the plasma concentration−QTc change observed was consistent with the literature. Conclusion Atomoxetine was not associated with a clinically significant change in QTc. However, a statistically significant increase in QTc was associated with increasing plasma concentrations. PMID:22803597

QT-interval effects of methadone, levomethadyl, and buprenorphine in a randomized trial.

PubMed

Wedam, Erich F; Bigelow, George E; Johnson, Rolley E; Nuzzo, Paul A; Haigney, Mark C P

2007-12-10

Levomethadyl acetate, methadone hydrochloride, and buprenorphine hydrochloride are equally effective treatments for opioid dependence. Each blocks the human ether-a-go-go-related gene (hERG)-associated channel in vitro and represents a risk for QT prolongation. To compare the effects of 3 known hERG-associated channel blockers on the corrected QT (QTc), we conducted a randomized, controlled trial of opioid-addicted subjects. We analyzed 12-lead electrocardiograms collected at baseline and every 4 weeks from 165 opioid-addicted participants in a 17-week randomized double-blind clinical trial of equally effective doses of levomethadyl, methadone, and buprenorphine at a major referral center. Analyses were limited to the 154 patients with a normal baseline QTc = (QT/ radical R-R) who had at least 1 subsequent in-treatment electrocardiogram. Patients were randomized to receive treatment with levomethadyl, methadone, or buprenorphine (hereinafter, levomethadyl, methadone, and buprenorphine groups, respectively). The prespecified end points were a QTc greater than 470 milliseconds in men (or >490 milliseconds in women), or an increase from baseline in QTc greater than 60 milliseconds. Baseline QTc was similar in the 3 groups. The levomethadyl and methadone groups were significantly more likely to manifest a QTc greater than 470 or 490 milliseconds (28% for the levomethadyl group vs 23% for the methadone group vs 0% for the buprenorphine group; P < .001) or an increase from baseline in QTc greater than 60 milliseconds (21% of the levomethadyl group [odds ratio, 15.8; 95% confidence interval, 3.7-67.1] and 12% of the methadone group [odds ratio, 8.4; 95% confidence interval, 1.9-36.4]) compared with the buprenorphine group (2% of subjects; P < .001). In subjects whose dosage of levomethadyl or methadone remained fixed over at least 8 weeks, the QTc continued to increase progressively over time (P = .08 for the levomethadyl group, P = .01 for the methadone group). Buprenorphine is associated with less QTc prolongation than levomethadyl or methadone and may be a safe alternative.

Long QT interval in Turner syndrome--a high prevalence of LQTS gene mutations.

PubMed

Trolle, Christian; Mortensen, Kristian H; Pedersen, Lisbeth N; Berglund, Agnethe; Jensen, Henrik K; Andersen, Niels H; Gravholt, Claus H

2013-01-01

QT-interval prolongation of unknown aetiology is common in Turner syndrome. This study set out to explore the presence of known long QT mutations in Turner syndrome and to examine the corrected QT-interval (QTc) over time and relate the findings to the Turner syndrome phenotype. Adult women with Turner syndrome (n = 88) were examined thrice and 68 age-matched healthy controls were examined once. QTc was measured by one blinded reader (intra-reader variability: 0.7%), and adjusted for influence of heart rate by Bazett's (bQTc) and Hodges's formula (hQTc). The prevalence of mutations in genes related to Long QT syndrome was determined in women with Turner syndrome and a QTc >432.0 milliseconds (ms). Echocardiographic assessment of aortic valve morphology, 24-hour blood pressures and blood samples were done. The mean hQTc in women with Turner syndrome (414.0 ± 25.5 ms) compared to controls (390.4 ± 17.8 ms) was prolonged (p<0.001) and did not change over time (416.9 ± 22.6 vs. 415.6 ± 25.5 ms; p =0.4). 45,X karyotype was associated with increased hQTc prolongation compared to other Turner syndrome karyotypes (418.2 ± 24.8 vs. 407.6 ± 25.5 ms; p = 0.055). In women with Turner syndrome and a bQTc >432 ms, 7 had mutations in major Long QT syndrome genes (SCN5A and KCNH2) and one in a minor Long QT syndrome gene (KCNE2). There is a high prevalence of mutations in the major LQTS genes in women with TS and prolonged QTc. It remains to be settled, whether these findings are related to the unexplained excess mortality in Turner women. NCT00624949. https://register.clinicaltrials.gov/prs/app/action/SelectProtocol/sid/S0001FLI/selectaction/View/ts/3/uid/U000099E.

Right precordial-directed electrocardiographical markers identify arrhythmogenic right ventricular cardiomyopathy in the absence of conventional depolarization or repolarization abnormalities.

PubMed

Cortez, Daniel; Svensson, Anneli; Carlson, Jonas; Graw, Sharon; Sharma, Nandita; Brun, Francesca; Spezzacatene, Anita; Mestroni, Luisa; Platonov, Pyotr G

2017-10-13

Arrhythmogenic right ventricular dysplasia/cardiomyopathy (ARVD/C) carries a risk of sudden death. We aimed to assess whether vectorcardiographic (VCG) parameters directed toward the right heart and a measured angle of the S-wave would help differentiate ARVD/C with otherwise normal electrocardiograms from controls. Task Force 2010 definite ARVD/C criteria were met for all patients. Those who did not fulfill Task Force depolarization or repolarization criteria (-ECG) were compared with age and gender-matched control subjects. Electrocardiogram measures of a 3-dimentional spatial QRS-T angle, a right-precordial-directed orthogonal QRS-T (RPD) angle, a root mean square of the right sided depolarizing forces (RtRMS-QRS), QRS duration (QRSd) and the corrected QT interval (QTc), and a measured angle including the upslope and downslope of the S-wave (S-wave angle) were assessed. Definite ARVD/C was present in 155 patients by 2010 Task Force criteria (41.7 ± 17.6 years, 65.2% male). -ECG ARVD/C patients (66 patients) were compared to 66 control patients (41.7 ± 17.6 years, 65.2% male). All parameters tested except the QRSd and QTc significantly differentiated -ECG ARVD/C from control patients (p < 0.004 to p < 0.001). The RPD angle and RtRMS-QRS best differentiated the groups. Combined, the 2 novel criteria gave 81.8% sensitivity, 90.9% specificity and odds ratio of 45.0 (95% confidence interval 15.8 to 128.2). ARVD/C disease process may lead to development of subtle ECG abnormalities that can be distinguishable using right-sided VCG or measured angle markers better than the spatial QRS-T angle, the QRSd or QTc, in the absence of Taskforce ECG criteria.

Cardiac conductive disturbance in patients with polycystic ovary syndrome.

PubMed

Huang, Jen-Hung; Tsai, Jen-Chen; Hsu, Ming-I; Chen, Yi-Jen

2010-12-01

Polycystic ovary syndrome (PCOS) is the most common endocrine abnormality of reproductive-aged women and increases the risk of cardiovascular disease. However, the effects of PCOS on electrocardiograms (ECGs) are not fully elucidated. The aim of this study was to evaluate the characteristics of ECGs in patients with PCOS. This study included 24 patients with PCOS and 12 patients without PCOS. The heart rate, PR interval, QRS duration, Sokolow-Lyon voltage (SV1 + RV5/6), Cornell voltage (RaVL + SV3), QT interval and QTc interval were measured in 12-lead ECGs. The QRS duration was wider in patients with PCOS than those without PCOS (91 ± 8 vs. 81 ± 10 ms, p < 0.05). The heart rate, PR interval, Sokolow-Lyon voltage, product of the QRS duration times Cornell voltage combination, QT interval, QTc interval, QT dispersion and QTc dispersion were similar between the two groups. PCOS is associated with a widening QRS duration, which may contribute to its increased cardiovascular risks.

Cardiac Safety of Ozanimod, a Novel Sphingosine‐1‐Phosphate Receptor Modulator: Results of a Thorough QT/QTc Study

PubMed Central

Hartung, Jeffrey P.; Olson, Allan D.; Mendzelevski, Boaz; Timony, Gregg A.; Boehm, Marcus F.; Peach, Robert J.; Gujrathi, Sheila; Frohna, Paul A.

2017-01-01

Abstract Ozanimod is a novel, selective, oral sphingosine‐1‐phosphate (1 and 5) receptor modulator in development for multiple sclerosis and inflammatory bowel disease. This randomized, double‐blind, placebo‐controlled, positive‐controlled, parallel‐group thorough QT study characterized the effects of ozanimod on cardiac repolarization in healthy subjects. Eligible subjects were randomized to 1 of 2 groups: ozanimod (escalated from 0.25 to 2 mg over 14 days) or placebo (for 14 days). A single dose of moxifloxacin 400 mg or placebo was administered on days 2 and 17. The primary end point was the time‐matched, placebo‐corrected, baseline‐adjusted mean QTcF (ΔΔQTcF). A total of 113/124 (91.1%) subjects completed the study. The upper limits of the 2‐sided 90% confidence intervals for ΔΔQTcF for both ozanimod 1 and 2 mg were below the 10‐millisecond regulatory threshold. No QTcF >480 milliseconds or postdose change in QTcF of >60 milliseconds was observed. There was no evidence of a positive relationship between concentrations of ozanimod and its active metabolites and ΔΔQTcF. Although ozanimod blunted the observed diurnal increase in heart rate, excursions below predose heart rates were no greater than with placebo. Results demonstrate that ozanimod does not prolong the QTc interval or cause clinically significant bradycardia, supporting ozanimod's evolving favorable cardiac safety profile. PMID:28783871

Effect of alectinib on cardiac electrophysiology: results from intensive electrocardiogram monitoring from the pivotal phase II NP28761 and NP28673 studies.

PubMed

Morcos, Peter N; Bogman, Katrijn; Hubeaux, Stanislas; Sturm-Pellanda, Carolina; Ruf, Thorsten; Bordogna, Walter; Golding, Sophie; Zeaiter, Ali; Abt, Markus; Balas, Bogdana

2017-03-01

Alectinib, a central nervous system (CNS)-active ALK inhibitor, has demonstrated efficacy and safety in ALK+ non-small-cell lung cancer that has progressed following crizotinib treatment. Other ALK inhibitors have shown concentration-dependent QTc prolongation and treatment-related bradycardia. Therefore, this analysis evaluated alectinib safety in terms of electrophysiologic parameters. Intensive triplicate centrally read electrocardiogram (ECG) and matched pharmacokinetic data were collected across two alectinib single-arm trials. Analysis of QTcF included central tendency analysis [mean changes from baseline with one-sided upper 95% confidence intervals (CIs)], categorical analyses, and relationship between change in QTcF and alectinib plasma concentrations. Alectinib effects on other ECG parameters (heart rate, PR interval and QRS duration) were also evaluated. Alectinib did not cause a clinically relevant change in QTcF. The maximum mean QTcF change from baseline was 5.3 ms observed pre-dose at week 2. The upper one-sided 95% CI was <10 ms at all time points. There was no relevant relationship between change in QTcF and alectinib plasma concentrations. Alectinib treatment resulted in a generally asymptomatic exposure-dependent decrease in mean heart rate of ~11 to 13 beats per minute at week 2. No clinically relevant effects were seen on other ECG parameters. Approximately 5% of patients reported cardiac adverse events of bradycardia or sinus bradycardia; however, these were all grade 1-2. Alectinib does not prolong the QTc interval or cause changes in cardiac function to a clinically relevant extent, with the exception of a decrease in heart rate which was generally asymptomatic.

[Factors related to the QT prolongation in chronic renal failure].

PubMed

Kurosu, M; Ando, Y; Akimoto, T; Ono, S; Kusano, E; Asano, Y

1999-04-01

QT prolongation, a risk factor for arrhythmia and cardiac death, is observed in uremic patients. Though hypocalcemia, autonomic nerve dysfunction and cardiac hypertrophy are assumed to cause the uremic QT prolongation, the exact mechanism remains unspecified. We therefore examined factors related to the QT interval in chronic renal failure (CRF). Corrected QT interval (QTc) was significantly prolonged in CRF just before the induction of dialysis therapy (group A) compared with nephrotic syndrome with the intact or mildly impaired renal function (group B). QTc was also prolonged in acute renal failure (group C). Cardio-thoracic ratio, serum albumin and Ca correlated with QTc in group A, but not in B or C. A single HD session in group A failed to shorten QTc, despite a significant increase in serum Ca++. Autonomic dysfunction did not appear to be a major determinant of QT prolongation, since QTc was not different between diabetics and non-diabetics in group A and in chronic HD patients (group D). In group D, QTc did not correlate with SV1 + RV5 on ECG or left ventricular wall thickness (LVWT) on echocardiography. In another group of chronic HD patients (group E), there was no significant correlation between QTc and the parameters of left ventricular mass, plasma brain natriuretic peptide (BNP). However, in the patients subjected to repeated echocardiography in group D, QTc and LVWT changed in parallel. In a retrospective analysis of QTc in group D, QTc was maximally prolonged at the time of starting HD therapy, and gradually improved in the following 1-5 years in both diabetics and non-diabetics. In contrast, chronic CAPD patients (group F) revealed no improvement of QTc. Thus, uremic QT prolongation cannot be explained simply by any of the previously assumed factors, but appears to be affected by multiple factors, which are partially correctable by chronic HD therapy.

The Half RR Rule: A Poor Rule of Thumb and Not a Risk Assessment Tool for QT Interval Prolongation.

PubMed

Berling, Ingrid; Isbister, Geoffrey K

2015-10-01

Measuring the QT interval on an electrocardiogram (ECG) is integral to risk assessment of Torsade de Pointes (TdP). This study aimed to investigate the accuracy of the 1/2 RR rule as a risk assessment tool for drug-induced TdP, comparing it to the QT nomogram, Bazett's corrected QT (QTcB), and Fridericia's corrected QT (QTcF). The authors calculated sensitivity and specificity of the 1/2 RR rule using a published data set of 129 cases of drug-induced TdP and 316 controls (noncardiotoxic overdoses), compared to the QT nomogram, QTcB > 500 msec and QTcF > 500 msec. To further determine the value of the 1/2 RR rule, its observed positive, and negative agreement were calculated when compared to the QT nomogram for determining an abnormal QT in eight samples of different drugs in overdose. The sensitivity and specificity of the 1/2 RR rule were 88% (95% confidence interval [CI] = 80% to 93%) and 53% (95% CI = 47% to 58%), respectively, compared to the QT nomogram (sensitivity = 97%, 95% CI = 92% to 99%; specificity = 99%, 95% CI = 97% to 100%). It was also less sensitive than QTcB > 500 msec and had a lower specificity than QTcB > 500 msec and QTcF > 500 msec. In drug overdose patients, the 1/2 RR rule had poor observed agreement averaging 41%, which was mainly due to poor positive agreement, except for amisulpride where there was good agreement. The 1/2 RR rule was not as sensitive as the QT nomogram or QTcB > 500 msec for drug-induced TdP. It had poor positive agreement in almost all overdose patients, resulting in over half of patients receiving unnecessary cardiac monitoring and repeat ECGs. © 2015 by the Society for Academic Emergency Medicine.

The assessment of P-wave dispersion and myocardial repolarization parameters in patients with chronic kidney disease.

PubMed

Kollu, Korhan; Altintepe, Lutfullah; Duran, Cevdet; Topal, Mustafa; Ecirli, Samil

2018-11-01

The risks of sudden death and cardiac arrhythmia are increased in patients with chronic kidney disease (CKD). Here, we aimed to evaluate the indicators of arrhythmias, such as p-wave dispersion (P-WD), QTc dispersion, Tp-e and Tp-e/QT ratio in patients with CKD stages 3-5 on no renal replacement therapy (RRT). One-hundred and thirty three patients with CKD stages 3-5 and 32 healthy controls were enrolled into the study. No patients received RRT. QTc dispersion, P-WD and Tp-e interval were measured using electrocardiogram and Tp-e/QT ratio was also calculated. Mean age rates were found similar in patients and controls (60.8 ± 14.2 and 61 ± 12.9 y, p = .937, respectively). Compared patients with controls, P-WD (45.85 ± 12.42 vs. 21.17 ± 6.6 msec, p < .001), QTc-min (366.99 ± 42.31 vs. 387.15 ± 20.5 msec, p < .001), QTc dispersion (71.13 ± 27.95 vs. 41.25 ± 14.55 msec, p < .001), Tp-e maximum (81.04 ± 10.34 vs. 75.49 ± 10.9 msec, p < .001), Tp-e minimum (62.25 ± 7.58 vs. 54.8 ± 6.72 msec, p < .001) and Tp-e/QTc ratio (0.19 ± 0.02 vs. 0.18 ± 0.01, p = .001) were found to be different. QTc-max and Tp-e interval were found to be similar in both groups. P-WD and QTc dispersion, Tp-e interval and Tp-e/QTc ratio were found to be increased in with CKD stages 3-5 on no RRT.

Moxifloxacin-induced QTc interval prolongations in healthy male Japanese and Caucasian volunteers: a direct comparison in a thorough QT study

PubMed Central

Morganroth, Joel; Wang, Yaning; Thorn, Michael; Kumagai, Yuji; Harris, Stuart; Stockbridge, Norman; Kleiman, Robert; Shah, Rashmi

2015-01-01

Aim We investigated whether moxifloxacin-induced QTc prolongations in Japanese and Caucasian healthy male volunteers were significantly different. Methods A two period, randomized, crossover, ICH-E14-compliant thorough QT (TQT) study compared placebo-corrected changes in QTc interval from baseline (ΔΔQTcF) and concentration–effect relationships following administration of placebo and 400 mg moxifloxacin to 40 healthy male volunteers from each ethnic population. The point estimates of ΔΔQTcF for each population, and the difference between the two, were calculated at a geometric mean Cmax of moxifloxacin using a linear mixed effects model. The concentration–effect slopes of the two populations were also compared. Equivalence was concluded if the two-sided 90% confidence interval of the difference in ΔΔQTcF was contained within −5 ms to +5 ms limits and the ratio of the slopes was between 0.5 and 2. Results There were no statistically significant differences between the two populations studied, Japanese vs. Caucasians, respectively, for moxifloxacin Cmax (3.27 ± 0.6 vs. 2.98 ± 0.7 µg ml–1), ΔΔQTcF (9.63 ± 1.15 vs. 11.46 ± 1.19 ms at Cmax of 3.07 µg ml–1) and concentration–response slopes (2.58 ± 0.62 vs. 2.34 ± 0.64 ms per µg ml–1). The difference in the two ΔΔQTcF of −1.8 (90% CI −4.6, 0.9) and the ratio of the two slopes (1.1; 90% CI 0.63, 1.82) were within pre-specified equivalence limits. Conclusions Moxifloxacin-induced QTc prolongations did not differ significantly between the Japanese and Caucasian subjects. However, before our findings are more widely generalized, further studies in other populations and with other QT-prolonging drugs are needed to clarify whether inter-ethnic differences in QT sensitivity exist and whether ethnicity of the study population may affect the outcome of a TQT study. PMID:26011050

Scientific white paper on concentration-QTc modeling.

PubMed

Garnett, Christine; Bonate, Peter L; Dang, Qianyu; Ferber, Georg; Huang, Dalong; Liu, Jiang; Mehrotra, Devan; Riley, Steve; Sager, Philip; Tornoe, Christoffer; Wang, Yaning

2018-06-01

The International Council for Harmonisation revised the E14 guideline through the questions and answers process to allow concentration-QTc (C-QTc) modeling to be used as the primary analysis for assessing the QTc interval prolongation risk of new drugs. A well-designed and conducted QTc assessment based on C-QTc modeling in early phase 1 studies can be an alternative approach to a thorough QT study for some drugs to reliably exclude clinically relevant QTc effects. This white paper provides recommendations on how to plan and conduct a definitive QTc assessment of a drug using C-QTc modeling in early phase clinical pharmacology and thorough QT studies. Topics included are: important study design features in a phase 1 study; modeling objectives and approach; exploratory plots; the pre-specified linear mixed effects model; general principles for model development and evaluation; and expectations for modeling analysis plans and reports. The recommendations are based on current best modeling practices, scientific literature and personal experiences of the authors. These recommendations are expected to evolve as their implementation during drug development provides additional data and with advances in analytical methodology.

Elevated heart rate triggers action potential alternans and sudden death. translational study of a homozygous KCNH2 mutation.

PubMed

Schweigmann, Ulrich; Biliczki, Peter; Ramirez, Rafael J; Marschall, Christoph; Takac, Ina; Brandes, Ralf P; Kotzot, Dieter; Girmatsion, Zenawit; Hohnloser, Stefan H; Ehrlich, Joachim R

2014-01-01

Long QT syndrome (LQTS) leads to arrhythmic events and increased risk for sudden cardiac death (SCD). Homozygous KCNH2 mutations underlying LQTS-2 have previously been termed "human HERG knockout" and typically express severe phenotypes. We studied genotype-phenotype correlations of an LQTS type 2 mutation identified in the homozygous index patient from a consanguineous Turkish family after his brother died suddenly during febrile illness. Clinical work-up, DNA sequencing, mutagenesis, cell culture, patch-clamp, in silico mathematical modelling, protein biochemistry, confocal microscopy were performed. Genetic analysis revealed a homozygous C-terminal KCNH2 mutation (p.R835Q) in the index patient (QTc ∼506 ms with notched T waves). Parents were I° cousins - both heterozygous for the mutation and clinically unremarkable (QTc ∼447 ms, father and ∼396 ms, mother). Heterologous expression of KCNH2-R835Q showed mildly reduced current amplitudes. Biophysical properties of ionic currents were also only nominally changed with slight acceleration of deactivation and more negative V50 in R835Q-currents. Protein biochemistry and confocal microscopy revealed similar expression patterns and trafficking of WT and R835Q, even at elevated temperature. In silico analysis demonstrated mildly prolonged ventricular action potential duration (APD) compared to WT at a cycle length of 1000 ms. At a cycle length of 350 ms M-cell APD remained stable in WT, but displayed APD alternans in R835Q. Kv11.1 channels affected by the C-terminal R835Q mutation display mildly modified biophysical properties, but leads to M-cell APD alternans with elevated heart rate and could precipitate SCD under specific clinical circumstances associated with high heart rates.

Cardiac Safety of Ozanimod, a Novel Sphingosine-1-Phosphate Receptor Modulator: Results of a Thorough QT/QTc Study.

PubMed

Tran, Jonathan Q; Hartung, Jeffrey P; Olson, Allan D; Mendzelevski, Boaz; Timony, Gregg A; Boehm, Marcus F; Peach, Robert J; Gujrathi, Sheila; Frohna, Paul A

2018-03-01

Ozanimod is a novel, selective, oral sphingosine-1-phosphate (1 and 5) receptor modulator in development for multiple sclerosis and inflammatory bowel disease. This randomized, double-blind, placebo-controlled, positive-controlled, parallel-group thorough QT study characterized the effects of ozanimod on cardiac repolarization in healthy subjects. Eligible subjects were randomized to 1 of 2 groups: ozanimod (escalated from 0.25 to 2 mg over 14 days) or placebo (for 14 days). A single dose of moxifloxacin 400 mg or placebo was administered on days 2 and 17. The primary end point was the time-matched, placebo-corrected, baseline-adjusted mean QTcF (ΔΔQTcF). A total of 113/124 (91.1%) subjects completed the study. The upper limits of the 2-sided 90% confidence intervals for ΔΔQTcF for both ozanimod 1 and 2 mg were below the 10-millisecond regulatory threshold. No QTcF >480 milliseconds or postdose change in QTcF of >60 milliseconds was observed. There was no evidence of a positive relationship between concentrations of ozanimod and its active metabolites and ΔΔQTcF. Although ozanimod blunted the observed diurnal increase in heart rate, excursions below predose heart rates were no greater than with placebo. Results demonstrate that ozanimod does not prolong the QTc interval or cause clinically significant bradycardia, supporting ozanimod's evolving favorable cardiac safety profile. © 2017 The Authors. Clinical Pharmacology in Drug Development Published by Wiley Periodicals, Inc. on behalf of The American College of Clinical Pharmacology.

Tp-e interval and Tp-e/QT ratio in patients with celiac disease.

PubMed

Demirtaş, K; Yayla, Ç; Yüksel, M; Açar, B; Ünal, S; Ertem, A G; Kaplan, M; Akpinar, M Y; Kiliç, Z M Y; Kayaçetin, E

2017-11-01

Celiac disease is a chronic immune-mediated disease of the small intestine. It has been known that dilated cardiomyopathy and ischemic coronary artery disease have become more frequent in patients with celiac disease. The aim of the study was to assess Tp-e interval and Tp-e/QT ratio in patients with celiac disease. This study was conducted at a single center in collaboration with gastroenterology and cardiology clinics. Between January 2014 and June 2015, a total of 76 consecutive patients were enrolled (38 patients with celiac disease and 38 control subjects). Tp-e interval, Tp-e/QT and Tp-e/QTc ratio were measured from the 12-lead electrocardiogram. Tp-e interval (64.2±11.0 vs. 44.5±6.0; p<0.001), Tp-e/QT ratio (0.18±0.02 vs. 0.13±0.02; p<0.001) and Tp-e/QTc ratio (0.16±0.02 vs. 0.11±0.01; p<0.001) were significantly higher in patients with celiac disease than control subjects. There was a significant positive correlation between Tp-e/QTc ratio and disease duration in patients with celiac disease (r=0.480, p=0.003) and also there was a significant positive correlation between Tp-e/QTc ratio and erythrocyte sedimentation rate (r=0.434, p<0.001). Our study showed that Tp-e interval, Tp-e/QT and Tp-e/QTc ratios were increased in patients with celiac disease. Whether these changes increase the risk of ventricular arrhythmia deserve further studies. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Medicina Interna (SEMI). All rights reserved.

The influence of type 2 diabetes and gender on ventricular repolarization dispersion in patients with sub-clinic left ventricular diastolic dysfunction

PubMed Central

Jani, Ylber; Kamberi, Ahmet; Xhunga, Sotir; Pocesta, Bekim; Ferati, Fatmir; Lala, Dali; Zeqiri, Agim; Rexhepi, Atila

2015-01-01

Objective: To assess the influence of type 2 DM and gender, on the QT dispersion, Tpeak-Tend dispersion of ventricular repolarization, in patients with sub-clinic left ventricular diastolic dysfunction of the heart. Background: QT dispersion, that reflects spatial inhomogeneity in ventricular repolarization, Tpeak-Tend dispersion, this on the other hand reflects transmural inhomogeneity in ventricular repolarization, that is increased in an early stage of cardiomyopathy, and in patients with left ventricular diastolic dysfunction, as well. The left ventricular diastolic dysfunction, a basic characteristic of diabetic heart disease (diabetic cardiomyopathy), that developes earlier than systolic dysfunction, suggests that diastolic markers might be sensitive for early cardiac injury. It is also demonstrated that gender has complex influence on indices of myocardial repolarization abnormalities such as QT interval and QT dispersion. Material and methods: We performed an observational study including 300 diabetic patients with similar epidemiological-demographic characteristics recruited in our institution from May 2009 to July 2014, divided into two groups. Demographic and laboratory echocardiographic data were obtained, twelve lead resting electrocardiography, QT, QTc, Tpeak-Tend-intervals and dispersion, were determined manually, and were compared between various groups. For statistical analysis a t-test, X2 test, and logistic regression are used according to the type of variables. A p value <0.05 was considered statistically significant for a confidence interval of 95%. Results: QTc max. interval, QTc dispersion and Tpeak-Tend dispersion, were significantly higher in diabetic group with subclinical LV (left ventricular) diastolic dysfunction, than in diabetic group with normal left ventricular diastolic function (445.24±14.7 ms vs. 433.55±14.4 ms, P<0.000; 44.98±18.78 ms vs. 32.05±17.9 ms, P<0.000; 32.60±1.6 ms vs. 17.46±2.0 ms, P<0.02. Prolonged QTc max. interval was found in 33% of patients, indiabetic group with subclinical left ventricular diastolic dysfunction vs. 13.3% of patients in diabetic group with normal left ventricular diastolic function, (Chi-square: 16.77, P<0.0001). A prolonged QTc dispersion, was found in 40.6% of patients, in diabetic group with subclinical left ventricular diastolic dysfunction vs. 20% of patients in diabetic group with normal left ventricular diastolic function Chi-square: 14.11, P<0.0002). A prolonged dispersion of Tpeak-Tend interval was found in 24% of patients in diabetic group with subclinical left ventricular diastolic dysfunction vs. 13.3% of patients in diabetic group with normal left ventricular diastolic function (Chi-square: 12.00, P<0.005). Females in diabetic group with subclinical left ventricular diastolic dysfunction in comparison with males in diabetic group with subclinical left ventricular diastolic dysfunction, have a significantly prolonged: mean QTc max. interval (23.3% vs. 10%, Chisquare: 12.0, P<0.005), mean QTc dispersion (27.3% vs. 13.3%, Chi-square: 10.24, P<0.001), mean Tpeak-Tend interval (10% vs. 3.3%, Chi-square: 5.77, P<0.01), mean Tpek-Tend dispersion (16.6% vs. 6.6%, Chi-square: 8.39, P<0.003). Conclusion: The present study has shown that influences of type 2 diabetes and gender in diabetics with sub-clinical left-ventricular diastolic dysfunction are reflected in a set of electrophysiological parameters that indicate a prolonged and more heterogeneous repolarization than in diabetic patients with normal diastolic function. In addition, it demonstrates that there exist differences between diabetic females with sub-clinic LV dysfunction and those with diabetes and normal LV function in the prevalence of increased set of electrophysiological parameters that indicate a prolonged and more heterogeneous repolarization. PMID:26550530

The influence of type 2 diabetes and gender on ventricular repolarization dispersion in patients with sub-clinic left ventricular diastolic dysfunction.

PubMed

Jani, Ylber; Kamberi, Ahmet; Xhunga, Sotir; Pocesta, Bekim; Ferati, Fatmir; Lala, Dali; Zeqiri, Agim; Rexhepi, Atila

2015-01-01

To assess the influence of type 2 DM and gender, on the QT dispersion, Tpeak-Tend dispersion of ventricular repolarization, in patients with sub-clinic left ventricular diastolic dysfunction of the heart. QT dispersion, that reflects spatial inhomogeneity in ventricular repolarization, Tpeak-Tend dispersion, this on the other hand reflects transmural inhomogeneity in ventricular repolarization, that is increased in an early stage of cardiomyopathy, and in patients with left ventricular diastolic dysfunction, as well. The left ventricular diastolic dysfunction, a basic characteristic of diabetic heart disease (diabetic cardiomyopathy), that developes earlier than systolic dysfunction, suggests that diastolic markers might be sensitive for early cardiac injury. It is also demonstrated that gender has complex influence on indices of myocardial repolarization abnormalities such as QT interval and QT dispersion. We performed an observational study including 300 diabetic patients with similar epidemiological-demographic characteristics recruited in our institution from May 2009 to July 2014, divided into two groups. Demographic and laboratory echocardiographic data were obtained, twelve lead resting electrocardiography, QT, QTc, Tpeak-Tend-intervals and dispersion, were determined manually, and were compared between various groups. For statistical analysis a t-test, X(2) test, and logistic regression are used according to the type of variables. A p value <0.05 was considered statistically significant for a confidence interval of 95%. QTc max. interval, QTc dispersion and Tpeak-Tend dispersion, were significantly higher in diabetic group with subclinical LV (left ventricular) diastolic dysfunction, than in diabetic group with normal left ventricular diastolic function (445.24±14.7 ms vs. 433.55±14.4 ms, P<0.000; 44.98±18.78 ms vs. 32.05±17.9 ms, P<0.000; 32.60±1.6 ms vs. 17.46±2.0 ms, P<0.02. Prolonged QTc max. interval was found in 33% of patients, indiabetic group with subclinical left ventricular diastolic dysfunction vs. 13.3% of patients in diabetic group with normal left ventricular diastolic function, (Chi-square: 16.77, P<0.0001). A prolonged QTc dispersion, was found in 40.6% of patients, in diabetic group with subclinical left ventricular diastolic dysfunction vs. 20% of patients in diabetic group with normal left ventricular diastolic function Chi-square: 14.11, P<0.0002). A prolonged dispersion of Tpeak-Tend interval was found in 24% of patients in diabetic group with subclinical left ventricular diastolic dysfunction vs. 13.3% of patients in diabetic group with normal left ventricular diastolic function (Chi-square: 12.00, P<0.005). Females in diabetic group with subclinical left ventricular diastolic dysfunction in comparison with males in diabetic group with subclinical left ventricular diastolic dysfunction, have a significantly prolonged: mean QTc max. interval (23.3% vs. 10%, Chisquare: 12.0, P<0.005), mean QTc dispersion (27.3% vs. 13.3%, Chi-square: 10.24, P<0.001), mean Tpeak-Tend interval (10% vs. 3.3%, Chi-square: 5.77, P<0.01), mean Tpek-Tend dispersion (16.6% vs. 6.6%, Chi-square: 8.39, P<0.003). The present study has shown that influences of type 2 diabetes and gender in diabetics with sub-clinical left-ventricular diastolic dysfunction are reflected in a set of electrophysiological parameters that indicate a prolonged and more heterogeneous repolarization than in diabetic patients with normal diastolic function. In addition, it demonstrates that there exist differences between diabetic females with sub-clinic LV dysfunction and those with diabetes and normal LV function in the prevalence of increased set of electrophysiological parameters that indicate a prolonged and more heterogeneous repolarization.

Prognostic implications of mutation-specific QTc standard deviation in congenital long QT syndrome.

PubMed

Mathias, Andrew; Moss, Arthur J; Lopes, Coeli M; Barsheshet, Alon; McNitt, Scott; Zareba, Wojciech; Robinson, Jennifer L; Locati, Emanuela H; Ackerman, Michael J; Benhorin, Jesaia; Kaufman, Elizabeth S; Platonov, Pyotr G; Qi, Ming; Shimizu, Wataru; Towbin, Jeffrey A; Michael Vincent, G; Wilde, Arthur A M; Zhang, Li; Goldenberg, Ilan

2013-05-01

Individual corrected QT interval (QTc) may vary widely among carriers of the same long QT syndrome (LQTS) mutation. Currently, neither the mechanism nor the implications of this variable penetrance are well understood. To hypothesize that the assessment of QTc variance in patients with congenital LQTS who carry the same mutation provides incremental prognostic information on the patient-specific QTc. The study population comprised 1206 patients with LQTS with 95 different mutations and ≥ 5 individuals who carry the same mutation. Multivariate Cox proportional hazards regression analysis was used to assess the effect of mutation-specific standard deviation of QTc (QTcSD) on the risk of cardiac events (comprising syncope, aborted cardiac arrest, and sudden cardiac death) from birth through age 40 years in the total population and by genotype. Assessment of mutation-specific QTcSD showed large differences among carriers of the same mutations (median QTcSD 45 ms). Multivariate analysis showed that each 20 ms increment in QTcSD was associated with a significant 33% (P = .002) increase in the risk of cardiac events after adjustment for the patient-specific QTc duration and the family effect on QTc. The risk associated with QTcSD was pronounced among patients with long QT syndrome type 1 (hazard ratio 1.55 per 20 ms increment; P<.001), whereas among patients with long QT syndrome type 2, the risk associated with QTcSD was not statistically significant (hazard ratio 0.99; P = .95; P value for QTcSD-by-genotype interaction = .002). Our findings suggest that mutations with a wider variation in QTc duration are associated with increased risk of cardiac events. These findings appear to be genotype-specific, with a pronounced effect among patients with the long QT syndrome type 1 genotype. Copyright © 2013. Published by Elsevier Inc.

Identifying the translational gap in the evaluation of drug-induced QTc interval prolongation

PubMed Central

Chain, Anne SY; Dubois, Vincent FS; Danhof, Meindert; Sturkenboom, Miriam CJM; Della Pasqua, Oscar

2013-01-01

Aims Given the similarities in QTc response between dogs and humans, dogs are used in pre-clinical cardiovascular safety studies. The objective of our investigation was to characterize the PKPD relationships and identify translational gaps across species following the administration of three compounds known to cause QTc interval prolongation, namely cisapride, d, l-sotalol and moxifloxacin. Methods Pharmacokinetic and pharmacodynamic data from experiments in conscious dogs and clinical trials were included in this analysis. First, pharmacokinetic modelling and deconvolution methods were applied to derive drug concentrations at the time of each QT measurement. A Bayesian PKPD model was then used to describe QT prolongation, allowing discrimination of drug-specific effects from other physiological factors known to alter QT interval duration. A threshold of ≥10 ms was used to explore the probability of prolongation after drug administration. Results A linear relationship was found to best describe the pro-arrhythmic effects of cisapride, d,l-sotalol and moxifloxacin both in dogs and in humans. The drug-specific parameter (slope) in dogs was statistically significantly different from humans. Despite such differences, our results show that the probability of QTc prolongation ≥10 ms in dogs nears 100% for all three compounds at the therapeutic exposure range in humans. Conclusions Our findings indicate that the slope of PKPD relationship in conscious dogs may be used as the basis for the prediction of drug-induced QTc prolongation in humans. Furthermore, the risk of QTc prolongation can be expressed in terms of the probability associated with an increase ≥10 ms, allowing direct inferences about the clinical relevance of the pro-arrhythmic potential of a molecule. PMID:23351036

Epilepsy is associated with ventricular alterations following convulsive status epilepticus in children.

PubMed

Ali, Wail; Bubolz, Beth A; Nguyen, Linh; Castro, Danny; Coss-Bu, Jorge; Quach, Michael M; Kennedy, Curtis E; Anderson, Anne E; Lai, Yi-Chen

2017-12-01

Convulsive status epilepticus can exert profound cardiovascular effects in adults including ventricular depolarization-repolarization abnormalities. Whether status epilepticus adversely affects ventricular electrical properties in children is less understood. Therefore, we sought to characterize ventricular alterations and the associated clinical factors in children following convulsive status epilepticus. We conducted a 2-year retrospective, case-control study. Children between 1 month and 21 years of age were included if they were admitted to the pediatric intensive care unit with primary diagnosis of convulsive status epilepticus and had 12-lead electrocardiogram (ECG) within 24 hours of admission. Children with heart disease, ion channelopathy, or on vasoactive medications were excluded. Age-matched control subjects had no history of seizures or epilepsy. The primary outcome was ventricular abnormalities represented by ST segment changes, abnormal T wave, QRS axis deviation, and corrected QT (QTc) interval prolongation. The secondary outcomes included QT/RR relationship, beat-to-beat QTc interval variability, ECG interval measurement between groups, and clinical factors associated with ECG abnormalities. Of 317 eligible children, 59 met the inclusion criteria. History of epilepsy was present in 31 children (epileptic) and absent in 28 children (non-epileptic). Compared with the control subjects (n = 31), the status epilepticus groups were more likely to have an abnormal ECG with overall odds ratio of 3.8 and 7.0 for the non-epileptic and the epileptic groups respectively. Simple linear regression analysis demonstrated that children with epilepsy exhibited impaired dependence and adaptation of the QT interval on heart rate. Beat-to-beat QTc interval variability, a marker of ventricular repolarization instability, was increased in children with epilepsy. Convulsive status epilepticus can adversely affect ventricular electrical properties and stability in children, especially those with epilepsy. These findings suggest that children with epilepsy may be particularly vulnerable to seizure-induced arrhythmias. Therefore postictal cardiac surveillance may be warranted in this population.

Effect of cimetidine and ranitidine on pharmacokinetics and pharmacodynamics of a single dose of dofetilide

PubMed Central

Abel, Samantha; Nichols, Donald J; Brearley, Christopher J; Eve, Malcolm D

2000-01-01

Aims The aim of this open-label, placebo-controlled, randomized, four-period crossover study was to determine the effects of cimetidine and ranitidine on the pharmacokinetics and pharmacodynamics of a single dose of dofetilide. Methods Twenty healthy male subjects received 100 or 400 mg twice daily of cimetidine, 150 mg twice daily of ranitidine, or placebo for 4 days. On the second day, a single oral 500 μg dose of dofetilide was administered immediately after the morning doses of cimetidine, ranitidine, or placebo. Treatment periods were separated by 1–2 weeks. Pharmacokinetic parameters were determined from plasma and urinary dofetilide concentrations; prolongation of the QTc interval was determined from three-lead electrocardiograms. Results Ranitidine did not significantly affect the pharmacokinetics or pharmacodynamics of dofetilide; however, a dose-dependent increase in exposure to dofetilide was observed with cimetidine. When dofetilide was administered with 100 and 400 mg of cimetidine, the area under the plasma concentration-time curve of dofetilide increased by 11% and 48% and the maximum plasma dofetilide concentration increased by 11% and 29%, respectively. The respective cimetidine doses reduced renal clearance of dofetilide by 13% and 33% and nonrenal clearance by 5% and 21%. Dofetilide-induced prolongation of the QTc interval was enhanced by cimetidine; the mean maximum change in QTc interval from baseline was increased by 22% and 33% with 100 and 400 mg of cimetidine, respectively. However, the relationship between the prolongation of the QTc interval and plasma dofetilide concentrations was unaffected by cimetidine or ranitidine; a 1 ng ml−1 increase in plasma dofetilide concentration produced a 17–19 ms prolongation of the QTc interval. Dofetilide was well tolerated, with no treatment-related adverse events or laboratory abnormalities. Conclusions These results suggest that cimetidine increased dofetilide exposure by inhibiting renal tubular dofetilide secretion, whereas ranitidine did not. This effect is not an H2-receptor antagonist class effect but is specific to cimetidine. If therapy with an H2-receptor antagonist is required, it is recommended that cimetidine at all doses be avoided; since ranitidine has no effect on dofetilide pharmacokinetics or prolongation of the QTc interval, it can be seen as a suitable alternative. PMID:10606839

Single therapeutic and supratherapeutic doses of corifollitropin alfa, a sustained follicle stimulant, do not prolong the QTcF-interval in healthy postmenopausal volunteers.

PubMed

de Kam, Pieter-Jan; van Kuijk, Jacqueline H M; Zandvliet, Anthe S; Thomsen, Torben

2015-09-01

Corifollitropin alfa (Elonva®) is the first hybrid follicle-stimulating hormone molecule with demonstrated sustained follicle-stimulating activity after a single subcutaneous injection. This trial evaluated if corifollitropin alfa is associated with QT/QTc prolongation and/ or proarrhythmic potential as compared to placebo in healthy post-menopausal women. Participants were healthy, postmenopausal women. Study treatments were corifollitropin alfa 150 μg, corifollitropin alfa 240 μg, and moxifloxacin 400 mg with placebo. This randomized, double blind, double-dummy, 4-period crossover trial compared single doses of corifollitropin alfa 150 μg (therapeutic dose), corifollitropin alfa 240 μg (supratherapeutic dose), and moxifloxacin 400 mg (positive control) with placebo. Corifollitropin alfa was administered on day 1 and moxifloxacin on day 2. The largest time-matched mean QTcF difference versus placebo for the therapeutic dose of corifollitropin alfa was 1.4 ms (upper limit of 1-sided 95% confidence interval (UL 95% CI) = 3.4 ms), and for the supratherapeutic dose was 1.2 ms (UL 95% CI = 3.6 ms). For both the therapeutic and the supratherapeutic dose of corifollitropin alfa and at all time points, the UL 95% CI for the time matched QTcF differences compared with placebo was below 10 ms, the threshold of relevance defined by the ICH E14 guideline. Single therapeutic and supratherapeutic doses of corifollitropin alfa are not associated with clinically relevant QT/QTc-interval prolongation in healthy post-menopausal women.

Evaluation of the Relationship Between Pharmacokinetics and the Safety of Aripiprazole and Its Cardiovascular Effects in Healthy Volunteers.

PubMed

Belmonte, Carmen; Ochoa, Dolores; Román, Manuel; Cabaleiro, Teresa; Talegón, Maria; Sánchez-Rojas, Sergio Daniel; Abad-Santos, Francisco

2016-12-01

The aim of this study was the evaluation of the possible relationship between pharmacokinetics and the safety of aripiprazole as well as its influence on blood pressure (BP), heart rate (HR), and corrected QT (QTc) interval. The study population comprised 157 healthy volunteers from 6 bioequivalence clinical trials. Subjects were administered a single 10-mg oral dose of each formulation separated by a 28-day washout period. Plasma concentrations were measured using high-performance liquid chromatography coupled to mass spectrometry. Blood pressure was measured at the following times: predose and 0.5, 2, 4, 6, and 8 hours postdose. An electrocardiogram was recorded at predose, 4, and 8 hours postdose. Area under the curve (AUC), maximum plasma concentration, half-life, and distribution volume corrected for weight were higher in women. Aripiprazole treatment produced a decrease of BP (9.3 mm Hg on systolic and 6.2 mm Hg on diastolic pressure) and an increase in HR (12.1 beats per minute) and QTc interval (9.1 milliseconds). There were sex differences in BP, HR, and QTc interval. Women and subjects with higher AUC and maximum plasma concentration values were more prone to experience adverse drug reactions and gastrointestinal adverse reactions. The AUC was related with systolic BP and diastolic BP decrease and HR increase but there was no relationship between aripiprazole concentrations and QTc increase. Aripiprazole decreases BP and increases HR and QTc interval. Pharmacokinetics, pharmacodynamics, and safety of aripiprazole are affected by sex. There is a directly proportional relationship between pharmacokinetic parameters and adverse drug reactions and effect on BP and HR.

Sample size, power calculations, and their implications for the cost of thorough studies of drug induced QT interval prolongation.

PubMed

Malik, Marek; Hnatkova, Katerina; Batchvarov, Velislav; Gang, Yi; Smetana, Peter; Camm, A John

2004-12-01

Regulatory authorities require new drugs to be investigated using a so-called "thorough QT/QTc study" to identify compounds with a potential of influencing cardiac repolarization in man. Presently drafted regulatory consensus requires these studies to be powered for the statistical detection of QTc interval changes as small as 5 ms. Since this translates into a noticeable drug development burden, strategies need to be identified allowing the size and thus the cost of thorough QT/QTc studies to be minimized. This study investigated the influence of QT and RR interval data quality and the precision of heart rate correction on the sample sizes of thorough QT/QTc studies. In 57 healthy subjects (26 women, age range 19-42 years), a total of 4,195 drug-free digital electrocardiograms (ECG) were obtained (65-84 ECGs per subject). All ECG parameters were measured manually using the most accurate approach with reconciliation of measurement differences between different cardiologists and aligning the measurements of corresponding ECG patterns. From the data derived in this measurement process, seven different levels of QT/RR data quality were obtained, ranging from the simplest approach of measuring 3 beats in one ECG lead to the most exact approach. Each of these QT/RR data-sets was processed with eight different heart rate corrections ranging from Bazett and Fridericia corrections to the individual QT/RR regression modelling with optimization of QT/RR curvature. For each combination of data quality and heart rate correction, standard deviation of individual mean QTc values and mean of individual standard deviations of QTc values were calculated and used to derive the size of thorough QT/QTc studies with an 80% power to detect 5 ms QTc changes at the significance level of 0.05. Irrespective of data quality and heart rate corrections, the necessary sample sizes of studies based on between-subject comparisons (e.g., parallel studies) are very substantial requiring >140 subjects per group. However, the required study size may be substantially reduced in investigations based on within-subject comparisons (e.g., crossover studies or studies of several parallel groups each crossing over an active treatment with placebo). While simple measurement approaches with ad-hoc heart rate correction still lead to requirements of >150 subjects, the combination of best data quality with most accurate individualized heart rate correction decreases the variability of QTc measurements in each individual very substantially. In the data of this study, the average of standard deviations of QTc values calculated separately in each individual was only 5.2 ms. Such a variability in QTc data translates to only 18 subjects per study group (e.g., the size of a complete one-group crossover study) to detect 5 ms QTc change with an 80% power. Cost calculations show that by involving the most stringent ECG handling and measurement, the cost of a thorough QT/QTc study may be reduced to approximately 25%-30% of the cost imposed by the simple ECG reading (e.g., three complexes in one lead only).

[Association of cardiovascular autonomic neuropathy and prolonged QT interval with cardiovascular morbidity and mortality in patients with type 2 diabetes mellitus].

PubMed

Ticse Aguirre, Ray; Villena, Jaime E

2011-03-01

In order to evaluate the relationship between cardiovascular autonomic neuropathy and corrected QT interval (QTc) with cardiovascular morbidity and mortality in patients with type 2 diabetes mellitus, we followed up for 5 years 67 patients attending the outpatient Endocrinology Service. 82% completed follow-up and cardiovascular events occurred in 16 patients. We found that long QTc interval was the only variable significantly associated with cardiovascular morbidity and mortality in the multiple logistic regression analysis (RR: 13.56, 95% CI: 2.01-91.36) (p = 0.0074).

Dynamic QT Interval Changes from Supine to Standing in Healthy Children.

PubMed

Dionne, Audrey; Fournier, Anne; Dahdah, Nagib; Abrams, Dominic; Khairy, Paul; Abadir, Sylvia

2018-01-01

QT-interval variations in response to exercise-induced increases in heart rate have been reported in children and adults in the diagnosis of long QT syndrome (LQTS). A quick standing challenge has been proposed as an alternative provocative test in adults, with no pediatric data yet available. A standing test was performed in 100 healthy children (mean age, 9.7 ± 3.1 years) after 10 minutes in a supine position with continuous electrocardiographic recording. QT intervals were measured at baseline, at maximal heart rate, at maximal QT, and at each minute of a 5-minute recovery while standing. Measurements were taken in leads II/V 5 and were corrected for heart rate (QTc). On standing, the heart rate increased by 29 ± 10 beats per minute (bpm). The QT interval was similar at baseline and on standing (394 ± 34 ms vs 394 ± 34 ms; P = 1.0). However, QTc increased from 426 ± 21 to 509 ± 41 ms (P < 0.001). The 95th percentile for QTc at baseline and maximal heart rate was 457 ms and 563 ms, respectively. At 1 minute of recovery, the QT interval was shorter (375 ± 31 ms) compared with baseline (394 ± 34 ms; P < 0.001) and standing (394 ± 34 ms; P < 0.001). QTc reached baseline values after 1 minute of recovery and remained stable thereafter (423 ± 23 ms at 1 minute; 426 ± 22 ms at 5 minutes; P = 1.0). This first characterization of QTc changes on standing in children shows substantial alterations, which are greater than those seen in adults. Two-thirds of the children would have been misclassified as having LQTS by adult criteria, indicating the need to create child-specific standards. Copyright © 2017 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.

Development of a Flight Simulation Concept and Aerodynamic Buildup for Investigation of Departure Prevention Systems in Tactical Aircraft.

DTIC Science & Technology

1983-09-01

I - c).Il.- 4 - OIL 1-0 40CA I ..04uLU 1-Z Z ម 00 >O~ 0 CC cc3 0 WCLW X04 g ’"-J0t-0QtcW at Z1--W0Uaow( W" 01- ZZ0Z :3 JCCQ~Aw1-cO 00’-ZI.-0’ Z4... OIL 40 ft.~~L ft t U- U~r ~- b O* - 0 . i 0LL ,;V; 0 O U. W l- oIZ 0U 0 Q W --. " Z-f Ci IL LU - 4 QILL0 - .% 0 (J wU--󈧭- 2 u Q - -JL ZU 0-’ 2 I - w Ow...0 0.440 -0t UI20-.Jc ’A 28.- >.J0Zb4 -JovV-$- UJa 8- C9444L W4-LU 4ao. a L . .4~ 11.0QQ 000002 .U.4’U. z 00".-Po .44in..4 0~4 LUV ., i

A Valuable Tool in Predicting Poor Outcome due to Sepsis in Pediatric Intensive Care Unit: Tp-e/QT Ratio.

PubMed

Ozdemir, Rahmi; Isguder, Rana; Kucuk, Mehmet; Karadeniz, Cem; Ceylan, Gokhan; Katipoglu, Nagehan; Yilmazer, Murat Muhtar; Yozgat, Yilmaz; Mese, Timur; Agin, Hasan

2016-10-01

To assess the feasibility of 12-lead electrocardiographic (ECG) measures such as P wave dispersion (PWd), QT interval, QT dispersion (QTd), Tp-e interval, Tp-e/QT and Tp-e/QTc ratio in predicting poor outcome in patients diagnosed with sepsis in pediatric intensive care unit (PICU). Ninety-three patients diagnosed with sepsis, severe sepsis or septic shock and 103 age- and sex-matched healthy children were enrolled into the study. PWd, QT interval, QTd, Tp-e interval and Tp-e/QT, Tp-e/QTc ratios were obtained from a 12-lead electrocardiogram. PWd, QTd, Tp-e interval and Tp-e/QT, Tp-e/QTc ratios were significantly higher in septic patients compared with the controls. During the study period, 41 patients had died. In multivariate logistic regression analyses, only Tp-e/QT ratio was found to be an independent predictor of mortality. The ECG measurements can predict the poor outcome in patients with sepsis. The Tp-e/QT ratio may be a valuable tool in predicting mortality for patients with sepsis in the PICU. © The Author [2016]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Associations between Changes in City and Address Specific Temperature and QT Interval - The VA Normative Aging Study

PubMed Central

Mehta, Amar J.; Kloog, Itai; Zanobetti, Antonella; Coull, Brent A.; Sparrow, David; Vokonas, Pantel; Schwartz, Joel

2014-01-01

Background The underlying mechanisms of the association between ambient temperature and cardiovascular morbidity and mortality are not well understood, particularly for daily temperature variability. We evaluated if daily mean temperature and standard deviation of temperature was associated with heart rate-corrected QT interval (QTc) duration, a marker of ventricular repolarization in a prospective cohort of older men. Methods This longitudinal analysis included 487 older men participating in the VA Normative Aging Study with up to three visits between 2000–2008 (n = 743). We analyzed associations between QTc and moving averages (1–7, 14, 21, and 28 days) of the 24-hour mean and standard deviation of temperature as measured from a local weather monitor, and the 24-hour mean temperature estimated from a spatiotemporal prediction model, in time-varying linear mixed-effect regression. Effect modification by season, diabetes, coronary heart disease, obesity, and age was also evaluated. Results Higher mean temperature as measured from the local monitor, and estimated from the prediction model, was associated with longer QTc at moving averages of 21 and 28 days. Increased 24-hr standard deviation of temperature was associated with longer QTc at moving averages from 4 and up to 28 days; a 1.9°C interquartile range increase in 4-day moving average standard deviation of temperature was associated with a 2.8 msec (95%CI: 0.4, 5.2) longer QTc. Associations between 24-hr standard deviation of temperature and QTc were stronger in colder months, and in participants with diabetes and coronary heart disease. Conclusion/Significance In this sample of older men, elevated mean temperature was associated with longer QTc, and increased variability of temperature was associated with longer QTc, particularly during colder months and among individuals with diabetes and coronary heart disease. These findings may offer insight of an important underlying mechanism of temperature-related cardiovascular morbidity and mortality in an older population. PMID:25238150

New age- and sex-specific criteria for QT prolongation based on rate correction formulas that minimize bias at the upper normal limits.

PubMed

Rautaharju, Pentti M; Mason, Jay W; Akiyama, Toshio

2014-07-01

Existing formulas for rate-corrected QT (QTc) commonly fail to properly adjust the upper normal limits which are more critical than the mean QTc for evaluation of prolonged QT. Age- and sex-related differences in QTc are also often overlooked. Our goal was to establish criteria for prolonged QTc using formulas that minimize QTc bias at the upper normal limits. Strict criteria were used in selecting a study group of 57,595 persons aged 5 to 89 years (54% women) and to exclude electrocardiograms (ECG) with possible disease-associated changes. Two QT rate adjustment formulas were identified which both minimized rate-dependency in the 98 th percentile limits: QTcmod, based on an electrophysiological model (QTcMod = QTx(120 + HR)/180)), and QTcLogLin, a power function of the RR interval with exponents 0.37 for men and 0.38 for women. QTc shortened in men during adolescence and QTcMod became 13 ms shorter than in women at age 20-29 years. The sex difference was maintained through adulthood although decreasing with age. The criteria established for prolonged QTc were: Age < 40 years, men 430 ms, women 440 ms; Age 40 to 69, men 440 ms, women 450 ms; Age ≥ 70 years, men 455 ms, and women 460 ms. Sex difference in QTc originates from shortened QT in adolescent males. Upper normal limits for QTc vary substantially by age and sex, and it is essential to use age- and sex-specific criteria for evaluation of QT prolongation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Lack of significant effect of bilastine administered at therapeutic and supratherapeutic doses and concomitantly with ketoconazole on ventricular repolarization: results of a thorough QT study (TQTS) with QT-concentration analysis.

PubMed

Tyl, Benoît; Kabbaj, Meriam; Azzam, Sara; Sologuren, Ander; Valiente, Román; Reinbolt, Elizabeth; Roupe, Kathryn; Blanco, Nathalie; Wheeler, William

2012-06-01

The effect of bilastine on cardiac repolarization was studied in 30 healthy participants during a multiple-dose, triple-dummy, crossover, thorough QT study that included 5 arms: placebo, active control (400 mg moxifloxacin), bilastine at therapeutic and supratherapeutic doses (20 mg and 100 mg once daily, respectively), and bilastine 20 mg administered with ketoconazole 400 mg. Time-matched, triplicate electrocardiograms (ECGs) were recorded with 13 time points extracted predose and 16 extracted over 72 hours post day 4 dosing. Four QT/RR corrections were implemented: QTcB; QTcF; a linear individual correction (QTcNi), the primary correction; and a nonlinear one (QTcNnl). Moxifloxacin was associated with a significant increase in QTcNi at all time points between 1 and 12 hours, inclusively. Bilastine administration at 20 mg and 100 mg had no clinically significant impact on QTc (maximum increase in QTcNi, 5.02 ms; upper confidence limit [UCL] of the 1-sided, 95% confidence interval, 7.87 ms). Concomitant administration of ketoconazole and bilastine 20 mg induced a clinically relevant increase in QTc (maximum increase in QTcNi, 9.3 ms; UCL, 12.16 ms). This result was most likely related to the cardiac effect of ketoconazole because for all time points, bilastine plasma concentrations were lower than those observed following the supratherapeutic dose.

Identifying QT prolongation from ECG impressions using a general-purpose Natural Language Processor

PubMed Central

Denny, Joshua C.; Miller, Randolph A.; Waitman, Lemuel Russell; Arrieta, Mark; Peterson, Joshua F.

2009-01-01

Objective Typically detected via electrocardiograms (ECGs), QT interval prolongation is a known risk factor for sudden cardiac death. Since medications can promote or exacerbate the condition, detection of QT interval prolongation is important for clinical decision support. We investigated the accuracy of natural language processing (NLP) for identifying QT prolongation from cardiologist-generated, free-text ECG impressions compared to corrected QT (QTc) thresholds reported by ECG machines. Methods After integrating negation detection to a locally-developed natural language processor, the KnowledgeMap concept identifier, we evaluated NLP-based detection of QT prolongation compared to the calculated QTc on a set of 44,318 ECGs obtained from hospitalized patients. We also created a string query using regular expressions to identify QT prolongation. We calculated sensitivity and specificity of the methods using manual physician review of the cardiologist-generated reports as the gold standard. To investigate causes of “false positive” calculated QTc, we manually reviewed randomly selected ECGs with a long calculated QTc but no mention of QT prolongation. Separately, we validated the performance of the negation detection algorithm on 5,000 manually-categorized ECG phrases for any medical concept (not limited to QT prolongation) prior to developing the NLP query for QT prolongation. Results The NLP query for QT prolongation correctly identified 2,364 of 2,373 ECGs with QT prolongation with a sensitivity of 0.996 and a positive predictive value of 1.000. There were no false positives. The regular expression query had a sensitivity of 0.999 and positive predictive value of 0.982. In contrast, the positive predictive value of common QTc thresholds derived from ECG machines was 0.07–0.25 with corresponding sensitivities of 0.994–0.046. The negation detection algorithm had a recall of 0.973 and precision of 0.982 for 10,490 concepts found within ECG impressions. Conclusions NLP and regular expression queries of cardiologists’ ECG interpretations can more effectively identify QT prolongation than the automated QTc intervals reported by ECG machines. Future clinical decision support could employ NLP queries to detect QTc prolongation and other reported ECG abnormalities. PMID:18938105

Detection of QT prolongation using a novel electrocardiographic analysis algorithm applying intelligent automation: prospective blinded evaluation using the Cardiac Safety Research Consortium electrocardiographic database.

PubMed

Green, Cynthia L; Kligfield, Paul; George, Samuel; Gussak, Ihor; Vajdic, Branislav; Sager, Philip; Krucoff, Mitchell W

2012-03-01

The Cardiac Safety Research Consortium (CSRC) provides both "learning" and blinded "testing" digital electrocardiographic (ECG) data sets from thorough QT (TQT) studies annotated for submission to the US Food and Drug Administration (FDA) to developers of ECG analysis technologies. This article reports the first results from a blinded testing data set that examines developer reanalysis of original sponsor-reported core laboratory data. A total of 11,925 anonymized ECGs including both moxifloxacin and placebo arms of a parallel-group TQT in 181 subjects were blindly analyzed using a novel ECG analysis algorithm applying intelligent automation. Developer-measured ECG intervals were submitted to CSRC for unblinding, temporal reconstruction of the TQT exposures, and statistical comparison to core laboratory findings previously submitted to FDA by the pharmaceutical sponsor. Primary comparisons included baseline-adjusted interval measurements, baseline- and placebo-adjusted moxifloxacin QTcF changes (ddQTcF), and associated variability measures. Developer and sponsor-reported baseline-adjusted data were similar with average differences <1 ms for all intervals. Both developer- and sponsor-reported data demonstrated assay sensitivity with similar ddQTcF changes. Average within-subject SD for triplicate QTcF measurements was significantly lower for developer- than sponsor-reported data (5.4 and 7.2 ms, respectively; P < .001). The virtually automated ECG algorithm used for this analysis produced similar yet less variable TQT results compared with the sponsor-reported study, without the use of a manual core laboratory. These findings indicate that CSRC ECG data sets can be useful for evaluating novel methods and algorithms for determining drug-induced QT/QTc prolongation. Although the results should not constitute endorsement of specific algorithms by either CSRC or FDA, the value of a public domain digital ECG warehouse to provide prospective, blinded comparisons of ECG technologies applied for QT/QTc measurement is illustrated. Copyright © 2012 Mosby, Inc. All rights reserved.

Detection of QT prolongation using a novel ECG analysis algorithm applying intelligent automation: Prospective blinded evaluation using the Cardiac Safety Research Consortium ECG database

PubMed Central

Green, Cynthia L.; Kligfield, Paul; George, Samuel; Gussak, Ihor; Vajdic, Branislav; Sager, Philip; Krucoff, Mitchell W.

2013-01-01

Background The Cardiac Safety Research Consortium (CSRC) provides both “learning” and blinded “testing” digital ECG datasets from thorough QT (TQT) studies annotated for submission to the US Food and Drug Administration (FDA) to developers of ECG analysis technologies. This manuscript reports the first results from a blinded “testing” dataset that examines Developer re-analysis of original Sponsor-reported core laboratory data. Methods 11,925 anonymized ECGs including both moxifloxacin and placebo arms of a parallel-group TQT in 191 subjects were blindly analyzed using a novel ECG analysis algorithm applying intelligent automation. Developer measured ECG intervals were submitted to CSRC for unblinding, temporal reconstruction of the TQT exposures, and statistical comparison to core laboratory findings previously submitted to FDA by the pharmaceutical sponsor. Primary comparisons included baseline-adjusted interval measurements, baseline- and placebo-adjusted moxifloxacin QTcF changes (ddQTcF), and associated variability measures. Results Developer and Sponsor-reported baseline-adjusted data were similar with average differences less than 1 millisecond (ms) for all intervals. Both Developer and Sponsor-reported data demonstrated assay sensitivity with similar ddQTcF changes. Average within-subject standard deviation for triplicate QTcF measurements was significantly lower for Developer than Sponsor-reported data (5.4 ms and 7.2 ms, respectively; p<0.001). Conclusion The virtually automated ECG algorithm used for this analysis produced similar yet less variable TQT results compared to the Sponsor-reported study, without the use of a manual core laboratory. These findings indicate CSRC ECG datasets can be useful for evaluating novel methods and algorithms for determining QT/QTc prolongation by drugs. While the results should not constitute endorsement of specific algorithms by either CSRC or FDA, the value of a public domain digital ECG warehouse to provide prospective, blinded comparisons of ECG technologies applied for QT/QTc measurement is illustrated. PMID:22424006

Early changes in myocardial repolarization and coronary perfusion after cardiopulmonary bypass surgery for ASD repair in children.

PubMed

Aburawi, Elhadi H; Souid, Abdul-Kader; Liuba, Petru; Zoubeidi, Taoufik; Pesonen, Erkki

2013-09-10

In adults, impaired myocardial repolarization and increased risk of arrhythmia are known consequences of open heart surgery. Little is known, however, about post-operative consequences of cardiopulmonary bypass surgery in children. The aim of this study was to assess ventricular repolarization and coronary perfusion after bypass surgery for atrial septal defect (ASD) repair in children. Twelve patients with ASD were assessed one day before and 5-6 days after ASD repair. Myocardial repolarization (corrected QT interval, QTc, QT dispersion, QTd, and PQ interval) was determined on 12-lead electrocardiograms. Coronary flow in proximal left anterior descending artery (peak flow velocity in diastole, PFVd) was assessed by transthoracic Doppler echocardiography. Ten of the 12 (83%) children had normal myocardial repolarization before and after surgery. After surgery, QTc increased 1-9% in 5 (42%) patients, decreased 2-11% in 5 (42%) patients and did not change in 2 (16%) patients. Post-op QTc positively correlated with bypass time (R=0.686, p=0.014) and changes in PFVd (R=0.741, p=0.006). After surgery, QTd increased 33-67% in 4 (33%) patients, decreased 25-50% in 6 patients (50%) and did not change in 2 (16%) patients. After surgery, PQ interval increased 5-30% in 4 (33%) patients, decreased 4-29% in 6 (50%) patients and did not change in 1 (8%) patient. Post-op PQ positively correlated with bypass time (R=0.636, p=0.027). As previously reported, PFVd significantly increased after surgery (p<0.001). Changes in QTc, PQ and PFVd are common in young children undergoing surgery for ASD repair. Post-op QTc significantly correlates with bypass time, suggesting prolonged cardiopulmonary bypass may impair ventricular repolarization. Post-op QTc significantly correlates with PFVd changes, suggesting increased coronary flow may also impair ventricular repolarization. The clinical significance and reversibility of these alternations require further investigations.

Evolving regulatory paradigm for proarrhythmic risk assessment for new drugs.

PubMed

Vicente, Jose; Stockbridge, Norman; Strauss, David G

Fourteen drugs were removed from the market worldwide because their potential to cause torsade de pointes (torsade), a potentially fatal ventricular arrhythmia. The observation that most drugs that cause torsade block the potassium channel encoded by the human ether-à-go-go related gene (hERG) and prolong the heart rate corrected QT interval (QTc) on the ECG, led to a focus on screening new drugs for their potential to block the hERG potassium channel and prolong QTc. This has been a successful strategy keeping torsadogenic drugs off the market, but has resulted in drugs being dropped from development, sometimes inappropriately. This is because not all drugs that block the hERG potassium channel and prolong QTc cause torsade, sometimes because they block other channels. The regulatory paradigm is evolving to improve proarrhythmic risk prediction. ECG studies can now use exposure-response modeling for assessing the effect of a drug on the QTc in small sample size first-in-human studies. Furthermore, the Comprehensive in vitro Proarrhythmia Assay (CiPA) initiative is developing and validating a new in vitro paradigm for cardiac safety evaluation of new drugs that provides a more accurate and comprehensive mechanistic-based assessment of proarrhythmic potential. Under CiPA, the prediction of proarrhythmic potential will come from in vitro ion channel assessments coupled with an in silico model of the human ventricular myocyte. The preclinical assessment will be checked with an assessment of human phase 1 ECG data to determine if there are unexpected ion channel effects in humans compared to preclinical ion channel data. While there is ongoing validation work, the heart rate corrected J-T peak interval is likely to be assessed under CiPA to detect inward current block in presence of hERG potassium channel block. Copyright © 2016 Elsevier Inc. All rights reserved.

Usefulness of Electrocardiographic QT Interval to Predict Left Ventricular Diastolic Dysfunction

PubMed Central

Wilcox, Jane E.; Rosenberg, Jonathan; Vallakati, Ajay; Gheorghiade, Mihai; Shah, Sanjiv J.

2013-01-01

Whether a normal electrocardiogram excludes left ventricular (LV) diastolic dysfunction (DD) and whether electrocardiographic parameters are associated with DD is unknown. We therefore sought to investigate the relation between electrocardiographic parameters and DD. We first evaluated 75 consecutive patients referred for echocardiography for clinical suspicion of heart failure (phase 1). Electrocardiography and comprehensive echocardiography were performed on all patients and were analyzed separately in a blinded fashion. Receiver operating characteristic curves and multivariate regression analyses were used to determine which electrocardiographic parameters were most closely associated with DD. Next, we prospectively validated our results in 100 consecutive, unselected patients undergoing echocardiography (phase 2). In phase 1 of our study, the mean age was 59 ± 14 years, 41% were women, 31% had coronary disease, 53% had hypertension, and 25% had diabetes. The mean ejection fraction was 54 ± 15%, and 64% had DD. Of all the electrocardiographic parameters, the QTc interval was most closely associated with DD. QTc was inversely associated with E′ velocity (r = −0.54, p <0.0001), and the area under the receiver operating characteristic curve for QTc as a predictor of DD was 0.82. QTc prolongation was independently associated with reduced E′ velocity (p = 0.021 after adjustment for age, gender, medications, QRS duration, and ejection fraction). In phase 2 of our study QTc was the electrocardiographic parameter most associated with reduced E′ velocity (435 ± 31 vs 419 ± 24 ms; p = 0.004), confirming our phase 1 study findings. In conclusion, QTc prolongation was the electrocardiographic marker most predictive of DD and was independently associated with DD. PMID:21907948

QTc Prolongation in Veterans With Heroin Dependence on Methadone Maintenance Treatment.

PubMed

Hassamal, Sameer; Fernandez, Antony; Moradi Rekabdarkolaee, Hossein; Pandurangi, Ananda

2015-06-01

QTc prolongation and Torsade de Ppointes have been reported in patients on methadone maintenance. In this study, QTc was compared before and after the veteran (n = 49) was on a stable dosage of methadone for 8.72 ± 4.50 years to treat heroin dependence. Risk factors were correlated with the QTc once the veteran was on a stable dose of methadone. Differences in the clinical risk factors in subgroups of veterans with below and above mean QTc change was compared. ECG data was obtained from a 12-lead electrocardiogram (pre-methadone and on methadone) on 49 veterans. Data and risk factors were retrospectively collected from the medical records. The mean QTc at baseline (pre-methadone) was 426 ± 34 msec and after being on methadone for an average of 8.72 ± 4.50 years was significantly higher at 450 ± 35 msec. No significant relationships were found between QTc prolongation and risk factors except for calcium. The methadone dosage was significantly higher in veterans with a QTc change above the mean change of ≥ 24 msec (88.48 ± 27.20 mg v.s 68.96 ± 19.84 mg). None of the veterans experienced cardiac arrhythmias. The low complexity of medical co-morbidities may explain the lack of a significant correlation between any risk factor with the QTc except calcium and methadone dosage. The absence of TdP may be explained by the low prevalence of QTc values > 500 msec as well as the retrospective design of the study. During long-term methadone treatment, there was a slight increase in the QTc interval but we did not find evidence of increased cardiac toxicity as a reason for treatment termination.

The DPP-4 inhibitor linagliptin does not prolong the QT interval at therapeutic and supratherapeutic doses

PubMed Central

Ring, Arne; Port, Andreas; Graefe-Mody, E Ulrike; Revollo, Ivette; Iovino, Mario; Dugi, Klaus A

2011-01-01

AIM To evaluate the potential effects of therapeutic and supratherapeutic doses of linagliptin (BI 1356) on the QT/QTc interval in healthy subjects. METHODS The study was a randomized, double-blind, placebo-controlled, four-period crossover study using single oral doses of linagliptin (5 mg and 100 mg), moxifloxacin (400 mg) and placebo. Electrocardiogram (ECG) profiles using triplicates of 12-lead 10-s ECGs were digitally recorded pre-dose and after drug administration. The mean change from baseline (MCfB) of the individually heart rate corrected QT interval (QTcI) between 1 and 4 h postdrug administration was the primary end point. Blood samples to measure plasma concentrations of linagliptin and its main metabolite were also obtained. RESULTS Forty-four Caucasian subjects (26 male) entered the study and 43 subjects completed the study as planned in the protocol. Linagliptin was not associated with an increase in the baseline-adjusted mean QTcI, at any time point. The placebo-corrected MCfB of QTcI was −1.1 (90% CI −2.7, 0.5) ms and −2.5 (–4.1, –0.9) ms for linagliptin 5 mg and 100 mg, respectively, thus within the non-inferiority margin of 10 ms according to ICH E14. Linagliptin was well tolerated; the assessment of ECGs and other safety parameters gave no clinically relevant findings at either dose tested. Maximum plasma concentrations after administration of 100-mg linagliptin were ∼24-fold higher than those observed previously for chronic treatment with the therapeutic 5-mg dose. Assay sensitivity was confirmed by a placebo-corrected MCfB of QTcI with moxifloxacin of 6.9 (90% CI 5.4, 8.5) ms. CONCLUSIONS Therapeutic and significantly supratherapeutic exposure to linagliptin is not associated with QT interval prolongation. PMID:21306414

Electrocardiographic findings in chronic hemodialysis patients.

PubMed

Bignotto, Luís Henrique; Kallás, Marina Esteves; Djouki, Rafael Jorge Teixeira; Sassaki, Marcela Mayume; Voss, Guilherme Ota; Soto, Cristina Lopez; Frattini, Fernando; Medeiros, Flávia Silva Reis

2012-01-01

Cardiovascular disease is the leading cause of mortality among patients on dialysis. When considering all causes of death, about 30% are classified as cardiac arrest, death of unknown cause or cardiac arrhythmia. The increasing time of ventricular depolarization and repolarization, measured non-invasively by measuring the QT interval on the electrocardiogram at rest, has emerged as a predictor of complex ventricular arrhythmias, a major cause of sudden cardiac death. To determine the electrocardiographic alterations present in hemodialysis (HD) patients, measuring the QT interval and its relationship with clinical and laboratory variables. Patients above 18 years on dialysis were approached to participate in the study and, after consent, were submitted to the examination of 12-lead electrocardiogram. Clinical data were reviewed to assess the presence of comorbidities, as well as anthropometric and blood pressure measures. Blood samples were collected to determinate hemoglobin and serum levels of calcium, phosphorus and potassium. One hundred and seventy nine patients were included in the study. The majority of the patients were male (64.8%) and white (54.7%); the average age was 58.5 ± 14.7 years old. About 50% of all patients had, at least, one electrical conduction disturb. About 50% of all patients had QTc prolongation and experienced a significant increase in the frequency of Left Ventricular Hypertrophy (LVH), changes of the cardiac rhythm and bundle branch blocks, and a lower body mass index (BMI), when compared with normal QTc interval patients. Patients with chronic kidney disease (CKD) on hemodialysis had high frequency of abnormal electrocardiographic findings, including a high prevalence of patients with prolonged QTc interval. This study also found a significant association between prolonged QTc interval and the presence of Diabetes and lower values of BMI.

Association of Serum Magnesium on Mortality in Patients Admitted to the Intensive Cardiac Care Unit.

PubMed

Naksuk, Niyada; Hu, Tiffany; Krittanawong, Chayakrit; Thongprayoon, Charat; Sharma, Sunita; Park, Jae Yoon; Rosenbaum, Andrew N; Gaba, Prakriti; Killu, Ammar M; Sugrue, Alan M; Peeraphatdit, Thoetchai; Herasevich, Vitaly; Bell, Malcolm R; Brady, Peter A; Kapa, Suraj; Asirvatham, Samuel J

2017-02-01

Although electrolyte disturbances may affect cardiac action potential, little is known about the association between serum magnesium and corrected QT (QTc) interval as well as clinical outcomes. A consecutive 8498 patients admitted to the Mayo Clinic Hospital-Rochester cardiac care unit (CCU) from January 1, 2004 through December 31, 2013 with 2 or more documented serum magnesium levels, were studied to test the hypothesis that serum magnesium levels are associated with in-hospital mortality, sudden cardiac death, and QTc interval. Patients were 67 ± 15 years; 62.2% were male. The primary diagnoses for CCU admissions were acute myocardial infarction (50.7%) and acute decompensated heart failure (42.5%), respectively. Patients with higher magnesium levels were older, more likely male, and had lower glomerular filtration rates. After multivariate analyses adjusted for clinical characteristics including kidney disease and serum potassium, admission serum magnesium levels were not associated with QTc interval or sudden cardiac death. However, the admission magnesium levels ≥2.4 mg/dL were independently associated with an increase in mortality when compared with the reference level (2.0 to <2.2 mg/dL), having an adjusted odds ratio of 1.80 and a 95% confidence interval of 1.25-2.59. The sensitivity analysis examining the association between postadmission magnesium and analysis that excluded patients with kidney failure and those with abnormal serum potassium yielded similar results. This retrospective study unexpectedly observed no association between serum magnesium levels and QTc interval or sudden cardiac death. However, serum magnesium ≥2.4 mg/dL was an independent predictor of increased hospital morality among CCU patients. Copyright © 2016 Elsevier Inc. All rights reserved.

Effect of gender on computerized electrocardiogram measurements in college athletes.

PubMed

Mandic, Sandra; Fonda, Holly; Dewey, Frederick; Le, Vy-van; Stein, Ricardo; Wheeler, Matt; Ashley, Euan A; Myers, Jonathan; Froelicher, Victor F

2010-06-01

Broad criteria for classifying an electrocardiogram (ECG) as abnormal and requiring additional testing prior to participating in competitive athletics have been recommended for the preparticipation examination (PPE) of athletes. Because these criteria have not considered gender differences, we examined the effect of gender on the computerized ECG measurements obtained on Stanford student athletes. Currently available computer programs require a basis for "normal" in athletes of both genders to provide reliable interpretation. During the 2007 PPE, computerized ECGs were recorded and analyzed on 658 athletes (54% male; mean age, 19 +/- 1 years) representing 22 sports. Electrocardiogram measurements included intervals and durations in all 12 leads to calculate 12-lead voltage sums, QRS amplitude and QRS area, spatial vector length (SVL), and the sum of the R wave in V5 and S wave in V2 (RSsum). By computer analysis, male athletes had significantly greater QRS duration, PR interval, Q-wave duration, J-point amplitude, and T-wave amplitude, and shorter QTc interval compared with female athletes (all P < 0.05). All ECG indicators of left ventricular electrical activity were significantly greater in males. Although gender was consistently associated with indices of atrial and ventricular electrical activity in multivariable analysis, ECG measurements correlated poorly with body dimensions. Significant gender differences exist in ECG measurements of college athletes that are not explained by differences in body size. Our tables of "normal" computerized gender-specific measurements can facilitate the development of automated ECG interpretation for screening young athletes.

Interplay Between Genetic Substrate, QTc Duration, and Arrhythmia Risk in Patients With Long QT Syndrome.

PubMed

Mazzanti, Andrea; Maragna, Riccardo; Vacanti, Gaetano; Monteforte, Nicola; Bloise, Raffaella; Marino, Maira; Braghieri, Lorenzo; Gambelli, Patrick; Memmi, Mirella; Pagan, Eleonora; Morini, Massimo; Malovini, Alberto; Ortiz, Martin; Sacilotto, Luciana; Bellazzi, Riccardo; Monserrat, Lorenzo; Napolitano, Carlo; Bagnardi, Vincenzo; Priori, Silvia G

2018-04-17

Long QT syndrome (LQTS) is a common inheritable arrhythmogenic disorder, often secondary to mutations in the KCNQ1, KCNH2, and SCN5A genes. The disease is characterized by a prolonged ventricular repolarization (QTc interval) that confers susceptibility to life-threatening arrhythmic events (LAEs). This study sought to create an evidence-based risk stratification scheme to personalize the quantification of the arrhythmic risk in patients with LQTS. Data from 1,710 patients with LQTS followed up for a median of 7.1 years (interquartile range [IQR]: 2.7 to 13.4 years) were analyzed to estimate the 5-year risk of LAEs based on QTc duration and genotype and to assess the antiarrhythmic efficacy of beta-blockers. The relationship between QTc duration and risk of events was investigated by comparison of linear and cubic spline models, and the linear model provided the best fit. The 5-year risk of LAEs while patients were off therapy was then calculated in a multivariable Cox model with QTc and genotype considered as independent factors. The estimated risk of LAEs increased by 15% for every 10-ms increment of QTc duration for all genotypes. Intergenotype comparison showed that the risk for patients with LQT2 and LQT3 increased by 130% and 157% at any QTc duration versus patients with LQT1. Analysis of response to beta-blockers showed that only nadolol reduced the arrhythmic risk in all genotypes significantly compared with no therapy (hazard ratio: 0.38; 95% confidence interval: 0.15 to 0.93; p = 0.03). The study provides an estimator of risk of LAEs in LQTS that allows a granular estimate of 5-year arrhythmic risk and demonstrate the superiority of nadolol in reducing the risk of LAEs in LQTS. Copyright © 2018 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Comparison of QTc and Troponin Levels in ST Elevation MIs Compared with Non-ST Elevation MIs.

PubMed

Henrie, Nathan; Harvell, Bryan; Ernst, Amy A; Weiss, Steven J; Oglesbee, Scott; Sarangarm, Dusadee; Hernandez, Lorenzo

2017-03-01

ST elevation myocardial infarctions (STEMIs) and non-ST elevation myocardial infarctions (NSTEMIs) have differences that can be important to differentiate. Our primary hypothesis was that corrected QT (QTc) duration and troponin I levels were higher in STEMIs compared with NSTEMIs. The objective of our study was to compare STEMIs with NSTEMIs for QTc duration and troponin levels. This was a retrospective case-control study of all STEMIs and a random sample of NSTEMIs during a 1-year period. STEMIs were retrieved by searching our electrocardiogram database for all of the cardiology-diagnosed STEMIs. NSTEMIs were found by selecting a randomized sample of all of the patients with a final discharge diagnosis of NSTEMI. Records and electrocardiograms were reviewed for initial troponin I levels and QTc duration. Data extractors were educated formally and a 5% sample was reevaluated by the other extractor as a reliability measure. Data analysis included χ 2 tests and parametric or nonparametric analysis, where appropriate. A logistic regression model was created with variables selected a priori for predictors of STEMIs compared with NSTEMIs. A total of 92 STEMIs and 111 NSTEMIs were evaluated, and interrater reliability showed 90% agreement. Patients with NSTEMIs had significantly longer QTc. Troponin I did not differ on univariate analysis. In a logistic model, Hispanics were more likely than whites to have a STEMI (adjusted odds ratio [AOR] 2.2, 95% confidence interval [CI] 1.09-4.5). An increase in troponin I of 1 was associated with a 7% increase in the AOR of a STEMI (AOR 1.7, 95% CI 1.03-1.12) and an increase in QTc by 10 was associated with a 13% decrease in the AOR of a STEMI (AOR 0.87, 95% CI 0.78-0.93). Patients with NSTEMIs had longer QTc intervals and lower troponin I levels than those with STEMIs.

QT interval and dispersion in drug-free anorexia nervosa adolescents: a case control study.

PubMed

Bomba, Monica; Tremolizzo, Lucio; Corbetta, Fabiola; Nicosia, Franco; Lanfranconi, Francesca; Poggioli, Gianni; Goulene, Karine; Stramba-Badiale, Marco; Conti, Elisa; Neri, Francesca; Nacinovich, Renata

2017-11-16

Long QT values have been reported in patients with anorexia nervosa of the restricting type (ANr) potentially increasing the risk of fatal arrhythmia, especially if psychotropic drug treatment is required. Nevertheless, the previous studies on this topic are biased by drug exposure, long disease durations, and small sample sizes. This study is aimed at assessing QTc and QTcd values in ANr adolescents with recent onset and drug free, as compared to subjects affected by psychiatric disorders other than ANr. We evaluated QTc and its dispersion (QTcd) in a population of 77 drug-free ANr female adolescents and compared to an equal number of healthy controls (H-CTRL) and pathological controls (P-CTRL, mixed psychiatric disorders). The QT determination was performed on a standard simultaneous 12-lead ECG in blind by a single experienced investigator. QTc was calculated by the Bazett's formula and QTcd was determined as the difference between the maximum and minimum QTc intervals in different leads. Only for ANr patients, clinico-demographic data, hormones, and electrolytes were obtained. QTc was slightly reduced in ANr patients (27.7 ms, < 10%, p < 0.0003) vs. controls, while QTcd was increased in P-CTRL (30%, p < 0.0003). Heart rate was significantly lower in ANr patients vs. controls (25%; p < 0.003). Tyroid hormones and serum potassium showed weak although significant positive correlations with QTc in ANr patients. QTcd displayed a weak negative correlation with the BMI percentile (r = - 0.262, p = 0.03). We reject the hypothesis that QTc and QTcd are increased in drug-free ANr adolescents with a relatively short-disease duration. Further studies are needed to understand if the previously reported increase might be related to other associated chronic disorders, such as hormonal or electrolyte imbalance.

Single Doses up to 800 mg of E-52862 Do Not Prolong the QTc Interval – A Retrospective Validation by Pharmacokinetic-Pharmacodynamic Modelling of Electrocardiography Data Utilising the Effects of a Meal on QTc to Demonstrate ECG Assay Sensitivity

PubMed Central

Täubel, Jörg; Ferber, Georg; Lorch, Ulrike; Wang, Duolao; Sust, Mariano; Camm, A. John

2015-01-01

Background E-52862 is a Sigma-1 receptor antagonist (S1RA) currently under investigation as a potential analgesic medicine. We successfully applied a concentration-effect model retrospectively to a four-way crossover Phase I single ascending dose study and utilized the QTc shortening effects of a meal to demonstrate assay sensitivity by establishing the time course effects from baseline in all four periods, independently from any potential drug effects. Methods Thirty two healthy male and female subjects were included in four treatment periods to receive single ascending doses of 500 mg, 600 mg or 800 mg of E-52862 or placebo. PK was linear over the dose range investigated and doses up to 600 mg were well tolerated. The baseline electrocardiography (ECG) measurements on Day-1 were time-matched with ECG and pharmacokinetic (PK) samples on Day 1 (dosing day). Results In this conventional mean change to time-matched placebo analysis, the largest time-matched difference to placebo QTcI was 1.44 ms (90% CI: -4.04, 6.93 ms) for 500 mg; -0.39 ms (90% CI: -3.91, 3.13 ms) for 600 mg and 1.32 ms (90% CI: -1.89, 4.53 ms) for 800 mg of E-52862, thereby showing the absence of any QTc prolonging effect at the doses tested. In addition concentration-effect models, one based on the placebo corrected change from baseline and one for the change of QTcI from average baseline with time as fixed effect were fitted to the data confirming the results of the time course analysis. Conclusion The sensitivity of this study to detect small changes in the QTc interval was confirmed by demonstrating a shortening of QTcF of -8.1 (90% CI: -10.4, -5.9) one hour and -7.2 (90% CI: -9.4, -5.0) three hours after a standardised meal. Trial Registration EU Clinical Trials Register EudraCT 2010 020343 13 PMID:26291080

Single Doses up to 800 mg of E-52862 Do Not Prolong the QTc Interval--A Retrospective Validation by Pharmacokinetic-Pharmacodynamic Modelling of Electrocardiography Data Utilising the Effects of a Meal on QTc to Demonstrate ECG Assay Sensitivity.

PubMed

Täubel, Jörg; Ferber, Georg; Lorch, Ulrike; Wang, Duolao; Sust, Mariano; Camm, A John

2015-01-01

E-52862 is a Sigma-1 receptor antagonist (S1RA) currently under investigation as a potential analgesic medicine. We successfully applied a concentration-effect model retrospectively to a four-way crossover Phase I single ascending dose study and utilized the QTc shortening effects of a meal to demonstrate assay sensitivity by establishing the time course effects from baseline in all four periods, independently from any potential drug effects. Thirty two healthy male and female subjects were included in four treatment periods to receive single ascending doses of 500 mg, 600 mg or 800 mg of E-52862 or placebo. PK was linear over the dose range investigated and doses up to 600 mg were well tolerated. The baseline electrocardiography (ECG) measurements on Day-1 were time-matched with ECG and pharmacokinetic (PK) samples on Day 1 (dosing day). In this conventional mean change to time-matched placebo analysis, the largest time-matched difference to placebo QTcI was 1.44 ms (90% CI: -4.04, 6.93 ms) for 500 mg; -0.39 ms (90% CI: -3.91, 3.13 ms) for 600 mg and 1.32 ms (90% CI: -1.89, 4.53 ms) for 800 mg of E-52862, thereby showing the absence of any QTc prolonging effect at the doses tested. In addition concentration-effect models, one based on the placebo corrected change from baseline and one for the change of QTcI from average baseline with time as fixed effect were fitted to the data confirming the results of the time course analysis. The sensitivity of this study to detect small changes in the QTc interval was confirmed by demonstrating a shortening of QTcF of -8.1 (90% CI: -10.4, -5.9) one hour and -7.2 (90% CI: -9.4, -5.0) three hours after a standardised meal. EU Clinical Trials Register EudraCT 2010 020343 13.

Pharmacokinetics and repolarization effects of intravenous and transdermal granisetron.

PubMed

Mason, Jay W; Selness, Daniel S; Moon, Thomas E; O'Mahony, Bridget; Donachie, Peter; Howell, Julian

2012-05-15

The need for greater clarity about the effects of 5-HT(3) receptor antagonists on cardiac repolarization is apparent in the changing product labeling across this therapeutic class. This study assessed the repolarization effects of granisetron, a 5-HT(3) receptor antagonist antiemetic, administered intravenously and by a granisetron transdermal system (GTDS). In a parallel four-arm study, healthy subjects were randomized to receive intravenous granisetron, GTDS, placebo, or oral moxifloxacin (active control). The primary endpoint was difference in change from baseline in mean Fridericia-corrected QT interval (QTcF) between GTDS and placebo (ddQTcF) on days 3 and 5. A total of 240 subjects were enrolled, 60 in each group. Adequate sensitivity for detection of QTc change was shown by a 5.75 ms lower bound of the 90% confidence interval (CI) for moxifloxacin versus placebo at 2 hours postdose on day 3. Day 3 ddQTcF values varied between 0.2 and 1.9 ms for GTDS (maximum upper bound of 90% CI, 6.88 ms), between -1.2 and 1.6 ms for i.v. granisetron (maximum upper bound of 90% CI, 5.86 ms), and between -3.4 and 4.7 ms for moxifloxacin (maximum upper bound of 90% CI, 13.45 ms). Day 5 findings were similar. Pharmacokinetic-ddQTcF modeling showed a minimally positive slope of 0.157 ms/(ng/mL), but a very low correlation (r = 0.090). GTDS was not associated with statistically or clinically significant effects on QTcF or other electrocardiographic variables. This study provides useful clarification on the effect of granisetron delivered by GTDS on cardiac repolarization. ©2012 AACR.

Atrioventricular depolarization differences identify coronary artery anomalies in Kawasaki disease.

PubMed

Cortez, Daniel; Sharma, Nandita; Jone, Pei-Ni

2017-03-01

Kawasaki disease (KD) is the leading cause of acquired heart disease in children. Signal average electrocardiogram changes in patients during the acute phase of KD with coronary artery anomalies (CAA) include depolarization changes. We set out to determine if 12-lead-derived atrioventricular depolarization differences can identify CAA in patients with KD. A blinded, retrospective case-control study of patients with KD was performed. Deep Q waves, corrected QT-intervals (QTc), spatial QRS-T angles, T-wave vector magnitudes (RMS-T), and a novel parameter for assessment of atrioventricular depolarization difference (the spatial PR angle) and a two dimensional PR angle were assessed. Comparisons between groups were performed to test for significant differences. One hundred one patients with KD were evaluated, with 68 having CAA (67.3%, mean age 3.6 ± 3.0 years, 82.6% male), and 32 without CAA (31.7%, mean age 2.7 ± 3.2 years, 70.4% male). The spatial PR angle significantly discriminated KD patients with CAA from those without, 59.7° ± 31.1° versus 41.6° ± 11.5° (p < .001). A spatial PR angle cutoff value of 56.9° gave positive/negative predictive values and odds ratios of 93.8%, 43.5%, and 11.5% (95% confidence interval (CI) 2.6-52.2). The two dimensional PR angle either below 7° or above 92° gave positive/negative predictive values and odds ratios of 100.0%, 38.8%, and 21.1% (95% CI 1.2-362.8). No other parameters significantly differentiated the groups. Atrioventricular depolarization differences, measured by the spatial or two dimensional PR angle differentiate KD patients with CAA versus those without. © 2016 Wiley Periodicals, Inc.

Method for Correction of Consequences of Radiation-Induced Heart Disease using Low-Intensity Electromagnetic Emission under Experimental Conditions.

PubMed

Bavrina, A P; Monich, V A; Malinovskaya, S L; Yakovleva, E I; Bugrova, M L; Lazukin, V F

2015-05-01

Effects of successive exposure to ionizing irradiation and low-intensity broadband red light on electrical activity of the heart and myocardium microstructure were studied in rats. Lowintensity red light corrected some ECG parameters, in particular, it normalized QT and QTc intervals and voltage of R and T waves. Changes in ECG parameters were followed by alterations in microstructure of muscle fi laments in the myocardium of treatment group animals comparing to control group.

Sleep-disordered breathing is associated with disturbed cardiac repolarization in patients with a coronary artery bypass graft surgery.

PubMed

Schmidleitner, Christina; Arzt, Michael; Tafelmeier, Maria; Ripfel, Sarah; Fauser, Miriam; Weizenegger, Teresa; Flörchinger, Bernhard; Camboni, Daniele; Wittmann, Sigrid; Zeman, Florian; Schmid, Christof; Maier, Lars S; Wagner, Stefan; Fisser, Christoph

2018-02-01

The development of malignant ventricular arrhythmias due to abnormal cardiac repolarization is a major complication after coronary artery bypass graft surgery (CABG). Sleep-disordered breathing (SDB) is linked to prolonged cardiac repolarization in non-surgical patients. This study evaluates cardiac repolarization in patients with and without SDB who underwent CABG. 100 patients who had received CABG (84% men, age 68 ± 10 years, body-mass-index [BMI] 28.7 ± 4.2 kg/m 2 ) were retrospectively evaluated. Polygraphy was recorded the night before CABG. SDB was defined as an apnea-hypopnea index (AHI) of ≥15/h and differentiated into central (CSA) and obstructive (OSA) sleep apnea. Cardiac repolarization was assessed by means of T-peak-to-end (TpTe) and QTc-intervals and TpTe/QT-ratios derived from 12-lead electrocardiography (ECG). 37% of patients had SDB, 14% CSA and 23% OSA. Before CABG, patients with CSA and OSA had longer TpTe intervals than those without SDB (TpTe: CSA 100 ± 26 vs. OSA 97 ± 19 vs. no SDB 85 ± 14 ms, p = 0.013). QTc intervals and TpTe/QT ratios differed between the two groups (QTc: 444 ± 54 vs. 462 ± 36 vs. 421 ± 32 ms, p < 0.001; TpTe/QT ratio: 0.24 ± 0.04 vs. 0.23 ± 0.05 vs. 0.21 ± 0.03, p = 0.045). SDB was associated with abnormal cardiac repolarization independent of known risk factors for cardiac arrhythmias, such as age, sex, BMI, N-terminal-pro-brain-natriuretic-peptide (NT-proBNP), and heart failure (TpTe: B-coefficient [95%CI]: 16.0, [7.6-24.3], p < 0.001; QTc: 27.2 [9.3-45.1], p = 0.003; TpTe/QT ratio: 2.9 [1.2-4.6], p < 0.001). Independent of known risk factors for cardiac arrhythmias, SDB was significantly associated with abnormal cardiac repolarization before CABG. Data suggest that SDB may contribute to an increased risk of ventricular arrhythmias after CABG. Copyright © 2018 Elsevier B.V. All rights reserved.

Risk management of QTc-prolongation in patients receiving haloperidol: an epidemiological study in a University hospital in Belgium.

PubMed

Vandael, Eline; Vandenberk, Bert; Vandenberghe, Joris; Spriet, Isabel; Willems, Rik; Foulon, Veerle

2016-04-01

Many drugs, including haloperidol, are linked with a risk of QTc-prolongation, which can lead to Torsade de Pointes and sudden cardiac death. To investigate the prevalence of concomitant risk factors for QTc-prolongation in patients treated with haloperidol, and the use of safety measures to minimize this risk. University Hospitals of Leuven, Belgium. Methods A retrospective epidemiological study was performed. On 15 consecutive Mondays, all patients with a prescription for haloperidol were included. A risk score for QTc-prolongation, inspired by the pro-QTc score of Haugaa et al., was calculated based on gender, comorbidities, lab results and concomitant QTc-prolonging drugs (each factor counting for one point). Available electrocardiograms before and during the treatment of haloperidol were registered. Management of the risk of QTc-prolongation. Two hundred twenty-two patients were included (59.0 % men, median age 77 years) of whom 26.6 % had a risk score of ≥4 (known to significantly increase the mortality). Overall, 24.3 % received haloperidol in combination with other drugs with a known risk of Torsade de Pointes. Half of the patients had an electrocardiogram in the week before the start of haloperidol; only in one-third a follow-up electrocardiogram during haloperidol treatment was performed. Of the patients with a moderately (n = 41) or severely (n = 14) prolonged QTc-interval before haloperidol, 48.8 % and 42.9 % respectively had a follow-up electrocardiogram. In patients with a risk score ≥4, significantly more electrocardiograms were taken before starting haloperidol (p = 0.020). Although many patients had risk factors for QTc-prolongation (including the use of other QTc-prolonging drugs) or had a prolonged QTc on a baseline electrocardiogram, follow-up safety measures were limited. Persistent efforts should be taken to develop decision support systems to manage this risk.

Can non‐clinical repolarization assays predict the results of clinical thorough QT studies? Results from a research consortium

PubMed Central

Park, Eunjung; Gintant, Gary A; Bi, Daoqin; Kozeli, Devi; Pettit, Syril D; Skinner, Matthew; Willard, James; Wisialowski, Todd; Koerner, John; Valentin, Jean‐Pierre

2018-01-01

Background and Purpose Translation of non‐clinical markers of delayed ventricular repolarization to clinical prolongation of the QT interval corrected for heart rate (QTc) (a biomarker for torsades de pointes proarrhythmia) remains an issue in drug discovery and regulatory evaluations. We retrospectively analysed 150 drug applications in a US Food and Drug Administration database to determine the utility of established non‐clinical in vitro IKr current human ether‐à‐go‐go‐related gene (hERG), action potential duration (APD) and in vivo (QTc) repolarization assays to detect and predict clinical QTc prolongation. Experimental Approach The predictive performance of three non‐clinical assays was compared with clinical thorough QT study outcomes based on free clinical plasma drug concentrations using sensitivity and specificity, receiver operating characteristic (ROC) curves, positive (PPVs) and negative predictive values (NPVs) and likelihood ratios (LRs). Key Results Non‐clinical assays demonstrated robust specificity (high true negative rate) but poor sensitivity (low true positive rate) for clinical QTc prolongation at low‐intermediate (1×–30×) clinical exposure multiples. The QTc assay provided the most robust PPVs and NPVs (ability to predict clinical QTc prolongation). ROC curves (overall test accuracy) and LRs (ability to influence post‐test probabilities) demonstrated overall marginal performance for hERG and QTc assays (best at 30× exposures), while the APD assay demonstrated minimal value. Conclusions and Implications The predictive value of hERG, APD and QTc assays varies, with drug concentrations strongly affecting translational performance. While useful in guiding preclinical candidates without clinical QT prolongation, hERG and QTc repolarization assays provide greater value compared with the APD assay. PMID:29181850

High Resolution ECG for Evaluation of QT Interval Variability during Exposure to Acute Hypoxia

NASA Technical Reports Server (NTRS)

Zupet, P.; Finderle, Z.; Schlegel, Todd T.; Starc, V.

2010-01-01

Ventricular repolarization instability as quantified by the index of QT interval variability (QTVI) is one of the best predictors for risk of malignant ventricular arrhythmias and sudden cardiac death. Because it is difficult to appropriately monitor early signs of organ dysfunction at high altitude, we investigated whether high resolution advanced ECG (HR-ECG) analysis might be helpful as a non-invasive and easy-to-use tool for evaluating the risk of cardiac arrhythmias during exposure to acute hypoxia. 19 non-acclimatized healthy trained alpinists (age 37, 8 plus or minus 4,7 years) participated in the study. Five-minute high-resolution 12-lead electrocardiograms (ECGs) were recorded (Cardiosoft) in each subject at rest in the supine position breathing room air and then after breathing 12.5% oxygen for 30 min. For beat-to-beat RR and QT variability, the program of Starc was utilized to derive standard time domain measures such as root mean square of the successive interval difference (rMSSD) of RRV and QTV, the corrected QT interval (QTc) and the QTVI in lead II. Changes were evaluated with paired-samples t-test with p-values less than 0.05 considered statistically significant. As expected, the RR interval and its variability both decreased with increasing altitude, with p = 0.000 and p = 0.005, respectively. Significant increases were found in both the rMSSDQT and the QTVI in lead II, with p = 0.002 and p = 0.003, respectively. There was no change in QTc interval length (p = non significant). QT variability parameters may be useful for evaluating changes in ventricular repolarization caused by hypoxia. These changes might be driven by increases in sympathetic nervous system activity at ventricular level.

ECG-ViEW II, a freely accessible electrocardiogram database

PubMed Central

Park, Man Young; Lee, Sukhoon; Jeon, Min Seok; Yoon, Dukyong; Park, Rae Woong

2017-01-01

The Electrocardiogram Vigilance with Electronic data Warehouse II (ECG-ViEW II) is a large, single-center database comprising numeric parameter data of the surface electrocardiograms of all patients who underwent testing from 1 June 1994 to 31 July 2013. The electrocardiographic data include the test date, clinical department, RR interval, PR interval, QRS duration, QT interval, QTc interval, P axis, QRS axis, and T axis. These data are connected with patient age, sex, ethnicity, comorbidities, age-adjusted Charlson comorbidity index, prescribed drugs, and electrolyte levels. This longitudinal observational database contains 979,273 electrocardiograms from 461,178 patients over a 19-year study period. This database can provide an opportunity to study electrocardiographic changes caused by medications, disease, or other demographic variables. ECG-ViEW II is freely available at http://www.ecgview.org. PMID:28437484

The electrocardiogram of athletes Comparison with untrained subjects1

PubMed Central

Van Ganse, W.; Versee, L.; Eylenbosch, W.; Vuylsteek, K.

1970-01-01

The resting electrocardiograms of 30 cyclists currently involved in competitive sport were compared with those of an equal number of healthy controls matched for age, height, and weight. The cyclists had significantly lower heart rates, longer PQ,QRS, and QTc intervals, higher T waves in lead II, left axis deviation of the T wave, higher R waves in the right and deeper S waves in the left praecordial leads, and deeper S waves in the right and higher R waves in the left praecordial leads. The possible significance of these findings should be assessed by prolonged prospective studies in athletes and untrained control subjects. PMID:4245411

A question about the potential cardiac toxicity of escitalopram.

PubMed

Howland, Robert H

2012-04-01

Previous reviews have focused on the potential cardiac toxicity of the racemic drug citalopram (Celexa(®)). Evaluating the safety of escitalopram (Lexapro(®)) is an important issue to consider, since it is the S-enantiomer of citalopram. Escitalopram has a small effect on the QTc interval. A prolonged QTc was seen in 2% to 14% of escitalopram overdose cases, without serious cardiac sequelae. The QTc prolongation effect of citalopram in beagle dogs has been attributed to the minor metabolite racemic didemethylcitalopram (DDCT). Whether the escitalopram minor metabolite S-DDCT has this effect is not known. Concentrations of S-DDCT are lower than DDCT, but for a broad range of doses of escitalopram and citalopram, the S-DDCT and DDCT concentrations are well below the QTc prolonging concentrations reported in dogs. There is no strong evidence from human and animal studies that the cardiac safety of escitalopram is significantly superior to that of citalopram. Copyright 2012, SLACK Incorporated.

Electocardiographic findings in adult Nigerians with sickle cell anaemia.

PubMed

Oguanobi, N I; Onwubere, B J C; Ike, S O; Anisiuba, B C; Ejim, E C; Ibegbulam, O G

2010-09-01

Cardiovascular system abnormalities are common causes of morbidity and mortality in sickle cell anaemia. The study aims at determining the pattern of electrocardiographic changes in adult Nigerian sickle cell anaemia patients. A descriptive cross sectional study was done on sixty sickle cell anaemia patients seen at the adult sickle cell clinic of University of Nigeria Teaching Hospital (UNTH) Enugu, and sixty age and sex matched normal controls. All the subjects had clinical evaluation as well as electrocardiographic examination. The mean heart rate, P-wave duration, P-wave dispersion, PR interval, QRS duration, QRS dispersion, QTc interval and QTc dispersion were significantly higher in the patients than in the control group. Electrocardiographic abnormalities identified by this study were: left ventricular hypertrophy (75%; 1.7%), left atrial enlargement (40%; 0%), biventricular hypertrophy (11%; 0), ST-segment elevation (10%; 0%) and increased P-wave and QTc dispersions. ST segment elevation was found more in patients with moderate and severe anaemia (P= 0.02, Spearman correlation r= 0.342; P= 0.007), Sickle cell anaemia is associated with significant electrocardiographic abnormalities. Further prospective studies are recommended to evaluate the prognostic significance of the electrocardiographic intervals dispersion on the long term disease outcome in sickle cell anaemia.

Analysis of Relationship between Levofloxacin and Corrected QT Prolongation Using a Clinical Data Warehouse

PubMed Central

Park, Man Young; Kim, Eun Yeob; Lee, Young Ho; Kim, Woojae; Kim, Ku Sang; Sheen, Seung Soo; Lim, Hong Seok

2011-01-01

Objective The aim of this study was to examine whether or not levofloxacin has any relationship with QT prolongation in a real clinical setting by analyzing a clinical data warehouse of data collected from different hospital information systems. Methods Electronic prescription data and medical charts from 3 different hospitals spanning the past 9 years were reviewed, and a clinical data warehouse was constructed. Patients who were both administrated levofloxacin and given electrocardiograms (ECG) were selected. The correlations between various patient characteristics, concomitant drugs, corrected QT (QTc) prolongation, and the interval difference in QTc before and after levofloxacin administration were analyzed. Results A total of 2,176 patients from 3 different hospitals were included in the study. QTc prolongation was found in 364 patients (16.7%). The study revealed that age (OR 1.026, p < 0.001), gender (OR 0.676, p = 0.007), body temperature (OR 1.267, p = 0.024), and cigarette smoking (OR 1.641, p = 0.022) were related with QTc prolongation. After adjusting for related factors, 12 drugs concomitant with levofloxacin were associated with QTc prolongation. For patients who took ECGs before and after administration of levofloxacin during their hospitalization (n = 112), there was no significant difference in QTc prolongation. Conclusions The age, gender, body temperature, cigarette smoking and various concomitant drugs might be related with QTc prolongation. However, there was no definite causal relationship or interaction between levofloxacin and QTc prolongation. Alternative surveillance methods utilizing the massive accumulation of electronic medical data seem to be essential to adverse drug reaction surveillance in future. PMID:21818458

Cumulative high doses of inhaled formoterol have less systemic effects in asthmatic children 6–11 years-old than cumulative high doses of inhaled terbutaline

PubMed Central

Kaae, Rikke; Agertoft, Lone; Pedersen, Sören; Nordvall, S Lennart; Pedroletti, Christophe; Bengtsson, Thomas; Johannes-Hellberg, Ingegerd; Rosenborg, Johan

2004-01-01

Objectives To evaluate high dose tolerability and relative systemic dose potency between inhaled clinically equipotent dose increments of formoterol and terbutaline in children. Methods Twenty boys and girls (6–11 years-old) with asthma and normal ECGs were studied. Ten doses of formoterol (Oxis®) 4.5 µg (F4.5) or terbutaline (Bricanyl®) 500 µg (T500) were inhaled cumulatively via a dry powder inhaler (Turbuhaler®) over 1 h (three patients) or 2.5 h (17 patients) and compared to a day of no treatment, in a randomised, double-blind (active treatments only), crossover trial. Blood pressure (BP), ECG, plasma potassium, glucose, lactate, and adverse events were monitored up to 10 h to assess tolerability and relative systemic dose potency. Results Formoterol and terbutaline had significant β2-adrenergic effects on most outcomes. Apart from the effect on systolic BP, QRS duration and PR interval, the systemic effects were significantly more pronounced with terbutaline than with formoterol. Thus, mean minimum plasma potassium, was suppressed from 3.56 (95% confidence interval, CI: 3.48–3.65) mmol l−1 on the day of no treatment to 2.98 (CI: 2.90–3.08) after 10 × F4.5 and 2.70 (CI: 2.61–2.78) mmol l−1 after 10 × T500, and maximum Q-Tc (heart rate corrected Q-T interval [Bazett's formula]) was prolonged from 429 (CI: 422–435) ms on the day of no treatment, to 455 (CI: 448–462) ms after 10 × F4.5 and 470 (CI: 463–476) ms after 10 × T500. Estimates of relative dose potency indicated that F4.5 µg had the same systemic activity as the clinically less effective dose of 250 µg terbutaline. The duration of systemic effects differed marginally between treatments. Spontaneously reported adverse events (most frequently tremor) were fewer with formoterol (78% of the children) than with terbutaline (95%). A serious adverse event occurred after inhalation of 45 µg formoterol over the 1 h dosing time, that prompted the extension of dosing time to 2.5 h. Conclusions Multiple inhalations over 2.5 h of formoterol (4.5 µg) via Turbuhaler® are at least as safe as and associated with less systemic effects than multiple inhalations of the clinically equipotent dose of terbutaline (500 µg) in children with asthma. PMID:15373934

Cumulative high doses of inhaled formoterol have less systemic effects in asthmatic children 6-11 years-old than cumulative high doses of inhaled terbutaline.

PubMed

Kaae, Rikke; Agertoft, Lone; Pedersen, Sören; Nordvall, S Lennart; Pedroletti, Christophe; Bengtsson, Thomas; Johannes-Hellberg, Ingegerd; Rosenborg, Johan

2004-10-01

To evaluate high dose tolerability and relative systemic dose potency between inhaled clinically equipotent dose increments of formoterol and terbutaline in children. Twenty boys and girls (6-11 years-old) with asthma and normal ECGs were studied. Ten doses of formoterol (Oxis) 4.5 microg (F4.5) or terbutaline (Bricanyl) 500 microg (T500) were inhaled cumulatively via a dry powder inhaler (Turbuhaler) over 1 h (three patients) or 2.5 h (17 patients) and compared to a day of no treatment, in a randomised, double-blind (active treatments only), crossover trial. Blood pressure (BP), ECG, plasma potassium, glucose, lactate, and adverse events were monitored up to 10 h to assess tolerability and relative systemic dose potency. Formoterol and terbutaline had significant beta2-adrenergic effects on most outcomes. Apart from the effect on systolic BP, QRS duration and PR interval, the systemic effects were significantly more pronounced with terbutaline than with formoterol. Thus, mean minimum plasma potassium, was suppressed from 3.56 (95% confidence interval, CI: 3.48-3.65) mmol l(-1) on the day of no treatment to 2.98 (CI: 2.90-3.08) after 10 x F4.5 and 2.70 (CI: 2.61-2.78) mmol l(-1) after 10 x T500, and maximum Q-Tc (heart rate corrected Q-T interval [Bazett's formula]) was prolonged from 429 (CI: 422-435) ms on the day of no treatment, to 455 (CI: 448-462) ms after 10 x F4.5 and 470 (CI: 463-476) ms after 10 x T500. Estimates of relative dose potency indicated that F4.5 microg had the same systemic activity as the clinically less effective dose of 250 microg terbutaline. The duration of systemic effects differed marginally between treatments. Spontaneously reported adverse events (most frequently tremor) were fewer with formoterol (78% of the children) than with terbutaline (95%). A serious adverse event occurred after inhalation of 45 microg formoterol over the 1 h dosing time, that prompted the extension of dosing time to 2.5 h. Multiple inhalations over 2.5 h of formoterol (4.5 microg) via Turbuhaler) are at least as safe as and associated with less systemic effects than multiple inhalations of the clinically equipotent dose of terbutaline (500 microg) in children with asthma. Copyright 2004 Blackwell Publishing Ltd

Electrocardiographic and blood pressure effects of energy drinks and Panax ginseng in healthy volunteers: A randomized clinical trial.

PubMed

Shah, Sachin A; Occiano, Andrew; Nguyen, Tinh An; Chan, Amanda; Sky, Joseph C; Bhattacharyya, Mouchumi; O'Dell, Kate M; Shek, Allen; Nguyen, Nancy N

2016-09-01

Energy drink usage has been linked to emergency room visits and deaths. The objective of the study is to assess the electrocardiographic and blood pressure effects of energy drinks, Panax ginseng and placebo in healthy individuals. This was a randomized, double blinded, placebo controlled, crossover study. Young healthy volunteers with no comorbid conditions consumed 32oz of an energy drink, control drink with 800mg of Panax ginseng or matching placebo-control drink over 45min. Primary endpoints were QTc interval and systolic blood pressure. Secondary endpoints included QT interval, PR interval, QRS duration, heart rate, and diastolic blood pressure. All endpoints were assessed at baseline, 1, 2, 3.5, and 5.5h. A significant increase in QTc interval 2h post energy drink consumption was evident when compared to placebo (3.37±10.7ms and -3.19±11.8ms respectively; p=0.030). Similarly, systolic blood pressure 2h post energy drink consumption increased when compared to placebo (2.00±6.37mmHg and -2.67±5.83mmHg respectively; p=0.014). The PR interval significantly reduced over a 2h period post energy drink use in a clinically non-meaningful manner. Heart rate at 2h was not significantly higher in the energy drink group when compared to others. The QT interval, QRS interval and diastolic blood pressure were not impacted at any time point. Certain energy drinks consumed at a high volume significantly increase the QTc interval and systolic blood pressure by over 6ms and 4mmHg respectively. Panax ginseng does not have a significant impact on ECG or blood pressure parameters. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

[Electrocardiographic abnormalities in acute olanzapine poisonings].

PubMed

Ciszowski, Krzysztof; Sein Anand, Jacek

2011-01-01

Olanzapine is an atypical antipsychotic used for many years in the treatment of schizophrenia and bipolar disorder. Poisonings with this medicine can results with cardiotoxic effects in the form of ECG abnormalities. To evaluate the nature and incidence of electrocardiographic abnormalities in patients with acute olanzapine poisoning. 23 adult (mean age 38.4 +/- 15.5 years) patients with acute olanzapine poisoning, including 10 men (30.4 +/- 8.1 years) and 11 women (45.7 +/- 17.2 years), where 1 man and 1 woman were poisoned twice. The toxic serum level of olanzapine (above 100 ng/mL) was confirmed in each patient. Evaluation of electrocardiograms performed in patients in the first day of hospitalization with automatic measurement of durations of PQ, QRS and QTc and the identification of arrhythmias and conduction disorders on the basis of visual analysis of the ECG waveforms. Statistical analysis of the results using the methods of descriptive statistics. The mean durations of PQ, QRS and QTc in the study group were as follows: 135 +/- 23 ms, 91 +/- 12 ms, and 453 +/- 48 ms, respectively. The most common ECG abnormalities were prolonged QTc and supraventricular tachycardia (including sinus tachycardia) - each 22%; less common were ST-T changes (17%) and supraventricular premature complexes (9%), and only in individual cases (4%) ventricular premature complexes, bundle branch block, sinus bradycardia and atrial fibrillation were present. In the course of acute olanzapine poisonings: (1) prolonged QTc interval is quite common, but rarely leads to torsade de pointes tachycardia; (2) fast supraventricular rhythms are also common, but rarely cause irregular tachyarrhythmias, eg. atrial fibrillation; (3) conduction disorders (atrioventricular blocks, bundle branch blocks) are not typical abnormalities; (4) the observed ECG abnormalities emphasize the need of continuous ECG monitoring in these patients.

Electrocardiographic consequences of cardiac iron overload in thalassemia major

PubMed Central

Detterich, Jon; Noetzli, Leila; Dorey, Fred; Bar-Cohen, Yaniv; Harmatz, Paul; Coates, Thomas; Wood, John

2011-01-01

Background Iron cardiomyopathy is a leading cause of death in transfusion dependent thalassemia major (TM) patients and MRI (T2*) can recognize preclinical cardiac iron overload, but, is unavailable to many centers. Design and Methods We evaluated the ability of 12-lead electrocardiography to predict cardiac iron loading in TM. 12-lead electrocardiogram and cardiac T2* measurements were performed prospectively, with a detectable cardiac iron cutoff of T2*less than 20 ms. Patients with and without cardiac iron were compared using two-sample statistics and against population norms using age and gender-matched Z-scores. Results 45/78 patients had detectable cardiac iron. Patients having cardiac iron were older and more likely female but had comparable liver iron burdens and serum ferritin. Increased heart rate (HR) and prolonged corrected QT interval (QTc) were present, regardless of cardiac iron status. Repolarization abnormalities were the strongest predictors of cardiac iron, including QT/QTc prolongation, left shift of T-wave axis, and interpretation of ST/T-wave morphology. Recursive partitioning of the data for females using T-axis and HR and for males using QT, HR and T-axis produced algorithms with AUROC’s of 88.3 and 87.1 respectively. Conclusions Bradycardia and repolarization abnormalities on 12-lead electrocardiography were the most specific markers for cardiac iron in thalassemia major. Changes in these variables may be helpful to stratify cardiac risk when cardiac MRI is unavailable. However, diagnostic algorithms need to be vetted on larger and more diverse patient populations and longitudinal studies are necessary to determine reversibility of the observed abnormalities. PMID:22052662

Evaluation of clinical and electrocardiographic changes during the euthanasia of horses.

PubMed

Buhl, R; Andersen, L O F; Karlshøj, M; Kanters, J K

2013-06-01

The objective of this prospective field study was to investigate whether commonly used criteria for clinical death occurred at the same time as cardiac death, as determined by electrocardiography. Specific ECG changes during euthanasia were also studied. Twenty-nine horses were euthanized with pentobarbital at two different dose rates and 15 of the 29 horses also received detomidine hydrochloride for sedation. ECG was recorded prior to and during euthanasia. Time to collapse, cessation of reflexes, heart sounds and asystole were recorded. ECG recordings were used to calculate RR intervals, PQ duration, QRS duration, distance from QRS complex to end of T wave corrected for HR (QTc interval), duration of T-wave from peak to end (TpeakTend) and amplitudes of T wave (Tpeak) before and during euthanasia. Differences between groups and ECG changes were evaluated using analysis of variance. Clinical determination of death occurred before cardiac death (P<0.05). Sedated horses took longer to collapse than unsedated horses (P<0.0001), but asystole occurred faster in sedated horses (P<0.0001). No significant changes in QRS duration were observed, but RR, PQ, QTc, TpeakTend and Tpeak were influenced by both pentobarbital dose and sedation (P<0.05-<0.0001). In conclusion, sedation prior to euthanasia resulted in a shorter time to asystole and is therefore recommended for the euthanasia of horses. Importantly, the results show that the clinical definition of death occurred significantly earlier than cardiac death (defined as asystole), which indicates that the clinical declaration of death in horses could be premature compared to that used in humans. Copyright © 2012 Elsevier Ltd. All rights reserved.

Relationships between QT interval and heart rate variability at rest and the covariates in healthy young adults.

PubMed

Arai, Kaori; Nakagawa, Yui; Iwata, Toyoto; Horiguchi, Hyogo; Murata, Katsuyuki

2013-01-01

To clarify the links between ECG QT-related parameters and heart rate variability (HRV) and the covariates possibly distorting them, the averaged RR and QT intervals in a single lead ECG were measured for 64 male and 86 female subjects aged 18-26. The QT index, defined by Rautaharju et al., in the young adults was not significantly related to any HRV parameters nor heart rate, but the Bazett's corrected QT (QTc) interval was associated negatively with the parasympathetic activity and positively with heart rate. No significant differences in the QTc interval, QT index or heart rate were seen between the men and women, but they significantly differed between both sexes after adjustment for possible covariates such as age and body mass index (BMI). Significant sex differences in parasympathetic parameters of the HRV were unchanged before and after the adjustment, but significant differences observed in the unadjusted sympathetic parameters disappeared after adjusting for covariates. Age, BMI and body fat percentage also were significant covariates affecting these ECG parameters. Consequently, QT index, unaffected by heart rate and HRV parameters, appears to be a more useful indicator than the QTc interval. Instead, the QT index and HRV parameters are recommended to be simultaneously measured in epidemiological research because they are probably complementary in assessing autonomic nervous function. Also, these parameters should be analyzed in men and women separately. Copyright © 2012 Elsevier B.V. All rights reserved.

QT Interval Prolongation and QRS Voltage Reduction in Patients with Liver Cirrhosis.

PubMed

Cichoż-Lach, Halina; Tomaszewski, Michał; Kowalik, Agnieszka; Lis, Emilia; Tomaszewski, Andrzej; Lach, Tomasz; Boczkowska, Sylwia; Celiński, Krzysztof

2015-01-01

Liver cirrhosis is associated with functional abnormalities of the cardiovascular system with co-existing electrocardiographic (ECG) abnormalities. The aim was to analyze ECG changes in patients with cirrhosis, to evaluate whether alcoholic etiology of cirrhosis and ascites has an impact on ECG changes. The study involved 81 patients with previously untreated alcoholic cirrhosis (64 patients with ascites, classes B and C according to the Child-Pugh classification; and 17 without ascites, categorized as class A); 41 patients with previously untreated cirrhosis due to chronic hepatitis C (HCV--30 patients with ascites, classes B and C; and 11 without ascites, class A); 42 with alcoholic steatohepatitis and 46 with alcoholic steatosis. The control group consisted of 32 healthy volunteers. Twelve-lead ECG recordings were performed and selected parameters were measured. Significantly longer QT and QTc intervals and lower QRS voltage were found in patients with alcoholic and HCV cirrhosis compared to the controls. Significantly lower QRS voltage was found in subjects with ascites than in those without ascites. Removal of ascites significantly increased QRS voltage. In cirrhosis, irrespective of etiology, ECG changes involved prolonged QT and QTc intervals and reduced QRS voltage. Prolonged QT and QTc intervals were not related to the severity of cirrhosis or to the presence of ascites. However, low QRS voltage was associated with the presence of ascites. Removal of ascites reverses low QRS voltage.

Alterations of Blood Pressure and ECG following Two-Week Consumption of Berberis integerrima Fruit Extract

PubMed Central

Mahdavi, Naser

2014-01-01

In light of the popularity and also the various nutritional and medicinal properties of Berberis integerrima, this study was conducted to assess the influence of its aqueous extract on hemodynamic and electrocardiogram (ECG) indices of rat. Animals were divided to control (CTL), B50, B100, and B200 groups that orally received tap water, aqueous extracts of B. integerrima fruit 50, 100, and 200 mg/kg/day, respectively, for two weeks and on day 15, data were recorded. Different doses of barberry fruit extract had no significant effect on blood pressure, heart rate, RR interval, P duration, and Q wave amplitude of electrocardiogram. Extract administration was associated with an incremental trend in PR interval that was not statistically significant. Higher doses (100 and 200 mg/kg) of extract significantly increased the QRS interval (P < 0.01 versus CTL and B50 groups) but decreased the QTc interval (P < 0.01 versus CTL group and P < 0.001 versus B50 group), the JT interval, and TpTe interval (P < 0.001 versus CTL and B50 groups). The results suggest that high doses of barberry extract definitely prolong the depolarization phase and shorten the repolarization phase of ventricular muscle and hence induce alteration in heart electrical conductivity. PMID:27351000

Mianserin, maprotiline and intracardiac conduction

PubMed Central

Edwards, J. Guy; Goldie, Ann

1983-01-01

1 High speed surface electrocardiograms were recorded in 35 patients during the baseline and after four weeks' treatment in a placebo-controlled trial of mianserin and maprotiline in primary depressive illness. 2 Measurements of the RR, PR and QT intervals, QRS width and T wave height were made blind to patient, drug and treatment interval and compared with plasma drug concentrations. The presence or absence of cardiac arrhythmias was recorded. 3 The only significant findings were an increased heart rate and PR interval and decreased QTc interval in the maprotiline group. Only one patient receiving maprotiline had a cardiac arrhythmia. There was no significant correlation between measurements of ECG parameters and plasma drug levels. 4 The results confirm the lack of cardiac effects of mianserin and show both anticholinergic activity and effects of an intracardiac conduction in the case of maprotiline. The mechanisms of these effects are discussed. PMID:6824556

Analyzing Thorough QT Study 1 & 2 in the Telemetric and Holter ECG Warehouse (THEW) using Hannover ECG System HES : A validation study.

PubMed

Khawaja, A; Petrovic, R; Safer, A; Baas, T; Dössel, O; Fischer, R

2010-01-01

Following the ICH E14 clinical evaluation guideline [1], the measurement of QT/QTc interval prolongation has become the standard surrogate biomarker for cardiac drug safety assessment and the faith of a drug development. In Thorough QT (TQT) study, a so-called positive control is employed to assess the ability of this study to detect the endpoint of interest, i.e. the QT prolongation by about five milliseconds. In other words the lower bound of the one-sided 95% confidence interval (CI) must be above 0 [ms]. Fully automated detection of ECG fiducial points and measurement of the corresponding intervals including QT intervals and RR intervals vary between different computerized algorithms. In this work we demonstrate the ability and reliability of Hannover ECG System (HES(®)) to assess drug effects by detecting QT/QTc prolongation effects that meet the threshold of regulatory concern as mentioned by using THEW database studies namely TQT studies one and two.

Characterization of Myocardial Repolarization Reserve in Adolescent Females With Anorexia Nervosa.

PubMed

Padfield, Gareth J; Escudero, Carolina A; DeSouza, Astrid M; Steinberg, Christian; Gibbs, Karen; Puyat, Joseph H; Lam, Pei Yoong; Sanatani, Shubhayan; Sherwin, Elizabeth; Potts, James E; Sandor, George; Krahn, Andrew D

2016-02-09

Patients with anorexia nervosa exhibit abnormal myocardial repolarization and are susceptible to sudden cardiac death. Exercise testing is useful in unmasking QT prolongation in disorders associated with abnormal repolarization. We characterized QT adaptation during exercise in anorexia. Sixty-one adolescent female patients with anorexia nervosa and 45 age- and sex-matched healthy volunteers performed symptom-limited cycle ergometry during 12-lead ECG monitoring. Changes in the QT interval during exercise were measured, and QT/RR-interval slopes were determined by using mixed-effects regression modeling. Patients had significantly lower body mass index than controls; however, resting heart rates and QT/QTc intervals were similar at baseline. Patients had shorter exercise times (13.7±4.5 versus 20.6±4.5 minutes; P<0.001) and lower peak heart rates (159±20 versus 184±9 beats/min; P<0.001). The mean QTc intervals were longer at peak exercise in patients (442±29 versus 422±19 ms; P<0.001). During submaximal exertion at comparable heart rates (114±6 versus 115±11 beats/min; P=0.54), the QTc interval had prolonged significantly more in patients than controls (37±28 versus 24±25 ms; P<0.016). The RR/QT slope, best described by a curvilinear relationship, was more gradual in patients than in controls (13.4; 95% confidence interval, 12.8-13.9 versus 15.8; 95% confidence interval, 15.3-16.4 ms QT change per 10% change in RR interval; P<0.001) and steepest in patients within the highest body mass index tertile versus the lowest (13.9; 95% confidence interval, 12.9-14.9 versus 12.3; 95% confidence interval, 11.3-13.3; P=0.026). Despite the absence of manifest QT prolongation, adolescent anorexic females have impaired repolarization reserve in comparison with healthy controls. Further study may identify impaired QT dynamics as a risk factor for arrhythmias in anorexia nervosa. © 2016 American Heart Association, Inc.

Tafenoquine at therapeutic concentrations does not prolong fridericia-corrected QT interval in healthy subjects

PubMed Central

Green, Justin A; Patel, Apurva K; Patel, Bela R; Hussaini, Azra; Harrell, Emma J; McDonald, Mirna J; Carter, Nick; Mohamed, Khadeeja; Duparc, Stephan; Miller, Ann K

2014-01-01

Tafenoquine is being developed for relapse prevention in Plasmodium vivax malaria. This Phase I, single-blind, randomized, placebo- and active-controlled parallel group study investigated whether tafenoquine at supratherapeutic and therapeutic concentrations prolonged cardiac repolarization in healthy volunteers. Subjects aged 18–65 years were randomized to one of five treatment groups (n = 52 per group) to receive placebo, tafenoquine 300, 600, or 1200 mg, or moxifloxacin 400 mg (positive control). Lack of effect was demonstrated if the upper 90% CI of the change from baseline in QTcF following supratherapeutic tafenoquine 1200 mg versus placebo (ΔΔQTcF) was <10 milliseconds for all pre-defined time points. The maximum ΔΔQTcF with tafenoquine 1200 mg (n = 50) was 6.39 milliseconds (90% CI 2.85, 9.94) at 72 hours post-final dose; that is, lack of effect for prolongation of cardiac depolarization was demonstrated. Tafenoquine 300 mg (n = 48) or 600 mg (n = 52) had no effect on ΔΔQTcF. Pharmacokinetic/pharmacodynamic modeling of the tafenoquine–QTcF concentration–effect relationship demonstrated a shallow slope (0.5 ms/μg mL–1) over a wide concentration range. For moxifloxacin (n = 51), maximum ΔΔQTcF was 8.52 milliseconds (90% CI 5.00, 12.04), demonstrating assay sensitivity. In this thorough QT/QTc study, tafenoquine did not have a clinically meaningful effect on cardiac repolarization. PMID:24700490

Tafenoquine at therapeutic concentrations does not prolong Fridericia-corrected QT interval in healthy subjects.

PubMed

Green, Justin A; Patel, Apurva K; Patel, Bela R; Hussaini, Azra; Harrell, Emma J; McDonald, Mirna J; Carter, Nick; Mohamed, Khadeeja; Duparc, Stephan; Miller, Ann K

2014-09-01

Tafenoquine is being developed for relapse prevention in Plasmodium vivax malaria. This Phase I, single-blind, randomized, placebo- and active-controlled parallel group study investigated whether tafenoquine at supratherapeutic and therapeutic concentrations prolonged cardiac repolarization in healthy volunteers. Subjects aged 18-65 years were randomized to one of five treatment groups (n = 52 per group) to receive placebo, tafenoquine 300, 600, or 1200 mg, or moxifloxacin 400 mg (positive control). Lack of effect was demonstrated if the upper 90% CI of the change from baseline in QTcF following supratherapeutic tafenoquine 1200 mg versus placebo (ΔΔQTcF) was <10 milliseconds for all pre-defined time points. The maximum ΔΔQTcF with tafenoquine 1200 mg (n = 50) was 6.39 milliseconds (90% CI 2.85, 9.94) at 72 hours post-final dose; that is, lack of effect for prolongation of cardiac depolarization was demonstrated. Tafenoquine 300 mg (n = 48) or 600 mg (n = 52) had no effect on ΔΔQTcF. Pharmacokinetic/pharmacodynamic modeling of the tafenoquine-QTcF concentration-effect relationship demonstrated a shallow slope (0.5 ms/μg mL(-1) ) over a wide concentration range. For moxifloxacin (n = 51), maximum ΔΔQTcF was 8.52 milliseconds (90% CI 5.00, 12.04), demonstrating assay sensitivity. In this thorough QT/QTc study, tafenoquine did not have a clinically meaningful effect on cardiac repolarization. © 2014, The American College of Clinical Pharmacology.

Cardiovascular effects of fenoterol under conditions of hypoxaemia.

PubMed Central

Bremner, P; Burgess, C D; Crane, J; McHaffie, D; Galletly, D; Pearce, N; Woodman, K; Beasley, R

1992-01-01

BACKGROUND: The reason for the association of increased risk of death with fenoterol in patients with asthma in New Zealand is unknown but may relate to its cardiovascular effects. Most deaths from asthma occur outside hospital, where hypoxaemia is likely to be a complicating factor. The cardiovascular effects of fenoterol have been investigated therefore under conditions of normoxaemia and hypoxaemia. METHOD: Eight healthy men were studied on two occasions. Measurements of heart rate, blood pressure, total electromechanical systole (QS2I), electrocardiographic QTc interval, cardiac index, stroke volume, and ejection fraction were made under conditions of normoxaemia and hypoxaemia (arterial oxygen saturation 90%) before and after administration of 800 micrograms of fenoterol by a metered dose inhaler. The order in which treatments were applied was according to a Latin square design. RESULTS: Before inhalation of fenoterol hypoxaemia was associated with a significant increase in heart rate (8 beats/min) and QTc interval (15.6 ms). Under conditions of normoxaemia fenoterol caused a significant increase in heart rate (14.3 beats/min), systolic blood pressure (7.7 mm Hg), stroke volume (27.7 ml), cardiac index (1.6 1/min/m2), ejection fraction (11.48), and QTc interval (32.9 ms) and a fall in QS2I (-23.2 ms) and diastolic blood pressure (-8.4 mm Hg). Under conditions of hypoxaemia the changes after inhalation of fenoterol were similar to those recorded during normoxaemia; thus the effects of hypoxaemia and fenoterol were additive (heart rate 21.9 beats/min, QTc 43.5 ms with fenoterol and hypoxaemia). CONCLUSION: The chronotropic and electrophysiological effects of fenoterol were enhanced by conditions of hypoxaemia. PMID:1481183

[Effect of down-regulation of IKs repolarization-reserve on ventricular arrhythmogenesis in a guinea pig model of cardiac hypertrophy].

PubMed

Wang, Hegui; Huang, Ting; Wang, Zheng; Ge, Nannan; Ke, Yongsheng

2018-04-28

To observe the changes of rapidly activated delayed rectifier potassium channel (IKr) and slowly activated delayed rectifier potassium channel (IKs) in cardiac hypertrophy and to evaluate the effects of IKr and IKs blocker on the incidence of ventricular arrhythmias in guinea pigs with left ventricular hypertrophy (LVH).
 Methods: Guinea pigs were divided into a sham operation group and a left ventricular hypertrophy (LVH) group. LVH model was prepared. Whole cell patch-clamp technique was used to record IKr and IKs tail currents in a guinea pig model with LVH. The changes of QTc and the incidence rate of ventricular arrhythmias in LVH guinea pigs were observed by using the IKr and IKs blockers.
 Results: Compared with cardiac cells in the control group, the interventricular septal thickness at end systole (IVSs), left ventricular posterior wall thickness at end systole (LVPWs), QTc interval and cell capacitance in guinea pigs with LVH were significantly increased (P<0.05); while IKs densities were significantly reduced [+60 mV: (0.36±0.03) pA/pF vs (0.58±0.05) pA/pF, P<0.01]. However, LVH exerted no significant effect on IKr densities. IKr blocker markedly prolonged the QTc interval (P<0.01) and increased the incidence of ventricular arrhythmias in guinea pigs with LVH compared with the control guinea pigs. In contrast, IKs blocker produced modest increase in QTc interval in guinea pigs of control group with no increase in LVH animals. IKs blocker did not induce ventricular arrhythmias incidence in either control or LVH animals.
 Conclusion: The cardiac hypertrophy-induced arrhythmogenesis is due to the down-regulation 
of IKs.

ICH E14 Q & A (R1) document: perspectives on the updated recommendations on thorough QT studies.

PubMed

Shah, Rashmi R; Morganroth, Joel

2013-04-01

The International Conference on Harmonization (ICH) guidance ICH E14 provides recommendations, focusing on a clinical 'thorough QT/QTc (TQT) study', to evaluate the QT liability of a drug during its development. An Implementation Working Group (IWG) was also established to assist the sponsors with any uncertainties and clarify any ambiguities. In April 2012, the IWG updated its June 2008 version of the Questions and Answers document to address additional issues. These include the gender of the study population, a reasonable approach to evaluating QTc changes in late stage clinical development and the recommended approach to correcting the measured QT interval. This commentary provides our observations and, when appropriate, recommendations, on these issues. We review briefly evidence that suggests that (i) the greater QT effect observed in females is not entirely related to differences in drug exposure and (ii) the Fridericia correction of measured QT interval is adequate for a majority of TQT studies. Until further evidence suggests otherwise, we recommend balanced gender representation in TQT studies, unless warranted otherwise, and for positive studies, subgroup analysis of key data by common demographic variables including the gender and ethnicity. We provide a general scheme for ECG monitoring in late phase clinical trials and consider that while intensive monitoring and centralized reading of ECGs in late phase clinical trials is the norm when a TQT study is positive, there are other circumstances that also call for high quality ECG reading. Therefore, locally read ECGs should only be acceptable as long as accurate high quality ECG data can be guaranteed. © 2012 The Authors. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.

A Multiple-Dose, Randomized, Double-Blind, Placebo-Controlled, Parallel-Group QT/QTc Study to Evaluate the Electrophysiologic Effects of THC/CBD Spray.

PubMed

Sellers, Edward M; Schoedel, Kerri; Bartlett, Cindy; Romach, Myroslava; Russo, Ethan B; Stott, Colin G; Wright, Stephen; White, Linda; Duncombe, Paul; Chen, Chien-Feng

2013-07-01

Delta-9-tetrahydrocannabinol (THC)/cannabidiol (CBD) oromucosal spray has proved efficacious in the treatment of spasticity in multiple sclerosis and chronic pain. A thorough QT/QTc study was performed to investigate the effects of THC/CBD spray on electrocardiogram (ECG) parameters in compliance with regulatory requirements, evaluating the effect of a recommended daily dose (8 sprays/day) and supratherapeutic doses (24 or 36 sprays/day) of THC/CBD spray on the QT/QTc interval in 258 healthy volunteers. The safety, tolerability, and pharmacokinetic profile of THC/CBD spray were also evaluated. Therapeutic and supratherapeutic doses of THC/CBD spray had no effect on cardiac repolarization with primary and secondary endpoints of QTcI and QTcF/QTcB, respectively, showing similar results. There was no indication of any effect on heart rate, atrioventricular conduction, or cardiac depolarization and no new clinically relevant morphological changes were observed. Overall, 19 subjects (25.0%) in the supratherapeutic (24/36 daily sprays of THC/CBD spray) dose group and one (1.6%) in the moxifloxacin group withdrew early due to intolerable AEs. Four psychiatric serious adverse events (AEs) in the highest dose group resulted in a reduction in the surpatherapeutic dose to 24 sprays/day. In conclusion, THC/CBD spray does not significantly affect ECG parameters. Additionally, THC/CBD spray is well tolerated at therapeutic doses with an AE profile similar to previous clinical studies. © The Author(s) 2013.

Impact of the Norepinephrine Prodrug Droxidopa on the QTc Interval in Healthy Individuals.

PubMed

White, William B; Hewitt, L Arthur; Mehdirad, Ali A

2018-03-01

A double-blind, 4-period crossover study (NCT01327066) was conducted to assess the effect of the novel norepinephrine prodrug droxidopa on the QT interval in in healthy subjects. Subjects were randomized to receive a single dose of droxidopa 600 mg (maximal dose) and 2000 mg (supratherapeutic dose) compared with the positive control, moxifloxacin 400 mg, and placebo, each separated by a 3-day washout period. Patients were monitored by continuous Holter monitoring, and electrocardiograms (ECGs) were extracted 0.5-23 hours after dosing. Blood samples for pharmacokinetic analysis were collected before dosing and after ECG data collection. The primary end point was the time-matched placebo-adjusted change from baseline in the individually corrected QT (QTcI). The time-averaged QTcI mean placebo-corrected changes from baseline for droxidopa 600 and 2000 mg were 0.1 milliseconds (90%CI, -0.9 to 1.0 milliseconds) and 0.3 milliseconds (90%CI, -0.6 to 1.3 milliseconds), respectively, and 9 milliseconds (90%CI, 8.4-10.3 milliseconds) for moxifloxacin. This study found no effect of either dose of droxidopa on cardiac repolarization using QTcI. Analysis of the pharmacokinetic/pharmacodynamic relationship and cardiac repolarization showed no association with droxidopa exposure. There were no clinically relevant effects of droxidopa on heart rate, atrioventricular conduction, or cardiac depolarization identified. No morphologic ECG changes were observed. © 2017 The Authors. Clinical Pharmacology in Drug Development Published by Wiley Periodicals, Inc. on behalf of American College of Clinical Pharmacology.

Impact of the Norepinephrine Prodrug Droxidopa on the QTc Interval in Healthy Individuals

PubMed Central

Hewitt, L. Arthur; Mehdirad, Ali A.

2017-01-01

Abstract A double‐blind, 4‐period crossover study (NCT01327066) was conducted to assess the effect of the novel norepinephrine prodrug droxidopa on the QT interval in in healthy subjects. Subjects were randomized to receive a single dose of droxidopa 600 mg (maximal dose) and 2000 mg (supratherapeutic dose) compared with the positive control, moxifloxacin 400 mg, and placebo, each separated by a 3‐day washout period. Patients were monitored by continuous Holter monitoring, and electrocardiograms (ECGs) were extracted 0.5–23 hours after dosing. Blood samples for pharmacokinetic analysis were collected before dosing and after ECG data collection. The primary end point was the time‐matched placebo‐adjusted change from baseline in the individually corrected QT (QTcI). The time‐averaged QTcI mean placebo‐corrected changes from baseline for droxidopa 600 and 2000 mg were 0.1 milliseconds (90%CI, ‐0.9 to 1.0 milliseconds) and 0.3 milliseconds (90%CI, ‐0.6 to 1.3 milliseconds), respectively, and 9 milliseconds (90%CI, 8.4–10.3 milliseconds) for moxifloxacin. This study found no effect of either dose of droxidopa on cardiac repolarization using QTcI. Analysis of the pharmacokinetic/pharmacodynamic relationship and cardiac repolarization showed no association with droxidopa exposure. There were no clinically relevant effects of droxidopa on heart rate, atrioventricular conduction, or cardiac depolarization identified. No morphologic ECG changes were observed. PMID:29024579

Single therapeutic and supratherapeutic doses of sacubitril/valsartan (LCZ696) do not affect cardiac repolarization.

PubMed

Langenickel, Thomas H; Jordaan, Pierre; Petruck, Jesika; Kode, Kiran; Pal, Parasar; Vaidya, Soniya; Chandra, Priya; Rajman, Iris

2016-08-01

Sacubitril/valsartan (LCZ696) is a first-in-class angiotensin receptor neprilysin inhibitor (ARNI) indicated to reduce the risk of cardiovascular death and hospitalization for heart failure in patients with chronic heart failure (NYHA class II-IV) and reduced ejection fraction. This study was aimed to evaluate the effect of single oral therapeutic (400 mg) and supratherapeutic (1200 mg) doses of LCZ696 on cardiac repolarization. This randomized double-blind crossover study in healthy male subjects compared the effect of therapeutic and supratherapeutic doses of LCZ696 with placebo and moxifloxacin 400 mg (open-label treatment) as positive control. The primary assessment was mean baseline- and placebo-corrected QTcF (∆∆QTcF; Fridericia correction). Additional assessments included the ∆∆QTcB (Bazett's correction), PR interval, QRS duration, heart rate (HR), LCZ696 pharmacokinetics, pharmacokinetic/pharmacodynamic relationships, and safety. Of the 84 subjects enrolled, 81 completed the study. The maximum upper bound of the two-sided 90 % confidence interval for ∆∆QTcF for LCZ696 400 mg and 1200 mg were <10 ms, and assay sensitivity was confirmed with moxifloxacin. No relevant treatment-emergent changes were observed in any of the ECG-derived parameters with LCZ696 or placebo, and the incidence of adverse events was comparable among the treatment groups. Single therapeutic and supratherapeutic doses of LCZ696 did not affect cardiac repolarization as defined by the E14 ICH guidelines.

QT interval dispersion in the patients with central serous chorioretinopathy

PubMed Central

Dagli, Necati; Turgut, Burak; Tanyildizi, Rumeysa; Kobat, Sabiha; Kobat, Mehmet Ali; Dogdu, Orhan

2015-01-01

AIM To evaluate QT dispersion (QTD) in patients with central serous chorioretinopathy (CSC). METHODS This clinical, comperative, case-control study included 30 patients with CSC at acute phase (Group 1) and 30 age- and sex-matched healthy subjects (Group 2, the control group). From all subjects, a 12-lead surface electrocardiography was obtained. The heart rate (HR), QT maximum (QTmax), QT minimum (QTmin), QT corrected (QTc), QTD and Tmean were manually measured and analyzed. Student's t-test and Pearson's method of correlation were used for statistical analysis. RESULTS The patient and control groups were matched for age, smoking status (rate and duration) and gender. There were no significant differences with regard to these among the groups (P>0.05). The participants included 19 men (63.3%) and 11 women (36.7%) in Group 1, 20 men (66.7%) and 10 women (33.3%) in Group 2. QTmax, QTD and QTc were significantly higher than those of healthy controls (P<0.001 for QTmax, P=0.01 for QTD and P=0.001 for QTc). QTmin, Tmean and HR did not differ significantly between the study groups (P=0.28 for QTmin, P=0.56 for Tmean and P>0.05 for HR). No significant correlation was found between duration of the disorder and QTD values (r=0.13, P>0.05). CONCLUSION These findings suggest that CSC may be associated with an increase in QTD and that the patients might be at risk for ventricular arrhythmia. PMID:25709909

QT interval dispersion in the patients with central serous chorioretinopathy.

PubMed

Dagli, Necati; Turgut, Burak; Tanyildizi, Rumeysa; Kobat, Sabiha; Kobat, Mehmet Ali; Dogdu, Orhan

2015-01-01

To evaluate QT dispersion (QTD) in patients with central serous chorioretinopathy (CSC). This clinical, comperative, case-control study included 30 patients with CSC at acute phase (Group 1) and 30 age- and sex-matched healthy subjects (Group 2, the control group). From all subjects, a 12-lead surface electrocardiography was obtained. The heart rate (HR), QT maximum (QTmax), QT minimum (QTmin), QT corrected (QTc), QTD and Tmean were manually measured and analyzed. Student's t-test and Pearson's method of correlation were used for statistical analysis. The patient and control groups were matched for age, smoking status (rate and duration) and gender. There were no significant differences with regard to these among the groups (P>0.05). The participants included 19 men (63.3%) and 11 women (36.7%) in Group 1, 20 men (66.7%) and 10 women (33.3%) in Group 2. QTmax, QTD and QTc were significantly higher than those of healthy controls (P<0.001 for QTmax, P=0.01 for QTD and P=0.001 for QTc). QTmin, Tmean and HR did not differ significantly between the study groups (P=0.28 for QTmin, P=0.56 for Tmean and P>0.05 for HR). No significant correlation was found between duration of the disorder and QTD values (r=0.13, P>0.05). These findings suggest that CSC may be associated with an increase in QTD and that the patients might be at risk for ventricular arrhythmia.

Ranolazine Shortens Repolarization in Patients with Sustained Inward Sodium Current Due To Type-3 Long QT Syndrome

PubMed Central

Moss, Arthur J.; Zareba, Wojciech; Schwarz, Karl Q.; Rosero, Spencer; McNitt, Scott; Robinson, Jennifer L.

2008-01-01

Introduction One form of the hereditary long QT-syndrome, LQT3-ΔKPQ, is associated with sustained inward sodium current during membrane depolarization. Ranolazine reduces late sodium channel current, and we hypothesized that ranolazine would have beneficial effects on electrical and mechanical cardiac function in LQT3 patients with the SCN5A-ΔKPQ mutation. Methods We assessed the effects of 8-hour intravenous ranolazine infusions (45mg/hr for 3 hours followed by 90mg/hr for 5 hours) on ventricular repolarization and myocardial relaxation in five LQT3 patients with the SCN5A-ΔKPQ mutation. Changes in electrocardiographic QTc parameters from before to during ranolazine infusion were evaluated by time-matched, paired t-test analyses. Cardiac ultrasound recordings were obtained before ranolazine infusion and just before completion of the 8-hour ranolazine infusion. Results Ranolazine shortened QTc by 26±3ms (p<0.0001) in a concentration-dependent manner. At peak ranolazine infusion, there was a significant 13% shortening in left ventricular isovolumic relaxation time, a significant 25% increase in mitral E-wave velocity, and a meaningful 22% decrease in mitral E-wave deceleration time compared to baseline. No adverse effects of ranolazine were observed in the study patients. Conclusion Ranolazine at therapeutic concentrations shortened a prolonged QTc interval and improved diastolic relaxation in patients with the LQT3-ΔKPQ mutation, a genetic disorder that is known to cause an increase of late sodium current. PMID:18662191

Potassium channel KCNH2 K897T polymorphism and cardiac repolarization during exercise test: The Finnish Cardiovascular Study.

PubMed

Koskela, J; Laiho, J; KäHönen, M; Rontu, R; Lehtinen, R; Viik, J; Niemi, M; Niemelä, K; Kööbi, T; Turjanmaa, V; Pörsti, I; Lehtimäki, T; Nieminen, T

2008-01-01

Cardiac repolarization is regulated, in part, by the KCNH2 gene, which encodes a rapidly activating component of the delayed rectifier potassium channel. The gene expresses a functional single nucleotide polymorphism, K897T, which changes the biophysical properties of the channel. The objective of this study was to evaluate whether this polymorphism influences two indices of repolarization--the QT interval and T-wave alternans (TWA)--during different phases of a physical exercise test. The cohort consisted of 1,975 patients undergoing an exercise test during which on-line electrocardiographic data were registered. Information on coronary risk factors and medication was recorded. The 2690A>C nucleotide variation in the KCNH2 gene corresponding to the K897T amino acid change was analysed after polymerase chain reaction with allele-specific TaqMan probes. Among all subjects, the QTc intervals did not differ between the three genotype groups (p> or =0.31, RANOVA). Women with the CC genotype tended to have longer QT intervals during the exercise test, but the difference was statistically significant only at rest (p = 0.011, ANOVA). This difference was also detected when the analysis was adjusted for several factors influencing the QT interval. No statistically significant effects of the K897T polymorphism on TWA were observed among all subjects (p = 0.16, RANOVA), nor in men and women separately. The K897T polymorphism of the KCNH2 gene may not be a major genetic determinant for the TWA, but the influence of the CC genotype on QT interval deserves further research among women.

The Effects of Fluvoxamine on the Steady-State Plasma Concentrations of Escitalopram and Desmethylescitalopram in Depressed Japanese Patients.

PubMed

Yasui-Furukori, Norio; Tsuchimine, Shoko; Kubo, Kazutoshi; Ishioka, Masamichi; Nakamura, Kazuhiko; Inoue, Yoshimasa

2016-08-01

The aim of this study was to determine the impact of fluvoxamine, an inhibitor of Cytochrome P450 (CYP) 2C19 (CYP2C19), on the pharmacokinetics of escitalopram, a substrate of CYP2C19. Thirteen depressed patients initially received a 20-mg/d dose of escitalopram alone. Subsequently, a 50-mg/d dose of fluvoxamine was administered because of the insufficient efficacy of escitalopram. Plasma concentrations of escitalopram and desmethylescitalopram were quantified using high-performance liquid chromatography before and after fluvoxamine coadministration. The QT and corrected QT (QTc) intervals were measured before and after fluvoxamine coadministration. Fluvoxamine significantly increased the plasma concentrations of escitalopram (72.3 ± 36.9 ng/mL versus 135.2 ± 79.7 ng/mL, P < 0.01) but not those of desmethylescitalopram (21.5 ± 7.0 ng/mL versus 24.9 ± 12.0 ng/mL, no significance [ns]). The ratios of desmethylescitalopram to escitalopram were significantly decreased during fluvoxamine coadministration (0.37 ± 0.21 versus 0.21 ± 0.10, P < 0.01). The CYP2C19 genotype did not fully explain the degree of the change. Fluvoxamine coadministration did not change the QT or QTc intervals. The results of this study suggest that adjunctive treatment with fluvoxamine increases the concentration of escitalopram. The QTc interval did not change in this condition.

QT effect of semagacestat at therapeutic and supratherapeutic doses.

PubMed

Zhang, Wei; Ayan-Oshodi, Mosun; Willis, Brian A; Annes, William; Hall, Stephen D; Chiesa, Joseph; Seger, Mary

2012-04-01

This thorough QT/ QT interval corrected for heart rate (QTc) study was designed to assess the potential of semagacestat, a functional gamma-secretase inhibitor, to delay cardiac repolarization. In this Phase I, single-dose, randomized, 4-period crossover study, semagacestat was compared with placebo in 54 healthy male and female subjects between the ages of 19 and 63 years, inclusive. Each study period included single oral-dose administrations of semagacestat 140 mg, semagacestat 280 mg, moxifloxacin 400 mg, or placebo. Study subjects and the investigator were blinded to the identity of semagacestat and placebo; however, moxifloxacin was administered as open-label. Moxifloxacin was compared with placebo for assay sensitivity analysis. Pharmacokinetic parameters were also assessed. For each QTc, the upper bound of the 2-sided 90% confidence interval (CI) for the least squares mean difference between semagacestat (at both the 140- and 280-mg dose levels) and placebo was < 10 msec at all time points, and thus, within the limits set for clinical relevance in regulatory guidelines. The results of this study indicate that single doses of 140 and 280 mg semagacestat did not prolong QTc to a clinically significant degree.

Heterologous expression of Talaromyces emersonii cellobiohydrolase Cel7A in Trichoderma reesei increases the efficiency of corncob residues saccharification.

PubMed

Sun, Ningning; Qian, Yuanchao; Wang, Weiwei; Zhong, Yaohua; Dai, Meixue

2018-07-01

Improve the hydrolysis efficiency of the Trichoderma reesei cellulase system by heterologously expressing cellobiohydrolase Cel7A (Te-Cel7A) from the thermophilic fungus Talaromyces emersonii. Te-Cel7A was expressed in T. reesei under control of the cdna1 promoter and the generated transformant QTC14 could successfully secrete Te-Cel7A into the supernatant using glucose as carbon source. The recombinant Te-Cel7A had a temperature optimum at 65 °C and an optimal pH of 5, which were similar to those from the native host. The culture supernatant of QTC14 exhibited a 28.8% enhancement in cellobiohydrolase activity and a 65.2% increase in filter paper activity relative to that of the parental strain QP4. Moreover, the QTC14 cellulase system showed higher thermal stability than that of the parental strain QP4. In the saccharification of delignified corncob residue, the cellulose conversion of QTC14 showed 13.9% higher than that of QP4 at the end of reaction. The thermophilic fungus-derived cellulases could be efficiently expressed by T. reesei and the recombinant cellulases had potential applications for biomass conversion.

Evaluation of electrocardiographic parameters for early diagnosis of autonomic dysfunction in children and adolescents with type-1 diabetes mellitus.

PubMed

Uysal, Fahrettin; Ozboyaci, Evren; Bostan, Ozlem; Saglam, Halil; Semizel, Evren; Cil, Ergun

2014-10-01

The aim of this study was to identify the sensitivity of electrocardiogram (ECG) in early diagnosis of cardiac autonomic function disorder in children with type 1 diabetes mellitus. A total of 150 children and adolescents with type 1 diabetes mellitus were enrolled between June 2009 and June 2010, as well as 100 age- and sex-matched healthy control children. Twelve-lead ECG was done in all cases and heart rate, QT and QTc interval, dispersion of P wave (Pd), and of QT (QTd) and QTc interval (QTcd) were measured. The clinical and demographic features such as age, gender, duration of follow up and level of HbA1c and fasting glucose were obtained and the effects of these parameters on ECG measurements were investigated. The mean age of the patients and controls was 11.61 ± 3.72 years and 10.92 ± 3.2 years, respectively. QT and QTc interval and QTcd interval were significantly higher in diabetic children compared to healthy controls but these ECG findings were not associated with the duration of diabetes or glycemic state. Pd was significantly higher in the diabetic patients with HbA1c >7.5% compared to control, and this was also found in patients that were followed up >1 year. Cardiac autonomic function disorder, which is one of the most important causes of morbidity and mortality, may emerge in the course of type 1 diabetes mellitus. It can be diagnosed on ECG even when the patients are asymptomatic. © 2014 Japan Pediatric Society.

Electrocardiographic Predictors of Incident Atrial Fibrillation

PubMed Central

Nguyen, Kaylin T.; Vittinghoff, Eric; Dewland, Thomas A.; Mandyam, Mala C.; Stein, Phyllis K.; Soliman, Elsayed Z.; Heckbert, Susan R.; Marcus, Gregory M.

2017-01-01

Atrial fibrillation (AF) is likely secondary to multiple different pathophysiological mechanisms that are increasingly, but incompletely understood. Motivated by the hypothesis that 3 previously described electrocardiographic (ECG) predictors of AF identify distinct AF mechanisms, we sought to determine if these ECG findings independently predict incident disease. Among Cardiovascular Health Study participants without prevalent AF, we determined whether left anterior fascicular block (LAFB), a prolonged QTC, and atrial premature complexes (APCs) each predicted AF after adjusting for each other. We then calculated the attributable risk in the exposed for each ECG marker. LAFB and QTC intervals were assessed on baseline 12-lead ECG (n=4,696). APC count was determined using 24-hour Holter recordings obtained in a random subsample (n=1,234). After adjusting for potential confounders and each ECG marker, LAFB (hazard ratio [HR. 2.1, 95% confidence interval [CI. 1.1–3.9, p=0.023), a prolonged QTC (HR 2.5, 95% CI 1.4–4.3, p=0.002), and every doubling of APC count (HR 1.2, 95% CI 1.1–1.3, p<0.001) each remained independently predictive of incident AF. The attributable risk of AF in the exposed was 35% (95% CI 13–52%) for LAFB, 25% (95% CI 0.6–44%) for a prolonged QTC, and 34% (95% CI 26–42%) for APCs. In conclusion, in a community-based cohort, 3 previously established ECG-derived AF predictors were each independently associated with incident AF, suggesting they may represent distinct mechanisms underlying the disease. PMID:27448684

The sodium glucose cotransporter 2 inhibitor empagliflozin does not prolong QT interval in a thorough QT (TQT) study

PubMed Central

2013-01-01

Background Empagliflozin is a potent, selective sodium glucose cotransporter 2 (SGLT2) inhibitor in development as an oral antidiabetic treatment. This QT interval study assessed potential effects of empagliflozin on ventricular repolarisation and other electrocardiogram (ECG) parameters. Methods A randomised, placebo-controlled, single-dose, double-blind, five-period crossover study incorporating a novel double-placebo period design to reduce sample size, while maintaining full statistical power. Treatments: single empagliflozin doses of 25 mg (therapeutic) and 200 mg (supratherapeutic), matching placebo and open-label moxifloxacin 400 mg (positive control). Triplicate 12-lead ECGs of 10 second duration were recorded at baseline and during the first 24 hours after dosing. The primary endpoint was mean change from baseline (MCfB) in the population heart rate-corrected QT interval (QTcN) between 1–4 hours after dosing. Results Thirty volunteers (16 male, 14 female, mean [range] age: 34.5 [18–52] years) were randomised. The placebo-corrected MCfB in QTcN 1–4 hours after dosing was 0.6 (90% CI: -0.7, 1.9) ms and -0.2 (-1.4, 0.9) ms for empagliflozin 25 mg and 200 mg, respectively, below the ICH E14 defined threshold of regulatory concern 10 ms. Assay sensitivity was confirmed by a placebo-corrected MCfB in QTcN 2–4 hours post-dose of 12.4 (10.7, 14.1) ms with moxifloxacin 400 mg. Empagliflozin tolerability was good for all volunteers; 23.3% experienced adverse events (AEs) with empagliflozin and 27.6% with placebo. The most frequent AE was nasopharyngitis. Conclusions/interpretation Single doses of empagliflozin 25 mg and 200 mg were not associated with QTcN prolongation and were well tolerated in healthy volunteers. Trial registration ClinicalTrials.gov: NCT01195675 PMID:23617452

The C-allele of tissue inhibitor of metalloproteinases 2 is associated with increased magnitude of QT dispersion prolongation in elderly Chinese - 4-year follow-up study.

PubMed

Lin, Tsung-Hsien; Chiu, Herng-Chia; Lee, Ya-Ting; Su, Ho-Ming; Juo, Suh-Hang Hank; Voon, Wen-Chol; Lai, Wen-Ter; Sheu, Sheng-Hsiung

2007-01-01

Matrix metalloproteinases (MMP) and tissue inhibitor of metalloproteinases (TIMP) trigger the signal cascade instigating cardiac remodeling and fibrosis, which lead to changes of repolarization variables. We investigate the influence of MMP9-1562 C/T and TIMP2-418 G/C gene polymorphisms on repolarization parameters including QT dispersion (QTd) and the peak and the end of the T wave interval (Tpe) in a prospective cohort. Of 1500 people screened, 106 elderly Chinese without organic heart disease were recruited and received electrocardiography at the baseline, second and 4th year follow-ups. The QTc (corrected QT), QTd, QTc dispersion (QTcd) and Tpe were manually calculated. Age was 72.7+/-4.1 y (range 62-81 y). QTd, QTcd and Tpe were significantly prolonged (all p <0.001 at the 2nd and 4th year). At the 4th year the magnitude of QTd prolongation but not Tpe was significantly higher in subjects carrying the TIMP2 C-allele than non C-allele carriers (p=0.033) as well as QTcd (p=0.010). This association was still significant in multivariate analyses (p=0.012 and p=0.003 for QTd and QTcd, respectively) but not in MMP9 genotype. The elderly Chinese with TIMP2 C-allele have higher magnitude of QTd and QTcd prolongation.

Ventricular Effective Refraction Period and Ventricular Repolarization Analysis in Experimental Tachycardiomyopathy in Swine.

PubMed

Noszczyk-Nowak, Agnieszka; Pasławska, Urszula; Gajek, Jacek; Janiszewski, Adrian; Pasławski, Robert; Zyśko, Dorota; Nicpoń, Józef

2016-01-01

Swine are recognized animal models of human cardiovascular diseases. However, little is known on the CHF-associated changes in the electrophysiological ventricular parameters of humans and animals. The aim of this study was to analyze changes in the durations of ventricular effective refraction period (VERP), QT and QTc intervals of pigs with chronic tachycardia-induced tachycardiomyopathy (TIC). The study was comprised of 28 adult pigs (8 females and 20 males) of the Polish Large White breed. A one-chamber pacemaker was implanted in each of the 28 pigs. Electrocardiographic, echocardiographic and electrophysiological studies were carried out prior to the pacemaker implantation and at subsequent 4-week intervals. All electrocardiographic, echocardiographic and short electrophysiological study measurements in all swine were done under general anesthesia (propofol) after premedication with midazolam, medetomidine, and ketamine. No significant changes in the duration of QT interval and corrected QT interval (QTc) were observed during consecutive weeks of the experiment. The duration of the QTc interval of female pigs was shown to be significantly longer than that of the males throughout the whole study period. Beginning from the 12th week of rapid ventricular pacing, a significant increase in duration of VERP was observed in both male and female pigs. Males and females did not differ significantly in terms of VERP duration determined throughout the whole study period. Ventricular pacing, stimulation with 2 and 3 premature impulses at progressively shorter coupling intervals and an imposed rhythm of 130 bpm or 150 bpm induced transient ventricular tachycardia in one female pig and four male pigs. One episode of permanent ventricular tachycardia was observed. The number of induced arrhythmias increased proportionally to the severity of heart failure and duration of the experiment. However, relatively aggressive protocols of stimulation were required in order to induce arrhythmia in the studied pigs.

QT Adaptation and Intrinsic QT Variability in Congenital Long QT Syndrome.

PubMed

Seethala, Srikanth; Singh, Prabhpreet; Shusterman, Vladimir; Ribe, Margareth; Haugaa, Kristina H; Němec, Jan

2015-12-16

Increased variability of QT interval (QTV) has been linked to arrhythmias in animal experiments and multiple clinical situations. Congenital long QT syndrome (LQTS), a pure repolarization disease, may provide important information on the relationship between delayed repolarization and QTV. Twenty-four-hour Holter monitor tracings from 78 genotyped congenital LQTS patients (52 females; 51 LQT1, 23 LQT2, 2 LQT5, 2 JLN, 27 symptomatic; age, 35.2±12.3 years) were evaluated with computer-assisted annotation of RR and QT intervals. Several models of RR-QT relationship were tested in all patients. A model assuming exponential decrease of past RR interval contributions to QT duration with 60-second time constant provided the best data fit. This model was used to calculate QTc and residual "intrinsic" QTV, which cannot be explained by heart rate change. The intrinsic QTV was higher in patients with long QTc (r=0.68; P<10(-4)), and in LQT2 than in LQT1/5 patients (5.65±1.28 vs 4.46±0.82; P<0.0002). Both QTc and intrinsic QTV were similar in symptomatic and asymptomatic patients (467±52 vs 459±53 ms and 5.10±1.19 vs 4.74±1.09, respectively). In LQTS patients, QT interval adaptation to heart rate changes occurs with time constant ≈60 seconds, similar to results reported in control subjects. Intrinsic QTV correlates with the degree of repolarization delay and might reflect action potential instability observed in animal models of LQTS. © 2015 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.

QT prolongation caused by insulin-induced hypoglycaemia - An interventional study in 119 individuals.

PubMed

Kacheva, Stella; Karges, Beate; Göller, Katrin; Marx, Nikolaus; Mischke, Karl; Karges, Wolfram

2017-01-01

Hypoglycaemia is associated with increased risk of cardiovascular events and mortality in patients with diabetes, but the extent and mechanisms of this link are ill defined. We here prospectively studied cardiac repolarization abnormalities during insulin-induced hypoglycaemia in humans. 119 individuals (69 males, age 47.5±13.4years, range 18-82years) were assessed during hypoglycaemia after the injection of 0.1-0.25units/kg human insulin. Corrected QT intervals (QTc) and QT dispersion (QTd) were calculated from serially recorded twelve lead electrocardiograms, and plasma glucose and other endocrine markers were studied. QTc increased from 415.1±21.9ms (mean±standard deviation) at baseline to 444.9±26.5ms during hypoglycaemia (plasma glucose nadir, 1.6±0.5mmol/L, p=0.001), accompanied by an increase of QTd from 45.0±22.7ms to 64.1±40.0ms (p<0.001). Hypoglycaemia-induced abnormal QTc prolongation (defined as ⩾460ms in females and ⩾450ms in males) occurred in 17% (9/54) of females and 26% (17/65) of males. 97 of 119 of individuals (82%) developed transient hypokalaemia (K + ⩽3.6mmol/L), and plasma epinephrine increased from 220.4±169.5pmol/L at baseline to 2945.6±2421.4pmol/L during hypoglycaemia. Baseline QTc, but not age or gender, was a significant predictor of hypoglycaemia-induced QTc prolongation (p=0.001). Insulin-induced hypoglycaemia frequently causes abnormal QT prolongation and is associated with hypokalaemia and sympathoadrenal activation, thereby increasing the potential risk for ventricular arrhythmias, particularly in individuals with pre-existing high normal QTc. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Pharmacokinetic interaction between domperidone and ketoconazole leads to QT prolongation in healthy volunteers: a randomized, placebo-controlled, double-blind, crossover study

PubMed Central

Boyce, Malcolm J; Baisley, Kathy J; Warrington, Steven J

2012-01-01

AIMS To assess the steady-state pharmacokinetic and QTc effects of domperidone and ketoconazole, given alone and together. METHODS A randomized, placebo-controlled, double-blind, crossover study was carried out. Healthy subjects (14 men, 10 women; age 18–39 years; mean weight 73.5 kg, range 53.8–98.8 kg; 23 Europid, 1 Afro-Caribbean) received orally, for 7 days each, placebo, domperidone 10 mg, four doses daily, at 4 h intervals, ketoconazole 200 mg 12-hourly and domperidone and ketoconazole together. The washout period was 15 days. Pharmacokinetics and serial 12-lead ECGs were assessed on day 7, and serial ECGs on day −1 and at follow-up. Two subjects withdrew before the third treatment period, so data were available for 22–24 subjects. RESULTS Ketoconazole tripled domperidone concentrations at steady-state. Domperidone, ketoconazole and their combination significantly increased QTcF in men. Overall adjusted mean differences from placebo were 4.20 (95% CI 0.77, 7.63), 9.24 (95% CI 5.85, 12.63) and 15.90 (95% CI 12.47, 19.33) ms, respectively. In women, QTcF was not significantly different from placebo on either domperidone or ketoconazole alone, or in combination. However, QTc was positively correlated with plasma drug concentrations, in both men and women. ΔQTcF increased by about 2 ms per 10 ng ml–1 rise in domperidone concentration, and per 1 µg ml–1 rise in ketoconazole concentration. CONCLUSIONS Ketoconazole tripled the plasma concentrations of domperidone. Domperidone and ketoconazole increased QTcF in men, whether given together or separately. The effect of domperidone alone was below the level of clinical importance. The negative result in women is unexplained. PMID:21883386

Red wine-cisapride interaction: comparison with grapefruit juice.

PubMed

Offman, E M; Freeman, D J; Dresser, G K; Munoz, C; Bend, J R; Bailey, D G

2001-07-01

Our objective was to compare the interactions of red wine and grapefruit juice with cisapride. The oral pharmacokinetics of cisapride, its norcisapride metabolite, and electrocardiographic QTc interval were determined over a 24-hour period after administration of cisapride 10 mg with 250 mL grapefruit juice, red wine (cabernet sauvignon), or water in a randomized 3-way crossover study in 12 healthy men. The cisapride area under the concentration-time curve (AUC) and the maximum plasma drug concentration after single-dose administration (C(max)) with grapefruit juice were 151% (P <.01) and 168% (P <.001), respectively, of those with water. The increase in cisapride AUC and C(max) was variable among individuals; however, cisapride AUC and C(max) were enhanced by the same proportion. The time to reach maximum concentration after drug administration (t(max)) and the apparent elimination half-life (t((1/2)) for cisapride and the pharmacokinetics of norcisapride were not altered. Norcisapride/cisapride ratios were reduced. Cisapride AUC and C(max) with red wine were 115% (difference not statistically significant) and 107% (difference not statistically significant), respectively, of those with water. The cisapride t(max) was slightly longer. Cisapride t((1/2)) and norcisapride pharmacokinetics were not different. The norcisapride/cisapride ratio at cisapride C(max) was lower. One subject had a doubling in cisapride AUC and C(max) and a decrease in norcisapride/cisapride ratios with red wine and also had the largest interaction with grapefruit juice. QTc interval was unchanged in all treatment groups and individuals. A single glass of grapefruit juice produced an individual-dependent variable increase in the systemic availability of cisapride by inhibition of intestinal cytochrome P450 3A4 (CYP3A4) activity. The identical volume of red wine caused only minor changes in cisapride pharmacokinetics despite some inhibition of CYP3A4 in most individuals. However, even this amount of red wine may cause a marked interaction similar to that for grapefruit juice in individuals with a preexisting high intestinal CYP3A4 content.

Obstructive Sleep Apnea in Patients with Congenital Long QT Syndrome: Implications for Increased Risk of Sudden Cardiac Death.

PubMed

Shamsuzzaman, Abu S; Somers, Virend K; Knilans, Timothy K; Ackerman, Michael J; Wang, Yu; Amin, Raouf S

2015-07-01

Congenital long QT syndrome (LQTS) is a familial arrhythmogenic cardiac channelopathy characterized by prolonged ventricular repolarization and increased risk of torsades de pointes-mediated syncope, seizures, and sudden cardiac death (SCD). QT prolongation corrected for heart rate (QTc) is an important diagnostic and prognostic feature in LQTS. Obstructive sleep apnea (OSA) has been increasingly implicated in the pathogenesis of cardiovascular disease, including arrhythmias and SCD. We tested the hypothesis that the presence of concomitant OSA in patients with LQTS is associated with increased QT intervals, both during sleep and while awake. Polysomnography with simultaneous overnight 12-lead electrocardiography (ECG) was recorded in 54 patients with congenital LQTS and 67 control subjects. OSA was diagnosed as apnea-hypopnea index (AHI) ≥ 5 events/h for adults and AHI > 1 event/h for children. RR and QT intervals were measured from the 12-lead surface ECG. QTc was determined by the Bazett formula. Respiratory disturbance index, AHI, and arousal index were significantly increased in patients with LQTS and with OSA compared to those without OSA and control subjects. QTc during different sleep stages and while awake was also significantly increased in patients with LQTS and OSA compared to those without OSA. Severity of OSA in patients with LQTS was directly associated with the degree of QTc. The presence and severity of obstructive sleep apnea (OSA) in patients with congenital long QT syndrome (LQTS) is associated with increased QT prolongation corrected for heart rate, which is an important biomarker of sudden cardiac death (SCD). Treatment of OSA in LQTS patients may reduce QT prolongation, thus reducing the risk of LQT-triggered SCD. © 2015 Associated Professional Sleep Societies, LLC.

Prolongation of the corrected QT complex--a cause of sudden cardiac death in the mountain environment?

PubMed

Windsor, J S; Rodway, G W; Mukherjee, R; Firth, P G; Shattock, M; Montgomery, H E

2011-03-01

In the mountain environment sudden cardiac death (SCD) has been shown to be responsible for the deaths of up to 52% of downhill skiers and 30% of hikers. The majority of SCD's are precipitated by a ventricular arrhythmia. Although most are likely to result from structural abnormalities associated with conditions such as ischaemic heart disease, a small but significant number may be due to abnormalities in ion channel activity, commonly known as, "channelopathies". Channelopathies have the potential to lengthen the time between ventricular depolarisation and repolarisation that can result in prolongation of the corrected QT interval (QTc) and episodes of polymorphic ventricular tachycardia (PVT) and eventually, ventricular fibrillation. This review examines the factors that prolong the QTc interval in the mountain environment and outlines a practical framework for preventing the life threatening arrhythmias that are associated with this condition.

Temperature sensitivity of soil microbial activity modeled by the square root equation as a unifying model to differentiate between direct temperature effects and microbial community adaptation.

PubMed

Bååth, Erland

2018-07-01

Numerous models have been used to express the temperature sensitivity of microbial growth and activity in soil making it difficult to compare results from different habitats. Q10 still is one of the most common ways to express temperature relationships. However, Q10 is not constant with temperature and will differ depending on the temperature interval used for the calculation. The use of the square root (Ratkowsky) relationship between microbial activity (A) and temperature below optimum temperature, √A = a × (T-T min ), is proposed as a simple and adequate model that allow for one descriptor, T min (a theoretical minimum temperature for growth and activity), to estimate correct Q10-values over the entire in situ temperature interval. The square root model can adequately describe both microbial growth and respiration, allowing for an easy determination of T min . Q10 for any temperature interval can then be calculated by Q10 = [(T + 10 - T min )/(T-T min )] 2 , where T is the lowest temperature in the Q10 comparison. T min also describes the temperature adaptation of the microbial community. An envelope of T min covering most natural soil habitats varying between -15°C (cold habitats like Antarctica/Arctic) to 0°C (tropical habitats like rain forests and deserts) is suggested, with an 0.3°C increase in T min per 1°C increase in mean annual temperature. It is shown that the main difference between common temperature relationships used in global models is differences in the assumed temperature adaptation of the soil microbial community. The use of the square root equation will allow for one descriptor, T min , determining the temperature response of soil microorganisms, and at the same time allow for comparing temperature sensitivity of microbial activity between habitats, including future projections. © 2018 John Wiley & Sons Ltd.

Early safety and efficacy of the combination of bedaquiline and delamanid for the treatment of patients with drug-resistant tuberculosis in Armenia, India, and South Africa: a retrospective cohort study.

PubMed

Ferlazzo, Gabriella; Mohr, Erika; Laxmeshwar, Chinmay; Hewison, Catherine; Hughes, Jennifer; Jonckheere, Sylvie; Khachatryan, Naira; De Avezedo, Virginia; Egazaryan, Lusine; Shroufi, Amir; Kalon, Stobdan; Cox, Helen; Furin, Jennifer; Isaakidis, Petros

2018-05-01

Bedaquiline and delamanid have been approved for treatment of multidrug-resistant (MDR) tuberculosis in the past 5 years. Because of theoretical safety concerns, patients have been unable to access the two drugs in combination. Médecins Sans Frontières has supported the use of combination bedaquiline and delamanid for people with few treatment options since 2016. We describe early safety and efficacy of regimens containing the bedaquiline and delamanid combination in patients with drug-resistant tuberculosis in Yerevan, Armenia; Mumbai, India; and Khayelitsha, South Africa. We retrospectively analysed a cohort of all patients who received 6-12 months of oral bedaquiline and delamanid in combination (400 mg bedaquiline once per day for 2 weeks, then 200 mg bedaquiline three times per week and 100 mg delamanid twice per day) in MSF-supported projects. We report serious adverse events, QTc corrected using the Fridericia formula (QTcF) interval data, and culture conversion data during the first 6 months of treatment. Between Jan 1, 2016, and Aug 31, 2016, 28 patients (median age 32·5 years [IQR 28·5-40·5], 17 men) were included in the analysis. 11 (39%) of 28 patients were HIV-positive. 24 patients (86%) had isolates resistant to fluoroquinolones; 14 patients (50%) had extensively drug-resistant tuberculosis. No patient had an increase of more than 500 ms in their QTcF interval. Four patients (14%) had six instances of QTcF increase of more than 60 ms from baseline but none permanently discontinued the drugs. 16 serious adverse events were reported in seven patients. Of 23 individuals with positive baseline cultures, 17 (74%) converted to negative by month 6 of treatment. Use of the bedaquiline and delamanid combination appears to reveal no additive or synergistic QTcF-prolonging effects. Access to bedaquiline and delamanid in combination should be expanded for people with few treatment options while awaiting the results of formal clinical trials. Médecins Sans Frontières (MSF). Copyright © 2018 Elsevier Ltd. All rights reserved.

Utility of heart rate turbulence and T-Wave alternans to assess risk for Re-admission and cardiac death in hospitalized heart failure patients.

PubMed

Yamada, Shinya; Yoshihisa, Akiomi; Sato, Yu; Sato, Takamasa; Kamioka, Masashi; Kaneshiro, Takashi; Oikawa, Masayoshi; Kobayashi, Atsushi; Suzuki, Hitoshi; Ishida, Takafumi; Takeishi, Yasuchika

2018-05-18

Heart failure (HF) patients have a higher risk of recurrent HF and cardiac death, and electrical remodeling is considered to be an important factor for HF progression. The present study aimed to validate the utility of electrocardiogram and Holter monitoring for the risk stratification of HF patients. Our study comprised 215 patients (144 males, mean age 62 years) who had been hospitalized due to acute decompensated HF. Electrocardiogram (QRS duration and QTc interval) and 24-hour Holter monitoring (heart rate variability, heart rate turbulence and T-wave alternans [TWA]) were performed in stable condition before discharge. The clinical characteristics and outcomes were then investigated. During a median follow-up period of 2.7 years, there were 83 (38.6%) cardiac events (re-hospitalization due to worsening HF [n = 51] or cardiac death [n = 32]). The patients with cardiac events had a lower turbulence slope (TS) and higher TWA compared to those without cardiac events (TS, 3.0±5.5 ms/RR vs. 5.3±5.6 ms/RR, P = 0.001; TWA, 66.1±19.6 μV vs. 54.7±15.1 μV, P < 0.001). Univariable analysis showed that TS, TWA, QRS duration, and QTc interval were associated with cardiac events (P = 0.004, P < 0.001, P = 0.037 and P = 0.024, respectively), while the multivariable analysis after the adjustment of multiple confounders showed that TS and TWA were independent predictive factors of cardiac events with a hazard ratio of 0.936 and 1.015 (95% confidence interval [CI]: 0.860-0.974, P = 0.006; and 95% CI: 1.003-1.027, p = 0.016), respectively. The measurement of TS and TWA is useful for assessing risk for re-hospitalization and cardiac death in HF patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Glucose ingestion causes cardiac repolarization disturbances in type 1 long QT syndrome patients and healthy subjects.

PubMed

Hyltén-Cavallius, Louise; Iepsen, Eva W; Christiansen, Michael; Graff, Claus; Linneberg, Allan; Pedersen, Oluf; Holst, Jens J; Hansen, Torben; Torekov, Signe S; Kanters, Jørgen K

2017-08-01

Both hypoglycemia and severe hyperglycemia constitute known risk factors for cardiac repolarization changes potentially leading to malignant arrhythmias. Patients with loss of function mutations in KCNQ1 are characterized by long QT syndrome (LQTS) and may be at increased risk for glucose-induced repolarization disturbances. The purpose of this study was to test the hypothesis that KCNQ1 LQTS patients are at particular risk for cardiac repolarization changes during the relative hyperglycemia that occurs after an oral glucose load. Fourteen KCNQ1 LQTS patients and 28 control participants matched for gender, body mass index, and age underwent a 3-hour oral 75-g glucose tolerance test with ECGs obtained at 7 time points. Fridericia corrected QT interval (QTcF), Bazett corrected QT interval (QTcB), and the Morphology Combination Score (MCS) were calculated. QTc and MCS increased in both groups. MCS remained elevated until 150 minutes after glucose ingestion, and the maximal change from baseline was larger among KCNQ1 LQTS patients compared with control subjects (0.28 ± 0.27 vs 0.15 ± 0.13; P <.05). Relative hyperglycemia induced by ingestion of 75-g glucose caused cardiac repolarization disturbances that were more severe in KCNQ1 LQTS patients compared with control subjects. Copyright © 2017 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

Pathogenesis of Lethal Cardiac Arrhythmias in Mecp2 Mutant Mice: Implication for Therapy in Rett Syndrome

PubMed Central

McCauley, Mark D.; Wang, Tiannan; Mike, Elise; Herrera, Jose; Beavers, David L.; Huang, Teng-Wei; Ward, Christopher S.; Skinner, Steven; Percy, Alan K.; Glaze, Daniel G.; Wehrens, Xander H. T.; Neul, Jeffrey L.

2013-01-01

Rett Syndrome is a neurodevelopmental disorder typically caused by mutations in Methyl-CpG-Binding Protein 2 (MECP2) in which 26% of deaths are sudden and of unknown cause. To explore the hypothesis that these deaths may be due to cardiac dysfunction, we characterized the electrocardiograms (ECGs) in 379 people with Rett syndrome and found that 18.5% show prolongation of the corrected QT interval (QTc), indicating a repolarization abnormality that can predispose to the development of an unstable fatal cardiac rhythm. Male mice lacking MeCP2 function, Mecp2Null/Y, also have prolonged QTc and show increased susceptibility to induced ventricular tachycardia. Female heterozygous null mice, Mecp2Null/+, show an age-dependent prolongation of QTc associated with ventricular tachycardia and cardiac-related death. Genetic deletion of MeCP2 function in only the nervous system was sufficient to cause long QTc and ventricular tachycardia, implicating neuronally-mediated changes to cardiac electrical conduction as a potential cause of ventricular tachycardia in Rett syndrome. The standard therapy for prolonged QTc in Rett syndrome, β-adrenergic receptor blockers, did not prevent ventricular tachycardia in Mecp2Null/Y mice. To determine whether an alternative therapy would be more appropriate, we characterized cardiomyocytes from Mecp2Null/Y mice and found increased persistent sodium current, which was normalized when cells were treated with the sodium channel-blocking anti-seizure drug phenytoin. Treatment with phenytoin reduced both QTc and sustained ventricular tachycardia in Mecp2Null/Y mice. These results demonstrate that cardiac abnormalities in Rett syndrome are secondary to abnormal nervous system control, which leads to increased persistent sodium current. Our findings suggest that treatment in people with Rett syndrome would be more effective if it targeted the increased persistent sodium current in order to prevent lethal cardiac arrhythmias. PMID:22174313

Effect of correlation on covariate selection in linear and nonlinear mixed effect models.

PubMed

Bonate, Peter L

2017-01-01

The effect of correlation among covariates on covariate selection was examined with linear and nonlinear mixed effect models. Demographic covariates were extracted from the National Health and Nutrition Examination Survey III database. Concentration-time profiles were Monte Carlo simulated where only one covariate affected apparent oral clearance (CL/F). A series of univariate covariate population pharmacokinetic models was fit to the data and compared with the reduced model without covariate. The "best" covariate was identified using either the likelihood ratio test statistic or AIC. Weight and body surface area (calculated using Gehan and George equation, 1970) were highly correlated (r = 0.98). Body surface area was often selected as a better covariate than weight, sometimes as high as 1 in 5 times, when weight was the covariate used in the data generating mechanism. In a second simulation, parent drug concentration and three metabolites were simulated from a thorough QT study and used as covariates in a series of univariate linear mixed effects models of ddQTc interval prolongation. The covariate with the largest significant LRT statistic was deemed the "best" predictor. When the metabolite was formation-rate limited and only parent concentrations affected ddQTc intervals the metabolite was chosen as a better predictor as often as 1 in 5 times depending on the slope of the relationship between parent concentrations and ddQTc intervals. A correlated covariate can be chosen as being a better predictor than another covariate in a linear or nonlinear population analysis by sheer correlation These results explain why for the same drug different covariates may be identified in different analyses. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

The role of the Na+/Ca2+ exchanger, INa and ICaL in the genesis of dofetilide-induced torsades de pointes in isolated, AV-blocked rabbit hearts

PubMed Central

Farkas, Attila S; Makra, Péter; Csík, Norbert; Orosz, Szabolcs; Shattock, Michael J; Fülöp, Ferenc; Forster, Tamás; Csanády, Miklós; Papp, Julius Gy; Varró, András; Farkas, András

2009-01-01

Background and purpose: The Na+/Ca2+ exchanger (NCX) may contribute to triggered activity and transmural dispersion of repolarization, which are substrates of torsades de pointes (TdP) type arrhythmias. This study examined the effects of selective inhibition of the NCX by SEA0400 on the occurrence of dofetilide-induced TdP. Experimental approach: Effects of SEA0400 (1 µmol·L−1) on dofetilide-induced TdP was studied in isolated, Langendorff-perfused, atrioventricular (AV)-blocked rabbit hearts. To verify the relevance of the model, lidocaine (30 µmol·L−1) and verapamil (750 nmol·L−1) were also tested against dofetilide-induced TdP. Key results: Acute AV block caused a chaotic idioventricular rhythm and strikingly increased beat-to-beat variability of the RR and QT intervals. SEA0400 exaggerated the dofetilide-induced increase in the heart rate-corrected QT interval (QTc) and did not reduce the incidence of dofetilide-induced TdP [100% in the SEA0400 + dofetilide group vs. 75% in the dofetilide (100 nmol·L−1) control]. In the second set of experiments, verapamil further increased the dofetilide-induced QTc prolongation and neither verapamil nor lidocaine reduced the dofetilide-induced increase in the beat-to-beat variability of the QT interval. However, lidocaine decreased and verapamil prevented the development of dofetilide-induced TdP as compared with the dofetilide control (TdP incidence: 13%, 0% and 88% respectively). Conclusions and implications: Na+/Ca2+ exchanger does not contribute to dofetilide-induced TdP, whereas Na+ and Ca2+ channel activity is involved in TdP genesis in isolated, AV-blocked rabbit hearts. Neither QTc prolongation nor an increase in the beat-to-beat variability of the QT interval is a sufficient prerequisite of TdP genesis in rabbit hearts. PMID:19222480

Obstructive sleep apnea is associated with increased QT corrected interval dispersion: the effects of continuous positive airway pressure.

PubMed

Bilal, Nagihan; Dikmen, Nursel; Bozkus, Fulsen; Sungur, Aylin; Sarica, Selman; Orhan, Israfil; Samur, Anil

2017-03-31

Severe obstructive sleep apnea (OSA) is associated with increased QT corrected interval dispersion (QTcd) and continuous positive airway pressure (CPAP) is thought to improve this arrhythmogenic marker. The aim of the study was to determine the decrease of ratio of cardiovascular risk in patients with obstructive sleep apnea. The study included 65 patients with severe OSA who had an apnea-hypopnea index (AHI) score of >30. Each patient underwent 12-channel electrocardiogram (ECG) monitoring and polysomnography. Patients with an AHI score of <5 were used as the control group. The control group also underwent ECG monitoring and polysomnography testing. The QTcd levels of both groups were calculated. Three months after CPAP treatment, ECG recordings were obtained from the 65 patients with severe OSA again, and their QTcd values were calculated. There were 44 male and 21 female patients with severe OSA syndrome. The age, gender, body mass index, initial saturation, minimum saturation, average saturation, and desaturation index were determined in both groups. The QTc intervals of the OSA patients (62.48±16.29ms) were significantly higher (p=0.001) than those of the control group (29.72±6.30ms). There were statistically significant differences between the QTc values before and after the CPAP treatment, with pretreatment QTc intervals of 62.48±16.29ms and 3-month post-treatment values of 41.42±16.96ms (p=0.001). There was a positive and significant correlation between QTcd periods and the AHI and hypopnea index (HI) in OSA patients (p=0.001; r=0.71; p=0.001; r=0.679, respectively). CPAP treatment reduced the QTcd in patients with severe OSA. In addition, shortening the QTcd periods in patients with severe OSA may reduce their risk of arrhythmias and cardiovascular disease. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

Behavioral Hyperventilation and Central Sleep Apnea in Two Children.

PubMed

Johnston, Thomas P; Tam-Williams, Jade; Schmandt, Margaret; Patel, Anand C; Cleveland, Claudia; Coste, Ferdinand; Kemp, James S

2015-04-01

Behavioral hyperventilation is a rarely recognized cause of central sleep apnea (CSA) among children. We report two pediatric patients who presented with prolonged central sleep apnea secondary to behavioral hyperventilation. One patient also had a prolonged corrected QT (QT(C)) interval resulting from hyperventilation

Induction of autoimmune response to the extracellular loop of the HERG channel pore induces QTc prolongation in guinea‐pigs

PubMed Central

Fabris, Frank; Yue, Yuankun; Qu, Yongxia; Chahine, Mohamed; Sobie, Eric; Lee, Peng; Wieczorek, Rosemary; Jiang, Xian‐Cheng; Capecchi, Pier‐Leopoldo; Laghi‐Pasini, Franco; Lazzerini, Pietro‐Enea

2016-01-01

Key points Channelopathies of autoimmune origin are novel and are associated with corrected QT (QTc) prolongation and complex ventricular arrhythmias.We have recently demonstrated that anti‐SSA/Ro antibodies from patients with autoimmune diseases and with QTc prolongation on the ECG target the human ether‐à‐go‐go‐related gene (HERG) K+ channel by inhibiting the corresponding current, I Kr, at the pore region.Immunization of guinea‐pigs with a peptide (E‐pore peptide) corresponding to the extracellular loop region connecting the S5 and S6 segments of the HERG channel induces high titres of antibodies that inhibit I Kr, lengthen the action potential and cause QTc prolongation on the surface ECG. In addition, anti‐SSA/Ro‐positive sera from patients with connective tissue diseases showed high reactivity to the E‐pore peptide.The translational impact is the development of a peptide‐based approach for the diagnosis and treatment of autoimmune‐associated long QT syndrome. Abstract We recently demonstrated that anti‐SSA/52 kDa Ro antibodies (Abs) from patients with autoimmune diseases and corrected QT (QTc) prolongation directly target and inhibit the human ether‐à‐go‐go‐related gene (HERG) K+ channel at the extracellular pore (E‐pore) region, where homology with SSA/52 kDa Ro antigen was demonstrated. We tested the hypothesis that immunization of guinea‐pigs with a peptide corresponding to the E‐pore region (E‐pore peptide) will generate pathogenic inhibitory Abs and cause QTc prolongation. Guinea‐pigs were immunized with a 31‐amino‐acid peptide corresponding to the E‐pore region of HERG. On days 10–62 after immunization, ECGs were recorded and blood was sampled for the detection of E‐pore peptide Abs. Serum samples from patients with autoimmune diseases were evaluated for reactivity to E‐pore peptide by enzyme‐linked immunosorbent assay (ELISA), and histology was performed on hearts using Masson's Trichrome. Inhibition of the HERG channel was assessed by electrophysiology and by computational modelling of the human ventricular action potential. The ELISA results revealed the presence of high titres of E‐pore peptide Abs and significant QTc prolongation after immunization. High reactivity to E‐pore peptide was found using anti‐SSA/Ro Ab‐positive sera from patients with QTc prolongation. Histological data showed no evidence of fibrosis in immunized hearts. Simulations of simultaneous inhibition of repolarizing currents by anti‐SSA/Ro Ab‐positive sera showed the predominance of the HERG channel in controlling action potential duration and the QT interval. These results are the first to demonstrate that inhibitory Abs to the HERG E‐pore region induce QTc prolongation in immunized guinea‐pigs by targeting the HERG channel independently from fibrosis. The reactivity of anti‐SSA/Ro Ab‐positive sera from patients with connective tissue diseases with the E‐pore peptide opens novel pharmacotherapeutic avenues in the diagnosis and management of autoimmune‐associated QTc prolongation. PMID:27296897

Models of torsades de pointes: effects of FPL64176, DPI201106, dofetilide, and chromanol 293B in isolated rabbit and guinea pig hearts.

PubMed

Cheng, Hsien C; Incardona, Josephine

2009-01-01

For studying the torsades de pointes (TdP) liability of a compound, most high and medium throughput methods use surrogate markers such as HERG inhibition and QT prolongation. In this study, we have tested whether isolated hearts may be modified to allow TdP to be the direct readout. Isolated spontaneously beating rabbit and guinea pig hearts were perfused according to the Langendorff method in hypokalemic (2.1 mM) solution. The in vitro lead II ECG equivalent and the incidence of TdP were monitored for 1 h. In addition, heart rate, QTc, Tp-Te, short-term variability (STV), time to arrhythmia, and time to TdP were also analyzed. FPL64176, a calcium channel activator; and DPI201106, a sodium channel inactivation inhibitor, produced TdP in isolated rabbit and guinea pig hearts in a concentration dependent manner; guinea pig hearts were 3- to 5-fold more sensitive than rabbit hearts. Both compounds also increased QTc and STV. In contrast, dofetilide, an IKr inhibitor, produced no (or a low incidence of) TdP in both species, in spite of prolongation of QTc intervals. Chromanol 293B, an IKs inhibitor, did not produce TdP in rabbit hearts but elicited TdP concentration dependently in guinea pig hearts even though the compound had no effect on QTc intervals. IKs inhibition appears to be more likely to produce TdP in isolated guinea pig hearts than IKr inhibition. Chromanol 293B did not produce TdP in rabbit hearts presumably due to a low level of IKs channels in the heart. TdP produced in this study was consistent with the notion that its production was a consequence of reduced repolarization reserve, thereby causing rhythmic abnormalities. This isolated, perfused, and spontaneously beating rabbit and guinea pig heart preparation in hypokalemic medium may be useful as a preclinical test model for studying proarrhythmic liability of compounds in new drug development.

Methadone prolongs cardiac conduction in young patients with cancer-related pain

PubMed Central

Anghelescu, Doralina L.; Patel, Rakesh M.; Mahoney, Daniel P.; Trujillo, Luis; Faughnan, Lane G.; Steen, Brenda D.; Baker, Justin N.; Pei, Deqing

2016-01-01

Objective Methadone prolongs cardiac conduction, from mild corrected QT (QTc) prolongation to torsades de pointes and ventricular fibrillation, in adults. However, methadone use for pain and its effects on cardiac conduction have not been investigated in pediatric populations. Methods A retrospective review of QTc intervals in patients receiving methadone analgesia was conducted. Medical records from a 4-year period (September 2006 to October 2010) at a pediatric oncology institution were reviewed, and correlations were tested between cardiac conduction and methadone dosage and duration of therapy, electrolyte levels, renal and hepatic dysfunction, and concurrent medications. Results Of the 61 patients who received methadone, 37 met our inclusion criteria and underwent 137 electrocardiograms (ECGs). During methadone treatment, the mean QTc was longer than that at baseline (446.5 vs 437.55 ms). The mean methadone dose was 27.0 ± 24.3 mg/d (range, 5–125 mg/d; median, 20 mg/d) or 0.47 ± 0.45 mg/kg per day (range, 0.05–2.25 mg/kg per day; median, 0.37 mg/kg per day), and the mean duration of therapy was 49 days. The authors identified a correlation between automated and manual ECG readings by two cardiologists (Pearson r = 0.649; p < 0.0001), but the authors found no correlations between methadone dose or duration and concurrent QTc-prolonging medications, sex, age, electrolyte abnormalities, or renal or hepatic dysfunction. Conclusion At a clinically effective analgesic dose, methadone dosage and duration were not correlated with QTc prolongation, even in the presence of other risk factors, suggesting that methadone use may be safe in pediatric populations. The correlation between automated and manual ECG readings suggests that automated ECG readings are reliable for monitoring cardiac conductivity during the reported methadone-dosage regimens. PMID:27194198

Prevalence of Electrocardiographic Patterns Associated With Sudden Cardiac Death in the Spanish Population Aged 40 Years or Older. Results of the OFRECE Study.

PubMed

Awamleh García, Paula; Alonso Martín, Joaquín Jesús; Graupner Abad, Catherine; Jiménez Hernández, Rosa María; Curcio Ruigómez, Alejandro; Talavera Calle, Pedro; Cristóbal Varela, Carmen; Serrano Antolín, José; Muñiz, Javier; Gómez Doblas, Juan José; Roig, Eulalia

2017-10-01

Some electrocardiographic patterns are associated with an increased risk of sudden cardiac death due to ventricular arrhythmias. There is no information on the prevalence of these patterns in the general population in Spain. The objective of this study was to analyze the prevalence of these patterns and associated clinical and epidemiological factors. This subanalysis of the OFRECE study selected a representative sample of the Spanish population aged ≥ 40 years. We studied the presence or absence of electrocardiographic patterns of Brugada syndrome and QT interval abnormalities. Clinical data and electrocardiograms were available in all participants. Electrocardiograms were evaluated by 2 cardiologists and a third cardiologist was consulted if there was disagreement in the diagnosis. We calculated the weighted prevalence and clinical factors associated with the presence of Brugada-type patterns or QT segment abnormalities. Overall, 8343 individuals were evaluated (59.2 years, 52.4% female). There were 12 Brugada cases (type 1, 2 cases; type 2, 10 cases; weighted prevalence, 0.13%). For corrected QT (QTc) analysis, we excluded participants with left bundle branch block or without sinus rhythm. Weighted prevalences were as follows: short QTc (< 340ms) 0.18%, borderline QTc (441-469ms) 8.33%, long QTc (≥ 470ms criterion) 1.01% and long QTc (≥ 480 criterion) 0.42%. A total of 0.6% to 1.1% of the Spanish population aged ≥ 40 years has an electrocardiographic pattern associated with a higher risk of sudden death (Brugada syndrome, long QT, or short QT). Copyright © 2016 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

Minimal T-wave representation and its use in the assessment of drug arrhythmogenicity.

PubMed

Shakibfar, Saeed; Graff, Claus; Kanters, Jørgen K; Nielsen, Jimmi; Schmidt, Samuel; Struijk, Johannes J

2017-05-01

Recently, numerous models and techniques have been developed for analyzing and extracting features from the T wave which could be used as biomarkers for drug-induced abnormalities. The majority of these techniques and algorithms use features that determine readily apparent characteristics of the T wave, such as duration, area, amplitude, and slopes. In the present work the T wave was down-sampled to a minimal rate, such that a good reconstruction was still possible. The entire T wave was then used as a feature vector to assess drug-induced repolarization effects. The ability of the samples or combinations of samples obtained from the minimal T-wave representation to correctly classify a group of subjects before and after receiving d,l-sotalol 160 mg and 320 mg was evaluated using a linear discriminant analysis (LDA). The results showed that a combination of eight samples from the minimal T-wave representation can be used to identify normal from abnormal repolarization significantly better compared to the heart rate-corrected QT interval (QTc). It was further indicated that the interval from the peak of the T wave to the end of the T wave (Tpe) becomes relatively shorter after I K r inhibition by d,l-sotalol and that the most pronounced repolarization changes were present in the ascending segment of the minimal T-wave representation. The minimal T-wave representation can potentially be used as a new tool to identify normal from abnormal repolarization in drug safety studies. © 2016 Wiley Periodicals, Inc.

Effect of Mobile Phone Radiofrequency Electromagnetic Fields on.

PubMed

Umar, Z U; Abubakar, M B; Ige, J; Igbokwe, U V; Mojiminiyi, F B O; Isezuo, S A

2014-12-29

Since cell phones emit radiofrequency electromagnetic fields (EMFs), this study tested the hypothesis that cell phones placed near the heart may interfere with the electrical rhythm of the heart or affect the blood pressure. Following informed consent, eighteen randomly selected apparently healthy male volunteers aged 21.44 ± 0.53 years had their blood pressure, pulse rates and ECG measured before and after acute exposure to a cell phone. The ECG parameters obtained were: heart rate (HR), QRS complex duration (QRS), PR interval (PR) and Corrected QT interval (QTc). Results are presented as mean ± SEM. Statistical analyses were done using two-tailed paired t test for blood pressure and pulse rate data and one way ANOVA with a post hoc Tukey test for the ECG data. P<0.05 was considered statistically significant. The blood pressure and pulse rates before and after exposure to the cell phone showed no significant difference. The ECG parameters (HR: beats/min, QRS:ms, PR:ms and QTc respectively) did not differ before (66.33 ± 2.50, 91.78 ± 1.36, 151.67 ± 5.39 and 395.44 ± 4.96), during (66.33 ± 2.40, 91.11 ± 1.61, 153.67 ± 5.06 and 394.33 ± 4.05) and after calls (67.22 ± 2.77, 91.11 ± 1.67, 157.44 ± 4.46 and 396.56 ± 4.93) compared to baseline (67.17 ± 2.19, 94.33 ± 1.57, 150.56 ± 4.93 and 399.56 ± 3.88). These results suggest that acute exposure to EMFs from cell phones placed near the heart may not interfere with the electrical activity of the heart or blood pressure in healthy individuals.

Combination Chemotherapy with Suboptimal Doses of Benznidazole and Pentoxifylline Sustains Partial Reversion of Experimental Chagas' Heart Disease

PubMed Central

Vilar-Pereira, Glaucia; Resende Pereira, Isabela; de Souza Ruivo, Leonardo Alexandre; Cruz Moreira, Otacilio; da Silva, Andrea Alice; Britto, Constança

2016-01-01

Chronic chagasic cardiomyopathy (CCC) progresses with parasite persistence, fibrosis, and electrical alterations associated with an unbalanced immune response such as high plasma levels of tumor necrosis factor (TNF) and nitric oxide (NO). Presently, the available treatments only mitigate the symptoms of CCC. To improve CCC prognosis, we interfered with the parasite load and unbalanced immune response using the trypanocidal drug benznidazole (Bz) and the immunoregulator pentoxifylline (PTX). C57BL/6 mice chronically infected with the Colombian strain of Trypanosoma cruzi and with signs of CCC were treated for 30 days with a suboptimal dose of Bz (25 mg/kg of body weight), PTX (20 mg/kg), or their combination (Bz plus PTX) and analyzed for electrocardiographic, histopathological, and immunological changes. Bz (76%) and Bz-plus-PTX (79%) therapies decreased parasite loads. Although the three therapies reduced myocarditis and fibrosis and ameliorated electrical alterations, only Bz plus PTX restored normal heart rate-corrected QT (QTc) intervals. Bz-plus-PTX-treated mice presented complementary effects of Bz and PTX, which reduced TNF expression (37%) in heart tissue and restored normal TNF receptor 1 expression on CD8+ T cells, respectively. Bz (85%) and PTX (70%) therapies reduced the expression of inducible nitric oxide synthase (iNOS/NOS2) in heart tissue, but only Bz (58%) reduced NO levels in serum. These effects were more pronounced after Bz-plus-PTX therapy. Moreover, 30 to 50 days after treatment cessation, reductions of the prolonged QTc and QRS intervals were sustained in Bz-plus-PTX-treated mice. Our findings support the importance of interfering with the etiological agent and immunological abnormalities to improve CCC prognosis, opening an opportunity for a better quality of life for Chagas' disease (CD) patients. PMID:27161638

Cardiac Repolarization Changes in the Children with Breath-Holding Spells

PubMed Central

Amoozgar, Hamid; Saleh, Fazl; Farhani, Nahal; Rafiei, Mohammad; Inaloo, Soroor; Asadipooya, Ali-Akbar

2013-01-01

Objective Breath-holding spells are known as benign attacks, frequencies of which decrease by the development of the autonomic nervous system. The present study aims to compare the electrocardiographic repolarization in children with breath-holding spells. Methods In this study, QT dispersion, QTc dispersion, T peak to T end dispersion, and P wave dispersion of the twelve-lead surface electrocardiography of fifty children who had breath-holding spells were measured and compared with normal children from April 2011 to August 2012. Findings Forty-four (88%) patients had cyanotic spells, while 6 (12%) had pallid spells. QTc dispersion was increased in the patients with breath-holding spells (148.2±33.1) compared to the healthy children (132±27.3) and the difference was statically significant (P = 0.01). Meanwhile, no statistically significant differences were observed between the patients and the control subjects regarding the other parameters (P > 0.05). Conclusion QTc dispersion was significantly increased in the patients with breath-holding spells compared to normal children and this is a sign of cardiac repolarization abnormality as well as the increased risk of cardiac arrhythmia in patients with breath-holding spells. PMID:24910749

In vivo cardiac electrical activity of nitric oxide in barium chloride treated male rats

NASA Astrophysics Data System (ADS)

Salihi, Abbas B. Q.; Shekha, Mudhir S.; Hamadamin, Peshraw S.; Maulood, Ismail M.; Rasul, Khder H.; Salim, Muhammed A.; Qadir, Fikry A.; Othman, Goran Q.; Mahmud, Almas M. R.; Al-Habib, Omar A. M.

2017-09-01

The aim of this study was to evaluate the effects of nitric oxide in barium chloride (BaCl2)-induced arrhythmia in male albino rats. 10mg/kg/hr of BaCl2 was infused intravenously through caudal vein to induce arrhythmia, to ameliorate this effect 1mg and 10mg/kg/hr of sodium nitroprusside (SNP; nitric oxide donor) were infused, respectively. The ECG signals and parameters were recorded and analyzed with the aid of BioAmp of ADInstruments data acquisition system and Labchart software. The results showed that infusion of both 1mg/kg/hr and 10mg/kg/hr of SNP non significantly changed heart rate (BPM), QRS interval (s), S amplitude (mV), T amplitude (mV), ST height (mV), JT height (mV), QT intervals (s) and QTc (s). In conclusion the results of the current study indicate that SNP cannot ameliorate arrhythmia-induced by BaCl2.

AVP-923, a combination of dextromethorphan hydrobromide and quinidine sulfate for the treatment of pseudobulbar affect and neuropathic pain.

PubMed

Olney, Nicholas; Rosen, Howard

2010-04-01

AVANIR Pharmaceuticals Inc, under license from Irisys Research & Development, is developing AVP-923 (Zenvia, Neurodex) for the treatment of pseudobulbar affect (PBA; in collaboration with Medison Pharma Ltd) and neuropathic pain associated with diabetic peripheral neuropathy. PBA, the main indication of AVP-923, is a neurological disorder characterized by uncontrollable and unpredictable episodes of laughing and/or crying. AVP-923 consists of a combination of the NMDA antagonist/sigma1 receptor agonist dextromethorphan hydrobromide (DM) and the cytochrome P450 2D6 (CYP2D6) enzyme inhibitor quinidine sulfate (Q). DM has been under investigation for several years as a neuroprotective agent in stroke, neurosurgery and amyotrophic lateral sclerosis (ALS); however, it is rapidly metabolized by CYP2D6, reducing the drug's bioavailability at neuronal targets. The inclusion of Q inhibits the rapid first-pass metabolism of DM to increase systemic concentrations of the drug in the plasma and, in theory, increase the potential efficacy. The initial clinical data for AVP-923 in the treatment of PBA demonstrated the combination was effective, but exhibited significant side effects. Of particular concern to the FDA were increased QTc intervals reported in patients dosed with a 30-/30-mg dose of DM/Q. A subsequent phase III clinical trial assessing a lower dose of AVP-923 (20 or 30 mg DM/10 mg Q) for the treatment of PBA in patients with ALS or multiple sclerosis was implemented by AVANIR and demonstrated a favorable safety profile of AVP-923 while maintaining efficacy. Pending approval of the data from the FDA, AVP-923 would be the first FDA-approved treatment for PBA.

A new 4-variable formula to differentiate normal variant ST segment elevation in V2-V4 (early repolarization) from subtle left anterior descending coronary occlusion - Adding QRS amplitude of V2 improves the model.

PubMed

Driver, Brian E; Khalil, Ayesha; Henry, Timothy; Kazmi, Faraz; Adil, Amina; Smith, Stephen W

Precordial normal variant ST elevation (NV-STE), previously often called "early repolarization," may be difficult to differentiate from subtle ischemic STE due to left anterior descending (LAD) occlusion. We previously derived and validated a logistic regression formula that was far superior to STE alone for differentiating the two entities on the ECG. The tool uses R-wave amplitude in lead V4 (RAV4), ST elevation at 60 ms after the J-point in lead V3 (STE60V3) and the computerized Bazett-corrected QT interval (QTc-B). The 3-variable formula is: 1.196 x STE60V3 + 0.059 × QTc-B - 0.326 × RAV4 with a value ≥23.4 likely to be acute myocardial infarction (AMI). Adding QRS voltage in V2 (QRSV2) would improve the accuracy of the formula. 355 consecutive cases of proven LAD occlusion were reviewed, and those that were obvious ST elevation myocardial infarction were excluded. Exclusion was based on one straight or convex ST segment in V2-V6, 1 millimeter of summed inferior ST depression, any anterior ST depression, Q-waves, "terminal QRS distortion," or any ST elevation >5 mm. The NV-STE group comprised emergency department patients with chest pain who ruled out for AMI by serial troponins, had a cardiologist ECG read of "NV-STE," and had at least 1 mm of STE in V2 and V3. R-wave amplitude in lead V4 (RAV4), ST elevation at 60 ms after the J-point in lead V3 (STE60V3) and the computerized Bazett-corrected QT interval (QTc-B) had previously been measured in all ECGs; physicians blinded to outcome then measured QRSV2 in all ECGs. A 4-variable formula was derived to more accurately classify LAD occlusion vs. NV-STE and optimize area under the curve (AUC) and compared with the previous 3-variable formula. There were 143 subtle LAD occlusions and 171 NV-STE. A low QRSV2 added diagnostic utility. The derived 4-variable formula is: 0.052*QTc-B - 0.151*QRSV2 - 0.268*RV4 + 1.062*STE60V3. The 3-variable formula had an AUC of 0.9538 vs. 0.9686 for the 4-variable formula (p = 0.0092). At the same specificity as the 3-variable formula [90.6%, at which cutpoint (≥23.4), 123 of 143 MI were correctly classified for 86% sensitivity], the sensitivity of the new formula at cutpoint ≥17.75 is 90.2%, with 129/143 correctly classified MI, identifying an additional 6 cases. The cutpoint with the highest accuracy (92.0%) was at a cutoff value ≥18.2, with 88.8% sensitivity, 94.7% specificity, and a positive and negative likelihood ratio of 16.9 (95% CI: 8.9-32) and 0.12 (95% CI: 0.07-0.19). At this cutpoint, it correctly classified an additional 11 cases (289 of 315, vs. 278 of 315): 127/143 for MI (an additional 4 cases) and 162/171 for NV-STE (an additional 7 cases). On the ECG, a 4-variable formula was derived which adds QRSV2; it differentiates subtle LAD occlusion from NV-STE better than the 3-variable formula. At a value ≥18.2, the formula (0.052*QTc-B - 0.151*QRSV2 - 0.268*RV4 + 1.062*STE60V3) was very accurate, sensitive, and specific, with excellent positive and negative likelihood ratios. This formula needs to be validated. Copyright © 2017 Elsevier Inc. All rights reserved.

Electrocardiographic Characteristics of Potential Organ Donors and Associations with Cardiac Allograft Utilization

PubMed Central

Khush, Kiran K.; Menza, Rebecca; Nguyen, John; Goldstein, Benjamin A.; Zaroff, Jonathan G.; Drew, Barbara J.

2012-01-01

Background Current regulations require that all cardiac allograft offers for transplantation must include an interpreted 12-lead electrocardiogram (ECG). However, little is known about the expected ECG findings in potential organ donors, or the clinical significance of any identified abnormalities in terms of cardiac allograft function and suitability for transplantation. Methods and Results A single experienced reviewer interpreted the first ECG obtained after brainstem herniation in 980 potential organ donors managed by the California Transplant Donor Network from 2002-2007. ECG abnormalities were summarized, and associations between specific ECG findings and cardiac allograft utilization for transplantation were studied. ECG abnormalities were present in 51% of all cases reviewed. The most common abnormalities included voltage criteria for left ventricular hypertrophy (LVH), prolongation of the corrected QT interval (QTc), and repolarization changes (ST/T wave abnormalities). Fifty seven percent of potential cardiac allografts in this cohort were accepted for transplantation. LVH on ECG was a strong predictor of allograft non-utilization. No significant associations were seen between QTc prolongation, repolarization changes and allograft utilization for transplantation, after adjusting for donor clinical variables and echocardiographic findings. Conclusions We have performed the first comprehensive study of ECG findings in potential donors for cardiac transplantation. Many of the common ECG abnormalities seen in organ donors may result from the heightened state of sympathetic activation that occurs after brainstem herniation, and are not associated with allograft utilization for transplantation. PMID:22615333

Association of Age, Sex, Body Size and Ethnicity with Electrocardiographic Values in Community-based Older Asian Adults.

PubMed

Tan, Eugene S J; Yap, Jonathan; Xu, Chang Fen; Feng, Liang; Nyunt, Shwe Zin; Santhanakrishnan, Rajalakshmi; Chan, Michelle M Y; Seow, Swee Chong; Ching, Chi Keong; Yeo, Khung Keong; Richards, A Mark; Ng, Tze Pin; Lim, Toon Wei; Lam, Carolyn S P

2016-07-01

Existing electrocardiographic (ECG) reference values were derived in middle-aged Caucasian adults. We aimed to assess the association of age, sex, body size and ethnicity on ECG parameters in a multi-ethnic Asian population. Resting 12-lead ECG and anthropometric measurements were performed in a community-based cohort of 3777 older Asians (age 64.7±9.1 years, 1467 men, 88.8% Chinese, 7.7% Malay, 3.5% Indian, body mass index [BMI] 24.0±3.9kg/m(2)). Men had longer PR interval, wider QRS, shorter QTc interval and taller SV3. In both sexes, older age was associated with longer PR interval, wider QRS, larger R aVL and more leftward QRS axis, while higher BMI was associated with longer PR interval, wider QRS, larger RaVL and more negative QRS axis. There were significant inter-ethnic differences in QRS duration among men, as well as in PR and QTc intervals among women (all adjusted p<0.05). Findings were similar in a healthy subset of 1158 adults (age 61.2±9.1 years, 365 men) without cardiovascular risk factors. These first community-based ECG data in multi-ethnic older Asians highlight the independent effects of age, sex, body size and ethnicity on ECG parameters. Copyright © 2016 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). Published by Elsevier B.V. All rights reserved.

Central aortic systolic blood pressure can predict prolonged QTc duration better than brachial artery systolic blood pressure in rural community residents.

PubMed

Huang, Yuqing; Tang, Songtao; Chen, Ji-Yan; Huang, Cheng; Li, Jie; Cai, An-Ping; Feng, Yingqing

2018-01-01

Previous studies have suggested that prolonged electrocardiogram QTc duration was independent risk factor for both increased cardiovascular and all-cause mortality, but there was no dating about the relationship between central aortic systolic blood pressure (CASP) and QTc duration. The aim of this study was to analyze the relationship between CASP and QTc duration, and assess whether CASP can predict prolonged QTc duration more than BSBP. A total of 500 patients were enrolled in this study, central and brachial aortic blood pressure and electrocardiogram QTc duration were measured. Pearson correlation was assessed for determining the associations of QTc duration with clinical conditions. Multivariate logistic regression analyses were performed to determine the independent predictor of prolonged QTc duration. Receiver operating characteristic (ROC) curve was used to evaluate the utility of blood pressure for prolonged QTc duration. We found QTc durations were significantly positive with CASP (r = 0.308, p < 0.001), BSBP (r = 0.227, p < 0.001), and age (r = 0.154, p = 0.010), but negatively related to heart rate (r = -440, p < 0.001). A multiple logistic regression analysis demonstrated that the CASP was an independent determinant of prolonged QTc (OR = 1.648; 95%CI: 1.032, 2.101; p < 0.001). CASP had a better predictive value for prolonged QTc duration than (AUC: 0.771 vs. 0.646, p < 0.001) BSBP. Our results suggested that the non-invasive CASP is independently correlated with QTc duration, and CASP can predict prolonged QTc duration more than BSBP.

Medical toxicologists' practice patterns regarding drug-induced QT prolongation in overdose patients: a survey in the United States of America, Europe, and Asia Pacific region.

PubMed

Othong, Rittirak; Devlin, John J; Kazzi, Ziad N

2015-05-01

To describe practice patterns of medical toxicologists in the United States of America (USA), Europe, and Asia Pacific Region regarding management of drug induced QT prolongation and torsades de pointes in overdose. A survey was developed to assess current practice patterns and consistency with guidelines published by the American Heart Association (AHA), American College of Cardiology (ACC), and European Society of Cardiology (ESC). It was reviewed by our department research committee and the American College of Medical Toxicology (ACMT). The ACMT, European Association of Poisons Centres and Clinical Toxicologists, and Asia Pacific Association of Medical Toxicology electronically disseminated the survey to their physician members in the USA, Europe and Asia Pacific Region. The overall response rate was 37% (229/617) (36% USA; 32% Europe; 52% Asia Pacific Region). Twelve toxicologists from Asia Pacific Region and Europe used the QT nomogram (Australia-5, New Zealand-1, United Kingdom-1) or QT alone (France-1, Russia-1, Romania-1, Germany-1, Philippines-1), in lieu of the corrected QT (QTc) to determine risks of developing torsades de pointes. Because only those who used QTc could proceed through the remainder of the survey, only 217 could do so. Approximately half of the respondents (52%) did not calculate QTc manually and based decisions on the electrocardiogram machines automated measurement. For those who corrected the QT interval themselves, the most common formula used was Bazett's (40%). There is great variation in the QTc value considered prolonged. Most responders considered QTc greater than 450 ms in men (28%) and 460 ms in women (25%) to be prolonged. Interestingly, approximately 15% of participants did not consider the QTc prolonged until it exceeded 500 ms in both men and women. Given an overdose scenario of a male patient with a QTc of 560 ms, heart rate of 90 beats/minute, 59% would not recommend administering intravenous magnesium sulfate. Forty-five percent and 36% believed magnesium could shorten QTc and prevent torsades de pointes, respectively. In addition, almost 90% believed administering 1-2 boluses of intravenous magnesium is safe, even when serum magnesium is not available. In regards to cardiac pacing of patients with QT prolongation and torsades de pointes, only 38% of the participating toxicologists' responses agreed with AHA/ACC/ESC recommendations. Furthermore, 21% would not pace a patient who developed torsades de pointes regardless of the scenario. The results indicate that medical toxicologists have considerable heterogeneity in terms of management practices for overdose patients with QT prolongation and torsades de pointes. Medical toxicologists may benefit from developing evidence-based consensus guidelines for the management of this relatively common finding in overdose of QT-prolonging drugs.

Heart rate, blood pressure and repolarization effects of an energy drink as compared to coffee.

PubMed

Brothers, R Matthew; Christmas, Kevin M; Patik, Jordan C; Bhella, Paul S

2017-11-01

The goal of this study was to investigate the impact of energy drinks on haemodynamic and cardiac physiology. Comparisons were made to coffee as well as water consumption. In Protocol #1 the caffeine content was normalized to body weight to represent a controlled environment. Heart rate, blood pressure and cardiac QTc interval were assessed in 15 participants, on 4 days, prior to and for 6·5 h postconsumption of (i) energy drink (2 mg caffeine per kg body weight; low dose), (ii) energy drink (3 mg caffeine per kg body weight; medium dose), (iii) coffee (2 mg caffeine per kg body weight) and (iv) 250 ml water. In Protocol #2, the beverages were consumed in volumes that they are purchased to represent real-life conditions. The aforementioned measurements were repeated in 15 participants following (i) 1 16 oz can of energy drink (16 oz Monster), (ii) 1 24 oz can of energy drink (24 oz Monster), (iii) 1 packet of Keurig K-Cup Starbucks coffee (coffee) and (iv) 250 ml water. The order of the beverages was performed in a randomized double-blinded fashion. For both protocols, QTc interval, heart rate and systolic blood pressure were unchanged in any condition (P>0·05). Diastolic blood pressure and mean blood pressure were slightly elevated in Protocol #1 (P<0·05, main effect of time) with no difference between beverages (P<0·05, interaction of beverage × time); however, they were unaffected in Protocol #2 (P>0·05). These findings suggest that acute consumption of these commonly consumed beverages has no negative effect on cardiac QTc interval. © 2016 Scandinavian Society of Clinical Physiology and Nuclear Medicine. Published by John Wiley & Sons Ltd.

Elevated Plasma Moxifloxacin Concentrations and SLCO1B1 g.−11187G>A Polymorphism in Adults with Pulmonary Tuberculosis

PubMed Central

Gelfond, Jon; Johnson-Pais, Teresa L.; Engle, Melissa; Peloquin, Charles A.; Johnson, John L.; Sizemore, Erin E.; Mac Kenzie, William R.

2018-01-01

ABSTRACT Moxifloxacin exhibits concentration-dependent prolongation of human QTc intervals and bactericidal activity against Mycobacterium tuberculosis. However, moxifloxacin plasma concentrations are variable between patients. We evaluated whether human gene polymorphisms affect moxifloxacin plasma concentrations in tuberculosis patients from two geographic regions. We enrolled a convenience sample of 49 adults with drug-sensitive pulmonary tuberculosis from Africa and the United States enrolled in two treatment trials of moxifloxacin as part of multidrug therapy. Pharmacokinetic parameters were evaluated by noncompartmental techniques. Human single-nucleotide polymorphisms of transporter genes were evaluated by analysis of covariance (ANCOVA) on moxifloxacin exposure and the peak (maximum) concentration (Cmax). The moxifloxacin area under the concentration-time curve from 0 to 24 h (AUC0–24) and Cmax were significantly increased by the drug milligram-per-kilogram dosage and the genotype of variant g.−11187G>A in the SLCO1B1 gene (rs4149015) but not by geographic region. The median moxifloxacin AUC0–24 was 46% higher and the median Cmax was 30% higher in 4 (8%) participants who had the SLCO1B1 g.−11187 AG genotype than in 45 participants who had the wild-type GG genotype (median AUC0–24 from the model, 34.4 versus 23.6 μg · h/ml [P = 0.005, ANCOVA]; median Cmax from the model, 3.5 versus 2.7 μg/ml [P = 0.009, ANCOVA]). Because moxifloxacin exhibits concentration-dependent prolongation of human QTc intervals and prolonged QTc intervals are associated with cardiac arrhythmia, further study is needed to evaluate the risk associated with the SLCO1B1 g.−11187G>A variant. (This study has been registered at ClinicalTrials.gov under identifier NCT00164463.) PMID:29463526

Cardiovascular responses to energy drinks in a healthy population: The C-energy study.

PubMed

Kozik, Teri M; Shah, Sachin; Bhattacharyya, Mouchumi; Franklin, Teresa T; Connolly, Therese Farrell; Chien, Walter; Charos, George S; Pelter, Michele M

2016-07-01

Energy drink consumption has increased significantly over the past decade and is associated with greater than 20,000 emergency department visits per year. Most often these visits are due to cardiovascular complaints ranging from palpitations to cardiac arrest. To determine if energy drinks alter; blood pressure, electrolytes, activated bleeding time (ACT), and/or cardiac responses measured with a 12-lead electrocardiographic (ECG) Holter. Continuous ECG data was collected for five hours (30 minutes baseline and 4 hours post consumption [PC]). Subjects consumed 32 ounces of energy drink within one hour and data (vital signs and blood samples) was collected throughout the study period. Paired students t-test and a corresponding non-parametric test (Wilcoxon signed rank) were used for analysis of the data. Fourteen healthy young subjects were recruited (mean age 28.6 years). Systolic blood pressure (baseline=132, ±7.83; PC=151, ±11.21; P=.001); QTc interval (baseline=423, ±22.74; PC=503, ±24.56; P<.001); magnesium level (baseline 2.04, ± 0.09; PC=2.13, ±0.15; P=.05); and calcium level (baseline=9.31, ±.28; PC=9.52, ±.22; P=.018) significantly increased from baseline. While potassium and ACT fluctuated (some subjects increased their levels while others decreased) these changes were not significant. Eight of the fourteen subjects (57%) developed a QTc >500 milliseconds PC. Other T-wave changes were noted in 9/14 (64.3%) subjects PC. Energy drinks increased systolic blood pressure, altered electrolytes, and resulted in repolarization abnormalities. These physiological responses can lead to arrhythmias and other abnormal cardiac responses highlighting the importance that emergency room personnel assess for energy drink consumption and potential toxicity. Copyright © 2016. Published by Elsevier Inc.

[Cardiac safety of electroconvulsive therapy in an elderly patient--a case report].

PubMed

Karakuła-Juchnowicz, Hanna; Próchnicki, Michał; Kiciński, Paweł; Olajossy, Marcin; Pelczarska-Jamroga, Agnieszka; Dzikowski, Michał; Jaroszyński, Andrzej

2015-10-01

Since electroconvulsive therapy (ECT) was introduced as treatment for psychiatric disorders in 1938, it has remained one of the most effective therapeutic methods. ECT is often used as a "treatment of last resort" when other methods fail, and a life-saving procedure in acute clinical states when a rapid therapeutic effect is needed. Mortality associated with ECT is lower, compared to the treatment with tricyclic antidepressants, and comparable to that observed in so-called minor surgery. In the literature, cases of effective and safe electroconvulsive therapy have been described in patients of advanced age, with a burden of many somatic disorders. However, cases of acute cardiac episodes have also been reported during ECT. The qualification of patients for ECT and the selection of a group of patients at the highest risk of cardiovascular complications remains a serious clinical problem. An assessment of the predictive value of parameters of standard electrocardiogram (ECG), which is a simple, cheap and easily available procedure, deserves special attention. This paper reports a case of a 74-year-old male patient treated with ECT for a severe depressive episode, in the context of cardiologic safety. Both every single ECT session and the full course were assessed to examine their impact on levels of troponin T, which is a basic marker of cardiac damage, and selected ECG parameters (QTc, QRS). In the presented case ECT demonstrated its high general and cardiac safety with no negative effect on cardiac troponin (TnT) levels, corrected QT interval (QTc) duration, or other measured ECG parameters despite initially increased troponin levels, the patient's advanced age, the burden of a severe somatic disease and its treatment (anticancer therapy). © 2015 MEDPRESS.

Electrocardiographic Impact of Myocardial Diffuse Fibrosis and Scar: MESA (Multi-Ethnic Study of Atherosclerosis)

PubMed Central

Inoue, Yuko Y.; Ambale-Venkatesh, Bharath; Mewton, Nathan; Volpe, Gustavo J.; Ohyama, Yoshiaki; Sharma, Ravi K.; Wu, Colin O.; Liu, Chia-Ying; Bluemke, David A.; Soliman, Elsayed Z.; Lima, João A. C.

2017-01-01

Purpose To examine the associations of myocardial diffuse fibrosis and scar with surface electrocardiographic (ECG) parameters in individuals free of prior coronary heart disease in four different ethnicities. Materials and Methods This prospective cross-sectional study was approved by the institutional review boards, and all participants gave informed consent. A total of 1669 participants in the Multi-Ethnic Study of Atherosclerosis, or MESA, who were free of prior myocardial infarction underwent both ECG and cardiac magnetic resonance imaging. In individuals without a late gadolinium enhancement–defined myocardial scar (n = 1131), T1 mapping was used to assess left ventricular (LV) interstitial diffuse fibrosis. The associations of LV diffuse fibrosis or myocardial scar with ECG parameters (QRS voltage, QRS duration, and corrected QT interval [QTc]) were evaluated by using multivariable regression analyses adjusted for demographic data, risk factors for scar, LV end-diastolic volume, and LV mass. Results The mean age of the 1669 participants was 67.4 years ± 8.7 (standard deviation); 49.8% were women. Lower postcontrast T1 time at 12 minutes was significantly associated with lower QRS Sokolow-Lyon voltage (β = 15.1 µV/10 msec, P = .004), lower QRS Cornell voltage (β = 9.2 µV/10 msec, P = .031), and shorter QRS duration (β = 0.16 msec/10 msec, P = .049). Greater extracellular volume (ECV) fraction was also significantly associated with lower QRS Sokolow-Lyon voltage (β = −35.2 µV/1% ECV increase, P < .001) and Cornell voltage (β = −23.7 µV/1% ECV increase, P < .001), independent of LV structural indexes. In contrast, the presence of LV scar (n = 106) was associated with longer QTc (β = 4.3 msec, P = .031). Conclusion In older adults without prior coronary heart disease, underlying greater LV diffuse fibrosis is associated with lower QRS voltage and shorter QRS duration at surface ECG, whereas clinically unrecognized myocardial scar is associated with a longer QT interval. © RSNA, 2016 Online supplemental material is available for this article. PMID:27740904

Arrhythmia Associated with Buprenorphine and Methadone Reported to the Food and Drug Administration

PubMed Central

Kao, David P; Haigney, Mark CP; Mehler, Philip S; Krantz, Mori J

2015-01-01

Aim To assess the relative frequency of reporting of adverse events involving ventricular arrhythmia, cardiac arrest, QTc prolongation, or torsade de pointes to the US Food and Drug Administration (FDA) between buprenorphine and methadone. Design Retrospective pharmacoepidemiologic study Setting Adverse drug events spontaneously reported to the FDA between 1969-June 2011 originating in 196 countries (71% events from the US). Cases Adverse event cases mentioning methadone (n=14,915) or buprenorphine (n=7,283) were evaluated against all other adverse event cases (n= 4,796,141). Measurements The primary outcome was the composite of ventricular arrhythmia or cardiac arrest. The secondary outcome was the composite of QTc prolongation or torsade de pointes. The proportional reporting ratio (PRR) was used to identify disproportionate reporting defined as a PRR>2, χ2 error>4, with ≥3 cases. Findings There were 132 (1.8%) ventricular arrhythmia/cardiac arrest and 19 (0.3%) QTc prolongation/torsade de pointes cases associated with buprenorphine compared with 1729 (11.6%) ventricular arrhythmia/cardiac arrest and 390 (2.6%) QTc prolongation/torsade de pointes cases involving methadone. PRRs associated with buprenorphine were not significant for ventricular arrhythmia/cardiac arrest (1.1 95% confidence interval (CI) 0.9–1.3, χ2=1.2) or QTc prolongation/torsade de pointes (1.0 95% CI 0.7–1.9, χ2=0.0006), but were for methadone (7.2 95% CI 6.9–7.5, χ2=9160; 10.6 95% CI 9.7–11.8, χ2=3305, respectively). Conclusion In spontaneously reported adverse events, methadone is associated with disproportionate reporting of cardiac arrhythmias, whereas buprenorphine is not. Although these findings probably reflect clinically relevant differences, a causal connection cannot be presumed and disproportionality analysis cannot quantify absolute risk per treatment episode. Population-based studies to definitively quantify differential incidence rates are warranted. PMID:26075588

Inverse Correlation between the Atrial Fibrillatory Rate and the Ventricular Repolarization Time: Observations at Baseline and after an Intravenous Infusion of a Combined Potassium and Sodium Current Blocker.

PubMed

Edvardsson, Nils; Aunes, Maria; Frison, Lars; Berggren, Anders R

2016-05-01

The atrial fibrillatory rate (AFR) and the ventricular rate and repolarization (QTcF) were studied at baseline and under the influence of the combined potassium and sodium current blocker AZD7009. Ninety-two patients with atrial fibrillation (AF) were randomized to an intravenous infusion of AZD7009 or placebo. The atrial fibrillatory activity in lead V1 was extracted using spatiotemporal QRST cancellation. The exponential decay (ED) characterized the degree of atrial signal organization. The mean (SD) AFR at baseline was 396  ±  57 (range 253-584) and 410 ± 33 (range 363-469) bpm in patients randomized to AZD7009 and placebo, respectively. The AFR decreased within the first minutes of the AZD7009 infusion and reached its minimum of 235 ± 34 bpm after 18 minutes. On placebo, the AFR was unchanged. On AZD7009, the ED decreased from 1.2 ± 0.3 to reach its lowest level at 0.7 ± 0.2 after 14 minutes. The ventricular rate did not change significantly over time. The AFR was statistically significantly related to the ventricular repolarization at baseline, the QTcF being longer at lower AFR values, and this relationship remained during and after AZD7009. In the full multivariate linear regression model, including age, sex, left ventricular ejection fraction, QRS duration, heart rate, QTcF, AF episode duration, AF history duration, and right atrial or left atrial size, only QTcF and age were statistically significantly correlated with the AFR. The correlation remained when the uncorrected QT interval was used. The QTcF was inversely correlated with AFR, both at baseline and during administration of AZD7009. The AFR was not correlated with the ventricular rate. © 2015 Wiley Periodicals, Inc.

Comparison between volatility return intervals of the S&P 500 index and two common models

NASA Astrophysics Data System (ADS)

Vodenska-Chitkushev, I.; Wang, F. Z.; Weber, P.; Yamasaki, K.; Havlin, S.; Stanley, H. E.

2008-01-01

We analyze the S&P 500 index data for the 13-year period, from January 1, 1984 to December 31, 1996, with one data point every 10 min. For this database, we study the distribution and clustering of volatility return intervals, which are defined as the time intervals between successive volatilities above a certain threshold q. We find that the long memory in the volatility leads to a clustering of above-median as well as below-median return intervals. In addition, it turns out that the short return intervals form larger clusters compared to the long return intervals. When comparing the empirical results to the ARMA-FIGARCH and fBm models for volatility, we find that the fBm model predicts scaling better than the ARMA-FIGARCH model, which is consistent with the argument that both ARMA-FIGARCH and fBm capture the long-term dependence in return intervals to a certain extent, but only fBm accounts for the scaling. We perform the Student's t-test to compare the empirical data with the shuffled records, ARMA-FIGARCH and fBm. We analyze separately the clusters of above-median return intervals and the clusters of below-median return intervals for different thresholds q. We find that the empirical data are statistically different from the shuffled data for all thresholds q. Our results also suggest that the ARMA-FIGARCH model is statistically different from the S&P 500 for intermediate q for both above-median and below-median clusters, while fBm is statistically different from S&P 500 for small and large q for above-median clusters and for small q for below-median clusters. Neither model can fully explain the entire regime of q studied.

PubMed Central

Russo, Vincenzo; Papa, Andrea Antonio; Rago, Anna; D'Ambrosio, Paola; Cimmino, Giovanni; Palladino, Alberto; Nigro, Gerardo

2016-01-01

Sudden cardiac death in myotonic dystrophy type I (DM1) patients can be attributed to atrioventricular blocks as far as to the development of life-threatening arrhythmias which occur even in hearts with normal left ventricular systolic and diastolic function. Heterogeneity of ventricular repolarization is considered to provide an electrophysiological substrate for malignant arrhythmias. QTc dispersion (QTc-D), JTc dispersion (JTc-D) and transmural dispersion of repolarization (TDR) could reflect the physiological variability of regional and transmural ventricular repolarization. Aim of the present study was to investigate the heterogeneity of ventricular repolarization in patients with DM1 and preserved diastolic and systolic cardiac function. The study enrolled 50 DM1 patients (mean age 44 ± 5 years; M:F: 29:21) with preserved systolic and diastolic function of left ventricle among 247 DM1 patients followed at Cardiomyology and Medical Genetics of Second University of Naples, and 50 sexand age-matched healthy controls. The electrocardiographic parameters investigated were the following: Heart Rate, QRS duration, maximum and minimum QT and JT intervals, QTc- D, JTc-D and TDR. Compared to the controls, the DM1 group presented increased values of QTc-D (86.7 ± 40.1 vs 52.3 ± 11.9 ms; p = 0.03), JTc-D (78.6 ± 31.3 vs 61.3 ± 10.2 ms; p = 0.001) and TDR (101.6 ± 18.06 vs 90.1 ± 14.3 ms; p = 0.004) suggesting a significant increase in regional and transmural heterogeneity of the ventricular repolarization in these patients, despite a preserved systolic and diastolic cardiac function. PMID:28344440

Predicting Optimal Dihydroartemisinin-Piperaquine Regimens to Prevent Malaria During Pregnancy for Human Immunodeficiency Virus-Infected Women Receiving Efavirenz.

PubMed

Wallender, Erika; Vucicevic, Katarina; Jagannathan, Prasanna; Huang, Liusheng; Natureeba, Paul; Kakuru, Abel; Muhindo, Mary; Nakalembe, Mirium; Havlir, Diane; Kamya, Moses; Aweeka, Francesca; Dorsey, Grant; Rosenthal, Philip J; Savic, Radojka M

2018-03-05

A monthly treatment course of dihydroartemisinin-piperaquine (DHA-PQ) effectively prevents malaria during pregnancy. However, a drug-drug interaction pharmacokinetic (PK) study found that pregnant human immunodeficiency virus (HIV)-infected women receiving efavirenz-based antiretroviral therapy (ART) had markedly reduced piperaquine (PQ) exposure. This suggests the need for alternative DHA-PQ chemoprevention regimens in this population. Eighty-three HIV-infected pregnant women who received monthly DHA-PQ and efavirenz contributed longitudinal PK and corrected QT interval (QTc) (n = 25) data. Population PK and PK-QTc models for PQ were developed to consider the benefits (protective PQ coverage) and risks (QTc prolongation) of alternative DHA-PQ chemoprevention regimens. Protective PQ coverage was defined as maintaining a concentration >10 ng/mL for >95% of the chemoprevention period. PQ clearance was 4540 L/day. With monthly DHA-PQ (2880 mg PQ), <1% of women achieved defined protective PQ coverage. Weekly (960 mg PQ) or low-dose daily (320 or 160 mg PQ) regimens achieved protective PQ coverage for 34% and >96% of women, respectively. All regimens were safe, with ≤2% of women predicted to have ≥30 msec QTc increase. For HIV-infected pregnant women receiving efavirenz, low daily DHA-PQ dosing was predicted to improve protection against parasitemia and reduce risk of toxicity compared to monthly dosing. NCT02282293. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Comparison of Digital 12-Lead ECG and Digital 12-Lead Holter ECG Recordings in Healthy Male Subjects: Results from a Randomized, Double-Blinded, Placebo-Controlled Clinical Trial.

PubMed

Wang, Duolao; Bakhai, Ameet; Arezina, Radivoj; Täubel, Jörg

2016-11-01

Electrocardiogram (ECG) variability is greatly affected by the ECG recording method. This study aims to compare Holter and standard ECG recording methods in terms of central locations and variations of ECG data. We used the ECG data from a double-blinded, placebo-controlled, randomized clinical trial and used a mixed model approach to assess the agreement between two methods in central locations and variations of eight ECG parameters (Heart Rate, PR, QRS, QT, RR, QTcB, QTcF, and QTcI intervals). A total of 34 heathy male subjects with mean age of 25.7 ± 4.78 years were randomized to receive either active drug or placebo. Digital 12-lead ECG and digital 12-lead Holter ECG recordings were performed to assess ECG variability. There are no significant differences in least square mean between the Holter and the standard method for all ECG parameters. The total variance is consistently higher for the Holter method than the standard method for all ECG parameters except for QRS. The intraclass correlation coefficient (ICC) values for the Holter method are consistently lower than those for the standard method for all ECG parameters except for QRS, in particular, the ICC for QTcF is reduced from 0.86 for the standard method to 0.67 for the Holter method. This study suggests that Holter ECGs recorded in a controlled environment are not significantly different but more variable than those from the standard method. © 2016 Wiley Periodicals, Inc.

Evaluation of 5 Hour Energy Drink on the Blood Pressure and Electrocardiograph Parameters on Young Healthy Volunteers: A Randomized, Double Blind, Crossover, Placebo-Controlled Trial (Presentation)

DTIC Science & Technology

2014-02-11

other substances. • There have been reports of atrial fibrillation , Takotsubo cardiomyopathy and sudden cardiac deaths in healthy individuals...baseline cardiac rhythm, history of atrial or ventricular arrhythmia, baseline corrected QT (QTc) interval greater than 440 milliseconds (msec

Association of functional genetic variants of A-kinase anchoring protein 10 with QT interval length in full-term Polish newborns.

PubMed

Łoniewska, Beata; Kaczmarczyk, Mariusz; Clark, Jeremy Simon; Gorący, Iwona; Horodnicka-Józwa, Anita; Ciechanowicz, Andrzej

2015-03-16

A-Kinase Anchoring Proteins (AKAPs) coordinate the specificity of protein kinase A signaling by localizing the kinase to subcellular sites. The 1936G (V646) AKAP10 allele has been associated in adults with low cholinergic/vagus nerve sensitivity, shortened PR intervals in ECG recording and in newborns with increased blood pressure and higher cholesterol cord blood concentration. The aim of the study was to answer the question of whether 1936A > G AKAP10 polymorphism is associated with the newborn electrocardiographic variables. Electrocardiograms were recorded from 114 consecutive healthy Polish newborns (55 females, 59 males), born after 37 gestational weeks to healthy women with uncomplicated pregnancies. All recordings were made between 3(rd) and 7(th) day of life to avoid QT variability. The heart rate per minute and duration of PR, QRS, RR and QT intervals were usually measured. The ECGs were evaluated independently by three observers. At birth, cord blood of neonates was obtained for isolation of genomic DNA. The distribution of anthropometric and electrocardiographic variables in our cohort approached normality (skewness < 2 for all variables). No significant differences in anthropometric variables and electrocardiographic traits with respect to AKAP10 genotype were found. Multiple regression analysis with adjustment for gender, gestational age and birth mass revealed that QTc interval in GG AKAP10 homozygotes was significantly longer, but in range, when compared with A alleles carriers (AA + AG, recessive mode of inheritance). No rhythm disturbances were observed. Results demonstrate possible association between AKAP10 1936A > G variant and QTc interval in Polish newborns.

Localization of an Ataxia-Telangiectasia Gene to an −500-kb Interval on Chromosome 11q23.1: Linkage Analysis of 176 Families by an International Consortium

PubMed Central

Lange, Ethan; Borresen, Anna-Lise; Chen, Xiaoguang; Chessa, Luciana; Chiplunkar, Sujata; Concannon, Patrick; Dandekar, Sugandha; Gerken, Steven; Lange, Kenneth; Liang, Teresa; McConville, Carmel; Polakow, Jeff; Porras, Oscar; Rotman, Galit; Sanal, Ozden; Sheikhavandi, Sepideh; Shiloh, Yosef; Sobel, Eric; Taylor, Malcolm; Telatar, Milhan; Teraoka, Sharon; Tolun, Aslihan; Udar, Nitin; Uhrhammer, Nancy; Vanagaite, Lina; Wang, Zhijun; Wapelhorst, Beth; Wright, Jocyndra; Yang, Huan-Ming; Yang, Lan; Ziv, Yael; Gatti, Richard A.

1995-01-01

We describe a 20-point linkage analysis map of chromosome 11q22-23 that is based on genotyping 249 families (59 CEPH and 190 A-T). Monte Carlo linkage analyses of 176 ataxia-telangiectasia (A-T) families localizes the major A-T locus to the region between S1819(A4) and S1818(A2). When seven nonlinking families were excluded from subsequent analyses, a 2-lod support interval of ∼500 kb was identified between S1819(A4) and S1294. No recombinants were observed between A-T and markers S384, B7, S535, or S1294. Only 17 of the international consortium families have been assigned to complementation groups. The available evidence favors either a cluster of A-T genes on chromosome 11 or intragenic defects in a single gene. PMID:7611279

Differential Changes in QTc Duration during In-Hospital Haloperidol Use

PubMed Central

Blom, Marieke T.; Bardai, Abdennasser; van Munster, Barbara C.; Nieuwland, Mei-Ing; de Jong, Hendrik; van Hoeijen, Daniel A.; Spanjaart, Anne M.; de Boer, Anthonius; de Rooij, Sophia E.; Tan, Hanno L.

2011-01-01

Aims To evaluate changes in QT duration during low-dose haloperidol use, and determine associations between clinical variables and potentially dangerous QT prolongation. Methods In a retrospective cohort study in a tertiary university teaching hospital in The Netherlands, all 1788 patients receiving haloperidol between 2005 and 2007 were studied; ninety-seven were suitable for final analysis. Rate-corrected QT duration (QTc) was measured before, during and after haloperidol use. Clinical variables before haloperidol use and at the time of each ECG recording were retrieved from hospital charts. Mixed model analysis was used to estimate changes in QT duration. Risk factors for potentially dangerous QT prolongation were estimated by logistic regression analysis. Results Patients with normal before-haloperidol QTc duration (male ≤430 ms, female ≤450 ms) had a significant increase in QTc duration of 23 ms during haloperidol use; twenty-three percent of patients rose to abnormal levels (male ≥450 ms, female ≥470 ms). In contrast, a significant decrease occurred in patients with borderline (male 430–450 ms, female 450–470 ms) or abnormal before-haloperidol QTc duration (15 ms and 46 ms, respectively); twenty-three percent of patients in the borderline group, and only 9% of patients in the abnormal group obtained abnormal levels. Potentially dangerous QTc prolongation was independently associated with surgery before haloperidol use (ORadj 34.9, p = 0.009) and before-haloperidol QTc duration (ORadj 0.94, p = 0.004). Conclusion QTc duration during haloperidol use changes differentially, increasing in patients with normal before-haloperidol QTc duration, but decreasing in patients with prolonged before-haloperidol QTc duration. Shorter before-haloperidol QTc duration and surgery before haloperidol use predict potentially dangerous QTc prolongation. PMID:21961030

Electrocardiogram Changes with Acute Alcohol Intoxication: A Systematic Review.

PubMed

Raheja, Hitesh; Namana, Vinod; Chopra, Kirti; Sinha, Ankur; Gupta, Sushilkumar Satish; Kamholz, Stephan; Moskovits, Norbert; Shani, Jacob; Hollander, Gerald

2018-01-01

Acute alcohol intoxication has been associated with cardiac arrhythmias but the electrocardiogram (ECG) changes associated with acute alcohol intoxication are not well defined in the literature. Highlight the best evidence regarding the ECG changes associated with acute alcohol intoxication in otherwise healthy patients and the pathophysiology of the changes. A literature search was carried out; 4 studies relating to ECG changes with acute alcohol intoxication were included in this review. Of the total 141 patients included in the review, 90 (63.8%) patients had P-wave prolongation, 80 (56%) patients had QTc prolongation, 19 (13.5%) patients developed T-wave abnormalities, 10 (7%) patients had QRS complex prolongation, 3 (2.12%) patients developed ST-segment depressions. The most common ECG changes associated with acute alcohol intoxication are (in decreasing order of frequency) P-wave and QTc prolongation, followed by T-wave abnormalities and QRS complex prolongation. Mostly, these changes are completely reversible.

V-T theory for the self-intermediate scattering function in a monatomic liquid

NASA Astrophysics Data System (ADS)

Wallace, Duane C.; Chisolm, Eric D.; De Lorenzi-Venneri, Giulia

2017-02-01

In V-T theory the atomic motion is harmonic vibrations in a liquid-specific potential energy valley, plus transits, which move the system rapidly among the multitude of such valleys. In its first application to the self intermediate scattering function (SISF), V-T theory produced an accurate account of molecular dynamics (MD) data at all wave numbers q and time t. Recently, analysis of the mean square displacement (MSD) resolved a crossover behavior that was not observed in the SISF study. Our purpose here is to apply the more accurate MSD calibration to the SISF, and assess the results. We derive and discuss the theoretical equations for vibrational and transit contributions to the SISF. The time evolution is divided into three successive intervals: the vibrational interval when the vibrational contribution alone accurately accounts for the MD data; the crossover when the vibrational contribution saturates and the transit contribution becomes resolved; and the diffusive interval when the transit contribution alone accurately accounts for the MD data. The resulting theoretical error is extremely small at all q and t. V-T theory is compared to mode-coupling theories for the MSD and SISF, and to recent developments in Brownian motion experiments and theory.

Chloroquine cardiotoxicity mimicking connective tissue disease heart involvement.

PubMed

Vereckei, András; Fazakas, Adám; Baló, Timea; Fekete, Béla; Molnár, Mária Judit; Karádi, István

2013-04-01

The authors report a case of rare chloroquine cardiotoxicity mimicking connective tissue disease heart involvement in a 56-year-old woman with mixed connective tissue disease (MCTD) manifested suddenly as third degree A-V block with QT(c) interval prolongation and short torsade de pointes runs ultimately degenerating into ventricular fibrillation. Immunological tests suggested an MCTD flare, implying that cardiac arrest had resulted from myocardial involvement by MCTD. However, QT(c) prolongation is not a characteristic of cardiomyopathy caused by connective tissue disease, unless anti-Ro/SSA positivity is present, but that was not the case. Therefore, looking for another cause of QT(c) prolongation the possibility of chloroquine cardiotoxicity emerged, which the patient had been receiving for almost two years in supramaximal doses. Biopsy of the deltoid muscle was performed, because in chloroquine toxicity, specific lesions are present both in the skeletal muscle and in the myocardium, and electron microscopy revealed the accumulation of cytoplasmic curvilinear bodies, which are specific to antimalarial-induced myocyte damage and are absent in all other muscle diseases, except neuronal ceroid lipofuscinosis. Thus, the diagnosis of chloroquine cardiotoxicity was established. It might be advisable to supplement the periodic ophthalmological examination, which is currently the only recommendation for patients on long-term chloroquine therapy, with ECG screening.

Atypical Findings in Massive Bupropion Overdose: A Case Report and Discussion of Psychopharmacologic Issues.

PubMed

Zhu, Yuanjia; Kolawole, Tiwalola; Jimenez, Xavier F

2016-09-01

Bupropion is an atypical antidepressant that is structurally similar to amphetamines. Its primary toxic effects include seizure, sinus tachycardia, hypertension, and agitation; however, at higher amounts of ingestion, paradoxical cardiac effects are seen. We report the case of a 21-year-old woman who ingested 13.5 g of bupropion, a dose higher than any other previously reported. The patient presented with seizure, sinus tachycardia with prolonged QTc and QRS intervals, dilated pupils, and agitation. Four days after overdose, the patient's sinus tachycardia and prolonged QTc and QRS intervals resolved with symptomatic management, but she soon developed sinus bradycardia, hypotension, and mild transaminitis. With continued conservative management and close monitoring, her sinus bradycardia resolved 8 days after the overdose. The transaminitis resolved 12 days after the overdose. Our findings are consistent with previously reported toxic effects associated with common overdose amounts of bupropion. In addition, we have observed transient cardiotoxicity manifesting as sinus bradycardia associated with massive bupropion overdose. These findings are less frequently reported and must be considered when managing patients with massive bupropion overdose. We review the psychopharmacologic implications of this and comment on previous literature.

Emotional stress as a cause of syncope and torsade de pointes in patients with long QT syndrome.

PubMed

Vukmirović, Mihailo; Vukmirović, Irena Tomašević; Angelkov, Lazar; Vukmirović, Filip

2015-02-01

Long QT syndrome (LQTS) is a disorder of myocardial repolarization characterized by the prolongation of QT interval and high risk propensity of torsade de pointes (TdP) that can lead to syncope, cardiac arrest and sudden death. Episodes may be provoked by various stimuli depending on the type of the condition. A 25-year-old famele patient was hospitalized due to syncope that occurred immediately after her solo concert, first time in her life. The patient studied solo singing and after intensive preparations the first solo concert was organized. Electrocardiography (ECG) on admission registered frequent ventricular premature beats (VES), followed by polymorphic ventricular tachycardia--TdP that degenerated into ventricular fibrilation (VF). After immediate cardioversion magnesium and beta-blockers were administered. TdP was registered again several times preceded by VES. The corrected QT interval (QTc) was 516 msec. For secondary prevention of sudden cardiac death, a cardioverter defibrillator was implanted, and beta-blockers continued. After a 1-year follow-up there were no recurrent episodes of TdP, and measured QTc was reduced to 484 msec. Patients with syncope following intensive emotional stress should be evaluated for malignant arrhythmias in the context of LQTS.

VizieR Online Data Catalog: Final Kepler transiting planet search (DR25) (Twicken+, 2016)

NASA Astrophysics Data System (ADS)

Twicken, J. D.; Jenkins, J. M.; Seader, S. E.; Tenenbaum, P.; Smith, J. C.; Brownston, L. S.; Burke, C. J.; Catanzarite, J. H.; Clarke, B. D.; Cote, M. T.; Girouard, F. R.; Klaus, T. C.; Li, J.; McCauliff, S. D.; Morris, R. L.; Wohler, B.; Campbell, J. R.; Uddin, A. K.; Zamudio, K. A.; Sabale, A.; Bryson, S. T.; Caldwell, D. A.; Christiansen, J. L.; Coughlin, J. L.; Haas, M. R.; Henze, C. E.; Sanderfer, D. T.; Thompson, S. E.

2017-01-01

The Kepler spacecraft is in an Earth-trailing heliocentric orbit and maintained a boresight pointing centered on α=19h22m40s, δ=+44.5° during the primary mission. The Kepler photometer acquired data on a 115-square-degree region of the sky. The data were acquired on 29.4-minute intervals, colloquially known as "long cadences". Long-cadence pixel values were obtained by accumulating 270 consecutive 6.02s exposures. Science acquisition of Q1 data began at 2009-05-13 00:01:07Z, and acquisition of Q17 data concluded at 2013-05-11 12:16:22Z. This time period contains 71427 long-cadence intervals. A total of 198709 targets observed by Kepler were searched for evidence of transiting planets in the final Q1-Q17 pipeline run (see Table1). The results of past Kepler Mission transiting planet searches have been presented in Tenenbaum et al. 2012 (Cat. J/ApJS/199/24) for Quarter 1 through Quarter 3 (i.e., Q1-Q3), Tenenbaum et al. 2013ApJS..206....5T for Q1-Q12, Tenenbaum et al. 2014ApJS..211....6T for Q1-Q16, and Seader et al. 2015 (Cat. J/ApJS/217/18) for Q1-Q17. We now present results of the final Kepler transiting planet search encompassing the complete 17-quarter primary mission. The data release for the final Q1-Q17 pipeline processing is referred to as Data Release 25 (DR25). (3 data files).

ECG Changes in Young Healthy Smokers: A Simple and Cost-Effective Method to Assess Cardiovascular Risk According to Pack-Years of Smoking.

PubMed

Sharma, Nirmal Kumar; Jaiswal, Kapil Kumar; Meena, S R; Chandel, Rahul; Chittora, Saurabh; Goga, Prem Singh; Harish, H B; Sagar, Rajesh

2017-06-01

To document the prevalence of ECG abnormalities in young healthy smokers and compare ECG changes in smokers, young healthy non-smokers and amongst smokers with different pack years. This was a prospective case-control study consisting of 200 young healthy male and female individuals, 150 smokers and 50 non-smokers between ages 25-40 years, further categorized and compared according to age, sex and pack years of smoking. The ECG recordings were analyzed for different ECG parameters like heart rate, P-wave duration, P-wave amplitude, PR interval, QRS duration, RR-interval, ST-segment duration, QT interval and QTc interval. The results were compared using statistical tools. In present study abnormalities in ECG parameters were significantly more prevalent in smokers as compared to non-smokers (56.66 % Vs 6.00 %) (p <.0001). Heart rate and QTc-interval increased with increase in the number of pack-years. This increase was reflected more in female with a similar number of pack years. P-wave amplitude tended to increase with increase in the number of pack years more so in males. P-wave duration, PR-interval, QRS-duration and RR-interval tended to decrease with increase in the number of pack years more so in females with similar number of pack years. QT-interval and ST-segment duration tended to decrease with increase in the number of pack years more so in males. ECG abnormalities in this study indicate cardiovascular risk in term of cardiac arrhythmia, pulmonary arterial hypertension, heart blocks etc in such subjects. As this procedure is non-invasive and cost effective it is potentially an effective and yet a simple method for cardiovascular risk evaluation in smokers. Furthermore, such ECG abnormalities may guide the clinician for risk evaluation in smokers and may be used to convince the smokers to quit smoking.

Heterogeneous Phenotype of Long QT Syndrome Caused by the KCNH2-H562R Mutation: Importance of Familial Genetic Testing.

PubMed

Muñoz-Esparza, Carmen; García-Molina, Esperanza; Salar-Alcaraz, Mariela; Peñafiel-Verdú, Pablo; Sánchez-Muñoz, Juan J; Martínez Sánchez, Juan; Cabañas-Perianes, Valentín; Valdés Chávarri, Mariano; García Alberola, Arcadio; Gimeno-Blanes, Juan R

2015-10-01

Long QT syndrome is an inherited ion channelopathy that leads to syncope and sudden death. Because of the heterogeneous phenotype of this disease, genetic testing is fundamental to detect individuals with concealed long QT syndrome. In this study, we determined the features of a family with 13 carriers of the KCNH2-H562R missense mutation, which affects the pore region of the HERG channel. We identified the KCNH2-H562R mutation in a 65-year-old man with a prolonged QTc interval who had experienced an episode of torsade de pointes. Subsequently, a total of 13 mutation carriers were identified in the family. Carriers (age 48 [26] years; 46% males) underwent clinical evaluation, electrocardiography and echocardiography. The mean (standard deviation) QTc in carriers was 493 (42) ms (3 [23%] showed normal QTc); 6 (46%) had symptoms (4, syncope; 1, sudden death; 1, aborted sudden death [proband]). While under treatment with beta-blockers, 11 of 12 carriers (92%) remained asymptomatic at 5 years of follow-up (1 patient required left cardiac sympathectomy). The QTc shortening with beta-blockers was 50 (37) ms. There was 1 sudden death in a patient who refused treatment. Family study is essential in the interpretation of a genetic testing result. This article describes the heterogeneous and variable phenotype of a large family with the KCNH2-H562R mutation and highlights the role of genetic study for the appropriate identification of at-risk individuals who would benefit from treatment. Copyright © 2014 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

Population-based studies of antithyroid drugs and sudden cardiac death

PubMed Central

van Noord, Charlotte; Sturkenboom, Miriam C J M; Straus, Sabine M J M; Hofman, Albert; Witteman, Jacqueline C M; Stricker, Bruno H Ch

2009-01-01

AIM Thyroid free T4 is associated with QTc-interval prolongation, which is a risk factor for sudden cardiac death (SCD). Hyperthyroidism has been associated with SCD in case reports, but there are no population-based studies confirming this. The aim was to investigate whether use of antithyroid drugs (as a direct cause or as an indicator of poorly controlled hyperthyroidism) is associated with an increased risk of SCD. METHODS We studied the occurrence of SCD in a two-step procedure in two different Dutch populations. First, the prospective population-based Rotterdam Study including 7898 participants (≥55 years old). Second, we used the Integrated Primary Care Information (IPCI) database, which is a longitudinal general practice research database to see whether we could replicate results from the first study. Drug use at the index date was assessed with prescription information from automated pharmacies (Rotterdam Study) or drug prescriptions from general practices (IPCI). We used a Cox proportional hazards model in a cohort analysis, adjusted for age, gender and use of QTc prolonging drugs (Rotterdam Study) and conditional logistic regression analysis in a case–control analysis, matched for age, gender, practice and calendar time and adjusted for arrhythmia and cerebrovascular ischaemia (IPCI). RESULTS In the Rotterdam Study, 375 participants developed SCD during follow-up. Current use of antithyroid drugs was associated with SCD [adjusted hazard ratio 3.9; 95% confidence interval (CI) 1.7, 8.7]. IPCI included 1424 cases with SCD and 14 443 controls. Also in IPCI, current use of antithyroid drugs was associated with SCD (adjusted odds ratio 2.9; 95% CI 1.1, 7.4). CONCLUSIONS Use of antithyroid drugs was associated with a threefold increased risk of SCD. Although this might be directly caused by antithyroid drug use, it might be more readily explained by underlying poorly controlled hyperthyroidism, since treated patients who developed SCD still had low thyroid-stimulating hormone levels shortly before death. PMID:19740403

Kinetic rate laws as derived from order parameter theory I: Theoretical concepts

NASA Astrophysics Data System (ADS)

Salje, Ekhard

1988-03-01

A theoretical concept is outlined, which links the kinetics of structural transformations with thermodynamic theories of structural phase transitions. Starting from Landau theory and Markovian processes, the general rate laws for crystals with long correlation lengths are derived. The rate laws in Ginzburg-Landau theory are 269_2004_Article_BF00311038_TeX2GIFE1.gif 1{text{n }}Δ Q - 1{text{n }}fleft( Q right) ∝ - t/tau {text{ for }}T ≪ T_c {text{ and }}T ≫ T_c and Q 2∝ for T ≈ T c . The physical meaning of the time constant τ and the correction term f( Q) are explained. Fluctuations of the order parameter lead to damping behaviour with explicit dependence on the wavelength of the fluctuation wave and modulation-dependent variations of the lattice strain. Lattice relaxations and activation processes are discussed. Typical rate laws are found to follow 269_2004_Article_BF00311038_TeX2GIFE2.gif begin{gathered} ln Δ Q = rlnΔ t, \\ lnQ/Q + {1\\varepsilon }/{2k_B T}left( {Q^2 - Q_0^2 } right) = {Δ t}/{tau *} \\ which leads for short time intervals to a linear rate law 269_2004_Article_BF00311038_TeX2GIFE3.gif Δ Q ∝ Δ t It is shown that linear terms in the Landau potential are equivalent to a logarithmic decay of the excess entropy Δ S ∝ ln Δ t which is also expected to be the dominant rate law in field-induced pseudo-spin glasses: 269_2004_Article_BF00311038_TeX2GIFE4.gif Δ Q ∝ 1{text{n }}Δ t{text{ and }}1{text{n}}left( {Δ {text{Q}} \\cdot Δ {text{t}}} right) = A{text{ }}Δ t + B Fluctuations lead to spatially heterogeneous distributions of the order parameter. A two phase field is found in this case where the nucleation energy is overcome by fluctuation processes. Random fields, arising, for example, from lattice imperfections, lead also to spacially inhomogeneous material. The dominant microstructure is the lattice modulation mostly in the form of a cross hatched pattern (tweed) but also in the form of incommensurate modulations.

Aldosterone-to-Renin Ratio Is Associated With Reduced 24-Hour Heart Rate Variability and QTc Prolongation in Hypertensive Patients

PubMed Central

Grübler, Martin R.; Kienreich, Katharina; Gaksch, Martin; Verheyen, Nicolas; Hartaigh, Bríain Ó.; Fahrleitner-Pammer, Astrid; März, Winfried; Schmid, Johannes; Oberreither, Eva-Maria; Wetzel, Julia; Catena, Cristiana; Sechi, Leonardo A.; Pieske, Burkert; Tomaschitz, Andreas; Pilz, Stefan

2016-01-01

Abstract Aldosterone is considered to exert direct effects on the myocardium and the sympathetic nervous system. Both QT time and heart rate (HR) variability (HRV) are considered to be markers of arrhythmic risk and autonomous dysregulation. In this study, we investigated the associations between aldosterone, QT time, and HRV in patients with arterial hypertension. We recruited 477 hypertensive patients (age: 60.2 ± 10.2 years; 52.3% females) with a mean systolic/diastolic 24-hour ambulatory blood pressure monitoring (ABPM) value of 128 ± 12.8/77.1 ± 9.2 mmHg and with a median of 2 (IQR: 1–3) antihypertensive agents. Patients were recruited from the outpatient clinic at the Department of Internal Medicine of the Medical University of Graz, Austria. Blood samples, 24-hour HRV derived from 24-hour blood pressure monitoring (ABPM) and ECG's were obtained. Plasma aldosterone and plasma renin concentrations were measured by means of a radioimmunoassay. Twenty-four-hour urine specimens were collected in parallel with ABPM. Mean QTc was 423.3 ± 42.0 milliseconds for males and 434.7 ± 38.3 milliseconds for females. Mean 24H-HR and 24H-HRV was 71.9 ± 9.8 and 10.0 ± 3.6 bpm, respectively. In linear regression analyses adjusted for age, sex, body mass index, ABPM, and current medication, aldosterone to active renin ratio (AARR) was significantly associated with the QTc interval, a marker for cardiac repolarization abnormalities (mean = 426 ± 42.4 milliseconds; β-coefficient = 0.121; P = 0.03) as well as with the 24-hour heart rate variability a surrogate for autonomic dysfunction (median = 9.67 [IQR = 7.38–12.22 bpm]; β-coefficient = −0.133; P = 0.01). In hypertensive patients, AARR is significantly related to QTc prolongation as well as HRV. Further studies investigating the effects of mineralocorticoid receptor blocker and aldosterone synthase inhibitors on QTc and HRV are warranted. PMID:26937909

A KCNQ1 mutation contributes to the concealed type 1 long QT phenotype by limiting the Kv7.1 channel conformational changes associated with protein kinase A phosphorylation.

PubMed

Bartos, Daniel C; Giudicessi, John R; Tester, David J; Ackerman, Michael J; Ohno, Seiko; Horie, Minoru; Gollob, Michael H; Burgess, Don E; Delisle, Brian P

2014-03-01

Type 1 long QT syndrome (LQT1) is caused by loss-of-function mutations in the KCNQ1-encoded Kv7.1 channel that conducts the slowly activating component of the delayed rectifier K(+) current (IKs). Clinically, the diagnosis of LQT1 is complicated by variable phenotypic expressivity, whereby approximately 25% of genotype-positive individuals present with concealed LQT1 (resting corrected QT [QTc] interval ≤460 ms). To determine whether a specific molecular mechanism contributes to concealed LQT1. We identified a multigenerational LQT1 family whereby 79% of the patients genotype-positive for p.Ile235Asn-KCNQ1 (I235N-Kv7.1) have concealed LQT1. We assessed the effect I235N-Kv7.1 has on IKs and the ventricular action potential (AP) by using in vitro analysis and computational simulations. Clinical data showed that all 10 patients with I235N-Kv7.1 have normal resting QTc intervals but abnormal QTc interval prolongation during the recovery phase of an electrocardiographic treadmill stress test. Voltage-clamping HEK293 cells coexpressing wild-type Kv7.1 and I235N-Kv7.1 (to mimic the patients' genotypes) showed that I235N-Kv7.1 generated relatively normal functioning Kv7.1 channels but were insensitive to protein kinase A (PKA) activation. Phosphomimetic and quinidine sensitivity studies suggest that I235N-Kv7.1 limits the conformational changes in Kv7.1 channels, which are necessary to upregulate IKs after PKA phosphorylation. Computational ventricular AP simulations predicted that the PKA insensitivity of I235N-Kv7.1 is primarily responsible for prolonging the AP with β-adrenergic stimulation, especially at slower cycle lengths. KCNQ1 mutations that generate relatively normal Kv7.1 channels, but limit the upregulation of IKs by PKA activation, likely contribute to concealed LQT1. Copyright © 2014 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

Correlation between ECG changes and early left ventricular remodeling in preadolescent footballers.

PubMed

Zdravkovic, M; Milovanovic, B; Hinic, S; Soldatovic, I; Durmic, T; Koracevic, G; Prijic, S; Markovic, O; Filipovic, B; Lovic, D

2017-03-01

The aim of this study was to assess the early electrocardiogram (ECG) changes induced by physical training in preadolescent elite footballers. This study included 94 preadolescent highly trained male footballers (FG) competing in Serbian Football League (minimum of 7 training hours/week) and 47 age-matched healthy male controls (less than 2 training hours/week) (CG). They were screened by ECG and echocardiography at a tertiary referral cardio center. Sokolow-Lyon index was used as a voltage electrocardiographic criterion for left ventricular hypertrophy diagnosis. Characteristic ECG intervals and voltage were compared and reference range was given for preadolescent footballers. Highly significant differences between FG and CG were registered in all ECG parameters: P-wave voltage (p < 0.001), S-wave (V1 or V2 lead) voltage (p < 0.001), R-wave (V5 and V6 lead) voltage (p < 0.001), ECG sum of S V 1-2  + R V 5-6 (p < 0.001), T-wave voltage (p < 0.001), QRS complex duration (p < 0.001), T-wave duration (p < 0.001), QTc interval duration (p < 0.001), and R/T ratio (p < 0.001). No differences were found in PQ interval duration between these two groups (p > 0.05). During 6-year follow-up period, there was no adverse cardiac event in these footballers. None of them expressed pathological ECG changes. Benign ECG changes are presented in the early stage of athlete's heart remodeling, but they are not related to pathological ECG changes and they should be regarded as ECG pattern of LV remodeling.

V-T theory for the Self-Intermediate Scattering Function in a Monatomic Liquid

DOE PAGES

Wallace, Duane C.; Chisolm, Eric D.; De Lorenzi-Venneri, Giulia

2016-12-12

In V-T theory the atomic motion is harmonic vibrations in a liquid-specific potential energy valley, plus transits, which move the system rapidly among the multitude of such valleys. Here, in its first application to the self intermediate scattering function (SISF), V-T theory produced an accurate account of molecular dynamics (MD) data at all wave numbers q and time t. Recently, analysis of the mean square displacement (MSD) resolved a crossover behavior that was not observed in the SISF study. Our purpose here is to apply the more accurate MSD calibration to the SISF, and assess the results. We derive andmore » discuss the theoretical equations for vibrational and transit contributions to the SISF. The time evolution is divided into three successive intervals: the vibrational interval when the vibrational contribution alone accurately accounts for the MD data; the crossover when the vibrational contribution saturates and the transit contribution becomes resolved; and the diffusive interval when the transit contribution alone accurately accounts for the MD data. Finally, the resulting theoretical error is extremely small at all q and t. V-T theory is compared to mode-coupling theories for the MSD and SISF, and to recent developments in Brownian motion experiments and theory.« less

Analytical validation and establishment of reference intervals for a 'high-sensitivity' cardiac troponin-T assay in horses.

PubMed

Shields, E; Seiden-Long, I; Massie, S; Passante, S; Leguillette, R

2016-06-13

Cardiac troponin-I assays have been validated in horses.'High-sensitivity' cardiac troponin assays are now the standard in human cardiology. Appropriately validate the'high-sensitivity' cardiac Troponin-T (hscTnT) assay for clinical use in horses, establish reference intervals, determine the biological variation, and demonstrate assay utility in selected clinical cases. Analytical validation of the Roche hscTnT assay included within- and between-run precision, linear dose response, limit of quantitation (LoQ), stability, and comparison with cTn-I (iSTAT). Reference intervals and biological variation were determined using adult, healthy, Non-Competition Horses (N = 125) and Racing-Thoroughbreds (N = 178). HscTnT levels were measured in two horses with cardiac pathology. The hscTnT demonstrates acceptable within-run (L1 = 6.5 ng/L, CV 14.9 %, L2 = 10.1 ng/L, CV 8.7 %, L3 = 15.3 ng/L, CV 5.4 %) and between-run precision (L1 = 12.2 ng/L, CV 8.4 %, L2 = 57.0 ng/L, CV 8.4 %, L3 = 256.0 ng/L, CV 9.0 %). The assay was linear from 3 to 391 ng/L. The LoQ was validated at 3 ng/L. Samples demonstrated insignificant decay over freeze-thaw cycle. Comparison with cTnI assay showed excellent correlation (range: 8.0-3535.0 ng/L, R(2) = 0.9996). Reference intervals: The upper 95(th) and 99(th) percentile of the hscTnT population distribution were 6.8 and 16.2 ng/L in Non-Competition Horses, and 14.0 and 23.2 ng/L in Racing-Thoroughbreds. Between-breed, diurnal effect, and between-day variation was below LoQ. Two clinical cases with presumed cardiac pathology had hscTnT levels of 220.9 ng/L and 5723.0 ng/L. This benchmark study is the first to comply with CLSI guidelines, thus further establishing the performance characteristics of the hscTnT assay, and reference intervals in healthy horses. Two clinical cases demonstrated further the clinical utility of the assay.

Electromagnetic energy radiated from mobile phone alters electrocardiographic records of patients with ischemic heart disease.

PubMed

Alhusseiny, Ah; Al-Nimer, Ms; Majeed, Ad

2012-07-01

Electromagnetic energy radiated from mobile phones did not show significant effect on the blood pressure, heart rate, and electrocardiographic (ECG) parameters in animals and humans. This study aimed to investigate the effect of radiofrequency of mobile phone on the electrocardiographic parameters in patients with history of ischemic heart disease, taking into consideration the gender factor. A total number of 356 participants (129 males and 227 females) were admitted in this study. They were grouped into: subjects without cardiac diseases (Group I), patients with ischemic heart disease (Group II), and patients with history of cardiac diseases not related to myocardial ischemia (Group III). Electrocardiogram was obtained from each patient when the mobile phone was placed at the belt level and over precordium in turn-off mode (baseline) and turn-on mode for 40 sec ringing. The records of ECG were electronically analyzed. Prolongation of QTc interval was significantly observed in male gender of Groups I and III (P < 0.001). Male patients of Group II showed significant QTc interval prolongation (P = 0.01) and changes in the voltage criteria (P = 0.001). These changes were not observed in female patients with ischemic heart disease. The position of mobile at the belt level or over the precordium showed effects on the heart. The radiofrequency of cell phone prolongs the QT interval in human beings and it interferes with voltage criteria of ECG records in male patients with myocardial ischemia.

Resting ECG findings in elite football players.

PubMed

Bohm, Philipp; Ditzel, Roman; Ditzel, Heribert; Urhausen, Axel; Meyer, Tim

2013-01-01

The purpose of the study was to evaluate ECG abnormalities in a large sample of elite football players. Data from 566 elite male football players (57 of them of African origin) above 16 years of age were screened retrospectively (age: 20.9 ± 5.3 years; BMI: 22.9 ± 1.7 kg · m(-2), training history: 13.8 ± 4.7 years). The resting ECGs were analysed and classified according to the most current ECG categorisation of the European Society of Cardiology (ESC) (2010) and a classification of Pelliccia et al. (2000) in order to assess the impact of the new ESC-approach. According to the classification of Pelliccia, 52.5% showed mildly abnormal ECG patterns and 12% were classified as distinctly abnormal ECG patterns. According to the classification of the ESC, 33.7% showed 'uncommon ECG patterns'. Short-QT interval was the most frequent ECG pattern in this group (41.9%), followed by a shortened PR-interval (19.9%). When assessed with a QTc cut-off-point of 340 ms (instead of 360 ms), only 22.2% would have had 'uncommon ECG patterns'. Resting ECG changes amongst elite football players are common. Adjustment of the ESC criteria by adapting proposed time limits for the ECG (e.g. QTc, PR) should further reduce the rate of false-positive results.

Effects of work stress and home stress on autonomic nervous function in Japanese male workers

PubMed Central

MAEDA, Eri; IWATA, Toyoto; MURATA, Katsuyuki

2014-01-01

Autonomic imbalance is one of the important pathways through which psychological stress contributes to cardiovascular diseases/sudden death. Although previous studies have focused mainly on stress at work (work stress), the association between autonomic function and stress at home (home stress) is still poorly understood. The purpose was to clarify the effect of work/home stress on autonomic function in 1,809 Japanese male workers. We measured corrected QT (QTc) interval and QT index on the electrocardiogram along with blood pressure and heart rate. Participants provided self-reported information about the presence/absence of work/home stress and the possible confounders affecting QT indicators. Home stress was related positively to QT index (p=0.040) after adjusting for the possible confounders, though work stress did not show a significant relation to QTc interval or QT index. The odds ratio of home stress to elevated QT index (≥105) was 2.677 (95% CI, 1.050 to 6.822). Work/home stress showed no significant relation to blood pressure or heart rate. These findings suggest that autonomic imbalance, readily assessed by QT indicators, can be induced by home stress in Japanese workers. Additional research is needed to identify different types of home stress that are strongly associated with autonomic imbalance. PMID:25382383

Effects of work stress and home stress on autonomic nervous function in Japanese male workers.

PubMed

Maeda, Eri; Iwata, Toyoto; Murata, Katsuyuki

2015-01-01

Autonomic imbalance is one of the important pathways through which psychological stress contributes to cardiovascular diseases/sudden death. Although previous studies have focused mainly on stress at work (work stress), the association between autonomic function and stress at home (home stress) is still poorly understood. The purpose was to clarify the effect of work/home stress on autonomic function in 1,809 Japanese male workers. We measured corrected QT (QTc) interval and QT index on the electrocardiogram along with blood pressure and heart rate. Participants provided self-reported information about the presence/absence of work/home stress and the possible confounders affecting QT indicators. Home stress was related positively to QT index (p=0.040) after adjusting for the possible confounders, though work stress did not show a significant relation to QTc interval or QT index. The odds ratio of home stress to elevated QT index (≥105) was 2.677 (95% CI, 1.050 to 6.822). Work/home stress showed no significant relation to blood pressure or heart rate. These findings suggest that autonomic imbalance, readily assessed by QT indicators, can be induced by home stress in Japanese workers. Additional research is needed to identify different types of home stress that are strongly associated with autonomic imbalance.

Dronerarone acts as a selective inhibitor of 3,5,3'-triiodothyronine binding to thyroid hormone receptor-alpha1: in vitro and in vivo evidence.

PubMed

Van Beeren, H C; Jong, W M C; Kaptein, E; Visser, T J; Bakker, O; Wiersinga, W M

2003-02-01

Dronedarone (Dron), without iodine, was developed as an alternative to the iodine-containing antiarrhythmic drug amiodarone (AM). AM acts, via its major metabolite desethylamiodarone, in vitro and in vivo as a thyroid hormone receptor alpha(1) (TRalpha(1)) and TRbeta(1) antagonist. Here we investigate whether Dron and/or its metabolite debutyldronedarone inhibit T(3) binding to TRalpha(1) and TRbeta(1) in vitro and whether dronedarone behaves similarly to amiodarone in vivo. In vitro, Dron had a inhibitory effect of 14% on the binding of T(3) to TRalpha(1), but not on TRbeta(1). Desethylamiodarone inhibited T(3) binding to TRalpha(1) and TRbeta(1) equally. Debutyldronedarone inhibited T(3) binding to TRalpha(1) by 77%, but to TRbeta(1) by only 25%. In vivo, AM increased plasma TSH and rT(3), and decreased T(3). Dron decreased T(4) and T(3), rT(3) did not change, and TSH fell slightly. Plasma total cholesterol was increased by AM, but remained unchanged in Dron-treated animals. TRbeta(1)-dependent liver low density lipoprotein receptor protein and type 1 deiodinase activities decreased in AM-treated, but not in Dron-treated, animals. TRalpha(1)-mediated lengthening of the QTc interval was present in both AM- and Dron-treated animals. The in vitro and in vivo findings suggest that dronedarone via its metabolite debutyldronedarone acts as a TRalpha(1)-selective inhibitor.

Statistics of return intervals between long heartbeat intervals and their usability for online prediction of disorders

NASA Astrophysics Data System (ADS)

Bogachev, Mikhail I.; Kireenkov, Igor S.; Nifontov, Eugene M.; Bunde, Armin

2009-06-01

We study the statistics of return intervals between large heartbeat intervals (above a certain threshold Q) in 24 h records obtained from healthy subjects. We find that both the linear and the nonlinear long-term memory inherent in the heartbeat intervals lead to power-laws in the probability density function PQ(r) of the return intervals. As a consequence, the probability WQ(t; Δt) that at least one large heartbeat interval will occur within the next Δt heartbeat intervals, with an increasing elapsed number of intervals t after the last large heartbeat interval, follows a power-law. Based on these results, we suggest a method of obtaining a priori information about the occurrence of the next large heartbeat interval, and thus to predict it. We show explicitly that the proposed method, which exploits long-term memory, is superior to the conventional precursory pattern recognition technique, which focuses solely on short-term memory. We believe that our results can be straightforwardly extended to obtain more reliable predictions in other physiological signals like blood pressure, as well as in other complex records exhibiting multifractal behaviour, e.g. turbulent flow, precipitation, river flows and network traffic.

Significance of screening electrocardiogram before the initiation of amitriptyline therapy in children with functional abdominal pain.

PubMed

Patra, Kamakshya P; Sankararaman, Senthilkumar; Jackson, Robert; Hussain, Sunny Z

2012-09-01

Amitriptyline (AMT) is commonly used in the management of children with irritable bowel syndrome. AMT is pro-arrhythmogenic and increases the risk of sudden cardiac death. However, there is not enough data regarding the cardiac toxicity in therapeutic doses of AMT in children and the need for screening electrocardiogram (EKG). Errors in computer EKG interpretation are not uncommon. In a risk-prevention study, the authors sought to identify the true incidence of prolonged corrected QT (QTc) interval and other arrhythmias in children with irritable bowel syndrome before the initiation of AMT. Out of the 760 EKGs screened, 3 EKGs demonstrated a true prolonged QTc after the careful manual reading by a pediatric cardiologist and they were not picked by computer-generated reading. The authors conclude that screening EKG should always be performed on children before initiating AMT therapy. Also, the computer-generated EKG needs to be verified by a pediatric cardiologist to avoid serious misinterpretations.

Interaction Between Domperidone and Ketoconazole: Toward Prediction of Consequent QTc Prolongation Using Purely In Vitro Information

PubMed Central

Mishra, H; Polak, S; Jamei, M; Rostami-Hodjegan, A

2014-01-01

We aimed to investigate the application of combined mechanistic pharmacokinetic (PK) and pharmacodynamic (PD) modeling and simulation in predicting the domperidone (DOM) triggered pseudo-electrocardiogram modification in the presence of a CYP3A inhibitor, ketoconazole (KETO), using in vitro–in vivo extrapolation. In vitro metabolic and inhibitory data were incorporated into physiologically based pharmacokinetic (PBPK) models within Simcyp to simulate time course of plasma DOM and KETO concentrations when administered alone or in combination with KETO (DOM+KETO). Simulated DOM concentrations in plasma were used to predict changes in gender-specific QTcF (Fridericia correction) intervals within the Cardiac Safety Simulator platform taking into consideration DOM, KETO, and DOM+KETO triggered inhibition of multiple ionic currents in population. Combination of in vitro–in vivo extrapolation, PBPK, and systems pharmacology of electric currents in the heart was able to predict the direction and magnitude of PK and PD changes under coadministration of the two drugs although some disparities were detected. PMID:25116274

Evaluation of Tp-Te Interval and Tp-Te/QT Ratio in Patients with Coronary Slow Flow Tp-Te/QT Ratio and Coronary Slow Flow.

PubMed

Tenekecioglu, Erhan; Karaagac, Kemal; Yontar, Osman Can; Agca, Fahriye Vatansever; Ozluk, Ozlem Arican; Tutuncu, Ahmet; Arslan, Burhan; Yilmaz, Mustafa

2015-06-01

Coronary slow flow (CSF) phenomenon is described by angiographically normal coronary arteries with delayed opacification of the distal vasculature. Several studies have suggested that the interval from the peak to the end of the electrocardiographic T wave (Tp-Te) may correspond to the transmural dispersion of the repolarization and that increased Tp-Te interval and Tp-Te/QT ratio are associated with malignant ventricular arrhythmias. The aim of this study was to evaluate the ventricular repolarization by using Tp-Te interval and Tp-Te/QT ratio in patients with CSF. This study included 50 CSF patients (40 male, mean age 48.6±12.5 years) and 40 control individuals (23 male, mean age 47.8±12.5 years). Tp-Te interval and Tp-Te/QT ratio were measured from the 12-lead electrocardiogram. These parameters were compared in groups. Baseline characteristics of the study groups were comparable. In electrocardiographic parameters analysis, QT and corrected QT were similar in CSF patients compared to the controls (357±35.2 vs 362±38.0 milliseconds and 419±25.8 vs 430±44.2 milliseconds, all p value >0.05). Tp-Te interval, Tp-Te/QT and Tp-Te/QTc ratio were significantly higher in CSF patients (85±13.7 vs 74±9.9 milliseconds and 0.24±0.03 vs 0.20±0.02 and 0.20±0.03 vs 0.17±0.02 all p value <0.001). Our study revealed that QTd, Tp-Te interval and Tp-Te/QT ratio are prolonged in patients with CSF.

Controllability of impulse controlled systems of heat equations coupled by constant matrices

NASA Astrophysics Data System (ADS)

Qin, Shulin; Wang, Gengsheng

2017-11-01

This paper studies the approximate and null controllability for impulse controlled systems of heat equations coupled by a pair (A , B) of constant matrices. We present a necessary and sufficient condition for the approximate controllability, which is exactly Kalman's controllability rank condition of (A , B). We prove that when such a system is approximately controllable, the approximate controllability over an interval [ 0 , T ] can be realized by adding controls at arbitrary q (A , B) different control instants 0 <τ1 <τ2 < ⋯ <τ q (A , B) < T, provided that τ q (A , B) -τ1

Cardiovascular Effects of Energy Drinks in Familial Long QT Syndrome: A Randomized Cross-Over Study.

PubMed

Gray, Belinda; Ingles, Jodie; Medi, Caroline; Driscoll, Timothy; Semsarian, Christopher

2017-03-15

Caffeinated energy drinks may trigger serious cardiac effects. The aim of this study was to determine the cardiovascular effects of caffeinated energy drink consumption in patients with familial long QT syndrome (LQTS). From 2014-2016, 24 LQTS patients aged 16-50 years were recruited to a randomized, double-blind, cross-over study of energy drink (ED) versus control (CD) with participants acting as their own controls (one week washout). The primary study outcome was an increase in corrected QT interval (QTc) by >20ms. Secondary outcomes were changes in systolic and diastolic blood pressure. In 24 patients with LQTS (no dropout), mean age was 29±9 years, 13/24 (54%) were female, and 8/24 (33%) were probands. Intention to treat analysis revealed no significant change in QTc with ED compared with CD (12±28ms vs 16±27ms, 3% vs 4%, p=0.71). The systolic and diastolic blood pressure significantly increased with ED compared to CD (peak change 7±16mmHg vs 1±16mmHg, 6% vs 0.8%, p=0.046 and 8±10 vs 2±9mmHg, 11% vs 3% p=0.01 respectively). These changes correlated with significant increases in serum caffeine (14.6±11.3 vs 0.5±0.1μmol/L, p<0.001) and serum taurine (737±199 vs -59±22μmol/L, p<0.001). There were three patients with dangerous QTc prolongation of ≥50ms following energy drink consumption. Caffeinated energy drinks have significant haemodynamic effects in patients with LQTS, especifically an acute increase in blood pressure. Since dangerous QTc prolongation was seen in some LQTS patients, we recommend caution in young patients with LQTS consuming energy drinks. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Cardiovascular and hypokalaemic effects of inhaled salbutamol, fenoterol, and isoprenaline.

PubMed Central

Crane, J; Burgess, C; Beasley, R

1989-01-01

The cardiovascular and hypokalaemic effects of equal doses of inhaled fenoterol, isoprenaline and salbutamol were compared in eight healthy male volunteers, in a double blind, placebo controlled study. Increasing doses of 400, 600, and 800 micrograms were given from a metered dose inhaler at 15 minute intervals, followed by measurements of heart rate, blood pressure, total electromechanical systole (as a measure of inotropic response), QTc interval, and plasma potassium concentration. After repeated inhalation, fenoterol resulted in significantly greater chronotropic, electrocardiographic, and hypokalaemic effects than either isoprenaline or salbutamol. The maximum inotropic effect of fenoterol was similar to that of isoprenaline. PMID:2928998

Standardization of magnetocardiography in nonhuman primates

NASA Astrophysics Data System (ADS)

Seki, Yusuke; Muneyuki, Kenta; Kandori, Akihiko; Tsukada, Keiji; Terao, Keiji; Ageyama, Naohide

2008-03-01

To establish the electrophysiological mappings of nonhuman primates by using magnetocardiogram (MCG) data and obtain the normal values of MCG parameters, we used 64-channel superconducting quantum interference devices to measure 8 × 8 MCG data for 95 cynomolgus monkeys (Macaca fascicularis, 51 female and 44 male). The PQ interval, QRS duration, QT interval and QTc were respectively 79 ± 14 ms, 42 ± 7 ms, 222 ± 23 ms and 363 ± 25 (mean ± SD), and these parameters did not differ significantly between female and male monkeys. These results indicate the normal values of the MCG parameters of the cynomolgus monkey and should facilitate animal experiments in magnetocardiography.

Comparison of a new multiplex real-time PCR with the Kato Katz thick smear and copro-antigen ELISA for the detection and differentiation of Taenia spp. in human stools.

PubMed

Ng-Nguyen, Dinh; Stevenson, Mark A; Dorny, Pierre; Gabriël, Sarah; Vo, Tinh Van; Nguyen, Van-Anh Thi; Phan, Trong Van; Hii, Sze Fui; Traub, Rebecca J

2017-07-01

Taenia solium, the cause of neurocysticercosis (NCC), has significant socioeconomic impacts on communities in developing countries. This disease, along with taeniasis is estimated to infect 2.5 to 5 million people globally. Control of T. solium NCC necessitates accurate diagnosis and treatment of T. solium taeniasis carriers. In areas where all three species of Taenia tapeworms (T. solium, Taenia saginata and Taenia asiatica) occur sympatrically, conventional microscope- and copro-antigen based diagnostic methods are unable to distinguish between these three Taenia species. Molecular diagnostic tools have been developed to overcome this limitation; however, conventional PCR-based techniques remain unsuitable for large-scale deployment in community-based surveys. Moreover, a real-time PCR (qPCR) for the discrimination of all three species of Taenia in human stool does not exist. This study describes the development and validation of a new triplex Taq-Man probe-based qPCR for the detection and discrimination of all three Taenia human tapeworms in human stools collected from communities in the Central Highlands of Vietnam. The diagnostic characteristics of the test are compared with conventional Kato Katz (KK) thick smear and copro-antigen ELISA (cAgELISA) method utilizing fecal samples from a community based cross-sectional study. Using this new multiplex real-time PCR we provide an estimate of the true prevalence of taeniasis in the source population for the community based cross-sectional study. Primers and TaqMan probes for the specific amplification of T. solium, T. saginata and T. asiatica were designed and successfully optimized to target the internal transcribed spacer I (ITS-1) gene of T. solium and the cytochrome oxidase subunit I (COX-1) gene of T. saginata and T. asiatica. The newly designed triplex qPCR (T3qPCR) was compared to KK and cAgELISA for the detection of Taenia eggs in stool samples collected from 342 individuals in Dak Lak province, Central Highlands of Vietnam. The overall apparent prevalence of taeniasis in Dak Lak province was 6.72% (95% confidence interval (CI) [3.94-9.50]) in which T. solium accounted for 1.17% (95% CI [0.37-3.17]), according to the T3qPCR. There was sympatric presence of T. solium, T. saginata and T. asiatica. The T3qPCR proved superior to KK and cAgELISA for the detection and differentiation of Taenia species in human feces. Diagnostic sensitivities of 0.94 (95% credible interval (CrI) [0.88-0.98]), 0.82 (95% CrI [0.58-0.95]) and 0.52 (95% CrI [0.07-0.94]), and diagnostic specificities of 0.98 (95% CrI [0.94-1.00]), 0.91 (95% CrI [0.85-0.96]) and 0.99 (95% CrI [0.96-1.00]) were estimated for the diagnosis of taeniasis for the T3qPCR, cAgELISA and KK thick smear in this study, respectively. T3qPCR is not only superior to the KK thick smear and cAgELISA in terms of diagnostic sensitivity and specificity, but it also has the advantage of discriminating between species of Taenia eggs in stools. Application of this newly developed T3qPCR has identified the existence of all three human Taenia tapeworms in Dak Lak province and proves for the first time, the existence of T. asiatica in the Central Highlands and the south of Vietnam.

Electrocardiographic predictors of adverse cardiovascular events in suspected poisoning.

PubMed

Manini, Alex F; Nelson, Lewis S; Skolnick, Adam H; Slater, William; Hoffman, Robert S

2010-06-01

Poisoning is the second leading cause of injury-related fatality in the USA and the leading cause of cardiac arrest in victims under 40 years of age. The study objective was to define the electrocardiographic (ECG) predictors of adverse cardiovascular events (ACVE) complicating suspected acute poisoning (SAP). This was a case-control study in adults at three tertiary-care hospitals and one regional Poison Control Center. We compared 34 cases of SAP complicated by ACVE to 101 consecutive control patients with uncomplicated SAP. The initial ECG was analyzed for rhythm, intervals, QT dispersion, ischemia, and infarction. ECGs were interpreted by a cardiologist, blinded to study hypothesis and case data. Subjects were 48% male, with mean age 42 +/- 19 years. In addition to clinical suspicion of poisoning in 100% of patients, routine toxicology screens were positive in 77%, most commonly for benzodiazepines, opioids, and/or acetaminophen. Neither the ventricular rate, the QRS duration, nor the presence of infarction predicted the risk of ACVE. However, the rhythm, QTc, QT dispersion, and presence of ischemia correlated with the risk of ACVE. Independent predictors of ACVE based on multivariable logistic regression were prolonged QTc, any non-sinus rhythm, ventricular ectopy, and ischemia. Recursive partitioning analysis identified very low risk criteria (94.1% sensitivity, 96.2% NPV) and high risk criteria (95% specificity). Among patients with SAP, the presence of QTc prolongation, QT dispersion, ventricular ectopy, any non-sinus rhythm, and evidence of ischemia on the initial ECG are strongly associated with ACVE.

Elliptic flow of muons from heavy-flavour hadron decays at forward rapidity in Pb–Pb collisions at s NN = 2.76   TeV

DOE PAGES

Adam, J.; Adamová, D.; Aggarwal, M. M.; ...

2015-12-02

We measured the elliptic flow, v 2, of muons from heavy-flavour hadron decays at forward rapidity (2.5 < y < 4) in Pb-Pb collisions at √s NN= 2.76TeVwith the ALICE detector at the LHC. The scalar product, two- and four-particle Q cumulants and Lee-Yang zeros methods are used. The dependence of the v 2 of muons from heavy-flavour hadron decays on the collision centrality, in the range 0-40%, and on transverse momentum, p T, is studied in the interval 3 < p T< 10 GeV/c. We also observe a positive v 2 with the scalar product and two-particle Q cumulantsmore » in semi-central collisions (10-20% and 20-40% centrality classes) for the p T interval from 3 to about 5GeV/c with a significance larger than 3 sigma, based on the combination of statistical and systematic uncertainties. The v 2 magnitude tends to decrease towards more central collisions and with increasing p T. It becomes compatible with zero in the interval 6 < p T< 10 GeV/c. Our results are compared to models describing the interaction of heavy quarks and open heavy-flavour hadrons with the high-density medium formed in high-energy heavy-ion collisions.« less

Elliptic flow of muons from heavy-flavour hadron decays at forward rapidity in Pb-Pb collisions at √{sNN} = 2.76 TeV

NASA Astrophysics Data System (ADS)

Adam, J.; Adamová, D.; Aggarwal, M. M.; Aglieri Rinella, G.; Agnello, M.; Agrawal, N.; Ahammed, Z.; Ahn, S. U.; Aiola, S.; Akindinov, A.; Alam, S. N.; Aleksandrov, D.; Alessandro, B.; Alexandre, D.; Alfaro Molina, R.; Alici, A.; Alkin, A.; Almaraz, J. R. M.; Alme, J.; Alt, T.; Altinpinar, S.; Altsybeev, I.; Alves Garcia Prado, C.; Andrei, C.; Andronic, A.; Anguelov, V.; Anielski, J.; Antičić, T.; Antinori, F.; Antonioli, P.; Aphecetche, L.; Appelshäuser, H.; Arcelli, S.; Armesto, N.; Arnaldi, R.; Arsene, I. C.; Arslandok, M.; Audurier, B.; Augustinus, A.; Averbeck, R.; Azmi, M. D.; Bach, M.; Badalà, A.; Baek, Y. W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Baltasar Dos Santos Pedrosa, F.; Baral, R. C.; Barbano, A. M.; Barbera, R.; Barile, F.; Barnaföldi, G. G.; Barnby, L. S.; Barret, V.; Bartalini, P.; Barth, K.; Bartke, J.; Bartsch, E.; Basile, M.; Bastid, N.; Basu, S.; Bathen, B.; Batigne, G.; Batista Camejo, A.; Batyunya, B.; Batzing, P. C.; Bearden, I. G.; Beck, H.; Bedda, C.; Behera, N. K.; Belikov, I.; Bellini, F.; Bello Martinez, H.; Bellwied, R.; Belmont, R.; Belmont-Moreno, E.; Belyaev, V.; Bencedi, G.; Beole, S.; Berceanu, I.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bertens, R. A.; Berzano, D.; Betev, L.; Bhasin, A.; Bhat, I. R.; Bhati, A. K.; Bhattacharjee, B.; Bhom, J.; Bianchi, L.; Bianchi, N.; Bianchin, C.; Bielčík, J.; Bielčíková, J.; Bilandzic, A.; Biswas, R.; Biswas, S.; Bjelogrlic, S.; Blair, J. T.; Blanco, F.; Blau, D.; Blume, C.; Bock, F.; Bogdanov, A.; Bøggild, H.; Boldizsár, L.; Bombara, M.; Book, J.; Borel, H.; Borissov, A.; Borri, M.; Bossú, F.; Botta, E.; Böttger, S.; Braun-Munzinger, P.; Bregant, M.; Breitner, T.; Broker, T. A.; Browning, T. A.; Broz, M.; Brucken, E. J.; Bruna, E.; Bruno, G. E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Buncic, P.; Busch, O.; Buthelezi, Z.; Butt, J. B.; Buxton, J. T.; Caffarri, D.; Cai, X.; Caines, H.; Calero Diaz, L.; Caliva, A.; Calvo Villar, E.; Camerini, P.; Carena, F.; Carena, W.; Carnesecchi, F.; Castillo Castellanos, J.; Castro, A. J.; Casula, E. A. R.; Cavicchioli, C.; Ceballos Sanchez, C.; Cepila, J.; Cerello, P.; Cerkala, J.; Chang, B.; Chapeland, S.; Chartier, M.; Charvet, J. L.; Chattopadhyay, S.; Chattopadhyay, S.; Chelnokov, V.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chibante Barroso, V.; Chinellato, D. D.; Chochula, P.; Choi, K.; Chojnacki, M.; Choudhury, S.; Christakoglou, P.; Christensen, C. H.; Christiansen, P.; Chujo, T.; Chung, S. U.; Chunhui, Z.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Colamaria, F.; Colella, D.; Collu, A.; Colocci, M.; Conesa Balbastre, G.; Conesa Del Valle, Z.; Connors, M. E.; Contreras, J. G.; Cormier, T. M.; Corrales Morales, Y.; Cortés Maldonado, I.; Cortese, P.; Cosentino, M. R.; Costa, F.; Crochet, P.; Cruz Albino, R.; Cuautle, E.; Cunqueiro, L.; Dahms, T.; Dainese, A.; Danu, A.; Das, D.; Das, I.; Das, S.; Dash, A.; Dash, S.; de, S.; de Caro, A.; de Cataldo, G.; de Cuveland, J.; de Falco, A.; de Gruttola, D.; De Marco, N.; de Pasquale, S.; Deisting, A.; Deloff, A.; Dénes, E.; D'Erasmo, G.; di Bari, D.; di Mauro, A.; di Nezza, P.; Diaz Corchero, M. A.; Dietel, T.; Dillenseger, P.; Divià, R.; Djuvsland, Ø.; Dobrin, A.; Dobrowolski, T.; Domenicis Gimenez, D.; Dönigus, B.; Dordic, O.; Drozhzhova, T.; Dubey, A. K.; Dubla, A.; Ducroux, L.; Dupieux, P.; Ehlers, R. J.; Elia, D.; Engel, H.; Epple, E.; Erazmus, B.; Erdemir, I.; Erhardt, F.; Espagnon, B.; Estienne, M.; Esumi, S.; Eum, J.; Evans, D.; Evdokimov, S.; Eyyubova, G.; Fabbietti, L.; Fabris, D.; Faivre, J.; Fantoni, A.; Fasel, M.; Feldkamp, L.; Felea, D.; Feliciello, A.; Feofilov, G.; Ferencei, J.; Fernández Téllez, A.; Ferreiro, E. G.; Ferretti, A.; Festanti, A.; Feuillard, V. J. G.; Figiel, J.; Figueredo, M. A. S.; Filchagin, S.; Finogeev, D.; Fionda, F. M.; Fiore, E. M.; Fleck, M. G.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Francescon, A.; Frankenfeld, U.; Fuchs, U.; Furget, C.; Furs, A.; Fusco Girard, M.; Gaardhøje, J. J.; Gagliardi, M.; Gago, A. M.; Gallio, M.; Gangadharan, D. R.; Ganoti, P.; Gao, C.; Garabatos, C.; Garcia-Solis, E.; Gargiulo, C.; Gasik, P.; Germain, M.; Gheata, A.; Gheata, M.; Ghosh, P.; Ghosh, S. K.; Gianotti, P.; Giubellino, P.; Giubilato, P.; Gladysz-Dziadus, E.; Glässel, P.; Goméz Coral, D. M.; Gomez Ramirez, A.; González-Zamora, P.; Gorbunov, S.; Görlich, L.; Gotovac, S.; Grabski, V.; Graczykowski, L. K.; Graham, K. L.; Grelli, A.; Grigoras, A.; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grinyov, B.; Grion, N.; Grosse-Oetringhaus, J. F.; Grossiord, J.-Y.; Grosso, R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gulkanyan, H.; Gunji, T.; Gupta, A.; Gupta, R.; Haake, R.; Haaland, Ø.; Hadjidakis, C.; Haiduc, M.; Hamagaki, H.; Hamar, G.; Harris, J. W.; Harton, A.; Hatzifotiadou, D.; Hayashi, S.; Heckel, S. T.; Heide, M.; Helstrup, H.; Herghelegiu, A.; Herrera Corral, G.; Hess, B. A.; Hetland, K. F.; Hilden, T. E.; Hillemanns, H.; Hippolyte, B.; Hosokawa, R.; Hristov, P.; Huang, M.; Humanic, T. J.; Hussain, N.; Hussain, T.; Hutter, D.; Hwang, D. S.; Ilkaev, R.; Ilkiv, I.; Inaba, M.; Ippolitov, M.; Irfan, M.; Ivanov, M.; Ivanov, V.; Izucheev, V.; Jacobs, P. M.; Jadlovska, S.; Jahnke, C.; Jang, H. J.; Janik, M. A.; Jayarathna, P. H. S. Y.; Jena, C.; Jena, S.; Jimenez Bustamante, R. T.; Jones, P. G.; Jung, H.; Jusko, A.; Kalinak, P.; Kalweit, A.; Kamin, J.; Kang, J. H.; Kaplin, V.; Kar, S.; Karasu Uysal, A.; Karavichev, O.; Karavicheva, T.; Karayan, L.; Karpechev, E.; Kebschull, U.; Keidel, R.; Keijdener, D. L. D.; Keil, M.; Mohisin Khan, M.; Khan, P.; Khan, S. A.; Khanzadeev, A.; Kharlov, Y.; Kileng, B.; Kim, B.; Kim, D. W.; Kim, D. J.; Kim, H.; Kim, J. S.; Kim, M.; Kim, M.; Kim, S.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Kiss, G.; Klay, J. L.; Klein, C.; Klein, J.; Klein-Bösing, C.; Kluge, A.; Knichel, M. L.; Knospe, A. G.; Kobayashi, T.; Kobdaj, C.; Kofarago, M.; Kollegger, T.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Kondratyuk, E.; Konevskikh, A.; Kopcik, M.; Kour, M.; Kouzinopoulos, C.; Kovalenko, O.; Kovalenko, V.; Kowalski, M.; Koyithatta Meethaleveedu, G.; Kral, J.; Králik, I.; Kravčáková, A.; Kretz, M.; Krivda, M.; Krizek, F.; Kryshen, E.; Krzewicki, M.; Kubera, A. M.; Kučera, V.; Kugathasan, T.; Kuhn, C.; Kuijer, P. G.; Kumar, A.; Kumar, J.; Kumar, L.; Kurashvili, P.; Kurepin, A.; Kurepin, A. B.; Kuryakin, A.; Kushpil, S.; Kweon, M. J.; Kwon, Y.; La Pointe, S. L.; La Rocca, P.; Lagana Fernandes, C.; Lakomov, I.; Langoy, R.; Lara, C.; Lardeux, A.; Lattuca, A.; Laudi, E.; Lea, R.; Leardini, L.; Lee, G. R.; Lee, S.; Legrand, I.; Lehas, F.; Lemmon, R. C.; Lenti, V.; Leogrande, E.; León Monzón, I.; Leoncino, M.; Lévai, P.; Li, S.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M. A.; Ljunggren, H. M.; Lodato, D. F.; Loenne, P. I.; Loginov, V.; Loizides, C.; Lopez, X.; López Torres, E.; Lowe, A.; Luettig, P.; Lunardon, M.; Luparello, G.; Luz, P. H. F. N. D.; Maevskaya, A.; Mager, M.; Mahajan, S.; Mahmood, S. M.; Maire, A.; Majka, R. D.; Malaev, M.; Maldonado Cervantes, I.; Malinina, L.; Mal'Kevich, D.; Malzacher, P.; Mamonov, A.; Manko, V.; Manso, F.; Manzari, V.; Marchisone, M.; Mareš, J.; Margagliotti, G. V.; Margotti, A.; Margutti, J.; Marín, A.; Markert, C.; Marquard, M.; Martin, N. A.; Martin Blanco, J.; Martinengo, P.; Martínez, M. I.; Martínez García, G.; Martinez Pedreira, M.; Martynov, Y.; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Massacrier, L.; Mastroserio, A.; Masui, H.; Matyja, A.; Mayer, C.; Mazer, J.; Mazzoni, M. A.; McDonald, D.; Meddi, F.; Melikyan, Y.; Menchaca-Rocha, A.; Meninno, E.; Mercado Pérez, J.; Meres, M.; Miake, Y.; Mieskolainen, M. M.; Mikhaylov, K.; Milano, L.; Milosevic, J.; Minervini, L. M.; Mischke, A.; Mishra, A. N.; Miśkowiec, D.; Mitra, J.; Mitu, C. M.; Mohammadi, N.; Mohanty, B.; Molnar, L.; Montaño Zetina, L.; Montes, E.; Morando, M.; Moreira de Godoy, D. A.; Moreno, L. A. P.; Moretto, S.; Morreale, A.; Morsch, A.; Muccifora, V.; Mudnic, E.; Mühlheim, D.; Muhuri, S.; Mukherjee, M.; Mulligan, J. D.; Munhoz, M. G.; Munzer, R. H.; Murray, S.; Musa, L.; Musinsky, J.; Nandi, B. K.; Nania, R.; Nappi, E.; Naru, M. U.; Nattrass, C.; Nayak, K.; Nayak, T. K.; Nazarenko, S.; Nedosekin, A.; Nellen, L.; Ng, F.; Nicassio, M.; Niculescu, M.; Niedziela, J.; Nielsen, B. S.; Nikolaev, S.; Nikulin, S.; Nikulin, V.; Noferini, F.; Nomokonov, P.; Nooren, G.; Noris, J. C. C.; Norman, J.; Nyanin, A.; Nystrand, J.; Oeschler, H.; Oh, S.; Oh, S. K.; Ohlson, A.; Okatan, A.; Okubo, T.; Olah, L.; Oleniacz, J.; Oliveira da Silva, A. C.; Oliver, M. H.; Onderwaater, J.; Oppedisano, C.; Orava, R.; Ortiz Velasquez, A.; Oskarsson, A.; Otwinowski, J.; Oyama, K.; Ozdemir, M.; Pachmayer, Y.; Pagano, P.; Paić, G.; Pajares, C.; Pal, S. K.; Pan, J.; Pandey, A. K.; Pant, D.; Papcun, P.; Papikyan, V.; Pappalardo, G. S.; Pareek, P.; Park, W. J.; Parmar, S.; Passfeld, A.; Paticchio, V.; Patra, R. N.; Paul, B.; Peitzmann, T.; Pereira da Costa, H.; Pereira de Oliveira Filho, E.; Peresunko, D.; Pérez Lara, C. E.; Perez Lezama, E.; Peskov, V.; Pestov, Y.; Petráček, V.; Petrov, V.; Petrovici, M.; Petta, C.; Piano, S.; Pikna, M.; Pillot, P.; Pinazza, O.; Pinsky, L.; Piyarathna, D. B.; Płoskoń, M.; Planinic, M.; Pluta, J.; Pochybova, S.; Podesta-Lerma, P. L. M.; Poghosyan, M. G.; Polichtchouk, B.; Poljak, N.; Poonsawat, W.; Pop, A.; Porteboeuf-Houssais, S.; Porter, J.; Pospisil, J.; Prasad, S. K.; Preghenella, R.; Prino, F.; Pruneau, C. A.; Pshenichnov, I.; Puccio, M.; Puddu, G.; Pujahari, P.; Punin, V.; Putschke, J.; Qvigstad, H.; Rachevski, A.; Raha, S.; Rajput, S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Rami, F.; Raniwala, R.; Raniwala, S.; Räsänen, S. S.; Rascanu, B. T.; Rathee, D.; Read, K. F.; Real, J. S.; Redlich, K.; Reed, R. J.; Rehman, A.; Reichelt, P.; Reidt, F.; Ren, X.; Renfordt, R.; Reolon, A. R.; Reshetin, A.; Rettig, F.; Revol, J.-P.; Reygers, K.; Riabov, V.; Ricci, R. A.; Richert, T.; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Ristea, C.; Rivetti, A.; Rocco, E.; Rodríguez Cahuantzi, M.; Rodriguez Manso, A.; Røed, K.; Rogochaya, E.; Rohr, D.; Röhrich, D.; Romita, R.; Ronchetti, F.; Ronflette, L.; Rosnet, P.; Rossi, A.; Roukoutakis, F.; Roy, A.; Roy, C.; Roy, P.; Rubio Montero, A. J.; Rui, R.; Russo, R.; Ryabinkin, E.; Ryabov, Y.; Rybicki, A.; Sadovsky, S.; Šafařík, K.; Sahlmuller, B.; Sahoo, P.; Sahoo, R.; Sahoo, S.; Sahu, P. K.; Saini, J.; Sakai, S.; Saleh, M. A.; Salgado, C. A.; Salzwedel, J.; Sambyal, S.; Samsonov, V.; Šándor, L.; Sandoval, A.; Sano, M.; Sarkar, D.; Scapparone, E.; Scarlassara, F.; Scharenberg, R. P.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H. R.; Schuchmann, S.; Schukraft, J.; Schulc, M.; Schuster, T.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Seger, J. E.; Sekiguchi, Y.; Sekihata, D.; Selyuzhenkov, I.; Senosi, K.; Seo, J.; Serradilla, E.; Sevcenco, A.; Shabanov, A.; Shabetai, A.; Shadura, O.; Shahoyan, R.; Shangaraev, A.; Sharma, A.; Sharma, M.; Sharma, M.; Sharma, N.; Shigaki, K.; Shtejer, K.; Sibiriak, Y.; Siddhanta, S.; Sielewicz, K. M.; Siemiarczuk, T.; Silvermyr, D.; Silvestre, C.; Simatovic, G.; Simonetti, G.; Singaraju, R.; Singh, R.; Singha, S.; Singhal, V.; Sinha, B. C.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T. B.; Slupecki, M.; Smirnov, N.; Snellings, R. J. M.; Snellman, T. W.; Søgaard, C.; Soltz, R.; Song, J.; Song, M.; Song, Z.; Soramel, F.; Sorensen, S.; Spacek, M.; Spiriti, E.; Sputowska, I.; Spyropoulou-Stassinaki, M.; Srivastava, B. K.; Stachel, J.; Stan, I.; Stefanek, G.; Stenlund, E.; Steyn, G.; Stiller, J. H.; Stocco, D.; Strmen, P.; Suaide, A. A. P.; Sugitate, T.; Suire, C.; Suleymanov, M.; Suljic, M.; Sultanov, R.; Šumbera, M.; Symons, T. J. M.; Szabo, A.; Szanto de Toledo, A.; Szarka, I.; Szczepankiewicz, A.; Szymanski, M.; Tabassam, U.; Takahashi, J.; Tambave, G. J.; Tanaka, N.; Tangaro, M. A.; Tapia Takaki, J. D.; Tarantola Peloni, A.; Tarhini, M.; Tariq, M.; Tarzila, M. G.; Tauro, A.; Tejeda Muñoz, G.; Telesca, A.; Terasaki, K.; Terrevoli, C.; Teyssier, B.; Thäder, J.; Thomas, D.; Tieulent, R.; Timmins, A. R.; Toia, A.; Trogolo, S.; Trubnikov, V.; Trzaska, W. H.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T. S.; Ullaland, K.; Uras, A.; Usai, G. L.; Utrobicic, A.; Vajzer, M.; Valencia Palomo, L.; Vallero, S.; van der Maarel, J.; van Hoorne, J. W.; van Leeuwen, M.; Vanat, T.; Vande Vyvre, P.; Varga, D.; Vargas, A.; Vargyas, M.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vauthier, A.; Vechernin, V.; Veen, A. M.; Veldhoen, M.; Velure, A.; Venaruzzo, M.; Vercellin, E.; Vergara Limón, S.; Vernet, R.; Verweij, M.; Vickovic, L.; Viesti, G.; Viinikainen, J.; Vilakazi, Z.; Villalobos Baillie, O.; Villatoro Tello, A.; Vinogradov, A.; Vinogradov, L.; Vinogradov, Y.; Virgili, T.; Vislavicius, V.; Viyogi, Y. P.; Vodopyanov, A.; Völkl, M. A.; Voloshin, K.; Voloshin, S. A.; Volpe, G.; von Haller, B.; Vorobyev, I.; Vranic, D.; Vrláková, J.; Vulpescu, B.; Vyushin, A.; Wagner, B.; Wagner, J.; Wang, H.; Wang, M.; Watanabe, D.; Watanabe, Y.; Weber, M.; Weber, S. G.; Wessels, J. P.; Westerhoff, U.; Wiechula, J.; Wikne, J.; Wilde, M.; Wilk, G.; Wilkinson, J.; Williams, M. C. S.; Windelband, B.; Winn, M.; Yaldo, C. G.; Yang, H.; Yang, P.; Yano, S.; Yin, Z.; Yokoyama, H.; Yoo, I.-K.; Yurchenko, V.; Yushmanov, I.; Zaborowska, A.; Zaccolo, V.; Zaman, A.; Zampolli, C.; Zanoli, H. J. C.; Zaporozhets, S.; Zardoshti, N.; Zarochentsev, A.; Závada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zgura, I. S.; Zhalov, M.; Zhang, H.; Zhang, X.; Zhang, Y.; Zhang, Z.; Zhao, C.; Zhigareva, N.; Zhou, D.; Zhou, Y.; Zhou, Z.; Zhu, H.; Zhu, J.; Zichichi, A.; Zimmermann, A.; Zimmermann, M. B.; Zinovjev, G.; Zyzak, M.; Alice Collaboration

2016-02-01

The elliptic flow, v2, of muons from heavy-flavour hadron decays at forward rapidity (2.5 < y < 4) is measured in Pb-Pb collisions at √{sNN} = 2.76 TeV with the ALICE detector at the LHC. The scalar product, two- and four-particle Q cumulants and Lee-Yang zeros methods are used. The dependence of the v2 of muons from heavy-flavour hadron decays on the collision centrality, in the range 0-40%, and on transverse momentum, pT, is studied in the interval 3

Sex is a moderator of the association between NOS1AP sequence variants and QTc in two long QT syndrome founder populations: a pedigree-based measured genotype association analysis.

PubMed

Winbo, Annika; Stattin, Eva-Lena; Westin, Ida Maria; Norberg, Anna; Persson, Johan; Jensen, Steen M; Rydberg, Annika

2017-07-18

Sequence variants in the NOS1AP gene have repeatedly been reported to influence QTc, albeit with moderate effect sizes. In the long QT syndrome (LQTS), this may contribute to the substantial QTc variance seen among carriers of identical pathogenic sequence variants. Here we assess three non-coding NOS1AP sequence variants, chosen for their previously reported strong association with QTc in normal and LQTS populations, for association with QTc in two Swedish LQT1 founder populations. This study included 312 individuals (58% females) from two LQT1 founder populations, whereof 227 genotype positive segregating either Y111C (n = 148) or R518* (n = 79) pathogenic sequence variants in the KCNQ1 gene, and 85 genotype negatives. All were genotyped for NOS1AP sequence variants rs12143842, rs16847548 and rs4657139, and tested for association with QTc length (effect size presented as mean difference between derived and wildtype, in ms), using a pedigree-based measured genotype association analysis. Mean QTc was obtained by repeated manual measurement (preferably in lead II) by one observer using coded 50 mm/s standard 12-lead ECGs. A substantial variance in mean QTc was seen in genotype positives 476 ± 36 ms (Y111C 483 ± 34 ms; R518* 462 ± 34 ms) and genotype negatives 433 ± 24 ms. Female sex was significantly associated with QTc prolongation in all genotype groups (p < 0.001). In a multivariable analysis including the entire study population and adjusted for KCNQ1 genotype, sex and age, NOS1AP sequence variants rs12143842 and rs16847548 (but not rs4657139) were significantly associated with QT prolongation, +18 ms (p = 0.0007) and +17 ms (p = 0.006), respectively. Significant sex-interactions were detected for both sequent variants (interaction term r = 0.892, p < 0.001 and r = 0.944, p < 0.001, respectively). Notably, across the genotype groups, when stratified by sex neither rs12143842 nor rs16847548 were significantly associated with QTc in females (both p = 0.16) while in males, a prolongation of +19 ms and +8 ms (p = 0.002 and p = 0.02) was seen in multivariable analysis, explaining up to 23% of QTc variance in all males. Sex was identified as a moderator of the association between NOS1AP sequence variants and QTc in two LQT1 founder populations. This finding may contribute to QTc sex differences and affect the usefulness of NOS1AP as a marker for clinical risk stratification in LQTS.

An increasing electromechanical window is a predictive marker of ventricular fibrillation in anesthetized rabbit with ischemic heart.

PubMed

Limprasutr, Vudhiporn; Pirintr, Prapawadee; Kijtawornrat, Anusak; Hamlin, Robert L

2018-05-10

The QTc interval is widely used in Safety Pharmacological studies to predict arrhythmia risk, and the electromechanical window (EMW) and short-term variability of QT intervals (STV QT ) have been studied as new biomarkers for drug-induced Torsades de Pointes (TdP). However, the use of EMW and STV QT to predict ventricular fibrillation (VF) has not been elucidated. This study aimed to evaluate EMW and STV QT to predict VF in anesthetized rabbit model of VF. VF was induced by ligation of the left anterior descending and a descending branch of the left circumflex coronary arteries in a sample population of rabbits (n=18). VF was developed 55.6% (10/18). In rabbit with VF, the EMW was significantly higher than in rabbits without VF (96.3 ± 15.6 ms and 49.5 ± 5.6 ms, respectively, P<0.05). STV QT had significantly increased before the onset of VF in rabbits that experienced VF, but not in rabbits that did not experience VF (11.7 ± 1.8 ms and 3.7 ± 0.4 ms, respectively, P<0.05). The EMW and STV QT had better predictive power for VF with higher sensitivity and specificity than the QTc measure. The result suggested that the increasing of EMW, as well as the elevation of STV QT , can potentially be used as biomarkers for predicting of VF.

Microvascular autonomic dysfunction may justify false-positive stress myocardial perfusion imaging in patients with liver cirrhosis undergoing liver transplantation.

PubMed

Senzolo, M; Bassanello, M; Graziotto, A; Zucchetta, P; Cillo, U; Maraglino, G; Loreno, M; Bellotto, F; Davià, G; Burra, P

2008-01-01

Up to 15% of liver transplant candidates have asymptomatic coronary artery diseases, which increase the risk of cardiac complications during and after transplantation. The aim of this study was to prospectively investigate the usefulness of an integrated cardiological approach in cirrhotic patients undergoing liver transplantation. Twenty-four consecutive patients undergoing evaluation for liver transplantation were studied by assessing risk factors for coronary artery diseases, electrocardiogram with QTc interval determination, chest X-ray, echocardiography, 24-hour Holter monitor, myocardial perfusion scintigraphy (99mTc)MIBI-GSPECT at rest and after dipyridamole infusion. Cardiac (123)I-metaiodobenzylguanidine (MIBG) scan and coronarography were performed in patients with myocardial perfusion defects. Twenty three of 24 patients underwent successful liver transplantation; one patient died on the waiting list. Before liver transplantation, 29% of patients were diabetic and 41% were smokers. Eleven of 24 patients had a prolonged QTc interval, and 3/24 had positive myocardioscintigraphy after dipyridamole infusion: in two coronarography was negative, while the (123)I-MIBG washout was altered. No cardiac events were recorded during the short-and long-term follow-up after surgery. Predictive value of positive cardiac (99mTc)MIBI-GSPECT in patients with liver cirrhosis is low, and this may be due to alterations of cardiac microvascular tone as showed by cardiac (123)I-MIBG scan.

Diagnosis and treatment of histoplasmosis in solid organ transplant patients.

PubMed

Gajurel, Kiran; Dhakal, Reshika; Deresinski, Stan

2018-05-05

Unlike immunocompetent hosts, solid organ transplant (SOT) recipients with posttransplant histoplasmosis (PTH) often present with disseminated disease and have an attributable mortality of approximately 10%. In this review, we discuss currently available diagnostic tests and treatment strategies in PTH. None of the available tests have a 100% diagnostic accuracy. Histoplasma antigen assays are the most sensitive commercially available tests. However, crossreactivity of histoplasma antigen with aspergillus galactomannan and false positive histoplasma antigen tests because of rabbit antithymocyte globulin may cause difficulty in interpreting positive test results in transplant recipients. Molecular assays such as amplification and sequencing of 'panfungal' portions of the 28S ribosomal RNA from clinical specimens appear to be promising.Lipid formulations of amphotericin B and itraconazole are the drugs of choice in the treatment of PTH. Other extended spectrum azoles also appear to be effective, but, like itraconazole, problems with drug interactions and prolongation of the QTc interval (except for isavuconazole, which shortens the QTc interval) remain. Mycophenolate therapy is associated with severe disease and should be stopped during active disease and, if feasible, calcineurin inhibitors and steroids should be reduced. A combination of various tests (culture, antigen tests, nucleic amplification tests, etc.) should be used to optimize diagnostic yield. The role of unbiased next generation sequencing for early diagnosis and newer azoles in the treatment needs to be further explored.

Effect of valsartan on cardiac senescence and apoptosis in a rat model of cardiotoxicity.

PubMed

Sakr, Hussein F; Abbas, Amr M; Elsamanoudy, Ayman Z

2016-06-01

The clinical application of doxorubicin is limited by its cardiotoxicity. The present study investigated the effect of valsartan on doxorubicin-induced cardiotoxicity in rats. Rats were divided into 6 groups: control, control + valsartan (10 mg/kg, for 14 days, orally), doxorubicin-treated (2.5 mg/kg, 3 times/week for 2 weeks, intraperitoneally), valsartan then doxorubicin, valsartan + doxorubicin, and doxorubicin then valsartan. ECG, isolated heart, lipid peroxidation (thiobaribituric acid reactive substances (TBARS)), total antioxidant capacity (TAC), and Bax, Bcl-2, and senescence marker protein 30 (SMP30) gene expression were measured in cardiac tissue. Blood samples were collected to measure lactate dehydrogenase (LDH) and creatine kinase MB (CK-MB). Doxorubicin significantly increased LDH, CK-MB, TBARS, heart rate (HR), Bax gene expression, and -dP/dtmax and decreased TAC, Bcl-2 and SMP30 gene expression, left ventricular developed pressure (LVDP), and +dP/dtmax. Also, doxorubicin lengthened ST, QT, and QTc intervals. Concurrent or post- but not pre-treatment of doxorubicin-treated rats with valsartan reduced LDH, CK-MB, TBARS, HR, Bax gene expression, -dP/dtmax, and ST, QT, and QTc intervals and increased TAC, Bcl-2 and SMP30 gene expression, LVDP, and +dP/dtmax. Therefore, we conclude that concurrent or post- but not pre-treatment of doxorubicin-induced rats with valsartan attenuated doxorubicin-induced cardiotoxicity through inhibiting oxidative stress, apoptosis, and senescence.

Effect of Retosiban on Cardiac Repolarization in a Randomized, Placebo- and Positive-controlled, Crossover Thorough QT/QTc Study in Healthy Men and Women.

PubMed

Stier, Brendt; Fossler, Michael; Liu, Feng; Caltabiano, Stephen

2015-07-01

Retosiban is a small molecule oxytocin receptor antagonist that is under evaluation in clinical studies for treatment of spontaneous preterm labor. A Thorough QT/QTc study was conducted to evaluate the effect of retosiban on cardiac repolarization according to International Conference on Harmonization E14 guidance. This was a randomized, placebo- and positive-controlled, single-dose, crossover study of healthy men and women. All study participants received a 100 mg dose of retosiban (therapeutic target exposure), a 800 mg dose of retosiban (supratherapeutic target exposure), a 400 mg dose of moxifloxacin (positive control), and placebo with an appropriate washout. Holter monitoring data at baseline (predose) and at 13 subsequent time points during the next 24 hours were extracted and manually read by a central ECG reader who was blinded to the treatment assignment and corrected for heart rate by using the Fridericia formula (QTcF). A linear exposure-QTc response model was developed: ΔΔQTcF=RI+Cp,R⋅RS+MI+Cp,M⋅MS, where RI and MI are intercept terms for retosiban and moxifloxacin, respectively, RS and MS are slope terms for retosiban and moxifloxacin, respectively, and Cp,R and Cp,M are plasma concentrations for retosiban and moxifloxacin, respectively. A total of 52 healthy men (n = 27) and women (n = 25), with a mean age of 32 years, were enrolled in the study, and 43 (83%) completed all treatment periods and assessments. Mean placebo-corrected change from baseline QT (ΔΔQTcF) for the 2 retosiban dose groups revealed statistically significant decreases in ΔΔQTcF between 2 and 3 hours after administration, reaching a value of -2.5 msec for both retosiban dose groups. The 400 mg moxifloxacin group had a statistically significant increase in the ΔΔQTcF value at 0.75 hours after administration, reaching a maximal increase of 11.10 msec at 4 hours after administration. Results of the exposure-QTc response modeling revealed that there was no significant effect of retosiban on the ΔΔQTcF at therapeutic exposures. For the supratherapeutic exposure of retosiban, there was a slight negative effect, with a mean decrease of -3.05 msec. The moxifloxacin arm had a mean increase in ΔΔQTcF of 10.7 msec. At therapeutic and supratherapeutic exposures, retosiban had no significant effect on cardiac repolarization, as estimated by the ΔΔQTcF. However, both doses of retosiban had a minor shortening effect. This is not considered to be clinically significant. CLINICALTRIALS. NCT01702376. Copyright © 2015 Elsevier HS Journals, Inc. All rights reserved.

Three-dimensional entertainment as a novel cause of takotsubo cardiomyopathy.

PubMed

Taylor, Montoya; Amin, Anish; Bush, Charles

2011-11-01

Takotsubo cardiomyopathy (TC) is an uncommon entity. It is known to occur in the setting of extreme catecholamine release and results in left ventricular dysfunction without evidence of angiographically definable coronary artery disease. There have been no published reports of TC occurring with visual stimuli, specifically 3-dimensional (3D) entertainment. We present a 55-year-old woman who presented to her primary care physician's office with extreme palpitations, nausea, vomiting, and malaise <48 hours after watching a 3D action movie at her local theater. Her electrocardiogram demonstrated ST elevations in aVL and V1, prolonged QTc interval, and T-wave inversions in leads I, II, aVL, and V2-V6. Coronary angiography revealed angiographically normal vessels, elevated left ventricular filling pressures, and decreased ejection fraction with a pattern of apical ballooning. The presumed final diagnosis was TC, likely due to visual-auditory-triggered catecholamine release causing impaired coronary microcirculation. © 2011 Wiley Periodicals, Inc.

[Effect of pazufloxacin mesilate, a new quinolone antibacterial agent, for intravenous use on QT interval].

PubMed

Fukuda, Hitoshi; Morita, Yukie; Shiotani, Norio; Mizuo, Midori; Komae, Norihisa

2004-08-01

The potential for QT interval prolongation of pazufloxacin mesilate (PZFX mesilate), a new quinolone antibacterial agent for intravenous use, was investigated by in vitro and in vivo electrophysiology studies. Following results were obtained. In vitro electrophysiology study using guinea pig papillary muscles: PZFX mesilate (30-300 microM) had no effects on resting membrane potential (RMP), action potential amplitude (APA) and action potential duration (APD). Reference quinolones, sparfloxacin (3-30 microM) and moxifloxacin (10-100 microM), had no effects on RMP and APA, but significantly prolonged APD at more than 3 and 10 microM, respectively, while ciprofloxacin (10-100 microM) had no effect on each parameter. In vivo electrophysiology study using anesthetized dogs: PZFX mesilate had no effects on electrocardiograph parameter (PR interval, QRS interval, QT interval and QTc) after intravenous administration of 3-30 mg/kg. These results suggest that PZFX mesilate has low potential for QT interval prolongation.

Evaluation of 5 Hour Energy Drink on the Blood Pressure and Electrocardiograph Parameters on Young Healthy Volunteers: A Randomized, Double Blind, Crossover, Placebo-Controlled Trial

DTIC Science & Technology

2014-02-11

Travis AFB CA INSTITUTIONAL REVIEW BOARD (IRB) ()~\\) Non-Exempt Study Final Report p3YVJ (Please 1J!J!£ all information. Use additional pages if...QTc interval after acute and chronic consumption. METHODS: This was a randomized, placebo controlled, crossover study enrolling young healthy volunteers...not on any medications. Subjects received the study drink (5 Hour Energy shot or placebo) twice daily separated by approximately 7 hours for the

Evidence Based Review: Risk of Cardiac Rhythm Problems During Spaceflight

NASA Technical Reports Server (NTRS)

Platts, Steven H.; Stenger, Michael B.; Phillips, Tiffany R.; Brown, Angela K.; Arzeno, Natalia M.; Levine, Benjamin; Summers, Richard

2009-01-01

Very little research has systematically evaluated the prevalence (or potential risk) of cardiac arrhythmias during space flight. There are several observational reports of non life-threatening but potentially concerning arrhythmias. At least two potential risk factors for arrhythmias have been reported either during or immediately after space flight: cardiac atrophy and a prolonged QTc interval. The potential severity of the mission impact of a serious arrhythmia requires that a systematic evaluation be conducted of the risk of arrhythmia due to space flight.

Behavioral Hyperventilation and Central Sleep Apnea in Two Children

PubMed Central

Johnston, Thomas P.; Tam-Williams, Jade; Schmandt, Margaret; Patel, Anand C.; Cleveland, Claudia; Coste, Ferdinand; Kemp, James S.

2015-01-01

Behavioral hyperventilation is a rarely recognized cause of central sleep apnea (CSA) among children. We report two pediatric patients who presented with prolonged central sleep apnea secondary to behavioral hyperventilation. One patient also had a prolonged corrected QT (QTC) interval resulting from hyperventilation. Citation: Johnston TP, Tam-Williams J, Schmandt M, Patel AC, Cleveland C, Coste F, Kemp JS. Behavioral hyperventilation and central sleep apnea in two children. J Clin Sleep Med 2015;11(4):487–489. PMID:26106657

Evidence for a crucial modulating role of the sodium channel in the QTc prolongation related to antipsychotics.

PubMed

Silvestre, Jordi S; O'Neill, Michael F; Prous, Josep R

2014-04-01

Blockade of the cardiac hERG channel is recognized as the main mechanism underlying the QT prolongation induced by many classes of drugs, including antipsychotics. However, antipsychotics interact with a variety of other pharmacological targets that could also modulate cardiac function. The present study aims to identify those key factors involved in the QT prolongation induced by antipsychotics. The interactions of 28 antipsychotics were measured on a variety of pharmacological targets. Binding affinity (K(i)), functional channel blockade (IC₅₀), and the corresponding ratios to total and free plasma drug concentration were compared with the corrected QT changes (QTc) associated with the therapeutic use of these drugs by multivariable linear regression analysis to determine the best predictors of QTc. Besides confirming hERG as the primary predictor of QTc, all analyses consistently show the concomitant involvement of Na(V)1.5 channel as modulating factor of the QTc related to hERG blockade. In particular, the hERG/Na(V)1.5 ratio explains the 57% of the overall QTc variability associated with antipsychotics. Since it is known that inhibition of late I Na could offset the dysfunctional effects of hERG blockade, we hypothesize the inhibition of late I(Na) as a crucial compensatory mechanism of the QTc associated with antipsychotics and hence an important factor to consider concomitantly with hERG blockade to appraise the arrhythmogenic risk of these drugs more accurately.

Prolonged QT interval and lipid alterations beyond β-oxidation in very long-chain acyl-CoA dehydrogenase null mouse hearts

PubMed Central

Gélinas, Roselle; Thompson-Legault, Julie; Bouchard, Bertrand; Daneault, Caroline; Mansour, Asmaa; Gillis, Marc-Antoine; Charron, Guy; Gavino, Victor; Labarthe, François

2011-01-01

Patients with very long-chain acyl-CoA dehydrogenase (VLCAD) deficiency frequently present cardiomyopathy and heartbeat disorders. However, the underlying factors, which may be of cardiac or extra cardiac origins, remain to be elucidated. In this study, we tested for metabolic and functional alterations in the heart from 3- and 7-mo-old VLCAD null mice and their littermate counterparts, using validated experimental paradigms, namely, 1) ex vivo perfusion in working mode, with concomitant evaluation of myocardial contractility and metabolic fluxes using 13C-labeled substrates under various conditions; as well as 2) in vivo targeted lipidomics, gene expression analysis as well as electrocardiogram monitoring by telemetry in mice fed various diets. Unexpectedly, when perfused ex vivo, working VLCAD null mouse hearts maintained values similar to those of the controls for functional parameters and for the contribution of exogenous palmitate to β-oxidation (energy production), even at high palmitate concentration (1 mM) and increased energy demand (with 1 μM epinephrine) or after fasting. However, in vivo, these hearts displayed a prolonged rate-corrected QT (QTc) interval under all conditions examined, as well as the following lipid alterations: 1) age- and condition-dependent accumulation of triglycerides, and 2) 20% lower docosahexaenoic acid (an omega-3 polyunsaturated fatty acid) in membrane phospholipids. The latter was independent of liver but affected by feeding a diet enriched in saturated fat (exacerbated) or fish oil (attenuated). Our finding of a longer QTc interval in VLCAD null mice appears to be most relevant given that such condition increases the risk of sudden cardiac death. PMID:21685264

Development and significance of a fetal electrocardiogram recorded by signal-averaged high-amplification electrocardiography.

PubMed

Hayashi, Risa; Nakai, Kenji; Fukushima, Akimune; Itoh, Manabu; Sugiyama, Toru

2009-03-01

Although ultrasonic diagnostic imaging and fetal heart monitors have undergone great technological improvements, the development and use of fetal electrocardiograms to evaluate fetal arrhythmias and autonomic nervous activity have not been fully established. We verified the clinical significance of the novel signal-averaged vector-projected high amplification ECG (SAVP-ECG) method in fetuses from 48 gravidas at 32-41 weeks of gestation and in 34 neonates. SAVP-ECGs from fetuses and newborns were recorded using a modified XYZ-leads system. Once noise and maternal QRS waves were removed, the P, QRS, and T wave intervals were measured from the signal-averaged fetal ECGs. We also compared fetal and neonatal heart rates (HRs), coefficients of variation of heart rate variability (CV) as a parasympathetic nervous activity, and the ratio of low to high frequency (LF/HF ratio) as a sympathetic nervous activity. The rate of detection of a fetal ECG by SAVP-ECG was 72.9%, and the fetal and neonatal QRS and QTc intervals were not significantly different. The neonatal CVs and LF/HF ratios were significantly increased compared with those in the fetus. In conclusion, we have developed a fetal ECG recording method using the SAVP-ECG system, which we used to evaluate autonomic nervous system development.

Resting and postexercise heart rate variability in professional handball players.

PubMed

Kayacan, Yildirim; Yildiz, Sedat

2016-03-01

The aim of this study was to evaluate heart rate variability (HRV) in professional handball players during rest and following a 5 min mild jogging exercise. For that purpose, electrocardiogram (ECG) of male handball players (N.=12, mean age 25±3.95 years) and sedentary controls (N.=14, mean age 23.5±2.95 years) were recorded for 5 min at rest and just after 5 min of mild jogging. ECGs were recorded and following HRV parameters were calculated: time-domain variables such as heart rate (HR), average normal-to-normal RR intervals, standard deviation of normal-to-normal RR intervals, square root of the mean of the squares of differences between adjacent NN intervals, percentage of differences between adjacent NN intervals that are greater than 50 milliseconds (pNN50), and frequency-domain variables such as very low frequency, low (LF) and high frequency (HF) of the power and LF/HF ratio. Unpaired t-test was used to find out differences among groups while paired t-test was used for comparison of each group for pre- and postjogging HRV. Pearson correlations were carried out to find out the relationships between the parameters. Blood pressures were not different between handball players and sedentary controls but exercise increased systolic blood pressure (P<0.01). HR was increased with exercise (P<0.001) and was slower in handball players (P<0.01). QTc was increased with exercise (P<0.001) and was higher in handball players (P<0.001). Exercise decreased pNN50 values in both groups but LF/HF ratio increased only in sedentary subjects. In conclusion, results of the HRV parameters show that sympathovagal balance does not appear to change in handball players in response to a mild, short-time (5 min) jogging exercise. However, in sedentary subjects, either the sympathetic regulation of the autonomous nervous system increased or vagal withdrawal occurred.

Effect of Left Cardiac Sympathetic Denervation on the Electromechanical Window in Patients with either Type 1 or Type 2 Long QT Syndrome: A Pilot Study.

PubMed

Schneider, Andrew E; Bos, J Martijn; Ackerman, Michael J

2016-09-01

Left cardiac sympathetic denervation (LCSD) exerts significant antifibrillatory effects in patients with long QT syndrome (LQTS). Recently, electromechanical window (EMW) has emerged as a novel torsadogenic marker in LQTS, superior to QT interval (QTc) in distinguishing symptomatic from asymptomatic patients. To explore the hypothesis that LCSD improves EMW most favorably in patients with LQT1. From September 2006 to July 2015, 44 LQT1 and 25 LQT2 patients underwent LCSD. Subset analysis was performed on the six LQT1 and seven LQT2 patients who had echocardiograms both pre-LCSD and ≥3 months post-LCSD. EMW is defined as the time difference (ms) between aortic valve closure and the end of the QT interval, measured from an ECG on the concurrent echocardiogram. Compared to published normal EMW values of 22 ± 19 ms, pre-LCSD EMW mean values were -78 ± 36 ms in LQT1 and -71 ± 35 ms in LQT2 (P < .001). Following LCSD, there was a 57 ± 35 ms decrease in QTc in LQT1 (P = .16) and 23 ± 21 ms decrease in QTc in LQT2 (P = .3). Overall, there was a 35 ± 57 ms mean improvement in EMW post-LCSD (P = .04). Five of the 6 (83%) LQT1 subjects had a favorable EMW change post-LCSD (mean improvement 56 ± 25 ms, P = .04). Five of the 7 (71%) LQT2 subjects had a favorable EMW change post-LCSD (mean improvement 18 ± 19 ms, P = .2). The precise mechanism of the LCSD therapeutic effect in LQTS patients is not fully understood. This pilot study raises the possibility that LCSD's antitorsadogenic effect in patients with LQT1 could be conferred in part by restoration of electromechanical order, evidenced by normalization of the EMW. © 2016 Wiley Periodicals, Inc.

Genetic basis of allochronic differentiation in the fall armyworm.

PubMed

Hänniger, Sabine; Dumas, Pascaline; Schöfl, Gerhard; Gebauer-Jung, Steffi; Vogel, Heiko; Unbehend, Melanie; Heckel, David G; Groot, Astrid T

2017-03-06

Very little is known on how changes in circadian rhythms evolve. The noctuid moth Spodoptera frugiperda (Lepidoptera: Noctuidae) consists of two strains that exhibit allochronic differentiation in their mating time, which acts as a premating isolation barrier between the strains. We investigated the genetic basis of the strain-specific timing differences to identify the molecular mechanisms of differentiation in circadian rhythms. Through QTL analyses we identified one major Quantitative trait chromosome (QTC) underlying differentiation in circadian timing of mating activity. Using RADtags, we identified this QTC to be homologous to Bombyx mori C27, on which the clock gene vrille is located, which thus became the major candidate gene. In S. frugiperda, vrille showed strain-specific polymorphisms. Also, vrille expression differed significantly between the strains, with the rice-strain showing higher expression levels than the corn-strain. In addition, RT-qPCR experiments with the other main clock genes showed that pdp1, antagonist of vrille in the modulatory feedback loop of the circadian clock, showed higher expression levels in the rice-strain than in the corn-strain. Together, our results indicate that the allochronic differentiation in the two strains of S. frugiperda is associated with differential transcription of vrille or a cis-acting gene close to vrille, which contributes to the evolution of prezygotic isolation in S. frugiperda.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fogh, Ellen; Toft-Petersen, Rasmus; Ressouche, Eric

Here, the magnetic phase diagram of magnetoelectric LiCoPO 4 is established using neutron diffraction and magnetometry in fields up to 25.9T applied along the crystallographic b axis. For fields greater than 11.9T, the magnetic unit cell triples in size with propagation vector Q = (0,1/3,0). A magnetized elliptic cycloid is formed with spins in the (b,c) plane and the major axis oriented along b. Such a structure allows for the magnetoelectric effect with an electric polarization along c induced by magnetic fields applied along b. Intriguingly, additional ordering vectors Q ≈ (0,1/4,0) and Q ≈ (0,1/2,0) appear for increasing fieldsmore » in the hysteresis region below the transition field. Traces of this behavior are also observed in the magnetization. A simple model based on a mean-field approach is proposed to explain these additional ordering vectors. In the field interval 20.5–21.0T, the propagation vector Q = (0,1/3,0) remains but the spins orient differently compared to the cycloid phase. Furthermore, above 21.0T and up until saturation, a commensurate magnetic structure exists with a ferromagnetic component along b and an antiferromagnetic component along« less

Comparison of a new multiplex real-time PCR with the Kato Katz thick smear and copro-antigen ELISA for the detection and differentiation of Taenia spp. in human stools

PubMed Central

Stevenson, Mark A.; Dorny, Pierre; Gabriël, Sarah; Vo, Tinh Van; Nguyen, Van-Anh Thi; Phan, Trong Van; Hii, Sze Fui; Traub, Rebecca J.

2017-01-01

Background Taenia solium, the cause of neurocysticercosis (NCC), has significant socioeconomic impacts on communities in developing countries. This disease, along with taeniasis is estimated to infect 2.5 to 5 million people globally. Control of T. solium NCC necessitates accurate diagnosis and treatment of T. solium taeniasis carriers. In areas where all three species of Taenia tapeworms (T. solium, Taenia saginata and Taenia asiatica) occur sympatrically, conventional microscope- and copro-antigen based diagnostic methods are unable to distinguish between these three Taenia species. Molecular diagnostic tools have been developed to overcome this limitation; however, conventional PCR-based techniques remain unsuitable for large-scale deployment in community-based surveys. Moreover, a real-time PCR (qPCR) for the discrimination of all three species of Taenia in human stool does not exist. This study describes the development and validation of a new triplex Taq-Man probe-based qPCR for the detection and discrimination of all three Taenia human tapeworms in human stools collected from communities in the Central Highlands of Vietnam. The diagnostic characteristics of the test are compared with conventional Kato Katz (KK) thick smear and copro-antigen ELISA (cAgELISA) method utilizing fecal samples from a community based cross-sectional study. Using this new multiplex real-time PCR we provide an estimate of the true prevalence of taeniasis in the source population for the community based cross-sectional study. Methodology/Principal findings Primers and TaqMan probes for the specific amplification of T. solium, T. saginata and T. asiatica were designed and successfully optimized to target the internal transcribed spacer I (ITS-1) gene of T. solium and the cytochrome oxidase subunit I (COX-1) gene of T. saginata and T. asiatica. The newly designed triplex qPCR (T3qPCR) was compared to KK and cAgELISA for the detection of Taenia eggs in stool samples collected from 342 individuals in Dak Lak province, Central Highlands of Vietnam. The overall apparent prevalence of taeniasis in Dak Lak province was 6.72% (95% confidence interval (CI) [3.94–9.50]) in which T. solium accounted for 1.17% (95% CI [0.37–3.17]), according to the T3qPCR. There was sympatric presence of T. solium, T. saginata and T. asiatica. The T3qPCR proved superior to KK and cAgELISA for the detection and differentiation of Taenia species in human feces. Diagnostic sensitivities of 0.94 (95% credible interval (CrI) [0.88–0.98]), 0.82 (95% CrI [0.58–0.95]) and 0.52 (95% CrI [0.07–0.94]), and diagnostic specificities of 0.98 (95% CrI [0.94–1.00]), 0.91 (95% CrI [0.85–0.96]) and 0.99 (95% CrI [0.96–1.00]) were estimated for the diagnosis of taeniasis for the T3qPCR, cAgELISA and KK thick smear in this study, respectively. Conclusions T3qPCR is not only superior to the KK thick smear and cAgELISA in terms of diagnostic sensitivity and specificity, but it also has the advantage of discriminating between species of Taenia eggs in stools. Application of this newly developed T3qPCR has identified the existence of all three human Taenia tapeworms in Dak Lak province and proves for the first time, the existence of T. asiatica in the Central Highlands and the south of Vietnam. PMID:28686662

Methadone, QTc prolongation and torsades de pointes: Current concepts, management and a hidden twist in the tale?

PubMed

Mujtaba, Sobia; Romero, Jorge; Taub, Cynthia C

2013-12-01

Methadone is a drug that has found widespread utility in the management of opioid addiction and pain. Along with its popularity, methadone has also earned an infamous reputation for causing prolongation of the QT interval and an increased risk of torsades de pointes. In this article we will give a brief overview of the long QT syndromes, followed by an in-depth look at the current pathophysiologic mechanisms of methadone induced QT prolongation, a review of the existing literature and the current concepts regarding the prevention and management of methadone induced torsades de pointes. In addition, we explore the idea and implications of a genetic link between methadone induced prolongation of the QT interval and torsades de pointes.

Glaubers Ising chain between two thermostats

NASA Astrophysics Data System (ADS)

Cornu, F.; Hilhorst, H. J.

2017-04-01

We consider a one-dimensional Ising model with N spins, each in contact with two thermostats of distinct temperatures, T 1 and T 2. Under Glauber dynamics the stationary state happens to coincide with the equilibrium state at an effective intermediate temperature T≤ft({{T}1},{{T}2}\\right) . The system nevertheless carries a nontrivial energy current between the thermostats. By means of the fermionization technique, for a chain initially in equilibrium at an arbitrary temperature T 0 we calculate the Fourier transform of the probability P≤ft(Q;τ \\right) for the time-integrated energy current Q during a finite time interval τ. In the long time limit we determine the corresponding generating function for the cumulants per site and unit of time, {< {{Q}n}>\\text{c}}/(Nτ ) , and explicitly give those with n  =  1, 2, 3, 4. We exhibit various phenomena in specific regimes: kinetic mean-field effects when one thermostat flips any spin less often than the other one, as well as dissipation towards a thermostat at zero temperature. Moreover, when the system size N goes to infinity while the effective temperature T vanishes, the cumulants of Q per unit of time grow linearly with N and are equal to those of a random walk process. In two adequate scaling regimes involving T and N we exhibit the dependence of the first correction upon the ratio of the spin-spin correlation length ξ (T) and the size N.

ECG parameters predict left ventricular conduction delay in patients with left ventricular dysfunction.

PubMed

Pastore, Gianni; Maines, Massimiliano; Marcantoni, Lina; Zanon, Francesco; Noventa, Franco; Corbucci, Giorgio; Baracca, Enrico; Aggio, Silvio; Picariello, Claudio; Lanza, Daniela; Rigatelli, Gianluca; Carraro, Mauro; Roncon, Loris; Barold, S Serge

2016-12-01

Estimating left ventricular electrical delay (Q-LV) from a 12-lead ECG may be important in evaluating cardiac resynchronization therapy (CRT). The purpose of this study was to assess the impact of Q-LV interval on ECG configuration. One hundred ninety-two consecutive patients undergoing CRT implantation were divided electrocardiographically into 3 groups: left bundle branch block (LBBB), right bundle branch block (RBBB), and nonspecific intraventricular conduction delay (IVCD). The IVCD group was further subdivided into 81 patients with left (L)-IVCD and 15 patients with right (R)-IVCD (resembling RBBB, but without S wave in leads I and aVL). The Q-LV interval in the different groups and the relationship between ECG parameters and the maximum Q-LV interval were analyzed. Patients with LBBB presented a long Q-LV interval (147.7 ± 14.6 ms, all exceeding cutoff value of 110 ms), whereas RBBB patients presented a very short Q-LV interval (75.2 ± 16.3 ms, all <110 ms). Patients with an IVCD displayed a wide range of Q-LV intervals. In L-IVCD, mid-QRS notching/slurring showed the strongest correlation with a longer Q-LV interval, followed, in decreasing order, by QRS duration >150 ms and intrinsicoid deflection >60 ms. Isolated mid-QRS notching/slurring predicted Q-LV interval >110 ms in 68% of patients. The R-IVCD group presented an unexpectedly longer Q-LV interval (127.0 ± 12.5 ms; 13/15 patients had Q-LV >110 ms). Patients with LBBB have a very prolonged Q-LV interval. Mid-QRS notching in lateral leads strongly predicts a longer Q-LV interval in L-IVCD patients. Patients with R-IVCD constitute a subgroup of patients with a long Q-LV interval. Copyright © 2016 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

Degree Of Diminution In Vagal-Cardiac Activity Predicts Sudden Death In Familial Dysautonomia When Resting Tachycardia Is Absent

NASA Technical Reports Server (NTRS)

Schlegel, T. T.; Marthol, H.; Bucchner, S.; Tutaj, M.; Berlin, D.; Axelrod, F. B.; Hilz, M. J.

2004-01-01

Patients with familial dysautonomia (FD) have an increased risk of sudden death, but sensitive and specific predictors of sudden death in FD are lacking. Methods. We recorded 10-min resting high-fidelity 12-lead ECGs in 14 FD patients and in 14 age/gender-matched healthy subjects and studied 25+ different heart rate variability (HRV) indices for their ability to predict sudden death in the FD patients. Indices studied included those from 4 "nonlinear" HRV techniques (detrended fluctuation analysis, approximate entropy, correlation dimension, and PoincarC analyses). The predictive value of PR, QRS, QTc and JTc intervals, QT dispersion (QTd), beat-to-beat QT and PR interval variability indices (QTVI and PRVI) and 12- lead high frequency QRS ECG (150-250 Hz) were also studied. FD patients and controls (C) differed (Pless than 0.0l) with respect to 20+ of the HRV indices (FD less than C) and with respect to QTVI and PRVI (FDBC) and HF QRS- related root mean squared voltages (FDBC) and reduced amplitude zone counts (FD less than C). They differed less with respect to PR intervals (FD less than C) and JTc intervals (FD greater than C) (P less than 0.05 for both) and did not differ at all with respect to QRS and QTc intervals and to QTd. Within 12 months after study, 2 of the 14 patients succumbed to sudden cardiac arrest. The best predictor of sudden death was the degree of diminution in HRV vagal-cardiac (parasympathetic) parameters such as RMSSD, the SDl of Poincare plots, and HF spectral power. Excluding the two FD patients who had resting tachycardia (HR greater than 100, which confounds traditional HRV analyses), the following criteria were independently 100% sensitive and 100% specific for predicting sudden death in the remaining 12 FD patients during spontaneous breathing: RMSSD less than 13 ms and/or PoincarC SD1 less than 9 ms. In FD patients without supine tachycardia, the degree of diminution in parasympathetic HRV parameters (by high-fidelity ECG) predicts incipient death.

Comet and Asteroid Hazard to the Terrestrial Planets

NASA Technical Reports Server (NTRS)

Ipatov, S. I.; Mather, J. C.; Oegerle, William (Technical Monitor)

2002-01-01

We made computer simulations of orbital evolution for intervals of at least 5-10 Myr of N=2000 Jupiter-crossing objects (JCOs) with initial orbits close to those of real comets with period P less than 10 yr, 500 objects with orbits close to that of Comet 10P, and the asteroids initially located at the 3:1 and 5:2 resonances with Jupiter at initial eccentricity e(sub 0)=0.15 and initial inclination i(sub 0)=10(sup 0). The gravitational influence of all planets, except for Mercury and Pluto, was taken into account (without dissipative factors). We calculated the probabilities of collisions of bodies with the terrestrial planets, using orbital elements obtained with a step equal to 500 yr, and then summarized the results for all bodies, obtaining, the total probability Psigma of collisions with a planet and the total time interval Tsigma during which perihelion distance q of bodies was less than a semimajor axis of the planet. The values of p(sub r) =10(exp 6)Psigma/N and T(sub r)=T/1000 yr (where T=Tsigma/N) are presented in a table together with the ratio r of the total time interval when orbits were of Apollo type (at a greater than 1 AU, q less than 1.017 AU, e less than 0.999) to that of Amor type (1.017 less than q less than 1.33 AU), r(sub 2) is the same as r but for Apollo objects with e less than 0.9. For asteroids we present only results obtained by direct integration, as a symplectic method can give large errors for these resonances.

Relationship of QT dispersion with sex hormones and insulin in young women with polycystic ovary syndrome: an observational study.

PubMed

Gazi, Emine; Gencer, Meryem; Hancı, Volkan; Temiz, Ahmet; Altun, Burak; Cakır Güngör, Ayşe Nur; Oztürk, Ufuk; Kırılmaz, Bahadır

2013-12-01

Polycystic ovary syndrome (PCOS) is a common endocrinopathy in reproductive women. Cardiovascular disease risk factors are more frequent in this population. We aimed in this study to investigate presence of QT dispersion and effects of sex hormones and insulin on QT duration in young PCOS patients. This present study was cross-sectional observational study. A total of 47 women, 25 patients with PCOS and 22 healthy, were included. Serum testosterone, estradiol and insulin levels were studied and electrocardiography was performed at 2nd or 3th days of menstrual cycle. The study population was divided into groups according to serum testosterone and estradiol levels. Sub-groups and pairwise groups were compared by Mann-Whitney U or student t-test. The associations of QTc durations with hormone levels were calculated using Spearman rank correlation analysis. The results were evaluated at the p<0.05 significance level. No differences found between groups regarding to demographic parameters. Estradiol and testosterone levels were higher in patients with PCOS (41.12 ± 13.59 vs. 35.57 ± 19.29 pg/mL, p=0.09 and 105 ± 58.5 vs. 17.6 ± 10.9 ng/dL, p=0.01, respectively). QT dispersion was significantly longer in PCOS patients (47.1 vs. 32.7 ms, p=0.01). A positive correlation was found between the serum insulin level and QTc min, QTc max, and QTc mean (r=0.402, p=0.011; r=0.341, p=0.033; r=0.337, p=0.036; respectively). QT dispersion with serum testosterone and estradiol levels were positively correlated (r=0.525, p=0.001 and r=0.326, p=0.046; respectively). Our results suggest that QT dispersion is prolonged and testosterone, estradiol and insulin are associated with QT duration in young PCOS patients.

Population pharmacokinetics and exposure-response of osimertinib in patients with non-small cell lung cancer.

PubMed

Brown, Kathryn; Comisar, Craig; Witjes, Han; Maringwa, John; de Greef, Rik; Vishwanathan, Karthick; Cantarini, Mireille; Cox, Eugène

2017-06-01

To develop a population (pop) pharmacokinetic (PK) model for osimertinib (AZD9291) and its metabolite (AZ5104) and investigate the exposure-response relationships for selected efficacy and safety parameters. PK, safety and efficacy data were collected from two non-small cell lung cancer (NSCLC) patient studies (n = 748) and one healthy volunteer study (n = 32), after single or multiple once-daily dosing of 20-240 mg osimertinib. Nonlinear mixed effects modelling was used to characterise the popPK. Individual exposure values were used to investigate the relationship with response evaluation criteria in solid tumours (RECIST 1.1) efficacy parameters and key safety parameters (rash, diarrhoea, QTcF). A popPK model that adequately described osimertinib and its metabolite AZ5104 in a joint manner was developed. Body weight, serum albumin and ethnicity were identified as significant covariates on PK in the analysis, but were not found to have a clinically relevant impact on osimertinib exposure. No relationship was identified between exposure and efficacy over the dose range studied. A linear relationship was observed between exposure and the occurrence of rash or diarrhoea, and between concentration and QTcF, with a predicted mean (upper 90% confidence interval) increase of 14.2 (15.8) ms at the maximum concentration for an 80 mg once-daily dose at steady state. PopPK and exposure-response models were developed for osimertinib and AZ5104. There was no relationship between exposure and efficacy but a linear relationship between exposure and safety endpoints (rash, diarrhoea and QTcF) was observed. © 2016 The British Pharmacological Society.

Magnetic order, hysteresis, and phase coexistence in magnetoelectric LiCoPO 4

DOE PAGES

Fogh, Ellen; Toft-Petersen, Rasmus; Ressouche, Eric; ...

2017-09-15

Here, the magnetic phase diagram of magnetoelectric LiCoPO 4 is established using neutron diffraction and magnetometry in fields up to 25.9T applied along the crystallographic b axis. For fields greater than 11.9T, the magnetic unit cell triples in size with propagation vector Q = (0,1/3,0). A magnetized elliptic cycloid is formed with spins in the (b,c) plane and the major axis oriented along b. Such a structure allows for the magnetoelectric effect with an electric polarization along c induced by magnetic fields applied along b. Intriguingly, additional ordering vectors Q ≈ (0,1/4,0) and Q ≈ (0,1/2,0) appear for increasing fieldsmore » in the hysteresis region below the transition field. Traces of this behavior are also observed in the magnetization. A simple model based on a mean-field approach is proposed to explain these additional ordering vectors. In the field interval 20.5–21.0T, the propagation vector Q = (0,1/3,0) remains but the spins orient differently compared to the cycloid phase. Furthermore, above 21.0T and up until saturation, a commensurate magnetic structure exists with a ferromagnetic component along b and an antiferromagnetic component along« less

Common Genetic Variant Risk Score Is Associated With Drug-Induced QT Prolongation and Torsade de Pointes Risk: A Pilot Study.

PubMed

Strauss, David G; Vicente, Jose; Johannesen, Lars; Blinova, Ksenia; Mason, Jay W; Weeke, Peter; Behr, Elijah R; Roden, Dan M; Woosley, Ray; Kosova, Gulum; Rosenberg, Michael A; Newton-Cheh, Christopher

2017-04-04

Drug-induced QT interval prolongation, a risk factor for life-threatening ventricular arrhythmias, is a potential side effect of many marketed and withdrawn medications. The contribution of common genetic variants previously associated with baseline QT interval to drug-induced QT prolongation and arrhythmias is not known. We tested the hypothesis that a weighted combination of common genetic variants contributing to QT interval at baseline, identified through genome-wide association studies, can predict individual response to multiple QT-prolonging drugs. Genetic analysis of 22 subjects was performed in a secondary analysis of a randomized, double-blind, placebo-controlled, crossover trial of 3 QT-prolonging drugs with 15 time-matched QT and plasma drug concentration measurements. Subjects received single doses of dofetilide, quinidine, ranolazine, and placebo. The outcome was the correlation between a genetic QT score comprising 61 common genetic variants and the slope of an individual subject's drug-induced increase in heart rate-corrected QT (QTc) versus drug concentration. The genetic QT score was correlated with drug-induced QTc prolongation. Among white subjects, genetic QT score explained 30% of the variability in response to dofetilide ( r =0.55; 95% confidence interval, 0.09-0.81; P =0.02), 23% in response to quinidine ( r =0.48; 95% confidence interval, -0.03 to 0.79; P =0.06), and 27% in response to ranolazine ( r =0.52; 95% confidence interval, 0.05-0.80; P =0.03). Furthermore, the genetic QT score was a significant predictor of drug-induced torsade de pointes in an independent sample of 216 cases compared with 771 controls ( r 2 =12%, P =1×10 -7 ). We demonstrate that a genetic QT score comprising 61 common genetic variants explains a significant proportion of the variability in drug-induced QT prolongation and is a significant predictor of drug-induced torsade de pointes. These findings highlight an opportunity for recent genetic discoveries to improve individualized risk-benefit assessment for pharmacological therapies. Replication of these findings in larger samples is needed to more precisely estimate variance explained and to establish the individual variants that drive these effects. URL: http://www.clinicaltrials.gov. Unique identifier: NCT01873950. © 2017 American Heart Association, Inc.

Measuring the value of endoscopic retrograde cholangiopancreatography activity: an opportunity to stratify endoscopists on the basis of their value.

PubMed

Parihar, Vikrant; Moran, Carthage; Maheshwari, Pardeep; Cheriyan, Danny; O'Toole, Aoibhlinn; Murray, Frank; Patchett, Stephen E; Harewood, Gavin C

2018-07-01

As finite healthcare resources come under pressure, the value of physician activity is assuming increasing importance. The value in healthcare can be defined as patient health outcomes achieved per monetary unit spent. Even though some attempts have been made to quantify the value of clinician activity, there is little in the medical literature describing the importance of endoscopists' activity. This study aimed to characterize the value of endoscopic retrograde cholangiopancreatography (ERCP) performance of five gastroenterologists. We carried out a retrospective-prospective cohort study using the databases of patients undergoing ERCP between September 2014 and March 2017. We collected data from 1070 patients who underwent ERCP comparing value among the ERCPists at index ERCP. Procedure value was calculated using the formula Q/(T/C), where Q is the quality of procedure, T is the duration of procedure and C is the adjusted for complexity level. Quality and complexity were derived on a 1-4 Likert scale on the basis of American Society for Gastrointestinal Endoscopy criteria; time was recorded (in min) from intubation to extubation. Endoscopist time calculated from procedure time was considered a surrogate marker of cost as individual components of procedure cost were not itemized. In total, 590 procedures were analysed: 465 retrospectively over 24 months and 125 prospectively over 6 months. There was a 32% variation in the value of endoscopist activity in a more substantial retrospective cohort, with an even more considerable 73% variation in a smaller prospective arm. In an analysis of greater than 1000 ERCPs by a small cohort of experienced ERCPists, there was a wide variation in the value of endoscopist activity. Although the precision of estimating procedural costs needs further refinement, these findings show the ability to stratify ERCPists on the basis of the value their activity. As healthcare costs are scrutinized more closely, such value measurements are likely to become more relevant.

Variants on 8q24 and prostate cancer risk in Chinese population: a meta-analysis.

PubMed

Ren, Xiao-Qiang; Zhang, Jian-Guo; Xin, Shi-Yong; Cheng, Tao; Li, Liang; Ren, Wei-Hua

2015-01-01

Previous studies have identified 8q24 as an important region to prostate cancer (PCa) susceptibility. The aim of this study was to investigate the role of six genetic variants on 8q24 (rs1447295, A; rs6983267, G; rs6983561, C; rs7837688, T; rs10090154, T and rs16901979, A) on PCa risk in Chinese population. Online electronic databases were searched to retrieve related articles concerning the association between 8q24 variants and PCa risk in men of Chinese population published between 2000 and 2014. Odds ratio (ORs) with its 95% correspondence interval (CI) were employed to assess the strength of association. Total eleven case-control studies were screened out, including 2624 PCa patients and 2438 healthy controls. Our results showed that three risk alleles of rs1447295 A (OR=1.35, 95% CI=1.19-1.53, P<0.00001), rs6983561 C (C vs. A: OR=1.41, 95% CI=1.21-1.63, P<0.00001) and rs10090154 T (T vs. C: OR=1.48, 95% CI=1.22-1.80, P<0.00001) on8q24 were significantly associated with PCa risk in Chinese population. Furthermore, genotypes of rs1447295, AA+AC; rs6983561, CC+AC and CC; rs10090154, TT+TC; and rs16901979, AA were associated with PCa as well (P<0.01). No association was found between rs6983267, rs7837688 and PCa risk. In conclusions, variants including rs1447295, rs6983561, rs10090154 and rs16901979 on 8q24 might be associated with PCa risk in Chinese population, indicating these four variations may contribute risk to this disease. This meta-analysis was the first study to assess the role of 8q24 variants on PCa risk in Chinese population.

Prolonged Tp-e Interval in Down Syndrome Patients with Congenitally Normal Hearts.

PubMed

Kucuk, Mehmet; Karadeniz, Cem; Ozdemir, Rahmi; Meşe, Timur

2018-03-25

Heterogeneity of ventricular repolarization has been assessed by using the QT dispersion in Down syndrome (DS) patients with congenitally normal hearts. However, novel repolarization indexes, the Tp-e interval and Tp-e/QT ratio, have not previously been evaluated in these patients. The aim of this study was to evaluate the Tp-e interval and Tp-e/QT ratio in DS patients without congenital heart defects. Twelve-lead surface electrocardiograms of 160 DS patients and 110 age- and sex-matched healthy controls were used to evaluate and compare the Tp-e interval, Tp-e dispersion, and Tp-e/QT ratio. Heart rate, Tp-e interval, Tp-e dispersion, Tp-e/QT and Tp-e/QTc ratios were significantly higher in DS group than in the controls. Myocardial repolarization indexes in DS patients with congenitally normal hearts were found to be prolonged compared to those in normal controls. Further evaluation is warranted to reveal a relationship between prolonged repolarization indexes and arrhythmic events in these patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The Association between Work-Related Stress and Autonomic Imbalance among Call Center Employees in Japan.

PubMed

Enoki, Mamiko; Maeda, Eri; Iwata, Toyoto; Murata, Katsuyuki

2017-12-01

There is little epidemiological evidence linking subjective stress to objective etiologic indicators. To clarify an association between work-related stress and autonomic nervous function, we examined call center employees (167 males and 371 females) undergoing electrocardiography (ECG) at the time of annual health checkups. The questionnaire was composed of the Brief Job Stress Questionnaire based on the demand-control-support model and the Social Readjustment Rating Scale including detailed contents of home stress. The Bazett's corrected QT (QTc) interval, QT index, and heart rate were obtained from the ECG data. The male employees showed significantly higher scores of job demand, job control, and supervisor support than the female ones. In the male employees, QT index indicating the extent of autonomic imbalance and heart rate were associated with high score of supervisor support and low score of coworker support (P < 0.05), but no significant relationships were seen between QTc interval and either job strain (i.e., job demand and job control) or home stress. By contrast, the female employees showed no significant links between any autonomic indicators and either work-related stress or home stress. These data suggest that work-related stress affected QT index in male employees suffering specific occupational stressors such as emotional abuse from unsatisfied customers. Specifically, supports from supervisors and coworkers were paradoxically associated with QT index, implying that supervisors may have failed to effectively support such male employees. Also, autonomic nervous function in male employees appears to be more vulnerable to work-related stress than that in female ones.

Preparticipation evaluation of novice, middle-age, long-distance runners.

PubMed

Aagaard, Philip; Sahlén, Anders; Bergfeldt, Lennart; Braunschweig, Frieder

2013-01-01

The purpose of this study was to assess the cardiovascular health and risk profile in middle-age men making an entry to participate for their first time in a long-distance race. Male first-time participants, 45 yr and older, in the world's largest cross-country running race, the Lidingöloppet, were evaluated with a medical history and physical examination, European systematic coronary risk evaluation (SCORE), 12-lead ECG, echocardiography, and blood tests. Further diagnostic workup was performed when clinically indicated. Of 265 eligible runners, 153 (58%, age 51 ± 5 yr) completed the study. Although the 10-yr fatal cardiovascular event risk was low (SCORE, 1%; interquartile range, 0%-1%), mild abnormalities were common, for example, elevated blood pressure (19%), left ventricular hypertrophy (6%), and elevated LDL cholesterol (5%). ECG changes compatible with the "athlete's heart" were present in 82%, for example, sinus bradycardia (61%) and/or early repolarization (32%). ECG changes considered training unrelated were found in 24%, for example, prolonged QTc-interval (13%), left axis deviation (5.3%), and left atrial enlargement (4%). In 14 runners (9%), additional diagnostic workup was clinically motivated, and 4 runners (2%) were ultimately discouraged from vigorous exercise because of QTc intervals >500 ms (n = 2), symptomatic atrioventricular block (n = 1), and cardiac tumor (n = 1). The physician examination and the ECG identified 12 of the 14 participants requiring further evaluation. Cardiovascular evaluation of middle-age men, including a physician examination and a 12-lead ECG, appears useful to identify individuals requiring further testing before vigorous exercise. The additional yield of routine echocardiography was small.

Effects of nandrolone and resistance training on the blood pressure, cardiac electrophysiology, and expression of atrial β-adrenergic receptors.

PubMed

das Neves, Vander José; Tanno, Ana Paula; Cunha, Tatiana Sousa; Fernandes, Tiago; Guzzoni, Vinicius; da Silva, Carlos Alberto; de Oliveira, Edilamar Menezes; Moura, Maria José Costa Sampaio; Marcondes, Fernanda Klein

2013-05-30

This study was performed to assess isolated and combined effects of nandrolone and resistance training on the blood pressure, cardiac electrophysiology, and expression of the β1- and β2-adrenergic receptors in the heart of rats. Wistar rats were randomly divided into four groups and submitted to a 6-week treatment with nandrolone and/or resistance training. Cardiac hypertrophy was accessed by the ratio of heart weight to the final body weight. Blood pressure was determined by a computerized tail-cuff system. Electrocardiography analyses were performed. Western blotting was used to access the protein levels of the β1- and β2-adrenergic receptors in the right atrium and left ventricle. Both resistance training and nandrolone induced cardiac hypertrophy. Nandrolone increased systolic blood pressure depending on the treatment time. Resistance training decreased systolic, diastolic and mean arterial blood pressure, as well as induced resting bradycardia. Nandrolone prolonged the QTc interval for both trained and non-trained groups when they were compared to their respective vehicle-treated one. Nandrolone increased the expression of β1- and β2-adrenergic receptors in the right atrium for both trained and non-trained groups when they were compared to their respective vehicle-treated one. This study indicated that nandrolone, associated or not with resistance training increases blood pressure depending on the treatment time, induces prolongation of the QTc interval, and increases the expression of β1- and β2-adrenergic receptors in the cardiac right atrium, but not in the left ventricle. Copyright © 2013. Published by Elsevier Inc.

The effects of diltiazem and metoprolol in QTc prolongation due to amitriptyline intoxication.

PubMed

Basol, Nursah; Erbas, Oytun

2016-01-01

Amitriptyline, a frequently used tricyclic antidepressant agent, has powerful cardiotoxic effects especially in high doses. Serum and urine levels of amitriptyline dosages are not correlated with severity of toxicity; therefore, it increases the importance of electrocardiography (ECG) abnormalities. The prolongation of QTc can be a predictive marker for cardiotoxicity. Hence, in this study, it is aimed to evaluate possible effects of metoprolol and diltiazem in amitriptyline toxicity. The rats were separated into four groups. First one was control group, the second was the amitriptyline + saline group, third one was the amitriptyline + metoprolol group, and forth one was the amitriptyline + diltiazem group. ECG were recorded on rats under anesthesia. In amitriptyline group, QTc duration was prolonged compared with all other groups. The prolongation of QTc was shorter in amitriptyline + metoprolol group and amitriptyline + diltiazem group than amitriptyline group (p < 0.01 and p < 0.01, respectively). According to the results, it is possible to report ameliorating effects of both metoprolol and diltiazem on QTc prolongation related with amitriptyline intoxication. With further studies, these agents may be used for amitriptyline toxicity and besides, they may be used for patients in cardiovascular risk groups who take amitriptyline treatment regularly. © The Author(s) 2015.

Methadone, QTc prolongation and torsades de pointes: Current concepts, management and a hidden twist in the tale?

PubMed Central

Mujtaba, Sobia; Romero, Jorge; Taub, Cynthia C.

2013-01-01

Methadone is a drug that has found widespread utility in the management of opioid addiction and pain. Along with its popularity, methadone has also earned an infamous reputation for causing prolongation of the QT interval and an increased risk of torsades de pointes. In this article we will give a brief overview of the long QT syndromes, followed by an in-depth look at the current pathophysiologic mechanisms of methadone induced QT prolongation, a review of the existing literature and the current concepts regarding the prevention and management of methadone induced torsades de pointes. In addition, we explore the idea and implications of a genetic link between methadone induced prolongation of the QT interval and torsades de pointes. PMID:24653586

On the asymmetric evolution of the perihelion distances of near-Earth Jupiter family comets around the discovery time

NASA Astrophysics Data System (ADS)

Sosa, A.; Fernández, J. A.; Pais, P.

2012-12-01

We study the dynamical evolution of the near-Earth Jupiter family comets (NEJFCs) that came close to or crossed the Earth's orbit at the epoch of their discovery (perihelion distances qdisc < 1.3 AU). We found a minimum in the time evolution of the mean perihelion distance bar{q} of the NEJFCs at the discovery time of each comet (taken as t = 0) and a past-future asymmetry of bar{q} in an interval -1000 yr, +1000 yr centred on t = 0, confirming previous results. The asymmetry indicates that there are more comets with greater q in the past than in the future. For comparison purposes, we also analysed the population of near-Earth asteroids in cometary orbits (defined as those with aphelion distances Q > 4.5 AU) and with absolute magnitudes H < 18. We found some remarkable differences in the dynamical evolution of both populations that argue against a common origin. To further analyse the dynamical evolution of NEJFCs, we integrated in time a large sample of fictitious comets, cloned from the observed NEJFCs, over a 20 000 yr time interval and started the integration before the comet's discovery time, when it had a perihelion distance q > 2 AU. By assuming that NEJFCs are mostly discovered when they decrease their perihelion distances below a certain threshold qthre = 1.05 AU for the first time during their evolution, we were able to reproduce the main features of the observed bar{q} evolution in the interval [-1000, 1000] yr with respect to the discovery time. Our best fits indicate that 40% of the population of NEJFCs would be composed of young, fresh comets that entered the region q < 2 AU a few hundred years before decreasing their perihelion distances below qthre, while 60% would be composed of older, more evolved comets, discovered after spending at least 3000 yr in the q < 2 AU region before their perihelion distances drop below qthre. As a byproduct, we put some constraints on the physical lifetime τphys of NEJFCs in the q < 2 AU region. We found a lower limit of a few hundreds of revolutions and an upper limit of about 10 000-12 000 yr, or about 1600-2000 revolutions, somewhat longer than some previous estimates. These constraints are consistent with other estimates of τphys, based either on mass loss (sublimation, outbursts, splittings) or on the extinction rate of Jupiter family comets (JFCs).

Increased beat-to-beat T-wave variability in myocardial infarction patients.

PubMed

Hasan, Muhammad A; Abbott, Derek; Baumert, Mathias; Krishnan, Sridhar

2018-03-28

The purpose of this study was to investigate the beat-to-beat variability of T-waves (TWV) and to assess the diagnostic capabilities of T-wave-based features for myocardial infarction (MI). A total of 148 recordings of standard 12-lead electrocardiograms (ECGs) from 79 MI patients (22 females, mean age 63±12 years; 57 males, mean age 57±10 years) and 69 recordings from healthy subjects (HS) (17 females, 42±18 years; 52 males, 40±13 years) were studied. For the quantification of beat-to-beat QT intervals in ECG signal, a template-matching algorithm was applied. To study the T-waves beat-to-beat, we measured the angle between T-wave max and T-wave end with respect to Q-wave (∠α) and T-wave amplitudes. We computed the standard deviation (SD) of beat-to-beat T-wave features and QT intervals as markers of variability in T-waves and QT intervals, respectively, for both patients and HS. Moreover, we investigated the differences in the studied features based on gender and age for both groups. Significantly increased TWV and QT interval variability (QTV) were found in MI patients compared to HS (p<0.05). No significant differences were observed based on gender or age. TWV may have some diagnostic attributes that may facilitate identifying patients with MI. In addition, the proposed beat-to-beat angle variability was found to be independent of heart rate variations. Moreover, the proposed feature seems to have higher sensitivity than previously reported feature (QT interval and T-wave amplitude) variability for identifying patients with MI.

Ziprasidone Augmentation of Escitalopram for Major Depressive Disorder: Cardiac, Endocrine, Metabolic, and Motoric Effects in a Randomized, Double-Blind, Placebo-Controlled Study.

PubMed

Mischoulon, David; Shelton, Richard C; Baer, Lee; Bobo, William V; Curren, Laura; Fava, Maurizio; Papakostas, George I

2017-04-01

To examine motoric, cardiovascular, endocrine, and metabolic effects of adjunctive ziprasidone in adults with major depressive disorder (MDD) and prior nonresponse to 8 weeks of open-label escitalopram. A multicenter, parallel, randomized, double-blind, placebo-controlled trial was conducted at 3 US academic medical centers from July 2008 to October 2013. Recruited were 139 outpatients with persistent DSM-IV MDD following an 8-week open-label trial of escitalopram. Subjects were then randomized to adjunctive ziprasidone (escitalopram + ziprasidone, n = 71) or placebo (escitalopram + placebo, n = 68) for 8 additional weeks. Cardiac and metabolic measures were obtained at each treatment visit. Barnes Akathisia Scale and Abnormal Involuntary Movement Scale (AIMS) scores were also obtained. Changes in outcome measures for each treatment group were compared by independent-samples t test. A trend toward significance (P = .06) in corrected QT interval (QTc) increase was observed for ziprasidone (mean [SD] = 8.8 [20.2] milliseconds) versus placebo (-0.02 [25.5] milliseconds). Ziprasidone-treated patients had a significantly greater increase in global akathisia scores (P = .01) and significant weight increase (mean [SD] = 3.5 [11.8] kg, or 7.7 [26.1] lb) compared to placebo (1.0 [6.4] kg, or 2.2 [14.1] lb) (P = .03). No significant changes in AIMS scores were observed for either treatment group. Adjunctive ziprasidone, added to escitalopram, led to a greater weight gain and greater but modest akathisia compared to placebo. The effect of ziprasidone on QTc showed a trend toward significance, and therefore caution should be used in the administration of ziprasidone. While ziprasidone augmentation in patients with MDD appears safe, precautions should be taken in practice, specifically regular monitoring of electrocardiogram, weight, extrapyramidal symptoms, and involuntary movements. ClinicalTrials.gov identifier: NCT00633399​​. © Copyright 2016 Physicians Postgraduate Press, Inc.

A new color vision test to differentiate congenital and acquired color vision defects.

PubMed

Shin, Young Joo; Park, Kyu Hyung; Hwang, Jeong-Min; Wee, Won Ryang; Lee, Jin Hak

2007-07-01

To investigate the efficacy of a novel computer-controlled color test for the differentiation of congenital and acquired color vision deficiency. Observational cross-sectional study. Thirty-one patients with congenital color vision deficiency and 134 patients with acquired color vision deficiency with a Snellen visual acuity better than 20/30 underwent an ophthalmologic examination including the Ishihara color test, Hardy-Rand-Rittler test, Nagel anomaloscopy, and the Seohan computerized hue test between June, 2003, and January, 2004. To investigate the type of color vision defect, a graph of the Seohan computerized hue test was divided into 4 quadrants and error scores in each quadrant were summated. The ratio between the sums of error scores of quadrants I and III (Q1+Q3) and those of quadrants II and IV (Q2+Q4) was calculated. Error scores and ratio in quadrant analysis of the Seohan computerized hue test. The Seohan computerized hue test showed that the sum of Q2+Q4 was significantly higher than the sum of Q1+Q3 in congenital color vision deficiency (P<0.01, paired t test) and that the sum of Q2+Q4 was significantly lower than the sum of Q1+Q3 in acquired color vision deficiency (P<0.01, paired t test). In terms of discriminating congenital and acquired color vision deficiency, the ratio in quadrant analysis had 93.3% sensitivity and 98.5% specificity with a reference value of 1.5 by the Seohan computerized hue test (95% confidence interval). The quadrant analysis and ratio of (Q2+Q4)/(Q1+Q3) using the Seohan computerized hue test effectively differentiated congenital and acquired color vision deficiency.

Prevalence and prognostic importance of hypomagnesemia and hypocalcemia in horses that have colic surgery.

PubMed

Garcia-Lopez, J M; Provost, P J; Rush, J E; Zicker, S C; Burmaster, H; Freeman, L M

2001-01-01

To determine the prevalence of hypomagnesemia and hypocalcemia in horses with surgical colic. 35 horses with surgically managed colic. Serum concentrations of total magnesium (tMg2+) and calcium (tCa2+), as well as ionized magnesium (iMg2+) and calcium (iCa2+) were analyzed before surgery and 1, 3, 5, and 7 days following surgery. A lead-II ECG and pertinent clinical data were also obtained at each time. Preoperative serum tMg2+ and iMg2+ concentrations were below the reference range in 6 (17%) and 19 (54%) horses, respectively. Serum concentrations of tCa2+ and iCa2+ were less than the reference range in 20 (57%) and 30 (86%) horses before surgery. Horses with strangulating lesions of the gastrointestinal tract had significantly lower preoperative serum concentrations of iMg2+ and iCa2+, as well as a higher heart rate than horses with nonstrangulating lesions. Horses that developed postoperative ileus had significantly lower serum concentrations of iMg2+ after surgery. Serum concentrations of magnesium and calcium (total and ionized) correlated significantly with the PR, QRS, QT, and corrected QT (QTc) intervals. Horses that were euthanatized at the time of surgery (n = 7) had significantly lower preoperative serum concentrations of iMg2+, compared with horses that survived. Neither serum magnesium nor calcium concentrations were predictors of hospitalization time or survival. Hypomagnesemia and hypocalcemia were common during the perioperative period, particularly in horses with strangulating intestinal lesions and ileus. Serum concentrations of tMg2+ and tCa2+ were less sensitive than iMg2+ and iCa2+ in detecting horses with hypomagnesemia and hypocalcemia.

Acute alteration of cardiac ECG, action potential, I{sub Kr} and the human ether-a-go-go-related gene (hERG) K{sup +} channel by PCB 126 and PCB 77

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, Mi-Hyeong; Park, Won Sun; Jo, Su-Hyun, E-mail: suhyunjo@kangwon.ac.kr

2012-07-01

Polychlorinated biphenyls (PCBs) have been known as serious persistent organic pollutants (POPs), causing developmental delays and motor dysfunction. We have investigated the effects of two PCB congeners, 3,3′,4,4′-tetrachlorobiphenyl (PCB 77) and 3,3′,4,4′,5-pentachlorobiphenyl (PCB 126) on ECG, action potential, and the rapidly activating delayed rectifier K{sup +} current (I{sub Kr}) of guinea pigs' hearts, and hERG K{sup +} current expressed in Xenopus oocytes. PCB 126 shortened the corrected QT interval (QTc) of ECG and decreased the action potential duration at 90% (APD{sub 90}), and 50% of repolarization (APD{sub 50}) (P < 0.05) without changing the action potential duration at 20% (APD{submore » 20}). PCB 77 decreased APD{sub 20} (P < 0.05) without affecting QTc, APD{sub 90}, and APD{sub 50}. The PCB 126 increased the I{sub Kr} in guinea-pig ventricular myocytes held at 36 °C and hERG K{sup +} current amplitude at the end of the voltage steps in voltage-dependent mode (P < 0.05); however, PCB 77 did not change the hERG K{sup +} current amplitude. The PCB 77 increased the diastolic Ca{sup 2+} and decreased Ca{sup 2+} transient amplitude (P < 0.05), however PCB 126 did not change. The results suggest that PCB 126 shortened the QTc and decreased the APD{sub 90} possibly by increasing I{sub Kr}, while PCB 77 decreased the APD{sub 20} possibly by other modulation related with intracellular Ca{sup 2+}. The present data indicate that the environmental toxicants, PCBs, can acutely affect cardiac electrophysiology including ECG, action potential, intracellular Ca{sup 2+}, and channel activity, resulting in toxic effects on the cardiac function in view of the possible accumulation of the PCBs in human body. -- Highlights: ► PCBs are known as serious environmental pollutants and developmental disruptors. ► PCB 126 shortened QT interval of ECG and action potential duration. ► PCB 126 increased human ether-a-go-go-related K{sup +} current and I{sub Kr}. ► PCB 77 decreased action potential duration and increased intracellular Ca{sup 2+} content. ► PCBs acutely change cardiac electrophysiology and rhythmicity.« less

Clinical significance of HOX11L2 expression linked to t(5;14)(q35;q32), of HOX11 expression, and of SIL-TAL fusion in childhood T-cell malignancies: results of EORTC studies 58881 and 58951.

PubMed

Cavé, Hélène; Suciu, Stefan; Preudhomme, Claude; Poppe, Bruce; Robert, Alain; Uyttebroeck, Anne; Malet, Michèle; Boutard, Patrick; Benoit, Yves; Mauvieux, Laurent; Lutz, Patrick; Méchinaud, Françoise; Grardel, Nathalie; Mazingue, Francoise; Dupont, Madeleine; Margueritte, Geneviève; Pages, Marie-Pierre; Bertrand, Yves; Plouvier, Emmanuel; Brunie, Ghislaine; Bastard, Christian; Plantaz, Dominique; Vande Velde, Isabel; Hagemeijer, Anne; Speleman, Frank; Lessard, Michel; Otten, Jacques; Vilmer, Etienne; Dastugue, Nicole

2004-01-15

In a series of 153 children with T-cell malignancies enrolled in 2 consecutive European Organization for Research and Treatment of Cancer (EORTC) trials, we assessed the HOX11L2 expression and/or the presence of a t(5;14)(q35;q32). Additionally, in 138 of these patients, HOX11 expression and SIL-TAL rearrangement were also assessed. These alterations were mutually exclusive, and their frequency was 23% (n = 35), 7% (n = 10), and 12% (n = 17), respectively. HOX11L2/t(5;14) positivity was more frequent in acute lymphoblastic leukemia (ALL) with cortical T immunophenotype and in children aged between 6 and 9 years. In contrast with previously reported data, patients positive and negative for HOX11L2/t(5;14) were comparable with regard to clinical outcome as well as to the response to a 7-day prephase treatment or to residual disease at completion of induction therapy. The 3-year event-free survival (EFS) rate (+/- SE percentage) for patients positive and negative for HOX11L2/t(5;14) was 75.5% (+/- 8.1%) and 68.3% (+/- 5.0%), respectively; the hazard ratio was 0.84 (95% confidence interval, 0.40-1.80). Patients with HOX11-high expression and those with SIL-TAL fusion had low levels of residual disease at the end of induction and a favorable prognosis: the 3-year EFS rate was 83.3% (+/- 8.5%) and 75.3% (+/- 12.6%), respectively. The results obtained in HOX11L2/t(5;14) patients in this study do not confirm the unfavorable prognosis reported in previous studies.

Predictors of Arrhythmic Events Detected by Implantable Loop Recorders in Renal Transplant Candidates

PubMed Central

Silva, Rodrigo Tavares; Martinelli Filho, Martino; Peixoto, Giselle de Lima; de Lima, José Jayme Galvão; de Siqueira, Sérgio Freitas; Costa, Roberto; Gowdak, Luís Henrique Wolff; de Paula, Flávio Jota; Kalil Filho, Roberto; Ramires, José Antônio Franchini

2015-01-01

Background The recording of arrhythmic events (AE) in renal transplant candidates (RTCs) undergoing dialysis is limited by conventional electrocardiography. However, continuous cardiac rhythm monitoring seems to be more appropriate due to automatic detection of arrhythmia, but this method has not been used. Objective We aimed to investigate the incidence and predictors of AE in RTCs using an implantable loop recorder (ILR). Methods A prospective observational study conducted from June 2009 to January 2011 included 100 consecutive ambulatory RTCs who underwent ILR and were followed-up for at least 1 year. Multivariate logistic regression was applied to define predictors of AE. Results During a mean follow-up of 424 ± 127 days, AE could be detected in 98% of patients, and 92% had more than one type of arrhythmia, with most considered potentially not serious. Sustained atrial tachycardia and atrial fibrillation occurred in 7% and 13% of patients, respectively, and bradyarrhythmia and non-sustained or sustained ventricular tachycardia (VT) occurred in 25% and 57%, respectively. There were 18 deaths, of which 7 were sudden cardiac events: 3 bradyarrhythmias, 1 ventricular fibrillation, 1 myocardial infarction, and 2 undetermined. The presence of a long QTc (odds ratio [OR] = 7.28; 95% confidence interval [CI], 2.01–26.35; p = 0.002), and the duration of the PR interval (OR = 1.05; 95% CI, 1.02–1.08; p < 0.001) were independently associated with bradyarrhythmias. Left ventricular dilatation (LVD) was independently associated with non-sustained VT (OR = 2.83; 95% CI, 1.01–7.96; p = 0.041). Conclusions In medium-term follow-up of RTCs, ILR helped detect a high incidence of AE, most of which did not have clinical relevance. The PR interval and presence of long QTc were predictive of bradyarrhythmias, whereas LVD was predictive of non-sustained VT. PMID:26351983

Upregulation of microRNA-1 and microRNA-133 contributes to arsenic-induced cardiac electrical remodeling.

PubMed

Shan, Hongli; Zhang, Yong; Cai, Benzhi; Chen, Xi; Fan, Yuhua; Yang, Lili; Chen, Xichuang; Liang, Haihai; Zhang, Ying; Song, Xiaohui; Xu, Chaoqian; Lu, Yanjie; Yang, Baofeng; Du, Zhimin

2013-09-10

A large body of evidence showed that arsenic trioxide (As2O3), a front-line drug for the treatment of acute promyelocytic leukemia, induced abnormal cardiac QT prolongation, which hampers its clinical use. The molecular mechanisms for this cardiotoxicity remained unclear. This study aimed to elucidate whether microRNAs (miRs) participate in As2O3-induced QT prolongation. A guinea pig model of As2O3-induced QT prolongation was established by intravenous injection with As2O3. Real-time PCR and Western blot were employed to determine the expression alterations of miRs and mRNAs, and their corresponding proteins. The QT interval and QRS complex were significantly prolonged in a dose-dependent fashion after 7-day administration of As2O3. As2O3 induced a significant upregulation of the muscle-specific miR-1 and miR-133, as well as their transactivator serum response factor. As2O3 depressed the protein levels of ether-a-go-go related gene (ERG) and Kir2.1, the K(+) channel subunits responsible for delayed rectifier K(+) current IKr and inward rectifier K(+) current IK1, respectively. In vivo transfer of miR-133 by direct intramuscular injection prolonged QTc interval and increased mortality rate, along with depression of ERG protein and IKr in guinea pig hearts. Similarly, forced expression of miR-1 widened QTc interval and QRS complex and increased mortality rate, accompanied by downregulation of Kir2.1 protein and IK1. Application of antisense inhibitors to knockdown miR-1 and miR-133 abolished the cardiac electrical disorders caused by As2O3. Deregulation of miR-133 and miR-1 underlies As2O3-induced cardiac electrical disorders and these miRs may serve as potential therapeutic targets for the handling of As2O3 cardiotoxicity. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Cardiac effects of granisetron in a prospective crossover randomized dose comparison trial.

PubMed

Cakir, F B; Yapar, O; Canpolat, C; Akalin, F; Berrak, S G

2012-10-01

Cardiac side effects of granisetron have been studied mostly in adult patients that are using cardiotoxic chemotherapeutics. There is limited evidence in pediatric age group and no information in pediatric oncology patients with non-cardiotoxic chemotherapeutics. In this prospective, crossover randomized study, the cardiac side effects of granisetron are compared in pediatric oncology patients who had carboplatin based chemotherapy. They were randomized to receive either 10 or 40 μg kg(-1) dose(-1) of granisetron before each cycle of chemotherapy. We drew blood for creatine phosphokinase (CPK), CPK-muscle band (MB) and Troponin-T before and 24 h after administering granisetron. Electrocardiography (ECG) tracings were taken at 0, 1, 2, 3, 6 and 24 h of granisetron. Twenty-four hours Holter ECG monitorisation was performed after each granisetron infusion. A total of 16 patients (median 8.7 years of age) were treated with weekly consecutive courses of carboplatin. There was bradycardia (p = 0.000) in patients that had granisetron at 40 μg/kg and PR interval was shortened in patients that had granisetron at 10 μg/kg dose (p = 0.021). At both doses of granisetron, QTc interval and dispersion were found to be similar. CPK, CK-MB and Troponin-T values were found to be normal before and 24 h after granisetron infusion. As the first study that has studied cardiac side effects of granisetron in patients that are not using cardiotoxic chemotherapeutics, we conclude that granisetron at 40 μg kg(-1) dose(-1) causes bradycardia only. We have also demonstrated that granisetron does not cause any clinically cardiac side effects either at 10 or 40 μg kg(-1) dose(-1). However, our results should be supported by prospective randomized studies with larger samples of patient groups.

The discovery of tropane-derived CCR5 receptor antagonists.

PubMed

Armour, Duncan R; de Groot, Marcel J; Price, David A; Stammen, Blanda L C; Wood, Anthony; Perros, Manos; Burt, Catherine

2006-04-01

The development of compound 1, a piperidine-based CCR5 receptor antagonist with Type I CYP2D6 inhibition, into the tropane-derived analogue 5, is described. This compound, which is devoid of CYP2D6 liabilities, is a highly potent ligand for the CCR5 receptor and has broad-spectrum activity against a range of clinically relevant HIV isolates. The identification of human ether a-go-go-related gene channel inhibition within this series is described and the potential for QTc interval prolongation discussed. Furthermore, structure activity relationship (SAR) around the piperidine moiety is also described.

Prospects of discovering stable double-heavy tetraquarks at a Tera-Z factory

NASA Astrophysics Data System (ADS)

Ali, Ahmed; Parkhomenko, Alexander Ya.; Qin, Qin; Wang, Wei

2018-07-01

Motivated by a number of theoretical considerations, predicting the deeply bound double-heavy tetraquarks T[ u bar d bar ]{ bb }, T[ u bar s bar ]{ bb } and T[ d bar s bar ]{ bb }, we explore the potential of their discovery at Tera-Z factories. Using the process Z → b b bar b b bar , we calculate, employing the Monte Carlo generators MadGraph5_aMC@NLO and Pythia6, the phase space configuration in which the bb pair is likely to fragment as a diquark. In a jet-cone, defined by an invariant mass interval mbb < M T[ q bar qbar‧ ]{ bb } + ΔM, the sought-after tetraquarks T[ q bar qbar‧ ]{ bb } as well as the double-bottom baryons, Ξbb0,-, and Ωbb- , can be produced. Using the heavy quark-diquark symmetry, we estimate B (Z → T[ u bar d bar ]{ bb } + b bar b bar) = (1.2-0.3+1.0) ×10-6, and about a half of this for the T[ u bar s bar ]{ bb } and T[ d bar s bar ]{ bb } . We also present an estimate of their lifetimes using the heavy quark expansion, yielding τ (T[ q bar qbar‧ ]{ bb }) ≃ 800 fs. Measuring the tetraquark masses would require decays, such as T[ u bar d bar ]{ bb } - →B-D-π+, T [ u bar d bar ]{ bb } - → J / ψK‾0B-, T[ u bar d bar ]{ bb } - → J / ψK-B‾0, T[ u bar s bar ]{ bb } - → Ξbc0 Σ-, and T[ d bar s bar ]{ bb } 0 → Ξbc0 Σbar0, with subsequent decay chains in exclusive non-leptonic final states. We estimate a couple of the decay widths and find that the product branching ratios do not exceed 10-5. Hence, a good fraction of these modes will be required for a discovery of T[ q bar qbar‧ ]{ bb } at a Tera-Z factory.

Evidence of Allergic Reactions and Cardiopulmonary Impairments among Traders Operating from Foodstuff Warehouses

PubMed Central

Egbosionu, Viola; Ibeneme, Georgian; Ezuma, Amarachi; Ettu, Theresa; Nwankwo, Joseph; Limaye, Dnyanesh; Nna, Emmanuel

2016-01-01

Background. Foodstuff traders operating from warehouses (FTFW) are potentially exposed to dangerous rodenticides/pesticides that may have adverse effects on cardiopulmonary function. Methods. Fifty consenting male foodstuff traders, comprising 15 traders (21–63 years) operating outside warehouses and 35 FTFW (20–64 years), were randomly recruited at Ogbete Market, Enugu, in a cross-sectional observational study of spirometric and electrocardiographic parameters. Seventeen FTFW (21–57 years) participated in focus group discussions. Qualitative and quantitative data were analysed thematically and with independent t-test and Pearson correlation coefficient at p < 0.05, respectively. Results. Most FTFW experienced respiratory symptoms, especially dry cough (97.1%) and wheezing (31.4%) with significant reductions in forced vital capacity (FVC) (t = −2.654; p = 0.011), forced expiratory volume in one second (FEV1) (t = −2.240; p = 0.030), maximum expiratory flow rate (FEF200–1200) (t = −1.148; p = −0.047), and forced end-expiratory flow (FEF75–85) (t = −1.11; p = 0.007). The maximum mid-expiratory flow (FEF25–75) was marginally decreased (p > 0.05) with a significantly prolonged (p < 0.05) QTc interval. Conclusion. Allergic response was evident in the FTFW. Significant decrease in FVC may negatively impact lung flow rates and explains the marginal decrease in FEF25–75, which implies a relative limitation in airflow of peripheral/distal airways and elastic recoil of the lungs. This is consistent with obstructive pulmonary disease; a significant decrease in FEF75–85/FEV1 supports this conclusion. Significant decrease in FEF200–1200 indicates abnormalities in the large airways/larynx just as significantly prolonged ventricular repolarization suggests cardiac arrhythmias. PMID:28116288

Not all Beta-Blockers are Equal in the Management of Long QT Syndrome Types 1 and 2: Higher Recurrence of Events under Metoprolol

PubMed Central

Chockalingam, Priya; Crotti, Lia; Girardengo, Giulia; Johnson, Jonathan N.; Harris, Katy M.; van der Heijden, Jeroen F.; Hauer, Richard N.W.; Beckmann, Britt M.; Spazzolini, Carla; Rordorf, Roberto; Rydberg, Annika; Clur, Sally-Ann B.; Fischer, Markus; van den Heuvel, Freek; Kääb, Stefan; Blom, Nico A.; Ackerman, Michael J.; Schwartz, Peter J.; Wilde, Arthur A.M.

2012-01-01

Objectives To compare the efficacy of beta-blockers (BB) in congenital long QT syndrome (LQTS). Background BB are the mainstay in managing LQTS. Studies comparing the efficacy of commonly-used BB are lacking and clinicians generally assume they are equally effective. Methods ECG and clinical parameters of 382 LQT1/LQT2 patients initiated on propranolol (n=134), metoprolol (n=147), and nadolol (n=101) were analyzed, excluding patients aged <1 year at BB initiation. Symptoms prior to therapy and the first breakthrough cardiac events (BCEs) were documented. Results Patients (56% females, 27% symptomatic, HR 76±16 bpm, QTc 472±46 ms) were started on BB therapy at a median age of 14 years (IQR 8–32 years). QTc-shortening with propranolol was significantly greater than with other BB in the total cohort and in the subset with QTc >480 ms. None of the asymptomatic patients had BCEs. Among symptomatic patients (n=101), 15 had BCEs (all syncopes). QTc-shortening was significantly less-pronounced among patients with BCEs. There was a greater risk of BCEs for symptomatic patients initiated on metoprolol compared to users of other two BB combined, after adjustment for genotype (OR 3.95, 95% CI 1.2–13.1, p=0.025). Kaplan-Meier analysis showed a significantly lower event-free survival for symptomatic patients on metoprolol compared to propranolol/nadolol. Conclusions Propranolol has a significantly better QTc-shortening effect compared to metoprolol and nadolol, especially in patients with prolonged QTc. Propranolol and nadolol are equally effective whereas symptomatic patients started on metoprolol are at a significantly higher risk for BCEs. Metoprolol should not be used in symptomatic LQT1 and LQT2 patients. PMID:23083782

Electrocardiographic features of patients with earthquake related posttraumatic stress disorder

PubMed Central

İlhan, Erkan; Kaplan, Abdullah; Güvenç, Tolga Sinan; Biteker, Murat; Karabulut, Evindar; Işıklı, Serhan

2013-01-01

AIM: To analyze electrocardiographic features of patients diagnosed with posttraumatic stress disorder (PTSD) after the Van-Erciş earthquake, with a shock measuring 7.2 on the Richter scale that took place in Turkey in October 2011. METHODS: Surface electrocardiograms of 12 patients with PTSD admitted to Van Erciş State Hospital (Van, Turkey) from February 2012 to May 2012 were examined. Psychiatric interviews of the sex and age matched control subjects, who had experienced the earthquake, confirmed the absence of any known diagnosable psychiatric conditions in the control group. RESULTS: A wide range of electrocardiogram (ECG) parameters, such as P-wave dispersion, QT dispersion, QT interval, Tpeak to Tend interval, intrinsicoid deflection durations and other traditional parameters were similar in both groups. There was no one with an abnormal P wave axis, short or long PR interval, long or short QT interval, negative T wave in lateral leads, abnormal T wave axis, abnormal left or right intrinsicoid deflection duration, low voltage, left bundle branch block, right bundle branch block, left posterior hemiblock, left or right axis deviation, left ventricular hypertrophy, right or left atrial enlargement and pathological q(Q) wave in either group. CONCLUSION: The study showed no direct effect of earthquake related PTSD on surface ECG in young patients. So, we propose that PTSD has no direct effect on surface ECG but may cause electrocardiographic changes indirectly by triggering atherosclerosis and/or contributing to the ongoing atherosclerotic process. PMID:23538549

Installation Restoration Program. Phase II. Confirmation/Quantification. Stage 1. Volume 2. Appendices A-M. Cannon AFB, New Mexico.

DTIC Science & Technology

1986-09-01

0’ - N tT qT -0 t" C-r C-, M z a <CLW 4 0 a. o.CL- C= un z LJJIIr-= r -I CiA c= cot ’ rcli LAJI LUU CLCL LLI- IOUa a. IF LLJLm I-l - ( Cft - 4 CL...Depth Graphic Core Sample Sample Cft ) Log Interval/ID Taken* Lithologic Description 0- .. ~.G TOPSOIL; with some wood and other debris. 5-.~J SB-lA-1 ST...Date Recev 7 T ime~ L Transported By La- aml No. 0,; 0 Comments_____________________ ________ ___ Inclusive Dates of Possession

Hyperglycemia and subsequent torsades de pointes with marked QT prolongation during refeeding.

PubMed

Nakashima, Takashi; Kubota, Tomoki; Takasugi, Nobuhiro; Kitagawa, Yuichiro; Yoshida, Takahiro; Ushikoshi, Hiroaki; Kawasaki, Masanori; Nishigaki, Kazuhiko; Ogura, Shinji; Minatoguchi, Shinya

2017-01-01

A fatal cardiac complication can occasionally present in malnourished patients during refeeding; this is known as refeeding syndrome. However, to our knowledge, hyperglycemia preceding torsades de pointes with QT prolongation during refeeding has not been reported. In the present study, we present a case in which hyperglycemia preceded torsades de pointes with QT prolongation during refeeding. The aim of this study was to determine the possible mechanism underlying QT prolongation during refeeding and indicate how to prevent it. A 32-y-old severely malnourished woman (body mass index 14.57 kg/m 2 ) was admitted to the intensive care unit of our institution after resuscitation from cardiopulmonary arrest due to ventricular fibrillation. She was diagnosed with anorexia nervosa. Although no obvious electrolyte abnormalities were observed, her blood glucose level was 11 mg/dL. A 12-lead electrocardiogram at admission showed sinus rhythm with normal QT interval (QTc 0.448). Forty mL of 50% glucose (containing 20 g of glucose) was intravenously injected, followed by a drip infusion of glucose to maintain blood glucose level within normal range. After 9 h, the patient's blood glucose level increased to 569 mg/dL. However, after 38 h, an episode of marked QT prolongation (QTc 0.931) followed by torsades de pointes developed. Hyperglycemia during refeeding can present with QT prolongation; consequently, monitoring blood glucose levels may be useful in avoiding hyperglycemia, which can result in QT prolongation. Furthermore, additional monitoring of QT intervals using a 12-lead electrocardiogram should allow the early detection of QT prolongation when glucose solution is administered to a malnourished patient with (severe) hypoglycemia. Copyright © 2016 Elsevier Inc. All rights reserved.

The Role of Post-Resuscitation Electrocardiogram in Patients With ST-Segment Changes in the Immediate Post-Cardiac Arrest Period.

PubMed

Kim, Youn-Jung; Min, Sun-Yang; Lee, Dong Hun; Lee, Byung Kook; Jeung, Kyung Woon; Lee, Hui Jai; Shin, Jonghwan; Ko, Byuk Sung; Ahn, Shin; Nam, Gi-Byoung; Lim, Kyoung Soo; Kim, Won Young

2017-03-13

The authors aimed to evaluate the role of post-resuscitation electrocardiogram (ECG) in patients showing significant ST-segment changes on the initial ECG and to provide useful diagnostic indicators for physicians to determine in which out-of-hospital cardiac arrest (OHCA) patients brain computed tomography (CT) should be performed before emergency coronary angiography. The usefulness of immediate brain CT and ECG for all resuscitated patients with nontraumatic OHCA remains controversial. Between January 2010 and December 2014, 1,088 consecutive adult nontraumatic patients with return of spontaneous circulation who visited the emergency department of 3 tertiary care hospitals were enrolled. After excluding 245 patients with obvious extracardiac causes, 200 patients were finally included. The patients were categorized into 2 groups: those with ST-segment changes with spontaneous subarachnoid hemorrhage (SAH) (n = 50) and those with OHCA of suspected cardiac origin group (n = 150). The combination of 4 ECG characteristics including narrow QRS (<120 ms), atrial fibrillation, prolonged QTc interval (≥460 ms), and ≥4 ST-segment depressions had a 66.0% sensitivity, 80.0% specificity, 52.4% positive predictive value, and 87.6% negative predictive value for predicting SAH. The area under the receiver-operating characteristic curves in the post-resuscitation ECG findings was 0.816 for SAH. SAH was observed in a substantial number of OHCA survivors (25.0%) with significant ST-segment changes on post-resuscitation ECG. Resuscitated patients with narrow QRS complex and any 2 ECG findings of atrial fibrillation, QTc interval prolongation, or ≥4 ST-segment depressions may help identify patients who need brain CT as the next diagnostic work-up. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Effects of energy drink consumption on corrected QT interval and heart rate variability in young obese Saudi male university students.

PubMed

Alsunni, Ahmed; Majeed, Farrukh; Yar, Talay; AlRahim, Ahmed; Alhawaj, Ali Fouad; Alzaki, Muneer

2015-01-01

Consumption of energy drinks has adverse effects on the heart that might be potentiated in obese individuals. Since the incidence of obesity and use of energy drinks is high among Saudi youth, we used non-invasive tests to study hemodynamic changes produced by altered autonomic cardiac activ.ity following consumption of energy drinks in obese male students. This cross-sectional study was carried out at Department of Physiology, College of Medicine, University of Dammam, Saudi Arabia, over a one-year period from December 2013 to December 2014. In Saudi male university students we measured continuous ECG recordings and a one-minute deep breathing maneuver to measure the expiratory-to-inspiratory ratio, the mean heart rate range (MHRR), the mean percentage variability. (M%VHR) and the corrected QT interval (QTc) at 0, 30 and 60 minutes after consumption of energy drink. We enrolled 31 students (18 overweight/obese and 13 normal weights. QTc was significantly in.creased at 60 min as compared with the resting state in overweight/obese subjects (P=.006). Heart rate variability was significantly less in obese as compared with normal weight subjects at 60 minutes as indicated by E:I ratio, (P=.037), MHRR (P=.012), M%VHR (P=.040) after energy drink consumption. Significant increases in diastolic (P=.020) and mean arterial blood pressure (P=.024) were observed at 30 minutes in the obese group. Hemodynamic changes after intake of energy drinks in obese subjects indicate that obesity and energy drinks could synergistically induce harmful effects. This finding warrants efforts to caution the obese on intake of energy drinks and timely intervention to motivate changes in lifestyle.

Toxicokinetics of ibogaine and noribogaine in a patient with prolonged multiple cardiac arrhythmias after ingestion of internet purchased ibogaine.

PubMed

Henstra, Marieke; Wong, Liza; Chahbouni, Abdel; Swart, Noortje; Allaart, Cor; Sombogaard, Ferdi

2017-07-01

Ibogaine is an agent that has been evaluated as an unapproved anti-addictive agent for the management of drug dependence. Sudden cardiac death has been described to occur secondary to its use. We describe the clinical effects and toxicokinetics of ibogaine and noribogaine in a single patient. For this purpose, we developed a LC-MS/MS-method to measure ibogaine and noribogaine plasma-concentrations. We used two compartments with first order absorption. The maximum concentration of ibogaine was 1.45 mg/L. Our patient developed markedly prolonged QTc interval of 647ms maximum, several multiple cardiac arrhythmias (i.e., atrial tachycardia and ventricular tachycardia and Torsades des Pointes). QTc-prolongation remained present until 12 days after ingestion, several days after ibogaine plasma-levels were low, implicating clinically relevant noribogaine concentrations long after ibogaine had been cleared from the plasma. The ratio k 12 /k 21 for noribogaine was 21.5 and 4.28 for ibogaine, implicating a lower distribution of noribogaine from the peripheral compartment into the central compartment compared to ibogaine. We demonstrated a linear relationship between the concentration of the metabolite and long duration of action, rather than with parent ibogaine. Therefore, after (prolonged) ibogaine ingestion, clinicians should beware of long-term effects due to its metabolite.

Assessment of stenosis severity: Correlation of angiography, T1-201 scintigraphy, and intracoronary pressure gradients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bateman, T.; Raymond, M.; Czer, L.

1984-01-01

To clarify the relationship between angiographic and hemodynamic stenosis severity and the appearance during stress-redistribution myocardial T1-201 scintigraphy (Ex-T1) of a visual (V) or quantitative (Q) perfusion defect (PD) or washout (WO) abnormality, 24 pts with CAD underwent intracoronary pressure gradient study at bypass surgery (CABG). All had pre-CABG Ex-T1 without interval deterioration. The mean diastolic pressure gradient (MDG) measured at reproducible hyperemic flow rates was determined for 34 stenoses (13 LAD, 7 LCX, 14 RCA) and compared with the results of Ex-T1 in subtended myocardial regions (LAD=anterior; LCX=posterolateral; RCA=inferior). Fourteen stenoses (50-99% diameter narrowing) were unassociated with VPD despitemore » maximal exercise: MDG was 9 +- 5mmHg, with MDG/mean aortic diastolic pressure (ADP) ratio of 0.12 +- 0.07. QPD and QWO analysis detected 8 of these. Thirteen stenoses (90-100% severity) led to reversible VPD: MDG was 36 +- 11 mm Hg, MDG/ADP ratio was 0.52 +- 0.17, and Q analysis was abnormal in 12/13. Seven stenoses (90-100% severity) subtended infarcted myocardium: MDG was 42 +- 21 mm Hg, MDG/ADP ratio was 0.52 +- 0.18, and V and Q analyses were abnormal in all. From this study, the authors derive the following conclusion: 1) Ex-T1 correlates better with hemodynamic severity of stenoses than does angiography; 2) V abnormalities identify stenoses of major angiographic and hemodynamic severity, while Q analysis detects some (57% in this study) stenoses of lesser severity; and 3) stenoses causing reversible Ex-T1 abnormalities present similar hemodynamic impediments to those causing myocardial infarcts.« less

Rank score and permutation testing alternatives for regression quantile estimates

USGS Publications Warehouse

Cade, B.S.; Richards, J.D.; Mielke, P.W.

2006-01-01

Performance of quantile rank score tests used for hypothesis testing and constructing confidence intervals for linear quantile regression estimates (0 ≤ τ ≤ 1) were evaluated by simulation for models with p = 2 and 6 predictors, moderate collinearity among predictors, homogeneous and hetero-geneous errors, small to moderate samples (n = 20–300), and central to upper quantiles (0.50–0.99). Test statistics evaluated were the conventional quantile rank score T statistic distributed as χ2 random variable with q degrees of freedom (where q parameters are constrained by H 0:) and an F statistic with its sampling distribution approximated by permutation. The permutation F-test maintained better Type I errors than the T-test for homogeneous error models with smaller n and more extreme quantiles τ. An F distributional approximation of the F statistic provided some improvements in Type I errors over the T-test for models with > 2 parameters, smaller n, and more extreme quantiles but not as much improvement as the permutation approximation. Both rank score tests required weighting to maintain correct Type I errors when heterogeneity under the alternative model increased to 5 standard deviations across the domain of X. A double permutation procedure was developed to provide valid Type I errors for the permutation F-test when null models were forced through the origin. Power was similar for conditions where both T- and F-tests maintained correct Type I errors but the F-test provided some power at smaller n and extreme quantiles when the T-test had no power because of excessively conservative Type I errors. When the double permutation scheme was required for the permutation F-test to maintain valid Type I errors, power was less than for the T-test with decreasing sample size and increasing quantiles. Confidence intervals on parameters and tolerance intervals for future predictions were constructed based on test inversion for an example application relating trout densities to stream channel width:depth.

The Significance of Sensitive Interferon Gamma Release Assays for Diagnosis of Latent Tuberculosis Infection in Patients Receiving Tumor Necrosis Factor-α Antagonist Therapy.

PubMed

Jung, Yu Jung; Woo, Hye In; Jeon, Kyeongman; Koh, Won-Jung; Jang, Dong Kyoung; Cha, Hoon Suk; Koh, Eun Mi; Lee, Nam Yong; Kang, Eun-Suk

2015-01-01

We compared two interferon gamma release assays (IGRAs), QuantiFERON-TB Gold In-Tube (QFT-GIT) and T-SPOT.TB, for diagnosis of latent tuberculosis infection (LTBI) in patients before and while receiving tumor necrosis factor (TNF)-α antagonist therapy. This study evaluated the significance of sensitive IGRAs for LTBI screening and monitoring. Before starting TNF-α antagonist therapy, 156 consecutive patients with rheumatic diseases were screened for LTBI using QFT-GIT and T-SPOT.TB tests. According to our study protocol, QFT-GIT-positive patients received LTBI treatment. Patients positive by any IGRAs were subjected to follow-up IGRA tests after completing LTBI-treatment and/or during TNF-α antagonist therapy. At the initial LTBI screening, 45 (28.9%) and 70 (44.9%) patients were positive by QFT-GIT and T-SPOT.TB, respectively. The agreement rate between IGRA results was 78.8% (k = 0.56; 95% confidence interval [95% CI] = 0.43 to 0.68). Of 29 patients who were positive only by T-SPOT.TB in the initial screening, 83% (19/23) were persistently positive by T-SPOT.TB, while QFT-GIT testing showed that 36% (9/25) had conversion during TNF-α antagonist therapy. By the end of the follow-up period (218 to 1,264 days), four patients (4/137, 2.9%) developed active tuberculosis (TB) diseases during receiving TNF-α antagonist therapy. Among them, one was Q-T+, one was Q+T-, and the remaining two were Q-T- at the initial screening (Q, QuantiFERON-TB Gold In-Tube; T, T-SPOT.TB; +, positive; -, negative). Two (2/4, 50%) patients with TB reactivation had at least one prior risk factor consistent with previous TB infection. This study demonstrated the need to capitalize on sensitive IGRAs to monitor for LTBI in at-risk patients for a more sensitive diagnosis in countries with an intermediate TB burden.

Electrocardiographic Biomarkers for Detection of Drug-Induced Late Sodium Current Block

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vicente, Jose; Johannesen, Lars; Hosseini, Meisam

Drugs that prolong the heart rate corrected QT interval (QTc) on the electrocardiogram (ECG) by blocking the hERG potassium channel and also block inward currents (late sodium or L-type calcium) are not associated with torsade de pointes (e.g. ranolazine and verapamil). Furthermore, identifying ECG signs of late sodium current block could aid in the determination of proarrhythmic risk for new drugs. A new cardiac safety paradigm for drug development (the "CiPA" initiative) will involve the preclinical assessment of multiple human cardiac ion channels and ECG biomarkers are needed to determine if there are unexpected ion channel effects in humans.

Electrocardiographic Biomarkers for Detection of Drug-Induced Late Sodium Current Block

DOE PAGES

Vicente, Jose; Johannesen, Lars; Hosseini, Meisam; ...

2016-12-30

Drugs that prolong the heart rate corrected QT interval (QTc) on the electrocardiogram (ECG) by blocking the hERG potassium channel and also block inward currents (late sodium or L-type calcium) are not associated with torsade de pointes (e.g. ranolazine and verapamil). Furthermore, identifying ECG signs of late sodium current block could aid in the determination of proarrhythmic risk for new drugs. A new cardiac safety paradigm for drug development (the "CiPA" initiative) will involve the preclinical assessment of multiple human cardiac ion channels and ECG biomarkers are needed to determine if there are unexpected ion channel effects in humans.

In vivo effects of the IKr agonist NS3623 on cardiac electrophysiology of the guinea pig.

PubMed

Hansen, Rie Schultz; Olesen, Søren-Peter; Rønn, Lars Christian B; Grunnet, Morten

2008-07-01

The long QT syndrome is characterized by a prolongation of the QT interval measured on the surface electrocardiogram. Prolonging the QT interval increases the risk of dangerous ventricular fibrillations, eventually leading to sudden cardiac death. Pharmacologically induced QT interval prolongations are most often caused by antagonizing effects on the repolarizing cardiac current called IKr. In humans IKr is mediated by the human ether-a-go-go related gene (hERG) potassium channel. We recently presented NS3623, a compound that selectively activates this channel. The present study was dedicated to examining the in vivo effects of NS3623. Injection of 30 mg/kg NS3623 shortened the corrected QT interval by 25 +/- 4% in anaesthetized guinea pigs. Accordingly, 50 mg/kg of NS3623 shortened the QT interval by 30 +/- 6% in conscious guinea pigs. Finally, pharmacologically induced QT prolongation by a hERG channel antagonist (0.15 mg/kg E-4031) could be reverted by injection of NS3623 (50 mg/kg) in conscious guinea pigs. In conclusion, the present in vivo study demonstrates that injection of the hERG channel agonist NS3623 results in shortening of the QTc interval as well as reversal of a pharmacologically induced QT prolongation in both anaesthetized and conscious guinea pigs.

Functional Characterization of CaVα2δ Mutations Associated with Sudden Cardiac Death*

PubMed Central

Bourdin, Benoîte; Shakeri, Behzad; Tétreault, Marie-Philippe; Sauvé, Rémy; Lesage, Sylvie; Parent, Lucie

2015-01-01

L-type Ca2+ channels play a critical role in cardiac rhythmicity. These ion channels are oligomeric complexes formed by the pore-forming CaVα1 with the auxiliary CaVβ and CaVα2δ subunits. CaVα2δ increases the peak current density and improves the voltage-dependent activation gating of CaV1.2 channels without increasing the surface expression of the CaVα1 subunit. The functional impact of genetic variants of CACNA2D1 (the gene encoding for CaVα2δ), associated with shorter repolarization QT intervals (the time interval between the Q and the T waves on the cardiac electrocardiogram), was investigated after recombinant expression of the full complement of L-type CaV1.2 subunits in human embryonic kidney 293 cells. By performing side-by-side high resolution flow cytometry assays and whole-cell patch clamp recordings, we revealed that the surface density of the CaVα2δ wild-type protein correlates with the peak current density. Furthermore, the cell surface density of CaVα2δ mutants S755T, Q917H, and S956T was not significantly different from the cell surface density of the CaVα2δ wild-type protein expressed under the same conditions. In contrast, the cell surface expression of CaVα2δ D550Y, CaVα2δ S709N, and the double mutant D550Y/Q917H was reduced, respectively, by ≈30–33% for the single mutants and by 60% for the latter. The cell surface density of D550Y/Q917H was more significantly impaired than protein stability, suggesting that surface trafficking of CaVα2δ was disrupted by the double mutation. Co-expression with D550Y/Q917H significantly decreased CaV1.2 currents as compared with results obtained with CaVα2δ wild type. It is concluded that D550Y/Q917H reduced inward Ca2+ currents through a defect in the cell surface trafficking of CaVα2δ. Altogether, our results provide novel insight in the molecular mechanism underlying the modulation of CaV1.2 currents by CaVα2δ. PMID:25527503

The Effect of a Combination Treatment Using Palonosetron, Promethazine, and Dexamethasone on the Prophylaxis of Postoperative Nausea and Vomiting and QTc Interval Duration in Patients Undergoing Craniotomy under General Anesthesia: A Pilot Study.

PubMed

Bergese, Sergio D; Puente, Erika G; Antor, Maria A; Capo, Gerardo; Yildiz, Vedat O; Uribe, Alberto A

2016-01-01

Postoperative nausea and vomiting (PONV) is a displeasing experience that distresses surgical patients during the first 24 h after a surgical procedure. The incidence of postoperative nausea occurs in about 50%, the incidence of postoperative vomiting is about 30%, and in high-risk patients, the PONV rate could be as high as 80%. Therefore, the study design of this single arm, non-randomized, pilot study assessed the efficacy and safety profile of a triple therapy combination with palonosetron, dexamethasone, and promethazine to prevent PONV in patients undergoing craniotomies under general anesthesia. The research protocol was approved by the institutional review board and 40 subjects were provided written informed consent. At induction of anesthesia, a triple therapy of palonosetron 0.075 mg IV, dexamethasone 10 mg IV, and promethazine 25 mg IV was given as PONV prophylaxis. After surgery, subjects were transferred to the surgical intensive care unit or post anesthesia care unit as clinically indicated. Ondansetron 4 mg IV was administered as primary rescue medication to subjects with PONV symptoms. PONV was assessed and collected every 24 h for 5 days via direct interview and/or medical charts review. The overall incidence of PONV during the first 24 h after surgery was 30% (n = 12). The incidence of nausea and emesis 24 h after surgery was 30% (n = 12) and 7.5% (n = 3), respectively. The mean time to first emetic episode, first rescue, and first significant nausea was 31.3 (±33.6), 15.1 (±25.8), and 21.1 (±25.4) hours, respectively. The overall incidence of nausea and vomiting after 24-120 h period after surgery was 30% (n = 12). The percentage of subjects without emesis episodes over 24-120 h postoperatively was 70% (n = 28). No subjects presented a prolonged QTc interval ≥500 ms before and/or after surgery. Our data demonstrated that this triple therapy regimen may be an adequate alternative regimen for the treatment of PONV in patients undergoing neurological surgery under general anesthesia. More studies with a control group should be performed to demonstrate the efficacy of this regimen and that palonosetron is a low risk for QTc prolongation. NCT02635828 (https://clinicaltrials.gov/show/NCT02635828).

The persistence of bifidobacteria populations in a river measured by molecular and culture techniques.

PubMed

Bonjoch, X; Lucena, F; Blanch, A R

2009-10-01

To determine relative to faecal coliforms (FC) and sulfite-reducing clostridia (SRC), the environmental persistence of natural populations of Bifidobacterium spp. enumerated by culturing and quantitative polymerase chain reaction (q-PCR). Dialysis tubing containing river supplemented with overnight cultures of Bifidobacterium adolescentis (BA) and Bifidobacterium dentium (BD) or urban wastewater were suspended in a river for up to 10 days. At intervals, the contents of each dialysis tube were assayed using q-PCR assays for BA and BD, and selective culture media for FC, SRC, total bifidobacteria (TB), sorbitol-fermenting bifidobacteria (SFB) and cultivable BA. Mean summer T(90) values were 251 h for SRC, 92 h for FC, 48 h for BA and BD by q-PCR, and 9 h for TB. Bifidobacterium spp. was the population with the lowest persistence, showing seasonal differences in T(90) when measured by culture techniques or by q-PCR. This difference in relative persistence is because of a longer persistence of molecular targets than cultivable cells. The persistence of a viable bifidobacteria cells is shorter, but the longest persistence of molecular targets. This factor could be used for origin the faecal pollution in water for the development of microbial source tracking (MST).

The genetics underlying acquired long QT syndrome: impact for genetic screening

PubMed Central

Itoh, Hideki; Crotti, Lia; Aiba, Takeshi; Spazzolini, Carla; Denjoy, Isabelle; Fressart, Véronique; Hayashi, Kenshi; Nakajima, Tadashi; Ohno, Seiko; Makiyama, Takeru; Wu, Jie; Hasegawa, Kanae; Mastantuono, Elisa; Dagradi, Federica; Pedrazzini, Matteo; Yamagishi, Masakazu; Berthet, Myriam; Murakami, Yoshitaka; Shimizu, Wataru; Guicheney, Pascale; Schwartz, Peter J.; Horie, Minoru

2016-01-01

Aims Acquired long QT syndrome (aLQTS) exhibits QT prolongation and Torsades de Pointes ventricular tachycardia triggered by drugs, hypokalaemia, or bradycardia. Sometimes, QTc remains prolonged despite elimination of triggers, suggesting the presence of an underlying genetic substrate. In aLQTS subjects, we assessed the prevalence of mutations in major LQTS genes and their probability of being carriers of a disease-causing genetic variant based on clinical factors. Methods and results We screened for the five major LQTS genes among 188 aLQTS probands (55 ± 20 years, 140 females) from Japan, France, and Italy. Based on control QTc (without triggers), subjects were designated ‘true aLQTS’ (QTc within normal limits) or ‘unmasked cLQTS’ (all others) and compared for QTc and genetics with 2379 members of 1010 genotyped congenital long QT syndrome (cLQTS) families. Cardiac symptoms were present in 86% of aLQTS subjects. Control QTc of aLQTS was 453 ± 39 ms, shorter than in cLQTS (478 ± 46 ms, P < 0.001) and longer than in non-carriers (406 ± 26 ms, P < 0.001). In 53 (28%) aLQTS subjects, 47 disease-causing mutations were identified. Compared with cLQTS, in ‘true aLQTS’, KCNQ1 mutations were much less frequent than KCNH2 (20% [95% CI 7–41%] vs. 64% [95% CI 43–82%], P < 0.01). A clinical score based on control QTc, age, and symptoms allowed identification of patients more likely to carry LQTS mutations. Conclusion A third of aLQTS patients carry cLQTS mutations, those on KCNH2 being more common. The probability of being a carrier of cLQTS disease-causing mutations can be predicted by simple clinical parameters, thus allowing possibly cost-effective genetic testing leading to cascade screening for identification of additional at-risk family members. PMID:26715165

The genetics underlying acquired long QT syndrome: impact for genetic screening.

PubMed

Itoh, Hideki; Crotti, Lia; Aiba, Takeshi; Spazzolini, Carla; Denjoy, Isabelle; Fressart, Véronique; Hayashi, Kenshi; Nakajima, Tadashi; Ohno, Seiko; Makiyama, Takeru; Wu, Jie; Hasegawa, Kanae; Mastantuono, Elisa; Dagradi, Federica; Pedrazzini, Matteo; Yamagishi, Masakazu; Berthet, Myriam; Murakami, Yoshitaka; Shimizu, Wataru; Guicheney, Pascale; Schwartz, Peter J; Horie, Minoru

2016-05-07

Acquired long QT syndrome (aLQTS) exhibits QT prolongation and Torsades de Pointes ventricular tachycardia triggered by drugs, hypokalaemia, or bradycardia. Sometimes, QTc remains prolonged despite elimination of triggers, suggesting the presence of an underlying genetic substrate. In aLQTS subjects, we assessed the prevalence of mutations in major LQTS genes and their probability of being carriers of a disease-causing genetic variant based on clinical factors. We screened for the five major LQTS genes among 188 aLQTS probands (55 ± 20 years, 140 females) from Japan, France, and Italy. Based on control QTc (without triggers), subjects were designated 'true aLQTS' (QTc within normal limits) or 'unmasked cLQTS' (all others) and compared for QTc and genetics with 2379 members of 1010 genotyped congenital long QT syndrome (cLQTS) families. Cardiac symptoms were present in 86% of aLQTS subjects. Control QTc of aLQTS was 453 ± 39 ms, shorter than in cLQTS (478 ± 46 ms, P < 0.001) and longer than in non-carriers (406 ± 26 ms, P < 0.001). In 53 (28%) aLQTS subjects, 47 disease-causing mutations were identified. Compared with cLQTS, in 'true aLQTS', KCNQ1 mutations were much less frequent than KCNH2 (20% [95% CI 7-41%] vs. 64% [95% CI 43-82%], P < 0.01). A clinical score based on control QTc, age, and symptoms allowed identification of patients more likely to carry LQTS mutations. A third of aLQTS patients carry cLQTS mutations, those on KCNH2 being more common. The probability of being a carrier of cLQTS disease-causing mutations can be predicted by simple clinical parameters, thus allowing possibly cost-effective genetic testing leading to cascade screening for identification of additional at-risk family members. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2015. For permissions please email: journals.permissions@oup.com.

Jervell and Lange-Nielsen syndrome in a father and daughter from a large highly inbred family: a 16-year follow-up of 59 living members.

PubMed

Sanyal, Shyamal Kumar; Kaul, Kanwar K; Hussein, Akhtar; Wilroy, Robert S; Agarwal, Kisan; Sohel, Saira

2013-08-01

To report the autosomal dominant inheritance of the Jervell and Lange-Nielsen syndrome in a highly inbred family, the initiation of Torsades de Pointes, and the natural history of the syndrome based on a 16-year follow-up of the kindred. A family tree was constructed that included 66 blood relatives from three successive generations. Electrocardiograms were obtained from 59 living members including the proband, four members from a nuclear family, and 54 from the extended family. Evoked response audiometry was recorded for the proband and the nuclear family. All 59 family members were followed up regularly for 16 years. A total of 24 living members were affected--QTc: 480-680 ms. The proband had long QTc, bilateral high-tone sensorineural deafness, recurrent syncope, and Torsades de Pointes. The asymptomatic father had long QTc and unilateral high-tone sensorineural deafness that involved specifically the left ear. One asymptomatic sibling of the proband had long QTc and normal hearing. The mother and another sibling were asymptomatic; QTc and hearing were normal in both. A total of 21 affected members from the extended family had only long QTc, and all were asymptomatic. There were three congenitally deaf first cousins who had recurrent syncope and adrenergic-triggered sudden death. In all, seven of 10 parents had consanguineous marriage to a first cousin. Each affected offspring had at least one affected parent. The severely symptomatic proband who received only β-blocker therapy and the 23 affected members without antiadrenergic therapy, all remained asymptomatic throughout the 16-year follow-up period. Jervell and Lange-Nielsen syndrome was inherited as autosomal dominant in this kindred. The majority of the affected members had a mild phenotype. The severity of auditory and cardiac phenotypes corresponded.

Is an Abnormal ECG Just the Tip of the ICE-berg? Examining the Utility of Electrocardiography in Detecting Methamphetamine-Induced Cardiac Pathology.

PubMed

Paratz, Elizabeth D; Zhao, Jessie; Sherwen, Amanda K; Scarlato, Rose-Marie; MacIsaac, Andrew I

2017-07-01

Methamphetamine use is escalating in Australia and New Zealand, with increasing emergency department attendance and mortality. Cardiac complications play a large role in methamphetamine-related mortality, and it would be informative to assess the frequency of abnormal electrocardiograms (ECGs) amongst methamphetamine users. To determine the frequency and severity of ECG abnormalities amongst methamphetamine users compared to a control group. We conducted a retrospective cohort analysis on 212 patients admitted to a tertiary hospital (106 patients with methamphetamine use, 106 age and gender-matched control patients). Electrocardiograms were analysed according to American College of Cardiology guidelines. Mean age was 33.4 years, with 73.6% male gender, with no significant differences between groups in smoking status, ECG indication, or coronary angiography rates. Methamphetamine users were more likely to have psychiatric admissions (22.6% vs 1.9%, p<0.0001). Overall, ECG abnormalities were significantly more common (71.7% vs 32.1%, p<0.0001) in methamphetamine users, particularly tachyarrhythmias (38.7% vs 26.4%, p<0.0001), right axis deviation (7.5% vs 0.0%, p=0.004), left ventricular hypertrophy (26.4% vs 4.7%, p<0.0001), P pulmonale pattern (7.5% vs 0.9%, p=0.017), inferior Q waves (10.4% vs 0.0%, p=0.001), lateral T wave inversion (3.8% vs 0.0%, p=0.043), and longer QTc interval (436.41±31.61ms vs 407.28±24.38ms, p<0.0001). Transthoracic echocardiogram (n=24) demonstrated left ventricular dysfunction (38%), thrombus (8%), valvular lesions (17%), infective endocarditis (17%), and pulmonary hypertension (13%). Electrocardiograms were only moderately sensitive at predicting abnormal TTE. Electrocardiographic abnormalities are more common in methamphetamine users than age and gender-matched controls. Due to the high frequency of abnormalities, ECGs should be performed in all methamphetamine users who present to hospital. Methamphetamine users with abnormal ECGs should undergo further cardiac investigations. Copyright © 2016 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). All rights reserved.

Pre-transplant soluble CD30 in combination with total DSA but not pre-transplant C1q-DSA predicts antibody-mediated graft loss in presensitized high-risk kidney transplant recipients.

PubMed

Schaefer, S M; Süsal, C; Opelz, G; Döhler, B; Becker, L E; Klein, K; Sickmüller, S; Waldherr, R; Macher-Goeppinger, S; Schemmer, P; Beimler, J; Zeier, M; Morath, C

2016-02-01

Presensitized kidney transplant recipients are at high-risk for early antibody-mediated rejection. We studied the impact of pre- and post-transplant donor-specific human leukocyte antigen (HLA) antibodies (DSA) and T-cell-activation on the occurrence of antibody-mediated rejection episodes (AMR) and graft loss (AMR-GL) in a unique cohort of 80 desensitized high-risk kidney transplant recipients. Patients with pre-transplant DSA demonstrated more AMR episodes than patients without DSA, but did not show a significantly increased rate of AMR-GL. The rates of AMR and AMR-GL were not significantly increased in patients with complement split product (C1q)-binding pre-transplant DSA. Pre-transplant C1q-DSA became undetectable post-transplant in 11 of 13 (85%) patients; 2 (18%) of these 11 patients showed AMR but no AMR-GL. In contrast, the post-transplant presence of C1q-DSA was associated with significantly higher rates of AMR (86 vs 33 vs 0%; P < 0.001) and AMR-GL (86 vs 0 vs 0%; log-rank P < 0.001) compared with post-transplant DSA without C1q-binding or the absence of DSA. Patients with both pre-transplant DSA and evidence of pre-transplant T-cell-activation as indicated by soluble CD30-positivity showed a significantly increased risk for AMR-GL [HR = 11.1, 95% confidence interval (CI) = 1.68-73.4; log-rank P = 0.013]. In these high-risk patients, AMR-GL was associated with total DSA in combination with T-cell-activation pre-transplant, and de novo or persistent C1q-binding DSA post-transplant. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Major Upgrades to the AIRS Version-6 Water Vapor Profile Methodology

NASA Technical Reports Server (NTRS)

Susskind, Joel; Blaisdell, John; Iredell, Lena; Lee, Jae N.

2015-01-01

Additional changes in Version-6.19 include all previous updates made to the q(p) retrieval since Version-6: Modified Neural-Net q0(p) guess above the tropopause Linearly tapers the neural net guess to match climatology at 70 mb, not at the top of the atmosphereChanged the 11 trapezoid q(p) perturbation functions used in Version-6 so as to match the 24 functions used in T(p) retrieval step. These modifications resulted in improved water vapor profiles in Version-6.19 compared to Version-6.Version-6.19 is tested for all of August 2013 and August 2014, as well for select other days. Before finalized and operational in 2016, the V-6.19 can be acquired upon request for limited time intervals.

On the nature of the liquid-to-glass transition equation

NASA Astrophysics Data System (ADS)

Sanditov, D. S.

2016-09-01

Within the model of delocalized atoms, it is shown that the parameter δ T g , which enters the glasstransition equation qτ g = δ T g and characterizes the temperature interval in which the structure of a liquid is frozen, is determined by the fluctuation volume fraction {f_g} = {( {{{Δ {V_e}} / V _{T = {T_g}}} frozen at the glass-transition temperature T g and the temperature T g itself. The parameter δ T g is estimated by data on f g and T g . The results obtained are in agreement with the values of δ T g calculated by the Williams-Landel-Ferry (WLF) equation, as well as with the product qτ g —the left-hand side of the glass-transition equation ( q is the cooling rate of the melt, and τ g is the structural relaxation time at the glass-transition temperature). Glasses of the same class with f g ≈ const exhibit a linear correlation between δ T g and T g . It is established that the currently used methods of Bartenev and Nemilov for calculating δ T g yield overestimated values, which is associated with the assumption, made during deriving the calculation formulas, that the activation energy of the glass-transition process is constant. A generalized Bartenev equation is derived for the dependence of the glass-transition temperature on the cooling rate of the melt with regard to the temperature dependence of the activation energy of the glasstransition process. A modified version of the kinetic glass-transition criterion is proposed. A conception is developed that the fluctuation volume fraction f = Δ V e / V can be interpreted as an internal structural parameter analogous to the parameter ξ in the Mandelstam-Leontovich theory, and a conjecture is put forward that the delocalization of an active atom—its critical displacement from the equilibrium position—can be considered as one of possible variants of excitation of a particle in the Vol'kenshtein-Ptitsyn theory. The experimental data used in the study refer to a constant cooling rate of q = 0.05 K/s (3 K/min).

Dextromethorphan/quinidine: in pseudobulbar affect.

PubMed

Garnock-Jones, Karly P

2011-05-01

Pseudobulbar affect is characterized by uncontrollable, inappropriate laughing and/or crying that is either unrelated or out of proportion to the emotions felt by the patient and occurs in patients with neurological disorders, such as amyotrophic lateral sclerosis (ALS), multiple sclerosis or traumatic brain injury. Dextromethorphan/quinidine is indicated in the US for the treatment of pseudobulbar affect. Dextromethorphan, when its metabolism is inhibited by the coadministration of quinidine, has been shown to have a positive effect on the symptoms of pseudobulbar affect. Dextromethorphan/quinidine 20 mg/10 mg twice daily was associated with a significantly greater decrease in the rate of pseudobulbar affect episodes per day (primary endpoint) than placebo in the 12-week, randomized, double-blind, placebo-controlled, multicentre STAR trial (Safety, Tolerability, And efficacy Results trial of AVP-923 in PBA [pseudobulbar affect]) involving patients with pseudobulbar affect and ALS or multiple sclerosis. Moreover, the mean change from baseline in Center for Neurologic Study-Lability Scale score at 12 weeks was significantly greater among recipients of dextromethorphan/quinidine 20 mg/10 mg twice daily than those receiving placebo. Dextromethorphan/quinidine 20 mg/10 mg twice daily was generally well tolerated. The drug has been shown to cause dosage-dependent corrected QT interval (QTc) prolongation; however, in the STAR trial, dextromethorphan/quinidine 20 mg/10 mg twice daily appeared to be well tolerated with regard to QTc prolongation.

Usefulness of simultaneous and sequential monitoring of glucose level and electrocardiogram in monkeys treated with gatifloxacin under conscious and nonrestricted conditions.

PubMed

Yoshimatsu, Yu; Ishizaka, Tomomichi; Chiba, Katsuyoshi; Mori, Kazuhiko

2018-05-10

Drug-induced cardiac electrophysiological abnormalities accompanied by hypoglycemia or hyperglycemia increase the risk for life-threatening arrhythmia. To assess the drug-induced cardiotoxic potential associated with extraordinary blood glucose (GLU) levels, the effect of gatifloxacin (GFLX) which was frequently associated with GLU abnormality and QT/QTc prolongations in the clinic on blood GLU and electrocardiogram (ECG) parameters was investigated in cynomolgus monkeys (n=4) given GFLX orally in an ascending dose regimen (10, 30, 60 and 100 mg/kg). Simultaneous and sequential GLU and ECG monitoring with a continuous GLU monitoring system and Holter ECG, respectively, were conducted for 24 h under free-moving conditions. Consequently, GFLX at 30 and 60 mg/kg dose-dependently induced a transient decrease in GLU without any ECG abnormality 2-4 h postdose. Highest dose of 100 mg/kg caused severe hypoglycemia with a mean GLU of <30 mg/dL, accompanied by remarkable QT/QTc prolongations by 20-30% in all animals. In contrast, hyperglycemia without QT/QTc prolongations was noted 24 h after dosing in one animal. A close correlation between GLU and QTc values was observed in animals treated with 100 mg/kg, suggesting that GFLX-induced hypoglycemia enhanced QT/QTc prolongations. Furthermore, the 24-h sequential GLU monitoring data clearly distinguished between GFLX-induced GLU abnormality and physiological GLU changes influenced by feeding throughout the day. In conclusion, the combined assessment of continuous GLU and ECG monitoring is valuable in predicting the drug-induced cardio-electrophysiological risk associated with both GLU and ECG abnormalities.

Aging modulates dispersion of ventricular repolarization in the very old of the geriatric population.

PubMed

Huang, Jen-Hung; Lin, Ying-Qin; Pan, Nan-Hung; Chen, Yi-Jen

2010-11-01

Aging plays an essential role in cardiac pathophysiology. Knowledge on the ventricular repolarization in very old individuals is limited. An increase of QT dispersion is associated with higher cardiovascular mortality. The purpose of this study is to investigate whether aging changes the QT dispersion in the very old. Heart rate, P wave duration, PR interval, QRS axis, QRS duration, QT interval, and QTc interval were measured from 12-lead resting ECG. QT dispersion (46 ± 21, 47 ± 17, 69 ± 31 ms, p < 0.005) was significantly increased in the age group ≧85 years (n = 29, 89 ± 4 years) than in the age group 75-84 years (n = 33, 79 ± 3 years) and the age group 65-74 years (n = 32, 68 ± 3 years). Aging modulates dispersion of ventricular repolarization, which may contribute to the cardiac mortality in the very old Asian population.

Testosterone-mediated upregulation of delayed rectifier potassium channel in cardiomyocytes causes abbreviation of QT intervals in rats.

PubMed

Masuda, Kimiko; Takanari, Hiroki; Morishima, Masaki; Ma, FangFang; Wang, Yan; Takahashi, Naohiko; Ono, Katsushige

2018-01-13

Men have shorter rate-corrected QT intervals (QTc) than women, especially at the period of adolescence or later. The aim of this study was to elucidate the long-term effects of testosterone on cardiac excitability parameters including electrocardiogram (ECG) and potassium channel current. Testosterone shortened QT intervals in ECG in castrated male rats, not immediately after, but on day 2 or later. Expression of Kv7.1 (KCNQ1) mRNA was significantly upregulated by testosterone in cardiomyocytes of male and female rats. Short-term application of testosterone was without effect on delayed rectifier potassium channel current (I Ks ), whereas I Ks was significantly increased in cardiomyocytes treated with dihydrotestosterone for 24 h, which was mimicked by isoproterenol (24 h). Gene-selective inhibitors of a transcription factor SP1, mithramycin, abolished the effects of testosterone on Kv7.1. Testosterone increases Kv7.1-I Ks possibly through a pathway related to a transcription factor SP1, suggesting a genomic effect of testosterone as an active factor for cardiac excitability.

Development and validation of a duplex real-time PCR assay for the diagnosis of equine piroplasmosis.

PubMed

Lobanov, Vladislav A; Peckle, Maristela; Massard, Carlos L; Brad Scandrett, W; Gajadhar, Alvin A

2018-03-02

Equine piroplasmosis (EP) is an economically significant infection of horses and other equine species caused by the tick-borne protozoa Theileria equi and Babesia caballi. The long-term carrier state in infected animals makes importation of such subclinical cases a major risk factor for the introduction of EP into non-enzootic areas. Regulatory testing for EP relies on screening of equines by serological methods. The definitive diagnosis of EP infection in individual animals will benefit from the availability of sensitive direct detection methods, for example, when used as confirmatory assays for non-negative serological test results. The objectives of this study were to develop a real-time quantitative polymerase chain reaction (qPCR) assay for simultaneous detection of both agents of EP, perform comprehensive evaluation of its performance and assess the assay's utility for regulatory testing. We developed a duplex qPCR targeting the ema-1 gene of T. equi and the 18S rRNA gene of B. caballi and demonstrated that the assay has high analytical sensitivities for both piroplasm species. Validation of the duplex qPCR on samples from 362 competitive enzyme-linked immunosorbent assay (cELISA)-negative horses from Canada and the United States yielded no false-positive reactions. The assay's performance was further evaluated using samples collected from 430 horses of unknown EP status from a highly endemic area in Brazil. This set of samples was also tested by a single-target 18S rRNA qPCR for T. equi developed at the OIE reference laboratory for EP in Japan, and a previously published single-target 18S rRNA qPCR for B. caballi whose oligonucleotides we adopted for use in the duplex qPCR. Matching serum samples were tested for antibodies to these parasites using cELISA. By the duplex qPCR, T. equi-specific 18S rRNA qPCR and cELISA, infections with T. equi were detected in 87.9% (95% confidence interval, CI: 84.5-90.7%), 90.5% (95% CI: 87.3-92.3%) and 87.4% (95% CI: 84.0-90.2%) of the horses, respectively. The B. caballi prevalence estimates were 9.3% (95% CI: 6.9-12.4%) by the duplex qPCR and 7.9% (95% CI: 5.7-10.9%) by the respective single-target qPCR assay. These values were markedly lower compared to the seroprevalence of 58.6% (95% CI: 53.9-63.2%) obtained by B. caballi-specific cELISA. The relative diagnostic sensitivity of the duplex qPCR for T. equi was 95.5%, as 359 of the 376 horses with exposure to T. equi confirmed by cELISA had parasitemia levels above the detection limit of the molecular assay. In contrast, only 39 (15.5%) of the 252 horses with detectable B. caballi-specific antibodies were positive for this piroplasm species by the duplex qPCR. The duplex qPCR described here performed comparably to the existing single-target qPCR assays for T. equi and B. caballi and will be more cost-effective in terms of results turnaround time and reagent costs when both pathogens are being targeted for disease control and epidemiological investigations. These validation data also support the reliability of the ema-1 gene-specific oligonucleotides developed in this study for confirmatory testing of non-negative serological test results for T. equi by qPCR. However, the B. caballi-specific qPCR cannot be similarly recommended as a confirmatory assay for routine regulatory testing due to the low level of agreement with serological test results demonstrated in this study. Further studies are needed to determine the transmission risk posed by PCR-negative equines with detectable antibodies to B. caballi.

Atrial Premature Depolarization-Induced Changes in QRS and T Wave Morphology on Resting Electrocardiograms in Horses.

PubMed

Broux, B; De Clercq, D; Decloedt, A; Van Der Vekens, N; Verheyen, T; Ven, S; Pardon, B; van Loon, G

2016-07-01

The electrocardiographic differentiation between atrial (APDs) and ventricular (VPDs) premature depolarizations is important. P wave prematurity and normal QRS and T wave morphology generally are used as discriminating criteria for APDs. The aim of this study was to determine whether P, Q, R, S, and T wave amplitude, PQ interval, QRS and P wave duration and P and T wave morphology differ between APDs and sinus beats. To determine the relationship between the RR coupling interval and the change in S wave amplitude between sinus beats and APDs. Case-control study. From a modified base-apex configuration of 30 horses with APDs at rest, sinus beat and APD associated preceding RR interval, P, PQ and QRS duration and P, R, S, and T wave amplitudes were measured. Linear mixed models and logistic regression were used to determine the effect of APDs on the ECG variables studied. In comparison to sinus beats, APDs were associated with a significant (P < .001) change in P amplitude (-0.03 ± 0.01 mV) and increase in S (0.20 ± 0.02 mV) and T (0.08 ± 0.03 mV) amplitude. PQ (-20.3 ± 5.2 ms) and RR (-519 ± 14 ms) interval and P duration (-21.1 ± 3.0 ms) decreased (P < .001). APDs were significantly associated with a singular positive P wave (OR: 11.0, P < .001) and were more likely to have a monophasic positive T wave (OR: 9.2, P < .001). A smaller RR coupling interval was associated with an increased relative difference in S amplitude (P < .01). Atrial premature depolarizations may lead to changes in QRS and T wave morphology. Knowledge of these changes is important to avoid interpreting certain APDs as VPDs. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

A contiguous clone map over 3 Mb on the long arm of chromosome 11 across a balanced translocation associated with schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Evans, K.L.; Shibasaki, Yoshiro; Devon, R.S.

1995-08-10

Forty-nine clones derived by microdissection of a schizophrenia-associated t(1;11)(q42.1;q14.3) breakpoint region have been assigned by somatic cell hybrid mapping to seven discrete intervals on the long arm of human chromosome 11. Eleven of the clones were shown to map to a small region immediately distal to the translocation breakpoint on 11q. A 3-Mb contiguous clone map of this region was established by isolation of corresponding YAC recombinants. The contig was oriented and shown to traverse the translocation breakpoint by FISH and microsatellite marker analysis. This contig will facilitate the isolation of candidate sequences whose expression may be affected by themore » translocation. 28 refs., 4 figs., 3 tabs.« less

A combinatorial model for the Macdonald polynomials.

PubMed

Haglund, J

2004-11-16

We introduce a polynomial C(mu)[Z; q, t], depending on a set of variables Z = z(1), z(2),..., a partition mu, and two extra parameters q, t. The definition of C(mu) involves a pair of statistics (maj(sigma, mu), inv(sigma, mu)) on words sigma of positive integers, and the coefficients of the z(i) are manifestly in N[q,t]. We conjecture that C(mu)[Z; q, t] is none other than the modified Macdonald polynomial H(mu)[Z; q, t]. We further introduce a general family of polynomials F(T)[Z; q, S], where T is an arbitrary set of squares in the first quadrant of the xy plane, and S is an arbitrary subset of T. The coefficients of the F(T)[Z; q, S] are in N[q], and C(mu)[Z; q, t] is a sum of certain F(T)[Z; q, S] times nonnegative powers of t. We prove F(T)[Z; q, S] is symmetric in the z(i) and satisfies other properties consistent with the conjecture. We also show how the coefficient of a monomial in F(T)[Z; q, S] can be expressed recursively. maple calculations indicate the F(T)[Z; q, S] are Schur-positive, and we present a combinatorial conjecture for their Schur coefficients when the set T is a partition with at most three columns.

Leading-order determination of the gluon polarisation from semi-inclusive deep inelastic scattering data

NASA Astrophysics Data System (ADS)

Adolph, C.; Aghasyan, M.; Akhunzyanov, R.; Alexeev, M. G.; Alexeev, G. D.; Amoroso, A.; Andrieux, V.; Anfimov, N. V.; Anosov, V.; Augustyniak, W.; Austregesilo, A.; Azevedo, C. D. R.; Badełek, B.; Balestra, F.; Barth, J.; Beck, R.; Bedfer, Y.; Bernhard, J.; Bicker, K.; Bielert, E. R.; Birsa, R.; Bisplinghoff, J.; Bodlak, M.; Boer, M.; Bordalo, P.; Bradamante, F.; Braun, C.; Bressan, A.; Büchele, M.; Chang, W.-C.; Chiosso, M.; Choi, I.; Chung, S.-U.; Cicuttin, A.; Crespo, M. L.; Curiel, Q.; Dalla Torre, S.; Dasgupta, S. S.; Dasgupta, S.; Denisov, O. Yu.; Dhara, L.; Donskov, S. V.; Doshita, N.; Duic, V.; Dünnweber, W.; Dziewiecki, M.; Efremov, A.; Eversheim, P. D.; Eyrich, W.; Faessler, M.; Ferrero, A.; Finger, M.; , M. Finger, Jr.; Fischer, H.; Franco, C.; du Fresne von Hohenesche, N.; Friedrich, J. M.; Frolov, V.; Fuchey, E.; Gautheron, F.; Gavrichtchouk, O. P.; Gerassimov, S.; Giordano, F.; Gnesi, I.; Gorzellik, M.; Grabmüller, S.; Grasso, A.; Grosse Perdekamp, M.; Grube, B.; Grussenmeyer, T.; Guskov, A.; Haas, F.; Hahne, D.; von Harrach, D.; Hashimoto, R.; Heinsius, F. H.; Heitz, R.; Herrmann, F.; Hinterberger, F.; Horikawa, N.; d'Hose, N.; Hsieh, C.-Y.; Huber, S.; Ishimoto, S.; Ivanov, A.; Ivanshin, Yu.; Iwata, T.; Jahn, R.; Jary, V.; Joosten, R.; Jörg, P.; Kabuß, E.; Ketzer, B.; Khaustov, G. V.; Khokhlov, Yu. A.; Kisselev, Yu.; Klein, F.; Klimaszewski, K.; Koivuniemi, J. H.; Kolosov, V. N.; Kondo, K.; Königsmann, K.; Konorov, I.; Konstantinov, V. F.; Kotzinian, A. M.; Kouznetsov, O. M.; Krämer, M.; Kremser, P.; Krinner, F.; Kroumchtein, Z. V.; Kulinich, Y.; Kunne, F.; Kurek, K.; Kurjata, R. P.; Lednev, A. A.; Lehmann, A.; Levillain, M.; Levorato, S.; Lichtenstadt, J.; Longo, R.; Maggiora, A.; Magnon, A.; Makins, N.; Makke, N.; Mallot, G. K.; Marchand, C.; Marianski, B.; Martin, A.; Marzec, J.; Matoušek, J.; Matsuda, H.; Matsuda, T.; Meshcheryakov, G. V.; Meyer, W.; Michigami, T.; Mikhailov, Yu. V.; Mikhasenko, M.; Miyachi, Y.; Montuenga, P.; Nagaytsev, A.; Nerling, F.; Neyret, D.; Nikolaenko, V. I.; Nový, J.; Nowak, W.-D.; Nukazuka, G.; Nunes, A. S.; Olshevsky, A. G.; Orlov, I.; Ostrick, M.; Panzieri, D.; Parsamyan, B.; Paul, S.; Peng, J.-C.; Pereira, F.; Pešek, M.; Peshekhonov, D. V.; Platchkov, S.; Pochodzalla, J.; Polyakov, V. A.; Pretz, J.; Quaresma, M.; Quintans, C.; Ramos, S.; Regali, C.; Reicherz, G.; Riedl, C.; Roskot, M.; Rossiyskaya, N. S.; Ryabchikov, D. I.; Rybnikov, A.; Rychter, A.; Salac, R.; Samoylenko, V. D.; Sandacz, A.; Santos, C.; Sarkar, S.; Savin, I. A.; Sawada, T.; Sbrizzai, G.; Schiavon, P.; Schmidt, K.; Schmieden, H.; Schönning, K.; Schopferer, S.; Seder, E.; Selyunin, A.; Shevchenko, O. Yu.; Silva, L.; Sinha, L.; Sirtl, S.; Slunecka, M.; Smolik, J.; Sozzi, F.; Srnka, A.; Stolarski, M.; Sulc, M.; Suzuki, H.; Szabelski, A.; Szameitat, T.; Sznajder, P.; Takekawa, S.; Tasevsky, M.; Tessaro, S.; Tessarotto, F.; Thibaud, F.; Tosello, F.; Tskhay, V.; Uhl, S.; Veloso, J.; Virius, M.; Vondra, J.; Weisrock, T.; Wilfert, M.; ter Wolbeek, J.; Zaremba, K.; Zavada, P.; Zavertyaev, M.; Zemlyanichkina, E.; Ziembicki, M.; Zink, A.

2017-04-01

Using a novel analysis technique, the gluon polarisation in the nucleon is re-evaluated using the longitudinal double-spin asymmetry measured in the cross section of semi-inclusive single-hadron muoproduction with photon virtuality Q^2>1 (GeV/c)^2. The data were obtained by the COMPASS experiment at CERN using a 160 GeV/ c polarised muon beam impinging on a polarised ^6LiD target. By analysing the full range in hadron transverse momentum p_T, the different p_T-dependences of the underlying processes are separated using a neural-network approach. In the absence of pQCD calculations at next-to-leading order in the selected kinematic domain, the gluon polarisation Δ g/g is evaluated at leading order in pQCD at a hard scale of μ ^2= < Q^2 \\rangle = 3 (GeV/c)^2. It is determined in three intervals of the nucleon momentum fraction carried by gluons, x_g, covering the range 0.04 < x_{g} < 0.28 and does not exhibit a significant dependence on x_g. The average over the three intervals, < Δ g/g \\rangle = 0.113 ± 0.038_(stat.)± 0.036_(syst.) at < x_g \\rangle ≈ 0.10, suggests that the gluon polarisation is positive in the measured x_g range.

Update on the evaluation of a new drug for effects on cardiac repolarization in humans: issues in early drug development

PubMed Central

Salvi, Vaibhav; Karnad, Dilip R; Panicker, Gopi Krishna; Kothari, Snehal

2010-01-01

Following reports of death from cardiac arrhythmias with drugs like terfenadine and cisapride, the International Conference for Harmonization formulated a guidance (E14) document. This specifies that all new drugs must undergo a ‘thorough QT/QTc’ (TQT) study to detect drug-induced QT prolongation, a surrogate marker of ventricular tachycardia, especially torsades de pointes (TdPs). With better understanding of data from several completed TQT studies, regulatory requirements have undergone some changes since the E14 guidance was implemented in October 2005. This article reviews the implications of the E14 guidance and the changes in its interpretation including choice of baseline QT, demonstration of assay sensitivity, statistical analysis of the effect of new drug and positive control, and PK-PD modelling. Some issues like use of automated QT measurements remain unresolved. Pharmaceutical companies too are modifying Phase 1 studies to detect QTc liability early in order to save time and resources. After the E14 guidance, development of several drugs that prolong QTc by >5 ms is being abandoned by sponsors. However, all drugs that prolong the QT interval do not increase risk of TdP. Researchers in regulatory agencies, academia and industry are working to find better biomarkers of drug-induced TdP which could prevent many useful drugs from being prematurely abandoned. Drug-induced TdP is a rare occurrence. With fewer drugs that prolong QT interval reaching the licensing stage, knowing which of these drugs are torsadogenic is proving to be elusive. Thus, paradoxically, the effectiveness of the E14 guidance itself has made prospective validation of new biomarkers difficult. This article is part of a themed section on QT safety. To view this issue visit http://www3.interscience.wiley.com/journal/121548564/issueyear?year=2010 PMID:19775279

Contribution of mammalian target of rapamycin in the pathophysiology of cirrhotic cardiomyopathy.

PubMed

Saeedi Saravi, Seyed Soheil; Ghazi-Khansari, Mahmoud; Ejtemaei Mehr, Shahram; Nobakht, Maliheh; Mousavi, Seyyedeh Elaheh; Dehpour, Ahmad Reza

2016-05-21

To explore the role of mammalian target of rapamycin (mTOR) in the pathogenesis of cirrhotic cardiomyopathy and the potential of rapamycin to improve this pathologic condition. Male albino Wistar rats weighing 100-120 g were treated with tetrachloride carbon (CCl4) for 8 wk to induce cirrhosis. Subsequently, animals were administered rapamycin (2 mg/kg per day). The QTc intervals were calculated in a 5-min electrocardiogram. Then, the left ventricular papillary muscles were isolated to examine inotropic responsiveness to β-adrenergic stimulation using a standard organ bath equipped by Powerlab system. Phosphorylated-mTOR localization in left ventricles was immunohistochemically assessed, and ventricular tumor necrosis factor (TNF)-α was measured. Western blot was used to measure levels of ventricular phosphorylated-mTOR protein. Cirrhosis was confirmed by hematoxylin and eosin staining of liver tissues, visual observation of lethargy, weight loss, jaundice, brown urine, ascites, liver stiffness, and a significant increase of spleen weight (P < 0.001). A significant prolongation in QTc intervals occurred in cirrhotic rats exposed to CCl4 (P < 0.001), while this prolongation was decreased with rapamycin treatment (P < 0.01). CCl4-induced cirrhosis caused a significant decrease of contractile responsiveness to isoproterenol stimulation and a significant increase in cardiac TNF-α. These findings were correlated with data from western blot and immunohistochemical studies on phosphorylated-mTOR expression in left ventricles. Phosphorylated-mTOR was significantly enhanced in cirrhotic rats, especially in the endothelium, compared to controls. Rapamycin treatment significantly increased contractile force and myocardial localization of phosphorylated-mTOR and decreased cardiac TNF-α concentration compared to cirrhotic rats with no treatment. In this study, we demonstrated a potential role for cardiac mTOR in the pathophysiology of cirrhotic cardiomyopathy. Rapamycin normalized the inotropic effect and altered phosphorylated-mTOR expression and myocardial localization in cirrhotic rats.

Acoustic field in unsteady moving media

NASA Technical Reports Server (NTRS)

Bauer, F.; Maestrello, L.; Ting, L.

1995-01-01

In the interaction of an acoustic field with a moving airframe the authors encounter a canonical initial value problem for an acoustic field induced by an unsteady source distribution, q(t,x) with q equivalent to 0 for t less than or equal to 0, in a medium moving with a uniform unsteady velocity U(t)i in the coordinate system x fixed on the airframe. Signals issued from a source point S in the domain of dependence D of an observation point P at time t will arrive at point P more than once corresponding to different retarded times, Tau in the interval (0, t). The number of arrivals is called the multiplicity of the point S. The multiplicity equals 1 if the velocity U remains subsonic and can be greater when U becomes supersonic. For an unsteady uniform flow U(t)i, rules are formulated for defining the smallest number of I subdomains V(sub i) of D with the union of V(sub i) equal to D. Each subdomain has multiplicity 1 and a formula for the corresponding retarded time. The number of subdomains V(sub i) with nonempty intersection is the multiplicity m of the intersection. The multiplicity is at most I. Examples demonstrating these rules are presented for media at accelerating and/or decelerating supersonic speed.

Treatment with grass allergen peptides improves symptoms of grass pollen-induced allergic rhinoconjunctivitis.

PubMed

Ellis, Anne K; Frankish, Charles W; O'Hehir, Robyn E; Armstrong, Kristen; Steacy, Lisa; Larché, Mark; Hafner, Roderick P

2017-08-01

Synthetic peptide immunoregulatory epitopes are a new class of immunotherapy to treat allergic rhinoconjunctivitis (ARC). Grass allergen peptides, comprising 7 synthetic T-cell epitopes derived from Cyn d 1, Lol p 5, Dac g 5, Hol l 5, and Phl p 5, is investigated for treatment of grass pollen-induced ARC. We sought to evaluate the efficacy, safety, and tolerability of intradermally administered grass allergen peptides. A multicenter, randomized, double-blind, placebo-controlled study evaluated 3 regimens of grass allergen peptides versus placebo in patients with grass pollen-induced allergy (18-65 years). After a 4-day baseline challenge to rye grass in the environmental exposure unit (EEU), subjects were randomized to receive grass allergen peptides at 6 nmol at 2-week intervals for a total of 8 doses (8x6Q2W), grass allergen peptides at 12 nmol at 4-week intervals for a total of 4 doses (4x12Q4W), or grass allergen peptides at 12 nmol at 2-week intervals for a total of 8 doses (8x12Q2W) or placebo and treated before the grass pollen season. The primary efficacy end point was change from baseline in total rhinoconjunctivitis symptom score across days 2 to 4 of a 4-day posttreatment challenge (PTC) in the EEU after the grass pollen season. Secondary efficacy end points and safety were also assessed. Two hundred eighty-two subjects were randomized. Significantly greater improvement (reduction of total rhinoconjunctivitis symptom score from baseline to PTC) occurred across days 2 to 4 with grass allergen peptide 8x6Q2W versus placebo (-5.4 vs -3.8, respectively; P = .0346). Greater improvement at PTC also occurred for grass allergen peptide 8x6Q2W versus placebo (P = .0403) in patients with more symptomatic ARC. No safety signals were detected. Grass allergen peptide 8x6Q2W significantly improved ARC symptoms after rye grass allergen challenge in an EEU with an acceptable safety profile. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

AdipoQ polymorphisms are associated with type 2 diabetes mellitus: a meta-analysis study.

PubMed

Chu, Haiyan; Wang, Meilin; Zhong, Dongyan; Shi, Danni; Ma, Lan; Tong, Na; Zhang, Zhengdong

2013-10-01

Adiponectin (AdipoQ) plays an important role in the pathogenesis of diabetes mellitus and is considered as an important candidate gene for type 2 diabetes mellitus (T2DM). So far, there have been many studies to investigate the association between the adiponectin polymorphisms and T2DM risk. However, the results are conflicting. To derive a more precise estimation, we performed a meta-analysis to assess the association between five AdipoQ polymorphisms [-11426A > G (rs16861194), -11391G > A (rs17300539), -11377C > G (rs266729), +45T > G (rs2241766) and +276G > T (rs1501299)], and T2DM risk. The fixed and random-effects model should be used to assess the summary odds ratios (ORs) of each study. ORs with 95% confidence intervals (CIs) were used to evaluate the strength of association. On the basis of the included criteria, we selected 39 papers, among which eight for -11426A > G, 14 for -11391G > A, 21 for -11377C > G, 28 for +45 T > G and 24 for +276G > T. Sensitivity analyses were conducted to assess the stability of the results. Both Begg's funnel plots and Egger's test are commonly used to evaluate publication bias. Overall, we found that individuals with the -11426G allele had a 0.15-fold significantly increased T2DM risk (additive model: 1.15, 1.04-1.27, 0.222). In the stratified analyses, we found that the -11426A > G, -11391G > A and -11377C > G polymorphisms could increase T2DM risk in European populations in the additive model. For Asian populations, we found that the -11377C > G polymorphism also could elevate T2DM risk. Our results suggested that the adiponectin -11426A > G polymorphism could contribute to the T2DM risk. Copyright © 2013 John Wiley & Sons, Ltd.

Myeloid Antigen-positive T Cell Acute Lymphocytic Leukemia with t(14;18) and Trisomy 10: Report of a Case and Literature Review.

PubMed

Lin, Guoqiang; Liu, Limin; Zhao, Guangsheng; Si, Yejun; Zhang, Xingxia; Sun, Yumei; Lu, Shuhua; Zhang, Yanming

2015-08-01

The chromosomal translocation t(14;18)(q32;q21) is commonly associated with neoplasms of follicular center cell origin and has also been reported in cases of chronic lymphocytic leukemia. However, T cell acute lymphoblastic (or lymphocytic) leukemia (T-ALL) with t(14;18)(q32;q21) has been rarely reported. Here, we report a case of myeloid antigen-positive T-ALL (My+T-ALL) with t(14;18)(q32;q21) and trisomy 10. This is the first reported case of My+T-ALL (L2) with such chromosomal abnormalities. Other published de novo ALL cases, with t(14;18)(q32;q21) and without a documented history of lymphoma, are summarized and reviewed in this report. The patient in this study was treated with remission induction therapy and intensive chemotherapy, followed by maintenance therapy. As of this writing, he has remained in remission for more than 3 years and has presented a better clinical outcome compared with other reported adult ALL patients with t(14;18)(q32;q21).

The Cardiovascular Effect of Single Injection and Toxicologic Effects of Repetitive 2-Week Intravenous Administration of Activin A/BMP-2 Chimera in Beagle Dog.

PubMed

Lee, Jae Hyup; Choe, Senyon; Han, Shihuan

2018-02-01

This study was performed for the purpose to evaluate the effect of activin A/BMP-2 chimera (AB204) on cardiovascular system and toxicological effect in beagle dogs. When administered AB204 at the dose of 0.32 mg/kg via intravenous injection in beagle dogs, there were no changes in systolic, diastolic and mean blood pressure as well as in pulse rate, in addition that there were no differences in ORS complex, PR interval, R-R interval, QT interval and QTcV interval on the electrocardiography. Also, when administered AB204 at the doses of 0.25 and 0.5 mg/kg/day via repetitive intravenous injection for 2 weeks, it did not cause any significant changes in general symptoms, weight, food intake, ophthalmologic abnormality, urine, hematology, serum biochemistry, organ weight and autopsy values. Therefore, AB204 did not affect cardiovascular functions including blood pressure, pulse rate and ECG, when administered at the dose of ≤0.32 mg/kg via single intravenous injection in male beagle dogs. When it was administered at the dose of 0.5 mg/kg repetitive intravenous injection for 2 weeks, it did not show any toxicity.

Cardiometabolic risks of blonanserin and perospirone in the management of schizophrenia: a systematic review and meta-analysis of randomized controlled trials.

PubMed

Kishi, Taro; Matsuda, Yuki; Iwata, Nakao

2014-01-01

The present study aimed to evaluate cardiometabolic risks [weight gain, blood lipid levels (total cholesterol and triglycerides), blood glucose levels, hemoglobin A1c (HbA1c) levels, and corrected QT interval (QTc) prolongation] associated with the use of blonanserin and perospirone versus other antipsychotics in the management of patients with schizophrenia. We conducted a systematic review and meta-analysis of patient data from randomized controlled trials comparing blonanserin or perospirone with other antipsychotics. In total, 4 blonanserin studies (n = 1080) were identified [vs. risperidone (2 studies, n = 508); vs. haloperidol (2 studies, n = 572)]. Blonanserin produced less weight gain compared with risperidone (weighted mean difference = -0.86, 95% confidence intervals = -1.36 to -0.36, p = 0.0008; 2 studies, 480 patients). However, no significant differences were observed in blood lipid, glucose, and HbA1c levels or QTc prolongation between blonanserin and risperidone or haloperidol. For perospirone studies, 5 studies [562 adult patients with schizophrenia randomized to perospirone (n = 256), olanzapine (n = 20), quetiapine (n = 28), risperidone (n = 53), aripiprazole (n = 49), haloperidol (n = 75), or mosapramine (n = 81)] were identified. Perospirone did not differ from other antipsychotics with regard to weight gain and total cholesterol levels. Our results suggest that blonanserin is associated with a lower of weight gain compared with other antipsychotics. Because the number of studies was small, additional controlled clinical trials with larger number of patients are indicated.

Delamanid for rifampicin-resistant tuberculosis: a retrospective study from South Africa.

PubMed

Mohr, Erika; Hughes, Jennifer; Reuter, Anja; Trivino Duran, Laura; Ferlazzo, Gabriella; Daniels, Johnny; De Azevedo, Virginia; Kock, Yulene; Steele, Sarah Jane; Shroufi, Amir; Ade, Serge; Alikhanova, Natavan; Benedetti, Guido; Edwards, Jeffrey; Cox, Helen; Furin, Jennifer; Isaakidis, Petros

2018-06-01

Experience with delamanid (Dlm) is limited, particularly among HIV-positive individuals. We describe early efficacy and safety data from a programmatic setting in South Africa.This was a retrospective cohort study of patients receiving Dlm-containing treatment regimens between November 2015 and August 2017. We report 12-month interim outcomes, sputum culture conversion (SCC) by months 2 and 6, serious adverse events (SAEs) and QT intervals corrected using the Frederica formula (QTcF).Overall, 103 patients were initiated on Dlm; 79 (77%) were HIV positive. The main indication for Dlm was intolerance to second-line anti-tuberculosis (TB) drugs (n=58, 56%). There were 12 months of follow-up for 46 patients; 28 (61%) had a favourable outcome (cure, treatment completion or culture negativity). Positive cultures were found for 57 patients at Dlm initiation; 16 out of 31 (52%) had SCC within 2 months and 25 out of 31 (81%) within 6 months. There were 67 SAEs reported in 29 patients (28%). There were four instances of QTcF prolongation >500 ms in two patients (2%), leading to permanent discontinuation in one case; however, no cardiac arrhythmias occurred.This large cohort of difficult-to-treat patients receiving Dlm for rifampicin-resistant TB treatment in a programmatic setting with high HIV prevalence had favourable early treatment response and tolerated treatment well. Dlm should remain available, particularly for those who cannot be treated with conventional regimens or with limited treatment options. Copyright ©ERS 2018.

Changes in the PQRST intervals and heart rate variability associated with rewarming in two newborns undergoing hypothermia therapy.

PubMed

Lasky, Robert E; Parikh, Nehal A; Williams, Amber L; Padhye, Nikhil S; Shankaran, Seetha

2009-01-01

Little is known about the effects of hypothermia therapy and subsequent rewarming on the PQRST intervals and heart rate variability (HRV) in term newborns with hypoxic-ischemic encephalopathy (HIE). This study describes the changes in the PQRST intervals and HRV during rewarming to normal core body temperature of 2 newborns with HIE after hypothermia therapy. Within 6 h after birth, 2 newborns with HIE were cooled to a core body temperature of 33.5 degrees C for 72 h using a cooling blanket, followed by gradual rewarming (0.5 degrees C per hour) until the body temperature reached 36.5 degrees C. Custom instrumentation recorded the electrocardiogram from the leads used for clinical monitoring of vital signs. Generalized linear mixed models were calculated to estimate temperature-related changes in PQRST intervals and HRV. For every 1 degrees C increase in body temperature, the heart rate increased by 9.2 bpm (95% CI 6.8-11.6), the QTc interval decreased by 21.6 ms (95% CI 17.3-25.9), and low and high frequency HRV decreased by 0.480 dB (95% CI 0.052-0.907) and 0.938 dB (95% CI 0.460-1.416), respectively. Hypothermia-induced changes in the electrocardiogram should be monitored carefully in future studies. Copyright 2009 S. Karger AG, Basel.

Precipitation-Frequency and Discharge-Frequency Relations for Basins Less than 32 Square Miles in Kansas

USGS Publications Warehouse

Perry, Charles A.

2008-01-01

Precipitation-frequency and discharge-frequency relations for small drainage basins with areas less than 32 square miles in Kansas were evaluated to reduce the uncertainty of discharge-frequency estimates. Gaged-discharge records were used to develop discharge-frequency equations for the ratio of discharge to drainage area (Q/A) values using data from basins with variable soil permeability, channel slope, and mean annual precipitation. Soil permeability and mean annual precipitation are the dominant basin characteristics in the multiple linear regression analyses. In addition, 28 discharge measurements at ungaged sites by indirect surveying methods and by velocity meters also were used in this analysis to relate precipitation-recurrence interval to discharge-recurrence interval. Precipitation-recurrence interval for each of these discharge measurements were estimated from weather-radar estimates of precipitation and from nearby raingages. Time of concentration for each basin for each of the ungaged sites was computed and used to determine the precipitation-recurrence interval based on precipitation depth and duration. The ratio of discharge/drainage area (Q/A) value for each event was then assigned to that precipitation-recurrence interval. The relation between the ratio of discharge/drainage area (Q/A) and precipitation-recurrence interval for all 28 measured events resulted in a correlation coefficient of 0.79. Using basins less than 5.4 mi2 only, the correlation decreases to 0.74. However, when basins greater than 5.4 and less than 32 mi2 are examined the relation improves to a correlation coefficient of 0.95. There were a sufficient number of discharge and radar-measured precipitation events for both the 5-year (8 events) and the 100-year (11 events) recurrence intervals to examine the effect of basin characteristics on the Q/A values for basins less than 32 mi2. At the 5-year precipitation-/discharge-recurrence interval, channel slope was a significant predictor (r=0.99) of Q/A. Permeability (r=0.68) also had a significant effect on Q/A values for the 5-year recurrence interval. At the 100-year recurrence interval, permeability, channel slope, and mean annual precipitation did not have a significant effect on Q/A; however, time of concentration was a significant factor in determining Q/A for the 100-year events with greater times of concentration resulting in lower Q/A values. Additional high-recurrence interval (5-, 10-, 25-, 50-, and 100-year) precipitation/discharge data are needed to confirm these relations suggested above. Discharge data with attendant basin-wide precipitation data from precipitation-radar estimates provides a unique opportunity to study the effects of basin characteristics on the relation between precipitation recurrence interval and discharge-recurrence interval. Discharge-frequency values from the Q/A equations, the rational method, and the Kansas discharge-frequency equations (KFFE) were compared to 28 measured weather-radar precipitation-/discharge-frequency values. The association between precipitation frequency from weather-radar estimates and the frequency of the resulting discharge was shown in these comparisons. The measured and Q/A equation computed discharges displayed the best equality from low to high discharges of the three methods. Here the slope of the line was nearly 1:1 (y=0.9844x0.9677). Comparisons with the rational method produced a slope greater than 1:1 (y=0.0722x1.235), and the KFFE equations produced a slope less than 1:1 (y=5.9103x0.7475). The Q/A equation standard error of prediction averaged 0.1346 log units for the 5.4-to 32-square-mile group and 0.0944 log units for the less than 5.4-square mile group. The KFFE standard error averaged 0.2107 log units for the less-than-30-square-mile equations. Using the Q/A equations for determining discharge frequency values for ungaged sites thus appears to be a good alternative to the other two methods because of this s

Effects of changing heart rate on electrophysiological and hemodynamic function in the dog.

PubMed

Hamlin, Robert L; Nakayama, Tomohiro; Nakayama, Hitomi; Carnes, Cynthia A

2003-03-14

Cardiovascular parameters were measured in dogs after RR interval was changed from 0.25 s to 1.2 s with atropine and graded doses of zatebradine, an I(f)-channel blocker. Left ventricular (LV) pre-ejection period (PEP), systemic vascular resistance, tau (an estimate of myocardial stiffness), PQ, QTc, dLVP/dt(max) and dLVP/dt(min), aortic pressure, and right atrial pressure did not change when each parameter was plotted against RR interval (r(2)'s < or = 0.5). LV end-diastolic pressure, stroke volume index, LV ejection time (ET), and QT all increased either linearly or curvilinearly as RR interval prolonged. Cardiac output index and PEP/ET decreased curvilinearly. When heart rate (HR) was fixed by pacing, and graded doses of zatebradine were given, changes in cardiovascular function were minimal. Thus zatebradine affects cardiovascular function principally by changing HR and not by affecting function directly. This study provides data on the effects of changing HR, alone, on cardiovascular parameters measured frequently during pharmacological and toxicological studies. It should prove useful when physiological variables, including HR, change, and there is need to know what change in HR, alone, contributes.

Molecular Characterisation of Chikungunya Virus Infections in Trinidad and Comparison of Clinical and Laboratory Features with Dengue and Other Acute Febrile Cases

PubMed Central

Sahadeo, Nikita; Mohammed, Hamish; Allicock, Orchid M.; Auguste, Albert J.; Widen, Steven G.; Badal, Kimberly; Pulchan, Krishna; Foster, Jerome E.; Weaver, Scott C.; Carrington, Christine V. F.

2015-01-01

Local transmission of Chikungunya virus (CHIKV) was first documented in Trinidad and Tobago (T&T) in July 2014 preceding a large epidemic. At initial presentation, it is difficult to distinguish chikungunya fever (CHIKF) from other acute undifferentiated febrile illnesses (AUFIs), including life-threatening dengue disease. We characterised and compared dengue virus (DENV) and CHIKV infections in 158 patients presenting with suspected dengue fever (DF) and CHIKF at a major hospital in T&T, and performed phylogenetic analyses on CHIKV genomic sequences recovered from 8 individuals. The characteristics of patients with and without PCR-confirmed CHIKV were compared using Pearson’s χ2 and student’s t-tests, and adjusted odds ratios (aORs) and 95% confidence intervals (CIs) were determined using logistic regression. We then compared signs and symptoms of people with RT-qPCR-confirmed CHIKV and DENV infections using the Mann-Whitney U, Pearson’s χ2 and Fisher’s exact tests. Among the 158 persons there were 8 (6%) RT-qPCR-confirmed DENV and 30 (22%) RT-qPCR-confirmed CHIKV infections. Phylogenetic analyses showed that the CHIKV strains belonged to the Asian genotype and were most closely related to a British Virgin Islands strain isolated at the beginning of the 2013/14 outbreak in the Americas. Compared to persons who were RT-qPCR-negative for CHIKV, RT-qPCR-positive individuals were significantly more likely to have joint pain (aOR: 4.52 [95% CI: 1.28–16.00]), less likely to be interviewed at a later stage of illness (days post onset of fever—aOR: 0.56 [0.40–0.78]) and had a lower white blood cell count (aOR: 0.83 [0.71–0.96]). Among the 38 patients with RT-qPCR-confirmed CHIKV or DENV, there were no significant differences in symptomatic presentation. However when individuals with serological evidence of recent DENV or CHIKV infection were included in the analyses, there were key differences in clinical presentation between CHIKF and other AUFIs including DF, which can be used to triage patients for appropriate care in the clinical setting. PMID:26580074

Increased risk for CRC in diabetic patients with the nonrisk allele of SNPs at 8q24.

PubMed

Ishimaru, Shinya; Mimori, Koshi; Yamamoto, Ken; Inoue, Hiroshi; Imoto, Seiya; Kawano, Shuichi; Yamaguchi, Rui; Sato, Tetsuya; Toh, Hiroyuki; Iinuma, Hisae; Maeda, Toyoki; Ishii, Hideshi; Suzuki, Sadao; Tokudome, Shinkan; Watanabe, Masahiko; Tanaka, Jun-ichi; Kudo, Shin-ei; Sugihara, Ken-ichi; Hase, Kazuo; Mochizuki, Hidetaka; Kusunoki, Masato; Yamada, Kazutaka; Shimada, Yasuhiro; Moriya, Yoshihiro; Barnard, Graham F; Miyano, Satoru; Mori, Masaki

2012-09-01

Colorectal cancer (CRC) oncogenesis was considered to be determined by interactions between genetic and environmental factors. Specific interacting factors that influence CRC morbidity have yet to be fully investigated. A multi-institutional collaborative study with 1511 CRC patients and 2098 control subjects was used to compare the odds ratios for the occurrence of polymorphisms at 11 known single nucleotide polymorphisms (SNPs). TaqMan PCR and questionnaires were used to evaluate the effects of environmental exposures. Variants of rs6983267 on 8q24 were the most significant markers of risk for CRC (odds ratio 1.16, 95% confidence interval 1.06-1.27, P = 0.0015). Non-insulin-dependent diabetes mellitus (DM), a higher body mass index at age 20, and meat consumption were environmental risk factors, whereas a tuna-rich diet and vitamin intake were protective factors. The cohort of rs6983267 SNP major (T) allele at 8q24 and DM had a 1.66-fold higher risk ratio than the cohort of major allele patients without DM. We confirmed that interactions between the genetic background and environmental factors are associated with increased risk for CRC. There is a robust risk of the minor G allele at the 8q24 rs6983267 SNP; however, a major T allele SNP could more clearly reveal a correlation with CRC specifically when DM is present.

A Hybrid Strategy for the Lattice Evaluation of the Leading Order Hadronic Contribution to (g - 2)μ

NASA Astrophysics Data System (ADS)

Golterman, Maarten; Maltman, Kim; Peris, Santiago

2016-04-01

The leading-order hadronic contribution to the muon anomalous magentic moment, aμLO,HVP, can be expressed as an integral over Euclidean Q2 of the vacuum polarization function. We point out that a simple trapezoid-rule numerical integration of the current lattice data is good enough to produce a result with a less-than-1% error for the contribution from the interval above Q2 ≳ 0.1 - 0.2GeV2. This leaves the interval below this value of Q2 as the one to focus on in the future. In order to achieve an accurate result also in this lower window Q2 ≲ 0.1 - 0.2GeV2, we indicate the usefulness of three possible tools. These are: Padé Approximants, polynomials in a conformal variable and a NNLO Chiral Perturbation Theory representation supplemented by a Q4 term. The combination of the numerical integration in the upper Q2 interval together with the use of these tools in the lower Q2 interval provides a hybrid strategy which looks promising as a means of reaching the desired goal on the lattice of a sub-percent precision in the hadronic vacuum polarization contribution to the muon anomalous magnetic moment.

The changing face of antihistamines and cardiac adverse drug reactions: a clinical perspective.

PubMed

Shaikh, W A

2000-07-01

Recent times have witnessed a qualitative shift in the recognition and management of adverse drug effects. Many of them occur in organs that are unconnected to the primary target of pharmacological action. Out of these, cardiac side-effects have drawn particular attention because of their potential to cause death. Starting with the early observations on antibiotics such as macrolides, followed by fluoroquinolones and others, the focus has now shifted to the antihistamine class of drugs which are used extensively by patients all over the world, thanks to the ever increasing levels of environmental pollution. The occurrence of prolonged QTc interval following treatment with terfenadine leading to ventricular tachycardia of torsades de points variety with a potentially fatal outcome has forced many regulatory authorities of the world to clamp a ban the use of this drug. Alerted by these developments, studies on a new member, followed by fluoroquinolones and others, the focus has now shifted to the antihistamine class of drugs which are used extensively by patients all over the world, thanks to the ever incresing levels of envrionmental pollution. The occurrence of prolonged QTc interval following treatment with terfenadine leading to ventricular tachycardia of torsades de points variety with a potentially fatal outcome has forced many regulatory authorities of the world to clamp a ban use of this drug. Alerted by these developments, studies on a new member of non-sedating antihistamine class viz, fexofenadine, have been reviewed especially because of the structural similarity between terfenadine and fexofenadine. It is now clear that despite the closeness of its chemical structure to terfenadine fexofenadine behaves in a different manner and does not affect the electrophysiology of the heart muscle tissue, as proved by data from extensive clinical trials as well as membrane models in vitro. Interestingly, the solitary false alarm that was sounded on the drug by a group of workers in the Netherlands was later rectified by the same group. Clinically speaking, the cardiovascular safety of fexofenadine has been convincingly demonstrated at various dose levels and various time intervals, alone and together with other drugs of potential toxigenicity. All things put together, it appears reasonable to conclude that fexofenadine is free from cardiovascular ADRs of clinical significance. It could also be concluded that cardiac side-effects of antihistamines is not a class effect.

Evaluation of three energy balance-based evaporation models for estimating monthly evaporation for five lakes using derived heat storage changes from a hysteresis model

NASA Astrophysics Data System (ADS)

Duan, Zheng; Bastiaanssen, W. G. M.

2017-02-01

The heat storage changes (Q t) can be a significant component of the energy balance in lakes, and it is important to account for Q t for reasonable estimation of evaporation at monthly and finer timescales if the energy balance-based evaporation models are used. However, Q t has been often neglected in many studies due to the lack of required water temperature data. A simple hysteresis model (Q t = a*Rn + b + c* dRn/dt) has been demonstrated to reasonably estimate Q t from the readily available net all wave radiation (Rn) and three locally calibrated coefficients (a-c) for lakes and reservoirs. As a follow-up study, we evaluated whether this hysteresis model could enable energy balance-based evaporation models to yield good evaporation estimates. The representative monthly evaporation data were compiled from published literature and used as ground-truth to evaluate three energy balance-based evaporation models for five lakes. The three models in different complexity are De Bruin-Keijman (DK), Penman, and a new model referred to as Duan-Bastiaanssen (DB). All three models require Q t as input. Each model was run in three scenarios differing in the input Q t (S1: measured Q t; S2: modelled Q t from the hysteresis model; S3: neglecting Q t) to evaluate the impact of Q t on the modelled evaporation. Evaluation showed that the modelled Q t agreed well with measured counterparts for all five lakes. It was confirmed that the hysteresis model with locally calibrated coefficients can predict Q t with good accuracy for the same lake. Using modelled Q t as inputs all three evaporation models yielded comparably good monthly evaporation to those using measured Q t as inputs and significantly better than those neglecting Q t for the five lakes. The DK model requiring minimum data generally performed the best, followed by the Penman and DB model. This study demonstrated that once three coefficients are locally calibrated using historical data the simple hysteresis model can offer reasonable Q t to force energy balance-based evaporation models to improve evaporation modelling at monthly timescales for conditions and long-term periods when measured Q t are not available. We call on scientific community to further test and refine the hysteresis model in more lakes in different geographic locations and environments.

Systolic time interval data acquisition system. Specialized cardiovascular studies

NASA Technical Reports Server (NTRS)

Baker, J. T.

1976-01-01

The development of a data acquisition system for noninvasive measurement of systolic time intervals is described. R-R interval from the ECG determines instantaneous heart rate prior to the beat to be measured. Total electromechanical systole (Q-S2) is measured from the onset of the ECG Q-wave to the onset of the second heart sound (S2). Ejection time (ET or LVET) is measured from the onset of carotid upstroke to the incisure. Pre-ejection period (PEP) is computed by subtracting ET from Q-S2. PEP/ET ratio is computed directly.

QT prolongation and proarrhythmia by moxifloxacin: concordance of preclinical models in relation to clinical outcome

PubMed Central

Chen, Xian; Cass, Jessica D; Bradley, Jenifer A; Dahm, Corinn M; Sun, Zhuoqian; Kadyszewski, Edmund; Engwall, Michael J; Zhou, Jun

2005-01-01

Moxifloxacin, a fluoroquinolone antibiotic associated with QT prolongation, has been recommended as a positive control by regulatory authorities to evaluate the sensitivity of both clinical and preclinical studies to detect small but significant increases in QT interval measurements. In this study, we investigated effects of moxifloxacin on the hERG current in HEK-293 cells, electrocardiograms in conscious telemetered dogs, and repolarization parameters and arrhythmogenic potentials in the arterially perfused rabbit ventricular wedge model. Moxifloxacin inhibited the hERG current with an IC50 of 35.7 μM. In conscious telemetered dogs, moxifloxacin significantly prolonged QTc at 30 and 90 mg kg−1, with mean serum Cmax of 8.52 and 22.3 μg ml−1, respectively. In the wedge preparation, moxifloxacin produced a concentration-dependent prolongation of the action potential duration, QT interval, and the time between peak and end of the T wave, an indicator for transmural dispersion of repolarization. Phase 2 early after-depolarizations were observed in one of five experiments at 30 μM and five of five experiments at 100 μM. The arrhythmogenic potential was also concentration-dependent, and 100 μM (∼18-fold above the typical unbound Cmax exposure in clinical usage) appeared to have a high risk of inducing torsade de pointes (TdP). Our data indicated a good correlation among the concentration–response relationships in the three preclinical models and with the available clinical data. The lack of TdP report by moxifloxacin in patients without other risk factors might be attributable to its well-behaved pharmacokinetic profile and other dose-limiting effects. PMID:16158069

A rare case of a three way complex variant positive Philadelphia translocation involving chromosome (9;11;22)(q34;p15;q11) in chronic myeloid leukemia: A case report

PubMed Central

Asif, Muhammad; Hussain, Abrar; Rasool, Mahmood

2016-01-01

The t(9;22)(q34;q11) translocation is present in 90–95% of patients with chronic myeloid leukemia (CML). Variant complex translocations have been observed in 5–8% of CML patients, in which a third chromosome other than (9;22) is involved. Imatinib mesylate is the first line breakpoint cluster region-Abelson gene (BCR/ABL)-targeted oral therapy for CML, and may produce a complete response in 70–80% of CML patients in the chronic phase. In the present study, a bone marrow sample was used for conventional cytogenetic analysis, and the fluorescence in situ hybridization (FISH) test was used for BCR/ABL gene detection. A hematological analysis was also performed to determine the white blood cell (WBC) count, red blood cell count, hemoglobin levels, packed and mean cell volumes, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration and platelet values of the patient. The hematological analysis of the patient indicated the increased WBC of 186.5×103 cells/µl, and decreased hemoglobin levels of 11.1 g/dl. The FISH test revealed that 67% cells demonstrated BCR/ABL gene translocation. The patient was treated with 400 mg imatinib mesylate daily, and was monitored at various intervals over a 6-month period. The present study reports the rare case of a patient that demonstrates a three-way Philadelphia chromosome-positive translocation involving 46XY,t(9;11;22)(q34;p15;q11)[10], alongside CML in the chronic phase. The translocation was analyzed using cytogenetic and FISH tests. PMID:27602125

Limits on the decay-rate difference of neutral B mesons and on CP, T, and CPT violation in B(0-0)B oscillations.

PubMed

Aubert, B; Barate, R; Boutigny, D; Gaillard, J-M; Hicheur, A; Karyotakis, Y; Lees, J P; Robbe, P; Tisserand, V; Zghiche, A; Palano, A; Pompili, A; Chen, J C; Qi, N D; Rong, G; Wang, P; Zhu, Y S; Eigen, G; Ofte, I; Stugu, B; Abrams, G S; Borgland, A W; Breon, A B; Brown, D N; Button-Shafer, J; Cahn, R N; Charles, E; Day, C T; Gill, M S; Gritsan, A V; Groysman, Y; Jacobsen, R G; Kadel, R W; Kadyk, J; Kerth, L T; Kolomensky, Yu G; Kral, J F; Kukartsev, G; LeClerc, C; Levi, M E; Lynch, G; Mir, L M; Oddone, P J; Orimoto, T J; Pripstein, M; Roe, N A; Romosan, A; Ronan, M T; Shelkov, V G; Telnov, A V; Wenzel, W A; Ford, K; Harrison, T J; Hawkes, C M; Knowles, D J; Morgan, S E; Penny, R C; Watson, A T; Watson, N K; Deppermann, T; Goetzen, K; Held, T; Koch, H; Lewandowski, B; Pelizaeus, M; Peters, K; Schmuecker, H; Steinke, M; Barlow, N R; Boyd, J T; Chevalier, N; Cottingham, W N; Kelly, M P; Latham, T E; Mackay, C; Wilson, F F; Abe, K; Cuhadar-Donszelmann, T; Hearty, C; Mattison, T S; McKenna, J A; Thiessen, D; Kyberd, P; McKemey, A K; Blinov, V E; Bukin, A D; Golubev, V B; Ivanchenko, V N; Kravchenko, E A; Onuchin, A P; Serednyakov, S I; Skovpen, Yu I; Solodov, E P; Yushkov, A N; Best, D; Bruinsma, M; Chao, M; Kirkby, D; Lankford, A J; Mandelkern, M; Mommsen, R K; Roethel, W; Stoker, D P; Buchanan, C; Hartfiel, B L; Shen, B C; del Re, D; Hadavand, H K; Hill, E J; MacFarlane, D B; Paar, H P; Rahatlou, Sh; Sharma, V; Berryhill, J W; Campagnari, C; Dahmes, B; Levy, S L; Long, O; Lu, A; Mazur, M A; Richman, J D; Verkerke, W; Beck, T W; Beringer, J; Eisner, A M; Heusch, C A; Lockman, W S; Schalk, T; Schmitz, R E; Schumm, B A; Seiden, A; Turri, M; Walkowiak, W; Williams, D C; Wilson, M G; Albert, J; Chen, E; Dubois-Felsmann, G P; Dvoretskii, A; Hitlin, D G; Narsky, I; Porter, F C; Ryd, A; Samuel, A; Yang, S; Jayatilleke, S; Mancinelli, G; Meadows, B T; Sokoloff, M D; Abe, T; Blanc, F; Bloom, P; Chen, S; Clark, P J; Ford, W T; Nauenberg, U; Olivas, A; Rankin, P; Roy, J; Smith, J G; van Hoek, W C; Zhang, L; Harton, J L; Hu, T; Soffer, A; Toki, W H; Wilson, R J; Zhang, J; Altenburg, D; Brandt, T; Brose, J; Colberg, T; Dickopp, M; Dubitzky, R S; Hauke, A; Lacker, H M; Maly, E; Müller-Pfefferkorn, R; Nogowski, R; Otto, S; Schubert, J; Schubert, K R; Schwierz, R; Spaan, B; Wilden, L; Bernard, D; Bonneaud, G R; Brochard, F; Cohen-Tanugi, J; Grenier, P; Thiebaux, Ch; Vasileiadis, G; Verderi, M; Khan, A; Lavin, D; Muheim, F; Playfer, S; Swain, J E; Tinslay, J; Andreotti, M; Azzolini, V; Bettoni, D; Bozzi, C; Calabrese, R; Cibinetto, G; Luppi, E; Negrini, M; Piemontese, L; Sarti, A; Treadwell, E; Anulli, F; Baldini-Ferroli, R; Biasini, M; Calcaterra, A; de Sangro, R; Falciai, D; Finocchiaro, G; Patteri, P; Peruzzi, I M; Piccolo, M; Pioppi, M; Zallo, A; Buzzo, A; Capra, R; Contri, R; Crosetti, G; Lo Vetere, M; Macri, M; Monge, M R; Passaggio, S; Patrignani, C; Robutti, E; Santroni, A; Tosi, S; Bailey, S; Morii, M; Won, E; Bhimji, W; Bowerman, D A; Dauncey, P D; Egede, U; Eschrich, I; Gaillard, J R; Morton, G W; Nash, J A; Sanders, P; Taylor, G P; Grenier, G J; Lee, S-J; Mallik, U; Cochran, J; Crawley, H B; Lamsa, J; Meyer, W T; Prell, S; Rosenberg, E I; Yi, J; Davier, M; Grosdidier, G; Höcker, A; Laplace, S; Le Diberder, F; Lepeltier, V; Lutz, A M; Petersen, T C; Plaszczynski, S; Schune, M H; Tantot, L; Wormser, G; Brigljević, V; Cheng, C H; Lange, D J; Wright, D M; Bevan, A J; Coleman, J P; Fry, J R; Gabathuler, E; Gamet, R; Kay, M; Parry, R J; Payne, D J; Sloane, R J; Touramanis, C; Back, J J; Harrison, P F; Shorthouse, H W; Strother, P; Vidal, P B; Brown, C L; Cowan, G; Flack, R L; Flaecher, H U; George, S; Green, M G; Kurup, A; Marker, C E; McMahon, T R; Ricciardi, S; Salvatore, F; Vaitsas, G; Winter, M A; Brown, D; Davis, C L; Allison, J; Barlow, R J; Forti, A C; Hart, P A; Jackson, F; Lafferty, G D; Lyon, A J; Weatherall, J H; Williams, J C; Farbin, A; Jawahery, A; Kovalskyi, D; Lae, C K; Lillard, V; Roberts, D A; Blaylock, G; Dallapiccola, C; Flood, K T; Hertzbach, S S; Kofler, R; Koptchev, V B; Moore, T B; Saremi, S; Staengle, H; Willocq, S; Cowan, R; Sciolla, G; Taylor, F; Yamamoto, R K; Mangeol, D J J; Milek, M; Patel, P M; Lazzaro, A; Palombo, F; Bauer, J M; Cremaldi, L; Eschenburg, V; Godang, R; Kroeger, R; Reidy, J; Sanders, D A; Summers, D J; Zhao, H W; Brunet, S; Cote-Ahern, D; Hast, C; Taras, P; Nicholson, H; Cartaro, C; Cavallo, N; De Nardo, G; Fabozzi, F; Gatto, C; Lista, L; Paolucci, P; Piccolo, D; Sciacca, C; Baak, M A; Raven, G; LoSecco, J M; Gabriel, T A; Brau, B; Gan, K K; Honscheid, K; Hufnagel, D; Kagan, H; Kass, R; Pulliam, T; Wong, Q K; Brau, J; Frey, R; Potter, C T; Sinev, N B; Strom, D; Torrence, E; Colecchia, F; Dorigo, A; Galeazzi, F; Margoni, M; Morandin, M; Posocco, M; Rotondo, M; Simonetto, F; Stroili, R; Tiozzo, G; Voci, C; Benayoun, M; Briand, H; Chauveau, J; David, P; de la Vaissière, Ch; Del Buono, L; Hamon, O; John, M J J; Leruste, Ph; Ocariz, J; Pivk, M; Roos, L; Stark, J; T'Jampens, S; Therin, G; Manfredi, P F; Re, V; Behera, P K; Gladney, L; Guo, Q H; Panetta, J; Angelini, C; Batignani, G; Bettarini, S; Bondioli, M; Bucci, F; Calderini, G; Carpinelli, M; Forti, F; Giorgi, M A; Lusiani, A; Marchiori, G; Martinez-Vidal, F; Morganti, M; Neri, N; Paoloni, E; Rama, M; Rizzo, G; Sandrelli, F; Walsh, J; Haire, M; Judd, D; Paick, K; Wagoner, D E; Danielson, N; Elmer, P; Lu, C; Miftakov, V; Olsen, J; Smith, A J S; Tanaka, H A; Varnes, E W; Bellini, F; Cavoto, G; Faccini, R; Ferrarotto, F; Ferroni, F; Gaspero, M; Mazzoni, M A; Morganti, S; Pierini, M; Piredda, G; Safai Tehrani, F; Voena, C; Christ, S; Wagner, G; Waldi, R; Adye, T; De Groot, N; Franek, B; Geddes, N I; Gopal, G P; Olaiya, E O; Xella, S M; Aleksan, R; Emery, S; Gaidot, A; Ganzhur, S F; Giraud, P-F; Hamel de Monchenault, G; Kozanecki, W; Langer, M; Legendre, M; London, G W; Mayer, B; Schott, G; Vasseur, G; Yeche, Ch; Zito, M; Purohit, M V; Weidemann, A W; Yumiceva, F X; Aston, D; Bartoldus, R; Berger, N; Boyarski, A M; Buchmueller, O L; Convery, M R; Coupal, D P; Dong, D; Dorfan, J; Dujmic, D; Dunwoodie, W; Field, R C; Glanzman, T; Gowdy, S J; Granges-Pous, E; Hadig, T; Halyo, V; Hryn'ova, T; Innes, W R; Jessop, C P; Kelsey, M H; Kim, P; Kocian, M L; Langenegger, U; Leith, D W G S; Luitz, S; Luth, V; Lynch, H L; Marsiske, H; Messner, R; Muller, D R; O'Grady, C P; Ozcan, V E; Perazzo, A; Perl, M; Petrak, S; Ratcliff, B N; Robertson, S H; Roodman, A; Salnikov, A A; Schindler, R H; Schwiening, J; Simi, G; Snyder, A; Soha, A; Stelzer, J; Su, D; Sullivan, M K; Va'vra, J; Wagner, S R; Weaver, M; Weinstein, A J R; Wisniewski, W J; Wright, D H; Young, C C; Burchat, P R; Edwards, A J; Meyer, T I; Petersen, B A; Roat, C; Ahmed, M; Ahmed, S; Alam, M S; Ernst, J A; Saleem, M; Wappler, F R; Bugg, W; Krishnamurthy, M; Spanier, S M; Eckmann, R; Kim, H; Ritchie, J L; Schwitters, R F; Izen, J M; Kitayama, I; Lou, X C; Ye, S; Bianchi, F; Bona, M; Gallo, F; Gamba, D; Borean, C; Bosisio, L; Della Ricca, G; Dittongo, S; Grancagnolo, S; Lanceri, L; Poropat, P; Vitale, L; Vuagnin, G; Panvini, R S; Banerjee, Sw; Brown, C M; Fortin, D; Jackson, P D; Kowalewski, R; Roney, J M; Band, H R; Dasu, S; Datta, M; Eichenbaum, A M; Johnson, J R; Kutter, P E; Li, H; Liu, R; Di Lodovico, F; Mihalyi, A; Mohapatra, A K; Pan, Y; Prepost, R; Sekula, S J; von Wimmersperg-Toeller, J H; Wu, J; Wu, S L; Yu, Z; Neal, H

2004-05-07

Using events in which one of two neutral B mesons from the decay of an Upsilon(4S) meson is fully reconstructed, we determine parameters governing decay (DeltaGamma(d)/Gamma(d)), CP, and T violation (|q/p|), and CP and CPT violation (Re z,Im z). The results, obtained from an analysis of 88 x 10(6) Upsilon(4S) decays recorded by BABAR, are sgn(Re lambda(CP))DeltaGamma(d)/Gamma(d)=-0.008+/-0.037(stat)+/-0.018(syst)[-0.084,0.068],|q/p|=1.029+/-0.013(stat)+/-0.011(syst)[1.001,1.057],(Re lambda(CP)/|lambda(CP)|) Re z=0.014+/-0.035(stat)+/-0.034(syst)[-0.072,0.101],Im z=0.038+/-0.029(stat)+/-0.025(syst)[-0.028,0.104]. The values inside the square brackets indicate the 90% confidence-level intervals. These results are consistent with standard model expectations.

Preliminary evaluation of flood frequency relations in the urban areas of Memphis, Tennessee

USGS Publications Warehouse

Boning, Charles W.

1977-01-01

A storm-runoff relation for streams in the urban areas of Memphis was determined by a statistical evaluation of 59 flood discharges from 19 gaging stations. These flood discharges were related to drainage area, percent imperviousness of the drainage basin, and rainfall occuring over 120-minute periods. The defined relation is Q=m3A*777A - .02 tI,,,,P + 1j-227 (1120).539(t120).40 where Q is flood discharge in cfs, A is drainage area in square miles, IMP is percent imperviousness in the basin, and I120 is rainfall in inches, over 120 minute time period. The defined relation was used to synthesize sets of annual flood peaks for drainage basins ranging from .05 square miles to 10 square miles and imperviousness ranging from 0 to 80 percent for the period of rainfall record at Memphis. From these series of flood peaks, frequency relations were defined and presented for 2, 5, 10, 25, 50 and 100 year recurrent intervals.

Impact of t(11;14)(q13;q32) on the outcome of autologous hematopoietic cell transplantation in multiple myeloma.

PubMed

Sasaki, Koji; Lu, Gary; Saliba, Rima M; Bashir, Qaiser; Hosing, Chitra; Popat, Uday; Shah, Nina; Parmar, Simrit; Dinh, Yvonne; Ahmed, Sairah; Shpall, Elizabeth J; Kebriaei, Partow; Shah, Jatin J; Orlowski, Robert Z; Champlin, Richard; Qazilbash, Muzaffar H

2013-08-01

The t(11;14)(q13;q32) translocation is seen in 15%-20% patients with multiple myeloma (MM). It generally is not associated with worse outcomes. We studied the impact of t(11;14)(q13;q32) on outcome in patients with MM who received high-dose chemotherapy followed by autologous hematopoietic stem cell transplantation (auto-HCT). Eligible patients underwent high-dose chemotherapy followed by auto-HCT at the M.D. Anderson Cancer Center between February 2000 and August 2010, and had conventional cytogenetic (CC) or fluorescence in situ hybridization (FISH) results available before auto-HCT (n = 993). The cohort was divided into 3 groups of patients: (1) normal (diploid by CC and negative by FISH; n = 869); (2) t(11;14)(q13;q32) by CC or FISH (n = 27); and (3) high-risk (HR) abnormalities by CC or FISH (n = 97). Of the 27 patients with t(11;14)(q13;q32), 18 had isolated t(11;14)(q13;q32) and 9 had concurrent HR abnormalities. The primary objective was to compare outcomes in patients with t(11;14)(q13;q32) and patients with diploid or HR markers detected by CC or FISH studies. The median duration of follow-up in surviving patients was 37 months. The 3-year progression-free survival (PFS) was 47% for the normal group, 27% for the t(11;14)(q13;q32) group, and 13% for the HR group (P < .00001). The 3-year OS was 83% for the normal group, 63% for the t(11;14)(q13;q32) group, and 34% for the HR group (P < .00001). On multivariate analysis, t(11;14)(q13;q32) and HR abnormalities by CC or FISH and relapsed disease at auto-HCT were associated with shorter PFS, whereas t(11;14)(q13;q32) and HR abnormalities by CC or FISH, β2 microglobulin of >3.5, and relapsed disease at the time of auto-HCT were associated with shorter OS. In conclusion, patients with t(11;14)(q13;q32) had worse outcomes than patients with normal CC or FISH studies, but better outcomes than patients with HR markers detected by CC or FISH studies. Copyright © 2013 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.

A Nonlinear Mathematical Model of Motions of a Planing Boat in Irregular Waves

DTIC Science & Technology

1979-09-01

VLLIN M4AIN 16 COMP4ON/OUT/NPHINT ,NPLOTENU MAIN 17 CO,440N/4TE𔃾S/J1,T2.73,T4,T5.Tb.T7. Td MAIN 18 COM4MON /RN&NS/ START,RISEvQAMe "AIN t9 COM440N...CR17ERIA CHECK IF IIC.CToH/AUTMEWflV C - -- -- -- -- IF YES THEr4 mALVt. INTER~VAL. OTHLRWISE STOP. KUTMERSO 90 A 2 I8.*A6S01C)- tdS (N3 KUTt4EQP IFfA...25 LiAU. 135 WRITE(6,12, IA(1.1.t,13) OA’jj 136 WRTE(6,14) (A( 1q3 ) .1:1,3l DAUX 138 Co * * * 0 * INVtQT TN’E A M4ATIX OAWI 139 Z2 CALL MATINS(A.J,3.F

Interstitial 13q14 deletions detected in the karyotype and translocations with concomitant deletion at 13q14 in chronic lymphocytic leukemia: different genetic mechanisms but equivalent poorer clinical outcome.

PubMed

Puiggros, Anna; Venturas, Marta; Salido, Marta; Blanco, Gonzalo; Fernandez-Rodriguez, Concepción; Collado, Rosa; Valiente, Alberto; Ruiz-Xivillé, Neus; Carrió, Ana; Ortuño, Francisco José; Luño, Elisa; Calasanz, María José; Ardanaz, María Teresa; Piñán, María Ángeles; Talavera, Elisabet; González, María Teresa; Ortega, Margarita; Marugán, Isabel; Ferrer, Ana; Gimeno, Eva; Bellosillo, Beatriz; Delgado, Julio; Hernández, José Ángel; Hernández-Rivas, Jesús María; Espinet, Blanca

2014-09-01

Deletion of 13q14 as the sole abnormality is a good prognostic marker in chronic lymphocytic leukemia (CLL). Nonetheless, the prognostic value of reciprocal 13q14 translocations [t(13q)] with related 13q losses has not been fully elucidated. We described clinical and biological characteristics of 25 CLL patients with t(13q), and compared with 62 patients carrying interstitial del(13q) by conventional G-banding cytogenetics (CGC) [i-del(13q)] and 295 patients with del(13q) only detected by fluorescence in situ hybridization (FISH) [F-del(13q)]. Besides from the CLL FISH panel (D13S319, CEP12, ATM, TP53), we studied RB1 deletions in all t(13q) cases and a representative group of i-del(13q) and F-del(13q). We analyzed NOTCH1, SF3B1, and MYD88 mutations in t(13q) cases by Sanger sequencing. In all, 25 distinct t(13q) were described. All these cases showed D13S319 deletion while 32% also lost RB1. The median percentage of 13q-deleted nuclei did not differ from i-del(13q) patients (73% vs. 64%), but both were significantly higher than F-del(13q) (52%, P < 0.001). Moreover, t(13q) patients showed an increased incidence of biallelic del(13q) (52% vs. 11.3% and 14.9%, P < 0.001) and higher rates of concomitant 17p deletion (37.5% vs. 8.6% and 7.2%, P < 0.001). RB1 involvement was significantly higher in the i-del(13q) group (79%, P < 0.001). Two t(13q) patients (11.8%) carried NOTCH1 mutations. Time to first treatment in t(13q) and i-del(13q) was shorter than F-del(13q) (67, 44, and 137 months, P = 0.029), and preserved significance in the multivariate analysis. In conclusion, t(13q) and del(13q) patients detected by CGC constitute a subgroup within the 13q-deleted CLL patients associated with a worse clinical outcome. © 2014 Wiley Periodicals, Inc.

Effect of Head-Down Bed Rest and Artificial Gravity Countermeasure on Cardiac Autonomic and Advanced Electrocardiographic Function

NASA Technical Reports Server (NTRS)

Schlegel, T. T.; Platts, S.; Stenger, M.; Ribeiro, C.; Natapoff, A.; Howarth, M.; Evans, J.

2007-01-01

To study the effects of 21 days of head-down bed rest (HDBR), with versus without an artificial gravity (AG) countermeasure, on cardiac autonomic and advanced electrocardiographic function. Fourteen healthy men participated in the study: seven experienced 21 days of HDBR alone ("HDBR controls") and seven the same degree and duration of HDBR but with approximately 1hr daily short-arm centrifugation as an AG countermeasure ("AG-treated"). Five minute supine high-fidelity 12-lead ECGs were obtained in all subjects: 1) 4 days before HDBR; 2) on the last day of HDBR; and 3) 7 days after HDBR. Besides conventional 12-lead ECG intervals and voltages, all of the following advanced ECG parameters were studied: 1) both stochastic (time and frequency domain) and deterministic heart rate variability (HRV); 2) beat-to-beat QT interval variability (QTV); 3) T-wave morphology, including signal-averaged T-wave residua (TWR) and principal component analysis ratios; 4) other SAECG-related parameters including high frequency QRS ECG and late potentials; and 5) several advanced ECG estimates of left ventricular (LV) mass. The most important results by repeated measures ANOVA were that: 1) Heart rates, Bazett-corrected QTc intervals, TWR, LF/HF power and the alpha 1 of HRV were significantly increased in both groups (i.e., by HDBR), but with no relevant HDBR*group differences; 2) All purely "vagally-mediated" parameters of HRV (e.g., RMSSD, HF power, Poincare SD1, etc.), PR intervals, and also several parameters of LV mass (Cornell and Sokolow-Lyon voltages, spatial ventricular activation times, ventricular gradients) were all significantly decreased in both groups (i.e., by HDBR), but again with no relevant HDBR*group differences); 3) All "generalized" or "vagal plus sympathetic" parameters of stochastic HRV (i.e., SDNN, total power, LF power) were significantly more decreased in the AG-treated group than in the HDBR-only group (i.e., here there was a relevant HDBR*group difference); and 4) QTV index was also significantly more changed (increased) in the AG-treated group than in the HDBR-only group, although this was clearly due to a greater decrease in generalized HRV and not to a greater increase in QTV proper because there was no relevant HDBR*group effect for either the SDNN or the RMSSD of QTV. Brief daily AG treatment by short-arm centrifuge during each of 21 days of HDBR does not appear to protect against HDBR-related losses of cardiac autonomic function or of LV mass as estimated by ECG.

Ship-bridge collision monitoring system based on flexible quantum tunneling composite with cushioning capability

NASA Astrophysics Data System (ADS)

Zheng, Qiaofeng; Han, Baoguo; Ou, Jinping

2018-07-01

In this paper, a ship-bridge collision monitoring system based on flexible quantum tunneling composite (QTC) with cushioning capability is proposed by investigating the sensing capability and positioning capability of QTC to collisions. QTCs with different rubber matrix and thickness were fabricated, and collision tests between steel ball and QTCs sensors were designed to simulate ship-bridge collision. The results show that QTCs have a sensing range over 50 MPa with stress resolution ranging between 0.017 and 0.13 MPa, enough to achieve the full-time monitoring of ship-bridge collision. The system has instant and repeatable respond to impact load, and can accurately position the collisions. Moreover, QTC can remarkably absorb the kinetic energy during collisions, exhibiting excellent cushioning capability. These findings indicate the proposed ship-bridge collision monitoring system has great potential for application to detecting collision information such as collision occurrence and duration, impact load and collision location, as well as providing basis for citizen evacuation, post-accident damage estimation and rescue strategy.

Synthetic Cannabinoids and Their Effects on the Cardiovascular System.

PubMed

Von Der Haar, Jonathan; Talebi, Soheila; Ghobadi, Farzaneh; Singh, Shailinder; Chirurgi, Roger; Rajeswari, Pingle; Kalantari, Hossein; Hassen, Getaw Worku

2016-02-01

In the past couple of years, there has been an outbreak of synthetic cannabinoid (SC) use in major cities in the United States. Patients can present with various symptoms affecting the central nervous and cardiovascular systems. The effects of endocannabinoid on contractility and Ca(2+) signaling have been shown through both cannabinoid receptors and a direct effect on ion channels. These effects result in abnormalities in ionotropy, chronotropy, and conduction. Here we report on two cases of SC abuse and abnormalities in the cardiovascular system. These cases raise concerns about the adverse effects of SCs and the possibility of QTc prolongation and subsequent complications when using antipsychotic medication in the presence of SC abuse. WHY SHOULD AN EMERGENCY PHYSICIAN BE AWARE OF THIS?: Given the rise in SC use and the potential effect on the cardiovascular system, physicians need to be mindful of potential cardiac complications, such as QTc prolongation and torsade de pointe, especially when administering medications that have the potential to cause QTc prolongation. Copyright © 2016 Elsevier Inc. All rights reserved.

Acute leukaemia and myelodysplastic syndromes with chromosomal rearrangement involving 11q23 locus, but not MLL gene.

PubMed

Zuo, Wenli; Wang, Sa A; DiNardo, Courtney; Yabe, Mariko; Li, Shaoying; Medeiros, L Jeffrey; Tang, Guilin

2017-03-01

Chromosome 11q23 translocations, resulting in MLL (KMT2A ) rearrangement, have been well characterised in acute myeloid leukaemia (AML) and acute lymphoblastic leukaemia (ALL). However, little is known of haematopoietic neoplasms associated with 11q23 translocation but without MLL rearrangement (11q23+/ MLL -). The aim of this study is to characterise such cases with 11q23+/ MLL -. We retrospectively searched our database for cases with haematopoietic malignancies with 11q23+/ MLL -. We identified nine patients, two with AML, two with B-lymphoblastic leukaemia (B-ALL); two with T-lymphoblastic leukaemia (T-ALL), two with myelodysplastic syndrome (MDS) and one with chronic myelomonocytic leukaemia (CMML). The translocations included t(X;11)(p11.2;q23), t(2;11)(p21;q23), t(6;11)(q27;q23), t(8;9;11)(q13;q13;q23), t(11;11)(p15;q23), t(11;14)(q23;q24) and t(11;15)(q23;q14). Five of six patients with acute leukaemia had received chemotherapy and detection of 11q23 translocation occurred at time of disease relapse. Both patients with MDS and the patient with CMML had 11q23 translocation detected at time of initial diagnosis, all three patients progressed to AML after >1 year on hypomethylating agent therapy. All patients received risk-adapted therapies, including stem cell transplant in five patients. At the last follow-up, eight patients died with a median overall survival of 14 months. 11q23+/ MLL - occurs rarely, involving different partner chromosomes and showing clinical and pathological features and disease subtypes different from those cases with MLL rearrangement. 11q23+/ MLL - appears to be associated with clonal evolution/disease progression in acute leukaemia, a high risk for AML progression in MDS/CMML and a high incidence of disease relapse. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Comparison of neostigmine and sugammadex for hemodynamic parameters in cardiac patients undergoing noncardiac surgery.

PubMed

Kizilay, Deniz; Dal, Didem; Saracoglu, Kemal T; Eti, Zeynep; Gogus, Fevzi Y

2016-02-01

The aim of this study is to compare the hemodynamic effects of neostigmine-atropine combination and sugammadex in patients with cardiac problems undergoing noncardiac surgery. Prospective randomized study. In the operating room. Ninety patients with a class 2 or 3 cardiovascular disease according to the New York Heart Association classification and aged between 18 and 75 years undergoing noncardiac surgery were randomized. Group N (n = 45) received 0.03 mg/kg IV neostigmine when T2 appeared as measured with a nerve muscle stimulator. When heart rate was 5 beats/min (±10 beats/min) lower than the heart rate before administration of the medication, 0.5 mg IV atropine sulfate was given. Group S (n = 45) received 3 mg/kg IV sugammadex when T2 appeared as measured with a nerve muscle stimulator. Heart rate, mean systolic and diastolic blood pressures, and electrocardiographic alterations including the QTc (QT Fredericia and QT Bazett) were recorded. There were no significant differences between and within the groups in terms of QTc values. Sugammadex group had a significant decrease on heart rate 1 minute after the medication when compared to the measurement before the medication (P < .05). Heart rate and systolic blood pressure increased in neostigmine group 3 minutes after the medication and during postoperative measurements (P < .05). Sugammadex group had lower systolic, diastolic, and mean blood pressures and heart rate when compared to neostigmine group (P < .05). We suggest that sugammadex might be preferred as it provides more hemodynamic stability compared to neostigmine-atropine combination to reverse rocuronium-induced neuromuscular blockage in cardiac patients undergoing noncardiac surgery. Copyright © 2016 Elsevier Inc. All rights reserved.

Maternal uniparental disomy of chromosome 14 in a boy with t(14q14q) associated with a paternal t(13q14q)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomkins, D.J.; Waye, J.S.; Whelan, D.T.

An 11-year-old boy was referred for chromosomal analysis because of precocious development and behavioral problems suggestive of the fragile X syndrome. The cytogenetic fragile X studies were normal, but a routine GTG-banded karyotype revealed an abnormal male karyotype with a Robertsonian translocation between the two chromosome 14`s: 46,XY,t(14q14q). Paternal karyotyping revealed another abnormal karyotype: 46,XY,t(13q14q). A brother had the same karyotype as the father; the mother was deceased. In order to determine if the apparently balanced t(14q14q) in the proband might be the cause of the clinical findings, molecular analysis of the origin of the chromosome 14`s was initiated. Southernmore » blotting and hybridization with D4S13 showed that the proband had two copies of one maternal allele which was shared by his brother. The brother`s second allele corresponded to one of the paternal alleles; the proband had no alleles from the father. Analysis of four other VNTRs demonstrated the probability of paternity to be greater than 99%. Thus, the t(14q14q) was most likely composed of two maternal chromosome 14`s. Further characterization of the t(14q14q) by dinucleotide repeat polymorphic markers is in progress to determine whether it has arisen from maternal isodisomy or heterodisomy. Several cases of uniparental disomy for chromosome 14 have been reported recently. Paternal disomy appears to be associated with more severe congenital anomalies and mental retardation, whereas maternal disomy may be associated with premature puberty and minimal intellectual impairment. The origin of the t(14q14q) in the present case may be related to the paternal translocation, as the segregation of the t(13q14q) in meiosis could lead to sperm that are nullisomic for chromosome 14.« less

Management of chemotherapy-induced nausea and vomiting in patients receiving multiple-day highly or moderately emetogenic chemotherapy: role of transdermal granisetron.

PubMed

Coluzzi, Flaminia; Mattia, Consalvo

2016-08-01

Granisetron transdermal delivery system (GTDS) is the first 5-HT3 drug to be transdermally delivered and represents a convenient alternative to oral and intravenous antiemetics for the treatment of chemotherapy-induced nausea and vomiting. GTDS is effective and well tolerated in patients receiving multiple-day moderate-to-highly emetogenic chemotherapy. In this setting noninferiority studies showed similar efficacy when GTDS was compared with intravenous and oral granisetron and intravenous palonosetron. GTDS has shown good cardiovascular safety; however, special caution is needed in patients at risk for developing excessive QTc interval prolongation and arrhythmias. So far, GTDS has been investigated for intravenous prevention in comparison with granisetron and palonosetron; however, further prospects open the route to future clinical investigations.

Lenalidomide and Cytarabine in Treating Patients With Relapsed or Refractory Acute Myeloid Leukemia

ClinicalTrials.gov

2018-06-18

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Recurrent Adult Acute Myeloid Leukemia

Bendamustine and Idarubicin in Treating Older Patients With Previously Untreated AML or MDS

ClinicalTrials.gov

2017-07-20

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); de Novo Myelodysplastic Syndromes; Myelodysplastic Syndrome With Isolated Del(5q); Untreated Adult Acute Myeloid Leukemia

Association of the mu-opioid receptor gene with type 2 diabetes mellitus in an African American population.

PubMed

Gallagher, Carla J; Gordon, Candace J; Langefeld, Carl D; Mychaleckyj, Josyf C; Freedman, Barry I; Rich, Stephen S; Bowden, Donald W; Sale, Michèle M

2006-01-01

African Americans (AA) are at increased risk for developing type 2 diabetes mellitus (T2DM) relative to European Americans. We previously detected linkage of T2DM to 6q24-q27 (LOD 2.26) at 163.5 cM, closest to marker D6S1035, in a genome-wide scan of AA families. The mu-opioid receptor gene (OPRM1) is located within the LOD-1 support interval of this linkage peak. OPRM1 is an attractive positional candidate gene for T2DM susceptibility since agonists of OPRM1 affect glucose-induced insulin release and OPRM1 knockout mice have a more rapid induction of insulin resistance than wild-type. Twenty-two SNPs in this gene, at an average spacing of 3.9 kb, were genotyped in 380 AA T2DM cases and 276 AA controls. In single SNP association analyses, rs648007 demonstrated significant evidence of association with T2DM (P=0.013). Four blocks of high linkage disequilibrium were detected across the OPRM1 gene. Association analyses of haplotypes in each of these blocks revealed two haplotype blocks with significant overall P values (P=0.007 and 0.046). Significant, but rare, risk and protective haplotypes were identified as driving these associations with T2DM (P=0.034-0.047). These associations suggest that the OPRM1 gene plays a role in T2DM susceptibility in African Americans.

Possible interethnic differences in quinidine-induced QT prolongation between healthy Caucasian and Korean subjects

PubMed Central

Shin, Jae-Gook; Kang, Won-ku; Shon, Ji-Hong; Arefayene, Million; Yoon, Young-Ran; Kim, Kyung-Ah; Kim, Doo-Il; Kim, Dong-Soo; Cho, Kwang-Hyun; Woosley, Raymond L; Flockhart, David A

2007-01-01

Aims The aim of this study was to evaluate the pharmacokinetics and pharmacodynamics of quinidine-induced QT prolongation in healthy Caucasian and Korean subjects to investigate interethnic differences in susceptibility to drug-induced arrhythmia. Methods A randomized, double-blind crossover study was conducted in 24 (12 male and 12 female) Korean and 13 (seven male and six female) Caucasian subjects. After a 20 min infusion of quinidine (4 mg kg−1) or saline, the serum concentration of quinidine and the QT interval corrected by Bazett's formula (QTc) were monitored. The dynamic data were analyzed by means of a population modelling approach using NONMEM. Results There were no statistical differences in the pharmacokinetic profiles of quinidine between ethnic groups. The QTc values in Caucasians were higher than those in Koreans at the same quinidine concentrations, especially at higher quinidine concentrations and in female subjects. According to an Emax model , the population modelling approach revealed that E0 (ms) was related to gender (408 + [34*(1 − Sex)]; 1 for male and 0 for female), ΔEmax (ms) was related to ethnicity ((136*fETHN) + Cfemale: fETHN = 1 for Koreans and 1.26 for Caucasians; Cfemale was 106 only for Caucasian females), and EC50 was estimated to be 3.13 µm. Conclusions These results suggest that Korean subjects were less sensitive to quinidine-induced QT prolongation than Caucasian subjects, and that this trend was particularly true for females. Further population-based studies are merited to characterize more completely the ethnic differences in drug-induced QT prolongation between Asians and other ethnic groups. PMID:17096683

Clinical Risk Factors for In-Hospital Adverse Cardiovascular Events After Acute Drug Overdose

PubMed Central

Manini, Alex F.; Hoffman, Robert S.; Stimmel, Barry; Vlahov, David

2015-01-01

Objectives It was recently demonstrated that adverse cardiovascular events (ACVE) complicate a high proportion of hospitalizations for patients with acute drug overdoses. The aim of this study was to derive independent clinical risk factors for ACVE in patients with acute drug overdoses. Methods This prospective cohort study was conducted over 3 years at two urban university hospitals. Patients were adults with acute drug overdoses enrolled from the ED. In-hospital ACVE was defined as any of myocardial injury, shock, ventricular dysrhythmia, or cardiac arrest. Results There were 1,562 patients meeting inclusion/exclusion criteria (mean age, 41.8 years; female, 46%; suicidal, 38%). ACVE occurred in 82 (5.7%) patients (myocardial injury, 61; shock, 37; dysrhythmia, 23; cardiac arrests, 22) and there were 18 (1.2%) deaths. On univariate analysis, ACVE risk increased with age, lower serum bicarbonate, prolonged QTc interval, prior cardiac disease, and altered mental status. In a multivariable model adjusting for these factors as well as patient sex and hospital site, independent predictors were: QTc > 500 msec (3.8% prevalence, odds ratio [OR] 27.6), bicarbonate < 20 mEql/L (5.4% prevalence, OR 4.4), and prior cardiac disease (7.1% prevalence, OR 9.5). The derived prediction rule had 51.6% sensitivity, 93.7% specificity, and 97.1% negative predictive value; while presence of two or more risk factors had 90.9% positive predictive value. Conclusions The authors derived independent clinical risk factors for ACVE in patients with acute drug overdose, which should be validated in future studies as a prediction rule in distinct patient populations and clinical settings. PMID:25903997

QT interval prolongation associated with sibutramine treatment

PubMed Central

Harrison-Woolrych, Mira; Clark, David W J; Hill, Geraldine R; Rees, Mark I; Skinner, Jonathan R

2006-01-01

Aims To investigate a possible association of sibutramine with QT interval prolongation. Methods Post-marketing surveillance using prescription event monitoring in the New Zealand Intensive Medicines Monitoring Programme (IMMP) identified a case of QT prolongation and associated cardiac arrest in a patient taking sibutramine for 25 days. This patient was further investigated, including genotyping for long QT syndrome. Other IMMP case reports suggesting arrhythmias associated with sibutramine were assessed and further reports were obtained from the World Health Organisation (WHO) adverse drug reactions database. Results The index case displayed a novel mutation in a cardiac potassium channel subunit gene, KCNQ1, which is likely to prolong cardiac membrane depolarization and increase susceptibility to long QT intervals. Assessment of further IMMP reports identified five additional patients who experienced palpitations associated with syncope or presyncopal symptoms, one of whom had a QTc at the upper limit of normal. Assessment of reports from the WHO database identified three reports of QT prolongation and one fatal case of torsade de pointes in a patient also taking cisapride. Conclusions This case series suggests that sibutramine may be associated with QT prolongation and related dysrhythmias. Further studies are required, but in the meantime we would recommend that sibutramine should be avoided in patients with long QT syndrome and in patients taking other medicines that may prolong the QT interval. PMID:16542208

Selinexor and Chemotherapy in Treating Patients With Relapsed or Refractory Acute Myeloid Leukemia

ClinicalTrials.gov

2018-04-02

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Recurrent Adult Acute Myeloid Leukemia; Secondary Acute Myeloid Leukemia

Decitabine in Treating Patients With Previously Untreated Acute Myeloid Leukemia

ClinicalTrials.gov

2016-05-18

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Secondary Acute Myeloid Leukemia; Untreated Adult Acute Myeloid Leukemia

CPI-613, Cytarabine, and Mitoxantrone Hydrochloride in Treating Patients With Relapsed or Refractory Acute Myeloid Leukemia

ClinicalTrials.gov

2017-07-31

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Recurrent Adult Acute Myeloid Leukemia

Studies in the Use of Color for Image Indexing and Retrieval in Specialized Databases

DTIC Science & Technology

2001-09-01

mA| x ��T�{� qR�&o x­o z{qÍ�h �[� » Ï ª h�u T=� q S ¸ T=V mAq®Ë{� Ë U ��¸[z{q¦Í�h �[� »çÏ ª hyu T=� q�tA|��{|Kq��Âorx � sKx6�#� X q T�X xmvx=sz{tAq

AR-42 and Decitabine in Treating Patients With Acute Myeloid Leukemia

ClinicalTrials.gov

2018-03-12

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Recurrent Adult Acute Myeloid Leukemia; Recurrent Childhood Acute Myeloid Leukemia; Secondary Acute Myeloid Leukemia; Untreated Adult Acute Myeloid Leukemia

Dasatinib, Cytarabine, and Idarubicin in Treating Patients With High-Risk Acute Myeloid Leukemia

ClinicalTrials.gov

2018-05-04

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Recurrent Adult Acute Myeloid Leukemia; Secondary Acute Myeloid Leukemia; Untreated Adult Acute Myeloid Leukemia

Vectorcardiographic results from Skylab medical experiment M092: Lower body negative pressure

NASA Technical Reports Server (NTRS)

Hoffler, G. W.; Johnson, R. L.; Nicogossian, A. E.; Bergman, S. A., Jr.; Jackson, M. M.

1974-01-01

Vectorcardiograms were recorded via a modified Frank lead system from all crewmen of the three Skylab missions in conjuction with the Lower Body Negative Pressure - M092 Experiment. Data were analyzed by a specially developed computer program (VECTAN). Design of the test sequences allowed direct comparisons of supine resting, Earth based (reference) vectorcardiograms with those taken during lower body negative pressure stress and those obtained at rest in orbit, as well as combinations of these conditions. Results revealed several statistically significant space flight related changes; namely, increased testing and lower body negative pressure stressed heart rates, modestly increased PR interval and corrected QTC interval, and greatly increased P and QPS loop maximal amplitudes. In addition, orientation changes in the QRS maximum vector and the J-vector at rest in space seem quite consistent among crewmen and different from those caused by the application of lower body negative pressure. No clinical abnormalities were observed. Etiology of these findings is conjectured to be, at least in part, related to fluid mass shifts occurring in weightlessness and attendant alterations in cardiovascular dynamics and myocardial autonomic control mechanisms.

Decitabine and Bortezomib in Treating Patients With Acute Myeloid Leukemia

ClinicalTrials.gov

2014-11-06

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Recurrent Adult Acute Myeloid Leukemia; Secondary Acute Myeloid Leukemia; Untreated Adult Acute Myeloid Leukemia

Sorafenib Tosylate and Chemotherapy in Treating Older Patients With Acute Myeloid Leukemia

ClinicalTrials.gov

2018-06-01

Acute Myeloid Leukemia; Acute Myeloid Leukemia (Megakaryoblastic) With t(1;22)(p13.3;q13.3); RBM15-MKL1; Acute Myeloid Leukemia With a Variant RARA Translocation; Acute Myeloid Leukemia With Inv(3) (q21.3;q26.2) or t(3;3) (q21.3;q26.2); GATA2, MECOM; Acute Myeloid Leukemia With t(6;9) (p23;q34.1); DEK-NUP214; Acute Myeloid Leukemia With t(9;11)(p22.3;q23.3); MLLT3-KMT2A; Acute Myeloid Leukemia With Variant MLL Translocations; Untreated Adult Acute Myeloid Leukemia

Detection of t(3;5) and NPM1/MLF1 rearrangement in an elderly patient with acute myeloid leukemia: clinical and laboratory study with review of the literature.

PubMed

Lim, Gayoung; Choi, Jong Rak; Kim, Min Jin; Kim, So Young; Lee, Hee Joo; Suh, Jin-Tae; Yoon, Hwi-Joong; Lee, Juhie; Lee, Sanggyu; Lee, Woo-In; Park, Tae Sung

2010-06-01

We present a novel case of acute myeloid leukemia with an NPM1/MLF1 rearrangement in a 78-year-old Korean woman. The bone marrow chromosome study showed a complex karyotype: 46,XX,t(2;13) (q13;q32),der(3)t(3;5)(q25.1;q34),der(5)del(5)(?q31q34)t(3;5),inv(9)(p11q13)c,del(20)(q11.2)[13]/49,idem,+5,+8,+der(13)t(2;13)[7]. Multiplex gene rearrangement testing, cloning, and sequencing analyses revealed an NPM1/MLF1 fusion rearrangement between exon 6 of NPM1 (ENSG00000181163) and exon 2 of MLF1 (ENSG00000178053). Although t(3;5)(q25.1;q34) or the NPM1/MLF1 rearrangement has been reported mostly as a sole karyotypic abnormality in younger patients, it should also be considered in elderly patients with complex chromosomal abnormalities in acute myeloid leukemia or myelodysplastic syndrome. Copyright 2010 Elsevier Inc. All rights reserved.

Defective calcium inactivation causes long QT in obese insulin-resistant rat.

PubMed

Lin, Yen-Chang; Huang, Jianying; Kan, Hong; Castranova, Vincent; Frisbee, Jefferson C; Yu, Han-Gang

2012-02-15

The majority of diabetic patients who are overweight or obese die of heart disease. We suspect that the obesity-induced insulin resistance may lead to abnormal cardiac electrophysiology. We tested this hypothesis by studying an obese insulin-resistant rat model, the obese Zucker rat (OZR). Compared with the age-matched control, lean Zucker rat (LZR), OZR of 16-17 wk old exhibited an increase in QTc interval, action potential duration, and cell capacitance. Furthermore, the L-type calcium current (I(CaL)) in OZR exhibited defective inactivation and lost the complete inactivation back to the closed state, leading to increased Ca(2+) influx. The current density of I(CaL) was reduced in OZR, whereas the threshold activation and the current-voltage relationship of I(CaL) were not significantly altered. L-type Ba(2+) current (I(BaL)) in OZR also exhibited defective inactivation, and steady-state inactivation was not significantly altered. However, the current-voltage relationship and activation threshold of I(BaL) in OZR exhibited a depolarized shift compared with LZR. The total and membrane protein expression levels of Cav1.2 [pore-forming subunit of L-type calcium channels (LTCC)], but not the insulin receptors, were decreased in OZR. The insulin receptor was found to be associated with the Cav1.2, which was weakened in OZR. The total protein expression of calmodulin was reduced, but that of Cavβ2 subunit was not altered in OZR. Together, these results suggested that the 16- to 17-wk-old OZR has 1) developed cardiac hypertrophy, 2) exhibited altered electrophysiology manifested by the prolonged QTc interval, 3) increased duration of action potential in isolated ventricular myocytes, 4) defective inactivation of I(CaL) and I(BaL), 5) weakened the association of LTCC with the insulin receptor, and 6) decreased protein expression of Cav1.2 and calmodulin. These results also provided mechanistic insights into a remodeled cardiac electrophysiology under the condition of insulin resistance, enhancing our understanding of long QT associated with obese type 2 diabetic patients.

Histone Deacetylase Inhibitors Prolong Cardiac Repolarization through Transcriptional Mechanisms.

PubMed

Spence, Stan; Deurinck, Mark; Ju, Haisong; Traebert, Martin; McLean, LeeAnne; Marlowe, Jennifer; Emotte, Corinne; Tritto, Elaine; Tseng, Min; Shultz, Michael; Friedrichs, Gregory S

2016-09-01

Histone deacetylase (HDAC) inhibitors are an emerging class of anticancer agents that modify gene expression by altering the acetylation status of lysine residues of histone proteins, thereby inducing transcription, cell cycle arrest, differentiation, and cell death or apoptosis of cancer cells. In the clinical setting, treatment with HDAC inhibitors has been associated with delayed cardiac repolarization and in rare instances a lethal ventricular tachyarrhythmia known as torsades de pointes. The mechanism(s) of HDAC inhibitor-induced effects on cardiac repolarization is unknown. We demonstrate that administration of structurally diverse HDAC inhibitors to dogs causes delayed but persistent increases in the heart rate corrected QT interval (QTc), an in vivo measure of cardiac repolarization, at timepoints far removed from the Tmax for parent drug and metabolites. Transcriptional profiling of ventricular myocardium from dogs treated with various HDAC inhibitors demonstrated effects on genes involved in protein trafficking, scaffolding and insertion of various ion channels into the cell membrane as well as genes for specific ion channel subunits involved in cardiac repolarization. Extensive in vitro ion channel profiling of various structural classes of HDAC inhibitors (and their major metabolites) by binding and acute patch clamp assays failed to show any consistent correlations with direct ion channel blockade. Drug-induced rescue of an intracellular trafficking-deficient mutant potassium ion channel, hERG (G601S), and decreased maturation (glycosylation) of wild-type hERG expressed by CHO cells in vitro correlated with prolongation of QTc intervals observed in vivo The results suggest that HDAC inhibitor-induced prolongation of cardiac repolarization may be mediated in part by transcriptional changes of genes required for ion channel trafficking and localization to the sarcolemma. These data have broad implications for the development of these drug classes and suggest that the optimal time to assess potentially transcriptionally mediated physiologic effects will be delayed relative to an epigenetic drug's Tmax/Cmax. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Bottom-Up Evaluation of Twig Join Pattern Queries in XML Document Databases

NASA Astrophysics Data System (ADS)

Chen, Yangjun

Since the extensible markup language XML emerged as a new standard for information representation and exchange on the Internet, the problem of storing, indexing, and querying XML documents has been among the major issues of database research. In this paper, we study the twig pattern matching and discuss a new algorithm for processing ordered twig pattern queries. The time complexity of the algorithmis bounded by O(|D|·|Q| + |T|·leaf Q ) and its space overhead is by O(leaf T ·leaf Q ), where T stands for a document tree, Q for a twig pattern and D is a largest data stream associated with a node q of Q, which contains the database nodes that match the node predicate at q. leaf T (leaf Q ) represents the number of the leaf nodes of T (resp. Q). In addition, the algorithm can be adapted to an indexing environment with XB-trees being used.

New optimal asymmetric quantum codes constructed from constacyclic codes

NASA Astrophysics Data System (ADS)

Xu, Gen; Li, Ruihu; Guo, Luobin; Lü, Liangdong

2017-02-01

In this paper, we propose the construction of asymmetric quantum codes from two families of constacyclic codes over finite field 𝔽q2 of code length n, where for the first family, q is an odd prime power with the form 4t + 1 (t ≥ 1 is integer) or 4t - 1 (t ≥ 2 is integer) and n1 = q2+1 2; for the second family, q is an odd prime power with the form 10t + 3 or 10t + 7 (t ≥ 0 is integer) and n2 = q2+1 5. As a result, families of new asymmetric quantum codes [[n,k,dz/dx

Clofarabine, Cytarabine, and G-CSF in Treating Patients With Relapsed or Refractory Acute Myeloid Leukemia

ClinicalTrials.gov

2018-02-08

Acute Myeloid Leukemia; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Adult Acute Promyelocytic Leukemia (M3); Recurrent Adult Acute Myeloid Leukemia

An alternative explanation of the change in T-dependence of the effective Debye-Waller factor at T{sub c} or T{sub B}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ngai, K. L.; CNR-IPCF, Largo Bruno Pontecorvo 3, I-56127 Pisa; Habasaki, J.

The cusp-like temperature dependence of the Debye-Waller factor or non-ergodicity parameter f{sub Q}(T) at some temperature T{sub c} above T{sub g} found by experiments in several fragile glassformers has been considered as critical evidence for validity of the ideal Mode Coupling Theory (MCT). A comprehensive review of experimental data of f{sub Q}(T) and beyond brings out various problems of the MCT predictions. For example, the molten salt, 0.4Ca(NO{sub 3}){sub 2}-0.6KNO{sub 3} (CKN), was the first glassformer measured by neutron scattering to verify the cusp-like behavior of f{sub Q}(T) at T{sub c} predicted by ideal MCT. While the fits of themore » other scaling laws of MCT to viscosity, light scattering, and dielectric relaxation data all give T{sub c} in the range from 368 to 375 K, there is no evidence of cusp-like behavior of f{sub Q}(T) at T{sub c} from more accurate neutron scattering data obtained later on by Mezei and Russina [J. Phys.: Condens. Matter 11, A341 (1999)] at temperatures below 400 K. In several molecular glass-formers, experiments have found at temperatures below T{sub c} that [1−f{sub Q}(T)] is manifested as nearly constant loss (NCL) in the frequency dependent susceptibility. The NCL persists down to below T{sub g} and is not predicted by the ideal MCT. No clear evidence of the change of T-dependence of f{sub Q}(T) at any T{sub c} was found in intermediate and strong glassformers, although ideal MCT does not distinguish fragile and strong glassformers in predicting the critical behavior of f{sub Q}(T) a priori. Experiments found f{sub Q}(T) changes T-dependence not only at T{sub c} but also at the glass transition temperature T{sub g}. The changes of T-dependence of f{sub Q}(T) at T{sub c} and T{sub g} are accompanied by corresponding changes of dynamic variables and thermodynamic quantities at T{sub B} ≈ T{sub c} and at T{sub g}. The dynamic variables include the relaxation time τ{sub α}(T), the non-exponentiality parameter n(T), and the generalized fragility m(T) of the structural α-relaxation. The thermodynamic quantities are the free volume deduced from positron annihilation spectroscopy, and the configurational entropy obtained from adiabatic calorimetry measurements. These changes of dynamic variables and thermodynamic quantities in temperature dependence at T{sub B} ≈ T{sub c} occur concurrently with the change of f{sub Q}(T) and suggest the effects are related, and have to be explained altogether. Since this task cannot be carried out by the ideal MCT, we have provided a different interpretation of f{sub Q}(T) and an alternative explanation of the change in its T-dependence of f{sub Q}(T) at T{sub B} ≈ T{sub c} as well as the other dynamic variables. We show f{sub Q}(T) originates from the dissipation of the molecules while caged by the anharmonic intermolecular potential, and manifested as the NCL at lower temperatures. The cusp-like change of T-dependence of f{sub Q}(T) at T{sub c} originates from the corresponding change of free volume and configurational entropy at T{sub B} ≈ T{sub c}, which also explains the simultaneous changes of the T-dependencies of the other dynamic variables. The alternative explanation is able to resolve the conundrum in CKN because T{sub B} is ≥400 K, and hence the change of T-dependence of f{sub Q}(T) at T{sub c} ≈ T{sub B} was not observed in data taken at temperatures lower than 400 K by Mezei and Russina. The alternative explanation also can rationalize the difference between fragile and non-fragile glassformers in the strength of the observed changes of f{sub Q}(T) at T{sub c} and T{sub g} as well as the other dynamic quantities at T{sub B} ≈ T{sub c} and T{sub g}.« less

Beyond the Length and Look of Repolarization: Defining the Non-QTc Electrocardiographic Profiles of Patients with Congenital Long QT Syndrome.

PubMed

Lane, Conor M; Bos, J Martijn; Rohatgi, Ram K; Ackerman, Michael J

2018-04-30

Little is known about the spectrum and prevalence of ECG features beyond the length and morphology of repolarization in patients with congenital long QT syndrome (LQTS). To characterize the full ECG phenotype of LQTS patients and evaluate differences by age and LQTS genotype. Retrospective review of 943 patients with LQTS (57% female, median age 25 years; IQR 9 - 34 years) was performed. Comprehensive analysis of their initial evaluation ECG was performed using definitions outlined in Heart Rhythm Society guidelines. Bradycardia was common (n=320; 34%), regardless of beta-blocker use. Left axis deviation (n=33, 3.5%) and bundle branch block (n=5, 0.5%) were uncommon. T-wave inversion (TWI) involving leads V1 and V3 was more common in LQT2 compared to LQT1 or LQT3 [OR for V1: 2.67 (95% CI 1.8 - 3.9) and OR for V3: 1.76 (95% CI 1.2 - 2.6)], while TWI in lead III and aVF was most common in LQT3 [OR for III: 2.38 (95% CI 1.4 - 4.2) and OR for aVF: 3.14 (95% CI 1.6 - 6.4)]. Notched T-waves were most apparent at younger ages (48% in patients between ages 4-10 compared to 12% in over 40s, p <0.0001). Beyond the QT interval and bradycardia, ECG abnormalities are uncommon in LQTS patients and patients almost never have concomitant bundle branch block. Notably, 19% of LQTS patients overall and 27% of LQT2 patients exhibit anterior TWI that would satisfy a diagnostic criterion for arrhythmogenic right ventricular cardiomyopathy creating the potential for diagnostic miscues. Copyright © 2018. Published by Elsevier Inc.

Advanced Electrocardiographic Predictors of Sudden Death in Familial Dysautonomia

NASA Technical Reports Server (NTRS)

Solaimanzadeh, I.; Schlegel, T. T.; Greco, E. C.; DePalma, J. L.; Starc, V.; Marthol, H.; Tutaj, M.; Buechner, S.; Axelrod, F. B.; Hilz, M. J.

2007-01-01

To identify accurate predictors for the risk of sudden death in patients with familial dysautonomia (FD). Ten-minute resting high-fidelity 12-lead ECGs were obtained from 14 FD patients and 14 age/gender-matched healthy subjects. Multiple conventional and advanced ECG parameters were studied for their ability to predict sudden death in FD over a subsequent 4.5-year period, including multiple indices of linear and non-linear heart rate variability (HRV); QT variability; waveform complexity; high frequency QRS; and derived Frank-lead parameters. Four of the 14 FD patients died suddenly during the follow-up period, usually with concomitant pulmonary disorder. The presence of low vagally-mediated HRV was the ECG finding most predictive of sudden death. Concomitant left ventricular hypertrophy and other ECG abnormalities such as increased QTc and JTc intervals, spatial QRS-T angles, T-wave complexity, and QT variability were also present in FD patients, suggesting that structural heart disease is fairly common in FD. Although excessive or unopposed cardiac vagal (relative to sympathetic) activity has been postulated as a contributor to sudden death in FD, the presence of low vagally-mediated HRV was paradoxically the best predictor of sudden death. However, we suggest that low vagally-mediated HRV be construed not as a direct cause of sudden death in FD, but rather as an effect of concurrent pathological processes, especially hypoxia due to pulmonary disorders and sleep apnea, that themselves increase the risk of sudden death in FD and simultaneously diminish HRV. We speculate that adenosine may play a role in sudden death in FD, possibly independently of vagal activity, and that adenosine inhibitors such as theophylline might therefore be useful as prophylaxis in this disorder.

Sirolimus and Azacitidine in Treating Patients With High Risk Myelodysplastic Syndrome or Acute Myeloid Leukemia That is Recurrent or Not Eligible for Intensive Chemotherapy

ClinicalTrials.gov

2018-06-18

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); de Novo Myelodysplastic Syndromes; Myelodysplastic Syndrome With Isolated Del(5q); Previously Treated Myelodysplastic Syndromes; Recurrent Adult Acute Myeloid Leukemia

Symptom-Adapted Physical Activity Intervention in Minimizing Physical Function Decline in Older Patients With Acute Myeloid Leukemia Undergoing Chemotherapy

ClinicalTrials.gov

2018-05-24

Adult Acute Myeloid Leukemia in Remission; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Recurrent Adult Acute Myeloid Leukemia; Untreated Adult Acute Myeloid Leukemia

Bioelectrical Impedance Measurement for Predicting Treatment Outcome in Patients With Newly Diagnosed Acute Leukemia

ClinicalTrials.gov

2018-04-26

Acute Undifferentiated Leukemia; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Mast Cell Leukemia; Myeloid/NK-cell Acute Leukemia; Untreated Adult Acute Lymphoblastic Leukemia; Untreated Adult Acute Myeloid Leukemia

Phase I Combination of Midostaurin, Bortezomib, and Chemo in Relapsed/Refractory Acute Myeloid Leukemia

ClinicalTrials.gov

2016-07-04

Acute Myeloid Leukemia; Acute Myeloid Leukemia With Multilineage Dysplasia Following; Myelodysplastic Syndrome; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Recurrent Adult Acute Myeloid Leukemia; Secondary Acute Myeloid Leukemia

[The influence of occupational lead exposure on transmural repolarization dispersion].

PubMed

Zyśko, Dorota; Gajek, Jacek; Chlebda, Ewa; Mazurek, Walentyna

2005-02-01

The parts of QT interval: time from Q wave to the peak of T wave (QTp) representing the de- and repolarization of subepicardial layer and the time from the peak of T wave to its end (QTp-e) building the transmural dispersion of repolarization enable more exact assessment of repolarization period of the heart muscle. Occupational exposure to lead influences the electrophysiologic properties of the heart. The aim of our study was to assess the QTp and QTp-e interval in workers occupationally exposed to lead. The study was carried out in 22 copper smelters aged 41.8 +/- 8.7 years, occupationally exposed to lead. The control group consisted of 14 healthy men. In all studied subjects blood lead concentration (Pb) and the concentration of free protoporphyrins in erytrocytes were assessed. 24-hour ECG holter monitoring was done to study rhythm disturbances and the duration in lead CM5 of QT interval, QTp interval, RR interval preceding the assessed QT interval (pRR) during sleep, rest during the awake state and moderate daily activity. The QTp-e interval is the difference between the duration of QT and QTp interval. The duration of QTp and QTp-e in occupationally exposed workers and healthy persons did not differ significantly. These parameters were significantly lower in both groups during moderately physical activity comparing to the values during sleep. The QTp-e/ QTp ratio in occupationally exposed workers during night hours was significantly lower than during daily activity what was not the case in control persons. Occupational exposure to lead do not change significantly the transmural dispersion of repolarization. Occupational exposure to lead diminishes the QTp-e/QTp ratio during the night.

Patients With Long-QT Syndrome Caused by Impaired hERG-Encoded Kv11.1 Potassium Channel Have Exaggerated Endocrine Pancreatic and Incretin Function Associated With Reactive Hypoglycemia

PubMed Central

Hyltén-Cavallius, Louise; Iepsen, Eva W.; Wewer Albrechtsen, Nicolai J.; Svendstrup, Mathilde; Lubberding, Anniek F.; Hartmann, Bolette; Jespersen, Thomas; Linneberg, Allan; Christiansen, Michael; Vestergaard, Henrik; Pedersen, Oluf; Holst, Jens J.; Kanters, Jørgen K.

2017-01-01

Background: Loss-of-function mutations in hERG (encoding the Kv11.1 voltage-gated potassium channel) cause long-QT syndrome type 2 (LQT2) because of prolonged cardiac repolarization. However, Kv11.1 is also present in pancreatic α and β cells and intestinal L and K cells, secreting glucagon, insulin, and the incretins glucagon-like peptide-1 (GLP-1) and GIP (glucose-dependent insulinotropic polypeptide), respectively. These hormones are crucial for glucose regulation, and long-QT syndrome may cause disturbed glucose regulation. We measured secretion of these hormones and cardiac repolarization in response to glucose ingestion in LQT2 patients with functional mutations in hERG and matched healthy participants, testing the hypothesis that LQT2 patients have increased incretin and β-cell function and decreased α-cell function, and thus lower glucose levels. Methods: Eleven patients with LQT2 and 22 sex-, age-, and body mass index–matched control participants underwent a 6-hour 75-g oral glucose tolerance test with ECG recording and blood sampling for measurements of glucose, insulin, C-peptide, glucagon, GLP-1, and GIP. Results: In comparison with matched control participants, LQT2 patients had 56% to 78% increased serum insulin, serum C-peptide, plasma GLP-1, and plasma GIP responses (P=0.03–0.001) and decreased plasma glucose levels after glucose ingestion (P=0.02) with more symptoms of hypoglycemia (P=0.04). Sixty-three percent of LQT2 patients developed hypoglycemic plasma glucose levels (<70 mg/dL) versus 36% control participants (P=0.16), and 18% patients developed serious hypoglycemia (<50 mg/dL) versus none of the controls. LQT2 patients had defective glucagon responses to low glucose, P=0.008. β-Cell function (Insulin Secretion Sensitivity Index-2) was 2-fold higher in LQT2 patients than in controls (4398 [95% confidence interval, 2259–8562] versus 2156 [1961–3201], P=0.03). Pharmacological Kv11.1 blockade (dofetilide) in rats had similar effect, and small interfering RNA inhibition of hERG in β and L cells increased insulin and GLP-1 secretion up to 50%. Glucose ingestion caused cardiac repolarization disturbances with increased QTc intervals in both patients and controls, but with a 122% greater increase in QTcF interval in LQT2 patients (P=0.004). Conclusions: Besides a prolonged cardiac repolarization phase, LQT2 patients display increased GLP-1, GIP, and insulin secretion and defective glucagon secretion, causing decreased plasma glucose and thus increased risk of hypoglycemia. Furthermore, glucose ingestion increased QT interval and aggravated the cardiac repolarization disturbances in LQT2 patients. Clinical Trial Registration: URL: http://clinicaltrials.gov. Unique identifier: NCT02775513. PMID:28235848

A new method to compare statistical tree growth curves: the PL-GMANOVA model and its application with dendrochronological data.

PubMed

Ricker, Martin; Peña Ramírez, Víctor M; von Rosen, Dietrich

2014-01-01

Growth curves are monotonically increasing functions that measure repeatedly the same subjects over time. The classical growth curve model in the statistical literature is the Generalized Multivariate Analysis of Variance (GMANOVA) model. In order to model the tree trunk radius (r) over time (t) of trees on different sites, GMANOVA is combined here with the adapted PL regression model Q = A · T+E, where for b ≠ 0 : Q = Ei[-b · r]-Ei[-b · r1] and for b = 0 : Q  = Ln[r/r1], A =  initial relative growth to be estimated, T = t-t1, and E is an error term for each tree and time point. Furthermore, Ei[-b · r]  = ∫(Exp[-b · r]/r)dr, b = -1/TPR, with TPR being the turning point radius in a sigmoid curve, and r1 at t1 is an estimated calibrating time-radius point. Advantages of the approach are that growth rates can be compared among growth curves with different turning point radiuses and different starting points, hidden outliers are easily detectable, the method is statistically robust, and heteroscedasticity of the residuals among time points is allowed. The model was implemented with dendrochronological data of 235 Pinus montezumae trees on ten Mexican volcano sites to calculate comparison intervals for the estimated initial relative growth A. One site (at the Popocatépetl volcano) stood out, with A being 3.9 times the value of the site with the slowest-growing trees. Calculating variance components for the initial relative growth, 34% of the growth variation was found among sites, 31% among trees, and 35% over time. Without the Popocatépetl site, the numbers changed to 7%, 42%, and 51%. Further explanation of differences in growth would need to focus on factors that vary within sites and over time.

Application of the CC(P;Q) Hierarchy of Coupled-Cluster Methods to the Beryllium Dimer.

PubMed

Magoulas, Ilias; Bauman, Nicholas P; Shen, Jun; Piecuch, Piotr

2018-02-08

The performance of coupled-cluster approaches with higher-than-doubly excited clusters, including the CCSD(T), CCSD(2) T , CR-CC(2,3), CCSD(TQ), and CR-CC(2,4) corrections to CCSD, the active-space CCSDt, CCSDtq, and CCSDTq methods, and the CC(t;3), CC(t,q;3), CC(t,q;3,4), and CC(q;4) corrections to CCSDt, CCSDtq, and CCSDTq resulting from the CC(P;Q) formalism, in reproducing the CCSDT and CCSDTQ potential energy curves and vibrational term values characterizing Be 2 in its electronic ground state is assessed. The correlation-consistent aug-cc-pVnZ and aug-cc-pCVnZ (n = T and Q) basis sets are employed. Among the CCSD-based corrections, the completely renormalized CR-CC(2,3) and CR-CC(2,4) approaches perform the best. The CC(t;3), CC(t,q;3), CC(t,q;3,4), and CC(q;4) methods, especially CC(t;3) and CC(q;4), outperform other employed approaches in reproducing the CCSDT and CCSDTQ data. Composite schemes combining the all-electron CCSDT calculations extrapolated to the complete basis set limit with the frozen-core CC(q;4) and CCSDTQ computations using the aug-cc-pVTZ basis to account for connected quadruple excitations reproduce the latest experimental vibrational spectrum of Be 2 to within 4-5 cm -1 , when the vibrational spacings are examined, with typical errors being below 1-2 cm -1 . The resulting binding energies and equilibrium bond lengths agree with their experimentally derived counterparts to within ∼10 cm -1 and 0.01 Å.

Myeloid- and lymphoid-specific breakpoint cluster regions in chromosome band 13q14 in acute leukemia.

PubMed

Coignet, L J; Lima, C S; Min, T; Streubel, B; Swansbury, J; Telford, N; Swanton, S; Bowen, A; Nagai, M; Catovsky, D; Fonatsch, C; Dyer, M J

1999-07-01

Abnormalities of chromosome band 13q14 occur in hematologic malignancies of all lineages and at all stages of differentiation. Unlike other chromosomal translocations, which are usually specific for a given lineage, the chromosomal translocation t(12;13)(p12;q14) has been observed in both B-cell and T-cell precursor acute lymphoblastic leukemia (BCP-, TCP-ALL), in differentiated and undifferentiated acute myeloblastic leukemia (AML), and in chronic myeloid leukemia (CML) at progression to blast crisis. The nature of these translocations and their pathologic consequences remain unknown. To begin to define the gene(s) involved on chromosome 13, we have performed fluorescence in situ hybridization (FISH) using a panel of YACs from the region, on a series of 10 cases of acute leukemia with t(12;13)(p12;q14) and 1 case each with "variant" translocations including t(12;13)(q21;q14), t(10;13)(q24;q14) and t(9;13)(p21;q14). In 8/13 cases/cell lines, the 13q14 break fell within a single 1.4 Mb CEPH MegaYAC. This YAC fell immediately telomeric of the forkhead (FKHR) gene, which is disrupted in the t(2;13)(q35;q14) seen in pediatric alveolar rhabdomyosarcoma. Seven of the 8 cases with breaks in this YAC were AML. In 4/13 cases, the 13q14 break fell within a 1.7-Mb YAC located about 3 Mb telomeric of the retinoblastoma (RB1) gene: all 4 cases were ALL. One case of myelodysplastic syndrome exhibited a break within 13q12, adjacent to the BRCA2 gene. These data indicate the presence of myeloid- and lymphoid-specific breakpoint cluster regions within chromosome band 13q14 in acute leukemia.

[BCL-2 in primary central nervous system lymphomas. Immunohistochemistry and molecular biology].

PubMed

Buccoliero, A M; Castiglione, F; Caldarella, A; Rossi Degl'Innocenti, D; Taddei, A; Ammannati, F; Mennonna, P; Taddei, G L

2004-10-01

BCL-2 is a membrane protein known to be an apoptosis inhibitor. It is the product of the bcl-2 gene located on chromosome 18. Several different tumors show BCL-2 over-expression as result of a translocation or independently from it. More than 85% of follicular lymphomas and a smaller number of diffuse large cell B lymphomas contain t(14;18) (q32;q21). The aim of this study was to investigate the immunohistochemical expression of the BCL-2 protein and to ascertain, by means of traditional PCR (Polimerase Chain Reaction), its possible dependence from t(14;18) (q32;q21) in 9 primary central nervous system lymphomas. Six cases (67%) shoved immunohistochemical BCL-2 over-expression and 3 cases (33%) had t(14;18). Precisely: 2 cases (22%) had immunohistochemical BCL-2 over-expression and t(14;18) (q32;q21); 4 cases (44%) had BCL-2 over-expression without translocation; 1 case (11%) did not show diffuse BCL-2 over-expression in presence of the traslocation; the remaining 2 cases (22%) did not demonstrate BCL-2 over-expression or t(14;18) (q32;q21). In conclusion, our results indicate primary central nervous system lymphomas frequently show BCL-2 over-expression that in some case may be related to t(14;18) (q32;q21). Nevertheless, t(14;18) (q32;q21), as evaluated by traditional PCR, may not correspond to diffuse immunohistochemical BCL-2 positivity.

Gene fusions AHRR-NCOA2, NCOA2-ETV4, ETV4-AHRR, P4HA2-TBCK, and TBCK-P4HA2 resulting from the translocations t(5;8;17)(p15;q13;q21) and t(4;5)(q24;q31) in a soft tissue angiofibroma

PubMed Central

Panagopoulos, Ioannis; Gorunova, Ludmila; Viset, Trond; Heim, Sverre

2016-01-01

We present an angiofibroma of soft tissue with the karyotype 46,XY,t(4;5)(q24;q31),t(5;8;17)(p15;q13;q21) [8]/46,XY,t(1;14)(p31;q32)[2]/46,XY[3]. RNA-sequencing showed that the t(4;5)(q24;q31) resulted in recombination of the genes TBCK on 4q24 and P4HA2 on 5q31.1 with generation of an in-frame TBCK-P4HA2 and the reciprocal but out-of-frame P4HA2-TBCK fusion transcripts. The putative TBCK-P4HA2 protein would contain the kinase, the rhodanese-like domain, and the Tre-2/Bub2/Cdc16 (TBC) domains of TBCK together with the P4HA2 protein which is a component of the prolyl 4-hydroxylase. The t(5;8;17)(p15;q13;q21) three-way chromosomal translocation targeted AHRR (on 5p15), NCOA2 (on 8q13), and ETV4 (on 17q21) generating the in-frame fusions AHRR-NCOA2 and NCOA2-ETV4 as well as an out-of-frame ETV4-AHRR transcript. In the AHRR-NCOA2 protein, the C-terminal part of AHRR is replaced by the C-terminal part of NCOA2 which contains two activation domains. The NCOA2-ETV4 protein would contain the helix-loop-helix, PAS_9 and PAS_11, CITED domains, the SRC-1 domain of NCOA2 and the ETS DNA-binding domain of ETV4. No fusion gene corresponding to t(1;14)(p31;q32) was found. Our findings indicate that, in spite of the recurrence of AHRR-NCOA2 in angiofibroma of soft tissue, additional genetic events (or fusion genes) might be required for the development of this tumor. PMID:27633981

Gene fusions AHRR-NCOA2, NCOA2-ETV4, ETV4-AHRR, P4HA2-TBCK, and TBCK-P4HA2 resulting from the translocations t(5;8;17)(p15;q13;q21) and t(4;5)(q24;q31) in a soft tissue angiofibroma.

PubMed

Panagopoulos, Ioannis; Gorunova, Ludmila; Viset, Trond; Heim, Sverre

2016-11-01

We present an angiofibroma of soft tissue with the karyotype 46,XY,t(4;5)(q24;q31),t(5;8;17)(p15;q13;q21)[8]/46,XY,t(1;14)(p31;q32)[2]/46,XY[3]. RNA‑sequencing showed that the t(4;5)(q24;q31) resulted in recombination of the genes TBCK on 4q24 and P4HA2 on 5q31.1 with generation of an in‑frame TBCK‑P4HA2 and the reciprocal but out‑of‑frame P4HA2‑TBCK fusion transcripts. The putative TBCK‑P4HA2 protein would contain the kinase, the rhodanese‑like domain, and the Tre‑2/Bub2/Cdc16 (TBC) domains of TBCK together with the P4HA2 protein which is a component of the prolyl 4‑hydroxylase. The t(5;8;17)(p15;q13;q21) three‑way chromosomal translocation targeted AHRR (on 5p15), NCOA2 (on 8q13), and ETV4 (on 17q21) generating the in‑frame fusions AHRR‑NCOA2 and NCOA2‑ETV4 as well as an out‑of‑frame ETV4‑AHRR transcript. In the AHRR‑NCOA2 protein, the C‑terminal part of AHRR is replaced by the C‑terminal part of NCOA2 which contains two activation domains. The NCOA2‑ETV4 protein would contain the helix‑loop‑helix, PAS_9 and PAS_11, CITED domains, the SRC‑1 domain of NCOA2 and the ETS DNA‑binding domain of ETV4. No fusion gene corresponding to t(1;14)(p31;q32) was found. Our findings indicate that, in spite of the recurrence of AHRR‑NCOA2 in angiofibroma of soft tissue, additional genetic events (or fusion genes) might be required for the development of this tumor.

The Mechanism of High Ductility for Novel High-Carbon Quenching-Partitioning-Tempering Martensitic Steel

NASA Astrophysics Data System (ADS)

Qin, Shengwei; Liu, Yu; Hao, Qingguo; Wang, Ying; Chen, Nailu; Zuo, Xunwei; Rong, Yonghua

2015-09-01

In this article, a novel quenching-partitioning-tempering (Q-P-T) process was applied to treat Fe-0.6C-1.5Mn-1.5Si-0.6Cr-0.05Nb hot-rolled high-carbon steel and the microstructures including retained austenite fraction and the average dislocation densities in both martensite and retained austenite were characterized by X-ray diffraction, scanning electron microscopy, and transmission electron microscopy, respectively. The Q-P-T steel exhibits high strength (1950 MPa) and elongation (12.4 pct). Comparing with the steel treated by traditional quenching and tempering (Q&T) process, the mechanism of high ductility for high-carbon Q-P-T steel is revealed as follows. Much more retained austenite existing in Q-P-T steel than in Q&T one remarkably enhances the ductility by the following two effects: the dislocation absorption by retained austenite effect and the transformation-induced plasticity effect. Besides, lower dislocation density in martensite matrix produced by Q-P-T process plays an important role in the improvement of ductility. However, some thin plates of twin-type martensite embedded in dislocation-type martensite matrix in high-carbon Q-P-T steel affect the further improvement of ductility.

Estimation of the EEG power spectrum using MRI T(2) relaxation time in traumatic brain injury.

PubMed

Thatcher, R W; Biver, C; Gomez, J F; North, D; Curtin, R; Walker, R A; Salazar, A

2001-09-01

To study the relationship between magnetic resonance imaging (MRI) T(2) relaxation time and the power spectrum of the electroencephalogram (EEG) in long-term follow up of traumatic brain injury. Nineteen channel quantitative electroencephalograms or qEEG, tests of cognitive function and quantitative MRI T(2) relaxation times (qMRI) were measured in 18 mild to severe closed head injured outpatients 2 months to 4.6 years after injury and 11 normal controls. MRI T(2) and the Laplacian of T(2) were then correlated with the power spectrum of the scalp electrical potentials and current source densities of the qEEG. qEEG and qMRI T(2) were related by a frequency tuning with maxima in the alpha (8-12Hz) and the lower EEG frequencies (0.5-5Hz), which varied as a function of spatial location. The Laplacian of T(2) acted like a spatial-temporal "lens" by increasing the spatial-temporal resolution of correlation between 3-dimensional T(2) and the ear referenced alert but resting spontaneous qEEG. The severity of traumatic brain injury can be modeled by a linear transfer function that relates the molecular qMRI to qEEG resonant frequencies.

Direct measurement of Lorentz transformation with Doppler effects

NASA Astrophysics Data System (ADS)

Chen, Shao-Guang

For space science and astronomy the fundamentality of one-way velocity of light (OWVL) is selfevident. The measurement of OWVL (distance/interval) and the clock synchronization with light-signal transfer make a logical circulation. This means that OWVL could not be directly measured but only come indirectly from astronomical method (Romer's Io eclipse and Bradley's sidereal aberration), furthermore, the light-year by definitional OWVL and the trigonometry distance with AU are also un-measurable. For to solve this problem two methods of clock synchronization were proposed: The direct method is that at one end of dual-speed transmissionline with single clock measure the arriving-time difference of longitudinal wave and transverse wave or ordinary light and extraordinary light, again to calculate the collective sending-time of two wave with Yang's /shear elastic-modulus ratio (E/k) or extraordinary/ordinary light refractive-index ratio (ne/no), which work as one earthquake-station with single clock measures first-shake time and the distance to epicenter; The indirect method is that the one-way wavelength l is measured by dual-counters Ca and Cb and computer's real-time operation of reading difference (Nb - Na) of two counters, the frequency f is also simultaneously measured, then l f is just OWVL. Therefore, with classical Newtonian mechanics and ether wave optics, OWVL can be measured in the Galileo coordinate system with an isotropic length unit (1889 international meter definition). Without any hypotheses special relativity can entirely establish on the metrical results. When a certain wavelength l is defined as length unit, foregoing measurement of one-way wavelength l will become as the measurement of rod's length. Let a rigidity-rod connecting Ca and Cb moves relative to lamp-house with velocity v, rod's length L = (Nb - Na) l will change follow v by known Doppler effect, i.e., L(q) =L0 (1+ (v/c) cos q), where L0 is the proper length when v= 0, v• r = v cos q, r is the unit vector from lamphouse point to counters. Or: L (0) L (pi) =L0 (1+(v/c)) L0 (1 - (v/c)) =L0 2 y2 =L2 Or: L ≡ [L(0)L(pi)]1/2 =L0 y , which y ≡ (1 - (v/c)2 )1/2 is just Fitzgerald-Lorentzian contraction-factor. Also, when a light-wave period p is defined as time unit, from Doppler's frequency-shift the count N with p of one period T of moving-clock is: T(q) = N(q) p = T0 /(1+(v/c) cos q) Or: T ≡ (T(0) T(pi))1/2 = T 0 /y , where T0 is the proper period when v = 0, which is just the moving-clock-slower effect. Let r from clock point to lamp-house ((v/c) symbol reverse), Doppler formula in the usual form is: f (q) = 1/T(q) = f0 (1 - (v/c) cos q). Therefore, Lorentz transformation is the square root average of positive and negative directions twice metrical results of Doppler's frequency-shift, which Doppler's once items ( positive and negative v/c ) are counteract only residual twice item (v/c)2 (relativity-factor). Then Lorentz transformation can be directly measured by Doppler's frequency-shift method. The half-life of moving mu-meson is statistical average of many particles, the usual explanation using relativity-factor y is correct. An airship moving simultaneously along contrary directions is impossible, which makes that the relativity-factor y and the twin-paradox are inexistent in the macroscopical movement. Thereby, in the navigations of airship or satellite only use the measurement of Doppler's frequency-shift but have no use for Lorentz transformation.

Evidence that breast cancer risk at the 2q35 locus is mediated through IGFBP5 regulation.

PubMed

Ghoussaini, Maya; Edwards, Stacey L; Michailidou, Kyriaki; Nord, Silje; Cowper-Sal Lari, Richard; Desai, Kinjal; Kar, Siddhartha; Hillman, Kristine M; Kaufmann, Susanne; Glubb, Dylan M; Beesley, Jonathan; Dennis, Joe; Bolla, Manjeet K; Wang, Qin; Dicks, Ed; Guo, Qi; Schmidt, Marjanka K; Shah, Mitul; Luben, Robert; Brown, Judith; Czene, Kamila; Darabi, Hatef; Eriksson, Mikael; Klevebring, Daniel; Bojesen, Stig E; Nordestgaard, Børge G; Nielsen, Sune F; Flyger, Henrik; Lambrechts, Diether; Thienpont, Bernard; Neven, Patrick; Wildiers, Hans; Broeks, Annegien; Van't Veer, Laura J; Th Rutgers, Emiel J; Couch, Fergus J; Olson, Janet E; Hallberg, Emily; Vachon, Celine; Chang-Claude, Jenny; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Peto, Julian; Dos-Santos-Silva, Isabel; Gibson, Lorna; Nevanlinna, Heli; Muranen, Taru A; Aittomäki, Kristiina; Blomqvist, Carl; Hall, Per; Li, Jingmei; Liu, Jianjun; Humphreys, Keith; Kang, Daehee; Choi, Ji-Yeob; Park, Sue K; Noh, Dong-Young; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Yatabe, Yasushi; Guénel, Pascal; Truong, Thérèse; Menegaux, Florence; Sanchez, Marie; Burwinkel, Barbara; Marme, Frederik; Schneeweiss, Andreas; Sohn, Christof; Wu, Anna H; Tseng, Chiu-Chen; Van Den Berg, David; Stram, Daniel O; Benitez, Javier; Zamora, M Pilar; Perez, Jose Ignacio Arias; Menéndez, Primitiva; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Qiuyin; Cox, Angela; Cross, Simon S; Reed, Malcolm W R; Andrulis, Irene L; Knight, Julia A; Glendon, Gord; Tchatchou, Sandrine; Sawyer, Elinor J; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Haiman, Christopher A; Henderson, Brian E; Schumacher, Fredrick; Le Marchand, Loic; Lindblom, Annika; Margolin, Sara; Teo, Soo Hwang; Yip, Cheng Har; Lee, Daphne S C; Wong, Tien Y; Hooning, Maartje J; Martens, John W M; Collée, J Margriet; van Deurzen, Carolien H M; Hopper, John L; Southey, Melissa C; Tsimiklis, Helen; Kapuscinski, Miroslav K; Shen, Chen-Yang; Wu, Pei-Ei; Yu, Jyh-Cherng; Chen, Shou-Tung; Alnæs, Grethe Grenaker; Borresen-Dale, Anne-Lise; Giles, Graham G; Milne, Roger L; McLean, Catriona; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Hartman, Mikael; Miao, Hui; Buhari, Shaik Ahmad Bin Syed; Teo, Yik Ying; Fasching, Peter A; Haeberle, Lothar; Ekici, Arif B; Beckmann, Matthias W; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Schoemaker, Minouk J; García-Closas, Montserrat; Figueroa, Jonine; Chanock, Stephen J; Lissowska, Jolanta; Simard, Jacques; Goldberg, Mark S; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Brauch, Hiltrud; Brüning, Thomas; Koto, Yon-Dschun; Radice, Paolo; Peterlongo, Paolo; Bonanni, Bernardo; Volorio, Sara; Dörk, Thilo; Bogdanova, Natalia V; Helbig, Sonja; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Devilee, Peter; Tollenaar, Robert A E M; Seynaeve, Caroline; Van Asperen, Christi J; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Slager, Susan; Toland, Amanda E; Ambrosone, Christine B; Yannoukakos, Drakoulis; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Hamann, Ute; Torres, Diana; Zheng, Wei; Long, Jirong; Anton-Culver, Hoda; Neuhausen, Susan L; Luccarini, Craig; Baynes, Caroline; Ahmed, Shahana; Maranian, Mel; Healey, Catherine S; González-Neira, Anna; Pita, Guillermo; Alonso, M Rosario; Alvarez, Nuria; Herrero, Daniel; Tessier, Daniel C; Vincent, Daniel; Bacot, Francois; de Santiago, Ines; Carroll, Jason; Caldas, Carlos; Brown, Melissa A; Lupien, Mathieu; Kristensen, Vessela N; Pharoah, Paul D P; Chenevix-Trench, Georgia; French, Juliet D; Easton, Douglas F; Dunning, Alison M

2014-09-23

GWAS have identified a breast cancer susceptibility locus on 2q35. Here we report the fine mapping of this locus using data from 101,943 subjects from 50 case-control studies. We genotype 276 SNPs using the 'iCOGS' genotyping array and impute genotypes for a further 1,284 using 1000 Genomes Project data. All but two, strongly correlated SNPs (rs4442975 G/T and rs6721996 G/A) are excluded as candidate causal variants at odds against >100:1. The best functional candidate, rs4442975, is associated with oestrogen receptor positive (ER+) disease with an odds ratio (OR) in Europeans of 0.85 (95% confidence interval=0.84-0.87; P=1.7 × 10(-43)) per t-allele. This SNP flanks a transcriptional enhancer that physically interacts with the promoter of IGFBP5 (encoding insulin-like growth factor-binding protein 5) and displays allele-specific gene expression, FOXA1 binding and chromatin looping. Evidence suggests that the g-allele confers increased breast cancer susceptibility through relative downregulation of IGFBP5, a gene with known roles in breast cell biology.

Association of late-onset Alzheimer disease with a genotype of PLAU, the gene encoding urokinase-type plasminogen activator on chromosome 10q22.2.

PubMed

Finckh, U; van Hadeln, K; Müller-Thomsen, T; Alberici, A; Binetti, G; Hock, C; Nitsch, R M; Stoppe, G; Reiss, J; Gal, A

2003-08-01

Urokinase-type plasminogen activator (uPA) converts plasminogen to plasmin. Plasmin is involved in processing of amyloid precursor protein and degrades secreted and aggregated amyloid-beta, a hallmark of Alzheimer disease (AD). PLAU, the gene encoding uPA, maps to chromosome 10q22.2 between two regions showing linkage to late-onset AD (LOAD). We genotyped a frequent C/T single nucleotide polymorphism in codon 141 of PLAU (P141L) in 347 patients with LOAD and 291 control subjects. LOAD was associated with homozygous C/C PLAU genotype in the whole sample (chi2=15.7, P=0.00039, df 2), as well as in all sub-samples stratified by gender or APOE epsilon4 carrier status (chi2> or = 6.84, P< or =0.033, df 2). Odds ratio for LOAD due to homozygosity C/C was 1.89 (95% confidence interval 1.37-2.61). PLAU is a promising new candidate gene for LOAD, with allele C (P141) being a recessive risk allele or allele T (L141) conferring protection.

Development of a Two-Dimensional/Axisymmetric Implicit Navier-Stokes Solver Using Flux-Difference Splitting Concepts and Fully General Geometry

DTIC Science & Technology

1985-09-01

Q+ + Q-)(A~tO~+ A~xei~+ A,fyfi~) + (R+ + R - ) (A~/tO ~ + A~/xein + AT/yfin ) - [A~x ev~ + A~ yfv ~ + a’lx ev~ q- A~y fv~] -t- O(A 2) 24 AEDC...8217 ~ - BAr Q+ + Q - A~t~ ~ + A/~xei~ (23) + A/~yfi~)+ ( R + + R-)(A~lt¢.~ + A~/xei.~ + A~yf.~)] + ~Ar(A~xev~ + A~ yfv ~ + A%ev, 1 + A~ yfv ~ + 0(A2

Prolonged QT Syndrome and Seizure Secondary to Alkaline Earth Metal Deficiency: A Case Report.

PubMed

McKinney, A; Keegan, B C

2011-01-01

Introduction. Alkaline earth metal deficiency is recognized as a cause of both seizure and long QT syndrome. Their deficiency can have significant repercussions on the function of cells, tissues, and organs of the body. An understanding of the role of electrolytes allows an appreciation of the significance of depleted levels on cell function. Case Report. A 65-year-old lady was admitted with symptoms of chest discomfort, vomiting, increased stoma output, and dizziness. Two days following admission she suffered a tonic-clonic seizure. ECG review demonstrated a prolonged QTc interval, raising the possibility of an underlying Torsades de Pointes as the precipitant. This was attributed to electrolyte disturbance arising as a result of multiple aetiologies. Discussion. This paper highlights the multisystem effects of electrolyte disturbance, with emphasis upon its role in precipitating cardiac arrhythmia and neurological symptoms.

Low-Dose Total-Body Irradiation and Fludarabine Phosphate Followed by Unrelated Donor Stem Cell Transplant in Treating Patients With Fanconi Anemia

ClinicalTrials.gov

2017-02-16

Adult Acute Myeloid Leukemia in Remission; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Childhood Acute Myeloid Leukemia in Remission; Childhood Myelodysplastic Syndromes; Fanconi Anemia; Previously Treated Myelodysplastic Syndromes

Clofarabine, Cytarabine, and Filgrastim in Treating Patients With Newly Diagnosed Acute Myeloid Leukemia, Advanced Myelodysplastic Syndrome, and/or Advanced Myeloproliferative Neoplasm

ClinicalTrials.gov

2017-09-18

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Chronic Myelomonocytic Leukemia; de Novo Myelodysplastic Syndromes; Refractory Anemia With Excess Blasts; Untreated Adult Acute Myeloid Leukemia; Myeloproliferative Neoplasm With 10% Blasts or Higher

Total Marrow and Lymphoid Irradiation and Chemotherapy Before Donor Stem Cell Transplant in Treating Patients With High-Risk Acute Lymphocytic or Myelogenous Leukemia

ClinicalTrials.gov

2018-03-15

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Recurrent Adult Acute Lymphoblastic Leukemia; Recurrent Adult Acute Myeloid Leukemia; Recurrent Childhood Acute Lymphoblastic Leukemia; Recurrent Childhood Acute Myeloid Leukemia

Flurbiprofen axetil increases arterial oxygen partial pressure by decreasing intrapulmonary shunt in patients undergoing one-lung ventilation.

PubMed

Chai, Xiao-Qing; Ma, Jun; Xie, Yan-Hu; Wang, Di; Chen, Kun-Zhou

2015-12-01

In the present study, we investigated whether flurbiprofen axetil (FA) alleviates hypoxemia during one-lung ventilation (OLV) by reducing the pulmonary shunt/total perfusion (Q s/Q t) ratio, and examined the relationship between the Q s/Q t ratio and the thromboxane B2 (TXB2)/6-keto-prostaglandin F1α (6-K-PGF1α) ratio. Sixty patients undergoing esophageal resection for carcinoma were randomly assigned to groups F and C (n = 30 for each group). FA and placebo were administered i.v. 15 min before skin incision in groups F and C, respectively. The partial pressure of arterial oxygen (PaO2) was measured and the Q s/Q t ratio was calculated. Serum TXB2, 6-K-PGF1α, and endothelin (ET) were measured by radioimmunoassay. The relationship between TXB2/6-K-PGF1α and Q s/Q t was investigated. Compared with group C, PaO2 was higher and the Q s/Q t ratio was lower during OLV in group F (P < 0.05). After treatment with FA, both serum TXB2 and 6-K-PGF1α decreased significantly (P < 0.05) but the TXB2/6-K-PGF1α ratio increased significantly (P < 0.01). Increases in the TXB2/6-K-PGF1α ratio were correlated with reductions in the Q s/Q t ratio during OLV in group F (r = -0.766, P < 0.01). There was no significant difference in serum ET between groups F and C. Treatment with FA reduced the Q s/Q t ratio and further increased the PaO2 level during OLV, possibly due to upregulation of the vasoactive agent TXB2/6-K-PGF1α ratio.

Levels of betatrophin decrease during pregnancy despite increased insulin resistance, beta-cell function and triglyceride levels.

PubMed

Zielińska, A; Maciulewski, R; Siewko, K; Popławska-Kita, A; Lipińska, D; Kozłowska, G; Górska, M; Szelachowska, M

2016-12-01

Evidence in support of an association between betatrophin and insulin resistance (IR) is mounting, with studies demonstrating that betatrophin is elevated in patients with type 2 diabetes, obesity and gestational diabetes. The aim of this study was to evaluate the role of betatrophin in IR and physiological proliferation of beta cells during pregnancy in healthy women. Eighty healthy pregnant women were examined at each trimester [T1 (first), T2 (second), T3 (third)], with a subgroup (n=45) that was also examined at 3 months postpartum (3MPP). The controls comprised 30 non-pregnant healthy women (HW) of reproductive age. Also measured were levels of betatrophin (ELISA), glucose (enzymatic method with hexokinase), insulin (IRMA), C-peptide (EASIA) and HbA 1c (HPLC), while HOMA-IR and HOMA-β scores were calculated. Betatrophin concentration was highest at T1, and differed significantly from T2 and T3 (1.84 [Q 1 =1.16, Q 3 =2.67]ng/mL vs 1.46 [Q 1 =0.96, Q 3 =2.21]ng/mL; P<0.05 and 1.23 [Q 1 =0.85, Q 3 =2.14]ng/mL; P<0.01, respectively). The T3 median concentration of betatrophin was the lowest of all trimesters, and significantly lower than at 3MPP (1.23 [Q 1 =0.85, Q 3 =2.14]ng/mL vs 1.49 [Q 1 =1.06, Q 3 =2.60]ng/mL; P<0.01, respectively). At 3MPP, the level of betatrophin was similar to that of HW (1.47 [Q 1 =0.89, Q 3 =2.67]ng/mL). HOMA-IR and HOMA-%β index scores increased during gestation, peaking at T3 (2.3 [Q 1 =1.66, Q 3 =2.72] and 227.7 [Q 1 =185.49, Q 3 =326.31], respectively) and returning to levels similar to those of HW at 3MPP (1.53 [Q 1 =1.12, Q 3 =2.41] and 88.86 [Q 1 =62.73, Q 3 =130.45] vs 1.35 [Q 1 =1.02, Q 3 =1.62] and 92.5 [Q 1 =74.20, Q 3 =111.47], respectively). Concentrations of betatrophin decrease during pregnancy, suggesting that the hormone does not play a significant role in the expansion of beta-cell mass and IR during pregnancy. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Cediranib Maleate in Treating Patients With Relapsed, Refractory, or Untreated Acute Myeloid Leukemia or High-Risk Myelodysplastic Syndrome

ClinicalTrials.gov

2016-12-28

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); de Novo Myelodysplastic Syndromes; Previously Treated Myelodysplastic Syndromes; Recurrent Adult Acute Myeloid Leukemia; Secondary Acute Myeloid Leukemia; Secondary Myelodysplastic Syndromes; Untreated Adult Acute Myeloid Leukemia

Azacitidine With or Without Entinostat in Treating Patients With Myelodysplastic Syndromes, Chronic Myelomonocytic Leukemia, or Acute Myeloid Leukemia

ClinicalTrials.gov

2016-12-08

Acute Myeloid Leukemia Arising From Previous Myelodysplastic Syndrome; Adult Acute Myeloid Leukemia in Remission; Adult Acute Myeloid Leukemia With Inv(16)(p13.1q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With t(16;16)(p13.1;q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); RUNX1-RUNX1T1; Adult Acute Myeloid Leukemia With t(9;11)(p22;q23); MLLT3-MLL; Adult Acute Promyelocytic Leukemia With t(15;17)(q22;q12); PML-RARA; Alkylating Agent-Related Acute Myeloid Leukemia; Chronic Myelomonocytic Leukemia; de Novo Myelodysplastic Syndrome; Previously Treated Myelodysplastic Syndrome; Recurrent Adult Acute Myeloid Leukemia; Secondary Acute Myeloid Leukemia; Secondary Myelodysplastic Syndrome; Untreated Adult Acute Myeloid Leukemia

High Frequency QRS ECG Accurately Detects Cardiomyopathy

NASA Technical Reports Server (NTRS)

Schlegel, Todd T.; Arenare, Brian; Poulin, Gregory; Moser, Daniel R.; Delgado, Reynolds

2005-01-01

High frequency (HF, 150-250 Hz) analysis over the entire QRS interval of the ECG is more sensitive than conventional ECG for detecting myocardial ischemia. However, the accuracy of HF QRS ECG for detecting cardiomyopathy is unknown. We obtained simultaneous resting conventional and HF QRS 12-lead ECGs in 66 patients with cardiomyopathy (EF = 23.2 plus or minus 6.l%, mean plus or minus SD) and in 66 age- and gender-matched healthy controls using PC-based ECG software recently developed at NASA. The single most accurate ECG parameter for detecting cardiomyopathy was an HF QRS morphological score that takes into consideration the total number and severity of reduced amplitude zones (RAZs) present plus the clustering of RAZs together in contiguous leads. This RAZ score had an area under the receiver operator curve (ROC) of 0.91, and was 88% sensitive, 82% specific and 85% accurate for identifying cardiomyopathy at optimum score cut-off of 140 points. Although conventional ECG parameters such as the QRS and QTc intervals were also significantly longer in patients than controls (P less than 0.001, BBBs excluded), these conventional parameters were less accurate (area under the ROC = 0.77 and 0.77, respectively) than HF QRS morphological parameters for identifying underlying cardiomyopathy. The total amplitude of the HF QRS complexes, as measured by summed root mean square voltages (RMSVs), also differed between patients and controls (33.8 plus or minus 11.5 vs. 41.5 plus or minus 13.6 mV, respectively, P less than 0.003), but this parameter was even less accurate in distinguishing the two groups (area under ROC = 0.67) than the HF QRS morphologic and conventional ECG parameters. Diagnostic accuracy was optimal (86%) when the RAZ score from the HF QRS ECG and the QTc interval from the conventional ECG were used simultaneously with cut-offs of greater than or equal to 40 points and greater than or equal to 445 ms, respectively. In conclusion 12-lead HF QRS ECG employing RAZ scoring is a simple, accurate and inexpensive screening technique for cardiomyopathy. Although HF QRS ECG is highly sensitive for cardiomyopathy, its specificity may be compromised in patients with cardiac pathologies other than cardiomyopathy, such as uncomplicated coronary artery disease or multiple coronary disease risk factors. Further studies are required to determine whether HF QRS might be useful for monitoring cardiomyopathy severity or the efficacy of therapy in a longitudinal fashion.

Quantitative calculations of fluorescence polarization and absorption anisotropy kinetics of double- and triple-chromophore complexes with energy transfer.

PubMed Central

Demidov, A A

1994-01-01

A new method is presented for calculation of the fluorescence depolarization and kinetics of absorption anisotropy for molecular complexes with a limited number of chromophores. The method considers absorption and emission of light by both chromophores, and also energy transfer between them, with regard to their mutual orientations. The chromophores in each individual complex are rigidly positioned. The complexes are randomly distributed and oriented in space, and there is no energy transfer between them. The new "practical" formula for absorption anisotropy and fluorescence depolarization kinetics, P(t) = [3B(t) - 1 + 2A(t)]/[3 + B(t) + 4A(t)], is derived both for double- and triple-chromophore complexes with delta-pulse excitation. The parameter B(t) is given by (a) B(t) = cos2(theta) for double-chromophore complexes, and (b) B(t) = q12(t)cos2(theta 12) + q13(t)-cos2(theta 13) + q23(t)cos2(theta 23) for triple-chromophore complexes, where q12(t) + q13(t) + q23(t) = 1. Here theta ij are the angles between the chromophore transition dipole moments in the individual molecular complex. The parameters qij(t) and A(t) are dependent on chromophore spectroscopic features and on the rates of energy transfer. PMID:7696461

A positivity result in the theory of Macdonald polynomials

PubMed Central

Garsia, A. M.; Haglund, J.

2001-01-01

We outline here a proof that a certain rational function Cn(q, t), which has come to be known as the “q, t-Catalan,” is in fact a polynomial with positive integer coefficients. This has been an open problem since 1994. Because Cn(q, t) evaluates to the Catalan number at t = q = 1, it has also been an open problem to find a pair of statistics a, b on the collection 𝒟n of Dyck paths Π of length 2n yielding Cn(q, t) = ∑π ta(Π)qb(Π). Our proof is based on a recursion for Cn(q, t) suggested by a pair of statistics recently proposed by J. Haglund. One of the byproducts of our results is a proof of the validity of Haglund's conjecture. PMID:11274351

Strategies to reduce the risk of drug-induced QT interval prolongation: a pharmaceutical company perspective.

PubMed

Pollard, C E; Valentin, J-P; Hammond, T G

2008-08-01

Drug-induced prolongation of the QT interval is having a significant impact on the ability of the pharmaceutical industry to develop new drugs. The development implications for a compound causing a significant effect in the 'Thorough QT/QTc Study' -- as defined in the clinical regulatory guidance (ICH E14) -- are substantial. In view of this, and the fact that QT interval prolongation is linked to direct inhibition of the hERG channel, in the early stages of drug discovery the focus is on testing for and screening out hERG activity. This has led to understanding of how to produce low potency hERG blockers whilst retaining desirable properties. Despite this, a number of factors mean that when an integrated risk assessment is generated towards the end of the discovery phase (by conducting at least an in vivo QT assessment) a QT interval prolongation risk is still often apparent; inhibition of hERG channel trafficking and partitioning into cardiac tissue are just two confounding factors. However, emerging information suggests that hERG safety margins have high predictive value and that when hERG and in vivo non-clinical data are combined, their predictive value to man, whilst not perfect, is >80%. Although understanding the anomalies is important and is being addressed, of greater importance is developing a better understanding of TdP, with the aim of being able to predict TdP rather than using an imperfect surrogate marker (QT interval prolongation). Without an understanding of how to predict TdP risk, high-benefit drugs for serious indications may never be marketed.

Use Correlation Coefficients in Gaussian Process to Train Stable ELM Models

DTIC Science & Technology

2015-05-22

confidence interval of prediction y′. There are two parameters that need to be determined in BELM: σ2N and α > 0. BELM effectively controls the over...similarly between h (u) and h (v) with vectorial angle cosine rather than distance between them. The increase of vector dimen- sion will not cause the... vectorial angle cosine approaches 0. Then, we can know that Q I with the increase of L. This reduces the chance of over-fitting. 414 Y. He et al. T a b

Caffeine delays autonomic recovery following acute exercise.

PubMed

Bunsawat, Kanokwan; White, Daniel W; Kappus, Rebecca M; Baynard, Tracy

2015-11-01

Impaired autonomic recovery of heart rate (HR) following exercise is associated with an increased risk of sudden death. Caffeine, a potent stimulator of catecholamine release, has been shown to augment blood pressure (BP) and sympathetic nerve activity; however, whether caffeine alters autonomic function after a bout of exercise bout remains unclear. In a randomized, crossover study, 18 healthy individuals (26 ± 1 years; 23.9 ± 0.8 kg·m(-2)) ingested caffeine (400 mg) or placebo pills, followed by a maximal treadmill test to exhaustion. Autonomic function and ventricular depolarization/repolarization were determined using heart rate variability (HRV) and corrected QT interval (QTc), respectively, at baseline, 5, 15, and 30 minutes post-exercise. Maximal HR (HRmax) was greater with caffeine (192 ± 2 vs. 190 ± 2 beat·min(-1), p < 0.05). During recovery, HR, mean arterial pressure (MAP), and diastolic blood pressure (DBP) remained elevated with caffeine (p < 0.05). Natural log transformation of low-to-high frequency ratio (LnLF/LnHF) of HRV was increased compared with baseline at all time points in both trials (p < 0.05), with less of an increase during 5 and 15 minutes post-exercise in the caffeine trial (p < 0.05). QTc increased from baseline at all time points in both trials, with greater increases in the caffeine trial (p < 0.05). Caffeine ingestion disrupts post-exercise autonomic recovery because of increased sympathetic nerve activity. The prolonged sympathetic recovery time could subsequently hinder baroreflex function during recovery and disrupt the stability of autonomic function, potentiating a pro-arrhythmogenic state in young adults. © The European Society of Cardiology 2014.

Cardiometabolic Risks of Blonanserin and Perospirone in the Management of Schizophrenia: A Systematic Review and Meta-Analysis of Randomized Controlled Trials

PubMed Central

Kishi, Taro; Matsuda, Yuki; Iwata, Nakao

2014-01-01

Background The present study aimed to evaluate cardiometabolic risks [weight gain, blood lipid levels (total cholesterol and triglycerides), blood glucose levels, hemoglobin A1c (HbA1c) levels, and corrected QT interval (QTc) prolongation] associated with the use of blonanserin and perospirone versus other antipsychotics in the management of patients with schizophrenia. Method We conducted a systematic review and meta-analysis of patient data from randomized controlled trials comparing blonanserin or perospirone with other antipsychotics. Results In total, 4 blonanserin studies (n  = 1080) were identified [vs. risperidone (2 studies, n = 508); vs. haloperidol (2 studies, n = 572)]. Blonanserin produced less weight gain compared with risperidone (weighted mean difference = −0.86, 95% confidence intervals = −1.36 to −0.36, p = 0.0008; 2 studies, 480 patients). However, no significant differences were observed in blood lipid, glucose, and HbA1c levels or QTc prolongation between blonanserin and risperidone or haloperidol. For perospirone studies, 5 studies [562 adult patients with schizophrenia randomized to perospirone (n = 256), olanzapine (n = 20), quetiapine (n = 28), risperidone (n = 53), aripiprazole (n = 49), haloperidol (n = 75), or mosapramine (n = 81)] were identified. Perospirone did not differ from other antipsychotics with regard to weight gain and total cholesterol levels. Conclusions Our results suggest that blonanserin is associated with a lower of weight gain compared with other antipsychotics. Because the number of studies was small, additional controlled clinical trials with larger number of patients are indicated. PMID:24505373

Fast Versus Slow Strategy of Switching Patients With Schizophrenia to Aripiprazole From Other Antipsychotics.

PubMed

Hwang, Tzung-Jeng; Lo, Wei-Ming; Chan, Hung-Yu; Lin, Ching-Feng; Hsieh, Ming H; Liu, Chen-Chun; Liu, Chih-Min; Hwu, Hai-Gwo; Kuo, Ching-Hua; Chen, Wei J

2015-12-01

This study aimed to compare strategies differing in the speed of switching schizophrenic patients to aripiprazole from other antipsychotic agents, with dual administration for 2 weeks and then tapering off the current antipsychotic in fast (within 1 week) versus slow (within 4 weeks) strategies. This 8-week, open-label, randomized, parallel study assigned patients with a primary Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, diagnosis of schizophrenia or schizoaffective disorder to either the fast-switching (n = 38) or slow-switching (n = 41) group. Efficacy assessments at 5 time points included Positive and Negative Syndrome Scale and Clinical Global Impression scale. Safety assessments included extrapyramidal symptoms, metabolic profile, serum prolactin level, QTc interval, and adverse events. Drug concentrations and cytochrome P450 CYP2D6 and CYP3A4 genotypes were also measured. The fast- and slow-switching groups were comparable in demographical and clinical features at baseline and dropout rate. In the intention-to-treat analysis using mixed-effects models, there were significant within-group decreases over time in the Positive and Negative Syndrome Scale total scores (P = 0.03) and its subscores except for positive subscores, whereas no between-group differences were found. A reduction in body weight (P = 0.01) and lower levels of total cholesterol (P = 0.03), triglycerides (P = 0.03), and prolactin (P = 0.01) were noted in both groups but no increase in extrapyramidal symptoms or prolongation of QTc. The blood concentrations of aripiprazole in all patients were in a therapeutic range at day 56, with CYP2D6*10 polymorphisms being associated with aripiprazole concentrations. In conclusion, there is no significant difference between the fast- and slow-switching strategy in terms of improvements in clinical symptoms and metabolic profile in this 8-week study.

Health Canada Warning on Citalopram and Escitalopram--Its Effects on Prescribing in Consultation-Liaison Psychiatry.

PubMed

Do, André; Noohi, Saeid; Elie, Dominique; Mahdanian, Artin A; Yu, Ching; Segal, Marilyn; Looper, Karl J; Rej, Soham

2016-01-01

Reports have suggested that citalopram and escitalopram may prolong the QTc interval, leading Health Canada to issue a warning to limit their dosages in 2012. Little is known about the effects of this warning and similar ones (e.g., by the Food and Drug Administration) on antidepressant prescribing in inpatients with acute medical illness, who are theoretically at high risk of QTc prolongation. The main objective of our study is to examine the effect of the Health Canada warning on citalopram/escitalopram prescribing patterns in the consultation-liaison (C-L) psychiatry setting. We performed a retrospective cohort study including 275 randomly selected inpatients with medical illness assessed by the psychiatric C-L team of a large Canadian academic hospital between 2008 and 2014. We grouped patients based on whether they were assessed by the C-L team before or after the citalopram Health Canada warning. Our primary outcome was change in citalopram/escitalopram prescribing patterns. We found that of patients seen before the Health Canada warning, a significantly higher number were prescribed citalopram/escitalopram (44.1% vs. 22.3%, χ(2) = 14.835, p < 0.001), even after controlling for confounders. However, the percentage of patients using a citalopram/escitalopram dose exceeding those recommended by the Health Canada warning was similar in both groups (8.9% vs. 12.1%, χ(2) = 0.233, p = 0.63). Overall, C-L psychiatrists were less likely to prescribe citalopram/escitalopram following the Health Canada warning, which did not translate into safer dosing. Clinicians should not avoid prescribing citalopram/escitalopram appropriately in medically vulnerable inpatients when benefits outweigh disadvantages. Copyright © 2016 The Academy of Psychosomatic Medicine. Published by Elsevier Inc. All rights reserved.

The Mechanism of the Calorigenic Action of Thyroid Hormone

PubMed Central

Ismail-Beigi, Faramarz; Edelman, Isidore S.

1971-01-01

In an earlier study, we proposed that thyroid hormone stimulation of energy utilization by the Na+ pump mediates the calorigenic response. In this study, the effects of triiodothyronine (T3) on total oxygen consumption (Q OO2), the ouabain-sensitive oxygen consumption [Q OO2(t)], and NaK-ATPase in liver, kidney, and cerebrum were measured. In liver, ∼90% of the increase in Q OO2 produced by T3 in either thyroidectomized or euthyroid rats was attributable to the increase in Q OO2(t). In kidney, the increase in Q OO2(t) accounted for 29% of the increase in Q OO2 in thyroidectomized and 46% of the increase in Q OO2 in euthyroid rats. There was no demonstrable effect of T3 in euthyroid rats on Q OO2 or Q OO2(t) of cerebral slices. The effects of T3 on NaK-ATPase activity in homogenates were as follows: In liver +81% from euthyroid rats and +54% from hypothyroid rats. In kidney, +21% from euthyroid rats and +69% from hypothyroid rats. T3 in euthyroid rats produced no significant changes in NaK-ATPase or Mg-ATPase activity of cerebral homogenates. Liver plasma membrane fractions showed a 69% increase in NaK-ATPase and no significant changes in either Mg-ATPase or 5'-nucleotidase activities after T3 injection. These results indicate that thyroid hormones stimulate NaK-ATPase activity differentially. This effect may account, at least in part, for the calorigenic effects of these hormones. PMID:4252666

The mechanism of the calorigenic action of thyroid hormone. Stimulation of Na plus + K plus-activated adenosinetriphosphatase activity.

PubMed

Ismail-Beigi, F; Edelman, I S

1971-06-01

In an earlier study, we proposed that thyroid hormone stimulation of energy utilization by the Na(+) pump mediates the calorigenic response. In this study, the effects of triiodothyronine (T(3)) on total oxygen consumption (Q(OO2)), the ouabain-sensitive oxygen consumption [Q(OO2)(t)], and NaK-ATPase in liver, kidney, and cerebrum were measured. In liver, approximately 90% of the increase in Q(OO2) produced by T(3) in either thyroidectomized or euthyroid rats was attributable to the increase in Q(OO2)(t). In kidney, the increase in Q(OO2)(t) accounted for 29% of the increase in Q(OO2) in thyroidectomized and 46% of the increase in Q(OO2) in euthyroid rats. There was no demonstrable effect of T(3) in euthyroid rats on Q(OO2) or Q(OO2)(t) of cerebral slices. The effects of T(3) on NaK-ATPase activity in homogenates were as follows: In liver +81% from euthyroid rats and +54% from hypothyroid rats. In kidney, +21% from euthyroid rats and +69% from hypothyroid rats. T(3) in euthyroid rats produced no significant changes in NaK-ATPase or Mg-ATPase activity of cerebral homogenates. Liver plasma membrane fractions showed a 69% increase in NaK-ATPase and no significant changes in either Mg-ATPase or 5'-nucleotidase activities after T(3) injection. These results indicate that thyroid hormones stimulate NaK-ATPase activity differentially. This effect may account, at least in part, for the calorigenic effects of these hormones.

Decitabine as Maintenance Therapy After Standard Therapy in Treating Patients With Previously Untreated Acute Myeloid Leukemia

ClinicalTrials.gov

2018-05-23

Acute Myeloid Leukemia; Acute Myeloid Leukemia With Myelodysplasia-Related Changes; Adult Acute Myeloid Leukemia With Inv(16)(p13.1q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With t(16;16)(p13.1;q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With t(8;21); (q22; q22.1); RUNX1-RUNX1T1; Adult Acute Myeloid Leukemia With t(9;11)(p22.3;q23.3); MLLT3-KMT2A; Untreated Adult Acute Myeloid Leukemia

Transmission of a t(13q22q) chromosome observed in three generations with segregation of the translocation D1-trisomy syndrome.

PubMed

Abe, T; Morita, M; Kawai, K; Misawa, S; Kanai, H; Hirose, G; Fujita, H

1975-09-20

A case of an inherited type of D/G translocation D1-trisomy syndrome was described. A female proposita who had the clinical signs of D1-trisomy syndrome was found to have a chromosome complement of 46,XX,--G,+t(DqGq). examination of Q- and G-stained karyotypes revealed that the chromosomes involved in the translocation were members of Nos. 13 and 22, or t(13q22q) with breaks at p12 of both chromosomes. C-stained figures also showed a large heterochromatin block in its centromeric region. The t(13q22q) chromosome was transmitted from the paternal grandmother of the proposita through at least three generations.

Vorinostat and Decitabine in Treating Patients With Relapsed, Refractory, or Poor-Prognosis Hematologic Cancer or Other Diseases

ClinicalTrials.gov

2013-01-04

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Chronic Myelomonocytic Leukemia; Myelodysplastic/Myeloproliferative Neoplasm, Unclassifiable; Philadelphia Chromosome Negative Chronic Myelogenous Leukemia; Previously Treated Myelodysplastic Syndromes; Recurrent Adult Acute Lymphoblastic Leukemia; Recurrent Adult Acute Myeloid Leukemia; Relapsing Chronic Myelogenous Leukemia

A Phase II Study Of The Farnesyltransferase Inhibitor ZANESTRA (R115777, NSC #702818, IND #58,359) In Complete Remission Following Induction And/Or Consolidation Chemotherapy In Adults With Poor-Risk Acute Myelogenous Leukemia (AML) And High-Risk Myelodysplasia (MDS)

ClinicalTrials.gov

2013-01-08

Adult Acute Myeloid Leukemia in Remission; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); de Novo Myelodysplastic Syndromes; Secondary Myelodysplastic Syndromes

Identification of a YAC spanning the translocation breakpoints in uterine leiomyomata, pulmonary chondroid hamartoma, and lipoma: Physical mapping of the 12q14-q15 breakpoint region in uterine leiomyomata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fejzo, M.S.; Yoon, S.J.; Kucherlapati, R.S.

1995-03-20

Uterine leiomyomata are the most common tumors in women and can cause abnormal uterine bleeding, pelvic pain, and infertility. Approximately 200,000 hysterectomies are performed annually in the U.S. to relieve patients of the medical sequelae of these benign neoplasms. Our efforts have focused on cloning the t(12;14)(q14-q15;q23-q24) breakpoint in uterine leiomyoma to further our understanding of the biology of these tumors. Thirty-nine YACs and six cosmids mapping to 12q14-q15 have been mapped by fluorescence in situ hybridization to tumor metaphase chromosomes containing a t(12;14). One YAC spanned the translocation breakpoint and was mapped to tumor metaphases from a pulmonary chondroidmore » hamartoma containing a t(12;14)(q14-q15;q23-q24) and a lipoma containing a t(12;15)(q15;q24); this YAC also spanned the breakpoint in these two tumors, suggesting that the same gene on chromosome 12 may be involved in the pathobiology of these distinct benign neoplasms. 41 refs., 2 figs., 1 tab.« less

Veliparib and Temozolomide in Treating Patients With Acute Leukemia

ClinicalTrials.gov

2018-04-20

Accelerated Phase of Disease; Acute Lymphoblastic Leukemia; Acute Myeloid Leukemia; Acute Myeloid Leukemia Arising From Previous Myelodysplastic Syndrome; Adult Acute Myeloid Leukemia With Inv(16)(p13.1q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With t(16;16)(p13.1;q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With t(8;21); (q22; q22.1); RUNX1-RUNX1T1; Adult Acute Myeloid Leukemia With t(9;11)(p22.3;q23.3); MLLT3-KMT2A; Adult Acute Promyelocytic Leukemia With PML-RARA; Adult B Acute Lymphoblastic Leukemia; Adult B Acute Lymphoblastic Leukemia With t(9;22)(q34.1;q11.2); BCR-ABL1; Adult T Acute Lymphoblastic Leukemia; Alkylating Agent-Related Acute Myeloid Leukemia; Blastic Phase; Chronic Myelomonocytic Leukemia; Recurrent Adult Acute Lymphoblastic Leukemia; Recurrent Adult Acute Myeloid Leukemia; Recurrent Disease; Secondary Acute Myeloid Leukemia; Untreated Adult Acute Lymphoblastic Leukemia; Untreated Adult Acute Myeloid Leukemia

A Note on the Relationship of Temperature and Water Vapor over Oceans, as well as the Sea Surface Temperature Impact

NASA Technical Reports Server (NTRS)

Shie, C.-L.; Tao, W.-K.; Simpson, J.

2005-01-01

This note follows up on a recent study by Shie et al. (2005) and extends the investigation of the domain-averaged moisture-temperature (Q-T) relationship from the Tropics (i.e., the previous study) to the tropical Pacific, Atlantic and Indian Oceans. The Q and T data examined in this study are obtained from the GEOS-3 [Goddard Earth Observing System Version-3] global re-analysis monthly products. Similar to what was found earlier in the Tropics, Q is also found to increase with T over the entire oceanic region; however, Q increases faster with T over oceans than over the Tropics. The Q-T distribution for the Tropics is in a quasi-linear relationship, which is embedded in a global Q-T distribution that is, however, in a more complex curvilinear relationship. The Q-T distribution over the oceanic regions seems to fall within the lower bound (ie., the relatively colder and driver regime) of the tropical Q-T distribution. T over oceans is also found increasing with SST (sea surface temperature), which seemingly implies that an air mass might have gained heat more readily from a warmer ocean as compared to a colder ocean. Q is also found to increase with SST in a manner that quantitatively resembles an earlier finding by Stevens (1990). We also found that relative humidity exhibits similar behaviors for oceanic and tropical regions, respectively, i.e., it increases with both SST and T over oceans and increases with T in the Tropics (Shie et al. 2005). All these similar features found between oceanic and tropical regions seem to inform us that oceans occupy most of the Tropics and so play a key role in determining what have happened in the Tropics.

Biological Therapy in Treating Patients With Advanced Myelodysplastic Syndrome, Acute or Chronic Myeloid Leukemia, or Acute Lymphoblastic Leukemia Who Are Undergoing Stem Cell Transplantation

ClinicalTrials.gov

2017-03-27

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); B-cell Adult Acute Lymphoblastic Leukemia; B-cell Childhood Acute Lymphoblastic Leukemia; Childhood Chronic Myelogenous Leukemia; Childhood Myelodysplastic Syndromes; Chronic Myelomonocytic Leukemia; Essential Thrombocythemia; Polycythemia Vera; Previously Treated Myelodysplastic Syndromes; Recurrent Adult Acute Lymphoblastic Leukemia; Recurrent Adult Acute Myeloid Leukemia; Recurrent Childhood Acute Lymphoblastic Leukemia; Recurrent Childhood Acute Myeloid Leukemia; Refractory Anemia With Excess Blasts; Refractory Anemia With Excess Blasts in Transformation; Relapsing Chronic Myelogenous Leukemia; Secondary Acute Myeloid Leukemia; T-cell Adult Acute Lymphoblastic Leukemia; T-cell Childhood Acute Lymphoblastic Leukemia

Belinostat and Azacitidine in Treating Patients With Advanced Hematologic Cancers or Other Diseases

ClinicalTrials.gov

2014-12-22

Accelerated Phase of Disease; Adult Acute Myeloid Leukemia With Inv(16)(p13.1q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With t(16;16)(p13.1;q22); CBFB-MYH11; Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); RUNX1-RUNX1T1; Adult Acute Myeloid Leukemia With t(9;11)(p22;q23); MLLT3-MLL; Adult Acute Promyelocytic Leukemia With t(15;17)(q22;q12); PML-RARA; Atypical Chronic Myeloid Leukemia, BCR-ABL1 Negative; Blastic Phase; Chronic Myelogenous Leukemia, BCR-ABL1 Positive; Chronic Myelomonocytic Leukemia; de Novo Myelodysplastic Syndrome; Myelodysplastic/Myeloproliferative Neoplasm, Unclassifiable; Philadelphia Chromosome Negative, BCR-ABL1 Positive Chronic Myelogenous Leukemia; Previously Treated Myelodysplastic Syndrome; Primary Myelofibrosis; Recurrent Adult Acute Lymphoblastic Leukemia; Recurrent Adult Acute Myeloid Leukemia; Recurrent Disease; Secondary Acute Myeloid Leukemia; Secondary Myelodysplastic Syndrome

Decitabine in Treating Patients With Myelodysplastic Syndromes or Acute Myeloid Leukemia

ClinicalTrials.gov

2013-09-27

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Atypical Chronic Myeloid Leukemia, BCR-ABL1 Negative; de Novo Myelodysplastic Syndromes; Myelodysplastic/Myeloproliferative Neoplasm, Unclassifiable; Previously Treated Myelodysplastic Syndromes; Recurrent Adult Acute Myeloid Leukemia; Secondary Acute Myeloid Leukemia; Secondary Myelodysplastic Syndromes; Untreated Adult Acute Myeloid Leukemia

Effect of Various Heat Treatment Processes on Fatigue Behavior of Tool Steel for Cold Forging Die

NASA Astrophysics Data System (ADS)

Jin, S. U.; Kim, S. S.; Lee, Y. S.; Kwon, Y. N.; Lee, J. H.

Effects of various heat treatment processes, including "Q/T (quenching and tempering)", "Q/CT/T (Quenching, cryogenic treatment and tempering)", "Q/T (quenching and tempering) + Ti-nitriding" and "Q/CT/T (Cryogenic treatment and tempering) + Ti-nitriding", on S-N fatigue behavior of AISI D2 tool steel were investigated. The optical micrographs and Vicker's hardness values at near surface and core area were examined for each specimen. Uniaxial fatigue tests were performed by using an electro-magnetic resonance fatigue testing machine at a frequency of 80 Hz and an R ratio of -1. The overall resistance to fatigue tends to decrease significantly with Ti-nitriding treatment compared to those for the general Q/T and Q/CT/T specimens. The reduced resistance to fatigue with Ti-nitriding is discussed based on the microstructural and fractographic analyses.

ZBTB16-RARα variant of acute promyelocytic leukemia with tuberculosis: a case report and review of literature.

PubMed

Palta, Anshu; Dhiman, Pratibha; Cruz, Sanjay D

2012-09-01

A 23-year-old male presented with pulmonary tuberculosis and swelling of both lower limbs. He was put on antitubercular treatment. Hemogram showed mild anemia and Pseudo Pelger-huet cells. The bone marrow (BM) examination showed 52% promyelocytes with regular round to oval nuclei, few granules and were positive for CD13 and CD33, and negative for HLA-DR. Cytogenetic analysis of the BM aspirate revealed an apparently balanced t(11;17)(q23;q21). Final diagnosis rendered was acute promyelocytic leukemia (APL) with t(11;17)(q23;q21); ZBTB16/RARA. APL is a distinct subtype of acute myeloid leukemia. The variant APL with t(11;17)(q23;q21) cases that are associated with the ZBTB16/RARA fusion gene have been reported as being resistant to all-trans-retinoic acid (ATRA). Therefore, differential diagnosis of variant APL with t(11;17)(q23;q12) from classical APL with t(15;17)(q22;q12); PML-RARA is very important. Here we have discussed the importance of distinct morphology of variant APL and also significance of rare presentation with tuberculosis.

Nonequilibrium Probabilistic Dynamics of the Logistic Map at the Edge of Chaos

NASA Astrophysics Data System (ADS)

Borges, Ernesto P.; Tsallis, Constantino; Añaños, Garín F.; de Oliveira, Paulo Murilo

2002-12-01

We consider nonequilibrium probabilistic dynamics in logisticlike maps xt+1=1-a|xt|z, (z>1) at their chaos threshold: We first introduce many initial conditions within one among W>>1 intervals partitioning the phase space and focus on the unique value qsen<1 for which the entropic form Sq≡(1- ∑i=1Wpqi)/(q-1) linearly increases with time. We then verify that Sqsen(t)-Sqsen(∞) vanishes like t-1/[qrel(W)-1] [qrel(W)>1]. We finally exhibit a new finite-size scaling, qrel(∞)-qrel(W)~W- |qsen|. This establishes quantitatively, for the first time, a long pursued relation between sensitivity to the initial conditions and relaxation, concepts which play central roles in nonextensive statistical mechanics.

Laser and Electron Beam Processing of Semiconductors: CW Beam- Recrystallized Polysilicon as a Device-Worthy Material

DTIC Science & Technology

1980-12-31

boundary is given by the thermionic emission current, kT 1 /2 qVB qVa Jth = qn (m) exp (- [exp (Kn)- 1 ] ( 1 ) where Va is the applied voltage, q is the...small applied voltage, qVa << kT, Eq. ( 1 ) reduces to Jth = LVa (2) where = q n exp - -T- q.na (3) which gives the effective grain boundary resistance...POLYSILICON AS A DEVICE-WORTHY MATERIAL BY STANFORD UNIVERSITY STANFORD, CALIFORNIA 94305 FOR THE PERIOD JANUARY 1 , 1978 THROUGH DECEMBER 31, 1980 Dr

Metastable Behavior for Bootstrap Percolation on Regular Trees

NASA Astrophysics Data System (ADS)

Biskup, Marek; Schonmann, Roberto H.

2009-08-01

We examine bootstrap percolation on a regular ( b+1)-ary tree with initial law given by Bernoulli( p). The sites are updated according to the usual rule: a vacant site becomes occupied if it has at least θ occupied neighbors, occupied sites remain occupied forever. It is known that, when b> θ≥2, the limiting density q= q( p) of occupied sites exhibits a jump at some p T= p T( b, θ)∈(0,1) from q T:= q( p T)<1 to q( p)=1 when p> p T. We investigate the metastable behavior associated with this transition. Explicitly, we pick p= p T+ h with h>0 and show that, as h ↓0, the system lingers around the "critical" state for time order h -1/2 and then passes to fully occupied state in time O(1). The law of the entire configuration observed when the occupation density is q∈( q T,1) converges, as h ↓0, to a well-defined measure.

Organ-Sparing Marrow-Targeted Irradiation Before Stem Cell Transplant in Treating Patients With High-Risk Hematologic Malignancies

ClinicalTrials.gov

2017-10-09

Adult Acute Lymphoblastic Leukemia in Remission; Adult Acute Myeloid Leukemia in Remission; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); de Novo Myelodysplastic Syndromes; Previously Treated Myelodysplastic Syndromes; Recurrent Adult Acute Lymphoblastic Leukemia; Recurrent Adult Acute Myeloid Leukemia; Secondary Myelodysplastic Syndromes; Untreated Adult Acute Lymphoblastic Leukemia; Untreated Adult Acute Myeloid Leukemia

Decitabine and Total-Body Irradiation Followed By Donor Bone Marrow Transplant and Cyclophosphamide in Treating Patients With Relapsed or Refractory Acute Myeloid Leukemia

ClinicalTrials.gov

2018-02-16

Acute Myeloid Leukemia With Multilineage Dysplasia Following Myelodysplastic Syndrome; Adult Acute Myeloid Leukemia in Remission; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); de Novo Myelodysplastic Syndromes; Previously Treated Myelodysplastic Syndromes; Recurrent Adult Acute Myeloid Leukemia; Secondary Acute Myeloid Leukemia

Chemotherapy Plus Sargramostim in Treating Patients With Refractory Myeloid Cancer

ClinicalTrials.gov

2013-01-08

Accelerated Phase Chronic Myelogenous Leukemia; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Blastic Phase Chronic Myelogenous Leukemia; Chronic Myelomonocytic Leukemia; Chronic Phase Chronic Myelogenous Leukemia; Paroxysmal Nocturnal Hemoglobinuria; Previously Treated Myelodysplastic Syndromes; Recurrent Adult Acute Myeloid Leukemia; Refractory Anemia; Refractory Anemia With Ringed Sideroblasts; Relapsing Chronic Myelogenous Leukemia; Thrombocytopenia; Untreated Adult Acute Myeloid Leukemia

Distributed System Optimal Control and Parameter Estimation: Computational Techniques Using Spline Approximations.

DTIC Science & Technology

1982-04-01

orthogonal proJec- differential equations (PDE) of hyperbolic or tion of Z onto ZN and N -pN’/PN. This parabolic type. Roughly speaking, in each results in...to choose a parameter from an sipative inequality in Z (such asə(q)ZZ> admissible set Q so as to yield a best fit < W < z,z> for z E Dom (.&(q))and .W...semigroup T(t;q). The approxi- sumed fixed and known and F in (1) is a N control input term , say F(t) = Bu(t). Then mating operators. S1(q) are defined

Stability of the Effect of a Standardized Meal on QTc.

PubMed

Täubel, Jörg; Fernandes, Sara; Ferber, Georg

2017-01-01

The assessment of QTc changes after the intake of a standardized meal has been proposed as an alternative approach to prove assay sensitivity when the proarrhythimic potential of a drug is to be excluded in either TQT or intensive Phase I QT studies. In this article, an analysis of the food effect at baseline across periods in two different studies is presented to support the robustness of the method. The results show that the time-effect attributed to food is stable over different study periods demonstrating consistency of the physiological response triggered by food. Stability and reproducibility of the effect is comparable with moxifloxacin. © 2016 Wiley Periodicals, Inc.

Vector-valued Lizorkin-Triebel spaces and sharp trace theory for functions in Sobolev spaces with mixed \\pmb{L_p}-norm for parabolic problems

NASA Astrophysics Data System (ADS)

Weidemaier, P.

2005-06-01

The trace problem on the hypersurface y_n=0 is investigated for a function u=u(y,t) \\in L_q(0,T;W_{\\underline p}^{\\underline m}(\\mathbb R_+^n)) with \\partial_t u \\in L_q(0,T; L_{\\underline p}(\\mathbb R_+^n)), that is, Sobolev spaces with mixed Lebesgue norm L_{\\underline p,q}(\\mathbb R^n_+\\times(0,T))=L_q(0,T;L_{\\underline p}(\\mathbb R_+^n)) are considered; here \\underline p=(p_1,\\dots,p_n) is a vector and \\mathbb R^n_+=\\mathbb R^{n-1} \\times (0,\\infty). Such function spaces are useful in the context of parabolic equations. They allow, in particular, different exponents of summability in space and time. It is shown that the sharp regularity of the trace in the time variable is characterized by the Lizorkin-Triebel space F_{q,p_n}^{1-1/(p_nm_n)}(0,T;L_{\\widetilde{\\underline p}}(\\mathbb R^{n-1})), \\underline p=(\\widetilde{\\underline p},p_n). A similar result is established for first order spatial derivatives of u. These results allow one to determine the exact spaces for the data in the inhomogeneous Dirichlet and Neumann problems for parabolic equations of the second order if the solution is in the space L_q(0,T; W_p^2(\\Omega)) \\cap W_q^1(0,T;L_p(\\Omega)) with p \\le q.

Tricaine (MS-222) is a safe anesthetic compound compared to benzocaine and pentobarbital to induce anesthesia in leopard frogs (Rana pipiens).

PubMed

Cakir, Yavuz; Strauch, Stephen M

2005-01-01

Tricaine (MS-222) is used commonly for sedation, immobilization, and anesthesia of poikilothermic animals. The anesthetic efficacy of different concentrations of MS-222 was compared to benzocaine and pentobarbital on the physiological changes, heart rate and ECG (electrocardiogram) parameters in the leopard frog, Rana pipiens. Loss of righting reflex (RR), loss of pain response (NR = nociceptor response) and recovery time were measured. Heart rate and ECG parameters were also tested before and during anesthesia. The time to loss of RR and NR decreased while recovery time markedly increased with the increasing concentration of MS-222. Benzocaine at 200 mg/l induced a rapid anesthesia, but all frogs needed resuscitation. Pentobarbital at 300 mg/l induced a slow anesthesia, however, all of the frogs also needed resuscitation. All anesthetics at the mentioned concentrations decreased heart rate significantly as well as altered the ECG parameters. All anesthetics prolonged the Q-T interval, and MS-222 at 800 mg/l and benzocaine at 200 mg/l were the most effective anesthetic concentrations in increasing the Q-T interval. Frogs anesthetized by benzocaine and pentobarbital and high concentrations of MS-222 required resuscitation due to hypoxia. Pentobarbital and benzocaine seem to be very effective compounds, but their safety margins are narrow because of ventilatory failure. Therefore, MS-222 at a concentration of 200 mg/l or less is highly recommended for leopard frogs because prolonged recovery, high mortality rate and significant ECG changes are observed with higher concentrations of MS-222.

Cardiac action potential repolarization revisited: early repolarization shows all-or-none behaviour.

PubMed

Trenor, Beatriz; Cardona, Karen; Saiz, Javier; Noble, Denis; Giles, Wayne

2017-11-01

In healthy mammalian hearts the action potential (AP) waveform initiates and modulates each contraction, or heartbeat. As a result, AP height and duration are key physiological variables. In addition, rate-dependent changes in ventricular AP duration (APD), and variations in APD at a fixed heart rate are both reliable biomarkers of electrophysiological stability. Present guidelines for the likelihood that candidate drugs will increase arrhythmias rely on small changes in APD and Q-T intervals as criteria for safety pharmacology decisions. However, both of these measurements correspond to the final repolarization of the AP. Emerging clinical evidence draws attention to the early repolarization phase of the action potential (and the J-wave of the ECG) as an additional important biomarker for arrhythmogenesis. Here we provide a mechanistic background to this early repolarization syndrome by summarizing the evidence that both the initial depolarization and repolarization phases of the cardiac action potential can exhibit distinct time- and voltage-dependent thresholds, and also demonstrating that both can show regenerative all-or-none behaviour. An important consequence of this is that not all of the dynamics of action potential repolarization in human ventricle can be captured by data from single myocytes when these results are expressed as 'repolarization reserve'. For example, the complex pattern of cell-to-cell current flow that is responsible for AP conduction (propagation) within the mammalian myocardium can change APD and the Q-T interval of the electrocardiogram alter APD stability, and modulate responsiveness to pharmacological agents (such as Class III anti-arrhythmic drugs). © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.

Molecular cloning of IGλ rearrangements using long-distance inverse PCR (LDI-PCR).

PubMed

Shimanuki, Masaya; Sonoki, Takashi; Hosoi, Hiroki; Watanuki, Jyuri; Murata, Shogo; Kawakami, Keiki; Matsuoka, Hiroshi; Hanaoka, Nobuyoshi; Nakakuma, Hideki

2013-01-01

Malignant cells of mature B-cell origin show tumor-specific clonal immunoglobulin gene (IG) rearrangements, including V(D)J recombinations, nucleotide mutations, or translocations. Rapid molecular cloning of the breakpoint sequence by long-distance inverse PCR (LDI-PCR) has so far been applied to rearrangements targeted to IGH joining, IGH switch, and IGκ regions. We tended to apply LDI-PCR method for cloning of IGλ rearrangements. To identify which IGλ isotype segment was rearranged, we performed Southern blot analysis using isotype-specific probes. We set inverse primers on the telomeric side of each joining region and amplified rearranged bands detected by Southern blot analysis as corresponding PCR products. All germline IGλ segments were successfully amplified as expected PCR products. We determined breakpoint sequences of five chromosome translocations involving IGλ locus: three novel t(8;22)(q24;q11), one known t(3;22)(q27;q11), and one partially known t(11;22)(q13;q11). Two of the three t(8;22)(q24;q11) were involved in Jλ with a recombination signal sequence and one of three in the first exon of IGLL5, which lies upstream of Jλ1. Three 8q24 breakpoints were widespread at 132, 260 and 366 kb downstream of MYC locus. The t(3;22)(q27;q11) showed a juxtaposition of Jλ2 and the first intron of BCL6, as previously reported. In t(11;22)(q13;q11), 3'UTR of cyclin D1 fused to the constant region of λ7 with nucleotide mutations. We also amplified four Vλ/Jλ recombination sequences. Our method is a useful tool for molecular analysis of genetic events in IGλ. © 2012 John Wiley & Sons A/S.

Progress towards mapping the constitutional t(11:22) breakpoint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barnoski, B.L.; Emanuel, B.S.; Bell, C.J.

1994-09-01

The reciprocal t(11;22)(q23;q11) is the most frequent, recurrent, non-Robertsonian, constitutional translocation in humans. Balanced carriers of this rearrangement are phenotypically normal, but are at risk for producing abnormal offspring with the Supernumerary der(22)t(11;22) Syndrome. Further, a recent report of association between t(11;22) balanced translocation carriers and breast cancer, suggests the involvement of genes on 11q and/or 22q in breast cancer tumorigenesis. Studies are in progress to examine the similarity between 11q23 and 22q11 breakpoints in multiple families with the constitutional t(11;22). A 750 kb YAC, which contains markers known to flank the 11q23 breakpoint, was identified in CEPH/Genethon database. FISHmore » with this YAC to two independent t(11;22) cell lines demonstrates signal on both derivative chromosomes. Numerous YACs containing BCRL2, the closest marker proximal to the breakpoint, were identified. Analysis of these YACs to determine which contain the actual breakpoint sequences is complicated by the presence of a duplicated segment of 22q11 which contains a GGTL and a BCRL locus. Sequences homologous to these loci are present at several other locations in 22q11. The BCRL positive YACs were analyzed by Southern hybridization under conditions which distinguish the four members of the BCR/BCRL family. FISH of total yeast DNA plus YAC DNA labeled by nick translation, or biotin-labeled inter-Alu PCR products confirmed the localization of these YACs to 22q11. Additional FISH with these YACS to metaphase spreads prepared from balanced t(11;22) carriers confirm that these clones span the breakpoint, and will allow rapid isolation and definition of the genetic region adjacent to the t(11;22) breakpoint.« less

Creation of a genetic calcium channel blocker by targeted gem gene transfer in the heart.

PubMed

Murata, Mitsushige; Cingolani, Eugenio; McDonald, Amy D; Donahue, J Kevin; Marbán, Eduardo

2004-08-20

Calcium channel blockers are among the most commonly used therapeutic drugs. Nevertheless, the utility of calcium channel blockers for heart disease is limited because of the potent vasodilatory effect that causes hypotension, and other side effects attributable to blockade of noncardiac channels. Therefore, focal calcium channel blockade by gene transfer is highly desirable. With a view to creating a focally applicable genetic calcium channel blocker, we overexpressed the ras-related small G-protein Gem in the heart by somatic gene transfer. Adenovirus-mediated delivery of Gem markedly decreased L-type calcium current density in ventricular myocytes, resulting in the abbreviation of action potential duration. Furthermore, transduction of Gem resulted in a significant shortening of the electrocardiographic QTc interval and reduction of left ventricular systolic function. Focal delivery of Gem to the atrioventricular (AV) node significantly slowed AV nodal conduction (prolongation of PR and AH intervals), which was effective in the reduction of heart rate during atrial fibrillation. Thus, these results indicate that gene transfer of Gem functions as a genetic calcium channel blocker, the local application of which can effectively modulate cardiac electrical and contractile function.

Regional Economic Development in the Soviet Union, Two Case Studies: The Baltic and Central Asia.

DTIC Science & Technology

1981-01-01

4 4 SZ W w0 0 OW us oJU x 4 qc ~ 4 II.- , Z j I..U U4 z 4 4 Z W w wL W I 0-1 en z - -z 4 0 C4 A 5 since one of the ...6 0 + 6 1fert%t 4 &2irri%t 26 (3) Qt- +t)Q~ ( 4 ) QAt a1q )Q ( 5 ) Hmpt Q t + QA t Inputs into the Productive Process. (6) POPt POPU t+ POPR t (7) [APoPut...differences in 4 7Gertrude Schroeder, "Regional Differences in Incomes and Levels of Living in the USSR," in

Understanding the Delay in Onset of Paget’s Disease of Bone

DTIC Science & Technology

2014-09-01

Virol 2011;85:3162-3171. 6. Indoh T , Yokota S, Okabayashi T , Yokosawa N, Fujii N. Suppression of NF-kappaB and AP-1 activation in monocytic cells...gene M S K T D W N V S G L S R MVC gene gccgagcccatcggctcgctggccgtcgaggaagccatggcagcatggtcagaaatatca A E P...R W P S R K P W Q H G Q K Y Q MVC gene gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C

Re-analysis of the cell line NALM-1 karyotype by GTG-banding, spectral karyotyping, and whole chromosome painting.

PubMed

Pelz, Antje-Friederike; Weilepp, Gisela; Wieacker, Peter F

2005-01-01

Chronic myelogenous leukemia (CML) is a clonal bone marrow disease with progression from a chronic phase to an aggressive blast crisis. The cell line NALM-1 was originally established by Minowada and coworkers from the peripheral blood of a patient in CML blastic crisis. A karyotype analysis of the NALM-1 cell line was performed in the 1970s. To the best of our knowledge, this karyotype was not re-analyzed by molecular cytogenetic techniques, although this cell line is the source of many molecular investigations including expression studies. To establish this cell line as a CML control in our own laboratory, NALM-1 was analyzed by GTG banding, fluorescence in situ hybridization, and spectral karyotyping. Our results differ from the original publication of Sonta and coworkers. We describe for the first time the karyotype of the NALM-1 cell line: 44,X,-X,der(7)t(7;9;15)(q10;?;q15),der(9)t(9;9)(p24;q33 approximately q34)t(9;22)(q34;q11),der(15)t(7;9;15) (?;?;q15),der(22)t(9;22)(q34;q11).

Antiarrhythmic and antioxidant activity of novel pyrrolidin-2-one derivatives with adrenolytic properties.

PubMed

Sapa, Jacek; Nowaczyk, Alicja; Kulig, Katarzyna

2011-01-01

A series of novel pyrrolidin-2-one derivatives (17 compounds) with adrenolytic properties was evaluated for antiarrhythmic, electrocardiographic and antioxidant activity. Some of them displayed antiarrhythmic activity in barium chloride-induced arrhythmia and in the rat coronary artery ligation-reperfusion model, and slightly decreased the heart rate, prolonged P-Q, Q-T intervals and QRS complex. Among them, compound EP-40 (1-[2-hydroxy-3-[4-[(2-hydroxyphenyl)piperazin-1-yl]propyl]pyrrolidin-2-one showed excellent antiarrhythmic activity. This compound had significantly antioxidant effect, too. The present results suggest that the antiarrhythmic effect of compound EP-40 is related to their adrenolytic and antioxidant properties. A biological activity prediction using the PASS software shows that compound EP-35 and EP-40 can be characterized by antiischemic activity; whereas, compound EP-68, EP-70, EP-71 could be good tachycardia agents.

Development of Core Data Set of the Officer Longitudinal Research Data Base

DTIC Science & Technology

1987-07-01

FR EQ U EN CI ES FR OM TH E OM F. J DA TA OM FF RE Q; IN FI LE...OC FR EQ ; n ~ > t-3 ctJ ~ 10 q ts:l z n t< n 0 q z t-3 (/) 0 I’Jj ~ t-3 > ts:l t’i ts:l ~ ts:l z t-3 (/) 0 1󈧏 )I ’t1 ’U tz j z 0 H X 0... FR EQ U EN CI ES FR OM TH E SO M F. I DA TA SO M FF RE Q; IN FI LE IN ; IN PU T SS N IB 4. TY R $C H A R2

Inheritance of a Balanced t(12;20)(q24.33;p12.2) and Unbalanced der(13)t(7;13)(p21.3;q33.2) from a Maternally Derived Double Balanced Translocation Carrier.

PubMed

Peterson, Jess F; Geddes, Gabrielle C; Basel, Donald G; Schippman, Dana; Grignon, John W; vanTuinen, Peter; Kappes, Ulrike P

2018-03-01

We report a 4-month-old male proband with a history of prominent forehead, hypertelorism, ear abnormalities, micrognathia, hypospadias, and multiple cardiac abnormalities. Initial microarray analysis detected a concurrent 7p21.3-p22.3 duplication and 13q33.2-q34 deletion indicating an unbalanced rearrangement. However, subsequent conventional cytogenetic studies only revealed what appeared to be a balanced t(12;20)(q24.33;p12.2). Fluorescence in situ hybridization (FISH) using chromosome-specific subtelomere probes confirmed the presence of an unbalanced der(13)t(7;13)(p21.3;q33.2) and balanced t(12;20)(q24.33;p12.2), both of maternal origin. In addition to our unique clinical findings, this case highlights the benefits and limitations of both conventional cytogenetic studies and microarray analysis and how FISH complements each methodology.

Therapeutic Allogeneic Lymphocytes and Aldesleukin in Treating Patients With High-Risk or Recurrent Myeloid Leukemia After Undergoing Donor Stem Cell Transplant

ClinicalTrials.gov

2017-02-13

Accelerated Phase Chronic Myelogenous Leukemia; Acute Myeloid Leukemia With Multilineage Dysplasia Following Myelodysplastic Syndrome; Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Blastic Phase Chronic Myelogenous Leukemia; Childhood Chronic Myelogenous Leukemia; Childhood Myelodysplastic Syndromes; Recurrent Adult Acute Myeloid Leukemia; Recurrent Childhood Acute Myeloid Leukemia; Relapsing Chronic Myelogenous Leukemia; Secondary Acute Myeloid Leukemia

Specific replacement of Q base in the anticodon of tRNA by guanine catalyzed by a cell-free extract of rabbit reticulocytes.

PubMed Central

Okada, N; Harada, F; Nishimura, S

1976-01-01

Guanylation of tRNA by a lysate of rabbit reticulocytes was reported previously by Farkas and Singh. This reaction was investigated further using 18 purified E. coli tRNAs as acceptors.Results showed that only tRNATyr, tRNAHis, tRNAAsn and tRNAAsp which contain the modified nucleoside Q in the anticodon acted as acceptors. Analysis of the nucleotide sequences in the guanylated tRNA showed that guanine specifically replaced Q base in these tRNAs. Images PMID:792816

Tretinoin and Arsenic Trioxide in Treating Patients With Untreated Acute Promyelocytic Leukemia

ClinicalTrials.gov

2017-07-18

Adult Acute Promyelocytic Leukemia With t(15;17)(q22;q12); PML-RARA; Childhood Acute Promyelocytic Leukemia With t(15;17)(q22;q12); PML-RARA; Untreated Adult Acute Myeloid Leukemia; Untreated Childhood Myeloid Neoplasm

Donor Peripheral Blood Stem Cell Transplant in Treating Patients With Hematologic Malignancies

ClinicalTrials.gov

2017-12-11

Acute Biphenotypic Leukemia; Acute Erythroid Leukemia in Remission; Acute Leukemia in Remission; Acute Megakaryoblastic Leukemia; Acute Myeloid Leukemia Arising From Previous Myelodysplastic Syndrome; Acute Myeloid Leukemia in Remission; Acute Myeloid Leukemia With FLT3/ITD Mutation; Acute Myeloid Leukemia With Inv(3) (q21.3;q26.2) or t(3;3) (q21.3;q26.2); GATA2, MECOM; Acute Myeloid Leukemia With Inv(3) (q21.3;q26.2); GATA2, MECOM; Acute Myeloid Leukemia With Multilineage Dysplasia; Acute Myeloid Leukemia With t(6;9) (p23;q34.1); DEK-NUP214; Acute Undifferentiated Leukemia; Adult Acute Lymphoblastic Leukemia in Complete Remission; B Acute Lymphoblastic Leukemia With t(1;19)(q23;p13.3); E2A-PBX1 (TCF3-PBX1); B Acute Lymphoblastic Leukemia With t(9;22)(q34.1;q11.2); BCR-ABL1; Burkitt Lymphoma; Childhood Acute Lymphoblastic Leukemia in Complete Remission; DS Stage II Plasma Cell Myeloma; DS Stage III Plasma Cell Myeloma; Myelodysplastic Syndrome; Recurrent Anaplastic Large Cell Lymphoma; Recurrent Diffuse Large B-Cell Lymphoma; Recurrent Follicular Lymphoma; Recurrent Hodgkin Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Marginal Zone Lymphoma; Recurrent Plasma Cell Myeloma; Refractory Plasma Cell Myeloma; Secondary Acute Myeloid Leukemia; T Lymphoblastic Lymphoma

Cardiac Repolarization Abnormalities and Potential Evidence for Loss of Cardiac Sodium Currents on ECGs of Patients with Chagas' Heart Disease

NASA Technical Reports Server (NTRS)

Schlegel, T. T.; Medina, R.; Jugo, D.; Nunez, T. J.; Borrego, A.; Arellano, E.; Arenare, B.; DePalma, J. L.; Greco, E. C.; Starc, V.

2007-01-01

Some individuals with Chagas disease develop right precordial lead ST segment elevation in response to an ajmaline challenge test, and the prevalence of right bundle branch block (RBBB) is also high in Chagas disease. Because these same electrocardiographic abnormalities occur in the Brugada syndrome, which involves genetically defective cardiac sodium channels, acquired damage to cardiac sodium channels may also occur in Chagas disease. We studied several conventional and advanced resting 12-lead/derived Frank-lead ECG parameters in 34 patients with Chagas -related heart disease (mean age 39 14 years) and in 34 age-/gender-matched healthy controls. All ECG recordings were of 5-10 min duration, obtained in the supine position using high fidelity hardware/software (CardioSoft, Houston, TX). Even after excluding those Chagas patients who had resting BBBs, tachycardia and/or pathologic arrhythmia (n=8), significant differences remained in multiple conventional and advanced ECG parameters between the Chagas and control groups (n=26/group), especially in their respective QT interval variability indices, maximal spatial QRS-T angles and low frequency HRV powers (p=0.0006, p=0.0015 and p=0.0314 respectively). In relation to the issue of potential damage to cardiac sodium channels, the Chagas patients had: 1) greater than or equal to twice the incidence of resting ST segment elevation in leads V1-V3 (n=10/26 vs. n=5/26) and of both leftward (n=5/26 versus n=0/26) and rightward (n=7/26 versus n=3/26) QRS axis deviation than controls; 2) significantly increased filtered (40-250 Hz) QRS interval durations (92.1 8.5 versus 85.3 plus or minus 9.0 ms, p=0.022) versus controls; and 3) significantly decreased QT and especially JT interval durations versus controls (QT interval: 387.5 plus or minus 26.4 versus 408.9 plus or minus 34.6 ms, p=0.013; JT interval: 290.5 plus or minus 26.3 versus 314.8 plus or minus 31.3 ms; p=0.0029). Heart rates and Bazett-corrected QTc/JTc intervals were not significantly different between groups. Patients with Chagas heart disease have increased cardiac repolarization abnormalities, especially by advanced ECG. Moreover, as a group, they have decreased uncorrected JT and QT interval durations and increased filtered QRS interval durations (versus age/gender-matched controls), all suggesting a potential loss of cardiac sodium channel function that might be mediated, in part, by cardiac autonomic damage. Overall findings support Brugada et al's recent hypothesis that the pathway leading to sudden death may often be similar in Chagas' disease and Brugada syndrome i.e., damage to the sodium channel (infectious/immunologic/autonomic in Chagas' genetic in Brugada) with consequent loss of sodium currents may facilitate a phase II-reentry based arrhythmic substrate for ventricular fibrillation in both conditions. In general, JT interval-related results have been underreported in the Chagas literature.

Detection of Abundant Carbon Monoxide in the Brown Dwarf Gliese 229B

NASA Astrophysics Data System (ADS)

Noll, K. S.; Geballe, T. R.; Marley, M. S.

1997-12-01

The spectrum of Gl 229B in the 4.5-5.1 mu m interval shows evidence for CO at mole fractions of qCO > 50 ppm. Molecular line opacity limits the depth to which we can see at these wavelengths to the T ~ 800 K level. At this temperature, the predicted equilibrium abundance of CO (Fegley and Lodders, ApJ 472, L37 [1996]) is more than 1600 times lower than the lower limit we determine. Dynamical quenching of CO-CH_4 equilibrium is one mechanism that can lead to enhanced CO at low temperatures, but this mechanism requires convection in the T ~ 800-1250 K, P ~ 1-8 bar region of Gl 229B's atmosphere, a region in which a detached convection zone is predicted by some models of Gl 229B (Marley et al. Science 272, 1919 [1996]). The presence of disequilibrium abundances of CO in Gl 229B's upper atmosphere reduces the emergent flux in the 4-5 mu m interval and may make searches for new brown dwarfs using this band less sensitive.

Simultaneous occurrence of t(9;22)(q34;q11.2) and t(16;16)(p13;q22) in a patient with chronic myeloid leukemia in blastic phase.

PubMed

Zámecníkova, Adriana; Al Bahar, Soad; Ramesh, Pandita

2008-06-01

Coexistence of two specific chromosomal translocations in the same clone is an infrequent phenomenon and has only rarely been reported in hematological malignancies. We report a combination of t(16;16)(p13;q22), the Philadelphia translocation t(9;22)(q34;q11.2), and deletion of the long arm of chromosome 7 in a patient with chronic myeloid leukemia in blast phase. Monotherapy treatment with imatinib mesylate resulted in the disappearance of the Ph-positive clone, but with persistence of t(16;16) and del(7) in all of the metaphases examined. The case illustrates that, although imatinib mesylate can be an effective treatment in eradication of the BCR-ABL fusion gene cells, the occurrence of additional specific abnormalities in Philadelphia-positive leukemias may pose a significant therapeutic challenge. (c) 2008 Elsevier Inc.

Monoclonal Antibody Therapy in Treating Patients With Ovarian Epithelial Cancer, Melanoma, Acute Myeloid Leukemia, Myelodysplastic Syndrome, or Non-Small Cell Lung Cancer

ClinicalTrials.gov

2013-01-09

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Atypical Chronic Myeloid Leukemia, BCR-ABL1 Negative; Myelodysplastic/Myeloproliferative Neoplasm, Unclassifiable; Previously Treated Myelodysplastic Syndromes; Recurrent Adult Acute Myeloid Leukemia; Recurrent Melanoma; Recurrent Non-small Cell Lung Cancer; Recurrent Ovarian Epithelial Cancer; Stage IV Melanoma; Stage IV Non-small Cell Lung Cancer

Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR.

PubMed

Peng, Xiujuan; Nguyen, Alex; Ghosh, Debadyuti

2018-02-01

TaqMan and SYBR Green quantitative PCR (qPCR) methods were developed as DNA-based approaches to reproducibly enumerate M13 and T7 phages from phage display selection experiments individually and simultaneously. The genome copies of M13 and T7 phages were quantified by TaqMan or SYBR Green qPCR referenced against M13 and T7 DNA standard curves of known concentrations. TaqMan qPCR was capable of quantifying M13 and T7 phage DNA simultaneously with a detection range of 2.75*10 1 -2.75*10 8 genome copies(gc)/μL and 2.66*10 1 -2.66*10 8 genome copies(gc)/μL respectively. TaqMan qPCR demonstrated an efficient amplification efficiency (E s ) of 0.97 and 0.90 for M13 and T7 phage DNA, respectively. SYBR Green qPCR was ten-fold more sensitive than TaqMan qPCR, able to quantify 2.75-2.75*10 7 gc/μL and 2.66*10 1 -2.66*10 7 gc/μL of M13 and T7 phage DNA, with an amplification efficiency E s of 1.06 and 0.78, respectively. Due to its superior sensitivity, SYBR Green qPCR was used to enumerate M13 and T7 phage display clones selected against a cell line, and quantified titers demonstrated accuracy comparable to titers from traditional double-layer plaque assay. Compared to enzyme linked immunosorbent assay, both qPCR methods exhibited increased detection sensitivity and reproducibility. These qPCR methods are reproducible, sensitive, and time-saving to determine their titers and to quantify a large number of phage samples individually or simultaneously, thus avoiding the need for time-intensive double-layer plaque assay. These findings highlight the attractiveness of qPCR for phage enumeration for applications ranging from selection to next-generation sequencing (NGS). Copyright © 2017 Elsevier B.V. All rights reserved.

A Pediatric Acute Promyelocytic Leukemia With a Rare Karyotype of ider(17)(q10)t(15;17) and Favorable Outcome: A Case Report.

PubMed

He, Yanli; Wang, Ping; Liang, Kaiwei; Chen, Xiangjun; Du, Wen; Li, Juan; Hu, Yanjie; Bai, Yan; Liu, Wei; Li, Xiaoqing; Jin, Runming; Zhang, Min; Zheng, Jine

2015-10-01

Acute promyelocytic leukemia (APL) is a specific malignant hematological disorder with a diagnostic hallmark of chromosome translocation t(15;17)(q22;q21). As a very rare secondary cytogenetic aberration in pediatric APL, ider(17q) (q10)t(15;17) was suggested to be a poor prognostic factor based on previous case reports.Here, we report a pediatric APL case with a rare karyotype of ider(17)(q10)t(15;17). Bone marrow aspiration, immunophenotyping, molecular biology, cytogenetic, and fluorescence in situ hybridization (FISH) analyses were performed at initial diagnosis and during the treatment.A 6-year-old boy was brought to our hospital with the chief complaint of bleeding gums twice and intermittent fever for 3 days in January 2013. He was diagnosed as low-risk APL according to the 2012 NCCN guideline on APL, with the expression of PML-RARA (bcr3 subtype) and the karyotype of 46,XY, der(15)t(15;17)(q22;q21),ider(17)(q10)t(15;17), which was further verified by FISH. The patient was treated through combination all-trans retinoic acid (ATRA) and arsenic with daunorubicin according to the 2012 NCCN guideline for APL. Continuous hematological completed remission (HCR) and major molecular remission (MMR) were achieved with normal karyotype for >28 months after induction chemotherapy.Different from previously reported cases, this pediatric APL patient with ider(17)(q10)t(15;17) displays favorable clinical outcomes, which might be related to the low-risk classification and arsenic treatment during the treatment. It suggests that ider(17)(q10)t(15;17) may not be the sole determinant for worse outcomes in pediatric APL and implies that more contributed factors should be considered for pediatric APL prognosis.

Quantitative Chemical Exchange Saturation Transfer MRI of Intervertebral Disc in a Porcine Model

PubMed Central

Zhou, Zhengwei; Bez, Maxim; Tawackoli, Wafa; Giaconi, Joseph; Sheyn, Dmitriy; de Mel, Sandra; Maya, Marcel M.; Pressman, Barry D.; Gazit, Zulma; Pelled, Gadi; Gazit, Dan; Li, Debiao

2017-01-01

Purpose Previous studies have associated low pH in interver-tebral discs (IVDs) with discogenic back pain. The purpose of this study was to determine whether quantitative CEST (qCEST) MRI can be used to detect pH changes in IVDs in vivo. Methods The exchange rate ksw between glycosaminoglycan (GAG) protons and water protons was determined from qCEST analysis. Its dependence on pH value was investigated in GAG phantoms with varying pH and concentrations. The relationship between ksw and pH was studied further in vivo in a porcine model on a 3T MR scanner and validated using a pH meter. Sodium lactate was injected into the IVDs to induce various pH values within the discs ranging from 5 to 7. Results Phantom and animal results revealed that ksw measured using qCEST MRI is highly correlated with pH level. In the animal studies, the relationship can be described as ksw =9.2 × 106 × 10−pH + 196.9, R2 = 0.7883. Conclusion The exchange rate between GAG and water protons determined from qCEST MRI is closely correlated with pH value. This technique has the potential to noninvasively measure pH in the IVDs of patients with discogenic pain. PMID:27670140

Depletion-Mode GaN HEMT Q-Spoil Switches for MRI Coils

PubMed Central

Lu, Jonathan Y.; Grafendorfer, Thomas; Zhang, Tao; Vasanawala, Shreyas; Robb, Fraser; Pauly, John M.; Scott, Greig C.

2017-01-01

Q-spoiling is the process of decoupling an MRI receive coil to protect the equipment and patient. Conventionally, Q-spoiling is performed using a PIN diode switch that draws significant current. In this work, a Q-spoiling technique using a depletion-mode Gallium Nitride HEMT device was developed for coil detuning at both 1.5 T and 3 T MRI. The circuits with conventional PIN diode Q-spoiling and the GaN HEMT device were implemented on surface coils. SNR was measured and compared for all surfaces coils. At both 1.5 T and 3 T, comparable SNR was achieved for all coils with the proposed technique and conventional Q-spoiling. The GaN HEMT device has significantly reduced the required power for Q-spoiling. The GaN HEMT device also provides useful safety features by detuning the coil when unpowered. PMID:27362895

Identification of α-tocotrienolquinone epoxides and development of an efficient molecular distillation procedure for quantitation of α-tocotrienol oxidation products in food matrices by high-performance liquid chromatography with diode array and fluorescence detection.

PubMed

Büsing, Anne; Drotleff, Astrid M; Ternes, Waldemar

2012-08-29

The aim of this study was to investigate the most important oxidation products of α-tocotrienol (α-T3) along with other tocochromanols in lipid matrices and tocotrienol-rich foods. For this purpose, an efficient molecular distillation procedure was developed for the extraction of analytes, and α-T3-spiked and thermally oxidized natural lipids (lard and wheat germ oil) and α-T3-rich foods (wholemeal rye bread and oil from dried brewer's spent grain) were investigated through HPLC-DAD-F. The following α-T3 oxidation products were extractable from lipid matrices along with tocochromanols: α-tocotrienolquinone (α-T3Q), α-tocotrienolquinone-4a,5-epoxide (α-T3Q-4a,5-E), α-tocotrienolquinone-7,8-epoxide (α-T3Q-7,8-E), 7-formyl-β-tocotrienol (7-FβT3), and 5-formyl-γ-tocotrienol (5-FγT3). Recovery rates were as high as 88% and enrichment factors up to 124. The proposed method allows the investigation of α-T3Q, α-T3Q-4a,5-E, α-T3Q-7,8-E, 7-FβT3, and 5-FγT3 in small quantities (<0.78 μg/g) in lipid matrices, which is necessary for the investigation and analysis of the formation kinetics of these oxidation products in fat, oils, and tocotrienol-rich foods.

Inconspicuous Insertion 22;12 in Myxoid/Round Cell Liposarcoma Accompanied by the Secondary Structural Abnormality der(16)t(1;16)

PubMed Central

Birch, Nathan C.; Antonescu, Cristina R.; Nelson, Marilu; Sarran, Lisa; Neff, James R.; Seemayer, Thomas; Bridge, Julia A.

2003-01-01

In myxoid/round cell liposarcoma, the t(12;16)(q13;p11) and its associated fusion transcript, FUS-CHOP, characterize greater than 95% of cases. The variant translocation t(12;22)(q13;q12) and associated EWS-CHOP fusion transcript are rare. A second non-random aberration observed in roughly 20% of Ewing’s sarcomas, and to a lesser extent other select sarcomas, is the unbalanced 1;16 translocation. Recognition of this secondary aberration in the absence of an obvious primary karyotypic abnormality strongly suggests that the use of other genetic approaches will be informative in uncovering a clinically suspected primary anomaly. The following case illustrates the utility of molecular cytogenetic and reverse transcriptase-polymerase chain reaction techniques in diagnosing an ins(22;12)(q12;q13q14) and associated EWS-CHOP fusion transcript in a myxoid/round cell liposarcoma exhibiting a der(16)t(1;16)(q11;q11). PMID:12876210

Inconspicuous insertion 22;12 in myxoid/round cell liposarcoma accompanied by the secondary structural abnormality der(16)t(1;16).

PubMed

Birch, Nathan C; Antonescu, Cristina R; Nelson, Marilu; Sarran, Lisa; Neff, James R; Seemayer, Thomas; Bridge, Julia A

2003-08-01

In myxoid/round cell liposarcoma, the t(12;16)(q13;p11) and its associated fusion transcript, FUS-CHOP, characterize greater than 95% of cases. The variant translocation t(12;22)(q13;q12) and associated EWS-CHOP fusion transcript are rare. A second non-random aberration observed in roughly 20% of Ewing's sarcomas, and to a lesser extent other select sarcomas, is the unbalanced 1;16 translocation. Recognition of this secondary aberration in the absence of an obvious primary karyotypic abnormality strongly suggests that the use of other genetic approaches will be informative in uncovering a clinically suspected primary anomaly. The following case illustrates the utility of molecular cytogenetic and reverse transcriptase-polymerase chain reaction techniques in diagnosing an ins(22;12)(q12;q13q14) and associated EWS-CHOP fusion transcript in a myxoid/round cell liposarcoma exhibiting a der(16)t(1;16)(q11;q11).

Renal cell carcinoma and a constitutional t(11;22)(q23;q11.2): case report and review of the potential link between the constitutional t(11;22) and cancer.

PubMed

Doyen, Jérôme; Carpentier, Xavier; Haudebourg, Juliette; Hoch, Benjamin; Karmous-Benailly, Houda; Ambrosetti, Damien; Fabas, Thibault; Amiel, Jean; Lambert, Jean-Claude; Pedeutour, Florence

2012-11-01

We observed a t(11;22)(q23-24;q11.2-12) and monosomy 3 in renal tumor cells from a 72-year-old man. The hypothesis of a primitive peripheral neuroectodermal tumor (PPNET) located in the kidney was promptly excluded: Histologically, the tumor was a clear cell renal cell carcinoma (RCC) and we did not observe an EWSR1 gene rearrangement. The constitutional origin of this alteration was established. We report on the second case of RCC in a patient with a constitutional t(11;22). The t(11;22)(q23;q11.2) is the main recurrent germline translocation in humans. Unbalanced translocation can be transmitted to the progeny and can cause Emanuel syndrome. Our observation alerts cancer cytogeneticists to the fortuitous discovery of the constitutional t(11;22) in tumor cells. This translocation appears grossly similar to the t(11;22)(q24;q12) of PPNET and should be evoked if present in all cells of a tumor other than PPNET. This is important when providing appropriate genetic counseling. Moreover, the potential oncogenic role of the t(11;22) and its predisposing risk of cancer are under debate. The family history of the patient revealed a disabled brother who died at an early age from colon cancer and a sister with breast cancer. This observation reopens the issue of a link between the constitutional t(11;22) and cancer, and the utility of cancer prevention workups for t(11;22) carriers. Copyright © 2012 Elsevier Inc. All rights reserved.

Donor Peripheral Stem Cell Transplant in Treating Patients With Hematolymphoid Malignancies

ClinicalTrials.gov

2016-11-17

Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Adult Nasal Type Extranodal NK/T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Peripheral T-cell Lymphoma; Recurrent Adult Acute Lymphoblastic Leukemia; Recurrent Adult Acute Myeloid Leukemia; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Grade III Lymphomatoid Granulomatosis; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Cutaneous T-cell Non-Hodgkin Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Marginal Zone Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent Small Lymphocytic Lymphoma; Refractory Chronic Lymphocytic Leukemia; Relapsing Chronic Myelogenous Leukemia; Splenic Marginal Zone Lymphoma; Waldenstrom Macroglobulinemia

Development of an NPM1/MLF1 D-FISH probe set for the detection of t(3;5)(q25;q35) identified in patients with acute myeloid leukemia.

PubMed

Aypar, Umut; Knudson, Ryan A; Pearce, Kathryn E; Wiktor, Anne E; Ketterling, Rhett P

2014-09-01

The t(3;5)(q25;q35) NPM1/MLF1 fusion has an incidence of approximately 0.5% in acute myeloid leukemia (AML) and has an intermediate prognosis at diagnosis. We have developed a dual-color, dual-fusion fluorescence in situ hybridization (D-FISH) assay to detect fusion of the MLF1 and NPM1 genes. A blinded investigation was performed using 25 normal bone marrow specimens and 26 bone marrow samples from patients with one or more metaphases with a t(3;5)(q21-q25;q31-q35) or a der(5)t(3;5)(q21-q25;q31-q35) previously identified by chromosome analysis. Once unblinded, the results indicate our D-FISH method identified NPM1/MLF1 fusion in 15 of the 26 fully evaluated patient samples. Excluding three samples with a single abnormal t(3;5) metaphase, 15 of 17 (88%) patient samples with a balanced t(3;5) demonstrated NPM1/MLF1 fusion, and 0 of 6 patient samples with a der(5)t(3;5) demonstrated NPM1/MLF1 fusion, suggesting only the balanced form of this 3;5 translocation as observed by karyotype is associated with NPM1/MLF1 fusion. Overall, the FISH results demonstrated five different outcomes (NPM1/MLF1 fusion, MLF1 disruption, MLF1 duplication, NPM1 deletion, and normal), indicating significant molecular heterogeneity when the 3;5 translocation is identified. The development of this sensitive D-FISH strategy for the detection of NPM1/MLF1 fusion adds to the AML FISH testing repertoire and is effective in the detection of this translocation at diagnosis as well as monitoring residual disease in AML patients. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Novel recurrent chromosomal aberrations detected in clonal plasma cells of light chain amyloidosis patients show potential adverse prognostic effect: first results from a genome-wide copy number array analysis

PubMed Central

Granzow, Martin; Hegenbart, Ute; Hinderhofer, Katrin; Hose, Dirk; Seckinger, Anja; Bochtler, Tilmann; Hemminki, Kari; Goldschmidt, Hartmut; Schönland, Stefan O.; Jauch, Anna

2017-01-01

Immunoglobulin light chain (AL) amyloidosis is a rare plasma cell dyscrasia characterized by the deposition of abnormal amyloid fibrils in multiple organs, thus impairing their function. In the largest cohort studied up to now of 118 CD138-purified plasma cell samples from previously untreated immunoglobulin light chain amyloidosis patients, we assessed in parallel copy number alterations using high-density copy number arrays and interphase fluorescence in situ hybridization (iFISH). We used fluorescence in situ hybridization probes for the IgH translocations t(11;14), t(4;14), and t(14;16) or any other IgH rearrangement as well as numerical aberrations of the chromosome loci 1q21, 8p21, 5p15/5q35, 11q22.3 or 11q23, 13q14, 15q22, 17p13, and 19q13. Recurrent gains included chromosomes 1q (36%), 9 (24%), 11q (24%), as well as 19 (15%). Recurrent losses affected chromosome 13 (29% monosomy) and partial losses of 14q (19%), 16q (14%) and 13q (12%), respectively. In 88% of patients with translocation t(11;14), the hallmark chromosomal aberration in AL amyloidosis, a concomitant gain of 11q22.3/11q23 detected by iFISH was part of the unbalanced translocation der(14)t(11;14)(q13;q32) with the breakpoint in the CCND1/MYEOV gene region. Partial loss of chromosome regions 14q and 16q were significantly associated to gain 1q. Gain 1q21 detected by iFISH almost always resulted from a gain of the long arm of chromosome 1 and not from trisomy 1, whereas deletions on chromosome 1p were rarely found. Overall and event-free survival analysis found a potential adverse prognostic effect of concomitant gain 1q and deletion 14q as well as of deletion 1p. In conclusion, in the first whole genome report of clonal plasma cells in AL amyloidosis, novel aberrations and hitherto unknown potential adverse prognostic effects were uncovered. PMID:28341732

Single dosing comparison of the relative cardiac beta 1/beta 2 activity of inhaled fenoterol and salbutamol in normal subjects.

PubMed Central

Newnham, D M; Wheeldon, N M; Lipworth, B J; McDevitt, D G

1993-01-01

BACKGROUND--The aim of the present study was to compare the dose related effects of fenoterol and salbutamol on cardiac beta 1 and beta 2 receptors using the beta 1 selective antagonist atenolol, in order to dissect out relative beta 1/beta 2 mediated responses. METHODS--Fourteen normal volunteers were randomised to receive pretreatment with either atenolol 25 mg or placebo, followed by inhaled fenoterol or salbutamol in equal doses by weight (cumulative doses of 1 mg and 4 mg). Measurements were made 30 minutes after inhaling each dose of beta 2 agonist. Values (mean and 95% CI) were expressed as a change from baseline. RESULTS--At 4 mg fenoterol produced equivalent falls in serum potassium and increases in tremor to salbutamol. The mean (95% CI) increase in heart rate (beats/min) with fenoterol at 4 mg after placebo was 47 (41-53) and after atenolol was 34 (28-40), with values for salbutamol being 46 (40-52) after placebo and 30 (24-36) after atenolol. The inotropic response (stroke distance) after atenolol at the 4 mg dose was 5.0 (3.9-6.1) cm for fenoterol and 4.7 (3.5-5.9) cm for salbutamol. There were no significant differences in heart rate or stroke distance response between the two drugs after either placebo or atenolol. Furthermore, ECG effects (Q-Tc and T wave) of fenoterol and salbutamol were comparable at both doses. CONCLUSIONS--These results show that there is no difference in the respective chronotropic or inotropic activities of fenoterol and salbutamol on cardiac beta 1 or beta 2 receptors when given at higher than conventional doses. PMID:8102213

Rasburicase and Allopurinol in Treating Patients With Hematologic Malignancies

ClinicalTrials.gov

2017-12-11

Adult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities; Adult Acute Myeloid Leukemia With Del(5q); Adult Acute Myeloid Leukemia With Inv(16)(p13;q22); Adult Acute Myeloid Leukemia With t(15;17)(q22;q12); Adult Acute Myeloid Leukemia With t(16;16)(p13;q22); Adult Acute Myeloid Leukemia With t(8;21)(q22;q22); Blastic Phase Chronic Myelogenous Leukemia; Contiguous Stage II Adult Burkitt Lymphoma; de Novo Myelodysplastic Syndromes; Noncontiguous Stage II Adult Burkitt Lymphoma; Previously Treated Myelodysplastic Syndromes; Recurrent Adult Acute Lymphoblastic Leukemia; Recurrent Adult Acute Myeloid Leukemia; Recurrent Adult Burkitt Lymphoma; Stage I Adult Burkitt Lymphoma; Stage III Adult Burkitt Lymphoma; Stage IV Adult Burkitt Lymphoma; Untreated Adult Acute Lymphoblastic Leukemia; Untreated Adult Acute Myeloid Leukemia

Evidence that breast cancer risk at the 2q35 locus is mediated through IGFBP5 regulation

PubMed Central

Ghoussaini, Maya; Edwards, Stacey L.; Michailidou, Kyriaki; Nord, Silje; Cowper-Sal·lari, Richard; Desai, Kinjal; Kar, Siddhartha; Hillman, Kristine M.; Kaufmann, Susanne; Glubb, Dylan M.; Beesley, Jonathan; Dennis, Joe; Bolla, Manjeet K.; Wang, Qin; Dicks, Ed; Guo, Qi; Schmidt, Marjanka K.; Shah, Mitul; Luben, Robert; Brown, Judith; Czene, Kamila; Darabi, Hatef; Eriksson, Mikael; Klevebring, Daniel; Bojesen, Stig E.; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Lambrechts, Diether; Thienpont, Bernard; Neven, Patrick; Wildiers, Hans; Broeks, Annegien; Van’t Veer, Laura J.; Th Rutgers, Emiel J.; Couch, Fergus J.; Olson, Janet E.; Hallberg, Emily; Vachon, Celine; Chang-Claude, Jenny; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Peto, Julian; dos-Santos-Silva, Isabel; Gibson, Lorna; Nevanlinna, Heli; Muranen, Taru A.; Aittomäki, Kristiina; Blomqvist, Carl; Hall, Per; Li, Jingmei; Liu, Jianjun; Humphreys, Keith; Kang, Daehee; Choi, Ji-Yeob; Park, Sue K.; Noh, Dong-Young; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Yatabe, Yasushi; Guénel, Pascal; Truong, Thérèse; Menegaux, Florence; Sanchez, Marie; Burwinkel, Barbara; Marme, Frederik; Schneeweiss, Andreas; Sohn, Christof; Wu, Anna H.; Tseng, Chiu-chen; Van Den Berg, David; Stram, Daniel O.; Benitez, Javier; Zamora, M. Pilar; Perez, Jose Ignacio Arias; Menéndez, Primitiva; Shu, Xiao-Ou; Lu, Wei; Gao, Yu-Tang; Cai, Qiuyin; Cox, Angela; Cross, Simon S.; Reed, Malcolm W. R.; Andrulis, Irene L.; Knight, Julia A.; Glendon, Gord; Tchatchou, Sandrine; Sawyer, Elinor J.; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Haiman, Christopher A.; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Lindblom, Annika; Margolin, Sara; TEO, Soo Hwang; YIP, Cheng Har; Lee, Daphne S. C.; Wong, Tien Y.; Hooning, Maartje J.; Martens, John W. M.; Collée, J. Margriet; van Deurzen, Carolien H. M.; Hopper, John L.; Southey, Melissa C.; Tsimiklis, Helen; Kapuscinski, Miroslav K.; Shen, Chen-Yang; Wu, Pei-Ei; Yu, Jyh-Cherng; Chen, Shou-Tung; Alnæs, Grethe Grenaker; Borresen-Dale, Anne-Lise; Giles, Graham G.; Milne, Roger L.; McLean, Catriona; Muir, Kenneth; Lophatananon, Artitaya; Stewart-Brown, Sarah; Siriwanarangsan, Pornthep; Hartman, Mikael; Miao, Hui; Buhari, Shaik Ahmad Bin Syed; Teo, Yik Ying; Fasching, Peter A.; Haeberle, Lothar; Ekici, Arif B.; Beckmann, Matthias W.; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Schoemaker, Minouk J.; García-Closas, Montserrat; Figueroa, Jonine; Chanock, Stephen J.; Lissowska, Jolanta; Simard, Jacques; Goldberg, Mark S.; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Brauch, Hiltrud; Brüning, Thomas; Koto, Yon-Dschun; Radice, Paolo; Peterlongo, Paolo; Bonanni, Bernardo; Volorio, Sara; Dörk, Thilo; Bogdanova, Natalia V.; Helbig, Sonja; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M.; Devilee, Peter; Tollenaar, Robert A. E. M.; Seynaeve, Caroline; Van Asperen, Christi J.; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Slager, Susan; Toland, Amanda E.; Ambrosone, Christine B.; Yannoukakos, Drakoulis; Sangrajrang, Suleeporn; Gaborieau, Valerie; Brennan, Paul; McKay, James; Hamann, Ute; Torres, Diana; Zheng, Wei; Long, Jirong; Anton-Culver, Hoda; Neuhausen, Susan L.; Luccarini, Craig; Baynes, Caroline; Ahmed, Shahana; Maranian, Mel; Healey, Catherine S.; González-Neira, Anna; Pita, Guillermo; Alonso, M. Rosario; Álvarez, Nuria; Herrero, Daniel; Tessier, Daniel C.; Vincent, Daniel; Bacot, Francois; de Santiago, Ines; Carroll, Jason; Caldas, Carlos; Brown, Melissa A.; Lupien, Mathieu; Kristensen, Vessela N.; Pharoah, Paul D P; Chenevix-Trench, Georgia; French, Juliet D; Easton, Douglas F.; Dunning, Alison M.; Chenevix-Trench, Georgia; Webb, Penny; Bowtell, David; De Fazio, Anna

2014-01-01

GWAS have identified a breast cancer susceptibility locus on 2q35. Here we report the fine mapping of this locus using data from 101,943 subjects from 50 case-control studies. We genotype 276 SNPs using the ‘iCOGS’ genotyping array and impute genotypes for a further 1,284 using 1000 Genomes Project data. All but two, strongly correlated SNPs (rs4442975 G/T and rs6721996 G/A) are excluded as candidate causal variants at odds against >100:1. The best functional candidate, rs4442975, is associated with oestrogen receptor positive (ER+) disease with an odds ratio (OR) in Europeans of 0.85 (95% confidence interval=0.84−0.87; P=1.7 × 10−43) per t-allele. This SNP flanks a transcriptional enhancer that physically interacts with the promoter of IGFBP5 (encoding insulin-like growth factor-binding protein 5) and displays allele-specific gene expression, FOXA1 binding and chromatin looping. Evidence suggests that the g-allele confers increased breast cancer susceptibility through relative downregulation of IGFBP5, a gene with known roles in breast cell biology. PMID:25248036

Application of a Delay-difference model for the stock assessment of southern Atlantic albacore ( Thunnus alalunga)

NASA Astrophysics Data System (ADS)

Zhang, Kui; Liu, Qun; Kalhoro, Muhsan Ali

2015-06-01

Delay-difference models are intermediate between simple surplus-production models and complicated age-structured models. Such intermediate models are more efficient and require less data than age-structured models. In this study, a delay-difference model was applied to fit catch and catch per unit effort (CPUE) data (1975-2011) of the southern Atlantic albacore ( Thunnus alalunga) stock. The proposed delay-difference model captures annual fluctuations in predicted CPUE data better than Fox model. In a Monte Carlo simulation, white noises (CVs) were superimposed on the observed CPUE data at four levels. Relative estimate error was then calculated to compare the estimated results with the true values of parameters α and β in Ricker stock-recruitment model and the catchability coefficient q. a is more sensitive to CV than β and q. We also calculated an 80% percentile confidence interval of the maximum sustainable yield (MSY, 21756 t to 23408 t; median 22490 t) with the delay-difference model. The yield of the southern Atlantic albacore stock in 2011 was 24122 t, and the estimated ratios of catch against MSY for the past seven years were approximately 1.0. We suggest that care should be taken to protect the albacore fishery in the southern Atlantic Ocean. The proposed delay-difference model provides a good fit to the data of southern Atlantic albacore stock and may be a useful choice for the assessment of regional albacore stock.

Saddlepoint Approximations in Conditional Inference

DTIC Science & Technology

1990-06-11

Then the inverse transform can be written as (%, Y) = (T, q(T, Z)) for some function q. When the transform is not one to one, the domain should be...general regularity conditions described at the beginning of this section hold and that the solution t1 in (9) exists. Denote the inverse transform by (X, Y...density hn(t 0 l z) are desired. Then the inverse transform (Y, ) = (T, q(T, Z)) exists and the variable v in the cumulant generating function K(u, v

Dynamical properties of the S =1/2 random Heisenberg chain

NASA Astrophysics Data System (ADS)

Shu, Yu-Rong; Dupont, Maxime; Yao, Dao-Xin; Capponi, Sylvain; Sandvik, Anders W.

2018-03-01

We study dynamical properties at finite temperature (T ) of Heisenberg spin chains with random antiferromagnetic exchange couplings, which realize the random singlet phase in the low-energy limit, using three complementary numerical methods: exact diagonalization, matrix-product-state algorithms, and stochastic analytic continuation of quantum Monte Carlo results in imaginary time. Specifically, we investigate the dynamic spin structure factor S (q ,ω ) and its ω →0 limit, which are closely related to inelastic neutron scattering and nuclear magnetic resonance (NMR) experiments (through the spin-lattice relaxation rate 1 /T1 ). Our study reveals a continuous narrow band of low-energy excitations in S (q ,ω ) , extending throughout the q space, instead of being restricted to q ≈0 and q ≈π as found in the uniform system. Close to q =π , the scaling properties of these excitations are well captured by the random-singlet theory, but disagreements also exist with some aspects of the predicted q dependence further away from q =π . Furthermore we also find spin diffusion effects close to q =0 that are not contained within the random-singlet theory but give non-negligible contributions to the mean 1 /T1 . To compare with NMR experiments, we consider the distribution of the local relaxation rates 1 /T1 . We show that the local 1 /T1 values are broadly distributed, approximately according to a stretched exponential. The mean 1 /T1 first decreases with T , but below a crossover temperature it starts to increase and likely diverges in the limit of a small nuclear resonance frequency ω0. Although a similar divergent behavior has been predicted and experimentally observed for the static uniform susceptibility, this divergent behavior of the mean 1 /T1 has never been experimentally observed. Indeed, we show that the divergence of the mean 1 /T1 is due to rare events in the disordered chains and is concealed in experiments, where the typical 1 /T1 value is accessed.

Pegmatite/wallrock interactions, Black Hills, South Dakota: Progressive boron metasomatism adjacent to the Tip Top pegmatite

NASA Astrophysics Data System (ADS)

Shearer, C. K.; Papike, J. J.; Simon, S. B.; Laul, J. C.; Christian, R. P.

1984-12-01

Interaction between country rock and fluids derived from the Tip Top pegmatite has resulted in a series of boron enriched assemblages. Between unaltered quartz-mica schist to the pegmatite contact is a succession of four mineral assemblages: (1) Quartz-Biotite-Potassium Feldspar assemblage (Q-B-K), which consists essentially of the original metamorphic silicate assemblage plus anomalously high amounts of modal tourmaline (2) Quartz-Biotite-Tourmaline assemblage (Q-B-T) (3) Tourmaline-Quartz-Muscovite assemblage (T-Q-M) (4) Tourmaline-Quartz assemblage (T-Q). Alkali elements (Cs, Rb, K, Li), SiO 2, and Ba show a decrease from the Q-B-K assemblage to the T-Q assemblage. A1 2O 3, Ga, B, total Fe and Zn increase moderately from the Q-B-K assemblage to the T-Q assemblage. The mineral chemistries also change considerably. The Mg/(Mg + Fe 2+) ratios in biotites range from 0.54 to 0.50 in samples from the Q-B-K assemblage to 0.39 in the (Q-B-T) assemblage. The range in tourmaline end-member components from the Q-B-K assemblage to the T-Q assemblage is as follows: Q-B-K: Dravite .63 Schorl .23 Elbaite .05 Buergerite .09 T-Q: Dravite .23 Schorl .37 Elbaite .17 Buergerite .23. Observed variations in mineral assemblage and whole rock chemistry within the alteration zone appear to a first approximation to be a function of μB2O3 (boron metasomatism) and μK2O (alkali leaching). The breakdown of feldspar and biotite may be approximated by reactions: 2HCl + 2(K, Na)AlSi 3O 8 /ai 2(K, Na)Cl + Al 2SiO 5 + 5SiO 2 + H 2O and 2 Annite + SiO 2 + 5Al 2SiO 5 + 2NaCl + 6H 3BO 3 /ai 2 Tourmaline + 2KCl + 7H 2O. The alteration zone may represent either a single episode (B-, Cs-, Li-, Rb-enriched fluid) or multiple episodes (B, Zn, Mn fluid and Cs, Li, Rb fluid) of pegmatite fluid-schist interactions. In both situations, B in the aqueous fluid from the pegmatite reacts with the schist breaking down sheet silicate "traps" for Cs, Rb, Li, and K and forming tourmaline-rich assemblages.

Pegmatite/wallrock interactions, Black Hills, South Dakota: Progressive boron metasomatism adjacent to the Tip Top pegmatite

USGS Publications Warehouse

Shearer, C.K.; Papike, J.J.; Simon, S.B.; Laul, J.C.; Christian, R.P.

1984-01-01

Interaction between country rock and fluids derived from the Tip Top pegmatite has resulted in a series of boron enriched assemblages. Between unaltered quartz-mica schist to the pegmatite contact is a succession of four mineral assemblages: 1. (1) Quartz-Biotite-Potassium Feldspar assemblage (Q-B-K), which consists essentially of the original metamorphic silicate assemblage plus anomalously high amounts of modal tourmaline 2. (2) Quartz-Biotite-Tourmaline assemblage (Q-B-T) 3. (3) Tourmaline-Quartz-Muscovite assemblage (T-Q-M) 4. (4) Tourmaline-Quartz assemblage (T-Q). Alkali elements (Cs, Rb, K, Li), SiO2, and Ba show a decrease from the Q-B-K assemblage to the T-Q assemblage. A12O3, Ga, B, total Fe and Zn increase moderately from the Q-B-K assemblage to the T-Q assemblage. The mineral chemistries also change considerably. The Mg/(Mg + Fe2+) ratios in biotites range from 0.54 to 0.50 in samples from the Q-B-K assemblage to 0.39 in the (Q-B-T) assemblage. The range in tourmaline end-member components from the Q-B-K assemblage to the T-Q assemblage is as follows: Q-B-K: Dravite.63 Schorl.23 Elbaite.05 Buergerite.09 T-Q: Dravite.23 Schorl.37 Elbaite.17 Buergerite.23. Observed variations in mineral assemblage and whole rock chemistry within the alteration zone appear to a first approximation to be a function of ??B2O3 (boron metasomatism) and ??K2O (alkali leaching). The breakdown of feldspar and biotite may be approximated by reactions: 2HCl + 2(K, Na)AlSi3O8 /ai 2(K, Na)Cl + Al2SiO5 + 5SiO2 + H2O and 2 Annite + SiO2 + 5Al2SiO5 + 2NaCl + 6H3BO3 /ai 2 Tourmaline + 2KCl + 7H2O. The alteration zone may represent either a single episode (B-, Cs-, Li-, Rb-enriched fluid) or multiple episodes (B, Zn, Mn fluid and Cs, Li, Rb fluid) of pegmatite fluid-schist interactions. In both situations, B in the aqueous fluid from the pegmatite reacts with the schist breaking down sheet silicate "traps" for Cs, Rb, Li, and K and forming tourmaline-rich assemblages. ?? 1984.