The applicability of TaqMan-based quantitative real-time PCR assays for detecting and enumeratIng Cryptosporidium spp. oocysts in the environment

EPA Science Inventory

Molecular detection methods such as PCR have been extensively used to type Cryptosporidium oocysts detected in the environment. More recently, studies have developed quantitative real-time PCR assays for detection and quantification of microbial contaminants in water as well as ...

Single Laboratory Comparison of Quantitative Real-Time PCR Assays for the Detection of Human Fecal Pollution - Poster

EPA Science Inventory

There are numerous quantitative real-time PCR (qPCR) methods available to detect and enumerate human fecal pollution in ambient waters. Each assay employs distinct primers and/or probes and many target different genes and microorganisms leading to potential variations in method p...

Comparative analysis of techniques for detection of quiescent Botrytis cinerea in grapes by quantitative PCR

USDA-ARS?s Scientific Manuscript database

Quantitative PCR (qPCR) can be used to detect and monitor pathogen colonization, but early attempts to apply the technology to quiescent Botrytis cinerea infections of grape berries identified some specific limitations. In this study, four DNA extraction methods, two tissue-grinding methods, two gra...

The detection of large deletions or duplications in genomic DNA.

PubMed

Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

2002-11-01

While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

Quantitation of heparosan with heparin lyase III and spectrophotometry.

PubMed

Huang, Haichan; Zhao, Yingying; Lv, Shencong; Zhong, Weihong; Zhang, Fuming; Linhardt, Robert J

2014-02-15

Heparosan is Escherichia coli K5 capsule polysaccharide, which is the key precursor for preparing bioengineered heparin. A rapid and effective quantitative method for detecting heparosan is important in the large-scale production of heparosan. Heparin lyase III (Hep III) effectively catalyzes the heparosan depolymerization, forming unsaturated disaccharides that are measurable using a spectrophotometer at 232 nm. We report a new method for the quantitative detection of heparosan with heparin lyase III and spectrophotometry that is safer and more specific than the traditional carbazole assay. In an optimized detection system, heparosan at a minimum concentration of 0.60 g/L in fermentation broth can be detected. Copyright © 2013 Elsevier Inc. All rights reserved.

Detection of sex chromosome aneuploidies using quantitative fluorescent PCR in the Hungarian population.

PubMed

Nagy, Balint; Nagy, Richard Gyula; Lazar, Levente; Schonleber, Julianna; Papp, Csaba; Rigo, Janos

2015-05-20

Aneuploidies are the most frequent chromosomal abnormalities at birth. Autosomal aneuploidies cause serious malformations like trisomy 21, trisomy 18 and trisomy 13. However sex chromosome aneuploidies are causing less severe syndromes. For the detection of these aneuploidies, the "gold standard" method is the cytogenetic analysis of fetal cells, karyograms show all numerical and structural abnormalities, but it takes 2-4 weeks to get the reports. Molecular biological methods were developed to overcome the long culture time, thus, FISH and quantitative fluorescent PCR were introduced. In this work we show our experience with a commercial kit for the detection of sex chromosome aneuploidies. We analyzed 20.173 amniotic fluid samples for the period of 2006-2013 in our department. A conventional cytogenetic analysis was performed on the samples. We checked the reliability of quantitative fluorescent PCR and DNA fragment analysis on those samples where sex chromosomal aneuploidy was diagnosed. From the 20.173 amniotic fluid samples we found 50 samples with sex chromosome aneuploidy. There were 19 samples showing 46, XO, 17 samples with 46, XXY, 9 samples with 47, XXX and 5 samples with 47, XYY karyotypes. The applied quantitative fluorescent PCR and DNA fragment analyses method are suitable to detect all abnormal sex chromosome aneuploidies. Quantitative fluorescent PCR is a fast and reliable method for detection of sex chromosome aneuploidies. Copyright © 2015. Published by Elsevier B.V.

Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods.

PubMed

Seo, K H; Valentin-Bon, I E; Brackett, R E

2006-03-01

Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.

Detection methods for biotech cotton MON 15985 and MON 88913 by PCR.

PubMed

Lee, Seong-Hun; Kim, Jin-Kug; Yi, Bu-Young

2007-05-02

Plants derived through agricultural biotechnology, or genetically modified organisms (GMOs), may affect human health and ecological environment. A living GMO is also called a living modified organism (LMO). Biotech cotton is a GMO in food or feed and also an LMO in the environment. Recently, two varieties of biotech cotton, MON 15985 and MON 88913, were developed by Monsanto Co. The detection method is an essential element for the GMO labeling system or LMO management of biotech plants. In this paper, two primer pairs and probes were designed for specific amplification of 116 and 120 bp PCR products from MON 15985 and MON 88913, respectively, with no amplification from any other biotech cotton. Limits of detection of the qualitative method were all 0.05% for MON 15985 and MON 88913. The quantitative method was developed using a TaqMan real-time PCR. A synthetic plasmid, as a reference molecule, was constructed from a taxon-specific DNA sequence of cotton and two construct-specific DNA sequences of MON 15985 and MON 88913. The quantitative method was validated using six samples that contained levels of biotech cotton mixed with conventional cotton ranging from 0.1 to 10.0%. As a result, the biases from the true value and the relative deviations were all within the range of +/-20%. Limits of quantitation of the quantitative method were all 0.1%. Consequently, it is reported that the proposed detection methods were applicable for qualitative and quantitative analyses for biotech cotton MON 15985 and MON 88913.

Study on the Simultaneously Quantitative Detection for β-Lactoglobulin and Lactoferrin of Cow Milk by Using Protein Chip Technique.

PubMed

Yin, Ji Yong; Huo, Jun Sheng; Ma, Xin Xin; Sun, Jing; Huang, Jian

2017-12-01

To research a protein chip method which can simultaneously quantitative detect β-Lactoglobulin (β-L) and Lactoferrin (Lf) at one time. Protein chip printer was used to print both anti-β-L antibodies and anti-Lf antibodies on each block of protein chip. And then an improved sandwich detection method was applied while the other two detecting antibodies for the two antigens were added in the block after they were mixed. The detection conditions of the quantitative detection for simultaneous measurement of β-L and Lf with protein chip were optimized and evaluated. Based on these detected conditions, two standard curves of the two proteins were simultaneously established on one protein chip. Finally, the new detection method was evaluated by using the analysis of precision and accuracy. By comparison experiment, mouse monoclonal antibodies of the two antigens were chosen as the printing probe. The concentrations of β-L and Lf probes were 0.5 mg/mL and 0.5 mg/mL, respectively, while the titers of detection antibodies both of β-L and Lf were 1:2,000. Intra- and inter-assay variability was between 4.88% and 38.33% for all tests. The regression coefficients of protein chip comparing with ELISA for β-L and Lf were better than 0.734, and both of the two regression coefficients were statistically significant (r = 0.734, t = 2.644, P = 0.038; and r = 0.774, t = 2.998, P = 0.024). A protein chip method of simultaneously quantitative detection for β-L and Lf has been established and this method is worthy in further application. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Target-responsive DNAzyme cross-linked hydrogel for visual quantitative detection of lead.

PubMed

Huang, Yishun; Ma, Yanli; Chen, Yahong; Wu, Xuemeng; Fang, Luting; Zhu, Zhi; Yang, Chaoyong James

2014-11-18

Because of the severe health risks associated with lead pollution, rapid, sensitive, and portable detection of low levels of Pb(2+) in biological and environmental samples is of great importance. In this work, a Pb(2+)-responsive hydrogel was prepared using a DNAzyme and its substrate as cross-linker for rapid, sensitive, portable, and quantitative detection of Pb(2+). Gold nanoparticles (AuNPs) were first encapsulated in the hydrogel as an indicator for colorimetric analysis. In the absence of lead, the DNAzyme is inactive, and the substrate cross-linker maintains the hydrogel in the gel form. In contrast, the presence of lead activates the DNAzyme to cleave the substrate, decreasing the cross-linking density of the hydrogel and resulting in dissolution of the hydrogel and release of AuNPs for visual detection. As low as 10 nM Pb(2+) can be detected by the naked eye. Furthermore, to realize quantitative visual detection, a volumetric bar-chart chip (V-chip) was used for quantitative readout of the hydrogel system by replacing AuNPs with gold-platinum core-shell nanoparticles (Au@PtNPs). The Au@PtNPs released from the hydrogel upon target activation can efficiently catalyze the decomposition of H2O2 to generate a large volume of O2. The gas pressure moves an ink bar in the V-chip for portable visual quantitative detection of lead with a detection limit less than 5 nM. The device was able to detect lead in digested blood with excellent accuracy. The method developed can be used for portable lead quantitation in many applications. Furthermore, the method can be further extended to portable visual quantitative detection of a variety of targets by replacing the lead-responsive DNAzyme with other DNAzymes.

[Clinical significance of monitoring BK polyomavirus in patients after hematopoietic stem cell transplantation].

PubMed

Yin, Chang-Xin; Jiang, Qian-Li; He, Han; Yu, Guo-Pan; Xu, Yue; Meng, Fan-Yi; Yang, Mo

2012-02-01

This study was aimed to establish a method for rapid detecting BK polyomavirus (BKV) and to investigate the feasibility and value used in leukemia patients undergoing hematopoietic stem cell transplantation. Primers were designed according to BKV gene sequence; the quantitative standards for BKV and a real-time fluorescent quantitative PCR for BKV were established. The BKV level in urine samples from 36 patients after hematopoietic stem cell transplantation were detected by established method. The results showed that the standard of reconstructed plasmid and real time fluorescent quantitative PCR method were successfully established, its good specificity, sensitivity and stability were confirmed by experiments. BKV was found in 55.56% of urine samples, and the BKV load in urine was 2.46 × 10(4) - 7.8 × 10(9) copy/ml. It is concluded that the establishment of real-time fluorescent quantitative PCR for BKV detection provides a method for early diagnosis of the patients with hemorrhagic cystitis after hematopoietic stem cell transplantation.

Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

PubMed

Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

2015-01-01

The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

EPA Science Inventory

A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

Ratiometric spectral imaging for fast tumor detection and chemotherapy monitoring in vivo

PubMed Central

Hwang, Jae Youn; Gross, Zeev; Gray, Harry B.; Medina-Kauwe, Lali K.; Farkas, Daniel L.

2011-01-01

We report a novel in vivo spectral imaging approach to cancer detection and chemotherapy assessment. We describe and characterize a ratiometric spectral imaging and analysis method and evaluate its performance for tumor detection and delineation by quantitatively monitoring the specific accumulation of targeted gallium corrole (HerGa) into HER2-positive (HER2 +) breast tumors. HerGa temporal accumulation in nude mice bearing HER2 + breast tumors was monitored comparatively by a. this new ratiometric imaging and analysis method; b. established (reflectance and fluorescence) spectral imaging; c. more commonly used fluorescence intensity imaging. We also tested the feasibility of HerGa imaging in vivo using the ratiometric spectral imaging method for tumor detection and delineation. Our results show that the new method not only provides better quantitative information than typical spectral imaging, but also better specificity than standard fluorescence intensity imaging, thus allowing enhanced in vivo outlining of tumors and dynamic, quantitative monitoring of targeted chemotherapy agent accumulation into them. PMID:21721808

Allelic-based gene-gene interaction associated with quantitative traits.

PubMed

Jung, Jeesun; Sun, Bin; Kwon, Deukwoo; Koller, Daniel L; Foroud, Tatiana M

2009-05-01

Recent studies have shown that quantitative phenotypes may be influenced not only by multiple single nucleotide polymorphisms (SNPs) within a gene but also by the interaction between SNPs at unlinked genes. We propose a new statistical approach that can detect gene-gene interactions at the allelic level which contribute to the phenotypic variation in a quantitative trait. By testing for the association of allelic combinations at multiple unlinked loci with a quantitative trait, we can detect the SNP allelic interaction whether or not it can be detected as a main effect. Our proposed method assigns a score to unrelated subjects according to their allelic combination inferred from observed genotypes at two or more unlinked SNPs, and then tests for the association of the allelic score with a quantitative trait. To investigate the statistical properties of the proposed method, we performed a simulation study to estimate type I error rates and power and demonstrated that this allelic approach achieves greater power than the more commonly used genotypic approach to test for gene-gene interaction. As an example, the proposed method was applied to data obtained as part of a candidate gene study of sodium retention by the kidney. We found that this method detects an interaction between the calcium-sensing receptor gene (CaSR), the chloride channel gene (CLCNKB) and the Na, K, 2Cl cotransporter gene (CLC12A1) that contributes to variation in diastolic blood pressure.

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs.

PubMed

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Zel, Jana; Gruden, Kristina

2008-10-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1-25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification.

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs

PubMed Central

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Žel, Jana; Gruden, Kristina

2008-01-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1–25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification. PMID:18710880

Comparison of propidium monoazide-quantitative PCR and reverse transcription quantitative PCR for viability detection of fresh Cryptosporidium oocysts following disinfection and after long-term storage in water samples

EPA Science Inventory

Purified oocysts of Cryptosporidium parvum were used to evaluate applicability of two quantitative PCR (qPCR) viability detection methods in raw surface water and disinfection treated water. Propidium monoazide-qPCR targeting hsp70 gene was compared to reverse transcription (RT)-...

Quantitative Method of Measuring Metastatic Activity

NASA Technical Reports Server (NTRS)

Morrison, Dennis R. (Inventor)

1999-01-01

The metastatic potential of tumors can be evaluated by the quantitative detection of urokinase and DNA. The cell sample selected for examination is analyzed for the presence of high levels of urokinase and abnormal DNA using analytical flow cytometry and digital image analysis. Other factors such as membrane associated uroldnase, increased DNA synthesis rates and certain receptors can be used in the method for detection of potentially invasive tumors.

Methods for Characterization of Alternative RNA Splicing.

PubMed

Harvey, Samuel E; Cheng, Chonghui

2016-01-01

Quantification of alternative splicing to detect the abundance of differentially spliced isoforms of a gene in total RNA can be accomplished via RT-PCR using both quantitative real-time and semi-quantitative PCR methods. These methods require careful PCR primer design to ensure specific detection of particular splice isoforms. We also describe analysis of alternative splicing using a splicing "minigene" in mammalian cell tissue culture to facilitate investigation of the regulation of alternative splicing of a particular exon of interest.

Quantitative secondary electron detection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Agrawal, Jyoti; Joy, David C.; Nayak, Subuhadarshi

Quantitative Secondary Electron Detection (QSED) using the array of solid state devices (SSD) based electron-counters enable critical dimension metrology measurements in materials such as semiconductors, nanomaterials, and biological samples (FIG. 3). Methods and devices effect a quantitative detection of secondary electrons with the array of solid state detectors comprising a number of solid state detectors. An array senses the number of secondary electrons with a plurality of solid state detectors, counting the number of secondary electrons with a time to digital converter circuit in counter mode.

Novel images extraction model using improved delay vector variance feature extraction and multi-kernel neural network for EEG detection and prediction.

PubMed

Ge, Jing; Zhang, Guoping

2015-01-01

Advanced intelligent methodologies could help detect and predict diseases from the EEG signals in cases the manual analysis is inefficient available, for instance, the epileptic seizures detection and prediction. This is because the diversity and the evolution of the epileptic seizures make it very difficult in detecting and identifying the undergoing disease. Fortunately, the determinism and nonlinearity in a time series could characterize the state changes. Literature review indicates that the Delay Vector Variance (DVV) could examine the nonlinearity to gain insight into the EEG signals but very limited work has been done to address the quantitative DVV approach. Hence, the outcomes of the quantitative DVV should be evaluated to detect the epileptic seizures. To develop a new epileptic seizure detection method based on quantitative DVV. This new epileptic seizure detection method employed an improved delay vector variance (IDVV) to extract the nonlinearity value as a distinct feature. Then a multi-kernel functions strategy was proposed in the extreme learning machine (ELM) network to provide precise disease detection and prediction. The nonlinearity is more sensitive than the energy and entropy. 87.5% overall accuracy of recognition and 75.0% overall accuracy of forecasting were achieved. The proposed IDVV and multi-kernel ELM based method was feasible and effective for epileptic EEG detection. Hence, the newly proposed method has importance for practical applications.

Repeatability Assessment by ISO 11843-7 in Quantitative HPLC for Herbal Medicines.

PubMed

Chen, Liangmian; Kotani, Akira; Hakamata, Hideki; Tsutsumi, Risa; Hayashi, Yuzuru; Wang, Zhimin; Kusu, Fumiyo

2015-01-01

We have proposed an assessment methods to estimate the measurement relative standard deviation (RSD) of chromatographic peaks in quantitative HPLC for herbal medicines by the methodology of ISO 11843 Part 7 (ISO 11843-7:2012), which provides detection limits stochastically. In quantitative HPLC with UV detection (HPLC-UV) of Scutellaria Radix for the determination of baicalin, the measurement RSD of baicalin by ISO 11843-7:2012 stochastically was within a 95% confidence interval of the statistically obtained RSD by repetitive measurements (n = 6). Thus, our findings show that it is applicable for estimating of the repeatability of HPLC-UV for determining baicalin without repeated measurements. In addition, the allowable limit of the "System repeatability" in "Liquid Chromatography" regulated in a pharmacopoeia can be obtained by the present assessment method. Moreover, the present assessment method was also successfully applied to estimate the measurement RSDs of quantitative three-channel liquid chromatography with electrochemical detection (LC-3ECD) of Chrysanthemi Flos for determining caffeoylquinic acids and flavonoids. By the present repeatability assessment method, reliable measurement RSD was obtained stochastically, and the experimental time was remarkably reduced.

Quantitation of Specific Barley, Rye, and Oat Marker Peptides by Targeted Liquid Chromatography-Mass Spectrometry To Determine Gluten Concentrations.

PubMed

Schalk, Kathrin; Koehler, Peter; Scherf, Katharina Anne

2018-04-04

Celiac disease is triggered by the ingestion of gluten from wheat, barley, rye, and possibly oats. Gluten is quantitated by DNA-based methods or enzyme-linked immunosorbent assays (ELISAs). ELISAs mostly detect the prolamin fraction and potentially over- or underestimate gluten contents. Therefore, a new independent method is required to comprehensively detect gluten. A targeted liquid chromatography-tandem mass spectrometry method was developed to quantitate seven barley, seven rye, and three oat marker peptides derived from each gluten protein fraction (prolamin and glutelin) and type (barley, B-, C-, D-, and γ-hordeins; rye, γ-75k-, γ-40k-, ω-, and HMW-secalins). The quantitation of each marker peptide in the chymotryptic digest of a defined amount of the respective reference gluten protein type resulted in peptide-specific yields, which enabled the conversion of peptide into protein concentrations. This method was applied to quantitate gluten in samples from the brewing process, in raw materials for sourdough fermentation, and in dried sourdoughs.

EVALUATION OF QUANTITATIVE REAL TIME PCR FOR THE MEASUREMENT OF HELICOBATER PYLORI AT LOW CONCENTRATIONS IN DRINKING WATER

EPA Science Inventory

Aims: To determine the performance of a rapid, real time polymerase chain reaction (PCR) method for the detection and quantitative analysis Helicobacter pylori at low concentrations in drinking water.

Methods and Results: A rapid DNA extraction and quantitative PCR (QPCR)...

Criteria For Evaluation of Proposed Protozoan Detection Methods

EPA Science Inventory

Currently, the only EPA approved method for detection and quantitation of protozoan cysts and oöcysts in source and drinking water, is the “ICR Protozoan Method for Detecting Giardia Cysts and Cryptosporidium Oöcysts in Water by a Fluorescent Antibody Procedure (ICR Microbial La...

[Application of recombinase polymerase amplification in the detection of Pseudomonas aeruginosa].

PubMed

Jin, X J; Gong, Y L; Yang, L; Mo, B H; Peng, Y Z; He, P; Zhao, J N; Li, X L

2018-04-20

Objective: To establish an optimized method of recombinase polymerase amplification (RPA) to rapidly detect Pseudomonas aeruginosa in clinic. Methods: (1) The DNA templates of one standard Pseudomonas aeruginosa strain was extracted and detected by polymerase chain reaction (PCR), real-time fluorescence quantitative PCR and RPA. Time of sample loading, time of amplification, and time of detection of the three methods were recorded. (2) One standard Pseudomonas aeruginosa strain was diluted in 7 concentrations of 1×10(7,) 1×10(6,) 1×10(5,) 1×10(4,) 1×10(3,) 1×10(2,) and 1×10(1) colony forming unit (CFU)/mL after recovery and cultivation. The DNA templates of Pseudomonas aeruginosa and negative control strain Pseudomonas putida were extracted and detected by PCR, real-time fluorescence quantitative PCR, and RPA separately. The sensitivity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (3) The DNA templates of one standard Pseudomonas aeruginosa strain and four negative control strains ( Staphylococcus aureus, Acinetobacter baumanii, Candida albicans, and Pseudomonas putida ) were extracted separately, and then they were detected by PCR, real-time fluorescence quantitative PCR, and RPA. The specificity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (4) The DNA templates of 28 clinical strains of Pseudomonas aeruginosa preserved in glycerin, 1 clinical strain of which was taken by cotton swab, and negative control strain Pseudomonas putida were extracted separately, and then they were detected by RPA. Positive amplification signals of the clinical strains were observed, and the detection rate was calculated. All experiments were repeated for 3 times. Sensitivity results were analyzed by GraphPad Prism 5.01 statistical software. Results: (1) The loading time of RPA, PCR, and real-time fluorescence quantitative PCR for detecting Pseudomonas aeruginosa were all 20 minutes. In PCR, time of amplification was 98 minutes, time of gel detection was 20 minutes, and the total time was 138 minutes. In real-time fluorescence quantitative PCR, amplification and detection could be completed simultaneously, which took 90 minutes, and the total time was 110 minutes. In RPA, amplification and detection could also be completed simultaneously, which took 15 minutes, and the total time was 35 minutes. (2) Pseudomonas putida did not show positive amplification signals or gel positive results in any of the three detection methods. The detection limit of Pseudomonas aeruginosa in real-time fluorescence quantitative PCR and PCR was 1×10(1) CFU/mL, and that of Pseudomonas aeruginosa in RPA was 1×10(2) CFU/mL. In RPA and real-time fluorescence quantitative PCR, the higher the concentration of Pseudomonas aeruginosa, the shorter threshold time and smaller the number of cycles, namely shorter time for detecting the positive amplified signal. In real-time fluorescence quantitative PCR, all positive amplification signal could be detected when the concentration of Pseudomonas aeruginosa was 1×10(1)-1×10(7) CFU/mL. In RPA, the detection rate of positive amplification signal was 0 when the concentration of Pseudomonas aeruginosa was 1×10(1) CFU/mL, while the detection rate of positive amplification signal was 67% when the concentration of Pseudomonas aeruginosa was 1×10(2) CFU/mL, and the detection rate of positive amplification signal was 100% when the concentration of Pseudomonas aeruginosa was 1×10(3)-1×10(7) CFU/mL. (3) In RPA, PCR, and real-time fluorescence quantitative PCR, Pseudomonas aeruginosa showed positive amplification signals and gel positive results, but there were no positive amplification signals or gel positive results in four negative control strains of Acinetobacter baumannii, Staphylococcus aureus, Candida albicans, and Pseudomonas putida . (4) In RPA, 28 clinical strains of Pseudomonas aeruginosa preserved in glycerin and 1 clinical strain of Pseudomonas aeruginosa taken by cotton swab showed positive amplification signals, while Pseudomonas putida did not show positive amplification signal. The detection rate of positive amplification signal of 29 clinical strains of Pseudomonas aeruginosa in RPA was 100%. Conclusions: The established optimized RPA technology for fast detection of Pseudomonas aeruginosa requires shorter time, with high sensitivity and specificity. It was of great value in fast detection of Pseudomonas aeruginosa infection in clinic.

Quantitative method of measuring cancer cell urokinase and metastatic potential

NASA Technical Reports Server (NTRS)

Morrison, Dennis R. (Inventor)

1993-01-01

The metastatic potential of tumors can be evaluated by the quantitative detection of urokinase and DNA. The cell sample selected for examination is analyzed for the presence of high levels of urokinase and abnormal DNA using analytical flow cytometry and digital image analysis. Other factors such as membrane associated urokinase, increased DNA synthesis rates and certain receptors can be used in the method for detection of potentially invasive tumors.

Sensitive elemental detection using microwave-assisted laser-induced breakdown imaging

NASA Astrophysics Data System (ADS)

Iqbal, Adeel; Sun, Zhiwei; Wall, Matthew; Alwahabi, Zeyad T.

2017-10-01

This study reports a sensitive spectroscopic method for quantitative elemental detection by manipulating the temporal and spatial parameters of laser-induced plasma. The method was tested for indium detection in solid samples, in which laser ablation was used to generate a tiny plasma. The lifetime of the laser-induced plasma can be extended to hundreds of microseconds using microwave injection to remobilize the electrons. In this novel method, temporal integrated signal of indium emission was significantly enhanced. Meanwhile, the projected detectable area of the excited indium atoms was also significantly improved using an interference-, instead of diffraction-, based technique, achieved by directly imaging microwave-enhanced plasma through a novel narrow-bandpass filter, exactly centered at the indium emission line. Quantitative laser-induce breakdown spectroscopy was also recorded simultaneously with the new imaging method. The intensities recorded from both methods exhibit very good mutual linear relationship. The detection intensity was improved to 14-folds because of the combined improvements in the plasma lifetime and the area of detection.

A new molecular diagnostic tool for quantitatively detecting and genotyping “Candidatus Liberibacter species”

USDA-ARS?s Scientific Manuscript database

A new molecular diagnostic method was developed for quantitative detection of “Candidatus Liberibacter” species associated with citrus Huanglongbing (“Ca. Liberibacter asiaticus”, “Ca. Liberibacter africanus” and “Ca. Liberibacter americanus”) and potato zebra chip disorder (“Ca. Liberibacter solana...

Quantitative PCR for Detection and Enumeration of Genetic Markers of Bovine Fecal Pollution

EPA Science Inventory

Accurate assessment of health risks associated with bovine (cattle) fecal pollution requires a reliable host-specific genetic marker and a rapid quantification method. We report the development of quantitative PCR assays for the detection of two recently described cow feces-spec...

Quantification of the methylation status of the PWS/AS imprinted region: comparison of two approaches based on bisulfite sequencing and methylation-sensitive MLPA.

PubMed

Dikow, Nicola; Nygren, Anders Oh; Schouten, Jan P; Hartmann, Carolin; Krämer, Nikola; Janssen, Bart; Zschocke, Johannes

2007-06-01

Standard methods used for genomic methylation analysis allow the detection of complete absence of either methylated or non-methylated alleles but are usually unable to detect changes in the proportion of methylated and unmethylated alleles. We compare two methods for quantitative methylation analysis, using the chromosome 15q11-q13 imprinted region as model. Absence of the non-methylated paternal allele in this region leads to Prader-Willi syndrome (PWS) whilst absence of the methylated maternal allele results in Angelman syndrome (AS). A proportion of AS is caused by mosaic imprinting defects which may be missed with standard methods and require quantitative analysis for their detection. Sequence-based quantitative methylation analysis (SeQMA) involves quantitative comparison of peaks generated through sequencing reactions after bisulfite treatment. It is simple, cost-effective and can be easily established for a large number of genes. However, our results support previous suggestions that methods based on bisulfite treatment may be problematic for exact quantification of methylation status. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) avoids bisulfite treatment. It detects changes in both CpG methylation as well as copy number of up to 40 chromosomal sequences in one simple reaction. Once established in a laboratory setting, the method is more accurate, reliable and less time consuming.

Detection of blur artifacts in histopathological whole-slide images of endomyocardial biopsies.

PubMed

Hang Wu; Phan, John H; Bhatia, Ajay K; Cundiff, Caitlin A; Shehata, Bahig M; Wang, May D

2015-01-01

Histopathological whole-slide images (WSIs) have emerged as an objective and quantitative means for image-based disease diagnosis. However, WSIs may contain acquisition artifacts that affect downstream image feature extraction and quantitative disease diagnosis. We develop a method for detecting blur artifacts in WSIs using distributions of local blur metrics. As features, these distributions enable accurate classification of WSI regions as sharp or blurry. We evaluate our method using over 1000 portions of an endomyocardial biopsy (EMB) WSI. Results indicate that local blur metrics accurately detect blurry image regions.

Detection of linkage between a quantitative trait and a marker locus by the lod score method: sample size and sampling considerations.

PubMed

Demenais, F; Lathrop, G M; Lalouel, J M

1988-07-01

A simulation study is here conducted to measure the power of the lod score method to detect linkage between a quantitative trait and a marker locus in various situations. The number of families necessary to detect such linkage with 80% power is assessed for different sets of parameters at the trait locus and different values of the recombination fraction. The effects of varying the mode of sampling families and the sibship size are also evaluated.

Collection of quantitative chemical release field data.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Demirgian, J.; Macha, S.; Loyola Univ.

1999-01-01

Detection and quantitation of chemicals in the environment requires Fourier-transform infrared (FTIR) instruments that are properly calibrated and tested. This calibration and testing requires field testing using matrices that are representative of actual instrument use conditions. Three methods commonly used for developing calibration files and training sets in the field are a closed optical cell or chamber, a large-scale chemical release, and a small-scale chemical release. There is no best method. The advantages and limitations of each method should be considered in evaluating field results. Proper calibration characterizes the sensitivity of an instrument, its ability to detect a component inmore » different matrices, and the quantitative accuracy and precision of the results.« less

On the Agreement between Manual and Automated Methods for Single-Trial Detection and Estimation of Features from Event-Related Potentials

PubMed Central

Biurrun Manresa, José A.; Arguissain, Federico G.; Medina Redondo, David E.; Mørch, Carsten D.; Andersen, Ole K.

2015-01-01

The agreement between humans and algorithms on whether an event-related potential (ERP) is present or not and the level of variation in the estimated values of its relevant features are largely unknown. Thus, the aim of this study was to determine the categorical and quantitative agreement between manual and automated methods for single-trial detection and estimation of ERP features. To this end, ERPs were elicited in sixteen healthy volunteers using electrical stimulation at graded intensities below and above the nociceptive withdrawal reflex threshold. Presence/absence of an ERP peak (categorical outcome) and its amplitude and latency (quantitative outcome) in each single-trial were evaluated independently by two human observers and two automated algorithms taken from existing literature. Categorical agreement was assessed using percentage positive and negative agreement and Cohen’s κ, whereas quantitative agreement was evaluated using Bland-Altman analysis and the coefficient of variation. Typical values for the categorical agreement between manual and automated methods were derived, as well as reference values for the average and maximum differences that can be expected if one method is used instead of the others. Results showed that the human observers presented the highest categorical and quantitative agreement, and there were significantly large differences between detection and estimation of quantitative features among methods. In conclusion, substantial care should be taken in the selection of the detection/estimation approach, since factors like stimulation intensity and expected number of trials with/without response can play a significant role in the outcome of a study. PMID:26258532

Real-time quantitative PCR detection of genetically modified Maximizer maize and Roundup Ready soybean in some representative foods.

PubMed

Vaïtilingom, M; Pijnenburg, H; Gendre, F; Brignon, P

1999-12-01

A fast and quantitative method was developed to detect transgenic "Maximizer" maize "event 176" (Novartis) and "Roundup Ready" soybean (Monsanto) in food by real-time quantitative PCR. The use of the ABI Prism 7700 sequence detection system allowed the determination of the amplified product accumulation through a fluorogenic probe (TaqMan). Fluorescent dyes were chosen in such a way as to coamplify total and transgenic DNA in the same tube. Using real-time quantitative PCR, 2 pg of transgenic or total DNA per gram of starting sample was detected in 3 h after DNA extraction and the relative amounts of "Maximizer" maize and "Roundup Ready" soybean in some representative food products were quantified.

Targeted liquid chromatography tandem mass spectrometry to quantitate wheat gluten using well-defined reference proteins.

PubMed

Schalk, Kathrin; Koehler, Peter; Scherf, Katharina Anne

2018-01-01

Celiac disease (CD) is an inflammatory disorder of the upper small intestine caused by the ingestion of storage proteins (prolamins and glutelins) from wheat, barley, rye, and, in rare cases, oats. CD patients need to follow a gluten-free diet by consuming gluten-free products with gluten contents of less than 20 mg/kg. Currently, the recommended method for the quantitative determination of gluten is an enzyme-linked immunosorbent assay (ELISA) based on the R5 monoclonal antibody. Because the R5 ELISA mostly detects the prolamin fraction of gluten, a new independent method is required to detect prolamins as well as glutelins. This paper presents the development of a method to quantitate 16 wheat marker peptides derived from all wheat gluten protein types by liquid chromatography tandem mass spectrometry (LC-MS/MS) in the multiple reaction monitoring mode. The quantitation of each marker peptide in the chymotryptic digest of a defined amount of the respective reference wheat protein type resulted in peptide-specific yields. This enabled the conversion of peptide into protein type concentrations. Gluten contents were expressed as sum of all determined protein type concentrations. This new method was applied to quantitate gluten in wheat starches and compared to R5 ELISA and gel-permeation high-performance liquid chromatography with fluorescence detection (GP-HPLC-FLD), which resulted in a strong correlation between LC-MS/MS and the other two methods.

Hepatitis C Virus RNA Real-Time Quantitative RT-PCR Method Based on a New Primer Design Strategy.

PubMed

Chen, Lida; Li, Wenli; Zhang, Kuo; Zhang, Rui; Lu, Tian; Hao, Mingju; Jia, Tingting; Sun, Yu; Lin, Guigao; Wang, Lunan; Li, Jinming

2016-01-01

Viral nucleic acids are unstable when improperly collected, handled, and stored, resulting in decreased sensitivity of currently available commercial quantitative nucleic acid testing kits. Using known unstable hepatitis C virus RNA, we developed a quantitative RT-PCR method based on a new primer design strategy to reduce the impact of nucleic acid instability on nucleic acid testing. The performance of the method was evaluated for linearity, limit of detection, precision, specificity, and agreement with commercial hepatitis C virus assays. Its clinical application was compared to that of two commercial kits--Cobas AmpliPrep/Cobas TaqMan (CAP/CTM) and Kehua. The quantitative RT-PCR method delivered a good performance, with a linearity of R(2) = 0.99, a total limit of detection (genotypes 1 to 6) of 42.6 IU/mL (95% CI, 32.84 to 67.76 IU/mL), a CV of 1.06% to 3.34%, a specificity of 100%, and a high concordance with the CAP/CTM assay (R(2) = 0.97), with a means ± SD value of -0.06 ± 1.96 log IU/mL (range, -0.38 to 0.25 log IU/mL). The method was superior to commercial assays in detecting unstable hepatitis C virus RNA (P < 0.05). This quantitative RT-PCR method can effectively eliminate the influence of RNA instability on nucleic acid testing. The principle of primer design strategy may be applied to the detection of other RNA or DNA viruses. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

A new method to evaluate image quality of CBCT images quantitatively without observers

PubMed Central

Shimizu, Mayumi; Okamura, Kazutoshi; Yoshida, Shoko; Weerawanich, Warangkana; Tokumori, Kenji; Jasa, Gainer R; Yoshiura, Kazunori

2017-01-01

Objectives: To develop an observer-free method for quantitatively evaluating the image quality of CBCT images by applying just-noticeable difference (JND). Methods: We used two test objects: (1) a Teflon (polytetrafluoroethylene) plate phantom attached to a dry human mandible; and (2) a block phantom consisting of a Teflon step phantom and an aluminium step phantom. These phantoms had holes with different depths. They were immersed in water and scanned with a CB MercuRay (Hitachi Medical Corporation, Tokyo, Japan) at tube voltages of 120 kV, 100 kV, 80 kV and 60 kV. Superimposed images of the phantoms with holes were used for evaluation. The number of detectable holes was used as an index of image quality. In detecting holes quantitatively, the threshold grey value (ΔG), which differentiated holes from the background, was calculated using a specific threshold (the JND), and we extracted the holes with grey values above ΔG. The indices obtained by this quantitative method (the extracted hole values) were compared with the observer evaluations (the observed hole values). In addition, the contrast-to-noise ratio (CNR) of the shallowest detectable holes and the deepest undetectable holes were measured to evaluate the contribution of CNR to detectability. Results: The results of this evaluation method corresponded almost exactly with the evaluations made by observers. The extracted hole values reflected the influence of different tube voltages. All extracted holes had an area with a CNR of ≥1.5. Conclusions: This quantitative method of evaluating CBCT image quality may be more useful and less time-consuming than evaluation by observation. PMID:28045343

Rapid and potentially portable detection and quantification technologies for foodborne pathogens

USDA-ARS?s Scientific Manuscript database

Introduction Traditional microbial culture methods are able to detect and identify a single specific bacterium, but may require days or weeks and typically do not produce quantitative data. The quest for faster, quantitative results has spurred development of “rapid methods” which usually employ bio...

Influence analysis in quantitative trait loci detection.

PubMed

Dou, Xiaoling; Kuriki, Satoshi; Maeno, Akiteru; Takada, Toyoyuki; Shiroishi, Toshihiko

2014-07-01

This paper presents systematic methods for the detection of influential individuals that affect the log odds (LOD) score curve. We derive general formulas of influence functions for profile likelihoods and introduce them into two standard quantitative trait locus detection methods-the interval mapping method and single marker analysis. Besides influence analysis on specific LOD scores, we also develop influence analysis methods on the shape of the LOD score curves. A simulation-based method is proposed to assess the significance of the influence of the individuals. These methods are shown useful in the influence analysis of a real dataset of an experimental population from an F2 mouse cross. By receiver operating characteristic analysis, we confirm that the proposed methods show better performance than existing diagnostics. © 2014 The Author. Biometrical Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ethanol analysis by headspace gas chromatography with simultaneous flame-ionization and mass spectrometry detection.

PubMed

Tiscione, Nicholas B; Alford, Ilene; Yeatman, Dustin Tate; Shan, Xiaoqin

2011-09-01

Ethanol is the most frequently identified compound in forensic toxicology. Although confirmation involving mass spectrometry is desirable, relatively few methods have been published to date. A novel technique utilizing a Dean's Switch to simultaneously quantitate and confirm ethyl alcohol by flame-ionization (FID) and mass spectrometric (MS) detection after headspace sampling and gas chromatographic separation is presented. Using 100 μL of sample, the limits of detection and quantitation were 0.005 and 0.010 g/dL, respectively. The zero-order linear range (r(2) > 0.990) was determined to span the concentrations of 0.010 to 1.000 g/dL. The coefficient of variation of replicate analyses was less than 3.1%. Quantitative accuracy was within ±8%, ±6%, ±3%, and ±1.5% at concentrations of 0.010, 0.025, 0.080, and 0.300 g/dL, respectively. In addition, 1,1-difluoroethane was validated for qualitative identification by this method. The validated FID-MS method provides a procedure for the quantitation of ethyl alcohol in blood by FID with simultaneous confirmation by MS and can also be utilized as an identification method for inhalants such as 1,1-difluoroethane.

Laboratory Evaluations of the Enterococcus qPCR Method for Recreational Water Quality Testing: Method Performance and Sources of Uncertainty in Quantitative Measurements

EPA Science Inventory

The BEACH Act of 2000 directed the U.S. EPA to establish more expeditious methods for the detection of pathogen indicators in coastal waters, as well as new water quality criteria based on these methods. Progress has been made in developing a quantitative PCR (qPCR) method for en...

Quantitative real-time in vivo detection of magnetic nanoparticles by their nonlinear magnetization

NASA Astrophysics Data System (ADS)

Nikitin, M. P.; Torno, M.; Chen, H.; Rosengart, A.; Nikitin, P. I.

2008-04-01

A novel method of highly sensitive quantitative detection of magnetic nanoparticles (MP) in biological tissues and blood system has been realized and tested in real time in vivo experiments. The detection method is based on nonlinear magnetic properties of MP and the related device can record a very small relative variation of nonlinear magnetic susceptibility up to 10-8 at room temperature, providing sensitivity of several nanograms of MP in 0.1ml volume. Real-time quantitative in vivo measurements of dynamics of MP concentration in blood flow have been performed. A catheter that carried the blood flow of a rat passed through the measuring device. After an MP injection, the quantity of MP in the circulating blood was continuously recorded. The method has also been used to evaluate the MP distribution between rat's organs. Its sensitivity was compared with detection of the radioactive MP based on isotope of Fe59. The comparison of magnetic and radioactive signals in the rat's blood and organ samples demonstrated similar sensitivity for both methods. However, the proposed magnetic method is much more convenient as it is safe, less expensive, and provides real-time measurements in vivo. Moreover, the sensitivity of the method can be further improved by optimization of the device geometry.

Rapid and Quantitative Detection of Vibrio parahemolyticus by the Mixed-Dye-Based Loop-Mediated Isothermal Amplification Assay on a Self-Priming Compartmentalization Microfluidic Chip.

PubMed

Pang, Bo; Ding, Xiong; Wang, Guoping; Zhao, Chao; Xu, Yanan; Fu, Kaiyue; Sun, Jingjing; Song, Xiuling; Wu, Wenshuai; Liu, Yushen; Song, Qi; Hu, Jiumei; Li, Juan; Mu, Ying

2017-12-27

Vibrio parahemolyticus (VP) mostly isolated from aquatic products is one of the major causes of bacterial food-poisoning events worldwide, which could be reduced using a promising on-site detection method. Herein, a rapid and quantitative method for VP detection was developed by applying a mixed-dye-loaded loop-mediated isothermal amplification (LAMP) assay on a self-priming compartmentalization (SPC) microfluidic chip, termed on-chip mixed-dye-based LAMP (CMD-LAMP). In comparison to conventional approaches, CMD-LAMP was advantageous on the limit of detection, which reached down to 1 × 10 3 CFU/mL in food-contaminated samples without the pre-enrichment of bacteria. Additionally, as a result of the use of a mixed dye and SPC chip, the quantitative result could be easily acquired, avoiding the requirement of sophisticated instruments and tedious operation. Also, CMD-LAMP was rapid and cost-effective. Conclusively, CMD-LAMP has great potential in realizing the on-site quantitative analysis of VP for food safety.

Detection and quantification of ginsenoside Re in ginseng samples by a chromatographic immunostaining method using monoclonal antibody against ginsenoside Re.

PubMed

Morinaga, Osamu; Tanaka, Hiroyuki; Shoyama, Yukihiro

2006-01-02

A chromatographic immunostaining method has been developed for the determination of ginsenoside Re (G-Re) in ginseng samples on a polyethersulphone (PES) membrane. G-Re standard and the extracts of ginseng roots were applied to a PES membrane and developed by methanol-water-acetic acid (45:55:1, by volume). G-Re was clearly detected by an immunostaining method using a monoclonal antibody against G-Re. The coloring spots of G-Re were analyzed quantitatively using NIH Image software indicating at least 0.125 microg of G-Re was detectable. G-Re can be analyzed quantitatively between 0.25 and 4.0 microg.

Rapid quantitative detection of glucose content in glucose injection by reaction headspace gas chromatography.

PubMed

Xie, Wei-Qi; Gong, Yi-Xian; Yu, Kong-Xian

2017-10-20

This work investigates an automated technique for rapid detecting the glucose content in glucose injection by reaction headspace gas chromatography (HS-GC). This method is based on the oxidation reaction of glucose in glucose injection with potassium dichromate. The carbon dioxide (CO 2 ) formed from the oxidation reaction can be quantitatively detected by GC. The results show that the relative standard deviation (RSD) of the present method was within 2.91%, and the measured glucose contents in glucose injection closely match those quantified by the reference method (relative differences <6.45%). The new HS-GC technique is rapid, practical and can be used to the batch detection of the glucose content in glucose injection related applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Quantitative and multiplexed detection for blood typing based on quantum dot-magnetic bead assay.

PubMed

Xu, Ting; Zhang, Qiang; Fan, Ya-Han; Li, Ru-Qing; Lu, Hua; Zhao, Shu-Ming; Jiang, Tian-Lun

2017-01-01

Accurate and reliable blood grouping is essential for safe blood transfusion. However, conventional methods are qualitative and use only single-antigen detection. We overcame these limitations by developing a simple, quantitative, and multiplexed detection method for blood grouping using quantum dots (QDs) and magnetic beads. In the QD fluorescence assay (QFA), blood group A and B antigens were quantified using QD labeling and magnetic beads, and the blood groups were identified according to the R value (the value was calculated with the fluorescence intensity from dual QD labeling) of A and B antigens. The optimized performance of QFA was established by blood typing 791 clinical samples. Quantitative and multiplexed detection for blood group antigens can be completed within 35 min with more than 10 5 red blood cells. When conditions are optimized, the assay performance is satisfactory for weak samples. The coefficients of variation between and within days were less than 10% and the reproducibility was good. The ABO blood groups of 791 clinical samples were identified by QFA, and the accuracy obtained was 100% compared with the tube test. Receiver-operating characteristic curves revealed that the QFA has high sensitivity and specificity toward clinical samples, and the cutoff points of the R value of A and B antigens were 1.483 and 1.576, respectively. In this study, we reported a novel quantitative and multiplexed method for the identification of ABO blood groups and presented an effective alternative for quantitative blood typing. This method can be used as an effective tool to improve blood typing and further guarantee clinical transfusion safety.

Micro-vibration detection with heterodyne holography based on time-averaged method

NASA Astrophysics Data System (ADS)

Qin, XiaoDong; Pan, Feng; Chen, ZongHui; Hou, XueQin; Xiao, Wen

2017-02-01

We propose a micro-vibration detection method by introducing heterodyne interferometry to time-averaged holography. This method compensates for the deficiency of time-average holography in quantitative measurements and widens its range of application effectively. Acousto-optic modulators are used to modulate the frequencies of the reference beam and the object beam. Accurate detection of the maximum amplitude of each point in the vibration plane is performed by altering the frequency difference of both beams. The range of amplitude detection of plane vibration is extended. In the stable vibration mode, the distribution of the maximum amplitude of each point is measured and the fitted curves are plotted. Hence the plane vibration mode of the object is demonstrated intuitively and detected quantitatively. We analyzed the method in theory and built an experimental system with a sine signal as the excitation source and a typical piezoelectric ceramic plate as the target. The experimental results indicate that, within a certain error range, the detected vibration mode agrees with the intrinsic vibration characteristics of the object, thus proving the validity of this method.

Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR

PubMed Central

2010-01-01

Background Human papillomaviruses (HPVs) remain a serious world health problem due to their association with anogenital/oral cancers and warts. While over 100 HPV types have been identified, a subset is associated with malignancy. HPV16 and 18 are the most prevalent oncogenic types, while HPV6 and 11 are most commonly responsible for anogenital warts. While other quantitative PCR (qPCR) assays detect oncogenic HPV, there is no single tube assay distinguishing the most frequent oncogenic types and the most common types found in warts. Results A Sybr Green-based qPCR assay was developed utilizing degenerate primers to the highly conserved HPV E1 theoretically detecting any HPV type. A single tube multiplex qPCR assay was also developed using type-specific primer pairs and TaqMan probes that allowed for detection and quantitation of HPV6,11,16,18. Each HPV type was detected over a range from 2 × 101 to 2 × 106copies/reaction providing a reliable method of quantitating type-specific HPV in 140 anogenital/cutaneous/oral benign and malignant specimens. 35 oncogenic and low risk alpha genus HPV types were detected. Concordance was detected in previously typed specimens. Comparisons to the gold standard detected an overall sensitivity of 89% (95% CI: 77% - 96%) and specificity of 90% (95%CI: 52% - 98%). Conclusion There was good agreement between the ability of the qPCR assays described here to identify HPV types in malignancies previously typed using standard methods. These novel qPCR assays will allow rapid detection and quantitation of HPVs to assess their role in viral pathogenesis. PMID:20723234

Targeted liquid chromatography tandem mass spectrometry to quantitate wheat gluten using well-defined reference proteins

PubMed Central

Schalk, Kathrin; Koehler, Peter

2018-01-01

Celiac disease (CD) is an inflammatory disorder of the upper small intestine caused by the ingestion of storage proteins (prolamins and glutelins) from wheat, barley, rye, and, in rare cases, oats. CD patients need to follow a gluten-free diet by consuming gluten-free products with gluten contents of less than 20 mg/kg. Currently, the recommended method for the quantitative determination of gluten is an enzyme-linked immunosorbent assay (ELISA) based on the R5 monoclonal antibody. Because the R5 ELISA mostly detects the prolamin fraction of gluten, a new independent method is required to detect prolamins as well as glutelins. This paper presents the development of a method to quantitate 16 wheat marker peptides derived from all wheat gluten protein types by liquid chromatography tandem mass spectrometry (LC-MS/MS) in the multiple reaction monitoring mode. The quantitation of each marker peptide in the chymotryptic digest of a defined amount of the respective reference wheat protein type resulted in peptide-specific yields. This enabled the conversion of peptide into protein type concentrations. Gluten contents were expressed as sum of all determined protein type concentrations. This new method was applied to quantitate gluten in wheat starches and compared to R5 ELISA and gel-permeation high-performance liquid chromatography with fluorescence detection (GP-HPLC-FLD), which resulted in a strong correlation between LC-MS/MS and the other two methods. PMID:29425234

Ultratrace level determination and quantitative analysis of kidney injury biomarkers in patient samples attained by zinc oxide nanorods

NASA Astrophysics Data System (ADS)

Singh, Manpreet; Alabanza, Anginelle; Gonzalez, Lorelis E.; Wang, Weiwei; Reeves, W. Brian; Hahm, Jong-In

2016-02-01

Determining ultratrace amounts of protein biomarkers in patient samples in a straightforward and quantitative manner is extremely important for early disease diagnosis and treatment. Here, we successfully demonstrate the novel use of zinc oxide nanorods (ZnO NRs) in the ultrasensitive and quantitative detection of two acute kidney injury (AKI)-related protein biomarkers, tumor necrosis factor (TNF)-α and interleukin (IL)-8, directly from patient samples. We first validate the ZnO NRs-based IL-8 results via comparison with those obtained from using a conventional enzyme-linked immunosorbent method in samples from 38 individuals. We further assess the full detection capability of the ZnO NRs-based technique by quantifying TNF-α, whose levels in human urine are often below the detection limits of conventional methods. Using the ZnO NR platforms, we determine the TNF-α concentrations of all 46 patient samples tested, down to the fg per mL level. Subsequently, we screen for TNF-α levels in approximately 50 additional samples collected from different patient groups in order to demonstrate a potential use of the ZnO NRs-based assay in assessing cytokine levels useful for further clinical monitoring. Our research efforts demonstrate that ZnO NRs can be straightforwardly employed in the rapid, ultrasensitive, quantitative, and simultaneous detection of multiple AKI-related biomarkers directly in patient urine samples, providing an unparalleled detection capability beyond those of conventional analysis methods. Additional key advantages of the ZnO NRs-based approach include a fast detection speed, low-volume assay condition, multiplexing ability, and easy automation/integration capability to existing fluorescence instrumentation. Therefore, we anticipate that our ZnO NRs-based detection method will be highly beneficial for overcoming the frequent challenges in early biomarker development and treatment assessment, pertaining to the facile and ultrasensitive quantification of hard-to-trace biomolecules.Determining ultratrace amounts of protein biomarkers in patient samples in a straightforward and quantitative manner is extremely important for early disease diagnosis and treatment. Here, we successfully demonstrate the novel use of zinc oxide nanorods (ZnO NRs) in the ultrasensitive and quantitative detection of two acute kidney injury (AKI)-related protein biomarkers, tumor necrosis factor (TNF)-α and interleukin (IL)-8, directly from patient samples. We first validate the ZnO NRs-based IL-8 results via comparison with those obtained from using a conventional enzyme-linked immunosorbent method in samples from 38 individuals. We further assess the full detection capability of the ZnO NRs-based technique by quantifying TNF-α, whose levels in human urine are often below the detection limits of conventional methods. Using the ZnO NR platforms, we determine the TNF-α concentrations of all 46 patient samples tested, down to the fg per mL level. Subsequently, we screen for TNF-α levels in approximately 50 additional samples collected from different patient groups in order to demonstrate a potential use of the ZnO NRs-based assay in assessing cytokine levels useful for further clinical monitoring. Our research efforts demonstrate that ZnO NRs can be straightforwardly employed in the rapid, ultrasensitive, quantitative, and simultaneous detection of multiple AKI-related biomarkers directly in patient urine samples, providing an unparalleled detection capability beyond those of conventional analysis methods. Additional key advantages of the ZnO NRs-based approach include a fast detection speed, low-volume assay condition, multiplexing ability, and easy automation/integration capability to existing fluorescence instrumentation. Therefore, we anticipate that our ZnO NRs-based detection method will be highly beneficial for overcoming the frequent challenges in early biomarker development and treatment assessment, pertaining to the facile and ultrasensitive quantification of hard-to-trace biomolecules. Electronic supplementary information (ESI) available: Typical SEM images of the ZnO NRs used in the biomarker assays are provided in Fig. S1. See DOI: 10.1039/c5nr08706f

[Comparative analysis of real-time quantitative PCR-Sanger sequencing method and TaqMan probe method for detection of KRAS/BRAF mutation in colorectal carcinomas].

PubMed

Zhang, Xun; Wang, Yuehua; Gao, Ning; Wang, Jinfen

2014-02-01

To compare the application values of real-time quantitative PCR-Sanger sequencing and TaqMan probe method in the detection of KRAS and BRAF mutations, and to correlate KRAS/BRAF mutations with the clinicopathological characteristics in colorectal carcinomas. Genomic DNA of the tumor cells was extracted from formalin fixed paraffin embedded (FFPE) tissue samples of 344 colorectal carcinomas by microdissection. Real-time quantitative PCR-Sanger sequencing and TaqMan probe method were performed to detect the KRAS/BRAF mutations. The frequency and types of KRAS/BRAF mutations, clinicopathological characteristics and survival time were analyzed. KRAS mutations were detected in 39.8% (137/344) and 38.7% (133/344) of 344 colorectal carcinomas by using real-time quantitative PCR-Sanger sequencing and TaqMan probe method, respectively. BRAF mutation was detected in 4.7% (16/344) and 4.1% (14/344), respectively. There was no significant correlation between the two methods. The frequency of the KRAS mutation in female was higher than that in male (P < 0.05). The frequency of the BRAF mutation in colon was higher than that in rectum. The frequency of the BRAF mutation in stage III-IV cases was higher than that in stageI-II cases. The frequency of the BRAF mutation in signet ring cell carcinoma was higher than that in mucinous carcinoma and nonspecific adenocarcinoma had the lowest mutation rate. The frequency of the BRAF mutation in grade III cases was higher than that in grade II cases (P < 0.05). The overall concordance for the two methods of KRAS/BRAF mutation detection was 98.8% (kappa = 0.976). There was statistic significance between BRAF and KRAS mutations for the survival time of colorectal carcinomas (P = 0.039). There were no statistic significance between BRAF mutation type and BRAF/KRAS wild type (P = 0.058). (1) Compared with real-time quantitative PCR-Sanger sequencing, TaqMan probe method is better with regard to handling time, efficiency, repeatability, cost and equipment. (2) The frequency of the KRAS mutation is correlated with gender. BRAF mutation is correlated with primary tumor site, TNM stage, histological types and histological grades.(3) BRAF gene mutation is an independent prognostic marker for colorectal carcinomas.

Quantitation of acrylamide in foods by high-resolution mass spectrometry.

PubMed

Troise, Antonio Dario; Fiore, Alberto; Fogliano, Vincenzo

2014-01-08

Acrylamide detection still represents one of the hottest topics in food chemistry. Solid phase cleanup coupled to liquid chromatography separation and tandem mass spectrometry detection along with GC-MS detection are nowadays the gold standard procedure for acrylamide quantitation thanks to high reproducibility, good recovery, and low relative standard deviation. High-resolution mass spectrometry (HRMS) is particularly suitable for the detection of low molecular weight amides, and it can provide some analytical advantages over other MS techniques. In this paper a liquid chromatography (LC) method for acrylamide determination using HRMS detection was developed and compared to LC coupled to tandem mass spectrometry. The procedure applied a simplified extraction, no cleanup steps, and a 4 min chromatography. It proved to be solid and robust with an acrylamide mass accuracy of 0.7 ppm, a limit of detection of 2.65 ppb, and a limit of quantitation of 5 ppb. The method was tested on four acrylamide-containing foods: cookies, French fries, ground coffee, and brewed coffee. Results were perfectly in line with those obtained by LC-MS/MS.

A strategy to apply quantitative epistasis analysis on developmental traits.

PubMed

Labocha, Marta K; Yuan, Wang; Aleman-Meza, Boanerges; Zhong, Weiwei

2017-05-15

Genetic interactions are keys to understand complex traits and evolution. Epistasis analysis is an effective method to map genetic interactions. Large-scale quantitative epistasis analysis has been well established for single cells. However, there is a substantial lack of such studies in multicellular organisms and their complex phenotypes such as development. Here we present a method to extend quantitative epistasis analysis to developmental traits. In the nematode Caenorhabditis elegans, we applied RNA interference on mutants to inactivate two genes, used an imaging system to quantitatively measure phenotypes, and developed a set of statistical methods to extract genetic interactions from phenotypic measurement. Using two different C. elegans developmental phenotypes, body length and sex ratio, as examples, we showed that this method could accommodate various metazoan phenotypes with performances comparable to those methods in single cell growth studies. Comparing with qualitative observations, this method of quantitative epistasis enabled detection of new interactions involving subtle phenotypes. For example, several sex-ratio genes were found to interact with brc-1 and brd-1, the orthologs of the human breast cancer genes BRCA1 and BARD1, respectively. We confirmed the brc-1 interactions with the following genes in DNA damage response: C34F6.1, him-3 (ortholog of HORMAD1, HORMAD2), sdc-1, and set-2 (ortholog of SETD1A, SETD1B, KMT2C, KMT2D), validating the effectiveness of our method in detecting genetic interactions. We developed a reliable, high-throughput method for quantitative epistasis analysis of developmental phenotypes.

Comparative evaluation of two Rickettsia typhi-specific quantitative real-time PCRs for research and diagnostic purposes.

PubMed

Papp, Stefanie; Rauch, Jessica; Kuehl, Svenja; Richardt, Ulricke; Keller, Christian; Osterloh, Anke

2017-02-01

Rickettsioses are caused by intracellular bacteria of the family of Rickettsiaceae. Rickettsia (R.) typhi is the causative agent of endemic typhus. The disease occurs worldwide and is one of the most prevalent rickettsioses. Rickettsial diseases, however, are generally underdiagnosed which is mainly due to the lack of sensitive and specific methods. In addition, methods for quantitative detection of the bacteria for research purposes are rare. We established two qPCRs for the detection of R. typhi by amplification of the outer membrane protein B (ompB) and parvulin-type PPIase (prsA) genes. Both qPCRs are specific and exclusively recognize R. typhi but no other rickettsiae including the closest relative, R. prowazekii. The prsA-based qPCR revealed to be much more sensitive than the amplification of ompB and provided highly reproducible results in the detection of R. typhi in organs of infected mice. Furthermore, as a nested PCR the prsA qPCR was applicable for the detection of R. typhi in human blood samples. Collectively, the prsA-based qPCR represents a reliable method for the quantitative detection of R. typhi for research purposes and is a promising candidate for differential diagnosis.

[Isolation and identification of Cronobacter (Enterobacter sakazakii) strains from food].

PubMed

Dong, Xiaohui; Li, Chengsi; Wu, Qingping; Zhang, Jumei; Mo, Shuping; Guo, Weipeng; Yang, Xiaojuan; Xu, Xiaoke

2013-05-04

This study aimed to detect and quantify Cronobacter in 300 powdered milk samples and 50 non-powdered milk samples. Totally, 24 Cronobacter (formerly Enterobacter sakazakii) strains isolated from powdered milk and other foods were identified and confirmed. Cronobacter strains were detected quantitatively using most probable number (MPN) method and molecular detection method. We identified 24 Cronobacter strains using biochemical patterns, including indole production and dulcitol, malonate, melezitose, turanose, and myo-Inositol utilization. Of the 24 strains, their 16S rRNA genes were sequenced, and constructed phylogenetic tree by N-J (Neighbour-Joining) with the 16S rRNA gene sequences of 17 identified Cronobacter strains and 10 non-Cronobacter strains. Quantitative detection showed that Cronobacter strains were detected in 23 out of 350 samples yielding 6.6% detection rate. Twenty-four Cronobacter strains were isolated from 23 samples and the Cronobacter was more than 100 MPN/100g in 4 samples out of 23 samples. The 24 Cronobacter spp. isolates strains were identified and confirmed, including 19 Cronobacter sakazakii strains, 2 C. malonaticus strains, 2 C. dubliensis subsp. lactaridi strains, and 1 C. muytjensii strain. The combination of molecular detection method and most probable number (MPN) method could be suitable for the detection of Cronobacter in powdered milk, with low rate of contamination and high demand of quantitative detection. 24 isolated strains were confirmed and identified by biochemical patterns and molecular technology, and C. sakazakii could be the dominant species. The problem of Cronobacter in powdered milk should be a hidden danger to nurseling, and should catch the government and consumer's attention.

Quantitative detection of the colloidal gold immunochromatographic strip in HSV color space

NASA Astrophysics Data System (ADS)

Wu, Yuanshu; Gao, Yueming; Du, Min

2014-09-01

In this paper, a fast, reliable and accurate quantitative detection method for the colloidal gold immunochromatographic strip(GICA) is presented. An image acquisition device which is mainly composed of annular LED source, zoom ratio lens, and 10bit CMOS image sensors with 54.5dB SNR is designed for the detection. Firstly, the test line is extracted from the strip window through using the H component peak points of the HSV space as the clustering centers via the Fuzzy C-Means(FCM) clustering method. Then, a two dimensional eigenvalue composed with the hue(H) and saturation(S) of HSV space was proposed to improve the accuracy of the quantitative detection. At last, the experiment of human chorionic gonadotropin(HCG) with the concentration range 0-500mIU/mL is carried out. The results show that the linear correlation coefficient between this method and optical density(OD) values measured by the fiber optical sensor reach 96.74%. Meanwhile, the linearity of fitting curve constructed with concentration was greater than 95.00%.

Development of a comprehensive analytical platform for the detection and quantitation of food fraud using a biomarker approach. The oregano adulteration case study.

PubMed

Wielogorska, Ewa; Chevallier, Olivier; Black, Connor; Galvin-King, Pamela; Delêtre, Marc; Kelleher, Colin T; Haughey, Simon A; Elliott, Christopher T

2018-01-15

Due to increasing number of food fraud incidents, there is an inherent need for the development and implementation of analytical platforms enabling detection and quantitation of adulteration. In this study a set of unique biomarkers of commonly found oregano adulterants became the targets in the development of a LC-MS/MS method which underwent a rigorous in-house validation. The method presented very high selectivity and specificity, excellent linearity (R 2 >0.988) low decision limits and detection capabilities (<2%), acceptable accuracy (intra-assay 92-113%, inter-assay 69-138%) and precision (CV<20%). The method was compared with an established FTIR screening assay and revealed a good correlation of quali- and quantitative results (R 2 >0.81). An assessment of 54 suspected adulterated oregano samples revealed that almost 90% of them contained at least one bulking agent, with a median level of adulteration of 50%. Such innovative methodologies need to be established as routine testing procedures to detect and ultimately deter food fraud. Copyright © 2017 Elsevier Ltd. All rights reserved.

[Multiplex real-time PCR method for rapid detection of Marburg virus and Ebola virus].

PubMed

Yang, Yu; Bai, Lin; Hu, Kong-Xin; Yang, Zhi-Hong; Hu, Jian-Ping; Wang, Jing

2012-08-01

Marburg virus and Ebola virus are acute infections with high case fatality rates. A rapid, sensitive detection method was established to detect Marburg virus and Ebola virus by multiplex real-time fluorescence quantitative PCR. Designing primers and Taqman probes from highly conserved sequences of Marburg virus and Ebola virus through whole genome sequences alignment, Taqman probes labeled by FAM and Texas Red, the sensitivity of the multiplex real-time quantitative PCR assay was optimized by evaluating the different concentrations of primers and Probes. We have developed a real-time PCR method with the sensitivity of 30.5 copies/microl for Marburg virus positive plasmid and 28.6 copies/microl for Ebola virus positive plasmids, Japanese encephalitis virus, Yellow fever virus, Dengue virus were using to examine the specificity. The Multiplex real-time PCR assays provide a sensitive, reliable and efficient method to detect Marburg virus and Ebola virus simultaneously.

Caries Detection Methods Based on Changes in Optical Properties between Healthy and Carious Tissue

PubMed Central

Karlsson, Lena

2010-01-01

A conservative, noninvasive or minimally invasive approach to clinical management of dental caries requires diagnostic techniques capable of detecting and quantifying lesions at an early stage, when progression can be arrested or reversed. Objective evidence of initiation of the disease can be detected in the form of distinct changes in the optical properties of the affected tooth structure. Caries detection methods based on changes in a specific optical property are collectively referred to as optically based methods. This paper presents a simple overview of the feasibility of three such technologies for quantitative or semiquantitative assessment of caries lesions. Two of the techniques are well-established: quantitative light-induced fluorescence, which is used primarily in caries research, and laser-induced fluorescence, a commercially available method used in clinical dental practice. The third technique, based on near-infrared transillumination of dental enamel is in the developmental stages. PMID:20454579

Detection of Legionella species in environmental water by the quantitative PCR method in combination with ethidium monoazide treatment.

PubMed

Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio

2015-01-01

We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.

Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

PubMed

Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

2014-01-01

A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

Apricot DNA as an indicator for persipan: detection and quantitation in marzipan using ligation-dependent probe amplification.

PubMed

Luber, Florian; Demmel, Anja; Hosken, Anne; Busch, Ulrich; Engel, Karl-Heinz

2012-06-13

The confectionery ingredient marzipan is exclusively prepared from almond kernels and sugar. The potential use of apricot kernels, so-called persipan, is an important issue for the quality assessment of marzipan. Therefore, a ligation-dependent probe amplification (LPA) assay was developed that enables a specific and sensitive detection of apricot DNA, as an indicator for the presence of persipan. The limit of detection was determined to be 0.1% persipan in marzipan. The suitability of the method was confirmed by the analysis of 20 commercially available food samples. The integration of a Prunus -specific probe in the LPA assay as a reference allowed for the relative quantitation of persipan in marzipan. The limit of quantitation was determined to be 0.5% persipan in marzipan. The analysis of two self-prepared mixtures of marzipan and persipan demonstrated the applicability of the quantitation method at concentration levels of practical relevance for quality control.

New Performance Metrics for Quantitative Polymerase Chain Reaction-Based Microbial Source Tracking Methods

EPA Science Inventory

Binary sensitivity and specificity metrics are not adequate to describe the performance of quantitative microbial source tracking methods because the estimates depend on the amount of material tested and limit of detection. We introduce a new framework to compare the performance ...

Analysis of Ergot Alkaloids

PubMed Central

Crews, Colin

2015-01-01

The principles and application of established and newer methods for the quantitative and semi-quantitative determination of ergot alkaloids in food, feed, plant materials and animal tissues are reviewed. The techniques of sampling, extraction, clean-up, detection, quantification and validation are described. The major procedures for ergot alkaloid analysis comprise liquid chromatography with tandem mass spectrometry (LC-MS/MS) and liquid chromatography with fluorescence detection (LC-FLD). Other methods based on immunoassays are under development and variations of these and minor techniques are available for specific purposes. PMID:26046699

Development and Application of Quantitative Detection Method for Viral Hemorrhagic Septicemia Virus (VHSV) Genogroup IVa

PubMed Central

Kim, Jong-Oh; Kim, Wi-Sik; Kim, Si-Woo; Han, Hyun-Ja; Kim, Jin Woo; Park, Myoung Ae; Oh, Myung-Joo

2014-01-01

Viral hemorrhagic septicemia virus (VHSV) is a problematic pathogen in olive flounder (Paralichthys olivaceus) aquaculture farms in Korea. Thus, it is necessary to develop a rapid and accurate diagnostic method to detect this virus. We developed a quantitative RT-PCR (qRT-PCR) method based on the nucleocapsid (N) gene sequence of Korean VHSV isolate (Genogroup IVa). The slope and R2 values of the primer set developed in this study were −0.2928 (96% efficiency) and 0.9979, respectively. Its comparison with viral infectivity calculated by traditional quantifying method (TCID50) showed a similar pattern of kinetic changes in vitro and in vivo. The qRT-PCR method reduced detection time compared to that of TCID50, making it a very useful tool for VHSV diagnosis. PMID:24859343

Detection of Protein Modifications and Counterfeit Protein Pharmaceuticals Using iTRAQ and MALDI TOF/TOF Mass Spectrometry: Studies with Insulins

PubMed Central

Ye, Hongping; Hill, John; Kauffman, John; Gryniewicz, Connie; Han, Xianlin

2013-01-01

iTRAQ (isotope tags for relative and absolute quantification) reagent coupled with MALDI TOF/TOF mass spectrometric analysis has been evaluated as both a qualitative and quantitative method for the detection of modifications to active pharmaceutical ingredients derived from recombinant DNA technologies, and as a method to detect counterfeit drug products. Five types of insulin (human, bovine, porcine, Lispro, Lantus®) were used as model products in the study because of their minor variations in amino acid sequence. Several experiments were conducted in which each insulin variant was separately digested with Glu-C, and the digestate was labeled with one of four different iTRAQ reagents. All digestates were then combined for desalting and MALDI TOF/TOF mass spectrometric analysis. When the digestion procedure was optimized, the insulin sequence coverage was 100%. Five different types of insulin were readily differentiated, including Human insulin (P28K29) and Lispro (K28P29), which only differ by the interchange of two contiguous residues. Moreover, quantitative analyses show that the results obtained from the iTRAQ method agree well with those determined by other conventional methods. Collectively, the iTRAQ method can be used as a qualitative and quantitative technique for the detection of protein modification and counterfeiting. PMID:18489896

Performance of two quantitative PCR methods for microbial source tracking of human sewage and implications for microbial risk assessment in recreational waters

EPA Science Inventory

Before new, rapid quantitative PCR (qPCR) methods for recreational water quality assessment and microbial source tracking (MST) can be useful in a regulatory context, an understanding of the ability of the method to detect a DNA target (marker) when the contaminant soure has been...

Portable and sensitive quantitative detection of DNA based on personal glucose meters and isothermal circular strand-displacement polymerization reaction.

PubMed

Xu, Xue-tao; Liang, Kai-yi; Zeng, Jia-ying

2015-02-15

A portable and sensitive quantitative DNA detection method based on personal glucose meters and isothermal circular strand-displacement polymerization reaction was developed. The target DNA triggered target recycling process, which opened capture DNA. The released target then found another capture DNA to trigger another polymerization cycle, which was repeated for many rounds, resulting in the multiplication of the DNA-invertase conjugation on the surface of Streptavidin-MNBs. The DNA-invertase was used to catalyze the hydrolysis of sucrose into glucose for PGM readout. There was a liner relationship between the signal of PGM and the concentration of target DNA in the range of 5.0 to 1000 fM, which is lower than some DNA detection method. In addition, the method exhibited excellent sequence selectivity and there was almost no effect of biological complex to the detection performance, which suggested our method can be successfully applied to DNA detection in real biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.

40 CFR 796.2750 - Sediment and soil adsorption isotherm.

Code of Federal Regulations, 2014 CFR

2014-07-01

... are highly reproducible. The test provides excellent quantitative data readily amenable to statistical... combination of methods suitable for the identification and quantitative detection of the parent test chemical... quantitative analysis of the parent chemical. (3) Amount of parent test chemical applied, the amount recovered...

40 CFR 796.2750 - Sediment and soil adsorption isotherm.

Code of Federal Regulations, 2013 CFR

2013-07-01

... highly reproducible. The test provides excellent quantitative data readily amenable to statistical... combination of methods suitable for the identification and quantitative detection of the parent test chemical... quantitative analysis of the parent chemical. (3) Amount of parent test chemical applied, the amount recovered...

40 CFR 796.2750 - Sediment and soil adsorption isotherm.

Code of Federal Regulations, 2012 CFR

2012-07-01

... highly reproducible. The test provides excellent quantitative data readily amenable to statistical... combination of methods suitable for the identification and quantitative detection of the parent test chemical... quantitative analysis of the parent chemical. (3) Amount of parent test chemical applied, the amount recovered...

A globotetraosylceramide (Gb₄) receptor-based ELISA for quantitative detection of Shiga toxin 2e.

PubMed

Togashi, Katsuhiro; Sasaki, Shiho; Sato, Wataru

2015-08-01

Currently, no simple assays are available for routine quantitative detection of Escherichia coli-produced Shiga toxin 2e (Stx2e) that causes porcine edema disease. Here, we present a novel quantitative detection method for Stx2e based on the measurement of Stx2e binding to the specific globotetraosylceramide (Gb4) receptor by ELISA (Gb4-ELISA). No cross-reactivity was found with the other Shiga toxins Stx1 and Stx2, indicating high specificity. When the recombinant Stx2e B subunit (Stx2eB) was used, the absorbance measured by Gb4-ELISA increased linearly with Stx2eB concentration in the range of 20-2,500 ng/ml. The Gb4-ELISA method can be easily performed, suggesting that it would be a useful diagnostic tool for porcine edema disease.

[Development of sample pretreatment techniques-rapid detection coupling methods for food security analysis].

PubMed

Huang, Yichun; Ding, Weiwei; Zhang, Zhuomin; Li, Gongke

2013-07-01

This paper summarizes the recent developments of the rapid detection methods for food security, such as sensors, optical techniques, portable spectral analysis, enzyme-linked immunosorbent assay, portable gas chromatograph, etc. Additionally, the applications of these rapid detection methods coupled with sample pretreatment techniques in real food security analysis are reviewed. The coupling technique has the potential to provide references to establish the selective, precise and quantitative rapid detection methods in food security analysis.

Real-time label-free quantitative fluorescence microscopy-based detection of ATP using a tunable fluorescent nano-aptasensor platform

NASA Astrophysics Data System (ADS)

Shrivastava, Sajal; Sohn, Il-Yung; Son, Young-Min; Lee, Won-Il; Lee, Nae-Eung

2015-11-01

Although real-time label-free fluorescent aptasensors based on nanomaterials are increasingly recognized as a useful strategy for the detection of target biomolecules with high fidelity, the lack of an imaging-based quantitative measurement platform limits their implementation with biological samples. Here we introduce an ensemble strategy for a real-time label-free fluorescent graphene (Gr) aptasensor platform. This platform employs aptamer length-dependent tunability, thus enabling the reagentless quantitative detection of biomolecules through computational processing coupled with real-time fluorescence imaging data. We demonstrate that this strategy effectively delivers dose-dependent quantitative readouts of adenosine triphosphate (ATP) concentration on chemical vapor deposited (CVD) Gr and reduced graphene oxide (rGO) surfaces, thereby providing cytotoxicity assessment. Compared with conventional fluorescence spectrometry methods, our highly efficient, universally applicable, and rational approach will facilitate broader implementation of imaging-based biosensing platforms for the quantitative evaluation of a range of target molecules.Although real-time label-free fluorescent aptasensors based on nanomaterials are increasingly recognized as a useful strategy for the detection of target biomolecules with high fidelity, the lack of an imaging-based quantitative measurement platform limits their implementation with biological samples. Here we introduce an ensemble strategy for a real-time label-free fluorescent graphene (Gr) aptasensor platform. This platform employs aptamer length-dependent tunability, thus enabling the reagentless quantitative detection of biomolecules through computational processing coupled with real-time fluorescence imaging data. We demonstrate that this strategy effectively delivers dose-dependent quantitative readouts of adenosine triphosphate (ATP) concentration on chemical vapor deposited (CVD) Gr and reduced graphene oxide (rGO) surfaces, thereby providing cytotoxicity assessment. Compared with conventional fluorescence spectrometry methods, our highly efficient, universally applicable, and rational approach will facilitate broader implementation of imaging-based biosensing platforms for the quantitative evaluation of a range of target molecules. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr05839b

Vitamin K

USDA-ARS?s Scientific Manuscript database

A wide range of analytical techniques are available for the detection, quantitation, and evaluation of vitamin K in foods. The methods vary from simple to complex depending on extraction, separation, identification and detection of the analyte. Among the extraction methods applied for vitamin K anal...

Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

PubMed

Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

2017-08-01

The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

The detection of Yersinia enterocolitica in surface water by quantitative PCR amplification of the ail and yadA genes.

PubMed

Cheyne, Bo M; Van Dyke, Michele I; Anderson, William B; Huck, Peter M

2010-09-01

Yersinia enterocolitica has been detected in surface water, and drinking untreated water is a risk factor for infection. PCR-based methods have been used to detect Y. enterocolitica in various sample types, but quantitative studies have not been conducted in water. In this study, quantitative PCR (qPCR)-based methods targeting the Yersinia virulence genes ail and yadA were used to survey the Grand River watershed in southern Ontario, Canada. Initial testing of reference strains showed that ail and yadA PCR assays were specific for pathogenic biotypes of Y. enterocolitica; however the genes were also detected in one clinical Yersinia intermedia isolate. A survey of surface water from the Grand River watershed showed that both genes were detected at five sampling locations, with the ail and yadA genes detected in 38 and 21% of samples, respectively. Both genes were detected more frequently at colder water temperatures. A screening of Yersinia strains isolated from the watershed showed that the ail gene was detected in three Y. enterocolitica 1A/O:5 isolates. Results of this study show that Yersinia virulence genes were commonly detected in a watershed used as a source of drinking water, and that the occurrence of these genes was seasonal.

A selective and sensitive method for quantitation of lysergic acid diethylamide (LSD) in whole blood by gas chromatography-ion trap tandem mass spectrometry.

PubMed

Libong, Danielle; Bouchonnet, Stéphane; Ricordel, Ivan

2003-01-01

A gas chromatography-ion trap tandem mass spectrometry (GC-ion trap MS-MS) method for detection and quantitation of LSD in whole blood is presented. The sample preparation process, including a solid-phase extraction step with Bond Elut cartridges, was performed with 2 mL of whole blood. Eight microliters of the purified extract was injected with a cold on-column injection method. Positive chemical ionization was performed using acetonitrile as reagent gas; LSD was detected in the MS-MS mode. The chromatograms obtained from blood extracts showed the great selectivity of the method. GC-MS quantitation was performed using lysergic acid methylpropylamide as the internal standard. The response of the MS was linear for concentrations ranging from 0.02 ng/mL (detection threshold) to 10.0 ng/mL. Several parameters such as the choice of the capillary column, the choice of the internal standard and that of the ionization mode (positive CI vs. EI) were rationalized. Decomposition pathways under both ionization modes were studied. Within-day and between-day stability were evaluated.

Improvement of ion chromatography with ultraviolet photometric detection and comparison with conductivity detection for the determination of serum cations.

PubMed

Shintani, H

1985-05-31

Studies were made of the analytical conditions required for indirect photometric ion chromatography using ultraviolet photometric detection (UV method) for the determination of serum cations following a previously developed serum pre-treatment. The sensitivities of the conductivity detection (CD) and UV methods and the amounts of serum cations determined by both methods were compared. Attempts to improve the sensitivity of the conventional UV method are reported. It was found that the mobile phase previously reported by Small and Miller showed no quantitative response when more than 4 mM copper(II) sulphate pentahydrate was used. As a result, there was no significant difference in the amounts of serum cations shown by the CD and UV methods. However, by adding 0.5-5 mM cobalt(II) sulphate heptahydrate, nickel(II) sulphate hexahydrate, zinc(II) sulphate heptahydrate or cobalt(II) diammonium sulphate hexahydrate to 0.5-1.5 mM copper(II) sulphate pentahydrate, higher sensitivity and a quantitative response were attained.

Quantitative analysis of sitagliptin using the (19)F-NMR method: a universal technique for fluorinated compound detection.

PubMed

Zhang, Fen-Fen; Jiang, Meng-Hong; Sun, Lin-Lin; Zheng, Feng; Dong, Lei; Shah, Vishva; Shen, Wen-Bin; Ding, Ya

2015-01-07

To expand the application scope of nuclear magnetic resonance (NMR) technology in quantitative analysis of pharmaceutical ingredients, (19)F nuclear magnetic resonance ((19)F-NMR) spectroscopy has been employed as a simple, rapid, and reproducible approach for the detection of a fluorine-containing model drug, sitagliptin phosphate monohydrate (STG). ciprofloxacin (Cipro) has been used as the internal standard (IS). Influential factors, including the relaxation delay time (d1) and pulse angle, impacting the accuracy and precision of spectral data are systematically optimized. Method validation has been carried out in terms of precision and intermediate precision, linearity, limit of detection (LOD) and limit of quantification (LOQ), robustness, and stability. To validate the reliability and feasibility of the (19)F-NMR technology in quantitative analysis of pharmaceutical analytes, the assay result has been compared with that of (1)H-NMR. The statistical F-test and student t-test at 95% confidence level indicate that there is no significant difference between these two methods. Due to the advantages of (19)F-NMR, such as higher resolution and suitability for biological samples, it can be used as a universal technology for the quantitative analysis of other fluorine-containing pharmaceuticals and analytes.

Application of Raman Spectroscopy for the Detection of Acetone Dissolved in Transformer Oil

NASA Astrophysics Data System (ADS)

Gu, Z.; Chen, W.; Du, L.; Shi, H.; Wan, F.

2018-05-01

The CLRS detection characteristics of acetone dissolved in transformer oil were analyzed. Raman spectral peak at 780 cm-1 was used as the characteristic spectral peak for qualitative and quantitative analyses. The effect of the detection depth and the temperature was investigated in order to obtain good Raman signals. The optimal detection depth and temperature were set as 3 mm and room temperature. A quantitative model relation between concentration and the Raman peak intensity ratio I 780/I 893 was constructed via the least-squares method. The results demonstrated that CLRS can quantitatively detect the concentration of acetone in transformer oil and CLRS has potential as a useful alternative for accelerating the in-situ analysis of the concentration of acetone in transformer oil.

Application of Raman Spectroscopy for the Detection of Acetone Dissolved in Transformer Oil

NASA Astrophysics Data System (ADS)

Gu, Z.; Chen, W.; Du, L.; Shi, H.; Wan, F.

2018-05-01

The CLRS detection characteristics of acetone dissolved in transformer oil were analyzed. Raman spectral peak at 780 cm-1 was used as the characteristic spectral peak for qualitative and quantitative analyses. The effect of the detection depth and the temperature was investigated in order to obtain good Raman signals. The optimal detection depth and temperature were set as 3 mm and room temperature. A quantitative model relation between concentration and the Raman peak intensity ratio I 780/ I 893 was constructed via the least-squares method. The results demonstrated that CLRS can quantitatively detect the concentration of acetone in transformer oil and CLRS has potential as a useful alternative for accelerating the in-situ analysis of the concentration of acetone in transformer oil.

Multi-allergen Quantitation and the Impact of Thermal Treatment in Industry-Processed Baked Goods by ELISA and Liquid Chromatography-Tandem Mass Spectrometry.

PubMed

Parker, Christine H; Khuda, Sefat E; Pereira, Marion; Ross, Mark M; Fu, Tong-Jen; Fan, Xuebin; Wu, Yan; Williams, Kristina M; DeVries, Jonathan; Pulvermacher, Brian; Bedford, Binaifer; Zhang, Xi; Jackson, Lauren S

2015-12-16

Undeclared food allergens account for 30-40% of food recalls in the United States. Compliance with ingredient labeling regulations and the implementation of effective manufacturing allergen control plans require the use of reliable methods for allergen detection and quantitation in complex food products. The objectives of this work were to (1) produce industry-processed model foods incurred with egg, milk, and peanut allergens, (2) compare analytical method performance for allergen quantitation in thermally processed bakery products, and (3) determine the effects of thermal treatment on allergen detection. Control and allergen-incurred cereal bars and muffins were formulated in a pilot-scale industry processing facility. Quantitation of egg, milk, and peanut in incurred baked goods was compared at various processing stages using commercial enzyme-linked immunosorbent assay (ELISA) kits and a novel multi-allergen liquid chromatography (LC)-tandem mass spectrometry (MS/MS) multiple-reaction monitoring (MRM) method. Thermal processing was determined to negatively affect the recovery and quantitation of egg, milk, and peanut to different extents depending on the allergen, matrix, and analytical test method. The Morinaga ELISA and LC-MS/MS quantitative methods reported the highest recovery across all monitored allergens, whereas the ELISA Systems, Neogen BioKits, Neogen Veratox, and R-Biopharm ELISA Kits underperformed in the determination of allergen content of industry-processed bakery products.

Evaluation of the Urine Protein/Creatinine Ratio Measured with the Dipsticks Clinitek Atlas PRO 12.

PubMed

Hermida, Fernando J; Soto, Sonia; Benitez, Alfonso J

2016-01-01

Screening for urine proteins is recommended for the detection of albuminuria in high risk groups. The aim of this study was to compare the Clinitek Atlas PRO12 reagent urine strip with quantitative methods for the determination of protein/creatinine ratio and to evaluate the usefulness of the semi-quantitative Clinitek Atlas PRO12 reagent urine strip as a tool in the early detection of albuminuria among the general population. Six hundred first morning urine specimens were collected from outpatients with various clinical conditions. The results showed that the test data for the urine dipstick Clinitek Atlas PRO12 show good agreement with the quantitative measurement of protein, creatinine and protein/creatinine ratio. In addition, this study shows that 97.2% of the samples which gave "normal" protein/creatinine ratios by the semi-quantitative method, showed albumin/creatinine ratio < 30 mg/g by the quantitative methods. Our results show that Clinitek Atlas PRO12 reagent strips can be used for the purposes of albuminuria screening in the general population.

ICP-MS as a novel detection system for quantitative element-tagged immunoassay of hidden peanut allergens in foods.

PubMed

Careri, Maria; Elviri, Lisa; Mangia, Alessandro; Mucchino, Claudio

2007-03-01

A novel ICP-MS-based ELISA immunoassay via element-tagged determination was devised for quantitative analysis of hidden allergens in food. The method was able to detect low amounts of peanuts (down to approximately 2 mg peanuts kg(-1) cereal-based matrix) by using a europium-tagged antibody. Selectivity was proved by the lack of detectable cross-reaction with a number of protein-rich raw materials.

Single Fluorescence Channel-based Multiplex Detection of Avian Influenza Virus by Quantitative PCR with Intercalating Dye

PubMed Central

Ahberg, Christian D.; Manz, Andreas; Neuzil, Pavel

2015-01-01

Since its invention in 1985 the polymerase chain reaction (PCR) has become a well-established method for amplification and detection of segments of double-stranded DNA. Incorporation of fluorogenic probe or DNA intercalating dyes (such as SYBR Green) into the PCR mixture allowed real-time reaction monitoring and extraction of quantitative information (qPCR). Probes with different excitation spectra enable multiplex qPCR of several DNA segments using multi-channel optical detection systems. Here we show multiplex qPCR using an economical EvaGreen-based system with single optical channel detection. Previously reported non quantitative multiplex real-time PCR techniques based on intercalating dyes were conducted once the PCR is completed by performing melting curve analysis (MCA). The technique presented in this paper is both qualitative and quantitative as it provides information about the presence of multiple DNA strands as well as the number of starting copies in the tested sample. Besides important internal control, multiplex qPCR also allows detecting concentrations of more than one DNA strand within the same sample. Detection of the avian influenza virus H7N9 by PCR is a well established method. Multiplex qPCR greatly enhances its specificity as it is capable of distinguishing both haemagglutinin (HA) and neuraminidase (NA) genes as well as their ratio. PMID:26088868

Use of Quantitative Real-Time PCR for Direct Detection of Serratia marcescens in Marine and Other Aquatic Environments

PubMed Central

Joyner, Jessica; Wanless, David; Sinigalliano, Christopher D.

2014-01-01

Serratia marcescens is the etiological agent of acroporid serratiosis, a distinct form of white pox disease in the threatened coral Acropora palmata. The pathogen is commonly found in untreated human waste in the Florida Keys, which may contaminate both nearshore and offshore waters. Currently there is no direct method for detection of this bacterium in the aquatic or reef environment, and culture-based techniques may underestimate its abundance in marine waters. A quantitative real-time PCR assay was developed to detect S. marcescens directly from environmental samples, including marine water, coral mucus, sponge tissue, and wastewater. The assay targeted the luxS gene and was able to distinguish S. marcescens from other Serratia species with a reliable quantitative limit of detection of 10 cell equivalents (CE) per reaction. The method could routinely discern the presence of S. marcescens for as few as 3 CE per reaction, but it could not be reliably quantified at this level. The assay detected environmental S. marcescens in complex sewage influent samples at up to 761 CE ml−1 and in septic system-impacted residential canals in the Florida Keys at up to 4.1 CE ml−1. This detection assay provided rapid quantitative abilities and good sensitivity and specificity, which should offer an important tool for monitoring this ubiquitous pathogen that can potentially impact both human health and coral health. PMID:24375136

Use of quantitative real-time PCR for direct detection of serratia marcescens in marine and other aquatic environments.

PubMed

Joyner, Jessica; Wanless, David; Sinigalliano, Christopher D; Lipp, Erin K

2014-03-01

Serratia marcescens is the etiological agent of acroporid serratiosis, a distinct form of white pox disease in the threatened coral Acropora palmata. The pathogen is commonly found in untreated human waste in the Florida Keys, which may contaminate both nearshore and offshore waters. Currently there is no direct method for detection of this bacterium in the aquatic or reef environment, and culture-based techniques may underestimate its abundance in marine waters. A quantitative real-time PCR assay was developed to detect S. marcescens directly from environmental samples, including marine water, coral mucus, sponge tissue, and wastewater. The assay targeted the luxS gene and was able to distinguish S. marcescens from other Serratia species with a reliable quantitative limit of detection of 10 cell equivalents (CE) per reaction. The method could routinely discern the presence of S. marcescens for as few as 3 CE per reaction, but it could not be reliably quantified at this level. The assay detected environmental S. marcescens in complex sewage influent samples at up to 761 CE ml(-1) and in septic system-impacted residential canals in the Florida Keys at up to 4.1 CE ml(-1). This detection assay provided rapid quantitative abilities and good sensitivity and specificity, which should offer an important tool for monitoring this ubiquitous pathogen that can potentially impact both human health and coral health.

Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods

EPA Science Inventory

Quantitative polymerase chain reaction (qPCR) is increasingly being used for the quantitative detection of fecal indicator bacteria in beach water. QPCR allows for same-day health warnings, and its application is being considered as an optionn for recreational water quality testi...

A Label-Free, Quantitative Fecal Hemoglobin Detection Platform for Colorectal Cancer Screening

PubMed Central

Soraya, Gita V.; Nguyen, Thanh C.; Abeyrathne, Chathurika D.; Huynh, Duc H.; Chan, Jianxiong; Nguyen, Phuong D.; Nasr, Babak; Chana, Gursharan; Kwan, Patrick; Skafidas, Efstratios

2017-01-01

The early detection of colorectal cancer is vital for disease management and patient survival. Fecal hemoglobin detection is a widely-adopted method for screening and early diagnosis. Fecal Immunochemical Test (FIT) is favored over the older generation chemical based Fecal Occult Blood Test (FOBT) as it does not require dietary or drug restrictions, and is specific to human blood from the lower digestive tract. To date, no quantitative FIT platforms are available for use in the point-of-care setting. Here, we report proof of principle data of a novel low cost quantitative fecal immunochemical-based biosensor platform that may be further developed into a point-of-care test in low-resource settings. The label-free prototype has a lower limit of detection (LOD) of 10 µg hemoglobin per gram (Hb/g) of feces, comparable to that of conventional laboratory based quantitative FIT diagnostic systems. PMID:28475117

Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

PubMed

Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

2014-01-01

Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

PubMed

Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

2005-11-30

Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

Composite Interval Mapping Based on Lattice Design for Error Control May Increase Power of Quantitative Trait Locus Detection.

PubMed

He, Jianbo; Li, Jijie; Huang, Zhongwen; Zhao, Tuanjie; Xing, Guangnan; Gai, Junyi; Guan, Rongzhan

2015-01-01

Experimental error control is very important in quantitative trait locus (QTL) mapping. Although numerous statistical methods have been developed for QTL mapping, a QTL detection model based on an appropriate experimental design that emphasizes error control has not been developed. Lattice design is very suitable for experiments with large sample sizes, which is usually required for accurate mapping of quantitative traits. However, the lack of a QTL mapping method based on lattice design dictates that the arithmetic mean or adjusted mean of each line of observations in the lattice design had to be used as a response variable, resulting in low QTL detection power. As an improvement, we developed a QTL mapping method termed composite interval mapping based on lattice design (CIMLD). In the lattice design, experimental errors are decomposed into random errors and block-within-replication errors. Four levels of block-within-replication errors were simulated to show the power of QTL detection under different error controls. The simulation results showed that the arithmetic mean method, which is equivalent to a method under random complete block design (RCBD), was very sensitive to the size of the block variance and with the increase of block variance, the power of QTL detection decreased from 51.3% to 9.4%. In contrast to the RCBD method, the power of CIMLD and the adjusted mean method did not change for different block variances. The CIMLD method showed 1.2- to 7.6-fold higher power of QTL detection than the arithmetic or adjusted mean methods. Our proposed method was applied to real soybean (Glycine max) data as an example and 10 QTLs for biomass were identified that explained 65.87% of the phenotypic variation, while only three and two QTLs were identified by arithmetic and adjusted mean methods, respectively.

Quantitative ultrasonic evaluation of concrete structures using one-sided access

NASA Astrophysics Data System (ADS)

Khazanovich, Lev; Hoegh, Kyle

2016-02-01

Nondestructive diagnostics of concrete structures is an important and challenging problem. A recent introduction of array ultrasonic dry point contact transducer systems offers opportunities for quantitative assessment of the subsurface condition of concrete structures, including detection of defects and inclusions. The methods described in this paper are developed for signal interpretation of shear wave impulse response time histories from multiple fixed distance transducer pairs in a self-contained ultrasonic linear array. This included generalizing Kirchoff migration-based synthetic aperture focusing technique (SAFT) reconstruction methods to handle the spatially diverse transducer pair locations, creating expanded virtual arrays with associated reconstruction methods, and creating automated reconstruction interpretation methods for reinforcement detection and stochastic flaw detection. Interpretation of the reconstruction techniques developed in this study were validated using the results of laboratory and field forensic studies. Applicability of the developed methods for solving practical engineering problems was demonstrated.

Recombinant plasmid-based quantitative Real-Time PCR analysis of Salmonella enterica serotypes and its application to milk samples.

PubMed

Gokduman, Kurtulus; Avsaroglu, M Dilek; Cakiris, Aris; Ustek, Duran; Gurakan, G Candan

2016-03-01

The aim of the current study was to develop, a new, rapid, sensitive and quantitative Salmonella detection method using a Real-Time PCR technique based on an inexpensive, easy to produce, convenient and standardized recombinant plasmid positive control. To achieve this, two recombinant plasmids were constructed as reference molecules by cloning the two most commonly used Salmonella-specific target gene regions, invA and ttrRSBC. The more rapid detection enabled by the developed method (21 h) compared to the traditional culture method (90 h) allows the quantitative evaluation of Salmonella (quantification limits of 10(1)CFU/ml and 10(0)CFU/ml for the invA target and the ttrRSBC target, respectively), as illustrated using milk samples. Three advantages illustrated by the current study demonstrate the potential of the newly developed method to be used in routine analyses in the medical, veterinary, food and water/environmental sectors: I--The method provides fast analyses including the simultaneous detection and determination of correct pathogen counts; II--The method is applicable to challenging samples, such as milk; III--The method's positive controls (recombinant plasmids) are reproducible in large quantities without the need to construct new calibration curves. Copyright © 2016 Elsevier B.V. All rights reserved.

Detecting Genetic Interactions for Quantitative Traits Using m-Spacing Entropy Measure

PubMed Central

Yee, Jaeyong; Kwon, Min-Seok; Park, Taesung; Park, Mira

2015-01-01

A number of statistical methods for detecting gene-gene interactions have been developed in genetic association studies with binary traits. However, many phenotype measures are intrinsically quantitative and categorizing continuous traits may not always be straightforward and meaningful. Association of gene-gene interactions with an observed distribution of such phenotypes needs to be investigated directly without categorization. Information gain based on entropy measure has previously been successful in identifying genetic associations with binary traits. We extend the usefulness of this information gain by proposing a nonparametric evaluation method of conditional entropy of a quantitative phenotype associated with a given genotype. Hence, the information gain can be obtained for any phenotype distribution. Because any functional form, such as Gaussian, is not assumed for the entire distribution of a trait or a given genotype, this method is expected to be robust enough to be applied to any phenotypic association data. Here, we show its use to successfully identify the main effect, as well as the genetic interactions, associated with a quantitative trait. PMID:26339620

Quantitative Detection of Trace Explosive Vapors by Programmed Temperature Desorption Gas Chromatography-Electron Capture Detector

PubMed Central

Field, Christopher R.; Lubrano, Adam; Woytowitz, Morgan; Giordano, Braden C.; Rose-Pehrsson, Susan L.

2014-01-01

The direct liquid deposition of solution standards onto sorbent-filled thermal desorption tubes is used for the quantitative analysis of trace explosive vapor samples. The direct liquid deposition method yields a higher fidelity between the analysis of vapor samples and the analysis of solution standards than using separate injection methods for vapors and solutions, i.e., samples collected on vapor collection tubes and standards prepared in solution vials. Additionally, the method can account for instrumentation losses, which makes it ideal for minimizing variability and quantitative trace chemical detection. Gas chromatography with an electron capture detector is an instrumentation configuration sensitive to nitro-energetics, such as TNT and RDX, due to their relatively high electron affinity. However, vapor quantitation of these compounds is difficult without viable vapor standards. Thus, we eliminate the requirement for vapor standards by combining the sensitivity of the instrumentation with a direct liquid deposition protocol to analyze trace explosive vapor samples. PMID:25145416

Quantitative detection of trace explosive vapors by programmed temperature desorption gas chromatography-electron capture detector.

PubMed

Field, Christopher R; Lubrano, Adam; Woytowitz, Morgan; Giordano, Braden C; Rose-Pehrsson, Susan L

2014-07-25

The direct liquid deposition of solution standards onto sorbent-filled thermal desorption tubes is used for the quantitative analysis of trace explosive vapor samples. The direct liquid deposition method yields a higher fidelity between the analysis of vapor samples and the analysis of solution standards than using separate injection methods for vapors and solutions, i.e., samples collected on vapor collection tubes and standards prepared in solution vials. Additionally, the method can account for instrumentation losses, which makes it ideal for minimizing variability and quantitative trace chemical detection. Gas chromatography with an electron capture detector is an instrumentation configuration sensitive to nitro-energetics, such as TNT and RDX, due to their relatively high electron affinity. However, vapor quantitation of these compounds is difficult without viable vapor standards. Thus, we eliminate the requirement for vapor standards by combining the sensitivity of the instrumentation with a direct liquid deposition protocol to analyze trace explosive vapor samples.

Validation of a simple liquid chromatographic method for determination and quantitation of residual ivermectin and doramectin in pig liver.

PubMed

Knold, Lone; Reitov, Marianne; Mortensen, Anna Birthe; Hansen-Møller, Jens

2002-01-01

A rapid and quantitative method for the extraction, derivatization, and liquid chromatography with fluorescence detection of ivermectin (IVM) and doramectin (DOM) residues in porcine liver was developed and validated. IVM and DOM were extracted from the liver samples with acetonitrile, the supernatant was evaporated to dryness at 37 degrees C under nitrogen, and the residue was reconstituted in 1-methylimidazole solution. After 2 min at room temperature, IVM and DOM were converted to a fluorescent derivative and then separated on a Hypersil ODS column. The derivatives of IVM and DOM were detected and quantitated with high specificity by fluorescence (excitation: 365 nm, emission: 475 nm). Abamectin was used as an internal standard. The mean extraction efficiencies from fortified samples (15 ng/g) were 75% for IVM and 70% for DOM. The limit of detection was 0.8 ng/g for both IVM and DOM.

Abseq: Ultrahigh-throughput single cell protein profiling with droplet microfluidic barcoding.

PubMed

Shahi, Payam; Kim, Samuel C; Haliburton, John R; Gartner, Zev J; Abate, Adam R

2017-03-14

Proteins are the primary effectors of cellular function, including cellular metabolism, structural dynamics, and information processing. However, quantitative characterization of proteins at the single-cell level is challenging due to the tiny amount of protein available. Here, we present Abseq, a method to detect and quantitate proteins in single cells at ultrahigh throughput. Like flow and mass cytometry, Abseq uses specific antibodies to detect epitopes of interest; however, unlike these methods, antibodies are labeled with sequence tags that can be read out with microfluidic barcoding and DNA sequencing. We demonstrate this novel approach by characterizing surface proteins of different cell types at the single-cell level and distinguishing between the cells by their protein expression profiles. DNA-tagged antibodies provide multiple advantages for profiling proteins in single cells, including the ability to amplify low-abundance tags to make them detectable with sequencing, to use molecular indices for quantitative results, and essentially limitless multiplexing.

Abseq: Ultrahigh-throughput single cell protein profiling with droplet microfluidic barcoding

NASA Astrophysics Data System (ADS)

Shahi, Payam; Kim, Samuel C.; Haliburton, John R.; Gartner, Zev J.; Abate, Adam R.

2017-03-01

Proteins are the primary effectors of cellular function, including cellular metabolism, structural dynamics, and information processing. However, quantitative characterization of proteins at the single-cell level is challenging due to the tiny amount of protein available. Here, we present Abseq, a method to detect and quantitate proteins in single cells at ultrahigh throughput. Like flow and mass cytometry, Abseq uses specific antibodies to detect epitopes of interest; however, unlike these methods, antibodies are labeled with sequence tags that can be read out with microfluidic barcoding and DNA sequencing. We demonstrate this novel approach by characterizing surface proteins of different cell types at the single-cell level and distinguishing between the cells by their protein expression profiles. DNA-tagged antibodies provide multiple advantages for profiling proteins in single cells, including the ability to amplify low-abundance tags to make them detectable with sequencing, to use molecular indices for quantitative results, and essentially limitless multiplexing.

Abseq: Ultrahigh-throughput single cell protein profiling with droplet microfluidic barcoding

PubMed Central

Shahi, Payam; Kim, Samuel C.; Haliburton, John R.; Gartner, Zev J.; Abate, Adam R.

2017-01-01

Proteins are the primary effectors of cellular function, including cellular metabolism, structural dynamics, and information processing. However, quantitative characterization of proteins at the single-cell level is challenging due to the tiny amount of protein available. Here, we present Abseq, a method to detect and quantitate proteins in single cells at ultrahigh throughput. Like flow and mass cytometry, Abseq uses specific antibodies to detect epitopes of interest; however, unlike these methods, antibodies are labeled with sequence tags that can be read out with microfluidic barcoding and DNA sequencing. We demonstrate this novel approach by characterizing surface proteins of different cell types at the single-cell level and distinguishing between the cells by their protein expression profiles. DNA-tagged antibodies provide multiple advantages for profiling proteins in single cells, including the ability to amplify low-abundance tags to make them detectable with sequencing, to use molecular indices for quantitative results, and essentially limitless multiplexing. PMID:28290550

Quantitative determination of Auramine O by terahertz spectroscopy with 2DCOS-PLSR model

NASA Astrophysics Data System (ADS)

Zhang, Huo; Li, Zhi; Chen, Tao; Qin, Binyi

2017-09-01

Residues of harmful dyes such as Auramine O (AO) in herb and food products threaten the health of people. So, fast and sensitive detection techniques of the residues are needed. As a powerful tool for substance detection, terahertz (THz) spectroscopy was used for the quantitative determination of AO by combining with an improved partial least-squares regression (PLSR) model in this paper. Absorbance of herbal samples with different concentrations was obtained by THz-TDS in the band between 0.2THz and 1.6THz. We applied two-dimensional correlation spectroscopy (2DCOS) to improve the PLSR model. This method highlighted the spectral differences of different concentrations, provided a clear criterion of the input interval selection, and improved the accuracy of detection result. The experimental result indicated that the combination of the THz spectroscopy and 2DCOS-PLSR is an excellent quantitative analysis method.

Real-time label-free quantitative fluorescence microscopy-based detection of ATP using a tunable fluorescent nano-aptasensor platform.

PubMed

Shrivastava, Sajal; Sohn, Il-Yung; Son, Young-Min; Lee, Won-Il; Lee, Nae-Eung

2015-12-14

Although real-time label-free fluorescent aptasensors based on nanomaterials are increasingly recognized as a useful strategy for the detection of target biomolecules with high fidelity, the lack of an imaging-based quantitative measurement platform limits their implementation with biological samples. Here we introduce an ensemble strategy for a real-time label-free fluorescent graphene (Gr) aptasensor platform. This platform employs aptamer length-dependent tunability, thus enabling the reagentless quantitative detection of biomolecules through computational processing coupled with real-time fluorescence imaging data. We demonstrate that this strategy effectively delivers dose-dependent quantitative readouts of adenosine triphosphate (ATP) concentration on chemical vapor deposited (CVD) Gr and reduced graphene oxide (rGO) surfaces, thereby providing cytotoxicity assessment. Compared with conventional fluorescence spectrometry methods, our highly efficient, universally applicable, and rational approach will facilitate broader implementation of imaging-based biosensing platforms for the quantitative evaluation of a range of target molecules.

Electrochemical and Infrared Absorption Spectroscopy Detection of SF₆ Decomposition Products.

PubMed

Dong, Ming; Zhang, Chongxing; Ren, Ming; Albarracín, Ricardo; Ye, Rixin

2017-11-15

Sulfur hexafluoride (SF₆) gas-insulated electrical equipment is widely used in high-voltage (HV) and extra-high-voltage (EHV) power systems. Partial discharge (PD) and local heating can occur in the electrical equipment because of insulation faults, which results in SF₆ decomposition and ultimately generates several types of decomposition products. These SF₆ decomposition products can be qualitatively and quantitatively detected with relevant detection methods, and such detection contributes to diagnosing the internal faults and evaluating the security risks of the equipment. At present, multiple detection methods exist for analyzing the SF₆ decomposition products, and electrochemical sensing (ES) and infrared (IR) spectroscopy are well suited for application in online detection. In this study, the combination of ES with IR spectroscopy is used to detect SF₆ gas decomposition. First, the characteristics of these two detection methods are studied, and the data analysis matrix is established. Then, a qualitative and quantitative analysis ES-IR model is established by adopting a two-step approach. A SF₆ decomposition detector is designed and manufactured by combining an electrochemical sensor and IR spectroscopy technology. The detector is used to detect SF₆ gas decomposition and is verified to reliably and accurately detect the gas components and concentrations.

Rapid detection methods for viable Mycobacterium avium subspecies paratuberculosis in milk and cheese.

PubMed

Botsaris, George; Slana, Iva; Liapi, Maria; Dodd, Christine; Economides, Constantinos; Rees, Catherine; Pavlik, Ivo

2010-07-31

Mycobacterium avium subsp. paratuberculosis (MAP) may have a role in the development of Crohn's disease in humans via the consumption of contaminated milk and milk products. Detection of MAP from milk and dairy products has been reported from countries on the European continent, Argentina, the UK and Australia. In this study three different methods (quantitative real time PCR, combined phage IS900 PCR and conventional cultivation) were used to detect the presence of MAP in bulk tank milk (BTM) and cheese originating from sheep, goat and mixed milks from farms and products in Cyprus. During the first survey the presence of MAP was detected in 63 (28.6%) of cows' BTM samples by quantitative real time PCR. A second survey of BTM used a new combined phage IS900 PCR assay, and in this case MAP was detected in 50 (22.2%) samples showing a good level of agreement by both methods. None of the herds tested were known to be affected by Johne's disease and the presence of viable MAP was confirmed by conventional culture in only two cases of cows BTM. This suggests that either rapid method used is more sensitive than the conventional culture when testing raw milk samples for MAP. The two isolates recovered from BTM were identified by IS1311 PCR REA as cattle and sheep strains, respectively. In contrast when cheese samples were tested, MAP DNA was detected by quantitative real time PCR in seven (25.0%) samples (n=28). However no viable MAP was detected when either the combined phage IS900 PCR or conventional culture methods were used. Copyright 2010 Elsevier B.V. All rights reserved.

[Influence of Spectral Pre-Processing on PLS Quantitative Model of Detecting Cu in Navel Orange by LIBS].

PubMed

Li, Wen-bing; Yao, Lin-tao; Liu, Mu-hua; Huang, Lin; Yao, Ming-yin; Chen, Tian-bing; He, Xiu-wen; Yang, Ping; Hu, Hui-qin; Nie, Jiang-hui

2015-05-01

Cu in navel orange was detected rapidly by laser-induced breakdown spectroscopy (LIBS) combined with partial least squares (PLS) for quantitative analysis, then the effect on the detection accuracy of the model with different spectral data ptetreatment methods was explored. Spectral data for the 52 Gannan navel orange samples were pretreated by different data smoothing, mean centralized and standard normal variable transform. Then 319~338 nm wavelength section containing characteristic spectral lines of Cu was selected to build PLS models, the main evaluation indexes of models such as regression coefficient (r), root mean square error of cross validation (RMSECV) and the root mean square error of prediction (RMSEP) were compared and analyzed. Three indicators of PLS model after 13 points smoothing and processing of the mean center were found reaching 0. 992 8, 3. 43 and 3. 4 respectively, the average relative error of prediction model is only 5. 55%, and in one word, the quality of calibration and prediction of this model are the best results. The results show that selecting the appropriate data pre-processing method, the prediction accuracy of PLS quantitative model of fruits and vegetables detected by LIBS can be improved effectively, providing a new method for fast and accurate detection of fruits and vegetables by LIBS.

Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

PubMed

Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

2012-04-27

To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

Optimization of Statistical Methods Impact on Quantitative Proteomics Data.

PubMed

Pursiheimo, Anna; Vehmas, Anni P; Afzal, Saira; Suomi, Tomi; Chand, Thaman; Strauss, Leena; Poutanen, Matti; Rokka, Anne; Corthals, Garry L; Elo, Laura L

2015-10-02

As tools for quantitative label-free mass spectrometry (MS) rapidly develop, a consensus about the best practices is not apparent. In the work described here we compared popular statistical methods for detecting differential protein expression from quantitative MS data using both controlled experiments with known quantitative differences for specific proteins used as standards as well as "real" experiments where differences in protein abundance are not known a priori. Our results suggest that data-driven reproducibility-optimization can consistently produce reliable differential expression rankings for label-free proteome tools and are straightforward in their application.

Performance of Two Quantitative PCR Methods for Microbial Source Tracking of Human Sewage and Implications for Microbial Risk Assessment in Recreational Waters

PubMed Central

Staley, Christopher; Gordon, Katrina V.; Schoen, Mary E.

2012-01-01

Before new, rapid quantitative PCR (qPCR) methods for assessment of recreational water quality and microbial source tracking (MST) can be useful in a regulatory context, an understanding of the ability of the method to detect a DNA target (marker) when the contaminant source has been diluted in environmental waters is needed. This study determined the limits of detection and quantification of the human-associated Bacteroides sp. (HF183) and human polyomavirus (HPyV) qPCR methods for sewage diluted in buffer and in five ambient, Florida water types (estuarine, marine, tannic, lake, and river). HF183 was quantifiable in sewage diluted up to 10−6 in 500-ml ambient-water samples, but HPyVs were not quantifiable in dilutions of >10−4. Specificity, which was assessed using fecal composites from dogs, birds, and cattle, was 100% for HPyVs and 81% for HF183. Quantitative microbial risk assessment (QMRA) estimated the possible norovirus levels in sewage and the human health risk at various sewage dilutions. When juxtaposed with the MST marker detection limits, the QMRA analysis revealed that HF183 was detectable when the modeled risk of gastrointestinal (GI) illness was at or below the benchmark of 10 illnesses per 1,000 exposures, but the HPyV method was generally not sensitive enough to detect potential health risks at the 0.01 threshold for frequency of illness. The tradeoff between sensitivity and specificity in the MST methods indicates that HF183 data should be interpreted judiciously, preferably in conjunction with a more host-specific marker, and that better methods of concentrating HPyVs from environmental waters are needed if this method is to be useful in a watershed management or monitoring context. PMID:22885746

Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods

PubMed Central

Wu, Yuhua; Wang, Yulei; Li, Jun; Li, Wei; Zhang, Li; Li, Yunjing; Li, Xiaofei; Li, Jun; Zhu, Li; Wu, Gang

2014-01-01

The Cauliflower mosaic virus (CaMV) 35S promoter (P35S) is a commonly used target for detection of genetically modified organisms (GMOs). There are currently 24 reported detection methods, targeting different regions of the P35S promoter. Initial assessment revealed that due to the absence of primer binding sites in the P35S sequence, 19 of the 24 reported methods failed to detect P35S in MON88913 cotton, and the other two methods could only be applied to certain GMOs. The rest three reported methods were not suitable for measurement of P35S in some testing events, because SNPs in binding sites of the primer/probe would result in abnormal amplification plots and poor linear regression parameters. In this study, we discovered a conserved region in the P35S sequence through sequencing of P35S promoters from multiple transgenic events, and developed new qualitative and quantitative detection systems targeting this conserved region. The qualitative PCR could detect the P35S promoter in 23 unique GMO events with high specificity and sensitivity. The quantitative method was suitable for measurement of P35S promoter, exhibiting good agreement between the amount of template and Ct values for each testing event. This study provides a general P35S screening method, with greater coverage than existing methods. PMID:25483893

Comprehensive methods for earlier detection and monitoring of forest decline

Treesearch

Jennifer Pontius; Richard Hallett

2014-01-01

Forested ecosystems are threatened by invasive pests, pathogens, and unusual climatic events brought about by climate change. Earlier detection of incipient forest health problems and a quantitatively rigorous assessment method is increasingly important. Here, we describe a method that is adaptable across tree species and stress agents and practical for use in the...

Quantitation and detection of vanadium in biologic and pollution materials

NASA Technical Reports Server (NTRS)

Gordon, W. A.

1974-01-01

A review is presented of special considerations and methodology for determining vanadium in biological and air pollution materials. In addition to descriptions of specific analysis procedures, general sections are included on quantitation of analysis procedures, sample preparation, blanks, and methods of detection of vanadium. Most of the information presented is applicable to the determination of other trace elements in addition to vanadium.

A Study of Dim Object Detection for the Space Surveillance Telescope

DTIC Science & Technology

2013-03-21

ENG-13-M-32 Abstract Current methods of dim object detection for space surveillance make use of a Gaussian log-likelihood-ratio-test-based...quantitatively comparing the efficacy of two methods for dim object detection , termed in this paper the point detector and the correlator, both of which rely... applications . It is used in national defense for detecting satellites. It is used to detecting space debris, which threatens both civilian and

Effective Heart Disease Detection Based on Quantitative Computerized Traditional Chinese Medicine Using Representation Based Classifiers.

PubMed

Shu, Ting; Zhang, Bob; Tang, Yuan Yan

2017-01-01

At present, heart disease is the number one cause of death worldwide. Traditionally, heart disease is commonly detected using blood tests, electrocardiogram, cardiac computerized tomography scan, cardiac magnetic resonance imaging, and so on. However, these traditional diagnostic methods are time consuming and/or invasive. In this paper, we propose an effective noninvasive computerized method based on facial images to quantitatively detect heart disease. Specifically, facial key block color features are extracted from facial images and analyzed using the Probabilistic Collaborative Representation Based Classifier. The idea of facial key block color analysis is founded in Traditional Chinese Medicine. A new dataset consisting of 581 heart disease and 581 healthy samples was experimented by the proposed method. In order to optimize the Probabilistic Collaborative Representation Based Classifier, an analysis of its parameters was performed. According to the experimental results, the proposed method obtains the highest accuracy compared with other classifiers and is proven to be effective at heart disease detection.

Event-specific qualitative and quantitative detection of five genetically modified rice events using a single standard reference molecule.

PubMed

Kim, Jae-Hwan; Park, Saet-Byul; Roh, Hyo-Jeong; Shin, Min-Ki; Moon, Gui-Im; Hong, Jin-Hwan; Kim, Hae-Yeong

2017-07-01

One novel standard reference plasmid, namely pUC-RICE5, was constructed as a positive control and calibrator for event-specific qualitative and quantitative detection of genetically modified (GM) rice (Bt63, Kemingdao1, Kefeng6, Kefeng8, and LLRice62). pUC-RICE5 contained fragments of a rice-specific endogenous reference gene (sucrose phosphate synthase) as well as the five GM rice events. An existing qualitative PCR assay approach was modified using pUC-RICE5 to create a quantitative method with limits of detection correlating to approximately 1-10 copies of rice haploid genomes. In this quantitative PCR assay, the square regression coefficients ranged from 0.993 to 1.000. The standard deviation and relative standard deviation values for repeatability ranged from 0.02 to 0.22 and 0.10% to 0.67%, respectively. The Ministry of Food and Drug Safety (Korea) validated the method and the results suggest it could be used routinely to identify five GM rice events. Copyright © 2017 Elsevier Ltd. All rights reserved.

Improved Methods for Capture, Extraction, and Quantitative Assay of Environmental DNA from Asian Bigheaded Carp (Hypophthalmichthys spp.)

PubMed Central

Turner, Cameron R.; Miller, Derryl J.; Coyne, Kathryn J.; Corush, Joel

2014-01-01

Indirect, non-invasive detection of rare aquatic macrofauna using aqueous environmental DNA (eDNA) is a relatively new approach to population and biodiversity monitoring. As such, the sensitivity of monitoring results to different methods of eDNA capture, extraction, and detection is being investigated in many ecosystems and species. One of the first and largest conservation programs with eDNA-based monitoring as a central instrument focuses on Asian bigheaded carp (Hypophthalmichthys spp.), an invasive fish spreading toward the Laurentian Great Lakes. However, the standard eDNA methods of this program have not advanced since their development in 2010. We developed new, quantitative, and more cost-effective methods and tested them against the standard protocols. In laboratory testing, our new quantitative PCR (qPCR) assay for bigheaded carp eDNA was one to two orders of magnitude more sensitive than the existing endpoint PCR assays. When applied to eDNA samples from an experimental pond containing bigheaded carp, the qPCR assay produced a detection probability of 94.8% compared to 4.2% for the endpoint PCR assays. Also, the eDNA capture and extraction method we adapted from aquatic microbiology yielded five times more bigheaded carp eDNA from the experimental pond than the standard method, at a per sample cost over forty times lower. Our new, more sensitive assay provides a quantitative tool for eDNA-based monitoring of bigheaded carp, and the higher-yielding eDNA capture and extraction method we describe can be used for eDNA-based monitoring of any aquatic species. PMID:25474207

Improved methods for capture, extraction, and quantitative assay of environmental DNA from Asian bigheaded carp (Hypophthalmichthys spp.).

PubMed

Turner, Cameron R; Miller, Derryl J; Coyne, Kathryn J; Corush, Joel

2014-01-01

Indirect, non-invasive detection of rare aquatic macrofauna using aqueous environmental DNA (eDNA) is a relatively new approach to population and biodiversity monitoring. As such, the sensitivity of monitoring results to different methods of eDNA capture, extraction, and detection is being investigated in many ecosystems and species. One of the first and largest conservation programs with eDNA-based monitoring as a central instrument focuses on Asian bigheaded carp (Hypophthalmichthys spp.), an invasive fish spreading toward the Laurentian Great Lakes. However, the standard eDNA methods of this program have not advanced since their development in 2010. We developed new, quantitative, and more cost-effective methods and tested them against the standard protocols. In laboratory testing, our new quantitative PCR (qPCR) assay for bigheaded carp eDNA was one to two orders of magnitude more sensitive than the existing endpoint PCR assays. When applied to eDNA samples from an experimental pond containing bigheaded carp, the qPCR assay produced a detection probability of 94.8% compared to 4.2% for the endpoint PCR assays. Also, the eDNA capture and extraction method we adapted from aquatic microbiology yielded five times more bigheaded carp eDNA from the experimental pond than the standard method, at a per sample cost over forty times lower. Our new, more sensitive assay provides a quantitative tool for eDNA-based monitoring of bigheaded carp, and the higher-yielding eDNA capture and extraction method we describe can be used for eDNA-based monitoring of any aquatic species.

Quantitative detection of pathogens in centrifugal microfluidic disks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory Jon

A system and methods for detection of a nucleic acid including forming a plurality of nucleic acid detection complexes are described, each of the complexes including a nucleic acid analyte, a detection agent and a functionalized probe. The method further including binding the nucleic acid detection complexes to a plurality of functionalized particles in a fluid sample and separating the functionalized particles having the nucleic acid detection complexes bound thereto from the fluid sample using a density media. The nucleic acid analyte is detected by detecting the detection agent.

Quantitative Infrared Spectroscopy in Challenging Environments: Applications to Passive Remote Sensing and Process Monitoring

DTIC Science & Technology

2012-12-01

IR remote sensing o ers a measurement method to detect gaseous species in the outdoor environment. Two major obstacles limit the application of this... method in quantitative analysis : (1) the e ect of both temperature and concentration on the measured spectral intensities and (2) the di culty and...crucial. In this research, particle swarm optimization, a population- based optimization method was applied. Digital ltering and wavelet processing methods

Measurement issues associated with quantitative molecular biology analysis of complex food matrices for the detection of food fraud.

PubMed

Burns, Malcolm; Wiseman, Gordon; Knight, Angus; Bramley, Peter; Foster, Lucy; Rollinson, Sophie; Damant, Andrew; Primrose, Sandy

2016-01-07

Following a report on a significant amount of horse DNA being detected in a beef burger product on sale to the public at a UK supermarket in early 2013, the Elliott report was published in 2014 and contained a list of recommendations for helping ensure food integrity. One of the recommendations included improving laboratory testing capacity and capability to ensure a harmonised approach for testing for food authenticity. Molecular biologists have developed exquisitely sensitive methods based on the polymerase chain reaction (PCR) or mass spectrometry for detecting the presence of particular nucleic acid or peptide/protein sequences. These methods have been shown to be specific and sensitive in terms of lower limits of applicability, but they are largely qualitative in nature. Historically, the conversion of these qualitative techniques into reliable quantitative methods has been beset with problems even when used on relatively simple sample matrices. When the methods are applied to complex sample matrices, as found in many foods, the problems are magnified resulting in a high measurement uncertainty associated with the result which may mean that the assay is not fit for purpose. However, recent advances in the technology and the understanding of molecular biology approaches have further given rise to the re-assessment of these methods for their quantitative potential. This review focuses on important issues for consideration when validating a molecular biology assay and the various factors that can impact on the measurement uncertainty of a result associated with molecular biology approaches used in detection of food fraud, with a particular focus on quantitative PCR-based and proteomics assays.

Developing the Quantitative Histopathology Image Ontology (QHIO): A case study using the hot spot detection problem.

PubMed

Gurcan, Metin N; Tomaszewski, John; Overton, James A; Doyle, Scott; Ruttenberg, Alan; Smith, Barry

2017-02-01

Interoperability across data sets is a key challenge for quantitative histopathological imaging. There is a need for an ontology that can support effective merging of pathological image data with associated clinical and demographic data. To foster organized, cross-disciplinary, information-driven collaborations in the pathological imaging field, we propose to develop an ontology to represent imaging data and methods used in pathological imaging and analysis, and call it Quantitative Histopathological Imaging Ontology - QHIO. We apply QHIO to breast cancer hot-spot detection with the goal of enhancing reliability of detection by promoting the sharing of data between image analysts. Copyright © 2016 Elsevier Inc. All rights reserved.

Precisely detecting atomic position of atomic intensity images.

PubMed

Wang, Zhijun; Guo, Yaolin; Tang, Sai; Li, Junjie; Wang, Jincheng; Zhou, Yaohe

2015-03-01

We proposed a quantitative method to detect atomic position in atomic intensity images from experiments such as high-resolution transmission electron microscopy, atomic force microscopy, and simulation such as phase field crystal modeling. The evaluation of detection accuracy proves the excellent performance of the method. This method provides a chance to precisely determine atomic interactions based on the detected atomic positions from the atomic intensity image, and hence to investigate the related physical, chemical and electrical properties. Copyright © 2014 Elsevier B.V. All rights reserved.

Optimisation of techniques for quantification of Botrytis cinerea in grape berries and receptacles by quantitative polymerase chain reaction

USDA-ARS?s Scientific Manuscript database

Quantitative PCR (qPCR) can be used to detect and monitor pathogen colonization, but early attempts to apply the technology to Botrytis cinerea infection of grape berries have identified limitations to current techniques. In this study, four DNA extraction methods, two grinding methods, two grape or...

Quantitation of TGF-beta1 mRNA in porcine mesangial cells by comparative kinetic RT/PCR: comparison with ribonuclease protection assay and in situ hybridization.

PubMed

Ceol, M; Forino, M; Gambaro, G; Sauer, U; Schleicher, E D; D'Angelo, A; Anglani, F

2001-01-01

Gene expression can be examined with different techniques including ribonuclease protection assay (RPA), in situ hybridisation (ISH), and quantitative reverse transcription-polymerase chain reaction (RT/PCR). These methods differ considerably in their sensitivity and precision in detecting and quantifying low abundance mRNA. Although there is evidence that RT/PCR can be performed in a quantitative manner, the quantitative capacity of this method is generally underestimated. To demonstrate that the comparative kinetic RT/PCR strategy-which uses a housekeeping gene as internal standard-is a quantitative method to detect significant differences in mRNA levels between different samples, the inhibitory effect of heparin on phorbol 12-myristate 13-acetate (PMA)-induced-TGF-beta1 mRNA expression was evaluated by RT/PCR and RPA, the standard method of mRNA quantification, and the results were compared. The reproducibility of RT/PCR amplification was calculated by comparing the quantity of G3PDH and TGF-beta1 PCR products, generated during the exponential phases, estimated from two different RT/PCR (G3PDH, r = 0.968, P = 0.0000; TGF-beta1, r = 0.966, P = 0.0000). The quantitative capacity of comparative kinetic RT/PCR was demonstrated by comparing the results obtained from RPA and RT/PCR using linear regression analysis. Starting from the same RNA extraction, but using only 1% of the RNA for the RT/PCR compared to RPA, significant correlation was observed (r = 0.984, P = 0.0004). Moreover the morphometric analysis of ISH signal was applied for the semi-quantitative evaluation of the expression and localisation of TGF-beta1 mRNA in the entire cell population. Our results demonstrate the close similarity of the RT/PCR and RPA methods in giving quantitative information on mRNA expression and indicate the possibility to adopt the comparative kinetic RT/PCR as reliable quantitative method of mRNA analysis. Copyright 2001 Wiley-Liss, Inc.

QUANTITATIVE MEASUREMENT OF HELICOBACTER PYLORI BY THE TAQMAN FLUOROGENIC PROBE SYSTEM

EPA Science Inventory

Culturing of H. pylori from environmental sources continues to be an obstacle in detecting and enumerating this organism. Successful methods of isolation and growth from water samples have not yet been developed. In this study a method involving real tme PCR product detection wit...

Chemoenzymatic method for glycomics: isolation, identification, and quantitation

PubMed Central

Yang, Shuang; Rubin, Abigail; Eshghi, Shadi Toghi; Zhang, Hui

2015-01-01

Over the past decade, considerable progress has been made with respect to the analytical methods for analysis of glycans from biological sources. Regardless of the specific methods that are used, glycan analysis includes isolation, identification, and quantitation. Derivatization is indispensable to increase their identification. Derivatization of glycans can be performed by permethylation or carbodiimide coupling / esterification. By introducing a fluorophore or chromophore at their reducing end, glycans can be separated by electrophoresis or chromatography. The fluorogenically labeled glycans can be quantitated using fluorescent detection. The recently developed approaches using solid-phase such as glycoprotein immobilization for glycan extraction and on-tissue glycan mass spectrometry imaging demonstrate advantages over methods performed in solution. Derivatization of sialic acids is favorably implemented on the solid support using carbodiimide coupling, and the released glycans can be further modified at the reducing end or permethylated for quantitative analysis. In this review, methods for glycan isolation, identification, and quantitation are discussed. PMID:26390280

Raman spectroscopy-based detection of chemical contaminants in food powders

USDA-ARS?s Scientific Manuscript database

Raman spectroscopy technique has proven to be a reliable method for qualitative detection of chemical contaminants in food ingredients and products. For quantitative imaging-based detection, each contaminant particle in a food sample must be detected and it is important to determine the necessary sp...

CdSe/ZnS Quantum Dot-Labeled Lateral Flow Strips for Rapid and Quantitative Detection of Gastric Cancer Carbohydrate Antigen 72-4

NASA Astrophysics Data System (ADS)

Yan, Xinyu; Wang, Kan; Lu, Wenting; Qin, Weijian; Cui, Daxiang; He, Jinghua

2016-03-01

Carbohydrate antigen 72-4 (CA72-4) is an important biomarker associated closely with diagnosis and prognosis of early gastric cancer. How to realize quick, sensitive, specific, and quantitative detection of CA72-4 in clinical specimens has become a great requirement. Herein, we reported a CdSe/ZnS quantum dot-labeled lateral flow test strip combined with a charge-coupled device (CCD)-based reader was developed for rapid, sensitive, and quantitative detection of CA72-4. Two mouse monoclonal antibodies (mAbs) against CA72-4 were employed. One of them was coated as a test line, while another mAb was labeled with quantum dots and coated onto conjugate pad. The goat anti-mouse IgG was immobilized as a control line. After sample was added, a sandwich structure was formed with CA72-4 and these two mAbs. The fluorescent signal from quantum dots (QD)-labeled mAb in sandwich structure was related to the amount of detected CA72-4. A CCD-based reader was used to realize quantitative detection of CA72-4. Results showed that developed QD-labeled lateral flow strips to detect CA72-4 biomarker with the sensitivity of 2 IU/mL and 10 min detection time. One hundred sera samples from clinical patients with gastric cancer and healthy people were used to confirm specificity of this strip method; results showed that established strip method own 100 % reproducibility and 100 % specificity compared with Roche electrochemiluminescence assay results. In conclusion, CdSe/ZnS quantum dot-labeled lateral flow strips for detection of CA72-4 could realize rapid, sensitive, and specific detection of clinical samples and could own great potential in clinical translation in near future.

Isolation and quantification of Quillaja saponaria Molina saponins and lipids in iscom-matrix and iscoms.

PubMed

Behboudi, S; Morein, B; Rönnberg, B

1995-12-01

In the iscom, multiple copies of antigen are attached by hydrophobic interaction to a matrix which is built up by Quillaja triterpenoid saponins and lipids. Thus, the iscom presents antigen in multimeric form in a small particle with a built-in adjuvant resulting in a highly immunogenic antigen formulation. We have designed a chloroform-methanol-water extraction procedure to isolate the triterpenoid saponins and lipids incorporated into iscom-matrix and iscoms. The triterpenoids in the triterpenoid phase were quantitated using orcinol sulfuric acid detecting their carbohydrate chains and by HPLC. The cholesterol and phosphatidylcholine in the lipid phase were quantitated by HPLC and a commercial colorimetric method for the cholesterol. The quantitative methods showed an almost total separation and recovery of triterpenoids and lipids in their respective phases, while protein was detected in all phases after extraction. The protein content was determined by the method of Lowry and by amino acid analysis. Amino acid analysis was shown to be the reliable method of the two to quantitate proteins in iscoms. In conclusion, simple, reproducible and efficient procedures have been designed to isolate and quantitate the triterpenoids and lipids added for preparation of iscom-matrix and iscoms. The procedures described should also be useful to adequately define constituents in prospective vaccines.

Quantitative analysis of PEG-functionalized colloidal gold nanoparticles using charged aerosol detection.

PubMed

Smith, Mackensie C; Crist, Rachael M; Clogston, Jeffrey D; McNeil, Scott E

2015-05-01

Surface characteristics of a nanoparticle, such as functionalization with polyethylene glycol (PEG), are critical to understand and achieve optimal biocompatibility. Routine physicochemical characterization such as UV-vis spectroscopy (for gold nanoparticles), dynamic light scattering, and zeta potential are commonly used to assess the presence of PEG. However, these techniques are merely qualitative and are not sensitive enough to distinguish differences in PEG quantity, density, or presentation. As an alternative, two methods are described here which allow for quantitative measurement of PEG on PEGylated gold nanoparticles. The first, a displacement method, utilizes dithiothreitol to displace PEG from the gold surface. The dithiothreitol-coated gold nanoparticles are separated from the mixture via centrifugation, and the excess dithiothreitol and dissociated PEG are separated through reversed-phase high-performance liquid chromatography (RP-HPLC). The second, a dissolution method, utilizes potassium cyanide to dissolve the gold nanoparticles and liberate PEG. Excess CN(-), Au(CN)2 (-), and free PEG are separated using RP-HPLC. In both techniques, the free PEG can be quantified against a standard curve using charged aerosol detection. The displacement and dissolution methods are validated here using 2-, 5-, 10-, and 20-kDa PEGylated 30-nm colloidal gold nanoparticles. Further value in these techniques is demonstrated not only by quantitating the total PEG fraction but also by being able to be adapted to quantitate the free unbound PEG and the bound PEG fractions. This is an important distinction, as differences in the bound and unbound PEG fractions can affect biocompatibility, which would not be detected in techniques that only quantitate the total PEG fraction.

Species Determination and Quantitation in Mixtures Using MRM Mass Spectrometry of Peptides Applied to Meat Authentication

PubMed Central

Gunning, Yvonne; Watson, Andrew D.; Rigby, Neil M.; Philo, Mark; Peazer, Joshua K.; Kemsley, E. Kate

2016-01-01

We describe a simple protocol for identifying and quantifying the two components in binary mixtures of species possessing one or more similar proteins. Central to the method is the identification of 'corresponding proteins' in the species of interest, in other words proteins that are nominally the same but possess species-specific sequence differences. When subject to proteolysis, corresponding proteins will give rise to some peptides which are likewise similar but with species-specific variants. These are 'corresponding peptides'. Species-specific peptides can be used as markers for species determination, while pairs of corresponding peptides permit relative quantitation of two species in a mixture. The peptides are detected using multiple reaction monitoring (MRM) mass spectrometry, a highly specific technique that enables peptide-based species determination even in complex systems. In addition, the ratio of MRM peak areas deriving from corresponding peptides supports relative quantitation. Since corresponding proteins and peptides will, in the main, behave similarly in both processing and in experimental extraction and sample preparation, the relative quantitation should remain comparatively robust. In addition, this approach does not need the standards and calibrations required by absolute quantitation methods. The protocol is described in the context of red meats, which have convenient corresponding proteins in the form of their respective myoglobins. This application is relevant to food fraud detection: the method can detect 1% weight for weight of horse meat in beef. The corresponding protein, corresponding peptide (CPCP) relative quantitation using MRM peak area ratios gives good estimates of the weight for weight composition of a horse plus beef mixture. PMID:27685654

Species Determination and Quantitation in Mixtures Using MRM Mass Spectrometry of Peptides Applied to Meat Authentication.

PubMed

Gunning, Yvonne; Watson, Andrew D; Rigby, Neil M; Philo, Mark; Peazer, Joshua K; Kemsley, E Kate

2016-09-20

We describe a simple protocol for identifying and quantifying the two components in binary mixtures of species possessing one or more similar proteins. Central to the method is the identification of 'corresponding proteins' in the species of interest, in other words proteins that are nominally the same but possess species-specific sequence differences. When subject to proteolysis, corresponding proteins will give rise to some peptides which are likewise similar but with species-specific variants. These are 'corresponding peptides'. Species-specific peptides can be used as markers for species determination, while pairs of corresponding peptides permit relative quantitation of two species in a mixture. The peptides are detected using multiple reaction monitoring (MRM) mass spectrometry, a highly specific technique that enables peptide-based species determination even in complex systems. In addition, the ratio of MRM peak areas deriving from corresponding peptides supports relative quantitation. Since corresponding proteins and peptides will, in the main, behave similarly in both processing and in experimental extraction and sample preparation, the relative quantitation should remain comparatively robust. In addition, this approach does not need the standards and calibrations required by absolute quantitation methods. The protocol is described in the context of red meats, which have convenient corresponding proteins in the form of their respective myoglobins. This application is relevant to food fraud detection: the method can detect 1% weight for weight of horse meat in beef. The corresponding protein, corresponding peptide (CPCP) relative quantitation using MRM peak area ratios gives good estimates of the weight for weight composition of a horse plus beef mixture.

High performance liquid chromatographic assay for the quantitation of total glutathione in plasma

NASA Technical Reports Server (NTRS)

Abukhalaf, Imad K.; Silvestrov, Natalia A.; Menter, Julian M.; von Deutsch, Daniel A.; Bayorh, Mohamed A.; Socci, Robin R.; Ganafa, Agaba A.

2002-01-01

A simple and widely used homocysteine HPLC procedure was applied for the HPLC identification and quantitation of glutathione in plasma. The method, which utilizes SBDF as a derivatizing agent utilizes only 50 microl of sample volume. Linear quantitative response curve was generated for glutathione over a concentration range of 0.3125-62.50 micromol/l. Linear regression analysis of the standard curve exhibited correlation coefficient of 0.999. Limit of detection (LOD) and limit of quantitation (LOQ) values were 5.0 and 15 pmol, respectively. Glutathione recovery using this method was nearly complete (above 96%). Intra-assay and inter-assay precision studies reflected a high level of reliability and reproducibility of the method. The applicability of the method for the quantitation of glutathione was demonstrated successfully using human and rat plasma samples.

Signal Amplification by Glyco-qPCR for Ultrasensitive Detection of Carbohydrates: Applications in Glycobiology**

PubMed Central

Kwon, Seok Joon; Lee, Kyung Bok; Solakyildirim, Kemal; Masuko, Sayaka; Ly, Mellisa; Zhang, Fuming; Li, Lingyun; Dordick, Jonathan S.; Linhardt, Robert J.

2012-01-01

Tiny amounts of carbohydrates (ca. 1 zmol) can be detected quantitatively by a real-time method based on the conjugation of carbohydrates with DNA markers (see picture). The proposed method (glyco-qPCR) provides uniform, ultrasensitive detection of carbohydrates, which can be applied to glycobiology, as well as carbohydrate-based drug discovery. PMID:23073897

Caries Detection around Restorations Using ICDAS and Optical Devices.

PubMed

Diniz, Michele Baffi; Eckert, George Joseph; González-Cabezas, Carlos; Cordeiro, Rita de Cássia Loiola; Ferreira-Zandona, Andrea Gonçalves

2016-01-01

Secondary caries is the major reason for replacement of restorations in operative dentistry. New detection methods and technology have the potential to improve the accuracy for diagnosis of secondary carious lesions. This in vitro study evaluated the performance of the ICDAS (International Caries Detection and Assessment System) visual criteria and optical devices for detecting secondary caries around amalgam and composite resin restorations in permanent teeth. A total of 180 extracted teeth with Class I amalgam (N = 90) and resin composite (N = 90) restorations were selected. Two examiners analyzed the teeth twice using the visual criteria (ICDAS), laser fluorescence (LF), light-emitting diode device (MID), quantitative light-induced fluorescence system (QLF), and a prototype system based on the Fluorescence Enamel Imaging technique (Professional Caries Detection System, PCDS). The gold standard was determined by means of confocal laser scanning microscopy. High-reproducibility values were shown for all methods, except for MID in the amalgam group. For both groups the QLF and PCDS were the most sensitive methods, whereas the other methods presented better specificity (p < 0.05). All methods, except the MID device appeared to be potential methods for detecting secondary caries only around resin composite restorations, whereas around amalgam restorations all methods seemed to be questionable. Using Internal Caries Detection and Assessment System (ICDAS), an LF device, quantitative light-induced fluorescence and a novel method based on Fluorescence Enamel Imaging technique may be effective for evaluating secondary caries around composite resin restorations. © 2016 Wiley Periodicals, Inc.

Quantitative photoacoustic elasticity and viscosity imaging for cirrhosis detection

NASA Astrophysics Data System (ADS)

Wang, Qian; Shi, Yujiao; Yang, Fen; Yang, Sihua

2018-05-01

Elasticity and viscosity assessments are essential for understanding and characterizing the physiological and pathological states of tissue. In this work, by establishing a photoacoustic (PA) shear wave model, an approach for quantitative PA elasticity imaging based on measurement of the rise time of the thermoelastic displacement was developed. Thus, using an existing PA viscoelasticity imaging method that features a phase delay measurement, quantitative PA elasticity imaging and viscosity imaging can be obtained in a simultaneous manner. The method was tested and validated by imaging viscoelastic agar phantoms prepared at different agar concentrations, and the imaging data were in good agreement with rheometry results. Ex vivo experiments on liver pathological models demonstrated the capability for cirrhosis detection, and the results were consistent with the corresponding histological results. This method expands the scope of conventional PA imaging and has potential to become an important alternative imaging modality.

Simple, Rapid, and Highly Sensitive Detection of Diphosgene and Triphosgene by Spectrophotometric Methods

PubMed Central

Joy, Abraham; Anim-Danso, Emmanuel; Kohn, Joachim

2009-01-01

Methods for the detection and estimation of diphosgene and triphosgene are described. These compounds are widely used phosgene precursors which produce an intensely colored purple pentamethine oxonol dye when reacted with 1,3-dimethylbarbituric acid (DBA) and pyridine (or a pyridine derivative). Two quantitative methods are described, based on either UV absorbance or fluorescence of the oxonol dye. Detection limits are ~ 4 µmol/L by UV and <0.4 µmol/L by fluorescence. The third method is a test strip for the simple and rapid detection and semi-quantitative estimation of diphosgene and triphosgene, using a filter paper embedded with dimethylbarbituric acid and poly(4-vinylpyridine). Addition of a test solution to the paper causes a color change from white to light blue at low concentrations and to pink at higher concentrations of triphosgene. The test strip is useful for quick on-site detection of triphosgene and diphosgene in reaction mixtures. The test strip is easy to perform and provides clear signal readouts indicative of the presence of phosgene precursors. The utility of this method was demonstrated by the qualitative determination of residual triphosgene during the production of poly(Bisphenol A carbonate). PMID:19782219

A PCR method for the detection and differentiation of Lentinus edodes and Trametes versicolor in defined-mixed cultures used for wastewater treatment.

PubMed

García-Mena, Jaime; Cano-Ramirez, Claudia; Garibay-Orijel, Claudio; Ramirez-Canseco, Sergio; Poggi-Varaldo, Héctor M

2005-06-01

A PCR-based method for the quantitative detection of Lentinus edodes and Trametes versicolor, two ligninolytic fungi applied for wastewater treatment and bioremediation, was developed. Genomic DNA was used to optimize a PCR method targeting the conserved copper-binding sequence of laccase genes. The method allowed the quantitative detection and differentiation of these fungi in single and defined-mixed cultures after fractionation of the PCR products by electrophoresis in agarose gels. Amplified products of about 150 bp for L. edodes, and about 200 bp for T. versicolor were purified and cloned. The PCR method showed a linear detection response in the 1.0 microg-1 ng range. The same method was tested with genomic DNA from a third fungus (Phanerochaete chrysosporium), yielding a fragment of about 400 bp. Southern-blot and DNA sequence analysis indicated that a specific PCR product was amplified from each genome, and that these corresponded to sequences of laccase genes. This PCR protocol permits the detection and differentiation of three ligninolytic fungi by amplifying DNA fragments of different sizes using a single pair of primers, without further enzymatic restriction of the PCR products. This method has potential use in the monitoring, evaluation, and improvement of fungal cultures used in wastewater treatment processes.

Detection of expression quantitative trait Loci in complex mouse crosses: impact and alleviation of data quality and complex population substructure.

PubMed

Iancu, Ovidiu D; Darakjian, Priscila; Kawane, Sunita; Bottomly, Daniel; Hitzemann, Robert; McWeeney, Shannon

2012-01-01

Complex Mus musculus crosses, e.g., heterogeneous stock (HS), provide increased resolution for quantitative trait loci detection. However, increased genetic complexity challenges detection methods, with discordant results due to low data quality or complex genetic architecture. We quantified the impact of theses factors across three mouse crosses and two different detection methods, identifying procedures that greatly improve detection quality. Importantly, HS populations have complex genetic architectures not fully captured by the whole genome kinship matrix, calling for incorporating chromosome specific relatedness information. We analyze three increasingly complex crosses, using gene expression levels as quantitative traits. The three crosses were an F(2) intercross, a HS formed by crossing four inbred strains (HS4), and a HS (HS-CC) derived from the eight lines found in the collaborative cross. Brain (striatum) gene expression and genotype data were obtained using the Illumina platform. We found large disparities between methods, with concordance varying as genetic complexity increased; this problem was more acute for probes with distant regulatory elements (trans). A suite of data filtering steps resulted in substantial increases in reproducibility. Genetic relatedness between samples generated overabundance of detected eQTLs; an adjustment procedure that includes the kinship matrix attenuates this problem. However, we find that relatedness between individuals is not evenly distributed across the genome; information from distinct chromosomes results in relatedness structure different from the whole genome kinship matrix. Shared polymorphisms from distinct chromosomes collectively affect expression levels, confounding eQTL detection. We suggest that considering chromosome specific relatedness can result in improved eQTL detection.

Surface-enhanced Raman spectroscopy detection of polybrominated diphenylethers using a portable Raman spectrometer.

PubMed

Jiang, Xiaohong; Lai, Yongchao; Wang, Wei; Jiang, Wei; Zhan, Jinhua

2013-11-15

Polybrominated diphenylethers (PBDEs), one of the most common brominated flame retardants, are toxic and persistent, generally detected by the chromatographic method. In this work, qualitative and quantitative detection of PBDEs were explored based on surface-enhanced Raman spectroscopy (SERS) technique using a portable Raman spectrometer. Alkanethiol modified silver nanoparticle aggregates were used as the substrate and PBDEs could be pre-concentrated close to the substrate surface through their hydrophobic interactions with alkanethiol. The effect of alkanethiols with different chain length on the SERS detection of PBDEs was evaluated. It was shown that 1-hexanethiol (HT) modified substrate has higher sensitivity, good stability and reusability. Qualitative and quantitative SERS detection of PBDEs in real sea water was accomplished, with the measured detection limits at 1.2×10(2) μg L(-1). These results illustrate SERS could be used as an effective method for the detection of PBDEs. Copyright © 2013 Elsevier B.V. All rights reserved.

Rapid and Inexpensive Screening of Genomic Copy Number Variations Using a Novel Quantitative Fluorescent PCR Method

PubMed Central

Han, Joan C.; Elsea, Sarah H.; Pena, Heloísa B.; Pena, Sérgio Danilo Junho

2013-01-01

Detection of human microdeletion and microduplication syndromes poses significant burden on public healthcare systems in developing countries. With genome-wide diagnostic assays frequently inaccessible, targeted low-cost PCR-based approaches are preferred. However, their reproducibility depends on equally efficient amplification using a number of target and control primers. To address this, the recently described technique called Microdeletion/Microduplication Quantitative Fluorescent PCR (MQF-PCR) was shown to reliably detect four human syndromes by quantifying DNA amplification in an internally controlled PCR reaction. Here, we confirm its utility in the detection of eight human microdeletion syndromes, including the more common WAGR, Smith-Magenis, and Potocki-Lupski syndromes with 100% sensitivity and 100% specificity. We present selection, design, and performance evaluation of detection primers using variety of approaches. We conclude that MQF-PCR is an easily adaptable method for detection of human pathological chromosomal aberrations. PMID:24288428

The occurrence of Campylobacter in river water and waterfowl within a watershed in southern Ontario, Canada.

PubMed

Van Dyke, M I; Morton, V K; McLellan, N L; Huck, P M

2010-09-01

Quantitative PCR and a culture method were used to investigate Campylobacter occurrence over 3 years in a watershed located in southern Ontario, Canada that is used as a source of drinking water. Direct DNA extraction from river water followed by quantitative PCR analysis detected thermophilic campylobacters at low concentrations (<130 cells 100 ml(-1) ) in 57-79% of samples taken from five locations. By comparison, a culture-based method detected Campylobacter in 0-23% of samples. Water quality parameters such as total Escherichia coli were not highly correlated with Campylobacter levels, although higher pathogen concentrations were observed at colder water temperatures (<10°C). Strains isolated from river water were primarily nalidixic acid-susceptible Campylobacter lari, and selected isolates were identified as Campylobacter lari ssp. concheus. Campylobacter from wild birds (seagulls, ducks and geese) were detected at a similar rate using PCR (32%) and culture-based (29%) methods, and although Campylobacter jejuni was isolated most frequently, C. lari ssp. concheus was also detected. Campylobacter were frequently detected at low concentrations in the watershed. Higher prevalence rates using quantitative PCR was likely because of the formation of viable but nonculturable cells and low recovery of the culture method. In addition to animal and human waste, waterfowl can be an important contributor of Campylobacter in the environment. Results of this study show that Campylobacter in surface water can be an important vector for human disease transmission and that method selection is important in determining pathogen occurrence in a water environment. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

Augmenting Amyloid PET Interpretations With Quantitative Information Improves Consistency of Early Amyloid Detection.

PubMed

Harn, Nicholas R; Hunt, Suzanne L; Hill, Jacqueline; Vidoni, Eric; Perry, Mark; Burns, Jeffrey M

2017-08-01

Establishing reliable methods for interpreting elevated cerebral amyloid-β plaque on PET scans is increasingly important for radiologists, as availability of PET imaging in clinical practice increases. We examined a 3-step method to detect plaque in cognitively normal older adults, focusing on the additive value of quantitative information during the PET scan interpretation process. Fifty-five F-florbetapir PET scans were evaluated by 3 experienced raters. Scans were first visually interpreted as having "elevated" or "nonelevated" plaque burden ("Visual Read"). Images were then processed using a standardized quantitative analysis software (MIMneuro) to generate whole brain and region of interest SUV ratios. This "Quantitative Read" was considered elevated if at least 2 of 6 regions of interest had an SUV ratio of more than 1.1. The final interpretation combined both visual and quantitative data together ("VisQ Read"). Cohen kappa values were assessed as a measure of interpretation agreement. Plaque was elevated in 25.5% to 29.1% of the 165 total Visual Reads. Interrater agreement was strong (kappa = 0.73-0.82) and consistent with reported values. Quantitative Reads were elevated in 45.5% of participants. Final VisQ Reads changed from initial Visual Reads in 16 interpretations (9.7%), with most changing from "nonelevated" Visual Reads to "elevated." These changed interpretations demonstrated lower plaque quantification than those initially read as "elevated" that remained unchanged. Interrater variability improved for VisQ Reads with the addition of quantitative information (kappa = 0.88-0.96). Inclusion of quantitative information increases consistency of PET scan interpretations for early detection of cerebral amyloid-β plaque accumulation.

Thermal quantitative sensory testing to assess the sensory effects of three local anesthetic solutions in a randomized trial of interscalene blockade for shoulder surgery.

PubMed

Sermeus, Luc A; Hans, Guy H; Schepens, Tom; Bosserez, Nathalie M-L; Breebaart, Margaretha B; Smitz, Carine J; Vercauteren, Marcel P

2016-01-01

This study investigated whether quantitative sensory testing (QST) with thermal stimulations can quantitatively measure the characteristics of an ultrasound-guided interscalene brachial plexus block (US-ISB). This was a prospective randomized trial in patients scheduled for arthroscopic shoulder surgery under general anesthesia and US-ISB. Participants and observers were blinded for the study. We assigned the study participants to one of three groups: 0.5% levobupivacaine 15 mL, 0.5% levobupivacaine 15 mL with 1:200,000 epinephrine, and 0.75% ropivacaine 15 mL. We performed thermal QST within dermatomes C4, C5, C6, and C7 before infiltration and 30 min, six hours, ten hours, and 24 hr after performing the US-ISB. In addition, we used QST, a semi-objective quantitative testing method, to measure the onset, intensity, duration, extent, and functional recovery of the sensory block. We also measured detection thresholds for cold/warm sensations and cold/heat pain. Detection thresholds for all thermal sensations within the ipsilateral C4, C5, C6, and C7 dermatomes increased rapidly (indicating the development of a hypoesthetic state) and reached a steady state after 30 min. This lasted for approximately ten hours and returned to normal detection thresholds by 24 hr. There were no differences detected between the three groups at 24 hr when we compared warm sensation thresholds on one dermatome. Visual inspection of the pooled results per dermatome suggests the ability of QST to detect clinically relevant differences in block intensity per dermatome. Quantitative sensory testing can be useful as a method for detecting the presence and characteristics of regional anesthesia-induced sensory block and may be used for the evaluation of clinical protocols. The three local anesthetic solutions exhibited a similar anesthetic effect. The results support the use of QST to assess block characteristics quantitatively under clinical research conditions. This trial was registered at Clinicaltrals.gov, NCT02271867.

Real time quantitative phase microscopy based on single-shot transport of intensity equation (ssTIE) method

NASA Astrophysics Data System (ADS)

Yu, Wei; Tian, Xiaolin; He, Xiaoliang; Song, Xiaojun; Xue, Liang; Liu, Cheng; Wang, Shouyu

2016-08-01

Microscopy based on transport of intensity equation provides quantitative phase distributions which opens another perspective for cellular observations. However, it requires multi-focal image capturing while mechanical and electrical scanning limits its real time capacity in sample detections. Here, in order to break through this restriction, real time quantitative phase microscopy based on single-shot transport of the intensity equation method is proposed. A programmed phase mask is designed to realize simultaneous multi-focal image recording without any scanning; thus, phase distributions can be quantitatively retrieved in real time. It is believed the proposed method can be potentially applied in various biological and medical applications, especially for live cell imaging.

Separation and quantitation of polyethylene glycols 400 and 3350 from human urine by high-performance liquid chromatography.

PubMed

Ryan, C M; Yarmush, M L; Tompkins, R G

1992-04-01

Polyethylene glycol 3350 (PEG 3350) is useful as an orally administered probe to measure in vivo intestinal permeability to macromolecules. Previous methods to detect polyethylene glycol (PEG) excreted in the urine have been hampered by inherent inaccuracies associated with liquid-liquid extraction and turbidimetric analysis. For accurate quantitation by previous methods, radioactive labels were required. This paper describes a method to separate and quantitate PEG 3350 and PEG 400 in human urine that is independent of radioactive labels and is accurate in clinical practice. The method uses sized regenerated cellulose membranes and mixed ion-exchange resin for sample preparation and high-performance liquid chromatography with refractive index detection for analysis. The 24-h excretion for normal individuals after an oral dose of 40 g of PEG 3350 and 5 g of PEG 400 was 0.12 +/- 0.04% of the original dose of PEG 3350 and 26.3 +/- 5.1% of the original dose of PEG 400.

Electrochemical and Infrared Absorption Spectroscopy Detection of SF6 Decomposition Products

PubMed Central

Dong, Ming; Ren, Ming; Ye, Rixin

2017-01-01

Sulfur hexafluoride (SF6) gas-insulated electrical equipment is widely used in high-voltage (HV) and extra-high-voltage (EHV) power systems. Partial discharge (PD) and local heating can occur in the electrical equipment because of insulation faults, which results in SF6 decomposition and ultimately generates several types of decomposition products. These SF6 decomposition products can be qualitatively and quantitatively detected with relevant detection methods, and such detection contributes to diagnosing the internal faults and evaluating the security risks of the equipment. At present, multiple detection methods exist for analyzing the SF6 decomposition products, and electrochemical sensing (ES) and infrared (IR) spectroscopy are well suited for application in online detection. In this study, the combination of ES with IR spectroscopy is used to detect SF6 gas decomposition. First, the characteristics of these two detection methods are studied, and the data analysis matrix is established. Then, a qualitative and quantitative analysis ES-IR model is established by adopting a two-step approach. A SF6 decomposition detector is designed and manufactured by combining an electrochemical sensor and IR spectroscopy technology. The detector is used to detect SF6 gas decomposition and is verified to reliably and accurately detect the gas components and concentrations. PMID:29140268

Development and evaluation of a quantitative PCR assay for detection of Hepatozoon sp.

PubMed

Criado-Fornelio, A; Buling, A; Cunha-Filho, N A; Ruas, J L; Farias, N A R; Rey-Valeiron, C; Pingret, J L; Etievant, M; Barba-Carretero, J C

2007-12-25

With the aim to improve current molecular diagnostic techniques of Hepatozoon sp. in carnivore mammals, we developed a quantitative PCR (qPCR) assay with SYBR Green I((R)). The method, consisting of amplification of a 235bp fragment of the 18S rRNA gene, is able to detect at least 0.1fg of parasite DNA. Reproducible quantitative results were obtained over a range of 0.1ng-0.1fg of Hepatozoon sp. DNA. To assess the performance of the qPCR assay, DNA samples from dogs (140) and cats (50) were tested with either standard PCR or qPCR. Positive samples were always confirmed by partial sequencing of the 18S rRNA gene. Quantitative PCR was 15.8% more sensitive than standard PCR to detect H. canis in dogs. In cats, no infections were detected by standard PCR, compared to two positives by qPCR (which were infected by H. canis as shown by sequencing).

Qualitative and Quantitative Detection of Botulinum Neurotoxins from Complex Matrices: Results of the First International Proficiency Test

PubMed Central

Worbs, Sylvia; Fiebig, Uwe; Zeleny, Reinhard; Schimmel, Heinz; Rummel, Andreas; Luginbühl, Werner; Dorner, Brigitte G.

2015-01-01

In the framework of the EU project EQuATox, a first international proficiency test (PT) on the detection and quantification of botulinum neurotoxins (BoNT) was conducted. Sample materials included BoNT serotypes A, B and E spiked into buffer, milk, meat extract and serum. Different methods were applied by the participants combining different principles of detection, identification and quantification. Based on qualitative assays, 95% of all results reported were correct. Successful strategies for BoNT detection were based on a combination of complementary immunological, MS-based and functional methods or on suitable functional in vivo/in vitro approaches (mouse bioassay, hemidiaphragm assay and Endopep-MS assay). Quantification of BoNT/A, BoNT/B and BoNT/E was performed by 48% of participating laboratories. It turned out that precise quantification of BoNT was difficult, resulting in a substantial scatter of quantitative data. This was especially true for results obtained by the mouse bioassay which is currently considered as “gold standard” for BoNT detection. The results clearly demonstrate the urgent need for certified BoNT reference materials and the development of methods replacing animal testing. In this context, the BoNT PT provided the valuable information that both the Endopep-MS assay and the hemidiaphragm assay delivered quantitative results superior to the mouse bioassay. PMID:26703724

An event-specific method for the detection and quantification of ML01, a genetically modified Saccharomyces cerevisiae wine strain, using quantitative PCR.

PubMed

Vaudano, Enrico; Costantini, Antonella; Garcia-Moruno, Emilia

2016-10-03

The availability of genetically modified (GM) yeasts for winemaking and, in particular, transgenic strains based on the integration of genetic constructs deriving from other organisms into the genome of Saccharomyces cerevisiae, has been a reality for several years. Despite this, their use is only authorized in a few countries and limited to two strains: ML01, able to convert malic acid into lactic acid during alcoholic fermentation, and ECMo01 suitable for reducing the risk of carbamate production. In this work we propose a quali-quantitative culture-independent method for the detection of GM yeast ML01 in commercial preparations of ADY (Active Dry Yeast) consisting of efficient extraction of DNA and qPCR (quantitative PCR) analysis based on event-specific assay targeting MLC (malolactic cassette), and a taxon-specific S. cerevisiae assay detecting the MRP2 gene. The ADY DNA extraction methodology has been shown to provide good purity DNA suitable for subsequent qPCR. The MLC and MRP2 qPCR assay showed characteristics of specificity, dynamic range, limit of quantification (LOQ) limit of detection (LOD), precision and trueness, which were fully compliant with international reference guidelines. The method has been shown to reliably detect 0.005% (mass/mass) of GM ML01 S. cerevisiae in commercial preparations of ADY. Copyright © 2016 Elsevier B.V. All rights reserved.

A novel approach for quantitation of nonderivatized sialic acid in protein therapeutics using hydrophilic interaction chromatographic separation and nano quantity analyte detection.

PubMed

Chemmalil, Letha; Suravajjala, Sreekanth; See, Kate; Jordan, Eric; Furtado, Marsha; Sun, Chong; Hosselet, Stephen

2015-01-01

This paper describes a novel approach for the quantitation of nonderivatized sialic acid in glycoproteins, separated by hydrophilic interaction chromatography, and detection by Nano Quantity Analyte Detector (NQAD). The detection technique of NQAD is based on measuring change in the size of dry aerosol and converting the particle count rate into chromatographic output signal. NQAD detector is suitable for the detection of sialic acid, which lacks sufficiently active chromophore or fluorophore. The water condensation particle counting technology allows the analyte to be enlarged using water vapor to provide highest sensitivity. Derivatization-free analysis of glycoproteins using HPLC/NQAD method with PolyGLYCOPLEX™ amide column is well correlated with HPLC method with precolumn derivatization using 1, 2-diamino-4, 5-methylenedioxybenzene (DMB) as well as the Dionex-based high-pH anion-exchange chromatography (or ion chromatography) with pulsed amperometric detection (HPAEC-PAD). With the elimination of derivatization step, HPLC/NQAD method is more efficient than HPLC/DMB method. HPLC/NQAD method is more reproducible than HPAEC-PAD method as HPAEC-PAD method suffers high variability because of electrode fouling during analysis. Overall, HPLC/NQAD method offers broad linear dynamic range as well as excellent precision, accuracy, repeatability, reliability, and ease of use, with acceptable comparability to the commonly used HPAEC-PAD and HPLC/DMB methods. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

Development and validation of a reverse transcription quantitative polymerase chain reaction for tilapia lake virus detection in clinical samples and experimentally challenged fish.

PubMed

Tattiyapong, P; Sirikanchana, K; Surachetpong, W

2018-02-01

Tilapia lake virus (TiLV) is an emerging pathogen associated with high mortalities of wild and farm-raised tilapia in different countries. In this study, a SYBR green-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay targeting segment three of the virus was developed to detect and quantify TiLV in clinical samples and experimentally challenged fish. All 30 field samples with clinical signs and history consistent with TiLV infection were positive for TiLV as detected by the developed RT-qPCR method. The RT-qPCR technique provided 100 and 10,000 times more sensitive for virus detection than those offered by the RT-PCR and virus isolation in cell culture methods, respectively. The detection limit of the RT-qPCR method was as low as two viral copies/μl. Moreover, the RT-qPCR technique could be applied for TiLV detection in various fish tissues including gills, liver, brain, heart, anterior kidney and spleen. Significantly, this study delivered an accurate and reliable method for rapid detection of TiLV viruses that facilitates active surveillance programme and disease containment. © 2017 John Wiley & Sons Ltd.

Low level vapor verification of monomethyl hydrazine

NASA Technical Reports Server (NTRS)

Mehta, Narinder

1990-01-01

The vapor scrubbing system and the coulometric test procedure for the low level vapor verification of monomethyl hydrazine (MMH) are evaluated. Experimental data on precision, efficiency of the scrubbing liquid, instrument response, detection and reliable quantitation limits, stability of the vapor scrubbed solution, and interference were obtained to assess the applicability of the method for the low ppb level detection of the analyte vapor in air. The results indicated that the analyte vapor scrubbing system and the coulometric test procedure can be utilized for the quantitative detection of low ppb level vapor of MMH in air.

Measurement of sulfur-containing compounds involved in the metabolism and transport of cysteamine and cystamine. Regional differences in cerebral metabolism☆

PubMed Central

Pinto, John T.; Khomenko, Tetyana; Szabo, Sandor; McLaren, Gordon D.; Denton, Travis T.; Krasnikov, Boris F.; Jeitner, Thomas M.; Cooper, Arthur J.L.

2009-01-01

An HPLC method with coulometric detection is presented for the quantitation of cysteamine, cystamine, thialysine, glutathione, glutathione disulfide and an oxidized metabolite of thialysine [S-(2-aminoethyl)-l-cysteine ketimine decarboxylated dimer (AECK-DD)]. The advantage of coulometric detection is that derivatization is unnecessary if the analyte is redox sensitive. The method was used to quantitate several sulfur-containing compounds in plasma and brain following gavage feeding of cysteamine to rats. Cysteamine, cystamine, thialysine and AECK-DD were detected in the brains of these animals. Interestingly, cysteamine treatment resulted in greatly elevated levels of cerebral methionine, despite the fact that cysteamine is not a precursor of methionine. PMID:19523884

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

PubMed

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

Determination of alkylphenol and alkylphenolethoxylates in biota by liquid chromatography with detection by tandem mass spectrometry and fluorescence spectroscopy

USGS Publications Warehouse

Schmitz-Afonso, I.; Loyo-Rosales, J.E.; de la Paz Aviles, M.; Rattner, B.A.; Rice, C.P.

2003-01-01

A quantitative method for the simultaneous determination of octylphenol, nonylphenol and the corresponding ethoxylates (1 to 5) in biota is presented. Extraction methods were developed for egg and fish matrices based on accelerated solvent extraction followed by a solid-phase extraction cleanup, using octadecylsilica or aminopropyl cartridges. Identification and quantitation were accomplished by liquid chromatography-electrospray tandem mass spectrometry (LC-MS-MS) and compared to the traditional liquid chromatography with fluorescence spectroscopy detection. LC-MS-MS provides high sensitivity and specificity required for these complex matrices and an accurate quantitation with the use of 13C-labeled internal standards. Quantitation limits by LC-MS-MS ranged from 4 to 12 ng/g in eggs, and from 6 to 22 ng/g in fish samples. These methods were successfully applied to osprey eggs from the Chesapeake Bay and fish from the Great Lakes area. Total levels found in osprey egg samples were up to 18 ng/g wet mass and as high as 8.2 ug/g wet mass in the fish samples.

Detection of protein modifications and counterfeit protein pharmaceuticals using isotope tags for relative and absolute quantification and matrix-assisted laser desorption/ionization tandem time-of-flight mass spectrometry: studies of insulins.

PubMed

Ye, Hongping; Hill, John; Kauffman, John; Gryniewicz, Connie; Han, Xianlin

2008-08-15

Isotope tags for relative and absolute quantification (iTRAQ) reagent coupled with matrix-assisted laser desorption/ionization tandem time-of-flight (MALDI-TOF/TOF) mass spectrometric analysis has been evaluated as both a qualitative and quantitative method for the detection of modifications to active pharmaceutical ingredients derived from recombinant DNA technologies and as a method to detect counterfeit drug products. Five types of insulin (human, bovine, porcine, Lispro, and Lantus) were used as model products in the study because of their minor variations in amino acid sequence. Several experiments were conducted in which each insulin variant was separately digested with Glu-C, and the digestate was labeled with one of four different iTRAQ reagents. All digestates were then combined for desalting and MALDI-TOF/TOF mass spectrometric analysis. When the digestion procedure was optimized, the insulin sequence coverage was 100%. Five different types of insulin were readily differentiated, including human insulin (P28K29) and Lispro insulin (K28P29), which differ only by the interchange of two contiguous residues. Moreover, quantitative analyses show that the results obtained from the iTRAQ method agree well with those determined by other conventional methods. Collectively, the iTRAQ method can be used as a qualitative and quantitative technique for the detection of protein modification and counterfeiting.

Apparatus and method for quantitatively evaluating total fissile and total fertile nuclide content in samples

DOEpatents

Caldwell, John T.; Kunz, Walter E.; Cates, Michael R.; Franks, Larry A.

1985-01-01

Simultaneous photon and neutron interrogation of samples for the quantitative determination of total fissile nuclide and total fertile nuclide material present is made possible by the use of an electron accelerator. Prompt and delayed neutrons produced from resulting induced fissions are counted using a single detection system and allow the resolution of the contributions from each interrogating flux leading in turn to the quantitative determination sought. Detection limits for .sup.239 Pu are estimated to be about 3 mg using prompt fission neutrons and about 6 mg using delayed neutrons.

Apparatus and method for quantitatively evaluating total fissile and total fertile nuclide content in samples. [Patent application

DOEpatents

Caldwell, J.T.; Kunz, W.E.; Cates, M.R.; Franks, L.A.

1982-07-07

Simultaneous photon and neutron interrogation of samples for the quantitative determination of total fissile nuclide and total fertile nuclide material present is made possible by the use of an electron accelerator. Prompt and delayed neutrons produced from resulting induced fission are counted using a single detection system and allow the resolution of the contributions from each interrogating flux leading in turn to the quantitative determination sought. Detection limits for /sup 239/Pu are estimated to be about 3 mg using prompt fission neutrons and about 6 mg using delayed neutrons.

Sequential (step-by-step) detection, identification and quantitation of extra virgin olive oil adulteration by chemometric treatment of chromatographic profiles.

PubMed

Capote, F Priego; Jiménez, J Ruiz; de Castro, M D Luque

2007-08-01

An analytical method for the sequential detection, identification and quantitation of extra virgin olive oil adulteration with four edible vegetable oils--sunflower, corn, peanut and coconut oils--is proposed. The only data required for this method are the results obtained from an analysis of the lipid fraction by gas chromatography-mass spectrometry. A total number of 566 samples (pure oils and samples of adulterated olive oil) were used to develop the chemometric models, which were designed to accomplish, step-by-step, the three aims of the method: to detect whether an olive oil sample is adulterated, to identify the type of adulterant used in the fraud, and to determine how much aldulterant is in the sample. Qualitative analysis was carried out via two chemometric approaches--soft independent modelling of class analogy (SIMCA) and K nearest neighbours (KNN)--both approaches exhibited prediction abilities that were always higher than 91% for adulterant detection and 88% for type of adulterant identification. Quantitative analysis was based on partial least squares regression (PLSR), which yielded R2 values of >0.90 for calibration and validation sets and thus made it possible to determine adulteration with excellent precision according to the Shenk criteria.

Accounting for Limited Detection Efficiency and Localization Precision in Cluster Analysis in Single Molecule Localization Microscopy

PubMed Central

Shivanandan, Arun; Unnikrishnan, Jayakrishnan; Radenovic, Aleksandra

2015-01-01

Single Molecule Localization Microscopy techniques like PhotoActivated Localization Microscopy, with their sub-diffraction limit spatial resolution, have been popularly used to characterize the spatial organization of membrane proteins, by means of quantitative cluster analysis. However, such quantitative studies remain challenged by the techniques’ inherent sources of errors such as a limited detection efficiency of less than 60%, due to incomplete photo-conversion, and a limited localization precision in the range of 10 – 30nm, varying across the detected molecules, mainly depending on the number of photons collected from each. We provide analytical methods to estimate the effect of these errors in cluster analysis and to correct for them. These methods, based on the Ripley’s L(r) – r or Pair Correlation Function popularly used by the community, can facilitate potentially breakthrough results in quantitative biology by providing a more accurate and precise quantification of protein spatial organization. PMID:25794150

Qualitative PCR method for Roundup Ready soybean: interlaboratory study.

PubMed

Kodama, Takashi; Kasahara, Masaki; Minegishi, Yasutaka; Futo, Satoshi; Sawada, Chihiro; Watai, Masatoshi; Akiyama, Hiroshi; Teshima, Reiko; Kurosawa, Yasunori; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

2011-01-01

Quantitative and qualitative methods based on PCR have been developed for genetically modified organisms (GMO). Interlaboratory studies were previously conducted for GMO quantitative methods; in this study, an interlaboratory study was conducted for a qualitative method for a GM soybean, Roundup Ready soy (RR soy), with primer pairs designed for the quantitative method of RR soy studied previously. Fourteen laboratories in Japan participated. Each participant extracted DNA from 1.0 g each of the soy samples containing 0, 0.05, and 0.10% of RR soy, and performed PCR with primer pairs for an internal control gene (Le1) and RR soy followed by agarose gel electrophoresis. The PCR product amplified in this PCR system for Le1 was detected from all samples. The sensitivity, specificity, and false-negative and false-positive rates of the method were obtained from the results of RR soy detection. False-negative rates at the level of 0.05 and 0.10% of the RR soy samples were 6.0 and 2.3%, respectively, revealing that the LOD of the method was somewhat below 0.10%. The current study demonstrated that the qualitative method would be practical for monitoring the labeling system of GM soy in kernel lots.

Quantitation of N,N-dimethyltryptamine and harmala alkaloids in human plasma after oral dosing with ayahuasca.

PubMed

Callaway, J C; Raymon, L P; Hearn, W L; McKenna, D J; Grob, C S; Brito, G S; Mash, D C

1996-10-01

Harmine, harmaline, tetrahydroharmine (THH), and N,N-dimethyltryptamine (DMT) were quantitated in plasma from 15 healthy male volunteers after the ingestion of ayahuasca, a beverage that has been used for religious purposes in Brazil since pre-Columbian times. A growing awareness of the interest in this ancient shamanistic practice in modern urban cultures and the widespread popular dissemination of the inebriant effects and type and sources of the plant admixtures used to prepare the beverage have provided additional impetus for this study. The three harmala alkaloids were quantitated from protein-precipitated plasma by high-performance liquid chromatography using fluorescence detection. Recovery from blank human plasma was quantitative, and the limit of quantitation (LOQ) was below 2 ng/mL of plasma for each of the harmala alkaloids. Standard concentrations ranged from 10 to 250 ng/mL for harmine and THH and from 1.0 to 25.0 ng/mL for harmaline, respectively. Linearity was observed for harmine, harmaline, and THH within these respective ranges. The highest concentrations of harmala alkaloids in human plasma were found to be 222.3 ng/mL for harmine, 134.5 ng/mL for THH, and 9.4 ng/mL for harmaline. DMT was quantitated by gas chromatography using nitrogen-phosphorus detection after liquid-liquid extraction with diphenhydramine as an internal standard. DMT recovery was quantitative, and the limit of detection and LOQ were 0.5 and 5 ng/mL, respectively. Linearity for DMT was observed from 5 to 1000 ng/mL. The one-step extraction method for DMT and the protein precipitation method for the three harmala alkaloids afford rapid, sensitive, and quantitative analyses of these alkaloids with minimal analyte loss. The analytical methods also may be applicable to other matrices, including whole blood and urine samples and homogenized tissue specimens. These are the first reported observations of DMT and harmala alkaloids in plasma after ritual ingestion of ayahuasca.

Detection of a sudden change of the field time series based on the Lorenz system.

PubMed

Da, ChaoJiu; Li, Fang; Shen, BingLu; Yan, PengCheng; Song, Jian; Ma, DeShan

2017-01-01

We conducted an exploratory study of the detection of a sudden change of the field time series based on the numerical solution of the Lorenz system. First, the time when the Lorenz path jumped between the regions on the left and right of the equilibrium point of the Lorenz system was quantitatively marked and the sudden change time of the Lorenz system was obtained. Second, the numerical solution of the Lorenz system was regarded as a vector; thus, this solution could be considered as a vector time series. We transformed the vector time series into a time series using the vector inner product, considering the geometric and topological features of the Lorenz system path. Third, the sudden change of the resulting time series was detected using the sliding t-test method. Comparing the test results with the quantitatively marked time indicated that the method could detect every sudden change of the Lorenz path, thus the method is effective. Finally, we used the method to detect the sudden change of the pressure field time series and temperature field time series, and obtained good results for both series, which indicates that the method can apply to high-dimension vector time series. Mathematically, there is no essential difference between the field time series and vector time series; thus, we provide a new method for the detection of the sudden change of the field time series.

Detection of Mycobacterium avium subsp. paratuberculosis in Drinking Water and Biofilms by Quantitative PCR ▿ †

PubMed Central

Beumer, Amy; King, Dawn; Donohue, Maura; Mistry, Jatin; Covert, Terry; Pfaller, Stacy

2010-01-01

It has been suggested that Mycobacterium avium subspecies paratuberculosis has a role in Crohn's disease. The organism may be acquired but is difficult to culture from the environment. We describe a quantitative PCR (qPCR) method to detect M. avium subsp. paratuberculosis in drinking water and the results of its application to drinking water and faucet biofilm samples collected in the United States. PMID:20817803

Analysis of metalaxyl racemate using high performance liquid chromatography coupled with four kinds of detectors.

PubMed

Chen, Tao; Fan, Jun; Gao, Ruiqi; Wang, Tai; Yu, Ying; Zhang, Weiguang

2016-10-07

Chiral stationary phase-high performance liquid chromatography coupled with various detectors has been one of most commonly used methods for analysis and separation of chiral compounds over the past decades. Various detectors exhibit different characteristics in qualitative and quantitative studies under different chromatographic conditions. Herein, a comparative evaluation of HPLC coupled with ultraviolet, optical rotation, refractive index, and evaporative light scattering detectors has been conducted for qualitative and quantitative analyses of metalaxyl racemate. Effects of separation conditions on the peak area ratio between two enantiomers, including sample concentration, column temperature, mobile phase composition, as well as flow rate, have been investigated in detail. In addition, the limits of detection, the limits of quantitation, quantitative range and precision for these two enantiomers by using four detectors have been also studied. As indicated, the chromatographic separation conditions have been slight effects on ultraviolet and refractive index detections and the peak area ratio between two enantiomers remains almost unchanged, but the evaporative light scattering detection has been significantly affected by the above-mentioned chromatographic conditions and the corresponding peak area ratios varied greatly. Moreover, the limits of detection, the limits of quantitation, and the quantitative ranges of two enantiomers with UV detection were remarkably lower by 1-2 magnitudes than the others. Copyright © 2016 Elsevier B.V. All rights reserved.

Comparative performance of two quantitative safety signalling methods: implications for use in a pharmacovigilance department.

PubMed

Almenoff, June S; LaCroix, Karol K; Yuen, Nancy A; Fram, David; DuMouchel, William

2006-01-01

There is increasing interest in using disproportionality-based signal detection methods to support postmarketing safety surveillance activities. Two commonly used methods, empirical Bayes multi-item gamma Poisson shrinker (MGPS) and proportional reporting ratio (PRR), perform differently with respect to the number and types of signals detected. The goal of this study was to compare and analyse the performance characteristics of these two methods, to understand why they differ and to consider the practical implications of these differences for a large, industry-based pharmacovigilance department. We compared the numbers and types of signals of disproportionate reporting (SDRs) obtained with MGPS and PRR using two postmarketing safety databases and a simulated database. We recorded signal counts and performed a qualitative comparison of the drug-event combinations signalled by the two methods as well as a sensitivity analysis to better understand how the thresholds commonly used for these methods impact their performance. PRR detected more SDRs than MGPS. We observed that MGPS is less subject to confounding by demographic factors because it employs stratification and is more stable than PRR when report counts are low. Simulation experiments performed using published empirical thresholds demonstrated that PRR detected false-positive signals at a rate of 1.1%, while MGPS did not detect any statistical false positives. In an attempt to separate the effect of choice of signal threshold from more fundamental methodological differences, we performed a series of experiments in which we modified the conventional threshold values for each method so that each method detected the same number of SDRs for the example drugs studied. This analysis, which provided quantitative examples of the relationship between the published thresholds for the two methods, demonstrates that the signalling criterion published for PRR has a higher signalling frequency than that published for MGPS. The performance differences between the PRR and MGPS methods are related to (i) greater confounding by demographic factors with PRR; (ii) a higher tendency of PRR to detect false-positive signals when the number of reports is small; and (iii) the conventional thresholds that have been adapted for each method. PRR tends to be more 'sensitive' and less 'specific' than MGPS. A high-specificity disproportionality method, when used in conjunction with medical triage and investigation of critical medical events, may provide an efficient and robust approach to applying quantitative methods in routine postmarketing pharmacovigilance.

MethylMeter(®): bisulfite-free quantitative and sensitive DNA methylation profiling and mutation detection in FFPE samples.

PubMed

McCarthy, David; Pulverer, Walter; Weinhaeusel, Andreas; Diago, Oscar R; Hogan, Daniel J; Ostertag, Derek; Hanna, Michelle M

2016-06-01

Development of a sensitive method for DNA methylation profiling and associated mutation detection in clinical samples. Formalin-fixed and paraffin-embedded tumors received by clinical laboratories often contain insufficient DNA for analysis with bisulfite or methylation sensitive restriction enzymes-based methods. To increase sensitivity, methyl-CpG DNA capture and Coupled Abscription PCR Signaling detection were combined in a new assay, MethylMeter(®). Gliomas were analyzed for MGMT methylation, glioma CpG island methylator phenotype and IDH1 R132H. MethylMeter had 100% assay success rate measuring all five biomarkers in formalin-fixed and paraffin-embedded tissue. MGMT methylation results were supported by survival and mRNA expression data. MethylMeter is a sensitive and quantitative method for multitarget DNA methylation profiling and associated mutation detection. The MethylMeter-based GliomaSTRAT assay measures methylation of four targets and one mutation to simultaneously grade gliomas and predict their response to temozolomide. This information is clinically valuable in management of gliomas.

Microelectrode-based technology for the detection of low levels of bacteria

NASA Technical Reports Server (NTRS)

Rogers, Tom D.; Hitchens, G. D.; Mishra, S. K.; Pierson, D. L.

1992-01-01

A microelectrode-based electrochemical detection method was used for quantitation of bacteria in water samples. The redox mediator, benzoquinone, was used to accept electrons from the bacterial metabolic pathway to create a flow of electrons by reducing the mediator. Electrochemical monitoring electrodes detected the reduced mediator as it diffused out of the cells and produced a small electrical current. By using a combination of microelectrodes and monitoring instrumentation, the cumulative current generated by a particular bacterial population could be monitored. Using commercially available components, an electrochemical detection system was assembled and tested to evaluate its potential as an emerging technology for rapid detection and quantitation of bacteria in water samples.

The fragmented testis method: development and its advantages of a new quantitative evaluation technique for detection of testis-ova in male fish.

PubMed

Lin, Bin-Le; Hagino, Satoshi; Kagoshima, Michio; Iwamatsu, Takashi

2009-02-01

A new quantitative evaluation technique, termed the fragmented testis method, has been developed for the detection of testis-ova in genotypic male fish using the medaka (Oryzias latipes). The routine traditional histological method for detection of testis-ova in male fish exposed to estrogens or suspected endocrine-disrupting chemicals has several disadvantages, including possible oversight of testis-ova due to limited sampling of selected tissue sections. The method we have developed here allows for the accurate determination of the developmental stages and the number and the size of testis-ova in a whole testis. Each testis was removed from the fish specimen, fixed with 10% buffered formalin solution, and then divided into small fragments on a glass slide with a dissecting needle or scalpel and aciform forceps in glycerin solution containing a small amount of methylene blue or toluidine blue. If present, all developing testis-ova of various sizes in fragmented testicular tissues were clearly stained and were observable under a dissecting microscope. Testis-ova occurred in controls were ascertained, while spermatozoa were also distinguishable using this method. This proved to be a convenient and cost-effective method for quantitatively evaluating testis-ova appearance in fish, and it may help to clarify the mechanism of testis-ova formation and the biological significance of testis-ova in future studies of endocrine disruption.

Quantitative measurement of intact alpha-synuclein proteoforms from post-mortem control and Parkinson's disease brain tissue by intact protein mass spectrometry.

PubMed

Kellie, John F; Higgs, Richard E; Ryder, John W; Major, Anthony; Beach, Thomas G; Adler, Charles H; Merchant, Kalpana; Knierman, Michael D

2014-07-23

A robust top down proteomics method is presented for profiling alpha-synuclein species from autopsied human frontal cortex brain tissue from Parkinson's cases and controls. The method was used to test the hypothesis that pathology associated brain tissue will have a different profile of post-translationally modified alpha-synuclein than the control samples. Validation of the sample processing steps, mass spectrometry based measurements, and data processing steps were performed. The intact protein quantitation method features extraction and integration of m/z data from each charge state of a detected alpha-synuclein species and fitting of the data to a simple linear model which accounts for concentration and charge state variability. The quantitation method was validated with serial dilutions of intact protein standards. Using the method on the human brain samples, several previously unreported modifications in alpha-synuclein were identified. Low levels of phosphorylated alpha synuclein were detected in brain tissue fractions enriched for Lewy body pathology and were marginally significant between PD cases and controls (p = 0.03).

Comparison of Real-Time PCR, Reverse Transcriptase Real-Time PCR, Loop-Mediated Isothermal Amplification, and the FDA Conventional Microbiological Method for the Detection of Salmonella spp. in Produce ▿ †

PubMed Central

Zhang, Guodong; Brown, Eric W.; González-Escalona, Narjol

2011-01-01

Contamination of foods, especially produce, with Salmonella spp. is a major concern for public health. Several methods are available for the detection of Salmonella in produce, but their relative efficiency for detecting Salmonella in commonly consumed vegetables, often associated with outbreaks of food poisoning, needs to be confirmed. In this study, the effectiveness of three molecular methods for detection of Salmonella in six produce matrices was evaluated and compared to the FDA microbiological detection method. Samples of cilantro (coriander leaves), lettuce, parsley, spinach, tomato, and jalapeno pepper were inoculated with Salmonella serovars at two different levels (105 and <101 CFU/25 g of produce). The inoculated produce was assayed by the FDA Salmonella culture method (Bacteriological Analytical Manual) and by three molecular methods: quantitative real-time PCR (qPCR), quantitative reverse transcriptase real-time PCR (RT-qPCR), and loop-mediated isothermal amplification (LAMP). Comparable results were obtained by these four methods, which all detected as little as 2 CFU of Salmonella cells/25 g of produce. All control samples (not inoculated) were negative by the four methods. RT-qPCR detects only live Salmonella cells, obviating the danger of false-positive results from nonviable cells. False negatives (inhibition of either qPCR or RT-qPCR) were avoided by the use of either a DNA or an RNA amplification internal control (IAC). Compared to the conventional culture method, the qPCR, RT-qPCR, and LAMP assays allowed faster and equally accurate detection of Salmonella spp. in six high-risk produce commodities. PMID:21803916

Enhanced Detection of Surface-Associated Bacteria in Indoor Environments by Quantitative PCR

PubMed Central

Buttner, Mark P.; Cruz-Perez, Patricia; Stetzenbach, Linda D.

2001-01-01

Methods for detecting microorganisms on surfaces are needed to locate biocontamination sources and to relate surface and airborne concentrations. Research was conducted in an experimental room to evaluate surface sampling methods and quantitative PCR (QPCR) for enhanced detection of a target biocontaminant present on flooring materials. QPCR and culture analyses were used to quantitate Bacillus subtilis (Bacillus globigii) endospores on vinyl tile, commercial carpet, and new and soiled residential carpet with samples obtained by four surface sampling methods: a swab kit, a sponge swipe, a cotton swab, and a bulk method. The initial data showed that greater overall sensitivity was obtained with the QPCR than with culture analysis; however, the QPCR results for bulk samples from residential carpet were negative. The swab kit and the sponge swipe methods were then tested with two levels of background biological contamination consisting of Penicillium chrysogenum spores. The B. subtilis values obtained by the QPCR method were greater than those obtained by culture analysis. The differences between the QPCR and culture data were significant for the samples obtained with the swab kit for all flooring materials except soiled residential carpet and with the sponge swipe for commercial carpet. The QPCR data showed that there were no significant differences between the swab kit and sponge swipe sampling methods for any of the flooring materials. Inhibition of QPCR due solely to biological contamination of flooring materials was not evident. However, some degree of inhibition was observed with the soiled residential carpet, which may have been caused by the presence of abiotic contaminants, alone or in combination with biological contaminants. The results of this research demonstrate the ability of QPCR to enhance detection and enumeration of biocontaminants on surface materials and provide information concerning the comparability of currently available surface sampling methods. PMID:11375164

Novel method for quantitative ANA measurement using near-infrared imaging.

PubMed

Peterson, Lisa K; Wells, Daniel; Shaw, Laura; Velez, Maria-Gabriela; Harbeck, Ronald; Dragone, Leonard L

2009-09-30

Antinuclear antibodies (ANA) have been detected in patients with systemic rheumatic diseases and are used in the screening and/or diagnosis of autoimmunity in patients as well as mouse models of systemic autoimmunity. Indirect immunofluorescence (IIF) on HEp-2 cells is the gold standard for ANA screening. However, its usefulness is limited in diagnosis, prognosis and monitoring of disease activity due to the lack of standardization in performing the technique, subjectivity in interpreting the results and the fact that it is only semi-quantitative. Various immunological techniques have been developed in an attempt to improve upon the method to quantify ANA, including enzyme-linked immunosorbent assays (ELISAs), line immunoassays (LIAs), multiplexed bead immunoassays and IIF on substrates other than HEp-2 cells. Yet IIF on HEp-2 cells remains the most common screening method for ANA. In this study, we describe a simple quantitative method to detect ANA which combines IIF on HEp-2 coated slides with analysis using a near-infrared imaging (NII) system. Using NII to determine ANA titer, 86.5% (32 of 37) of the titers for human patient samples were within 2 dilutions of those determined by IIF, which is the acceptable range for proficiency testing. Combining an initial screening for nuclear staining using microscopy with titration by NII resulted in 97.3% (36 of 37) of the titers detected to be within two dilutions of those determined by IIF. The NII method for quantitative ANA measurements using serum from both patients and mice with autoimmunity provides a fast, relatively simple, objective, sensitive and reproducible assay, which could easily be standardized for comparison between laboratories.

Rapid Determination of Lymphogranuloma Venereum Serovars of Chlamydia trachomatis by Quantitative High-Resolution Melt Analysis (HRMA)

PubMed Central

Stevens, Matthew P.; Garland, Suzanne M.; Zaia, Angelo M.; Tabrizi, Sepehr N.

2012-01-01

A quantitative high-resolution melt analysis assay was developed to differentiate lymphogranuloma venereum-causing serovars of Chlamydia trachomatis (L1 to L3) from other C. trachomatis serovars (D to K). The detection limit of this assay is approximately 10 copies per reaction, comparable to the limits of other quantitative-PCR-based methods. PMID:22933594

MethylMeter®: bisulfite-free quantitative and sensitive DNA methylation profiling and mutation detection in FFPE samples

PubMed Central

McCarthy, David; Pulverer, Walter; Weinhaeusel, Andreas; Diago, Oscar R; Hogan, Daniel J; Ostertag, Derek; Hanna, Michelle M

2016-01-01

Aim: Development of a sensitive method for DNA methylation profiling and associated mutation detection in clinical samples. Materials & methods: Formalin-fixed and paraffin-embedded tumors received by clinical laboratories often contain insufficient DNA for analysis with bisulfite or methylation sensitive restriction enzymes-based methods. To increase sensitivity, methyl-CpG DNA capture and Coupled Abscription PCR Signaling detection were combined in a new assay, MethylMeter®. Gliomas were analyzed for MGMT methylation, glioma CpG island methylator phenotype and IDH1 R132H. Results: MethylMeter had 100% assay success rate measuring all five biomarkers in formalin-fixed and paraffin-embedded tissue. MGMT methylation results were supported by survival and mRNA expression data. Conclusion: MethylMeter is a sensitive and quantitative method for multitarget DNA methylation profiling and associated mutation detection. The MethylMeter-based GliomaSTRAT assay measures methylation of four targets and one mutation to simultaneously grade gliomas and predict their response to temozolomide. This information is clinically valuable in management of gliomas. PMID:27337298

Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions.

PubMed

Belmonte, Frances R; Martin, James L; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A; Kaufman, Brett A

2016-04-28

Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error.

Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions

PubMed Central

Belmonte, Frances R.; Martin, James L.; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A.; Kaufman, Brett A.

2016-01-01

Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error. PMID:27122135

[Development and application of CK-MB specific monoclonal antibodies].

PubMed

Chen, Zimin; Zhou, Guoliang; Xu, Weiling; Zheng, Xiaohong; Tong, Xunzhang; Ke, Qishen; Song, Liuwei; Ge, Shengxiang

2017-01-25

The aim of this study is to develop creatine kinase isoenzyme MB (CK-MB) specific monoclonal antibodies (mAb), and characterize the monoclonal antibody and further development of quantitative detection assay for CK-MB. The BALB/c mice were immunized with purchased CK-MB antigen, then monoclonal antibodies were prepared according to conventional hybridoma technique and screened by indirect and capture ELISA method. To identify the epitopes and evaluate the classification, purchased creatine kinase isoenzyme MB (CK-MM/BB/MB) antigen was used to identify the epitopes, with immunoblotting and synthetic CK-MM and CK-BB in different linear epitope. A double antibody sandwich ELISA was applied to screen the mAb pairs for CK-MB detection, and the quantitative detection assay for CK-MB was developed. We used 74 cases of clinical specimens for comparison of our assay with Roche's CK-MB assay. We successfully developed 22 strains of hybridoms against CK-MB, these mAbs can be divided into linear, partial conformational CK-MB, CK-MM or CK-BB cross monoclonal antibody and CK-MB specific reaction with partial conformational monoclonal antibody, and CK-MB quantitative detection assay was developed by using partial conformational monoclonal antibody. The correlation coefficient factor r of our reagent and Roche's was 0.930 9. This study established a screening method for CK-MB partial conformational specific monoclonal antibody, and these monoclonal antibodies were analyzed and an established quantitative detection assay was developed. The new assay had a high concordance with Roche's.

Detection of lysergic acid diethylamide (LSD) in urine by gas chromatography-ion trap tandem mass spectrometry.

PubMed

Sklerov, J H; Kalasinsky, K S; Ehorn, C A

1999-10-01

A confirmatory method for the detection and quantitation of lysergic acid diethylamide (LSD) is presented. The method employs gas chromatography-tandem mass spectrometry (GC-MS-MS) using an internal ionization ion trap detector for sensitive MS-MS-in-time measurements of LSD extracted from urine. Following a single-step solid-phase extraction of 5 mL of urine, underivatized LSD can be measured with limits of quantitation and detection of 80 and 20 pg/mL, respectively. Temperature-programmed on-column injections of urine extracts were linear over the concentration range 20-2000 pg/mL (r2 = 0.999). Intraday and interday coefficients of variation were < 6% and < 13%, respectively. This procedure has been applied to quality-control specimens and LSD-positive samples in this laboratory. Comparisons with alternate GC-MS methods and extraction procedures are discussed.

Detection and measurement of surface contamination by multiple antineoplastic drugs using multiplex bead assay

PubMed Central

Smith, Jerome P; Sammons, Deborah L; Robertson, Shirley A; Pretty, Jack; Debord, D Gayle; Connor, Thomas H; Snawder, John

2015-01-01

Objectives Contamination of workplace surfaces by antineoplastic drugs presents an exposure risk for healthcare workers. Traditional instrumental methods to detect contamination such as liquid chromatography-tandem mass spectrometry (LC-MS/MS) are sensitive and accurate but expensive. Since immunochemical methods may be cheaper and faster than instrumental methods, we wanted to explore their use for routine drug residue detection for preventing worker exposure. Methods In this study we examined the feasibility of using fluorescence covalent microbead immunosorbent assay (FCMIA) for simultaneous detection and semi-quantitative measurement of three antineoplastic drugs (5-fluorouracil, paclitaxel, and doxorubicin). The concentration ranges for the assay were 0–1000 ng/ml for 5-fluorouracil, 0–100 ng/ml for paclitaxel, and 0–2 ng/ml for doxorubicin. The surface sampling technique involved wiping a loaded surface with a swab wetted with wash buffer, extracting the swab in storage/blocking buffer, and measuring drugs in the extract using FCMIA. Results There was no significant cross reactivity between these drugs at the ranges studied indicated by a lack of response in the assay to cross analytes. The limit of detection (LOD) for 5-fluorouracil on the surface studied was 0.93 ng/cm2 with a limit of quantitation (LOQ) of 2.8 ng/cm2, the LOD for paclitaxel was 0.57 ng/cm2 with an LOQ of 2.06 ng/cm2, and the LOD for doxorubicin was 0.0036 ng/cm2 with an LOQ of 0.013 ng/cm2. Conclusion The use of FCMIA with a simple sampling technique has potential for low cost simultaneous detection and semi-quantitative measurement of surface contamination from multiple antineoplastic drugs. PMID:25293722

Confirmatory and quantitative analysis of beta-lactam antibiotics in bovine kidney tissue by dispersive solid-phase extraction and liquid chromatography-tandem mass spectrometry.

PubMed

Fagerquist, Clifton K; Lightfield, Alan R; Lehotay, Steven J

2005-03-01

A simple, rapid, rugged, sensitive, and specific method for the confirmation and quantitation of 10 beta-lactam antibiotics in fortified and incurred bovine kidney tissue has been developed. The method uses a simple solvent extraction, dispersive solid-phase extraction (dispersive-SPE) cleanup, and liquid chromatography-tandem mass spectrometry (LC/MS/MS) for confirmation and quantitation. Dispersive-SPE greatly simplifies and accelerates sample cleanup and improves overall recoveries compared with conventional SPE cleanup. The beta-lactam antibiotics tested were as follows: deacetylcephapirin (an antimicrobial metabolite of cephapirin), amoxicillin, desfuroylceftiofur cysteine disulfide (DCCD, an antimicrobial metabolite of ceftiofur), ampicillin, cefazolin, penicillin G, oxacillin, cloxacillin, naficillin, and dicloxacillin. Average recoveries of fortified samples were 70% or better for all beta-lactams except DCCD, which had an average recovery of 58%. The LC/MS/MS method was able to demonstrate quantitative recoveries at established tolerance levels and provide confirmatory data for unambiguous analyte identification. The method was also tested on 30 incurred bovine kidney samples obtained from the USDA Food Safety and Inspection Service, which had previously tested the samples using the approved semiquantitative microbial assay. The results from the quantitative LC/MS/MS analysis were in general agreement with the microbial assay for 23 samples although the LC/MS/MS method was superior in that it could specifically identify which beta-lactam was present and quantitate its concentration, whereas the microbial assay could only identify the type of beta-lactam present and report a concentration with respect to the microbial inhibition of a penicillin G standard. In addition, for 6 of the 23 samples, LC/MS/MS analysis detected a penicillin and a cephalosporin beta-lactam, whereas the microbial assay detected only a penicillin beta-lactam. For samples that do not fall into the "general agreement" category, the most serious discrepancy involves two samples where the LC/MS/MS method detected a violative level of a cephalosporin beta-lactam (deacetylcephapirin) in the first sample and a possibly violative level of desfuroylceftiofur in the second, whereas the microbial assay identified the two samples as having only violative levels of a penicillin beta-lactam.

Quantitative detection of RASSF1A DNA promoter methylation in tumors and serum of patients with serous epithelial ovarian cancer.

PubMed

Bondurant, Amy E; Huang, Zhiqing; Whitaker, Regina S; Simel, Lauren R; Berchuck, Andrew; Murphy, Susan K

2011-12-01

Detection of cell free tumor-specific DNA methylation has been proposed as a potentially useful noninvasive mechanism to detect malignancies, including ovarian cancer, and to monitor response to treatment. However, there are few easily implemented quantitative approaches available for DNA methylation analysis. Our objectives were to develop an absolute quantitative method for detection of DNA methylation using RASSF1A, a known target of promoter methylation in ovarian cancer, and test the ability to detect RASSF1A methylation in tumors and serum specimens of women with ovarian cancer. Bisulfite modified DNAs were subjected to real time PCR using nondiscriminatory PCR primers and a probe with sequence containing a single CpG site, theoretically able to capture the methylation status of that CpG for every allele within a given specimen. Input DNA was normalized to ACTB levels detected simultaneously by assay multiplexing. Methylation levels were established by comparison to results obtained from universally methylated DNA. The assay was able to detect one methylated RASSF1A allele in 100,000 unmethylated alleles. RASSF1A was methylated in 54 of 106 (51%) invasive serous ovarian cancers analyzed and methylation status was concordant in 20/20 matched preoperative serum-tumor pairs. Serial serum specimens taken over the course of treatment for 8 of 9 patients showed fluctuations in RASSF1A methylation concomitant with disease status. This novel assay provides a real-time PCR-based method for absolute quantitation of DNA methylation. Our results support feasibility of monitoring RASSF1A methylation from serum samples taken over the course of treatment from women with ovarian cancer. Copyright © 2011 Elsevier Inc. All rights reserved.

PALATAL DYSMORPHOGENESIS: QUANTITATIVE RT-PCR

EPA Science Inventory

ABSTRACT

Palatal Dysmorphogenesis : Quantitative RT-PCR

Gary A. Held and Barbara D. Abbott

Reverse transcription PCR (RT-PCR) is a very sensitive method for detecting mRNA in tissue samples. However, as it is usually performed it is does not yield quantitativ...

Quantitative naturalistic methods for detecting change points in psychotherapy research: an illustration with alliance ruptures.

PubMed

Eubanks-Carter, Catherine; Gorman, Bernard S; Muran, J Christopher

2012-01-01

Analysis of change points in psychotherapy process could increase our understanding of mechanisms of change. In particular, naturalistic change point detection methods that identify turning points or breakpoints in time series data could enhance our ability to identify and study alliance ruptures and resolutions. This paper presents four categories of statistical methods for detecting change points in psychotherapy process: criterion-based methods, control chart methods, partitioning methods, and regression methods. Each method's utility for identifying shifts in the alliance is illustrated using a case example from the Beth Israel Psychotherapy Research program. Advantages and disadvantages of the various methods are discussed.

A novel quadruplex real-time PCR method for simultaneous detection of Cry2Ae and two genetically modified cotton events (GHB119 and T304-40).

PubMed

Li, Xiang; Wang, Xiuxiu; Yang, Jielin; Liu, Yueming; He, Yuping; Pan, Liangwen

2014-05-16

To date, over 150 genetically modified (GM) crops are widely cultivated. To comply with regulations developed for genetically modified organisms (GMOs), including labeling policies, many detection methods for GMO identification and quantification have been developed. To detect the entrance and exit of unauthorized GM crop events in China, we developed a novel quadruplex real-time PCR method for simultaneous detection and quantification of GM cotton events GHB119 and T304-40 in cotton-derived products (based on the 5'-flanking sequence) and the insect-resistance gene Cry2Ae. The limit of detection was 10 copies for GHB119 and Cry2Ae and 25 copies for T304-40. The limit of quantification was 25 copies for GHB119 and Cry2Ae and 50 copies for T304-40. Moreover, low bias and acceptable standard deviation and relative standard deviation values were obtained in quantification analysis of six blind samples containing different GHB119 and T304-40 ingredients. The developed quadruplex quantitative method could be used for quantitative detection of two GM cotton events (GHB119 and T304-40) and Cry2Ae gene ingredient in cotton derived products.

A novel quadruplex real-time PCR method for simultaneous detection of Cry2Ae and two genetically modified cotton events (GHB119 and T304-40)

PubMed Central

2014-01-01

Background To date, over 150 genetically modified (GM) crops are widely cultivated. To comply with regulations developed for genetically modified organisms (GMOs), including labeling policies, many detection methods for GMO identification and quantification have been developed. Results To detect the entrance and exit of unauthorized GM crop events in China, we developed a novel quadruplex real-time PCR method for simultaneous detection and quantification of GM cotton events GHB119 and T304-40 in cotton-derived products (based on the 5′-flanking sequence) and the insect-resistance gene Cry2Ae. The limit of detection was 10 copies for GHB119 and Cry2Ae and 25 copies for T304-40. The limit of quantification was 25 copies for GHB119 and Cry2Ae and 50 copies for T304-40. Moreover, low bias and acceptable standard deviation and relative standard deviation values were obtained in quantification analysis of six blind samples containing different GHB119 and T304-40 ingredients. Conclusions The developed quadruplex quantitative method could be used for quantitative detection of two GM cotton events (GHB119 and T304-40) and Cry2Ae gene ingredient in cotton derived products. PMID:24884946

Sensitive method for the quantitation of droloxifene in plasma and serum by high-performance liquid chromatography employing fluorimetric detection.

PubMed

Tess, D A; Cole, R O; Toler, S M

1995-12-15

A simple and highly sensitive reversed-phase fluorimetric HPLC method for the quantitation of droloxifene from rat, monkey, and human plasma as well as human serum is described. This assay employs solid-phase extraction and has a dynamic range of 25 to 10,000 pg/ml. Sample extraction (efficiencies > 86%) was accomplished using a benzenesulfonic acid (SCX) column with water and methanol rinses. Droloxifene and internal standard were eluted with 1 ml of 3.5% (v/v) ammonium hydroxide (30%) in methanol. Samples were quantitated using post-column UV-photochemical cyclization coupled with fluorimetric detection with excitation and emission wavelengths of 260 nm and 375 nm, respectively. Relative ease of sample extraction and short run times allow for the analysis of approximately 100 samples per day.

Accurate virus quantitation using a Scanning Transmission Electron Microscopy (STEM) detector in a scanning electron microscope.

PubMed

Blancett, Candace D; Fetterer, David P; Koistinen, Keith A; Morazzani, Elaine M; Monninger, Mitchell K; Piper, Ashley E; Kuehl, Kathleen A; Kearney, Brian J; Norris, Sarah L; Rossi, Cynthia A; Glass, Pamela J; Sun, Mei G

2017-10-01

A method for accurate quantitation of virus particles has long been sought, but a perfect method still eludes the scientific community. Electron Microscopy (EM) quantitation is a valuable technique because it provides direct morphology information and counts of all viral particles, whether or not they are infectious. In the past, EM negative stain quantitation methods have been cited as inaccurate, non-reproducible, and with detection limits that were too high to be useful. To improve accuracy and reproducibility, we have developed a method termed Scanning Transmission Electron Microscopy - Virus Quantitation (STEM-VQ), which simplifies sample preparation and uses a high throughput STEM detector in a Scanning Electron Microscope (SEM) coupled with commercially available software. In this paper, we demonstrate STEM-VQ with an alphavirus stock preparation to present the method's accuracy and reproducibility, including a comparison of STEM-VQ to viral plaque assay and the ViroCyt Virus Counter. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985.

PubMed

Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing

2010-02-01

To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.

Method for the Simultaneous Quantitation of Apolipoprotein E Isoforms using Tandem Mass Spectrometry

PubMed Central

Wildsmith, Kristin R.; Han, Bomie; Bateman, Randall J.

2009-01-01

Using Apolipoprotein E (ApoE) as a model protein, we developed a protein isoform analysis method utilizing Stable Isotope Labeling Tandem Mass Spectrometry (SILT MS). ApoE isoforms are quantitated using the intensities of the b and y ions of the 13C-labeled tryptic isoform-specific peptides versus unlabeled tryptic isoform-specific peptides. The ApoE protein isoform analysis using SILT allows for the simultaneous detection and relative quantitation of different ApoE isoforms from the same sample. This method provides a less biased assessment of ApoE isoforms compared to antibody-dependent methods, and may lead to a better understanding of the biological differences between isoforms. PMID:19653990

Quantitation of peptides from non-invasive skin tapings using isotope dilution and tandem mass spectrometry.

PubMed

Reisdorph, Nichole; Armstrong, Michael; Powell, Roger; Quinn, Kevin; Legg, Kevin; Leung, Donald; Reisdorph, Rick

2018-05-01

Previous work from our laboratories utilized a novel skin taping method and mass spectrometry-based proteomics to discover clinical biomarkers of skin conditions; these included atopic dermatitis, Staphylococcus aureus colonization, and eczema herpeticum. While suitable for discovery purposes, semi-quantitative proteomics is generally time-consuming and expensive. Furthermore, depending on the method used, discovery-based proteomics can result in high variation and inadequate sensitivity to detect low abundant peptides. Therefore, we strove to develop a rapid, sensitive, and reproducible method to quantitate disease-related proteins from skin tapings. We utilized isotopically-labeled peptides and tandem mass spectrometry to obtain absolute quantitation values on 14 peptides from 7 proteins; these proteins had shown previous importance in skin disease. The method demonstrated good reproducibility, dynamic range, and linearity (R 2  > 0.993) when n = 3 standards were analyzed across 0.05-2.5 pmol. The method was used to determine if differences exist between skin proteins in a small group of atopic versus non-atopic individuals (n = 12). While only minimal differences were found, peptides were detected in all samples and exhibited good correlation between peptides for 5 of the 7 proteins (R 2  = 0.71-0.98). This method can be applied to larger cohorts to further establish the relationships of these proteins to skin disease. Copyright © 2017. Published by Elsevier B.V.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Methods for transfer a saliva based alcohol content test to a dermal patch

DOE Office of Scientific and Technical Information (OSTI.GOV)

Silks, III, Louis A.

Detection and quantitation of ethanol which is highly sensitive, specific, and efficient has been a commercial target for sometime. Clearly analytical methods are useful such as gas and liquid chromatography, mass spectrometry, and NMR spectroscopy. However, those methods are best used in the laboratory and a less useful for detection and quantitation of ethanol in the field. Enzymes have been employed for the detection and quantitation of EtOH. Enzymes are proteins that perform a particular task in a bio-catalytic way. Most of the chemistry that these enzymes do are frequently exquisitely specific in that only one alcohol reacts and onlymore » one product is produced. One enzyme molecule can catalyze the reaction of numerous substrate molecules which in itself is an amplification of the recognition signal. Alcohol dehydrogenase (ADH) and alcohol oxidase (AO) are two possible enzymatic targets for EtOH sensor development.1 The ADH oxidizes the alcohol using a co-factor nicotinamide adenine dinucleotide. This co-factor needs to be within close proximity of the ADH. AO also oxidizes the ethanol using molecular oxygen giving rise to the production of the aldehyde and hydrogen peroxide.« less

Robust and fast characterization of OCT-based optical attenuation using a novel frequency-domain algorithm for brain cancer detection

NASA Astrophysics Data System (ADS)

Yuan, Wu; Kut, Carmen; Liang, Wenxuan; Li, Xingde

2017-03-01

Cancer is known to alter the local optical properties of tissues. The detection of OCT-based optical attenuation provides a quantitative method to efficiently differentiate cancer from non-cancer tissues. In particular, the intraoperative use of quantitative OCT is able to provide a direct visual guidance in real time for accurate identification of cancer tissues, especially these without any obvious structural layers, such as brain cancer. However, current methods are suboptimal in providing high-speed and accurate OCT attenuation mapping for intraoperative brain cancer detection. In this paper, we report a novel frequency-domain (FD) algorithm to enable robust and fast characterization of optical attenuation as derived from OCT intensity images. The performance of this FD algorithm was compared with traditional fitting methods by analyzing datasets containing images from freshly resected human brain cancer and from a silica phantom acquired by a 1310 nm swept-source OCT (SS-OCT) system. With graphics processing unit (GPU)-based CUDA C/C++ implementation, this new attenuation mapping algorithm can offer robust and accurate quantitative interpretation of OCT images in real time during brain surgery.

Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water

USGS Publications Warehouse

Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.

2007-01-01

The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.

Stable Isotope Quantitative N-Glycan Analysis by Liquid Separation Techniques and Mass Spectrometry.

PubMed

Mittermayr, Stefan; Albrecht, Simone; Váradi, Csaba; Millán-Martín, Silvia; Bones, Jonathan

2017-01-01

Liquid phase separation analysis and subsequent quantitation remains a challenging task for protein-derived oligosaccharides due to their inherent structural complexity and diversity. Incomplete resolution or co-detection of multiple glycan species complicates peak area-based quantitation and associated statistical analysis when optical detection methods are used. The approach outlined herein describes the utilization of stable isotope variants of commonly used fluorescent tags that allow for mass-based glycan identification and relative quantitation following separation by liquid chromatography (LC) or capillary electrophoresis (CE). Comparability assessment of glycoprotein-derived oligosaccharides is performed by derivatization with commercially available isotope variants of 2-aminobenzoic acid or aniline and analysis by LC- and CE-mass spectrometry. Quantitative information is attained from the extracted ion chromatogram/electropherogram ratios generated from the light and heavy isotope clusters.

Quantitative analysis of ginger components in commercial products using liquid chromatography with electrochemical array detection

PubMed Central

Shao, Xi; Lv, Lishuang; Parks, Tiffany; Wu, Hou; Ho, Chi-Tang; Sang, Shengmin

2010-01-01

For the first time, a sensitive reversed-phase HPLC electrochemical array method has been developed for the quantitative analysis of eight major ginger components ([6]-, [8]-, and [10]-gingerol, [6]-, [8]-, and [10]-shogaol, [6]-paradol, and [1]-dehydrogingerdione) in eleven ginger-containing commercial products. This method was valid with unrivaled sensitivity as low as 7.3 – 20.2 pg of limit of detection and a range of 14.5 to 40.4 pg of limit of quantification. Using this method, we quantified the levels of eight ginger components in eleven different commercial products. Our results found that both levels and ratios among the eight compounds vary greatly in commercial products. PMID:21090746

Low angle light scattering analysis: a novel quantitative method for functional characterization of human and murine platelet receptors.

PubMed

Mindukshev, Igor; Gambaryan, Stepan; Kehrer, Linda; Schuetz, Claudia; Kobsar, Anna; Rukoyatkina, Natalia; Nikolaev, Viacheslav O; Krivchenko, Alexander; Watson, Steve P; Walter, Ulrich; Geiger, Joerg

2012-07-01

Determinations of platelet receptor functions are indispensable diagnostic indicators of cardiovascular and hemostatic diseases including hereditary and acquired receptor defects and receptor responses to drugs. However, presently available techniques for assessing platelet function have some disadvantages, such as low sensitivity and the requirement of large sample sizes and unphysiologically high agonist concentrations. Our goal was to develop and initially characterize a new technique designed to quantitatively analyze platelet receptor activation and platelet function on the basis of measuring changes in low angle light scattering. We developed a novel technique based on low angle light scattering registering changes in light scattering at a range of different angles in platelet suspensions during activation. The method proved to be highly sensitive for simultaneous real time detection of changes in size and shape of platelets during activation. Unlike commonly-used methods, the light scattering method could detect platelet shape change and aggregation in response to nanomolar concentrations of extracellular nucleotides. Furthermore, our results demonstrate that the advantages of the light scattering method make it a choice method for platelet receptor monitoring and for investigation of both murine and human platelets in disease models. Our data demonstrate the suitability and superiority of this new low angle light scattering method for comprehensive analyses of platelet receptors and functions. This highly sensitive, quantitative, and online detection of essential physiological, pathophysiological and pharmacological-response properties of human and mouse platelets is a significant improvement over conventional techniques.

Quantitative analysis of benzodiazepines in vitreous humor by high-performance liquid chromatography

PubMed Central

Bazmi, Elham; Behnoush, Behnam; Akhgari, Maryam; Bahmanabadi, Leila

2016-01-01

Objective: Benzodiazepines are frequently screened drugs in emergency toxicology, drugs of abuse testing, and in forensic cases. As the variations of benzodiazepines concentrations in biological samples during bleeding, postmortem changes, and redistribution could be biasing forensic medicine examinations, hence selecting a suitable sample and a validated accurate method is essential for the quantitative analysis of these main drug categories. The aim of this study was to develop a valid method for the determination of four benzodiazepines (flurazepam, lorazepam, alprazolam, and diazepam) in vitreous humor using liquid–liquid extraction and high-performance liquid chromatography. Methods: Sample preparation was carried out using liquid–liquid extraction with n-hexane: ethyl acetate and subsequent detection by high-performance liquid chromatography method coupled to diode array detector. This method was applied to quantify benzodiazepines in 21 authentic vitreous humor samples. Linear curve for each drug was obtained within the range of 30–3000 ng/mL with coefficient of correlation higher than 0.99. Results: The limit of detection and quantitation were 30 and 100 ng/mL respectively for four drugs. The method showed an appropriate intra- and inter-day precision (coefficient of variation < 10%). Benzodiazepines recoveries were estimated to be over 80%. The method showed high selectivity; no additional peak due to interfering substances in samples was observed. Conclusion: The present method was selective, sensitive, accurate, and precise for the quantitative analysis of benzodiazepines in vitreous humor samples in forensic toxicology laboratory. PMID:27635251

Qualification of a Quantitative Method for Monitoring Aspartate Isomerization of a Monoclonal Antibody by Focused Peptide Mapping.

PubMed

Cao, Mingyan; Mo, Wenjun David; Shannon, Anthony; Wei, Ziping; Washabaugh, Michael; Cash, Patricia

Aspartate (Asp) isomerization is a common post-translational modification of recombinant therapeutic proteins that can occur during manufacturing, storage, or administration. Asp isomerization in the complementarity-determining regions of a monoclonal antibody may affect the target binding and thus a sufficiently robust quality control method for routine monitoring is desirable. In this work, we utilized a liquid chromatography-mass spectrometry (LC/MS)-based approach to identify the Asp isomerization in the complementarity-determining regions of a therapeutic monoclonal antibody. To quantitate the site-specific Asp isomerization of the monoclonal antibody, a UV detection-based quantitation assay utilizing the same LC platform was developed. The assay was qualified and implemented for routine monitoring of this product-specific modification. Compared with existing methods, this analytical paradigm is applicable to identify Asp isomerization (or other modifications) and subsequently develop a rapid, sufficiently robust quality control method for routine site-specific monitoring and quantitation to ensure product quality. This approach first identifies and locates a product-related impurity (a critical quality attribute) caused by isomerization, deamidation, oxidation, or other post-translational modifications, and then utilizes synthetic peptides and MS to assist the development of a LC-UV-based chromatographic method that separates and quantifies the product-related impurities by UV peaks. The established LC-UV method has acceptable peak specificity, precision, linearity, and accuracy; it can be validated and used in a good manufacturing practice environment for lot release and stability testing. Aspartate isomerization is a common post-translational modification of recombinant proteins during manufacture process and storage. Isomerization in the complementarity-determining regions (CDRs) of a monoclonal antibody A (mAb-A) has been detected and has been shown to have impact on the binding affinity to the antigen. In this work, we utilized a mass spectrometry-based peptide mapping approach to detect and quantitate the Asp isomerization in the CDRs of mAb-A. To routinely monitor the CDR isomerization of mAb-A, a focused peptide mapping method utilizing reversed phase chromatographic separation and UV detection has been developed and qualified. This approach is generally applicable to monitor isomerization and other post-translational modifications of proteins in a specific and high-throughput mode to ensure product quality. © PDA, Inc. 2016.

A novel multi-walled carbon nanotube-based antibody conjugate for quantitative and semi-quantitative lateral flow assays.

PubMed

Sun, Wenjuan; Hu, Xiaolong; Liu, Jia; Zhang, Yurong; Lu, Jianzhong; Zeng, Libo

2017-10-01

In this study, the multi-walled carbon nanotubes (MWCNTs) were applied in lateral flow strips (LFS) for semi-quantitative and quantitative assays. Firstly, the solubility of MWCNTs was improved using various surfactants to enhance their biocompatibility for practical application. The dispersed MWCNTs were conjugated with the methamphetamine (MET) antibody in a non-covalent manner and then manufactured into the LFS for the quantitative detection of MET. The MWCNTs-based lateral flow assay (MWCNTs-LFA) exhibited an excellent linear relationship between the values of test line and MET when its concentration ranges from 62.5 to 1500 ng/mL. The sensitivity of the LFS was evaluated by conjugating MWCNTs with HCG antibody and the MWCNTs conjugated method is 10 times more sensitive than the one conjugated with classical colloidal gold nanoparticles. Taken together, our data demonstrate that MWCNTs-LFA is a more sensitive and reliable assay for semi-quantitative and quantitative detection which can be used in forensic analysis.

Fast and simultaneous determination of 12 polyphenols in apple peel and pulp by using chemometrics-assisted high-performance liquid chromatography with diode array detection.

PubMed

Wang, Tong; Wu, Hai-Long; Xie, Li-Xia; Zhu, Li; Liu, Zhi; Sun, Xiao-Dong; Xiao, Rong; Yu, Ru-Qin

2017-04-01

In this work, a smart chemometrics-enhanced strategy, high-performance liquid chromatography, and diode array detection coupled with second-order calibration method based on alternating trilinear decomposition algorithm was proposed to simultaneously quantify 12 polyphenols in different kinds of apple peel and pulp samples. The proposed strategy proved to be a powerful tool to solve the problems of coelution, unknown interferences, and chromatographic shifts in the process of high-performance liquid chromatography analysis, making it possible for the determination of 12 polyphenols in complex apple matrices within 10 min under simple conditions of elution. The average recoveries with standard deviations, and figures of merit including sensitivity, selectivity, limit of detection, and limit of quantitation were calculated to validate the accuracy of the proposed method. Compared to the quantitative analysis results from the classic high-performance liquid chromatography method, the statistical and graphical analysis showed that our proposed strategy obtained more reliable results. All results indicated that our proposed method used in the quantitative analysis of apple polyphenols was an accurate, fast, universal, simple, and green one, and it was expected to be developed as an attractive alternative method for simultaneous determination of multitargeted analytes in complex matrices. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Quantitative EEG analysis using error reduction ratio-causality test; validation on simulated and real EEG data.

PubMed

Sarrigiannis, Ptolemaios G; Zhao, Yifan; Wei, Hua-Liang; Billings, Stephen A; Fotheringham, Jayne; Hadjivassiliou, Marios

2014-01-01

To introduce a new method of quantitative EEG analysis in the time domain, the error reduction ratio (ERR)-causality test. To compare performance against cross-correlation and coherence with phase measures. A simulation example was used as a gold standard to assess the performance of ERR-causality, against cross-correlation and coherence. The methods were then applied to real EEG data. Analysis of both simulated and real EEG data demonstrates that ERR-causality successfully detects dynamically evolving changes between two signals, with very high time resolution, dependent on the sampling rate of the data. Our method can properly detect both linear and non-linear effects, encountered during analysis of focal and generalised seizures. We introduce a new quantitative EEG method of analysis. It detects real time levels of synchronisation in the linear and non-linear domains. It computes directionality of information flow with corresponding time lags. This novel dynamic real time EEG signal analysis unveils hidden neural network interactions with a very high time resolution. These interactions cannot be adequately resolved by the traditional methods of coherence and cross-correlation, which provide limited results in the presence of non-linear effects and lack fidelity for changes appearing over small periods of time. Copyright © 2013 International Federation of Clinical Neurophysiology. Published by Elsevier Ireland Ltd. All rights reserved.

EVALUATION OF RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

EPA Science Inventory

Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan (trademark)) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glab...

Qualitative and quantitative analysis of mixtures of compounds containing both hydrogen and deuterium

NASA Technical Reports Server (NTRS)

Crespi, H. L.; Harkness, L.; Katz, J. J.; Norman, G.; Saur, W.

1969-01-01

Method allows qualitative and quantitative analysis of mixtures of partially deuterated compounds. Nuclear magnetic resonance spectroscopy determines location and amount of deuterium in organic compounds but not fully deuterated compounds. Mass spectroscopy can detect fully deuterated species but not the location.

ANALYSIS OF PERFLUORINATED CARBOXYLIC ACIDS IN SOILS: DETECTION AND QUANTITATION ISSUES AT LOW CONCENTRATIONS

EPA Science Inventory

Methods were developed for the extraction from soil, identification, confirmation and quantitation by LC/MS/MS of trace levels of perfluorinated octanoic acid (PFOA), perfluorinated nonanoic acid (PFNA) and perfluorinated decanoic acid (PFDA). Whereas PFOA, PFNA and PFDA all can...

Highly sensitive and quantitative detection of rare pathogens through agarose droplet microfluidic emulsion PCR at the single-cell level.

PubMed

Zhu, Zhi; Zhang, Wenhua; Leng, Xuefei; Zhang, Mingxia; Guan, Zhichao; Lu, Jiangquan; Yang, Chaoyong James

2012-10-21

Genetic alternations can serve as highly specific biomarkers to distinguish fatal bacteria or cancer cells from their normal counterparts. However, these mutations normally exist in very rare amount in the presence of a large excess of non-mutated analogs. Taking the notorious pathogen E. coli O157:H7 as the target analyte, we have developed an agarose droplet-based microfluidic ePCR method for highly sensitive, specific and quantitative detection of rare pathogens in the high background of normal bacteria. Massively parallel singleplex and multiplex PCR at the single-cell level in agarose droplets have been successfully established. Moreover, we challenged the system with rare pathogen detection and realized the sensitive and quantitative analysis of a single E. coli O157:H7 cell in the high background of 100,000 excess normal K12 cells. For the first time, we demonstrated rare pathogen detection through agarose droplet microfluidic ePCR. Such a multiplex single-cell agarose droplet amplification method enables ultra-high throughput and multi-parameter genetic analysis of large population of cells at the single-cell level to uncover the stochastic variations in biological systems.

Quantitative detection of pork in commercial meat products by TaqMan® real-time PCR assay targeting the mitochondrial D-loop region.

PubMed

Kim, Miju; Yoo, Insuk; Lee, Shin-Young; Hong, Yeun; Kim, Hae-Yeong

2016-11-01

The TaqMan® real-time PCR assay using the mitochondrial D-loop region was developed for the quantitative detection of pork in processed meat products. The newly designed primers and probe specifically amplified pork without any cross-reactivity with non-target animal species. The limit of detection of the real-time PCR assay was 0.1pg of heat-treated pork meat and 0.1% (w/w) pork meat in beef and chicken meat mixtures. The quantitative real-time PCR assay was applied to analyze the pork meat content in 22 commercial processed meat products including jerkies, press hams, sausages, hamburger patties and steaks, grilled short rib patties, and nuggets. The developed real-time PCR method was able to detect pork meat in various types of processed meat products that declared the use of pork meat on their label. All processed meat products that declared no use of pork meat showed a negative result in the assay. The method developed in this study showed sensitivity and specificity in the quantification of pork meat in commercial processed meat products. Copyright © 2016 Elsevier Ltd. All rights reserved.

Detecting Autophagy and Autophagy Flux in Chronic Myeloid Leukemia Cells Using a Cyto-ID Fluorescence Spectrophotometric Assay.

PubMed

Guo, Sujuan; Pridham, Kevin J; Sheng, Zhi

2016-01-01

Autophagy is a catabolic process whereby cellular components are degraded to fuel cells for longer survival during stress. Hence, autophagy plays a vital role in determining cell fate and is central for homeostasis and pathogenesis of many human diseases including chronic myeloid leukemia (CML). It has been well established that autophagy is important for the leukemogenesis as well as drug resistance in CML. Thus, autophagy is an intriguing therapeutic target. However, current approaches that detect autophagy lack reliability and often fail to provide quantitative measurements. To overcome this hurdle and facilitate the development of autophagy-related therapies, we have recently developed an autophagy assay termed as the Cyto-ID fluorescence spectrophotometric assay. This method uses a cationic fluorescence dye, Cyto-ID, which specifically labels autophagic compartments and is detected by a spectrophotometer to permit a large-scale and quantitative analysis. As such, it allows rapid, reliable, and quantitative detection of autophagy and estimation of autophagy flux. In this chapter, we further provide technical details of this method and step-by-step protocols for measuring autophagy or autophagy flux in CML cell lines as well as primary hematopoietic cells.

Originality Detection Software in a Graduate Policy Course: A Mixed-Methods Evaluation of Plagiarism

ERIC Educational Resources Information Center

Dreuth Zeman, Laura; Steen, Julie A.; Metz Zeman, Natalie

2011-01-01

The authors used a mixed-methods approach to evaluate the use of Turnitin originality detection software in a graduate social work course. Qualitative analysis of student responses revealed positive and negative spent completing assignments, and the tone of the class. Quantitative analysis of students' originality scores indicated a short-term…

Development of a quantitative fluorescence single primer isothermal amplification-based method for the detection of Salmonella.

PubMed

Wang, Jianchang; Li, Rui; Hu, Lianxia; Sun, Xiaoxia; Wang, Jinfeng; Li, Jing

2016-02-16

Food-borne disease caused by Salmonella has long been, and continues to be, an important global public health problem, necessitating rapid and accurate detection of Salmonella in food. Real time PCR is the most recently developed approach for Salmonella detection. Single primer isothermal amplification (SPIA), a novel gene amplification technique, has emerged as an attractive microbiological testing method. SPIA is performed under a constant temperature, eliminating the need for an expensive thermo-cycler. In addition, SPIA reactions can be accomplished in 30 min, faster than real time PCR that usually takes over 2h. We developed a quantitative fluorescence SPIA-based method for the detection of Salmonella. Using Salmonella Typhimurium genomic DNA as template and a primer targeting Salmonella invA gene, we showed the detection limit of SPIA was 2.0 × 10(1)fg DNA. Its successful amplification of different serotypic Salmonella genomic DNA but not non-Salmonella bacterial DNA demonstrated the specificity of SPIA. Furthermore, this method was validated with artificially contaminated beef. In conclusion, we showed high sensitivity and specificity of SPIA in the detection of Salmonella, comparable to real time PCR. In addition, SPIA is faster and more cost-effective (non-use of expensive cyclers), making it a potential alternative for field detection of Salmonella in resource-limited settings that are commonly encountered in developing countries. Copyright © 2015 Elsevier B.V. All rights reserved.

A Spectral Method for Color Quantitation of a Protein Drug Solution.

PubMed

Swartz, Trevor E; Yin, Jian; Patapoff, Thomas W; Horst, Travis; Skieresz, Susan M; Leggett, Gordon; Morgan, Charles J; Rahimi, Kimia; Marhoul, Joseph; Kabakoff, Bruce

2016-01-01

Color is an important quality attribute for biotherapeutics. In the biotechnology industry, a visual method is most commonly utilized for color characterization of liquid drug protein solutions. The color testing method is used for both batch release and on stability testing for quality control. Using that method, an analyst visually determines the color of the sample by choosing the closest matching European Pharmacopeia reference color solution. The requirement to judge the best match makes it a subjective method. Furthermore, the visual method does not capture data on hue or chroma that would allow for improved product characterization and the ability to detect subtle differences between samples. To overcome these challenges, we describe a quantitative method for color determination that greatly reduces the variability in measuring color and allows for a more precise understanding of color differences. Following color industry standards established by International Commission on Illumination, this method converts a protein solution's visible absorption spectra to L*a*b* color space. Color matching is achieved within the L*a*b* color space, a practice that is already widely used in other industries. The work performed here is to facilitate the adoption and transition for the traditional visual assessment method to a quantitative spectral method. We describe here the algorithm used such that the quantitative spectral method correlates with the currently used visual method. In addition, we provide the L*a*b* values for the European Pharmacopeia reference color solutions required for the quantitative method. We have determined these L*a*b* values by gravimetrically preparing and measuring multiple lots of the reference color solutions. We demonstrate that the visual assessment and the quantitative spectral method are comparable using both low- and high-concentration antibody solutions and solutions with varying turbidity. In the biotechnology industry, a visual assessment is the most commonly used method for color characterization, batch release, and stability testing of liquid protein drug solutions. Using this method, an analyst visually determines the color of the sample by choosing the closest match to a standard color series. This visual method can be subjective because it requires an analyst to make a judgment of the best match of color of the sample to the standard color series, and it does not capture data on hue and chroma that would allow for improved product characterization and the ability to detect subtle differences between samples. To overcome these challenges, we developed a quantitative spectral method for color determination that greatly reduces the variability in measuring color and allows for a more precise understanding of color differences. The details of the spectral quantitative method are described. A comparison between the visual assessment method and spectral quantitative method is presented. This study supports the transition to a quantitative spectral method from the visual assessment method for quality testing of protein solutions. © PDA, Inc. 2016.

Design and synthesis of target-responsive aptamer-cross-linked hydrogel for visual quantitative detection of ochratoxin A.

PubMed

Liu, Rudi; Huang, Yishun; Ma, Yanli; Jia, Shasha; Gao, Mingxuan; Li, Jiuxing; Zhang, Huimin; Xu, Dunming; Wu, Min; Chen, Yan; Zhu, Zhi; Yang, Chaoyong

2015-04-01

A target-responsive aptamer-cross-linked hydrogel was designed and synthesized for portable and visual quantitative detection of the toxin Ochratoxin A (OTA), which occurs in food and beverages. The hydrogel network forms by hybridization between one designed DNA strand containing the OTA aptamer and two complementary DNA strands grafting on linear polyacrylamide chains. Upon the introduction of OTA, the aptamer binds with OTA, leading to the dissociation of the hydrogel, followed by release of the preloaded gold nanoparticles (AuNPs), which can be observed by the naked eye. To enable sensitive visual and quantitative detection, we encapsulated Au@Pt core-shell nanoparticles (Au@PtNPs) in the hydrogel to generate quantitative readout in a volumetric bar-chart chip (V-Chip). In the V-Chip, Au@PtNPs catalyzes the oxidation of H2O2 to generate O2, which induces movement of an ink bar to a concentration-dependent distance for visual quantitative readout. Furthermore, to improve the detection limit in complex real samples, we introduced an immunoaffinity column (IAC) of OTA to enrich OTA from beer. After the enrichment, as low as 1.27 nM (0.51 ppb) OTA can be detected by the V-Chip, which satisfies the test requirement (2.0 ppb) by the European Commission. The integration of a target-responsive hydrogel with portable enrichment by IAC, as well as signal amplification and quantitative readout by a simple microfluidic device, offers a new method for portable detection of food safety hazard toxin OTA.

Development of liquid chromatography-tandem mass spectrometry methods for the quantitation of Anisakis simplex proteins in fish.

PubMed

Fæste, Christiane Kruse; Moen, Anders; Schniedewind, Björn; Haug Anonsen, Jan; Klawitter, Jelena; Christians, Uwe

2016-02-05

The parasite Anisakis simplex is present in many marine fish species that are directly used as food or in processed products. The anisakid larvae infect mostly the gut and inner organs of fish but have also been shown to penetrate into the fillet. Thus, human health can be at risk, either by contracting anisakiasis through the consumption of raw or under-cooked fish, or by sensitisation to anisakid proteins in processed food. A number of different methods for the detection of A. simplex in fish and products thereof have been developed, including visual techniques and PCR for larvae tracing, and immunological assays for the determination of proteins. The recent identification of a number of anisakid proteins by mass spectrometry-based proteomics has laid the groundwork for the development of two quantitative liquid chromatography-tandem mass spectrometry methods for the detection of A. simplex in fish that are described in the present study. Both, the label-free semi-quantitative nLC-nESI-Orbitrap-MS/MS (MS1) and the heavy peptide-applying absolute-quantitative (AQUA) LC-TripleQ-MS/MS (MS2) use unique reporter peptides derived from anisakid hemoglobin and SXP/RAL-2 protein as analytes. Standard curves in buffer and in salmon matrix showed limits of detection at 1μg/mL and 10μg/mL for MS1 and 0.1μg/mL and 2μg/mL for MS2. Preliminary method validation included the assessment of sensitivity, repeatability, reproducibility, and applicability to incurred and naturally-contaminated samples for both assays. By further optimization and full validation in accordance with current recommendations the LC-MS/MS methods could be standardized and used generally as confirmative techniques for the detection of A. simplex protein in fish. Copyright © 2016 Elsevier B.V. All rights reserved.

Detection and correction of laser induced breakdown spectroscopy spectral background based on spline interpolation method

NASA Astrophysics Data System (ADS)

Tan, Bing; Huang, Min; Zhu, Qibing; Guo, Ya; Qin, Jianwei

2017-12-01

Laser-induced breakdown spectroscopy (LIBS) is an analytical technique that has gained increasing attention because of many applications. The production of continuous background in LIBS is inevitable because of factors associated with laser energy, gate width, time delay, and experimental environment. The continuous background significantly influences the analysis of the spectrum. Researchers have proposed several background correction methods, such as polynomial fitting, Lorenz fitting and model-free methods. However, less of them apply these methods in the field of LIBS Technology, particularly in qualitative and quantitative analyses. This study proposes a method based on spline interpolation for detecting and estimating the continuous background spectrum according to its smooth property characteristic. Experiment on the background correction simulation indicated that, the spline interpolation method acquired the largest signal-to-background ratio (SBR) over polynomial fitting, Lorenz fitting and model-free method after background correction. These background correction methods all acquire larger SBR values than that acquired before background correction (The SBR value before background correction is 10.0992, whereas the SBR values after background correction by spline interpolation, polynomial fitting, Lorentz fitting, and model-free methods are 26.9576, 24.6828, 18.9770, and 25.6273 respectively). After adding random noise with different kinds of signal-to-noise ratio to the spectrum, spline interpolation method acquires large SBR value, whereas polynomial fitting and model-free method obtain low SBR values. All of the background correction methods exhibit improved quantitative results of Cu than those acquired before background correction (The linear correlation coefficient value before background correction is 0.9776. Moreover, the linear correlation coefficient values after background correction using spline interpolation, polynomial fitting, Lorentz fitting, and model-free methods are 0.9998, 0.9915, 0.9895, and 0.9940 respectively). The proposed spline interpolation method exhibits better linear correlation and smaller error in the results of the quantitative analysis of Cu compared with polynomial fitting, Lorentz fitting and model-free methods, The simulation and quantitative experimental results show that the spline interpolation method can effectively detect and correct the continuous background.

Direct analysis of psychoactive tryptamine and harmala alkaloids in the Amazonian botanical medicine ayahuasca by liquid chromatography-electrospray ionization-tandem mass spectrometry.

PubMed

McIlhenny, Ethan H; Pipkin, Kelly E; Standish, Leanna J; Wechkin, Hope A; Strassman, Rick; Barker, Steven A

2009-12-18

A direct injection/liquid chromatography-electrospray ionization-tandem mass spectrometry procedure has been developed for the simultaneous quantitation of 11 compounds potentially found in the increasingly popular Amazonian botanical medicine and religious sacrament ayahuasca. The method utilizes a deuterated internal standard for quantitation and affords rapid detection of the alkaloids by a simple dilution assay, requiring no extraction procedures. Further, the method demonstrates a high degree of specificity for the compounds in question, as well as low limits of detection and quantitation despite using samples for analysis that had been diluted up to 200:1. This approach also appears to eliminate potential matrix effects. Method bias for each compound, examined over a range of concentrations, was also determined as was inter- and intra-assay variation. Its application to the analysis of three different ayahuasca preparations is also described. This method should prove useful in the study of ayahuasca in clinical and ethnobotanical research as well as in forensic examinations of ayahuasca preparations.

A simple quantitative approach for the determination of long and medium chain lipids in bio-relevant matrices by high performance liquid chromatography with refractive index detection.

PubMed

Lee, Kathy Wai Yu; Porter, Christopher J H; Boyd, Ben J

2013-09-01

There is increasing attention in the literature towards understanding the behaviour of lipid-based drug formulations under digestion conditions using in vitro and in vivo methods. This necessitates a convenient method for quantitation of lipids and lipid digestion products. In this study, a simple and accessible method for the separation and quantitative determination of typical formulation and digested lipids using high performance liquid chromatography coupled to refractive index detection (HPLC-RI) is described. Long and medium chain lipids were separated and quantified in a biological matrix (gastrointestinal content) without derivatisation using HPLC-RI on C18 and C8 columns, respectively. The intra- and inter-assay accuracy was between 92% and 106%, and the assays were precise to within a coefficient of variation of less than 10% over the range of 0.1-2 mg/mL for both long and medium chain lipids. This method is also shown to be suitable for quantifying the lipolysis products collected from the gastrointestinal tract in the course of in vivo lipid digestion studies.

Highly sensitive fluorescence quantitative detection of specific DNA sequences with molecular beacons and nucleic acid dye SYBR Green I.

PubMed

Xiang, Dongshan; Zhai, Kun; Xiang, Wenjun; Wang, Lianzhi

2014-11-01

A highly sensitive fluorescence method of quantitative detection for specific DNA sequence is developed based on molecular beacon (MB) and nucleic acid dye SYBR Green I by synchronous fluorescence analysis. It is demonstrated by an oligonucleotide sequence of wild-type HBV (target DNA) as a model system. In this strategy, the fluorophore of MB is designed to be 6-carboxyfluorescein group (FAM), and the maximum excitation wavelength and maximum emission wavelength are both very close to that of SYBR Green I. In the presence of targets DNA, the MBs hybridize with the targets DNA and form double-strand DNA (dsDNA), the fluorophore FAM is separated from the quencher BHQ-1, thus the fluorophore emit fluorescence. At the same time, SYBR Green I binds to dsDNA, the fluorescence intensity of SYBR Green I is significantly enhanced. When targets DNA are detected by synchronous fluorescence analysis, the fluorescence peaks of FAM and SYBR Green I overlap completely, so the fluorescence signal of system will be significantly enhanced. Thus, highly sensitive fluorescence quantitative detection for DNA can be realized. Under the optimum conditions, the total fluorescence intensity of FAM and SYBR Green I exhibits good linear dependence on concentration of targets DNA in the range from 2×10(-11) to 2.5×10(-9)M. The detection limit of target DNA is estimated to be 9×10(-12)M (3σ). Compared with previously reported methods of detection DNA with MB, the proposed method can significantly enhance the detection sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

Rotor damage detection by using piezoelectric impedance

NASA Astrophysics Data System (ADS)

Qin, Y.; Tao, Y.; Mao, Y. F.

2016-04-01

Rotor is a core component of rotary machinery. Once the rotor has the damage, it may lead to a major accident. Thus the quantitative rotor damage detection method based on piezoelectric impedance is studied in this paper. With the governing equation of piezoelectric transducer (PZT) in a cylindrical coordinate, the displacement along the radius direction is derived. The charge of PZT is calculated by the electric displacement. Then, by the use of the obtained displacement and charge, an analytic piezoelectric impedance model of the rotor is built. Given the circular boundary condition of a rotor, annular elements are used as the analyzed objects and spectral element method is used to set up the damage detection model. The Electro-Mechanical (E/M) coupled impedance expression of an undamaged rotor is deduced with the application of a low-cost impedance test circuit. A Taylor expansion method is used to obtain the approximate E/M coupled impedance expression for the damaged rotor. After obtaining the difference between the undamaged and damaged rotor impedance, a rotor damage detection method is proposed. This method can directly calculate the change of bending stiffness of the structural elements, it follows that the rotor damage can be effectively detected. Finally, a preset damage configuration is used for the numerical simulation. The result shows that the quantitative damage detection algorithm based on spectral element method and piezoelectric impedance proposed in this paper can identify the location and the severity of the damaged rotor accurately.

Detection of a sudden change of the field time series based on the Lorenz system

PubMed Central

Li, Fang; Shen, BingLu; Yan, PengCheng; Song, Jian; Ma, DeShan

2017-01-01

We conducted an exploratory study of the detection of a sudden change of the field time series based on the numerical solution of the Lorenz system. First, the time when the Lorenz path jumped between the regions on the left and right of the equilibrium point of the Lorenz system was quantitatively marked and the sudden change time of the Lorenz system was obtained. Second, the numerical solution of the Lorenz system was regarded as a vector; thus, this solution could be considered as a vector time series. We transformed the vector time series into a time series using the vector inner product, considering the geometric and topological features of the Lorenz system path. Third, the sudden change of the resulting time series was detected using the sliding t-test method. Comparing the test results with the quantitatively marked time indicated that the method could detect every sudden change of the Lorenz path, thus the method is effective. Finally, we used the method to detect the sudden change of the pressure field time series and temperature field time series, and obtained good results for both series, which indicates that the method can apply to high-dimension vector time series. Mathematically, there is no essential difference between the field time series and vector time series; thus, we provide a new method for the detection of the sudden change of the field time series. PMID:28141832

Studying Overt Word Reading and Speech Production with Event-Related fMRI: A Method for Detecting, Assessing, and Correcting Articulation-Induced Signal Changes and for Measuring Onset Time and Duration of Articulation

ERIC Educational Resources Information Center

Huang, Jie; Francis, Andrea P.; Carr, Thomas H.

2008-01-01

A quantitative method is introduced for detecting and correcting artifactual signal changes in BOLD time series data arising from the magnetic field warping caused by motion of the articulatory apparatus when speaking aloud, with extensions to detection of subvocal articulatory activity during silent reading. Whole-head images allow the large,…

Identification and quantification of three genetically modified insect resistant cotton lines using conventional and TaqMan real-time polymerase chain reaction methods.

PubMed

Yang, Litao; Pan, Aihu; Zhang, Kewei; Guo, Jinchao; Yin, Changsong; Chen, Jianxiu; Huang, Cheng; Zhang, Dabing

2005-08-10

As the genetically modified organisms (GMOs) labeling policies are issued in many countries, qualitative and quantitative polymerase chain reaction (PCR) techniques are increasingly used for the detection of genetically modified (GM) crops in foods. Qualitative PCR and TaqMan real-time quantitative PCR methods to detect and identify three varieties of insect resistant cotton, i.e., Mon531 cotton (Monsanto Co.) and GK19 and SGK321 cottons (Chinese Academy of Agricultural Sciences), which were approved for commercialization in China, were developed in this paper. Primer pairs specific to inserted DNAs, such as Cowpea trypsin inhibitor (CpTI) gene of SGK321 cotton and the specific junction DNA sequences containing partial Cry1A(c) gene and NOS terminator of Mon531, GK19, and SGK321 cotton varieties were designed to conduct the identified PCR assays. In conventional specific identified PCR assays, the limit of detection (LOD) was 0.05% for Mon531, GK19, or SGK321 in 100 ng of cotton genomic DNA for one reaction. Also, the multiplex PCR method for screening the three GM cottons was also established, which could save time and cost in practical detection. Furthermore, a real-time quantitative PCR assay based on TaqMan chemistry for detection of insect resistant gene, Cry1A(c), was developed. This assay also featured the use of a standard plasmid as a reference molecule, which contained both a specific region of the transgene Cry1A(c) and an endogenous stearoyl-acyl carrier protein desaturase (Sad1) gene of the cotton. In quantitative PCR assay, the quantification range was from 0.01 to 100% in 100 ng of the genome DNA template, and in the detection of 1.0, 3.0, and 5.0% levels of three insect resistant cotton lines, respectively, all of the relative standard deviations (RSDs) were less than 8.2% except for the GM cotton samples with 1.0% Mon531 or GK19, which meant that our real-time PCR assays involving the use of reference molecule were reliable and practical for GM insect resistant cottons quantification. All of these results indicated that our established conventional and TaqMan real-time PCR assays were applicable to detect the three insect resistant cottons qualitatively and quantitatively.

Radiometric Method for the Detection of Coliform Organisms in Water

PubMed Central

Bachrach, Uriel; Bachrach, Zelilah

1974-01-01

A new radiometric method for the detection of coliform bacteria in water has been described. The method is based on the release of 14CO2 from [14C]lactose by bacteria suspended in growth medium and incubated at 37 C. The evolved 14CO2 is trapped by hyamine hydroxide and counted in a liquid scintillation spectrometer. The method permits the detection of 1 to 10 organisms within 6 h of incubation. Coliform bacteria suspended in water for several days recover from starvation and may be quantitated by the proposed method. Bacteria from water samples may also be concentrated by filtration through membrane filters and detected by the radiometric assay. PMID:4605007

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

EPA Science Inventory

Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

Micro-Droplet Detection Method for Measuring the Concentration of Alkaline Phosphatase-Labeled Nanoparticles in Fluorescence Microscopy

PubMed Central

Li, Rufeng; Wang, Yibei; Xu, Hong; Fei, Baowei; Qin, Binjie

2017-01-01

This paper developed and evaluated a quantitative image analysis method to measure the concentration of the nanoparticles on which alkaline phosphatase (AP) was immobilized. These AP-labeled nanoparticles are widely used as signal markers for tagging biomolecules at nanometer and sub-nanometer scales. The AP-labeled nanoparticle concentration measurement can then be directly used to quantitatively analyze the biomolecular concentration. Micro-droplets are mono-dispersed micro-reactors that can be used to encapsulate and detect AP-labeled nanoparticles. Micro-droplets include both empty micro-droplets and fluorescent micro-droplets, while fluorescent micro-droplets are generated from the fluorescence reaction between the APs adhering to a single nanoparticle and corresponding fluorogenic substrates within droplets. By detecting micro-droplets and calculating the proportion of fluorescent micro-droplets to the overall micro-droplets, we can calculate the AP-labeled nanoparticle concentration. The proposed micro-droplet detection method includes the following steps: (1) Gaussian filtering to remove the noise of overall fluorescent targets, (2) a contrast-limited, adaptive histogram equalization processing to enhance the contrast of weakly luminescent micro-droplets, (3) an red maximizing inter-class variance thresholding method (OTSU) to segment the enhanced image for getting the binary map of the overall micro-droplets, (4) a circular Hough transform (CHT) method to detect overall micro-droplets and (5) an intensity-mean-based thresholding segmentation method to extract the fluorescent micro-droplets. The experimental results of fluorescent micro-droplet images show that the average accuracy of our micro-droplet detection method is 0.9586; the average true positive rate is 0.9502; and the average false positive rate is 0.0073. The detection method can be successfully applied to measure AP-labeled nanoparticle concentration in fluorescence microscopy. PMID:29160812

Micro-Droplet Detection Method for Measuring the Concentration of Alkaline Phosphatase-Labeled Nanoparticles in Fluorescence Microscopy.

PubMed

Li, Rufeng; Wang, Yibei; Xu, Hong; Fei, Baowei; Qin, Binjie

2017-11-21

This paper developed and evaluated a quantitative image analysis method to measure the concentration of the nanoparticles on which alkaline phosphatase (AP) was immobilized. These AP-labeled nanoparticles are widely used as signal markers for tagging biomolecules at nanometer and sub-nanometer scales. The AP-labeled nanoparticle concentration measurement can then be directly used to quantitatively analyze the biomolecular concentration. Micro-droplets are mono-dispersed micro-reactors that can be used to encapsulate and detect AP-labeled nanoparticles. Micro-droplets include both empty micro-droplets and fluorescent micro-droplets, while fluorescent micro-droplets are generated from the fluorescence reaction between the APs adhering to a single nanoparticle and corresponding fluorogenic substrates within droplets. By detecting micro-droplets and calculating the proportion of fluorescent micro-droplets to the overall micro-droplets, we can calculate the AP-labeled nanoparticle concentration. The proposed micro-droplet detection method includes the following steps: (1) Gaussian filtering to remove the noise of overall fluorescent targets, (2) a contrast-limited, adaptive histogram equalization processing to enhance the contrast of weakly luminescent micro-droplets, (3) an red maximizing inter-class variance thresholding method (OTSU) to segment the enhanced image for getting the binary map of the overall micro-droplets, (4) a circular Hough transform (CHT) method to detect overall micro-droplets and (5) an intensity-mean-based thresholding segmentation method to extract the fluorescent micro-droplets. The experimental results of fluorescent micro-droplet images show that the average accuracy of our micro-droplet detection method is 0.9586; the average true positive rate is 0.9502; and the average false positive rate is 0.0073. The detection method can be successfully applied to measure AP-labeled nanoparticle concentration in fluorescence microscopy.

An optimized method for neurotransmitters and their metabolites analysis in mouse hypothalamus by high performance liquid chromatography-Q Exactive hybrid quadrupole-orbitrap high-resolution accurate mass spectrometry.

PubMed

Yang, Zong-Lin; Li, Hui; Wang, Bing; Liu, Shu-Ying

2016-02-15

Neurotransmitters (NTs) and their metabolites are known to play an essential role in maintaining various physiological functions in nervous system. However, there are many difficulties in the detection of NTs together with their metabolites in biological samples. A new method for NTs and their metabolites detection by high performance liquid chromatography coupled with Q Exactive hybrid quadruple-orbitrap high-resolution accurate mass spectrometry (HPLC-HRMS) was established in this paper. This method was a great development of the applying of Q Exactive MS in the quantitative analysis. This method enabled a rapid quantification of ten compounds within 18min. Good linearity was obtained with a correlation coefficient above 0.99. The concentration range of the limit of detection (LOD) and the limit of quantitation (LOQ) level were 0.0008-0.05nmol/mL and 0.002-25.0nmol/mL respectively. Precisions (relative standard deviation, RSD) of this method were at 0.36-12.70%. Recovery ranges were between 81.83% and 118.04%. Concentrations of these compounds in mouse hypothalamus were detected by Q Exactive LC-MS technology with this method. Copyright © 2016 Elsevier B.V. All rights reserved.

Qualitative and quantitative analysis of the diuretic component ergone in Polyporus umbellatus by HPLC with fluorescence detection and HPLC-APCI-MS/MS.

PubMed

Zhao, Ying-Yong; Zhao, Ye; Zhang, Yong-Min; Lin, Rui-Chao; Sun, Wen-Ji

2009-06-01

Polyporus umbellatus is a widely used anti-aldosteronic diuretic in Traditional Chinese medicine (TCM). A new, sensitive and selective high-performance liquid chromatography-fluorescence detector (HPLC-FLD) and high-performance liquid chromatography-atmospheric pressure chemical ionization-mass spectrometry (HPLC-APCI-MS/MS) method for quantitative and qualitative determination of ergosta-4,6,8(14),22-tetraen-3-one(ergone), which is the main diuretic component, was provided for quality control of P. umbellatus crude drug. The ergone in the ethanolic extract of P. umbellatus was unambiguously characterized by HPLC-APCI, and further confirmed by comparing with a standard compound. The trace ergone was detected by the sensitive and selective HPLC-FLD. Linearity (r2 > 0.9998) and recoveries of low, medium and high concentration (100.5%, 100.2% and 100.4%) were consistent with the experimental criteria. The limit of detection (LOD) of ergone was around 0.2 microg/mL. Our results indicated that the content of ergone in P. umbellatus varied significantly from habitat to habitat with contents ranging from 2.13 +/- 0.02 to 59.17 +/- 0.05 microg/g. Comparison among HPLC-FLD and HPLC-UV or HPLC-APCI-MS/MS demonstrated that the HPLC-FLD and HPLC-APCI-MS/MS methods gave similar quantitative results for the selected herb samples, the HPLC-UV methods gave lower quantitative results than HPLC-FLD and HPLC-APCI-MS/MS methods. The established new HPLC-FLD method has the advantages of being rapid, simple, selective and sensitive, and could be used for the routine analysis of P. umbellatus crude drug.

Ultrafast gas chromatography method with direct injection for the quantitative determination of benzene, toluene, ethylbenzene, and xylenes in commercial gasoline.

PubMed

Miranda, Nahieh Toscano; Sequinel, Rodrigo; Hatanaka, Rafael Rodrigues; de Oliveira, José Eduardo; Flumignan, Danilo Luiz

2017-04-01

Benzene, toluene, ethylbenzene, and xylenes are some of the most hazardous constituents found in commercial gasoline samples; therefore, these components must be monitored to avoid toxicological problems. We propose a new routine method of ultrafast gas chromatography coupled to flame ionization detection for the direct determination of benzene, toluene, ethylbenzene, and xylenes in commercial gasoline. This method is based on external standard calibration to quantify each compound, including the validation step of the study of linearity, detection and quantification limits, precision, and accuracy. The time of analysis was less than 3.2 min, with quantitative statements regarding the separation and quantification of all compounds in commercial gasoline samples. Ultrafast gas chromatography is a promising alternative method to official analytical techniques. Government laboratories could consider using this method for quality control. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A Novel HPLC Method for the Concurrent Analysis and Quantitation of Seven Water-Soluble Vitamins in Biological Fluids (Plasma and Urine): A Validation Study and Application

PubMed Central

Grotzkyj Giorgi, Margherita; Howland, Kevin; Martin, Colin; Bonner, Adrian B.

2012-01-01

An HPLC method was developed and validated for the concurrent detection and quantitation of seven water-soluble vitamins (C, B1, B2, B5, B6, B9, B12) in biological matrices (plasma and urine). Separation was achieved at 30°C on a reversed-phase C18-A column using combined isocratic and linear gradient elution with a mobile phase consisting of 0.01% TFA aqueous and 100% methanol. Total run time was 35 minutes. Detection was performed with diode array set at 280 nm. Each vitamin was quantitatively determined at its maximum wavelength. Spectral comparison was used for peak identification in real samples (24 plasma and urine samples from abstinent alcohol-dependent males). Interday and intraday precision were <4% and <7%, respectively, for all vitamins. Recovery percentages ranged from 93% to 100%. PMID:22536136

A novel HPLC method for the concurrent analysis and quantitation of seven water-soluble vitamins in biological fluids (plasma and urine): a validation study and application.

PubMed

Giorgi, Margherita Grotzkyj; Howland, Kevin; Martin, Colin; Bonner, Adrian B

2012-01-01

An HPLC method was developed and validated for the concurrent detection and quantitation of seven water-soluble vitamins (C, B(1), B(2), B(5), B(6), B(9), B(12)) in biological matrices (plasma and urine). Separation was achieved at 30°C on a reversed-phase C18-A column using combined isocratic and linear gradient elution with a mobile phase consisting of 0.01% TFA aqueous and 100% methanol. Total run time was 35 minutes. Detection was performed with diode array set at 280 nm. Each vitamin was quantitatively determined at its maximum wavelength. Spectral comparison was used for peak identification in real samples (24 plasma and urine samples from abstinent alcohol-dependent males). Interday and intraday precision were <4% and <7%, respectively, for all vitamins. Recovery percentages ranged from 93% to 100%.

A double-label time-resolved fluorescent strip for rapidly quantitative detection of carbofuran residues in agro-products.

PubMed

Zhang, Qi; Qu, Qiaoyu; Chen, Shanshan; Liu, Xiaowei; Li, Peiwu

2017-09-15

A rapid and quantitative time-resolved fluorescent immunochromatographic assay (TRFICA) for detecting carbofuran residues in agro-products was reported in this paper. This assay was developed based on double-label immunoprobes, one of which was a carbofuran-specific antibody coupled with europium microbeads for the test (T) line signal while the other was mouse IgG coupled with europium microbeads for the control (C) line signal. Quantitative relationships between carbofuran concentrations and T/C ratios were established to determine the analyte concentration. To increase assay accuracy, four standard curves were established for the agro-products (green bean, cabbage, apple, and pear). The limits of detection (LODs) ranged from 0.04 to 0.76mgL -1 . The spiked recoveries of carbofuran in the agro-products were in the range of 81-103%, which was in good agreement with a standard HPLC method. Therefore, we provided a new and reliable method for determination of N-methylcarbamate pesticide carbofuran residues in agro-products including vegetables and fruits. Copyright © 2017. Published by Elsevier Ltd.

Radiologic methods of evaluating generalized osteopenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schneider, R.

1984-10-01

Noninvasive methods of evaluating generalized osteopenia include radiography, radionuclide studies, and various quantitative studies. These methods differ in availability, cost, accuracy, precision, radiation dose, and information supplied about bony change. A combination of methods is necessary to detect and follow the course and treatment of osteopenia.

Validation of the Mass-Extraction-Window for Quantitative Methods Using Liquid Chromatography High Resolution Mass Spectrometry.

PubMed

Glauser, Gaétan; Grund, Baptiste; Gassner, Anne-Laure; Menin, Laure; Henry, Hugues; Bromirski, Maciej; Schütz, Frédéric; McMullen, Justin; Rochat, Bertrand

2016-03-15

A paradigm shift is underway in the field of quantitative liquid chromatography-mass spectrometry (LC-MS) analysis thanks to the arrival of recent high-resolution mass spectrometers (HRMS). The capability of HRMS to perform sensitive and reliable quantifications of a large variety of analytes in HR-full scan mode is showing that it is now realistic to perform quantitative and qualitative analysis with the same instrument. Moreover, HR-full scan acquisition offers a global view of sample extracts and allows retrospective investigations as virtually all ionized compounds are detected with a high sensitivity. In time, the versatility of HRMS together with the increasing need for relative quantification of hundreds of endogenous metabolites should promote a shift from triple-quadrupole MS to HRMS. However, a current "pitfall" in quantitative LC-HRMS analysis is the lack of HRMS-specific guidance for validated quantitative analyses. Indeed, false positive and false negative HRMS detections are rare, albeit possible, if inadequate parameters are used. Here, we investigated two key parameters for the validation of LC-HRMS quantitative analyses: the mass accuracy (MA) and the mass-extraction-window (MEW) that is used to construct the extracted-ion-chromatograms. We propose MA-parameters, graphs, and equations to calculate rational MEW width for the validation of quantitative LC-HRMS methods. MA measurements were performed on four different LC-HRMS platforms. Experimentally determined MEW values ranged between 5.6 and 16.5 ppm and depended on the HRMS platform, its working environment, the calibration procedure, and the analyte considered. The proposed procedure provides a fit-for-purpose MEW determination and prevents false detections.

Detection of propofol concentrations in blood by Raman spectroscopy

NASA Astrophysics Data System (ADS)

Wróbel, M. S.; Gnyba, M.; UrniaŻ, R.; Myllylä, T. S.; Jedrzejewska-Szczerska, M.

2015-07-01

In this paper we present a proof-of-concept of a Raman spectroscopy-based approach for measuring the content of propofol, a common anesthesia drug, in whole human blood, and plasma, which is intended for use during clinical procedures. This method utilizes the Raman spectroscopy as a chemically-sensitive method for qualitative detection of the presence of a drug and a quantitative determination of its concentration. A number of samples from different patients with added various concentrations of propofol IV solution were measured. This is most equivalent to a real in-vivo situation. Subsequent analysis of a set of spectra was carried out to extract qualitative and quantitative information. We conclude, that the changes in the spectra of blood with propofol, overlap with the most prominent lines of the propofol solution, especially at spectral regions: 1450 cm-1, 1250- 1260 cm-1, 1050 cm-1, 875-910 cm-1, 640 cm-1. Later, we have introduced a quantitative analysis program based on correlation matrix closest fit, and a LOO cross-validation. We have achieved 36.67% and 60% model precision when considering full spectra, or specified bands, respectively. These results prove the possibility of using Raman spectroscopy for quantitative detection of propofol concentrations in whole human blood.

Rapid Quantitation of Ascorbic and Folic Acids in SRM 3280 Multivitamin/Multielement Tablets using Flow-Injection Tandem Mass Spectrometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhandari, Deepak; Kertesz, Vilmos; Van Berkel, Gary J

RATIONALE: Ascorbic acid (AA) and folic acid (FA) are water-soluble vitamins and are usually fortified in food and dietary supplements. For the safety of human health, proper intake of these vitamins is recommended. Improvement in the analysis time required for the quantitative determination of these vitamins in food and nutritional formulations is desired. METHODS: A simple and fast (~5 min) in-tube sample preparation was performed, independently for FA and AA, by mixing extraction solvent with a powdered sample aliquot followed by agitation, centrifugation, and filtration to recover an extract for analysis. Quantitative detection was achieved by flow-injection (1 L injectionmore » volume) electrospray ionization tandem mass spectrometry (ESI-MS/MS) in negative ion mode using the method of standard addition. RESULTS: Method of standard addition was employed for the quantitative estimation of each vitamin in a sample extract. At least 2 spiked and 1 non-spiked sample extract were injected in triplicate for each quantitative analysis. Given an injection-to-injection interval of approximately 2 min, about 18 min was required to complete the quantitative estimation of each vitamin. The concentration values obtained for the respective vitamins in the standard reference material (SRM) 3280 using this approach were within the statistical range of the certified values provided in the NIST Certificate of Analysis. The estimated limit of detections of FA and AA were 13 and 5.9 ng/g, respectively. CONCLUSIONS: Flow-injection ESI-MS/MS was successfully applied for the rapid quantitation of FA and AA in SRM 3280 multivitamin/multielement tablets.« less

A Radioactivity Based Quantitative Analysis of the Amount of Thorium Present in Ores and Metallurgical Products; ANALYSE QUANTITATIVE DU THORIUM DANS LES MINERAIS ET LES PRODUITS THORIFERES PAR UNE METHODE BASEE SUR LA RADIOACTIVITE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collee, R.; Govaerts, J.; Winand, L.

1959-10-31

A brief resume of the classical methods of quantitative determination of thorium in ores and thoriferous products is given to show that a rapid, accurate, and precise physical method based on the radioactivity of thorium would be of great utility. A method based on the utilization of the characteristic spectrum of the thorium gamma radiation is presented. The preparation of the samples and the instruments needed for the measurements is discussed. The experimental results show that the reproducibility is very satisfactory and that it is possible to detect Th contents of 1% or smaller. (J.S.R.)

Epitope mapping and targeted quantitation of the cardiac biomarker troponin by SID-MRM mass spectrometry.

PubMed

Zhao, Cheng; Trudeau, Beth; Xie, Helen; Prostko, John; Fishpaugh, Jeffrey; Ramsay, Carol

2014-06-01

The absolute quantitation of the targeted protein using MS provides a promising method to evaluate/verify biomarkers used in clinical diagnostics. In this study, a cardiac biomarker, troponin I (TnI), was used as a model protein for method development. The epitope peptide of TnI was characterized by epitope excision followed with LC/MS/MS method and acted as the surrogate peptide for the targeted protein quantitation. The MRM-based MS assay using a stable internal standard that improved the selectivity, specificity, and sensitivity of the protein quantitation. Also, plasma albumin depletion and affinity enrichment of TnI by anti-TnI mAb-coated microparticles reduced the sample complexity, enhanced the dynamic range, and further improved the detecting sensitivity of the targeted protein in the biological matrix. Therefore, quantitation of TnI, a low abundant protein in human plasma, has demonstrated the applicability of the targeted protein quantitation strategy through its epitope peptide determined by epitope mapping method. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Intra-laboratory validation of chronic bee paralysis virus quantitation using an accredited standardised real-time quantitative RT-PCR method.

PubMed

Blanchard, Philippe; Regnault, Julie; Schurr, Frank; Dubois, Eric; Ribière, Magali

2012-03-01

Chronic bee paralysis virus (CBPV) is responsible for chronic bee paralysis, an infectious and contagious disease in adult honey bees (Apis mellifera L.). A real-time RT-PCR assay to quantitate the CBPV load is now available. To propose this assay as a reference method, it was characterised further in an intra-laboratory study during which the reliability and the repeatability of results and the performance of the assay were confirmed. The qPCR assay alone and the whole quantitation method (from sample RNA extraction to analysis) were both assessed following the ISO/IEC 17025 standard and the recent XP U47-600 standard issued by the French Standards Institute. The performance of the qPCR assay and of the overall CBPV quantitation method were validated over a 6 log range from 10(2) to 10(8) with a detection limit of 50 and 100 CBPV RNA copies, respectively, and the protocol of the real-time RT-qPCR assay for CBPV quantitation was approved by the French Accreditation Committee. Copyright © 2011 Elsevier B.V. All rights reserved.

A novel strategy for rapid detection of NT-proBNP

NASA Astrophysics Data System (ADS)

Cui, Qiyao; Sun, Honghao; Zhu, Hui

2017-09-01

In order to establish a simple, rapid, sensitive, and specific quantitative assay to detect the biomarkers of heart failure, in this study, biotin-streptavidin technology was employed with fluorescence immunochromatographic assay to detect the concentration of the biomarkers in serum, and this method was applied to detect NT-proBNP, which is valuable for diagnostic evaluation of heart failure.

Identification of Lactobacillus delbrueckii and Streptococcus thermophilus Strains Present in Artisanal Raw Cow Milk Cheese Using Real-time PCR and Classic Plate Count Methods.

PubMed

Stachelska, Milena A

2017-12-04

The aim of this paper was to detect Lactobacillus delbrueckii and Streptococcus thermophilus using real-time quantitative PCR assay in 7-day ripening cheese produced from unpasteurised milk. Real-time quantitative PCR assays were designed to identify and enumerate the chosen species of lactic acid bacteria (LAB) in ripened cheese. The results of molecular quantification and classic bacterial enumeration showed a high level of similarity proving that DNA extraction was carried out in a proper way and that genomic DNA solutions were free of PCR inhibitors. These methods revealed the presence of L. delbrueckii and S. thermophilus. The real-time PCR enabled quantification with a detection of 101-103 CFU/g of product. qPCR-standard curves were linear over seven log units down to 101 copies per reaction; efficiencies ranged from 77.9% to 93.6%. Cheese samples were analysed with plate count method and qPCR in parallel. Compared with the classic plate count method, the newly developed qPCR method provided faster and species specific identification of two dairy LAB and yielded comparable quantitative results.

Detection and quantitation of Kaposi's sarcoma-associated herpesvirus (KSHV) by a single competitive-quantitative polymerase chain reaction.

PubMed

Curreli, Francesca; Robles, Monica A; Friedman-Kien, Alvin E; Flore, Ornella

2003-02-01

Kaposi's sarcoma-associated herpesvirus is a novel herpesvirus linked to AIDS-related neoplasms. Currently it is difficult to evaluate the number of virions in viral preparation or in samples obtained from patients with Kaposi's sarcoma (KS), since no protocol for determining the plaque forming units of KSHV exists. We constructed a fragment of a different size than the target viral DNA to carry out a competitive-quantitative PCR. Both fragment and viral DNA were added to a single PCR reaction to compete for the same set of primers. By knowing the amount of the competitor added to the reaction, we could determine the number of viral DNA molecules. We used this assay successfully to detect and quantify KSHV genomes from KS skin biopsies and pleural effusion lymphoma, and from different viral preparations. To date, this is the most convenient and economic method that allows an accurate and fast viral detection/quantitation with a single PCR.

Elucidating the Burden of HIV in Tissues Using Multiplexed Immunofluorescence and In Situ Hybridization: Methods for the Single-Cell Phenotypic Characterization of Cells Harboring HIV In Situ.

PubMed

Vasquez, Joshua J; Hussien, Rajaa; Aguilar-Rodriguez, Brandon; Junger, Henrik; Dobi, Dejan; Henrich, Timothy J; Thanh, Cassandra; Gibson, Erica; Hogan, Louise E; McCune, Joseph; Hunt, Peter W; Stoddart, Cheryl A; Laszik, Zoltan G

2018-06-01

Persistent tissue reservoirs of HIV present a major barrier to cure. Defining subsets of infected cells in tissues is a major focus of HIV cure research. Herein, we describe a novel multiplexed in situ hybridization (ISH) (RNAscope) protocol to detect HIV-DNA (vDNA) and HIV-RNA (vRNA) in formalin-fixed paraffin-embedded (FFPE) human tissues in combination with immunofluorescence (IF) phenotyping of the infected cells. We show that multiplexed IF and ISH (mIFISH) is suitable for quantitative assessment of HIV vRNA and vDNA and that multiparameter IF phenotyping allows precise identification of the cellular source of the ISH signal. We also provide semi-quantitative data on the impact of various tissue fixatives on the detectability of vDNA and vRNA with RNAscope technology. Finally, we describe methods to quantitate the ISH signal on whole-slide digital images and validation of the quantitative ISH data with quantitative real-time PCR for vRNA. It is our hope that this approach will provide insight into the biology of HIV tissue reservoirs and to inform strategies aimed at curing HIV.

Detection and quantitation of trace phenolphthalein (in pharmaceutical preparations and in forensic exhibits) by liquid chromatography-tandem mass spectrometry, a sensitive and accurate method.

PubMed

Sharma, Kakali; Sharma, Shiba P; Lahiri, Sujit C

2013-01-01

Phenolphthalein, an acid-base indicator and laxative, is important as a constituent of widely used weight-reducing multicomponent food formulations. Phenolphthalein is an useful reagent in forensic science for the identification of blood stains of suspected victims and for apprehending erring officials accepting bribes in graft or trap cases. The pink-colored alkaline hand washes originating from the phenolphthalein-smeared notes can easily be determined spectrophotometrically. But in many cases, colored solution turns colorless with time, which renders the genuineness of bribe cases doubtful to the judiciary. No method is known till now for the detection and identification of phenolphthalein in colorless forensic exhibits with positive proof. Liquid chromatography-tandem mass spectrometry had been found to be most sensitive, accurate method capable of detection and quantitation of trace phenolphthalein in commercial formulations and colorless forensic exhibits with positive proof. The detection limit of phenolphthalein was found to be 1.66 pg/L or ng/mL, and the calibration curve shows good linearity (r(2) = 0.9974). © 2012 American Academy of Forensic Sciences.

Physical interpretation and development of ultrasonic nondestructive evaluation techniques applied to the quantitative characterization of textile composite materials

NASA Technical Reports Server (NTRS)

Miller, James G.

1993-01-01

In this Progress Report, we describe our current research activities concerning the development and implementation of advanced ultrasonic nondestructive evaluation methods applied to the characterization of stitched composite materials and bonded aluminum plate specimens. One purpose of this investigation is to identify and characterize specific features of polar backscatter interrogation which enhance the ability of ultrasound to detect flaws in a stitched composite laminate. Another focus is to explore the feasibility of implementing medical linear array imaging technology as a viable ultrasonic-based nondestructive evaluation method to inspect and characterize bonded aluminum lap joints. As an approach to implementing quantitative ultrasonic inspection methods to both of these materials, we focus on the physics that underlies the detection of flaws in such materials.

[A quantitative real time polymerase chain reaction for detection of HBV covalently closed circular DNA in livers of the HBV infected patients].

PubMed

Wang, Mei-Rong; Qiu, Ning; Lu, Shi-Chun; Xiu, Dian-Rong; Yu, Jian-Guo; Li, Tong; Liu, Xue-En; Zhuang, Hui

2011-05-01

To establish and optimize a sensitive and specific quantitative real-time polymerase chain reaction (PCR) method for detection of hepatitis B virus covalently closed circular DNA (HBV cccDNA) in liver tissue. Specific primers and probes were designed to detect HBV DNA (tDNA) and cccDNA. A series of plasmids (3.44 × 10(0) - 3.44 × 10(9) copies/µl) containing a full double-stranded copies of HBV genome (genotype C) were used to establish the standard curve of real-time PCR. Liver samples of 33 patients with HBV related hepatocellular carcinoma (HCC), 13 Chronic hepatitis B patients (CHB) and 10 non-HBV patients were collected to verify the sensitivity and specificity of the assay. A fraction of extracted DNA was digested with a Plasmid-Safe ATP-dependent Dnase (PSAD) for HBV cccDNA detection and the remaining was used for tDNA and β-globin detection. The amount (copies/cell) of HBV cccDNA and tDNA were measured by a real-time PCR, using β-globin housekeeping gene as a quantitation standard. The standard curves of real-time PCR with a linear range of 3.44 × 10(0) to 3.44 × 10(9) copies/µl were established for detecting HBV cccDNA and tDNA, and both of the lowest detection limits of HBV cccDNA and tDNA were 3.44 × 10(0) copies/µl. The lowest quantitation levels of HBV cccDNA in liver tissues tested in 33 HBV related HCC patients and 13 CHB patients were 0.003 copies/cell and 0.031 copies/cell, respectively. HBV cccDNA and tDNA in liver tissue of 10 non-HBV patient appeared to be negative. The true positive rate was increasing through the digestion of HBV DNA by PSAD, and the analytic specificity of cccDNA detection improved by 7.24 × 10(2) times. Liver tissues of 2 patients were retested 5 times in the PCR for detecting cccDNA and the coefficient of variations on cycle threshold (Ct) were between 0.224% - 0.609%. A highly sensitive and specific quantitative real time PCR method for the detection of HBV cccDNA in liver tissue was established and could be used for clinical and epidemiological studies.

Comparison of salivary collection and processing methods for quantitative HHV-8 detection.

PubMed

Speicher, D J; Johnson, N W

2014-10-01

Saliva is a proved diagnostic fluid for the qualitative detection of infectious agents, but the accuracy of viral load determinations is unknown. Stabilising fluids impede nucleic acid degradation, compared with collection onto ice and then freezing, and we have shown that the DNA Genotek P-021 prototype kit (P-021) can produce high-quality DNA after 14 months of storage at room temperature. Here we evaluate the quantitative capability of 10 collection/processing methods. Unstimulated whole mouth fluid was spiked with a mixture of HHV-8 cloned constructs, 10-fold serial dilutions were produced, and samples were extracted and then examined with quantitative PCR (qPCR). Calibration curves were compared by linear regression and qPCR dynamics. All methods extracted with commercial spin columns produced linear calibration curves with large dynamic range and gave accurate viral loads. Ethanol precipitation of the P-021 does not produce a linear standard curve, and virus is lost in the cell pellet. DNA extractions from the P-021 using commercial spin columns produced linear standard curves with wide dynamic range and excellent limit of detection. When extracted with spin columns, the P-021 enables accurate viral loads down to 23 copies μl(-1) DNA. The quantitative and long-term storage capability of this system makes it ideal for study of salivary DNA viruses in resource-poor settings. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Quantitative microbial faecal source tracking with sampling guided by hydrological catchment dynamics.

PubMed

Reischer, G H; Haider, J M; Sommer, R; Stadler, H; Keiblinger, K M; Hornek, R; Zerobin, W; Mach, R L; Farnleitner, A H

2008-10-01

The impairment of water quality by faecal pollution is a global public health concern. Microbial source tracking methods help to identify faecal sources but the few recent quantitative microbial source tracking applications disregarded catchment hydrology and pollution dynamics. This quantitative microbial source tracking study, conducted in a large karstic spring catchment potentially influenced by humans and ruminant animals, was based on a tiered sampling approach: a 31-month water quality monitoring (Monitoring) covering seasonal hydrological dynamics and an investigation of flood events (Events) as periods of the strongest pollution. The detection of a ruminant-specific and a human-specific faecal Bacteroidetes marker by quantitative real-time PCR was complemented by standard microbiological and on-line hydrological parameters. Both quantitative microbial source tracking markers were detected in spring water during Monitoring and Events, with preponderance of the ruminant-specific marker. Applying multiparametric analysis of all data allowed linking the ruminant-specific marker to general faecal pollution indicators, especially during Events. Up to 80% of the variation of faecal indicator levels during Events could be explained by ruminant-specific marker levels proving the dominance of ruminant faecal sources in the catchment. Furthermore, soil was ruled out as a source of quantitative microbial source tracking markers. This study demonstrates the applicability of quantitative microbial source tracking methods and highlights the prerequisite of considering hydrological catchment dynamics in source tracking study design.

Methods for detection of GMOs in food and feed.

PubMed

Marmiroli, Nelson; Maestri, Elena; Gullì, Mariolina; Malcevschi, Alessio; Peano, Clelia; Bordoni, Roberta; De Bellis, Gianluca

2008-10-01

This paper reviews aspects relevant to detection and quantification of genetically modified (GM) material within the feed/food chain. The GM crop regulatory framework at the international level is evaluated with reference to traceability and labelling. Current analytical methods for the detection, identification, and quantification of transgenic DNA in food and feed are reviewed. These methods include quantitative real-time PCR, multiplex PCR, and multiplex real-time PCR. Particular attention is paid to methods able to identify multiple GM events in a single reaction and to the development of microdevices and microsensors, though they have not been fully validated for application.

Method and apparatus for chromatographic quantitative analysis

DOEpatents

Fritz, James S.; Gjerde, Douglas T.; Schmuckler, Gabriella

1981-06-09

An improved apparatus and method for the quantitative analysis of a solution containing a plurality of anion species by ion exchange chromatography which utilizes a single eluent and a single ion exchange bed which does not require periodic regeneration. The solution containing the anions is added to an anion exchange resin bed which is a low capacity macroreticular polystyrene-divinylbenzene resin containing quarternary ammonium functional groups, and is eluted therefrom with a dilute solution of a low electrical conductance organic acid salt. As each anion species is eluted from the bed, it is quantitatively sensed by conventional detection means such as a conductivity cell.

Quantitative determination of dimethicone in commercial tablets and capsules by Fourier transform infrared spectroscopy and antifoaming activity test.

PubMed

Torrado, G; García-Arieta, A; de los Ríos, F; Menéndez, J C; Torrado, S

1999-03-01

Fourier transform infrared (FTIR) spectroscopy and antifoaming activity test have been employed for the quantitative analysis of dimethicone. Linearity, accuracy and precision are presented for both methods. These methods have been also used to compare different dimethicone-containing proprietary medicines. FTIR spectroscopy has shown to be adequate for quantitation of dimethicone in commercial tablets and capsules in order to comply with USP requirements. The antifoaming activity test is able to detect incompatibilities between dimethicone and other constituents. The presence of certain enzymes in some medicinal products increases the defoaming properties of these formulations.

A reversed-phase high-performance liquid chromatography method for bovine serum albumin assay in pharmaceutical dosage forms and protein/antigen delivery systems.

PubMed

Hamidi, Mehrdad; Zarei, Najmeh

2009-05-01

Bovine serum albumin (BSA) is among the most widely used proteins in protein formulations as well as in the development of novel delivery systems as a typical model for therapeutic/diagnostic proteins and the new versions of vaccines. The development of reliable and easily available assay methods for quantitation of this protein would therefore play a crucial role in these types of studies. A simple gradient reversed-phase high-performance liquid chromatography with ultra-violet detection (HPLC-UV) method has been developed for quantitation of BSA in dosage forms and protein delivery systems. The method produced linear responses throughout the wide BSA concentration range of 1 to 100 micro g/mL. The average within-run and between-run variations of the method within the linear concentration range of BSA were 2.46% and 2.20%, respectively, with accuracies of 104.49% and 104.58% for within-run and between-run samples, respectively. The limits of detection (LOD) and quantitation (LOQ) of the method were 0.5 and 1 microg/mL, respectively. The method showed acceptable system suitability indices, which enabled us to use it successfully during our particulate vaccine delivery research project. Copyright 2009 John Wiley & Sons, Ltd.

ELEGANT ENVIRONMENTAL IMMUNOASSAYS

EPA Science Inventory

Immunochemical methods are based on selective antibodies directed to a particular target analyte. The specific binding between antibody and analyte can be used for detection and quantitation. Methods such as the enzyme-linked immunosorbent assay (ELISA) can provide a sensitiv...

Combination of atomic force microscopy and mass spectrometry for the detection of target protein in the serum samples of children with autism spectrum disorders

NASA Astrophysics Data System (ADS)

Kaysheva, A. L.; Pleshakova, T. O.; Kopylov, A. T.; Shumov, I. D.; Iourov, I. Y.; Vorsanova, S. G.; Yurov, Y. B.; Ziborov, V. S.; Archakov, A. I.; Ivanov, Y. D.

2017-10-01

Possibility of detection of target proteins associated with development of autistic disorders in children with use of combined atomic force microscopy and mass spectrometry (AFM/MS) method is demonstrated. The proposed method is based on the combination of affine enrichment of proteins from biological samples and visualization of these proteins by AFM and MS analysis with quantitative detection of target proteins.

Silver Nanoparticle-Based Fluorescence-Quenching Lateral Flow Immunoassay for Sensitive Detection of Ochratoxin A in Grape Juice and Wine.

PubMed

Jiang, Hu; Li, Xiangmin; Xiong, Ying; Pei, Ke; Nie, Lijuan; Xiong, Yonghua

2017-02-28

A silver nanoparticle (AgNP)-based fluorescence-quenching lateral flow immunoassay with competitive format (cLFIA) was developed for sensitive detection of ochratoxin A (OTA) in grape juice and wine samples in the present study. The Ru(phen) 3 2 + -doped silica nanoparticles (RuNPs) were sprayed on the test and control line zones as background fluorescence signals. The AgNPs were designed as the fluorescence quenchers of RuNPs because they can block the exciting light transferring to the RuNP molecules. The proposed method exhibited high sensitivity for OTA detection, with a detection limit of 0.06 µg/L under optimized conditions. The method also exhibited a good linear range for OTA quantitative analysis from 0.08 µg/L to 5.0 µg/L. The reliability of the fluorescence-quenching cLFIA method was evaluated through analysis of the OTA-spiked red grape wine and juice samples. The average recoveries ranged from 88.0% to 110.0% in red grape wine and from 92.0% to 110.0% in grape juice. Meanwhile, less than a 10% coefficient variation indicated an acceptable precision of the cLFIA method. In summary, the new AgNP-based fluorescence-quenching cLFIA is a simple, rapid, sensitive, and accurate method for quantitative detection of OTA in grape juice and wine or other foodstuffs.

Silver Nanoparticle-Based Fluorescence-Quenching Lateral Flow Immunoassay for Sensitive Detection of Ochratoxin A in Grape Juice and Wine

PubMed Central

Jiang, Hu; Li, Xiangmin; Xiong, Ying; Pei, Ke; Nie, Lijuan; Xiong, Yonghua

2017-01-01

A silver nanoparticle (AgNP)-based fluorescence-quenching lateral flow immunoassay with competitive format (cLFIA) was developed for sensitive detection of ochratoxin A (OTA) in grape juice and wine samples in the present study. The Ru(phen)32+-doped silica nanoparticles (RuNPs) were sprayed on the test and control line zones as background fluorescence signals. The AgNPs were designed as the fluorescence quenchers of RuNPs because they can block the exciting light transferring to the RuNP molecules. The proposed method exhibited high sensitivity for OTA detection, with a detection limit of 0.06 µg/L under optimized conditions. The method also exhibited a good linear range for OTA quantitative analysis from 0.08 µg/L to 5.0 µg/L. The reliability of the fluorescence-quenching cLFIA method was evaluated through analysis of the OTA-spiked red grape wine and juice samples. The average recoveries ranged from 88.0% to 110.0% in red grape wine and from 92.0% to 110.0% in grape juice. Meanwhile, less than a 10% coefficient variation indicated an acceptable precision of the cLFIA method. In summary, the new AgNP-based fluorescence-quenching cLFIA is a simple, rapid, sensitive, and accurate method for quantitative detection of OTA in grape juice and wine or other foodstuffs. PMID:28264472

A novel device for quantitative measurement of chloride concentration by fluorescence indicator

NASA Astrophysics Data System (ADS)

Wang, Junsheng; Wu, Xudong; Chon, Chanhee; Gonska, Tanja; Li, Dongqing

2012-02-01

Cystic fibrosis (CF) is a life-threatening genetic disease. At present, the common method for diagnosis of CF is to detect the chloride concentration in sweat using ion-selective electrodes. However, the current sweat testing methods require a relatively large quantity of sweat sample, at least 25 µL, which is very difficult to obtain, especially for newborns. This paper presents a new method and a new device for rapid detection of the chloride concentration from a small volume of solution. In this method, the chloride concentration is determined quantitatively by the fluorescence intensity of MQAE, a chloride ion fluorescent indicator. In this device, the sample is carried by a small piece of filter paper on a cover glass exposed to an UV LED light source. The resulting fluorescent signals are detected by a Si photodiode. Data acquisition and processing are accomplished by LabVIEW software in a PDA. Based on the Stern-Volmer relationship, the effects of different parameters on the fluorescence intensity were analyzed. The observed significant difference between 40 and 60 mM (the borderline of chloride concentration for CF) is discussed in this paper. The results show that detection can be completed within 10 s. The minimum detectable volume of the chloride solution is 1 μL. The novel method and the device are of great potential for CF diagnosis.

Analysis of Natural Toxins by Liquid Chromatography-Chemiluminescence Nitrogen Detection and Application to the Preparation of Certified Reference Materials.

PubMed

Thomas, Krista; Wechsler, Dominik; Chen, Yi-Min; Crain, Sheila; Quilliam, Michael A

2016-09-01

The implementation of instrumental analytical methods such as LC-MS for routine monitoring of toxins requires the availability of accurate calibration standards. This is a challenge because many toxins are rare, expensive, dangerous to handle, and/or unstable, and simple gravimetric procedures are not reliable for establishing accurate concentrations in solution. NMR has served as one method of qualitative and quantitative characterization of toxin calibration solution Certified Reference Materials (CRMs). LC with chemiluminescence N detection (LC-CLND) was selected as a complementary method for comprehensive characterization of CRMs because it provides a molar response to N. Here we report on our investigation of LC-CLND as a method suitable for quantitative analysis of nitrogenous toxins. It was demonstrated that a wide range of toxins could be analyzed quantitatively by LC-CLND. Furthermore, equimolar responses among diverse structures were established and it was shown that a single high-purity standard such as caffeine could be used for instrument calibration. The limit of detection was approximately 0.6 ng N. Measurement of several of Canada's National Research Council toxin CRMs with caffeine as the calibrant showed precision averaging 2% RSD and accuracy ranging from 97 to 102%. Application of LC-CLND to the production of calibration solution CRMs and the establishment of traceability of measurement results are presented.

Assessment of Intrathecal Free Light Chain Synthesis: Comparison of Different Quantitative Methods with the Detection of Oligoclonal Free Light Chains by Isoelectric Focusing and Affinity-Mediated Immunoblotting.

PubMed

Zeman, David; Kušnierová, Pavlína; Švagera, Zdeněk; Všianský, František; Byrtusová, Monika; Hradílek, Pavel; Kurková, Barbora; Zapletalová, Olga; Bartoš, Vladimír

2016-01-01

We aimed to compare various methods for free light chain (fLC) quantitation in cerebrospinal fluid (CSF) and serum and to determine whether quantitative CSF measurements could reliably predict intrathecal fLC synthesis. In addition, we wished to determine the relationship between free kappa and free lambda light chain concentrations in CSF and serum in various disease groups. We analysed 166 paired CSF and serum samples by at least one of the following methods: turbidimetry (Freelite™, SPAPLUS), nephelometry (N Latex FLC™, BN ProSpec), and two different (commercially available and in-house developed) sandwich ELISAs. The results were compared with oligoclonal fLC detected by affinity-mediated immunoblotting after isoelectric focusing. Although the correlations between quantitative methods were good, both proportional and systematic differences were discerned. However, no major differences were observed in the prediction of positive oligoclonal fLC test. Surprisingly, CSF free kappa/free lambda light chain ratios were lower than those in serum in about 75% of samples with negative oligoclonal fLC test. In about a half of patients with multiple sclerosis and clinically isolated syndrome, profoundly increased free kappa/free lambda light chain ratios were found in the CSF. Our results show that using appropriate method-specific cut-offs, different methods of CSF fLC quantitation can be used for the prediction of intrathecal fLC synthesis. The reason for unexpectedly low free kappa/free lambda light chain ratios in normal CSFs remains to be elucidated. Whereas CSF free kappa light chain concentration is increased in most patients with multiple sclerosis and clinically isolated syndrome, CSF free lambda light chain values show large interindividual variability in these patients and should be investigated further for possible immunopathological and prognostic significance.

Quantitative thermal sensory testing -- value of testing for both cold and warm sensation detection in evaluation of small fiber neuropathy.

PubMed

Shukla, Garima; Bhatia, Manvir; Behari, Madhuri

2005-10-01

Small fiber neuropathy is a common neurological disorder, often missed or ignored by physicians, since examination and routine nerve conduction studies are usually normal in this condition. Many methods including quantitative thermal sensory testing are currently being used for early detection of this condition, so as to enable timely investigation and treatment. This study was conducted to assess the yield of quantitative thermal sensory testing in diagnosis of small fiber neuropathy. We included patients presenting with history suggestive of positive and/or negative sensory symptoms, with normal examination findings, clinically suggestive of small fiber neuropathy, with normal or minimally abnormal routine nerve conduction studies. These patients were subjected to quantitative thermal sensory testing using a Medoc TSA-II Neurosensory analyser at two sites and for two modalities. QST data were compared with those in 120 normal healthy controls. Twenty-five patients (16 males, 9 females) with mean age 46.8+/-16.6 years (range: 21-75 years) were included in the study. The mean duration of symptoms was 1.6+/-1.6 years (range: 3 months-6 years). Eighteen patients (72%) had abnormal thresholds in at least one modality. Thermal thresholds were normal in 7 out of the 25 patients. This study demonstrates that quantitative thermal sensory testing is a fairly sensitive method for detection of small fiber neuropathy especially in patients with normal routine nerve conduction studies.

Detection limits and cost comparisons of human- and gull-associated conventional and quantitative PCR assays in artificial and environmental waters

EPA Science Inventory

Modern techniques for tracking fecal pollution in environmental waters require investing in DNA-based methods to determine the presence of specific fecal sources. To help water quality managers decide whether to employ routine polymerase chain reaction (PCR) or quantitative PC...

Enamel microcracks in terms of orthodontic treatment: A novel method for their detection and evaluation.

PubMed

Dumbryte, Irma; Linkeviciene, Laura; Linkevicius, Tomas; Malinauskas, Mangirdas

2017-07-26

The study aimed at introducing current available techniques for enamel microcracks (EMCs) detection, and presenting a method for direct quantitative analysis of an individual EMC. Measurements of the detailed EMCs characteristics (location, length, and width) were taken from the reconstructed images of the buccal tooth surface (teeth extracted from two age groups of patients) employing a scanning electron microscopy (SEM) and our derived formulas before and after ceramic brackets removal. Measured parameters of EMCs for younger age group were 2.41 µm (width), 3.68 mm (length) before and 2.73 µm, 3.90 mm after debonding; for older -4.03 µm, 4.35 mm before and 4.80 µm, 4.37 mm after brackets removal. Following debonding EMCs increased for both groups, however the changes in width and length were statistically insignificant. Regardless of the age group, proposed method enabled precise detection of the same EMC before and after debonding, and quantitative examination of its characteristics.

Picomolar quantitation of free sulfite in foods by means of [57Co]hydroxocobalamin and radiometric chromatography of [57Co]sulfitocobalamin. Method, applications and significance of coexisting sulfides.

PubMed

Beck, R A; Anes, J M; Savini, L M; Mateer, R A

2000-06-09

The concentration dependent reaction of sulfite with 57Co-labeled hydroxocobalamin (OH57CoCbl) to produce a sulfitocobalamin (SO(3)57CoCbl) adduct served as a quantification strategy for foodborne sulfite residues freely extracted into pH 5.2, 0.05 M acetate buffer. SO(3)57CoCbl was then resolved using SP-Sephadex C-25 gel chromatography and its radiometric detection allowed calculation of a standard logit plot from which unknown sulfite concentrations could be determined. The sulfite detection range was 6.0 nM-0.3 pM with respective relative standard deviations of 4.4-29.4% for 50-microl samples. Individual incidences of foodborne sulfite intolerances provoked by L-cysteine or sulfite additive use in bakery products, which remained undetected using conventional sulfite analytical methods, underscored the quantitative value of the method. The analytical significance and occurrences of detectable sulfides coexisting with foodborne sulfite residues was also addressed.

Determination of seven flavonoids in Ixeridium gracile (DC.) Shih by high-performance liquid chromatography.

PubMed

Chen, Juan; Ma, Xue-Mei; Shi, Yan-Ping

2009-01-01

A high-performance liquid chromatographic technique coupled with photodiode array detection was proposed for the simultaneous determination of 7 flavonoids, i.e., quercetin, kaempferol, 7-hydroxyflavanone, 7-methoxyflavanone, 2',4'-dihydroxychalcone, 2',4'-dihydroxydihydrochalcone, and 7,2'-dihydroxy-3', 4'-dimethoxyisoflavane, in extracts of the plant Ixeridium gracile. Optimum separation was obtained by using a reversed-phase C18 method. Because of the different UV characteristics of these components, 5 detection wavelengths were used for the quantitative analysis. All of the flavonoids showed good linearity (r > 0.9999). The limit of detection and limit of quantitation values for the analytes ranged from 0.06 to 0.46 microg/mL and from 0.18 to 1.48 microg/mL, respectively. The method was validated by evaluating repeatability, precision, stability, and accuracy. Five different extraction and purification procedures were investigated for preparation of the sample solution. The optimized method was applied to the determination of flavonoids in I. gracile and was found to be efficient.

Transcriptomic biomarkers of altered erythropoiesis to detect autologous blood transfusion.

PubMed

Salamin, Olivier; Mignot, Jonathan; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

2018-03-01

Autologous blood transfusion is a powerful means of improving performance and remains one of the most challenging methods to detect. Recent investigations have identified 3 candidate reticulocytes genes whose expression was significantly influenced by blood transfusion. Using quantitative reverse transcription polymerase chain reaction as an alternative quantitative method, the present study supports that delta-aminolevulinate synthase 2 (ALAS2), carbonic anhydrase (CA1), and solute carrier family 4 member 1 (SLC4A1) genes are down-regulated post-transfusion. The expression of these genes exhibited stronger correlation with immature reticulocyte fraction than with reticulocytes percentage. Moreover, the repression of reticulocytes' gene expression was more pronounced than the diminution of immature reticulocyte fraction and reticulocyte percentage following blood transfusion. It suggests that the 3 candidate genes are reliable predictors of bone marrow's response to blood transfusion and that they represent potential biomarkers for the detection of this method prohibited in sports. Copyright © 2017 John Wiley & Sons, Ltd.

Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

PubMed

Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

2005-01-01

Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific, sensitive, and economic alternative to the current quantitative methods.

Application of surface enhanced Raman scattering and competitive adaptive reweighted sampling on detecting furfural dissolved in transformer oil

NASA Astrophysics Data System (ADS)

Chen, Weigen; Zou, Jingxin; Wan, Fu; Fan, Zhou; Yang, Dingkun

2018-03-01

Detecting the dissolving furfural in mineral oil is an essential technical method to evaluate the ageing condition of oil-paper insulation and the degradation of mechanical properties. Compared with the traditional detection method, Raman spectroscopy is obviously convenient and timesaving in operation. This study explored the method of applying surface enhanced Raman scattering (SERS) on quantitative analysis of the furfural dissolved in oil. Oil solution with different concentration of furfural were prepared and calibrated by high-performance liquid chromatography. Confocal laser Raman spectroscopy (CLRS) and SERS technology were employed to acquire Raman spectral data. Monte Carlo cross validation (MCCV) was used to eliminate the outliers in sample set, then competitive adaptive reweighted sampling (CARS) was developed to select an optimal combination of informative variables that most reflect the chemical properties of concern. Based on selected Raman spectral features, support vector machine (SVM) combined with particle swarm algorithm (PSO) was used to set up a furfural quantitative analysis model. Finally, the generalization ability and prediction precision of the established method were verified by the samples made in lab. In summary, a new spectral method is proposed to quickly detect furfural in oil, which lays a foundation for evaluating the ageing of oil-paper insulation in oil immersed electrical equipment.

Detection of proximal caries using quantitative light-induced fluorescence-digital and laser fluorescence: a comparative study.

PubMed

Yoon, Hyung-In; Yoo, Min-Jeong; Park, Eun-Jin

2017-12-01

The purpose of this study was to evaluate the in vitro validity of quantitative light-induced fluorescence-digital (QLF-D) and laser fluorescence (DIAGNOdent) for assessing proximal caries in extracted premolars, using digital radiography as reference method. A total of 102 extracted premolars with similar lengths and shapes were used. A single operator conducted all the examinations using three different detection methods (bitewing radiography, QLF-D, and DIAGNOdent). The bitewing x-ray scale, QLF-D fluorescence loss (ΔF), and DIAGNOdent peak readings were compared and statistically analyzed. Each method showed an excellent reliability. The correlation coefficient between bitewing radiography and QLF-D, DIAGNOdent were -0.644 and 0.448, respectively, while the value between QLF-D and DIAGNOdent was -0.382. The kappa statistics for bitewing radiography and QLF-D had a higher diagnosis consensus than those for bitewing radiography and DIAGNOdent. The QLF-D was moderately to highly accurate (AUC = 0.753 - 0.908), while DIAGNOdent was moderately to less accurate (AUC = 0.622 - 0.784). All detection methods showed statistically significant correlation and high correlation between the bitewing radiography and QLF-D. QLF-D was found to be a valid and reliable alternative diagnostic method to digital bitewing radiography for in vitro detection of proximal caries.

Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

PubMed

Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

2009-11-25

Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

Enzyme-Encapsulated Liposome-Linked Immunosorbent Assay Enabling Sensitive Personal Glucose Meter Readout for Portable Detection of Disease Biomarkers.

PubMed

Lin, Bingqian; Liu, Dan; Yan, Jinmao; Qiao, Zhi; Zhong, Yunxin; Yan, Jiawei; Zhu, Zhi; Ji, Tianhai; Yang, Chaoyong James

2016-03-23

There is considerable demand for sensitive, selective, and portable detection of disease-associated proteins, particularly in clinical practice and diagnostic applications. Portable devices are highly desired for detection of disease biomarkers in daily life due to the advantages of being simple, rapid, user-friendly, and low-cost. Herein we report an enzyme-encapsulated liposome-linked immunosorbent assay for sensitive detection of proteins using personal glucose meters (PGM) for portable quantitative readout. Liposomes encapsulating a large amount of amyloglucosidase or invertase are surface-coated with recognition elements such as aptamers or antibodies for target recognition. By translating molecular recognition signal into a large amount of glucose with the encapsulated enzyme, disease biomarkers such as thrombin or C-reactive protein (CRP) can be quantitatively detected by a PGM with a high detection limit of 1.8 or 0.30 nM, respectively. With the advantages of portability, ease of use, and low-cost, the method reported here has potential for portable and quantitative detection of various targets for different POC testing scenarios, such as rapid diagnosis in clinic offices, health monitoring at the bedside, and chemical/biochemical safety control in the field.

Ultrasensitive Genotypic Detection of Antiviral Resistance in Hepatitis B Virus Clinical Isolates▿ †

PubMed Central

Fang, Jie; Wichroski, Michael J.; Levine, Steven M.; Baldick, Carl J.; Mazzucco, Charles E.; Walsh, Ann W.; Kienzle, Bernadette K.; Rose, Ronald E.; Pokornowski, Kevin A.; Colonno, Richard J.; Tenney, Daniel J.

2009-01-01

Amino acid substitutions that confer reduced susceptibility to antivirals arise spontaneously through error-prone viral polymerases and are selected as a result of antiviral therapy. Resistance substitutions first emerge in a fraction of the circulating virus population, below the limit of detection by nucleotide sequencing of either the population or limited sets of cloned isolates. These variants can expand under drug pressure to dominate the circulating virus population. To enhance detection of these viruses in clinical samples, we established a highly sensitive quantitative, real-time allele-specific PCR assay for hepatitis B virus (HBV) DNA. Sensitivity was accomplished using a high-fidelity DNA polymerase and oligonucleotide primers containing locked nucleic acid bases. Quantitative measurement of resistant and wild-type variants was accomplished using sequence-matched standards. Detection methodology that was not reliant on hybridization probes, and assay modifications, minimized the effect of patient-specific sequence polymorphisms. The method was validated using samples from patients chronically infected with HBV through parallel sequencing of large numbers of cloned isolates. Viruses with resistance to lamivudine and other l-nucleoside analogs and entecavir, involving 17 different nucleotide substitutions, were reliably detected at levels at or below 0.1% of the total population. The method worked across HBV genotypes. Longitudinal analysis of patient samples showed earlier emergence of resistance on therapy than was seen with sequencing methodologies, including some cases of resistance that existed prior to treatment. In summary, we established and validated an ultrasensitive method for measuring resistant HBV variants in clinical specimens, which enabled earlier, quantitative measurement of resistance to therapy. PMID:19433559

A novel statistical method for quantitative comparison of multiple ChIP-seq datasets.

PubMed

Chen, Li; Wang, Chi; Qin, Zhaohui S; Wu, Hao

2015-06-15

ChIP-seq is a powerful technology to measure the protein binding or histone modification strength in the whole genome scale. Although there are a number of methods available for single ChIP-seq data analysis (e.g. 'peak detection'), rigorous statistical method for quantitative comparison of multiple ChIP-seq datasets with the considerations of data from control experiment, signal to noise ratios, biological variations and multiple-factor experimental designs is under-developed. In this work, we develop a statistical method to perform quantitative comparison of multiple ChIP-seq datasets and detect genomic regions showing differential protein binding or histone modification. We first detect peaks from all datasets and then union them to form a single set of candidate regions. The read counts from IP experiment at the candidate regions are assumed to follow Poisson distribution. The underlying Poisson rates are modeled as an experiment-specific function of artifacts and biological signals. We then obtain the estimated biological signals and compare them through the hypothesis testing procedure in a linear model framework. Simulations and real data analyses demonstrate that the proposed method provides more accurate and robust results compared with existing ones. An R software package ChIPComp is freely available at http://web1.sph.emory.edu/users/hwu30/software/ChIPComp.html. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Quantitative detection of type A staphylococcal enterotoxin by Laurell electroimmunodiffusion.

PubMed

Gasper, E; Heimsch, R C; Anderson, A W

1973-03-01

The detection of staphylococcal enterotoxin A by the quantitative technique of electroimmunodiffusion is described. High dilutions of type-specific rabbit antiserum were used in 1% agarose gels, 1 mm thick, and prepared in 0.05-mug barbital buffer, pH 8.6. Volumes of 10 muliters containing 1.5 to 10 ng of toxin were electrophoresed out of 4-mm diameter wells at 5 mA/cm width of gel. The precipitin cones formed were made visible by first immersing the agarose gels in 0.2 M NaCl and then overlaying the surface with the purified globulin fraction of sheep serum against rabbit globulin, followed by soaking of the gels in 1% aqueous cadmium acetate and staining with 0.1% thiazine red in 1% glacial acetic acid. Fully extended cones, 4 to 23 mm in length depending on toxin concentration and antiserum dilution, were developed in 2 to 5 h of electrophoresis, and visualization was achieved within 2 to 3 h. Because the method is qualitative, quantitative, simple, rapid, and sensitive, it offers a practical tool for the detection of small amounts of bacterial toxins in contaminated foods. The method should also qualify as a sensitive detection device in biochemical procedures which attempt to trace, detect, and identify biological substances in nanogram quantities, provided these substances are antigenic and capable of forming a precipitate with their specific antibodies.

Quantitative detection of powdered activated carbon in wastewater treatment plant effluent by thermogravimetric analysis (TGA).

PubMed

Krahnstöver, Therese; Plattner, Julia; Wintgens, Thomas

2016-09-15

For the elimination of potentially harmful micropollutants, powdered activated carbon (PAC) adsorption is applied in many wastewater treatment plants (WWTP). This holds the risk of PAC leakage into the WWTP effluent and desorption of contaminants into natural water bodies. In order to assess a potential PAC leakage, PAC concentrations below several mg/L have to be detected in the WWTP effluent. None of the methods that are used for water analysis today are able to differentiate between activated carbon and solid background matrix. Thus, a selective, quantitative and easily applicable method is still needed for the detection of PAC residues in wastewater. In the present study, a method was developed to quantitatively measure the PAC content in wastewater by using filtration and thermogravimetric analysis (TGA), which is a well-established technique for the distinction between different solid materials. For the sample filtration, quartz filters with a temperature stability up to 950 °C were used. This allowed for sensitive and well reproducible measurements, as the TGA was not affected by the presence of the filter. The sample's mass fractions were calculated by integrating the mass decrease rate obtained by TGA in specific, clearly identifiable peak areas. A two-step TGA heating method consisting of N2 and O2 atmospheres led to a good differentiation between PAC and biological background matrix, thanks to the reduction of peak overlapping. A linear correlation was found between a sample's PAC content and the corresponding peak areas under N2 and O2, the sample volume and the solid mass separated by filtration. Based on these findings, various wastewater samples from different WWTPs were then analyzed by TGA with regard to their PAC content. It was found that, compared to alternative techniques such as measurement of turbidity or total suspended solids, the newly developed TGA method allows for a quantitative and selective detection of PAC concentrations down to 0.1 mg/L. The method showed a linearity coefficient of 0.98 and relative standard deviations of 10%, using small water sample volumes between 0.3 and 0.6 L. Copyright © 2016 Elsevier Ltd. All rights reserved.

Protein detection by Simple Western™ analysis.

PubMed

Harris, Valerie M

2015-01-01

Protein Simple© has taken a well-known protein detection method, the western blot, and revolutionized it. The Simple Western™ system uses capillary electrophoresis to identify and quantitate a protein of interest. Protein Simple© provides multiple detection apparatuses (Wes, Sally Sue, or Peggy Sue) that are suggested to save scientists valuable time by allowing the researcher to prepare the protein sample, load it along with necessary antibodies and substrates, and walk away. Within 3-5 h the protein will be separated by size, or charge, immuno-detection of target protein will be accurately quantitated, and results will be immediately made available. Using the Peggy Sue instrument, one study recently examined changes in MAPK signaling proteins in the sex-determining stage of gonadal development. Here the methodology is described.

Colorimetric detection of uranium in water

DOEpatents

DeVol, Timothy A [Clemson, SC; Hixon, Amy E [Piedmont, SC; DiPrete, David P [Evans, GA

2012-03-13

Disclosed are methods, materials and systems that can be used to determine qualitatively or quantitatively the level of uranium contamination in water samples. Beneficially, disclosed systems are relatively simple and cost-effective. For example, disclosed systems can be utilized by consumers having little or no training in chemical analysis techniques. Methods generally include a concentration step and a complexation step. Uranium concentration can be carried out according to an extraction chromatographic process and complexation can chemically bind uranium with a detectable substance such that the formed substance is visually detectable. Methods can detect uranium contamination down to levels even below the MCL as established by the EPA.

Fully automated analytical procedure for propofol determination by sequential injection technique with spectrophotometric and fluorimetric detections.

PubMed

Šrámková, Ivana; Amorim, Célia G; Sklenářová, Hana; Montenegro, Maria C B M; Horstkotte, Burkhard; Araújo, Alberto N; Solich, Petr

2014-01-01

In this work, an application of an enzymatic reaction for the determination of the highly hydrophobic drug propofol in emulsion dosage form is presented. Emulsions represent a complex and therefore challenging matrix for analysis. Ethanol was used for breakage of a lipid emulsion, which enabled optical detection. A fully automated method based on Sequential Injection Analysis was developed, allowing propofol determination without the requirement of tedious sample pre-treatment. The method was based on spectrophotometric detection after the enzymatic oxidation catalysed by horseradish peroxidase and subsequent coupling with 4-aminoantipyrine leading to a coloured product with an absorbance maximum at 485 nm. This procedure was compared with a simple fluorimetric method, which was based on the direct selective fluorescence emission of propofol in ethanol at 347 nm. Both methods provide comparable validation parameters with linear working ranges of 0.005-0.100 mg mL(-1) and 0.004-0.243 mg mL(-1) for the spectrophotometric and fluorimetric methods, respectively. The detection and quantitation limits achieved with the spectrophotometric method were 0.0016 and 0.0053 mg mL(-1), respectively. The fluorimetric method provided the detection limit of 0.0013 mg mL(-1) and limit of quantitation of 0.0043 mg mL(-1). The RSD did not exceed 5% and 2% (n=10), correspondingly. A sample throughput of approx. 14 h(-1) for the spectrophotometric and 68 h(-1) for the fluorimetric detection was achieved. Both methods proved to be suitable for the determination of propofol in pharmaceutical formulation with average recovery values of 98.1 and 98.5%. © 2013 Elsevier B.V. All rights reserved.

Rapid Quantitative Analysis of Multiple Explosive Compound Classes on a Single Instrument via Flow-Injection Analysis Tandem Mass Spectrometry.

PubMed

Ostrinskaya, Alla; Kunz, Roderick R; Clark, Michelle; Kingsborough, Richard P; Ong, Ta-Hsuan; Deneault, Sandra

2018-05-24

A flow-injection analysis tandem mass spectrometry (FIA MSMS) method was developed for rapid quantitative analysis of 10 different inorganic and organic explosives. Performance is optimized by tailoring the ionization method (APCI/ESI), de-clustering potentials, and collision energies for each specific analyte. In doing so, a single instrument can be used to detect urea nitrate, potassium chlorate, 2,4,6-trinitrotoluene, 2,4,6-trinitrophenylmethylnitramine, triacetone triperoxide, hexamethylene triperoxide diamine, pentaerythritol tetranitrate, 1,3,5-trinitroperhydro-1,3,5-triazine, nitroglycerin, and octohy-dro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine with sensitivities all in the picogram per milliliter range. In conclusion, FIA APCI/ESI MSMS is a fast (<1 min/sample), sensitive (~pg/mL LOQ), and precise (intraday RSD < 10%) method for trace explosive detection that can play an important role in criminal and attributional forensics, counterterrorism, and environmental protection areas, and has the potential to augment or replace several of the existing explosive detection methods. © 2018 American Academy of Forensic Sciences.

Improved assay to detect Plasmodium falciparum using an uninterrupted, semi-nested PCR and quantitative lateral flow analysis

PubMed Central

2013-01-01

Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to < two hours. Analysis of the PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252

Fast quantitative analysis of boric acid by gas chromatography-mass spectrometry coupled with a simple and selective derivatization reaction using triethanolamine.

PubMed

Zeng, Li-Min; Wang, Hao-Yang; Guo, Yin-Long

2010-03-01

A fast, selective, and sensitive GC-MS method has been developed and validated for the determination of boric acid in the drinking water by derivatization with triethanolamine. This analytic strategy successfully converts the inorganic, nonvolatile boric acid B(OH)(3) present in the drinking water to a volatile triethanolamine borate B(OCH(2)CH(2))(3)N in a quantitative manner, which facilitates the GC measurement. The SIM mode was applied in the analysis and showed high accuracy, specificity, and reproducibility, as well as reducing the matrix effect effectively. The calibration curve was obtained from 0.01 microg/mL to 10.0 microg/mL with a satisfactory correlation coefficient of 0.9988. The limit of detection for boric acid was 0.04 microg/L. Then the method was applied for detection of the amount of boric acid in bottled drinking water and the results are in accordance with the reported concentration value of boric acid. This study offers a perspective into the utility of GC-MS as an alternate quantitative tool for detection of B(OH)(3), even for detection of boron in various other samples by digesting the boron compounds to boric acid. Copyright 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

Mycotoxin analysis: an update.

PubMed

Krska, Rudolf; Schubert-Ullrich, Patricia; Molinelli, Alexandra; Sulyok, Michael; MacDonald, Susan; Crews, Colin

2008-02-01

Mycotoxin contamination of cereals and related products used for feed can cause intoxication, especially in farm animals. Therefore, efficient analytical tools for the qualitative and quantitative analysis of toxic fungal metabolites in feed are required. Current methods usually include an extraction step, a clean-up step to reduce or eliminate unwanted co-extracted matrix components and a separation step with suitably specific detection ability. Quantitative methods of analysis for most mycotoxins use immunoaffinity clean-up with high-performance liquid chromatography (HPLC) separation in combination with UV and/or fluorescence detection. Screening of samples contaminated with mycotoxins is frequently performed by thin layer chromatography (TLC), which yields qualitative or semi-quantitative results. Nowadays, enzyme-linked immunosorbent assays (ELISA) are often used for rapid screening. A number of promising methods, such as fluorescence polarization immunoassays, dipsticks, and even newer methods such as biosensors and non-invasive techniques based on infrared spectroscopy, have shown great potential for mycotoxin analysis. Currently, there is a strong trend towards the use of multi-mycotoxin methods for the simultaneous analysis of several of the important Fusarium mycotoxins, which is best achieved by LC-MS/MS (liquid chromatography with tandem mass spectrometry). This review focuses on recent developments in the determination of mycotoxins with a special emphasis on LC-MS/MS and emerging rapid methods.

Rapid Trace Detection and Isomer Quantitation of Pesticide Residues via Matrix-Assisted Laser Desorption/Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectrometry.

PubMed

Wu, Xinzhou; Li, Weifeng; Guo, Pengran; Zhang, Zhixiang; Xu, Hanhong

2018-04-18

Matrix-assisted laser desorption/ionization Fourier transform ion cyclotron resonance mass spectrometry (MALDI-FTICR-MS) has been applied for rapid, sensitive, undisputed, and quantitative detection of pesticide residues on fresh leaves with little sample pretreatment. Various pesticides (insecticides, bactericides, herbicides, and acaricides) are detected directly in the complex matrix with excellent limits of detection down to 4 μg/L. FTICR-MS could unambiguously identify pesticides with tiny mass differences (∼0.017 75 Da), thereby avoiding false-positive results. Remarkably, pesticide isomers can be totally discriminated by use of diagnostic fragments, and quantitative analysis of pesticide isomers is demonstrated. The present results expand the horizons of the MALDI-FTICR-MS platform in the reliable determination of pesticides, with integrated advantages of ultrahigh mass resolution and accuracy. This method provides growing evidence for the resultant detrimental effects of pesticides, expediting the identification and evaluation of innovative pesticides.

Automated measurement of stent strut coverage in intravascular optical coherence tomography

NASA Astrophysics Data System (ADS)

Ahn, Chi Young; Kim, Byeong-Keuk; Hong, Myeong-Ki; Jang, Yangsoo; Heo, Jung; Joo, Chulmin; Seo, Jin Keun

2015-02-01

Optical coherence tomography (OCT) is a non-invasive, cross-sectional imaging modality that has become a prominent imaging method in percutaneous intracoronary intervention. We present an automated detection algorithm for stent strut coordinates and coverage in OCT images. The algorithm for stent strut detection is composed of a coordinate transformation from the polar to the Cartesian domains and application of second derivative operators in the radial and the circumferential directions. Local region-based active contouring was employed to detect lumen boundaries. We applied the method to the OCT pullback images acquired from human patients in vivo to quantitatively measure stent strut coverage. The validation studies against manual expert assessments demonstrated high Pearson's coefficients ( R = 0.99) in terms of the stent strut coordinates, with no significant bias. An averaged Hausdorff distance of < 120 μm was obtained for vessel border detection. Quantitative comparison in stent strut to vessel wall distance found a bias of < 12.3 μm and a 95% confidence of < 110 μm.

Quantitation of silibinin, a putative cancer chemopreventive agent derived from milk thistle (Silybum marianum), in human plasma by high-performance liquid chromatography and identification of possible metabolites.

PubMed

Hoh, Carmen S L; Boocock, David J; Marczylo, Timothy H; Brown, V A; Cai, Hong; Steward, William P; Berry, David P; Gescher, Andreas J

2007-04-04

Silibinin has recently received attention as a potential cancer chemopreventive agent because of its antiproliferative and anticarcinogenic effects. A simple and specific reversed-phase high-performance liquid chromatography method was developed and validated for the quantitation of silibinin in human plasma. Sample preparation involved simple protein precipitation, and separation was achieved on a Waters Atlantis C18 column with flow rate of 1.0 mL/min at 40 degrees C and UV detection at 290 nm. Silibinin was detected as two peaks corresponding to trans-diastereoisomers. The peak area was linear over the investigated concentration range (0-5000 ng/mL). The limits of detection were 2 and 1 ng/mL for the two diastereoisomers (d1 and d2), with a recovery of 53-58%. This method was utilized to detect silibinin in plasma of colorectal patients after 7 days of treatment with silipide (silibinin formulated with phosphatidyl choline).

NAIMA as a solution for future GMO diagnostics challenges.

PubMed

Dobnik, David; Morisset, Dany; Gruden, Kristina

2010-03-01

In the field of genetically modified organism (GMO) diagnostics, real-time PCR has been the method of choice for target detection and quantification in most laboratories. Despite its numerous advantages, however, the lack of a true multiplexing option may render real-time PCR less practical in the face of future GMO detection challenges such as the multiplicity and increasing complexity of new transgenic events, as well as the repeated occurrence of unauthorized GMOs on the market. In this context, we recently reported the development of a novel multiplex quantitative DNA-based target amplification method, named NASBA implemented microarray analysis (NAIMA), which is suitable for sensitive, specific and quantitative detection of GMOs on a microarray. In this article, the performance of NAIMA is compared with that of real-time PCR, the focus being their performances in view of the upcoming challenge to detect/quantify an increasing number of possible GMOs at a sustainable cost and affordable staff effort. Finally, we present our conclusions concerning the applicability of NAIMA for future use in GMO diagnostics.

A liquid chromatography–tandem mass spectrometric method for quantitative determination of native 5-methyltetrahydrofolate and its polyglutamyl derivatives in raw vegetables

PubMed Central

Wang, Chao; Riedl, Ken M.; Schwartz, Steven J.

2013-01-01

Folate deficiency is a prevalent phenomenon worldwide especially in underprivileged countries. Polyglutamyl 5-methyltetrahydrofolate (5MTHF) species are the naturally occurring principle folate in store-bought vegetables. Here we report a simple and complete extraction method for the determination of native polyglutamyl 5-methyltetrahydrofolate in vegetables using high performance liquid chromatography with tandem mass spectrometric detection (HPLC–MS/MS). Coarsely chopped samples (18 different vegetables) were steamed to inactivate glutamylase enzymes and liberate folate from binding proteins and extracted in a reducing buffer with 13C5 5MTHF stable isotope added as internal standard. The polyglutamyl 5-methyltetrahydrofolate species were separated in 9 min on a C18 column using a reversed phase system. HPLC eluate was interfaced with a triple quadrupole mass spectrometer operated in electrospray positive mode. The respective pseudomolecular cation of each polyglutamyl 5-methyltetrahydrofolate species was selected for fragmentation to a common daughter ion for detection. We quantitated polyglutamyl 5-methyltetrahydrofolate in store-bought vegetables from families Brassicaceae, Asteraceae and Amaranthaceae (including mustard greens, romaine lettuce and Swiss chard) of which most have not been quantitated previously. Most vegetables from Asteraceae and those from Amaranthaceae contained similar amounts of monoglutamyl 5MTHF and polyglutamyl 5MTHF while Brassicaceae were dominated by polyglutamyls and endive species (Asteraceae) contained mainly monoglutamyl 5MTHF. The precision of the method for the various polyglutamyl 5-methyltetrahydrofolate forms was 1–9% RSD, recovery 84–91%, limit of detection 64–658 fmol and limit of quantitation 193–1994 fmol. Herein we describe a rapid, sensitive and selective HPLC–MS/MS technique to quantitate polyglutamyl 5-methyltetrahydrofolate species. This method may be suitable for analyzing the polyglutamyl 5-methyltetrahydrofolate profile of inherent folates in a wide range of leafy green vegetables. PMID:20888309

Apparatus and method for monitoring breath acetone and diabetic diagnostics

DOEpatents

Duan, Yixiang [Los Alamos, NM; Cao, Wenqing [Los Alamos, NM

2008-08-26

An apparatus and method for monitoring diabetes through breath acetone detection and quantitation employs a microplasma source in combination with a spectrometer. The microplasma source provides sufficient energy to produce excited acetone fragments from the breath gas that emit light. The emitted light is sent to the spectrometer, which generates an emission spectrum that is used to detect and quantify acetone in the breath gas.

[Improvement of 2-mercaptoimidazoline analysis in rubber products containing chlorine].

PubMed

Kaneko, Reiko; Haneishi, Nahoko; Kawamura, Yoko

2012-01-01

An improved analysis method for 2-mercaptoimidazoline in rubber products containing chlorine was developed. 2-Mercaptoimidazoline (20 µg/mL) is detected by means of TLC with two developing solvents in the official method. But, this method is not quantitative. Instead, we employed HPLC using water-methanol (9 : 1) as the mobile phase. This procedure decreased interfering peaks, and the quantitation limit was 2 µg/mL of standard solution. 2-Mercaptoimidazoline was confirmed by GC-MS (5 µg/mL) and LC/MS (1 µg/mL) in the scan mode. For preparation of test solution, a soaking extraction method, in which 20 mL of methanol was added to the sample and allowed to stand overnight at about 40°C, was used. This gave similar values to the Soxhlet extraction method (official method) and was more convenient. The results indicate that our procedure is suitable for analysis of 2-mercaptoimidazoline. When 2-mercaptoimidazoline is detected, it is confirmed by either GC/MS or LC/MS.

Simplex and duplex event-specific analytical methods for functional biotech maize.

PubMed

Lee, Seong-Hun; Kim, Su-Jeong; Yi, Bu-Young

2009-08-26

Analytical methods are very important in the control of genetically modified organism (GMO) labeling systems or living modified organism (LMO) management for biotech crops. Event-specific primers and probes were developed for qualitative and quantitative analysis for biotech maize event 3272 and LY 038 on the basis of the 3' flanking regions, respectively. The qualitative primers confirmed the specificity by a single PCR product and sensitivity to 0.05% as a limit of detection (LOD). Simplex and duplex quantitative methods were also developed using TaqMan real-time PCR. One synthetic plasmid was constructed from two taxon-specific DNA sequences of maize and two event-specific 3' flanking DNA sequences of event 3272 and LY 038 as reference molecules. In-house validation of the quantitative methods was performed using six levels of mixing samples, from 0.1 to 10.0%. As a result, the biases from the true value and the relative deviations were all within the range of +/-30%. Limits of quantitation (LOQs) of the quantitative methods were all 0.1% for simplex real-time PCRs of event 3272 and LY 038 and 0.5% for duplex real-time PCR of LY 038. This study reports that event-specific analytical methods were applicable for qualitative and quantitative analysis for biotech maize event 3272 and LY 038.

Method for the concentration and separation of actinides from biological and environmental samples

DOEpatents

Horwitz, E. Philip; Dietz, Mark L.

1989-01-01

A method and apparatus for the quantitative recover of actinide values from biological and environmental sample by passing appropriately prepared samples in a mineral acid solution through a separation column of a dialkyl(phenyl)-N,N-dialylcarbamoylmethylphosphine oxide dissolved in tri-n-butyl phosphate on an inert substrate which selectively extracts the actinide values. The actinide values can be eluted either as a group or individually and their presence quantitatively detected by alpha counting.

xTract: software for characterizing conformational changes of protein complexes by quantitative cross-linking mass spectrometry.

PubMed

Walzthoeni, Thomas; Joachimiak, Lukasz A; Rosenberger, George; Röst, Hannes L; Malmström, Lars; Leitner, Alexander; Frydman, Judith; Aebersold, Ruedi

2015-12-01

Chemical cross-linking in combination with mass spectrometry generates distance restraints of amino acid pairs in close proximity on the surface of native proteins and protein complexes. In this study we used quantitative mass spectrometry and chemical cross-linking to quantify differences in cross-linked peptides obtained from complexes in spatially discrete states. We describe a generic computational pipeline for quantitative cross-linking mass spectrometry consisting of modules for quantitative data extraction and statistical assessment of the obtained results. We used the method to detect conformational changes in two model systems: firefly luciferase and the bovine TRiC complex. Our method discovers and explains the structural heterogeneity of protein complexes using only sparse structural information.

Static headspace gas chromatographic method for quantitative determination of residual solvents in pharmaceutical drug substances according to european pharmacopoeia requirements.

PubMed

Otero, Raquel; Carrera, Guillem; Dulsat, Joan Francesc; Fábregas, José Luís; Claramunt, Juan

2004-11-19

A static headspace (HS) gas chromatographic method for quantitative determination of residual solvents in a drug substance has been developed according to European Pharmacopoeia general procedure. A water-dimethylformamide mixture is proposed as sample solvent to obtain good sensitivity and recovery. The standard addition technique with internal standard quantitation was used for ethanol, tetrahydrofuran and toluene determination. Validation was performed within the requirements of ICH validation guidelines Q2A and Q2B. Selectivity was tested for 36 solvents, and system suitability requirements described in the European Pharmacopoeia were checked. Limits of detection and quantitation, precision, linearity, accuracy, intermediate precision and robustness were determined, and excellent results were obtained.

A Droplet Digital PCR Method for Severe Combined Immunodeficiency Newborn Screening.

PubMed

Vidal-Folch, Noemi; Milosevic, Dragana; Majumdar, Ramanath; Gavrilov, Dimitar; Matern, Dietrich; Raymond, Kimiyo; Rinaldo, Piero; Tortorelli, Silvia; Abraham, Roshini S; Oglesbee, Devin

2017-09-01

Severe combined immunodeficiency (SCID) benefits from early intervention via hematopoietic cell transplantation to reverse T-cell lymphopenia (TCL). Newborn screening (NBS) programs use T-cell receptor excision circle (TREC) levels to detect SCID. Real-time quantitative PCR is often performed to quantify TRECs in dried blood spots (DBSs) for NBS. Yet, real-time quantitative PCR has inefficiencies necessitating normalization, repeat analyses, or standard curves. To address these issues, we developed a multiplex, droplet digital PCR (ddPCR) method for measuring absolute TREC amounts in one DBS punch. TREC and RPP30 levels were simultaneously measured with a Bio-Rad AutoDG and QX200 ddPCR system. DBSs from 610 presumed-normal, 29 lymphocyte-profiled, and 10 clinically diagnosed infants (1 X-linked SCID, 1 RAG1 Omenn syndrome, and other conditions) were tested. Control infants showed 14 to 474 TREC copies/μL blood. SCID infants, and other TCL conditions, had ≤15 TREC copies/μL. The ddPCR lower limit of quantitation was 14 TREC copies/μL, and the limit of detection was 4 TREC copies/μL. Intra-assay and interassay imprecision was <20% CV for DBSs at 54 to 60 TREC copies/μL. Testing 29 infants with known lymphocyte profiles resulted in a sensitivity of 88.9% and a specificity of 100% at TRECs <20 copies/μL. We developed a multiplex ddPCR method for the absolute quantitation of DBS TRECs that can detect SCID and other TCL conditions associated with absent or low TRECs and validated this method for NBS. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

A simplified and accurate detection of the genetically modified wheat MON71800 with one calibrator plasmid.

PubMed

Kim, Jae-Hwan; Park, Saet-Byul; Roh, Hyo-Jeong; Park, Sunghoon; Shin, Min-Ki; Moon, Gui Im; Hong, Jin-Hwan; Kim, Hae-Yeong

2015-06-01

With the increasing number of genetically modified (GM) events, unauthorized GMO releases into the food market have increased dramatically, and many countries have developed detection tools for them. This study described the qualitative and quantitative detection methods of unauthorized the GM wheat MON71800 with a reference plasmid (pGEM-M71800). The wheat acetyl-CoA carboxylase (acc) gene was used as the endogenous gene. The plasmid pGEM-M71800, which contains both the acc gene and the event-specific target MON71800, was constructed as a positive control for the qualitative and quantitative analyses. The limit of detection in the qualitative PCR assay was approximately 10 copies. In the quantitative PCR assay, the standard deviation and relative standard deviation repeatability values ranged from 0.06 to 0.25 and from 0.23% to 1.12%, respectively. This study supplies a powerful and very simple but accurate detection strategy for unauthorized GM wheat MON71800 that utilizes a single calibrator plasmid. Copyright © 2014 Elsevier Ltd. All rights reserved.

Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

PubMed

Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

2013-06-01

A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

Segmentation and detection of fluorescent 3D spots.

PubMed

Ram, Sundaresh; Rodríguez, Jeffrey J; Bosco, Giovanni

2012-03-01

The 3D spatial organization of genes and other genetic elements within the nucleus is important for regulating gene expression. Understanding how this spatial organization is established and maintained throughout the life of a cell is key to elucidating the many layers of gene regulation. Quantitative methods for studying nuclear organization will lead to insights into the molecular mechanisms that maintain gene organization as well as serve as diagnostic tools for pathologies caused by loss of nuclear structure. However, biologists currently lack automated and high throughput methods for quantitative and qualitative global analysis of 3D gene organization. In this study, we use confocal microscopy and fluorescence in-situ hybridization (FISH) as a cytogenetic technique to detect and localize the presence of specific DNA sequences in 3D. FISH uses probes that bind to specific targeted locations on the chromosomes, appearing as fluorescent spots in 3D images obtained using fluorescence microscopy. In this article, we propose an automated algorithm for segmentation and detection of 3D FISH spots. The algorithm is divided into two stages: spot segmentation and spot detection. Spot segmentation consists of 3D anisotropic smoothing to reduce the effect of noise, top-hat filtering, and intensity thresholding, followed by 3D region-growing. Spot detection uses a Bayesian classifier with spot features such as volume, average intensity, texture, and contrast to detect and classify the segmented spots as either true or false spots. Quantitative assessment of the proposed algorithm demonstrates improved segmentation and detection accuracy compared to other techniques. Copyright © 2012 International Society for Advancement of Cytometry.

Analysis of processing contaminants in edible oils. Part 2. Liquid chromatography-tandem mass spectrometry method for the direct detection of 3-monochloropropanediol and 2-monochloropropanediol diesters.

PubMed

MacMahon, Shaun; Begley, Timothy H; Diachenko, Gregory W

2013-05-22

A method was developed and validated for the detection of fatty acid diesters of 2-monochloropropanediol (2-MCPD) and 3-monochloropropanediol (3-MCPD) in edible oils. These analytes are potentially carcinogenic chemical contaminants formed during edible oil processing. After separation from oil matrices using a two-step solid-phase extraction (SPE) procedure, the target compounds are quantitated using liquid chromatography-tandem mass spectrometry (LC-MS/MS) with electrospray ionization (ESI). The first chromatographic conditions have been developed that separate intact diesters of 2-MCPD and 3-MCPD, allowing for their individual quantitation. The method has been validated for 28 3-MCPD diesters of lauric, myristic, palmitic, linolenic, linoleic, oleic, and stearic acids in coconut, olive, and palm oils, as well as 3 2-MCPD diesters, using an external calibration curve. The range of average recoveries and relative standard deviations (RSDs) across the three oil matrices at three spiking concentrations are 88-118% (2-16% RSD) with maximum limits of quantitation of 30 ng/g (ppb).

Quantitative Urine Culture Method Using a Plastic „Paddle” Containing Dual Media

PubMed Central

Craig, William A.; Kunin, Calvin M.

1972-01-01

A new dip-inoculum method for quantitative urine culture is described which utilizes a dual-chambered plastic „paddle” housing both a general purpose and differential medium. Comparative bacterial counts of 1,000 clinical specimens using the pour plate and this device were identical in 82.9% and within a factor of five in 95.6%. The „paddle” detected all but 19 of 258 specimens (92.6%) with 100,000 or greater colonies per ml. This simple, convenient method should allow more extensive use of quantitative urine culture in the diagnosis and follow-up of patients with urinary tract infections in office practice. It should not be considered as a substitute for the more definitive pour plate method or for standard methods for characterization of bacteriological species when more exact information is required. PMID:4555636

An effective method for the quantitative detection of porcine endogenous retrovirus in pig tissues.

PubMed

Zhang, Peng; Yu, Ping; Wang, Wei; Zhang, Li; Li, Shengfu; Bu, Hong

2010-05-01

Xenotransplantation shows great promise for providing a virtually limitless supply of cells, tissues, and organs for a variety of therapeutical procedures. However, the potential of porcine endogenous retrovirus (PERV) as a human-tropic pathogen, particularly as a public health risk, is a major concern for xenotransplantation. This study focus on the detection of copy number in various tissues and organs in Banna Minipig Inbreed (BMI) from 2006 to 2007 in West China Hospital, Sichuan University. Real-time quantitative polymerase chain reaction (SYBR Green I) was performed in this study. The results showed that the pol gene had the most copy number in tissues compared with gag, envA, and envB. Our experiment will offer a rapid and accurate method for the detection of the copy number in various tissues and was especially suitable for the selection of tissues or organs in future clinical xenotransplantation.

Effect of saliva stabilisers on detection of porcine reproductive and respiratory syndrome virus in oral fluid by quantitative reverse transcriptase real-time PCR.

PubMed

Decorte, Inge; Van der Stede, Yves; Nauwynck, Hans; De Regge, Nick; Cay, Ann Brigitte

2013-08-01

This study evaluated the effect of extraction-amplification methods, storage temperature and saliva stabilisers on detection of porcine reproductive and respiratory syndrome virus (PRRSV) RNA by quantitative reverse transcriptase real-time PCR (qRT-PCR) in porcine oral fluid. The diagnostic performance of different extraction-amplification methods was examined using a dilution series of oral fluid spiked with PRRSV. To determine RNA stability, porcine oral fluid, with or without commercially available saliva stabilisers, was spiked with PRRSV, stored at 4°C or room temperature and tested for the presence of PRRSV RNA by qRT-PCR. PRRSV RNA could be detected in oral fluid using all extraction-amplification combinations, but the limit of detection varied amongst different combinations. Storage temperature and saliva stabilisers had an effect on the stability of PRRSV RNA, which could only be detected for 7 days when PRRSV spiked oral fluid was kept at 4°C or stabilised at room temperature with a commercial mRNA stabiliser. Copyright © 2013 Elsevier Ltd. All rights reserved.

Gold Nanoparticle-Based Facile Detection of Human Serum Albumin and Its Application as an INHIBIT Logic Gate.

PubMed

Huang, Zhenzhen; Wang, Haonan; Yang, Wensheng

2015-05-06

In this work, a facile colorimetric method is developed for quantitative detection of human serum albumin (HSA) based on the antiaggregation effect of gold nanoparticles (Au NPs) in the presence of HSA. The citrate-capped Au NPs undergo a color change from red to blue when melamine is added as a cross-linker to induce the aggregation of the NPs. Such an aggregation is efficiently suppressed upon the adsorption of HSA on the particle surface. This method provides the advantages of simplicity and cost-efficiency for quantitative detection of HSA with a detection limit of ∼1.4 nM by monitoring the colorimetric changes of the Au NPs with UV-vis spectroscopy. In addition, this approach shows good selectivity for HSA over various amino acids, peptides, and proteins and is qualified for detection of HSA in a biological sample. Such an antiaggregation effect can be further extended to fabricate an INHIBIT logic gate by using HSA and melamine as inputs and the color changes of Au NPs as outputs, which may have application potentials in point-of-care medical diagnosis.

Validation of quantitative light-induced fluorescence-digital (QLF-D) for the detection of approximal caries in vitro.

PubMed

Ko, Hae-Youn; Kang, Si-Mook; Kim, Hee Eun; Kwon, Ho-Keun; Kim, Baek-Il

2015-05-01

Detection of approximal caries lesions can be difficult due to their anatomical position. This study aimed to assess the ability of the quantitative light-induced fluorescence-digital (QLF-D) in detecting approximal caries, and to compare the performance with those of the International Caries Detection and Assessment System II (ICDAS II) and digital radiography (DR). Extracted permanent teeth (n=100) were selected and mounted in pairs. The simulation pairs were assessed by one calibrated dentist using each detection method. After all the examinations, the teeth (n=95) were sectioned and examined histologically as gold standard. The modalities were compared in terms of sensitivity, specificity, areas under receiver operating characteristic curves (AUROC) for enamel (D1) and dentine (D3) levels. The intra-examiner reliability was assessed for all modalities. At D1 threshold, the ICDAS II presented the highest sensitivity (0.80) while the DR showed the highest specificity (0.89); however, the methods with the greatest AUC values at D1 threshold were DR and QLF-D (0.80 and 0.80 respectively). At D3 threshold, the methods with the highest sensitivity were ICDAS II and QLF-D (0.64 and 0.64 respectively) while the method with the lowest sensitivity was DR (0.50). However, with regard to the AUC values at D3 threshold, the QLF-D presented the highest value (0.76). All modalities showed to have excellent intra-examiner reliability. The newly developed QLF-D was not only able to detect proximal caries, but also showed to have comparable performance to the visual inspection and radiography in detecting proximal caries. QLF-D has the potential to be a useful detection method for proximal caries. Copyright © 2015 Elsevier Ltd. All rights reserved.

Qualitative and quantitative determination of yohimbine in authentic yohimbe bark and in commercial aphrodisiacs by HPLC-UV-API/ MS methods.

PubMed

Zanolari, Boris; Ndjoko, Karine; Ioset, Jean-Robert; Marston, Andrew; Hostettmann, Kurt

2003-01-01

The development and validation of a rapid qualitative and quantitative method based on an HPLC-UV-MS technique with atmospheric pressure chemical ionisation and electrospray ionisation for the analysis of yohimbine in a number of commercial aphrodisiac products is reported. HPLC with multiple-stage mass spectrometry experiments allowed the identification of the target compound and increased the selectivity of complex analyses such as those involved with multi-botanical preparations. The precision and the robustness of the method were improved by the use of two internal standards: codeine for UV detection and deuterium-labelled yohimbine for MS detection. Twenty commercial aphrodisiac preparations were analysed and the amount of yohimbine measured and expressed as the maximal dose per day suggested on product labels ranged from 1.32 to 23.16 mg.

Meat Authentication via Multiple Reaction Monitoring Mass Spectrometry of Myoglobin Peptides.

PubMed

Watson, Andrew D; Gunning, Yvonne; Rigby, Neil M; Philo, Mark; Kemsley, E Kate

2015-10-20

A rapid multiple reaction monitoring (MRM) mass spectrometric method for the detection and relative quantitation of the adulteration of meat with that of an undeclared species is presented. Our approach uses corresponding proteins from the different species under investigation and corresponding peptides from those proteins, or CPCP. Selected peptide markers can be used for species detection. The use of ratios of MRM transition peak areas for corresponding peptides is proposed for relative quantitation. The approach is introduced by use of myoglobin from four meats: beef, pork, horse and lamb. Focusing in the present work on species identification, by use of predictive tools, we determine peptide markers that allow the identification of all four meats and detection of one meat added to another at levels of 1% (w/w). Candidate corresponding peptide pairs to be used for the relative quantification of one meat added to another have been observed. Preliminary quantitation data presented here are encouraging.

Quantitation of zolpidem in biological fluids by electro-driven microextraction combined with HPLC-UV analysis.

PubMed

Yaripour, Saeid; Mohammadi, Ali; Esfanjani, Isa; Walker, Roderick B; Nojavan, Saeed

2018-01-01

In this study, for the first time, an electro-driven microextraction method named electromembrane extraction combined with a simple high performance liquid chromatography and ultraviolet detection was developed and validated for the quantitation of zolpidem in biological samples. Parameters influencing electromembrane extraction were evaluated and optimized. The membrane consisted of 2-ethylhexanol immobilized in the pores of a hollow fiber. As a driving force, a 150 V electric field was applied to facilitate the analyte migration from the sample matrix to an acceptor solution through a supported liquid membrane. The pHs of donor and acceptor solutions were optimized to 6.0 and 2.0, respectively. The enrichment factor was obtained >75 within 15 minutes. The effect of carbon nanotubes (as solid nano-sorbents) on the membrane performance and EME efficiency was evaluated. The method was linear over the range of 10-1000 ng/mL for zolpidem (R 2 >0.9991) with repeatability ( %RSD) between 0.3 % and 7.3 % ( n = 3). The limits of detection and quantitation were 3 and 10 ng/mL, respectively. The sensitivity of HPLC-UV for the determination of zolpidem was enhanced by electromembrane extraction. Finally, the method was employed for the quantitation of zolpidem in biological samples with relative recoveries in the range of 60-79 %.

Quantitation of zolpidem in biological fluids by electro-driven microextraction combined with HPLC-UV analysis

PubMed Central

Yaripour, Saeid; Mohammadi, Ali; Esfanjani, Isa; Walker, Roderick B.; Nojavan, Saeed

2018-01-01

In this study, for the first time, an electro-driven microextraction method named electromembrane extraction combined with a simple high performance liquid chromatography and ultraviolet detection was developed and validated for the quantitation of zolpidem in biological samples. Parameters influencing electromembrane extraction were evaluated and optimized. The membrane consisted of 2-ethylhexanol immobilized in the pores of a hollow fiber. As a driving force, a 150 V electric field was applied to facilitate the analyte migration from the sample matrix to an acceptor solution through a supported liquid membrane. The pHs of donor and acceptor solutions were optimized to 6.0 and 2.0, respectively. The enrichment factor was obtained >75 within 15 minutes. The effect of carbon nanotubes (as solid nano-sorbents) on the membrane performance and EME efficiency was evaluated. The method was linear over the range of 10-1000 ng/mL for zolpidem (R2 >0.9991) with repeatability ( %RSD) between 0.3 % and 7.3 % (n = 3). The limits of detection and quantitation were 3 and 10 ng/mL, respectively. The sensitivity of HPLC-UV for the determination of zolpidem was enhanced by electromembrane extraction. Finally, the method was employed for the quantitation of zolpidem in biological samples with relative recoveries in the range of 60-79 %. PMID:29805344

Competitor internal standards for quantitative detection of mycoplasma DNA.

PubMed

Sidhu, M K; Rashidbaigi, A; Testa, D; Liao, M J

1995-05-01

Homologous internal controls were used as competitor DNA in the polymerase chain reaction for the quantitative detection of mycoplasma DNA. PCR primer sets were designed on the basis of the most conserved nucleotide sequences of the 16S rRNA gene of mycoplasma species. Amplification of this gene was examined in five different mycoplasma species: Mycoplasma orale, M. hyorhinus, M. synoviae, M. gallisepticum and M. pneumoniae. To evaluate the primers, a number of different cell lines were assayed for the detection of mycoplasma infections. All positive cell lines showed a distinct product on agarose gels while uninfected cells showed no DNA amplification. Neither bacterial nor eukaryotic DNA produced any cross-reaction with the primers used, thus confirming their specificity. Internal control DNA to be used for quantitation was constructed by modifying the sizes of the wild-type amplified products and cloning them in plasmid vectors. These controls used the same primer binding sites as the wild-type and the amplified products were differentiated by a size difference. The detection limits for all the mycoplasma species by competitive quantitative PCR were estimated to range from 4 to 60 genome copies per assay as determined by ethidium bromide-stained agarose gels. These internal standards also serve as positive controls in PCR-based detection of mycoplasma DNA, and therefore accidental contamination of test samples with wild-type positive controls can be eliminated. The quantitative PCR method developed will be useful in monitoring the progression and significance of mycoplasma in the disease process.

Evaluation of Various Campylobacter-Specific Quantitative PCR (qPCR) Assays for Detection and Enumeration of Campylobacteraceae in Irrigation Water and Wastewater via a Miniaturized Most-Probable-Number–qPCR Assay

PubMed Central

Banting, Graham S.; Braithwaite, Shannon; Scott, Candis; Kim, Jinyong; Jeon, Byeonghwa; Ashbolt, Nicholas; Ruecker, Norma; Tymensen, Lisa; Charest, Jollin; Pintar, Katarina; Checkley, Sylvia

2016-01-01

ABSTRACT Campylobacter spp. are the leading cause of bacterial gastroenteritis worldwide, and water is increasingly seen as a risk factor in transmission. Here we describe a most-probable-number (MPN)–quantitative PCR (qPCR) assay in which water samples are centrifuged and aliquoted into microtiter plates and the bacteria are enumerated by qPCR. We observed that commonly used Campylobacter molecular assays produced vastly different detection rates. In irrigation water samples, detection rates varied depending upon the PCR assay and culture method used, as follows: 0% by the de Boer Lv1-16S qPCR assay, 2.5% by the Van Dyke 16S and Jensen glyA qPCR assays, and 75% by the Linton 16S endpoint PCR when cultured at 37°C. Primer/probe specificity was the major confounder, with Arcobacter spp. routinely yielding false-positive results. The primers and PCR conditions described by Van Dyke et al. (M. I. Van Dyke, V. K. Morton, N. L. McLellan, and P. M. Huck, J Appl Microbiol 109:1053–1066, 2010, http://dx.doi.org/10.1111/j.1365-2672.2010.04730.x) proved to be the most sensitive and specific for Campylobacter detection in water. Campylobacter occurrence in irrigation water was found to be very low (<2 MPN/300 ml) when this Campylobacter-specific qPCR was used, with the most commonly detected species being C. jejuni, C. coli, and C. lari. Campylobacters in raw sewage were present at ∼102/100 ml, with incubation at 42°C required for reducing microbial growth competition from arcobacters. Overall, when Campylobacter prevalence and/or concentration in water is reported using molecular methods, considerable validation is recommended when adapting methods largely developed for clinical applications. Furthermore, combining MPN methods with molecular biology-based detection algorithms allows for the detection and quantification of Campylobacter spp. in environmental samples and is potentially suited to quantitative microbial risk assessment for improved public health disease prevention related to food and water exposures. IMPORTANCE The results of this study demonstrate the importance of assay validation upon data interpretation of environmental monitoring for Campylobacter when using molecular biology-based assays. Previous studies describing Campylobacter prevalence in Canada utilized primers that we have determined to be nonspecific due to their cross-amplification of Arcobacter spp. As such, Campylobacter prevalence may have been vastly overestimated in other studies. Additionally, the development of a quantitative assay described in this study will allow accurate determination of Campylobacter concentrations in environmental water samples, allowing more informed decisions to be made about water usage based on quantitative microbial risk assessment. PMID:27235434

Correlated ion and neutral time of flight technique combined with velocity map imaging: Quantitative measurements for dissociation processes in excited molecular nano-systems

NASA Astrophysics Data System (ADS)

Berthias, F.; Feketeová, L.; Della Negra, R.; Dupasquier, T.; Fillol, R.; Abdoul-Carime, H.; Farizon, B.; Farizon, M.; Märk, T. D.

2018-01-01

The combination of the Dispositif d'Irradiation d'Agrégats Moléculaire with the correlated ion and neutral time of flight-velocity map imaging technique provides a new way to explore processes occurring subsequent to the excitation of charged nano-systems. The present contribution describes in detail the methods developed for the quantitative measurement of branching ratios and cross sections for collision-induced dissociation processes of water cluster nano-systems. These methods are based on measurements of the detection efficiency of neutral fragments produced in these dissociation reactions. Moreover, measured detection efficiencies are used here to extract the number of neutral fragments produced for a given charged fragment.

Quantitative determination of a chemically modified hammerhead ribozyme in blood plasma using 96-well solid-phase extraction coupled with high-performance liquid chromatography or capillary gel electrophoresis.

PubMed

Bellon, L; Maloney, L; Zinnen, S P; Sandberg, J A; Johnson, K E

2000-08-01

Versatile bioanalytical assays to detect chemically stabilized hammerhead ribozyme and putative ribozyme metabolites from plasma are described. The extraction protocols presented are based on serial solid-phase extractions performed on a 96-well plate format and are compatible with either IEX-HPLC or CGE back-end analysis. A validation of both assays confirmed that both the HPLC and the CGE methods possess the required linearity, accuracy, and precision to accurately measure concentrations of hammerhead ribozyme extracted from plasma. These methods should be of general use to detect and quantitate ribozymes from other biological fluids such as serum and urine. Copyright 2000 Academic Press.

Detection and quantification limits of the EPA Enterococcus qPCR method

EPA Science Inventory

The U.S. EPA will be recommending a quantitative polymerase chain reaction (qPCR) method targeting Enterococcus spp. as an option for monitoring recreational beach water quality in 2013 and has published preliminary proposed water quality criteria guidelines for the method. An im...

Sensitive and quantitative detection of botulinum neurotoxin in neurons derived from mouse embryonic stem cells.

PubMed

Pellett, Sabine; Du, Zhong-wei; Pier, Christina L; Tepp, William H; Zhang, Su-chun; Johnson, Eric A

2011-01-07

Botulinum neurotoxins (BoNTs), the most poisonous protein toxins known, represent a serious bioterrorism threat but are also used as a unique and important bio-pharmaceutical to treat an increasing myriad of neurological disorders. The only currently accepted detection method by the United States Food and Drug Administration for biological activity of BoNTs and for potency determination of pharmaceutical preparations is the mouse bioassay (MBA). Recent advances have indicated that cell-based assays using primary neuronal cells can provide an equally sensitive and robust detection platform as the MBA to reliably and quantitatively detect biologically active BoNTs. This study reports for the first time a BoNT detection assay using mouse embryonic stem cells to produce a neuronal cell culture. The data presented indicate that this assay can reliably detect BoNT/A with a similar sensitivity as the MBA. Published by Elsevier Inc.

Location precision analysis of stereo thermal anti-sniper detection system

NASA Astrophysics Data System (ADS)

He, Yuqing; Lu, Ya; Zhang, Xiaoyan; Jin, Weiqi

2012-06-01

Anti-sniper detection devices are the urgent requirement in modern warfare. The precision of the anti-sniper detection system is especially important. This paper discusses the location precision analysis of the anti-sniper detection system based on the dual-thermal imaging system. It mainly discusses the following two aspects which produce the error: the digital quantitative effects of the camera; effect of estimating the coordinate of bullet trajectory according to the infrared images in the process of image matching. The formula of the error analysis is deduced according to the method of stereovision model and digital quantitative effects of the camera. From this, we can get the relationship of the detecting accuracy corresponding to the system's parameters. The analysis in this paper provides the theory basis for the error compensation algorithms which are put forward to improve the accuracy of 3D reconstruction of the bullet trajectory in the anti-sniper detection devices.

A SVM-based quantitative fMRI method for resting-state functional network detection.

PubMed

Song, Xiaomu; Chen, Nan-kuei

2014-09-01

Resting-state functional magnetic resonance imaging (fMRI) aims to measure baseline neuronal connectivity independent of specific functional tasks and to capture changes in the connectivity due to neurological diseases. Most existing network detection methods rely on a fixed threshold to identify functionally connected voxels under the resting state. Due to fMRI non-stationarity, the threshold cannot adapt to variation of data characteristics across sessions and subjects, and generates unreliable mapping results. In this study, a new method is presented for resting-state fMRI data analysis. Specifically, the resting-state network mapping is formulated as an outlier detection process that is implemented using one-class support vector machine (SVM). The results are refined by using a spatial-feature domain prototype selection method and two-class SVM reclassification. The final decision on each voxel is made by comparing its probabilities of functionally connected and unconnected instead of a threshold. Multiple features for resting-state analysis were extracted and examined using an SVM-based feature selection method, and the most representative features were identified. The proposed method was evaluated using synthetic and experimental fMRI data. A comparison study was also performed with independent component analysis (ICA) and correlation analysis. The experimental results show that the proposed method can provide comparable or better network detection performance than ICA and correlation analysis. The method is potentially applicable to various resting-state quantitative fMRI studies. Copyright © 2014 Elsevier Inc. All rights reserved.

Improved method and apparatus for chromatographic quantitative analysis

DOEpatents

Fritz, J.S.; Gjerde, D.T.; Schmuckler, G.

An improved apparatus and method are described for the quantitative analysis of a solution containing a plurality of anion species by ion exchange chromatography which utilizes a single element and a single ion exchange bed which does not require periodic regeneration. The solution containing the anions is added to an anion exchange resin bed which is a low capacity macroreticular polystyrene-divinylbenzene resin containing quarternary ammonium functional groups, and is eluted therefrom with a dilute solution of a low electrical conductance organic acid salt. As each anion species is eluted from the bed, it is quantitatively sensed by conventional detection means such as a conductivity cell.

Impact of terminal cleaning and disinfection on isolation of Acinetobacter baumannii complex from inanimate surfaces of hospital rooms by quantitative and qualitative methods.

PubMed

Manian, Farrin A; Griesnauer, Sandra; Senkel, Diane

2013-04-01

Quantitative broth cultures were obtained from hospital rooms newly vacated by patients positive for multidrug-resistant Acinetobacter baumannii complex (ABC) before and after terminal cleaning and disinfection. Of 10 ABC-positive precleaned room surfaces, 6 (60%) remained culture-positive after terminal cleaning and disinfection. Of a total of 16 room surfaces with detectable ABC by the quantitative method, 5 (31.2%; 95% confidence interval, 13.9%-55.8%) were also culture-positive by the qualitative technique. Copyright © 2013 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

Synthetic internal control sequences to increase negative call veracity in multiplexed, quantitative PCR assays for Phakopsora pachyrhizi

USDA-ARS?s Scientific Manuscript database

Quantitative PCR (Q-PCR) utilizing specific primer sequences and a fluorogenic, 5’-exonuclease linear hydrolysis probe is well established as a detection and identification method for Phakopsora pachyrhizi, the soybean rust pathogen. Because of the extreme sensitivity of Q-PCR, the DNA of a single u...

Interdisciplinary Program for Quantitative Flaw Definition.

DTIC Science & Technology

1978-01-01

Ceramics .................... 284 UNIT C, TASK 4 - Microfocus X-Ray and Image Enhance- ment of Radiographic Data ....................... 292 UNIT C, TASK 5...Conventional Ultrasonic Inspection Methods Applied to Ceramics ..................... 294 iii 7! SC595.32SA OVERVIEW PROJECT I - QUANTITATIVE...parameters. Unit C was initiated in October of 1977 following encouraging nondestructive defect detectability studies in structural ceramics , using

Homogeneous Immunoassays: Historical Perspective and Future Promise

NASA Astrophysics Data System (ADS)

Ullman, Edwin F.

1999-06-01

The founding and growth of Syva Company is examined in the context of its leadership role in the development of homogeneous immunoassays. The simple mix and read protocols of these methods offer advantages in routine analytical and clinical applications. Early homogeneous methods were based on insensitive detection of immunoprecipitation during antigen/antibody binding. The advent of reporter groups in biology provided a means of quantitating immunochemical binding by labeling antibody or antigen and physically separating label incorporated into immune complexes from free label. Although high sensitivity was achieved, quantitative separations were experimentally demanding. Only when it became apparent that reporter groups could provide information, not only about the location of a molecule but also about its microscopic environment, was it possible to design practical non-separation methods. The evolution of early homogenous immunoassays was driven largely by the development of improved detection strategies. The first commercial spin immunoassays, developed by Syva for drug abuse testing during the Vietnam war, were followed by increasingly powerful methods such as immunochemical modulation of enzyme activity, fluorescence, and photo-induced chemiluminescence. Homogeneous methods that quantify analytes at femtomolar concentrations within a few minutes now offer important new opportunities in clinical diagnostics, nucleic acid detection and drug discovery.

Infrared vibrational spectroscopy: a rapid and novel diagnostic and monitoring tool for cystinuria

PubMed Central

Oliver, Katherine V.; Vilasi, Annalisa; Maréchal, Amandine; Moochhala, Shabbir H.; Unwin, Robert J.; Rich, Peter R.

2016-01-01

Cystinuria is the commonest inherited cause of nephrolithiasis (~1% in adults; ~6% in children) and is the result of impaired cystine reabsorption in the renal proximal tubule. Cystine is poorly soluble in urine with a solubility of ~1 mM and can readily form microcrystals that lead to cystine stone formation, especially at low urine pH. Diagnosis of cystinuria is made typically by ion-exchange chromatography (IEC) detection and quantitation, which is slow, laboursome and costly. More rapid and frequent monitoring of urinary cystine concentration would significantly improve the diagnosis and clinical management of cystinuria. We used attenuated total reflection - Fourier transform infrared spectroscopy (ATR-FTIR) to detect and quantitate insoluble cystine in 22 cystinuric and 5 healthy control urine samples. Creatinine concentration was also determined by ATR-FTIR to adjust for urinary concentration/dilution. Urine was centrifuged, the insoluble fraction re-suspended in 5 μL water and dried on the ATR prism. Cystine was quantitated using its 1296 cm−1 absorption band and levels matched with parallel measurements made using IEC. ATR-FTIR afforded a rapid and inexpensive method of detecting and quantitating insoluble urinary cystine. This proof-of-concept study provides a basis for developing a high-throughput, cost-effective diagnostic method for cystinuria, and for point-of-care clinical monitoring PMID:27721432

Analytical Characterization of an Oil-in-Water Adjuvant Emulsion.

PubMed

Sun, Jenny; Remmele, Richard L; Sanyal, Gautam

2017-07-01

Adjuvants are typically used in subunit vaccine formulations to enhance immune responses elicited by individual antigens. Physical chemical characterization of novel adjuvants is an important step in ensuring their effective use in vaccine formulations. This paper reports application of a panel of quantitative assays developed to analyze and characterize an oil-in-water adjuvant emulsion, which contains glucopyranosyl lipid A (GLA) and is a squalene-based emulsion. GLA is a fully synthetic analogue of monophosphoryl lipid A, which is a Toll-like receptor type 4 agonist and an FDA-approved adjuvant. The GLA-stable emulsion (GLA-SE) is currently being used for a respiratory syncytial virus vaccine in a phase 2 clinical trial. GLA was quantitated using reverse-phased high-performance liquid chromatography (RP-HPLC) coupled to a mass spectrometric detector, achieving higher assay sensitivity than the charged aerosol detection routinely used. Quantitation of the excipients of GLA-SE, including squalene, egg phosphatidyl choline, and Poloxamer 188, was achieved using a simple and rapid RP-HPLC method with evaporative light scattering detection, eliminating chemical derivatization typically required for these chromophore-lacking compounds. DL-α-tocopherol, the antioxidant of the GLA-SE, was quantitated using a RP-HPLC method with conventional UV detection. The experimental results compared well with values expected for these compounds based on targeted composition of the adjuvant. The assays were applied to identify degradation of individual components in a GLA-SE sample that degraded into distinct aqueous and oil phases. The methods developed and reported here are effective tools in monitoring physicochemical integrity of the adjuvant, as well as in formulation studies.

Accurate Quantitation and Analysis of Nitrofuran Metabolites, Chloramphenicol, and Florfenicol in Seafood by Ultrahigh-Performance Liquid Chromatography-Tandem Mass Spectrometry: Method Validation and Regulatory Samples.

PubMed

Aldeek, Fadi; Hsieh, Kevin C; Ugochukwu, Obiadada N; Gerard, Ghislain; Hammack, Walter

2018-05-23

We developed and validated a method for the extraction, identification, and quantitation of four nitrofuran metabolites, 3-amino-2-oxazolidinone (AOZ), 3-amino-5-morpholinomethyl-2-oxazolidinone (AMOZ), semicarbazide (SC), and 1-aminohydantoin (AHD), as well as chloramphenicol and florfenicol in a variety of seafood commodities. Samples were extracted by liquid-liquid extraction techniques, analyzed by ultrahigh-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS), and quantitated using commercially sourced, derivatized nitrofuran metabolites, with their isotopically labeled internal standards in-solvent. We obtained recoveries of 90-100% at various fortification levels. The limit of detection (LOD) was set at 0.25 ng/g for AMOZ and AOZ, 1 ng/g for AHD and SC, and 0.1 ng/g for the phenicols. Various extraction methods, standard stability, derivatization efficiency, and improvements to conventional quantitation techniques were also investigated. We successfully applied this method to the identification and quantitation of nitrofuran metabolites and phenicols in 102 imported seafood products. Our results revealed that four of the samples contained residues from banned veterinary drugs.

Quantitative determination of methamphetamine in oral fluid by liquid-liquid extraction and gas chromatography/mass spectrometry.

PubMed

Bahmanabadi, L; Akhgari, M; Jokar, F; Sadeghi, H B

2017-02-01

Methamphetamine abuse is one of the most medical and social problems many countries face. In spite of the ban on the use of methamphetamine, it is widely available in Iran's drug black market. There are many analytical methods for the detection of methamphetamine in biological specimen. Oral fluid has become a popular specimen to test for the presence of methamphetamine. The purpose of the present study was to develop a method for the extraction and detection of methamphetamine in oral fluid samples using liquid-liquid extraction (LLE) and gas chromatography/mass spectrometry (GC/MS) methods. An analytical study was designed in that blank and 50 authentic oral fluid samples were collected to be first extracted by LLE and subsequently analysed by GC/MS. The method was fully validated and showed an excellent intra- and inter-assay precision (reflex sympathetic dystrophy ˂ 10%) for external quality control samples. Recovery with LLE methods was 96%. Limit of detection and limit of quantitation were 5 and 15 ng/mL, respectively. The method showed high selectivity, no additional peak due to interfering substances in samples was observed. The introduced method was sensitive, accurate and precise enough for the extraction of methamphetamine from oral fluid samples in forensic toxicology laboratories.

[The use of the deuterated internal standard for morphine quantitation for the purpose of doping control by gas chromatography with mass-selective detection].

PubMed

Savel'eva, N B; Bykovskaia, N Iu; Dikunets, M A; Bolotov, S L; Rodchenkov, G M

2010-01-01

The objective of this study was to demonstrate the possibility to use deuterated compounds as internal standards for the quantitative analysis of morphine by gas chromatography with mass-selective detection for the purpose of doping control. The paper is focused on the problems associated with the use of deuterated morphine-D3 as the internal standard. Quantitative characteristics of the calibration dependence thus documented are presented along with uncertainty values obtained in the measurements with the use of deuterated morphine-D6. An approach to the assessment of method bias associated with the application of morphine-D6 as the deuterated internal standard is described.

Accounting for imperfect detection in ecology: a quantitative review.

PubMed

Kellner, Kenneth F; Swihart, Robert K

2014-01-01

Detection in studies of species abundance and distribution is often imperfect. Assuming perfect detection introduces bias into estimation that can weaken inference upon which understanding and policy are based. Despite availability of numerous methods designed to address this assumption, many refereed papers in ecology fail to account for non-detection error. We conducted a quantitative literature review of 537 ecological articles to measure the degree to which studies of different taxa, at various scales, and over time have accounted for imperfect detection. Overall, just 23% of articles accounted for imperfect detection. The probability that an article incorporated imperfect detection increased with time and varied among taxa studied; studies of vertebrates were more likely to incorporate imperfect detection. Among articles that reported detection probability, 70% contained per-survey estimates of detection that were less than 0.5. For articles in which constancy of detection was tested, 86% reported significant variation. We hope that our findings prompt more ecologists to consider carefully the detection process when designing studies and analyzing results, especially for sub-disciplines where incorporation of imperfect detection in study design and analysis so far has been lacking.

A two-factor error model for quantitative steganalysis

NASA Astrophysics Data System (ADS)

Böhme, Rainer; Ker, Andrew D.

2006-02-01

Quantitative steganalysis refers to the exercise not only of detecting the presence of hidden stego messages in carrier objects, but also of estimating the secret message length. This problem is well studied, with many detectors proposed but only a sparse analysis of errors in the estimators. A deep understanding of the error model, however, is a fundamental requirement for the assessment and comparison of different detection methods. This paper presents a rationale for a two-factor model for sources of error in quantitative steganalysis, and shows evidence from a dedicated large-scale nested experimental set-up with a total of more than 200 million attacks. Apart from general findings about the distribution functions found in both classes of errors, their respective weight is determined, and implications for statistical hypothesis tests in benchmarking scenarios or regression analyses are demonstrated. The results are based on a rigorous comparison of five different detection methods under many different external conditions, such as size of the carrier, previous JPEG compression, and colour channel selection. We include analyses demonstrating the effects of local variance and cover saturation on the different sources of error, as well as presenting the case for a relative bias model for between-image error.

Magnetoresistive biosensors for quantitative proteomics

NASA Astrophysics Data System (ADS)

Zhou, Xiahan; Huang, Chih-Cheng; Hall, Drew A.

2017-08-01

Quantitative proteomics, as a developing method for study of proteins and identification of diseases, reveals more comprehensive and accurate information of an organism than traditional genomics. A variety of platforms, such as mass spectrometry, optical sensors, electrochemical sensors, magnetic sensors, etc., have been developed for detecting proteins quantitatively. The sandwich immunoassay is widely used as a labeled detection method due to its high specificity and flexibility allowing multiple different types of labels. While optical sensors use enzyme and fluorophore labels to detect proteins with high sensitivity, they often suffer from high background signal and challenges in miniaturization. Magnetic biosensors, including nuclear magnetic resonance sensors, oscillator-based sensors, Hall-effect sensors, and magnetoresistive sensors, use the specific binding events between magnetic nanoparticles (MNPs) and target proteins to measure the analyte concentration. Compared with other biosensing techniques, magnetic sensors take advantage of the intrinsic lack of magnetic signatures in biological samples to achieve high sensitivity and high specificity, and are compatible with semiconductor-based fabrication process to have low-cost and small-size for point-of-care (POC) applications. Although still in the development stage, magnetic biosensing is a promising technique for in-home testing and portable disease monitoring.

Development of a colloidal gold immunochromatographic strip assay for simple and fast detection of human α-lactalbumin in genetically modified cow milk.

PubMed

Tao, Chenyu; Zhang, Qingde; Feng, Na; Shi, Deshi; Liu, Bang

2016-03-01

The qualitative and quantitative declaration of food ingredients is important to consumers, especially for genetically modified food as it experiences a rapid increase in sales. In this study, we designed an accurate and rapid detection system using colloidal gold immunochromatographic strip assay (GICA) methods to detect genetically modified cow milk. First, we prepared 2 monoclonal antibodies for human α-lactalbumin (α-LA) and measured their antibody titers; the one with the higher titer was used for further experiments. Then, we found the optimal pH value and protein amount of GICA for detection of pure milk samples. The developed strips successfully detected genetically modified cow milk and non-modified cow milk. To determine the sensitivity of GICA, a quantitative ELISA system was used to determine the exact amount of α-LA, and then genetically modified milk was diluted at different rates to test the sensitivity of GICA; the sensitivity was 10 μg/mL. Our results demonstrated that the applied method was effective to detect human α-LA in cow milk. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Development and evaluation of event-specific quantitative PCR method for genetically modified soybean A2704-12.

PubMed

Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2011-01-01

A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.

[Detection of methyl carbamate and ethyl carbamate in yellow rice wine by gas chromatography-mass spectrometry].

PubMed

Wu, Ping-gu; Ma, Bing-jie; Wang, Li-yuan; Shen, Xiang-hong; Zhang, Jing; Tan, Ying; Jiang, Wei

2013-11-01

To establish the method of simultaneous determination of methylcarbamate (MC) and ethylcarbamate (EC) in yellow rice wine by gas chromatography-mass spectrometry (GC/MS). MC and EC in yellow rice wine were derived by 9-xanthydrol, and then the derivants were detected by GC/MS; and quantitatively analyzed by D5-EC isotope internal standard method. The linearity of MC and EC ranged from 2.0 µg/L to 400.0 µg/L, with correlation coefficients at 0.998 and 0.999, respectively. The limits of quantitation (LOQ) and detection (LOD) were 0.67 and 2.0 µg/kg. When MC and EC were added in yellow rice wine at the range of 2.0-300.0 µg/kg, the intraday average recovery rate was 78.8%-102.3%, relative standard deviation was 3.2%-11.6%; interday average recovery rate was 75.4%-101.3%, relative standard deviation was 3.8%-13.4%. 20 samples of yellow rice wine from supermarket were detected using this method, the contents of MC were in the range of ND (no detected) to 1.2 µg/kg, the detection rate was 6% (3/20), the contents of EC in the range of 18.6 µg/kg to 432.3 µg/kg, with the average level at 135.2 µg/kg. The method is simple, rapid and useful for simultaneous determination of MC and EC in yellow rice wine.

Development and validation of stability indicating method for the quantitative determination of venlafaxine hydrochloride in extended release formulation using high performance liquid chromatography

PubMed Central

Kaur, Jaspreet; Srinivasan, K. K.; Joseph, Alex; Gupta, Abhishek; Singh, Yogendra; Srinivas, Kona S.; Jain, Garima

2010-01-01

Objective: Venlafaxine,hydrochloride is a structurally novel phenethyl bicyclic antidepressant, and is usually categorized as a serotonin–norepinephrine reuptake inhibitor (SNRI) but it has been referred to as a serotonin–norepinephrine–dopamine reuptake inhibitor. It inhibits the reuptake of dopamine. Venlafaxine HCL is widely prescribed in the form of sustained release formulations. In the current article we are reporting the development and validation of a fast and simple stability indicating, isocratic high performance liquid chromatographic (HPLC) method for the determination of venlafaxine hydrochloride in sustained release formulations. Materials and Methods: The quantitative determination of venlafaxine hydrochloride was performed on a Kromasil C18 analytical column (250 × 4.6 mm i.d., 5 μm particle size) with 0.01 M phosphate buffer (pH 4.5): methanol (40: 60) as a mobile phase, at a flow rate of 1.0 ml/min. For HPLC methods, UV detection was made at 225 nm. Results: During method validation, parameters such as precision, linearity, accuracy, stability, limit of quantification and detection and specificity were evaluated, which remained within acceptable limits. Conclusions: The method has been successfully applied for the quantification and dissolution profiling of Venlafaxine HCL in sustained release formulation. The method presents a simple and reliable solution for the routine quantitative analysis of Venlafaxine HCL. PMID:21814426

Verification of spectrophotometric method for nitrate analysis in water samples

NASA Astrophysics Data System (ADS)

Kurniawati, Puji; Gusrianti, Reny; Dwisiwi, Bledug Bernanti; Purbaningtias, Tri Esti; Wiyantoko, Bayu

2017-12-01

The aim of this research was to verify the spectrophotometric method to analyze nitrate in water samples using APHA 2012 Section 4500 NO3-B method. The verification parameters used were: linearity, method detection limit, level of quantitation, level of linearity, accuracy and precision. Linearity was obtained by using 0 to 50 mg/L nitrate standard solution and the correlation coefficient of standard calibration linear regression equation was 0.9981. The method detection limit (MDL) was defined as 0,1294 mg/L and limit of quantitation (LOQ) was 0,4117 mg/L. The result of a level of linearity (LOL) was 50 mg/L and nitrate concentration 10 to 50 mg/L was linear with a level of confidence was 99%. The accuracy was determined through recovery value was 109.1907%. The precision value was observed using % relative standard deviation (%RSD) from repeatability and its result was 1.0886%. The tested performance criteria showed that the methodology was verified under the laboratory conditions.

HPLC method development for evolving applications in the pharmaceutical industry and nanoscale chemistry

NASA Astrophysics Data System (ADS)

Castiglione, Steven Louis

As scientific research trends towards trace levels and smaller architectures, the analytical chemist is often faced with the challenge of quantitating said species in a variety of matricies. The challenge is heightened when the analytes prove to be potentially toxic or possess physical or chemical properties that make traditional analytical methods problematic. In such cases, the successful development of an acceptable quantitative method plays a critical role in the ability to further develop the species under study. This is particularly true for pharmaceutical impurities and nanoparticles (NP). The first portion of the research focuses on the development of a part-per-billion level HPLC method for a substituted phenazine-class pharmaceutical impurity. The development of this method was required due to the need for a rapid methodology to quantitatively determine levels of a potentially toxic phenazine moiety in order to ensure patient safety. As the synthetic pathway for the active ingredient was continuously refined to produce progressively lower amounts of the phenazine impurity, the approach for increasingly sensitive quantitative methods was required. The approaches evolved across four discrete methods, each employing a unique scheme for analyte detection. All developed methods were evaluated with regards to accuracy, precision and linear adherence as well as ancillary benefits and detriments -- e.g., one method in this evolution demonstrated the ability to resolve and detect other species from the phenazine class. The second portion of the research focuses on the development of an HPLC method for the quantitative determination of NP size distributions. The current methodology for the determination of NP sizes employs tunneling electron microscopy (TEM), which requires sample drying without particle size alteration and which, in many cases, may prove infeasible due to cost or availability. The feasibility of an HPLC method for NP size characterizations evolved across three methods, each employing a different approach for size resolution. These methods were evaluated primarily for sensitivity, which proved to be a substantial hurdle to further development, but does not appear to deter future research efforts.

Improving membrane based multiplex immunoassays for semi-quantitative detection of multiple cytokines in a single sample

PubMed Central

2014-01-01

Background Inflammatory mediators can serve as biomarkers for the monitoring of the disease progression or prognosis in many conditions. In the present study we introduce an adaptation of a membrane-based technique in which the level of up to 40 cytokines and chemokines can be determined in both human and rodent blood in a semi-quantitative way. The planar assay was modified using the LI-COR (R) detection system (fluorescence based) rather than chemiluminescence and semi-quantitative outcomes were achieved by normalizing the outcomes using the automated exposure settings of the Odyssey readout device. The results were compared to the gold standard assay, namely ELISA. Results The improved planar assay allowed the detection of a considerably higher number of analytes (n = 30 and n = 5 for fluorescent and chemiluminescent detection, respectively). The improved planar method showed high sensitivity up to 17 pg/ml and a linear correlation of the normalized fluorescence intensity with the results from the ELISA (r = 0.91). Conclusions The results show that the membrane-based technique is a semi-quantitative assay that correlates satisfactorily to the gold standard when enhanced by the use of fluorescence and subsequent semi-quantitative analysis. This promising technique can be used to investigate inflammatory profiles in multiple conditions, particularly in studies with constraints in sample sizes and/or budget. PMID:25022797

Multiple animal studies for medical chemical defense program in soldier/patient decontamination and drug development on task 85-17: Validation of an analytical method for the detection of soman (GD), mustard (HD), tabun (GA), and VX in wastewater samples. Final report, 13 October 1985-1 January 1989

DOE Office of Scientific and Technical Information (OSTI.GOV)

Joiner, R.L.; Hayes, L.; Rust, W.

1989-05-01

The following report summarizes the development and validation of an analytical method for the analyses of soman (GD), mustard (HD), VX, and tabun (GA) in wastewater. The need for an analytical method that can detect GD, HD, VX, and GA with the necessary sensitivity (< 20 parts per billion (PPB))and selectivity is essential to Medical Research and Evaluation Facility (MREF) operations. The analytical data were generated using liquid-liquid extraction of the wastewater, with the extract being concentrated and analyzed by gas chromatography (GC) methods. The sample preparation and analyses methods were developed in support of ongoing activities within the MREF.more » We have documented the precision and accuracy of the analytical method through an expected working calibration range (3.0 to 60 ppb). The analytical method was statistically evaluated over a range of concentrations to establish a detection limit and quantitation limit for the method. Whenever the true concentration is 8.5 ppb or above, the probability is at least 99.9 percent that the measured concentration will be ppb or above. Thus, 6 ppb could be used as a lower reliability limit for detecting concentrations in excess of 8.5 ppb. In summary, the proposed sample extraction and analyses methods are suitable for quantitative analyses to determine the presence of GD, HD, VX, and GA in wastewater samples. Our findings indicate that we can detect any of these chemical surety materiel (CSM) in water at or below the established U.S. Army Surgeon General's safety levels in drinking water.« less

Quantitative analysis of phylloquinone (vitamin K1) in soy bean oils by high-performance liquid chromatography.

PubMed

Zonta, F; Stancher, B

1985-07-19

A high-performance liquid chromatographic method for determining phylloquinone (vitamin K1) in soy bean oils is described. Resolution of vitamin K1 from interfering peaks of the matrix was obtained after enzymatic digestion, extraction and liquid-solid chromatography on alumina. An isocratic reversed-phase chromatography with UV detection was used in the final stage. The quantitation was carried out by the standard addition method, and the recovery of the whole procedure was 88.2%.

Method for the concentration and separation of actinides from biological and environmental samples

DOEpatents

Horwitz, E.P.; Dietz, M.L.

1989-05-30

A method and apparatus for the quantitative recover of actinide values from biological and environmental sample by passing appropriately prepared samples in a mineral acid solution through a separation column of a dialkyl(phenyl)-N,N-dialylcarbamoylmethylphosphine oxide dissolved in tri-n-butyl phosphate on an inert substrate which selectively extracts the actinide values. The actinide values can be eluted either as a group or individually and their presence quantitatively detected by alpha counting. 3 figs.

Automatic vertebral bodies detection of x-ray images using invariant multiscale template matching

NASA Astrophysics Data System (ADS)

Sharifi Sarabi, Mona; Villaroman, Diane; Beckett, Joel; Attiah, Mark; Marcus, Logan; Ahn, Christine; Babayan, Diana; Gaonkar, Bilwaj; Macyszyn, Luke; Raghavendra, Cauligi

2017-03-01

Lower back pain and pathologies related to it are one of the most common results for a referral to a neurosurgical clinic in the developed and the developing world. Quantitative evaluation of these pathologies is a challenge. Image based measurements of angles/vertebral heights and disks could provide a potential quantitative biomarker for tracking and measuring these pathologies. Detection of vertebral bodies is a key element and is the focus of the current work. From the variety of medical imaging techniques, MRI and CT scans have been typically used for developing image segmentation methods. However, CT scans are known to give a large dose of x-rays, increasing cancer risk [8]. MRI can be substituted for CTs when the risk is high [8] but are difficult to obtain in smaller facilities due to cost and lack of expertise in the field [2]. X-rays provide another option with its ability to control the x-ray dosage, especially for young people, and its accessibility for smaller facilities. Hence, the ability to create quantitative biomarkers from x-ray data is especially valuable. Here, we develop a multiscale template matching, inspired by [9], to detect centers of vertebral bodies from x-ray data. The immediate application of such detection lies in developing quantitative biomarkers and in querying similar images in a database. Previously, shape similarity classification methods have been used to address this problem, but these are challenging to use in the presence of variation due to gross pathology and even subtle effects [1].

Digital PCR analysis of circulating nucleic acids.

PubMed

Hudecova, Irena

2015-10-01

Detection of plasma circulating nucleic acids (CNAs) requires the use of extremely sensitive and precise methods. The commonly used quantitative real-time polymerase chain reaction (PCR) poses certain technical limitations in relation to the precise measurement of CNAs whereas the costs of massively parallel sequencing are still relatively high. Digital PCR (dPCR) now represents an affordable and powerful single molecule counting strategy to detect minute amounts of genetic material with performance surpassing many quantitative methods. Microfluidic (chip) and emulsion (droplet)-based technologies have already been integrated into platforms offering hundreds to millions of nanoliter- or even picoliter-scale reaction partitions. The compelling observations reported in the field of cancer research, prenatal testing, transplantation medicine and virology support translation of this technology into routine use. Extremely sensitive plasma detection of rare mutations originating from tumor or placental cells among a large background of homologous sequences facilitates unraveling of the early stages of cancer or the detection of fetal mutations. Digital measurement of quantitative changes in plasma CNAs associated with cancer or graft rejection provides valuable information on the monitoring of disease burden or the recipient's immune response and subsequent therapy treatment. Furthermore, careful quantitative assessment of the viral load offers great value for effective monitoring of antiviral therapy for immunosuppressed or transplant patients. The present review describes the inherent features of dPCR that make it exceptionally robust in precise and sensitive quantification of CNAs. Moreover, I provide an insight into the types of potential clinical applications that have been developed by researchers to date. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ

USDA-ARS?s Scientific Manuscript database

The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...

Detection of Echinoderm Microtubule Associated Protein Like 4-Anaplastic Lymphoma Kinase Fusion Genes in Non-small Cell Lung Cancer Clinical Samples by a Real-time Quantitative Reverse Transcription Polymerase Chain Reaction Method.

PubMed

Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao

2016-12-20

Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.

Protein Stains to Detect Antigen on Membranes.

PubMed

Dsouza, Anil; Scofield, R Hal

2015-01-01

Western blotting (protein blotting/electroblotting) is the gold standard in the analysis of complex protein mixtures. Electroblotting drives protein molecules from a polyacrylamide (or less commonly, of an agarose) gel to the surface of a binding membrane, thereby facilitating an increased availability of the sites with affinity for both general and specific protein reagents. The analysis of these complex protein mixtures is achieved by the detection of specific protein bands on a membrane, which in turn is made possible by the visualization of protein bands either by chemical staining or by reaction with an antibody of a conjugated ligand. Chemical methods employ staining with organic dyes, metal chelates, autoradiography, fluorescent dyes, complexing with silver, or prelabeling with fluorophores. All of these methods have differing sensitivities and quantitative determinations vary significantly. This review will describe the various protein staining methods applied to membranes after western blotting. "Detection" precedes and is a prerequisite to obtaining qualitative and quantitative data on the proteins in a sample, as much as to comparing the protein composition of different samples. "Detection" is often synonymous to staining, i.e., the reversible or irreversible binding by the proteins of a colored organic or inorganic chemical.

Detecting cell death with optical coherence tomography and envelope statistics

NASA Astrophysics Data System (ADS)

Farhat, Golnaz; Yang, Victor X. D.; Czarnota, Gregory J.; Kolios, Michael C.

2011-02-01

Currently no standard clinical or preclinical noninvasive method exists to monitor cell death based on morphological changes at the cellular level. In our past work we have demonstrated that quantitative high frequency ultrasound imaging can detect cell death in vitro and in vivo. In this study we apply quantitative methods previously used with high frequency ultrasound to optical coherence tomography (OCT) to detect cell death. The ultimate goal of this work is to use these methods for optically-based clinical and preclinical cancer treatment monitoring. Optical coherence tomography data were acquired from acute myeloid leukemia cells undergoing three modes of cell death. Significant increases in integrated backscatter were observed for cells undergoing apoptosis and mitotic arrest, while necrotic cells induced a decrease. These changes appear to be linked to structural changes observed in histology obtained from the cell samples. Signal envelope statistics were analyzed from fittings of the generalized gamma distribution to histograms of envelope intensities. The parameters from this distribution demonstrated sensitivities to morphological changes in the cell samples. These results indicate that OCT integrated backscatter and first order envelope statistics can be used to detect and potentially differentiate between modes of cell death in vitro.

Protein stains to detect antigen on membranes.

PubMed

D'souza, Anil; Scofield, R Hal

2009-01-01

Western blotting (protein blotting/electroblotting) is the gold standard in the analysis of complex protein mixtures. Electroblotting drives protein molecules from a polyacrylamide (or less commonly, of an agarose) gel to the surface of a binding membrane, thereby facilitating an increased availability of the sites with affinity for both general and specific protein reagents. The analysis of these complex protein mixtures is achieved by the detection of specific protein bands on a membrane, which in turn is made possible by the visualization of protein bands either by chemical staining or by reaction with an antibody of a conjugated ligand. Chemical methods employ staining with organic dyes, metal chelates, autoradiography, fluorescent dyes, complexing with silver, or prelabeling with fluorophores. All of these methods have differing sensitivities and quantitative determinations vary significantly. This review will describe the various protein staining methods applied to membranes after electrophoresis. "Detection" precedes and is a prerequisite to obtaining qualitative and quantitative data on the proteins in a sample, as much as to comparing the protein composition of different samples. Detection is often synonymous to staining, i.e., the reversible or irreversible binding by the proteins of a colored organic or inorganic chemical.

Detection of genetically modified organisms in foods by DNA amplification techniques.

PubMed

García-Cañas, Virginia; Cifuentes, Alejandro; González, Ramón

2004-01-01

In this article, the different DNA amplification techniques that are being used for detecting genetically modified organisms (GMOs) in foods are examined. This study intends to provide an updated overview (including works published till June 2002) on the principal applications of such techniques together with their main advantages and drawbacks in GMO detection in foods. Some relevant facts on sampling, DNA isolation, and DNA amplification methods are discussed. Moreover; these analytical protocols are discuissed from a quantitative point of view, including the newest investigations on multiplex detection of GMOs in foods and validation of methods.

Simple and cost-effective liquid chromatography-mass spectrometry method to measure dabrafenib quantitatively and six metabolites semi-quantitatively in human plasma.

PubMed

Vikingsson, Svante; Dahlberg, Jan-Olof; Hansson, Johan; Höiom, Veronica; Gréen, Henrik

2017-06-01

Dabrafenib is an inhibitor of BRAF V600E used for treating metastatic melanoma but a majority of patients experience adverse effects. Methods to measure the levels of dabrafenib and major metabolites during treatment are needed to allow development of individualized dosing strategies to reduce the burden of such adverse events. In this study, an LC-MS/MS method capable of measuring dabrafenib quantitatively and six metabolites semi-quantitatively is presented. The method is fully validated with regard to dabrafenib in human plasma in the range 5-5000 ng/mL. The analytes were separated on a C18 column after protein precipitation and detected in positive electrospray ionization mode using a Xevo TQ triple quadrupole mass spectrometer. As no commercial reference standards are available, the calibration curve of dabrafenib was used for semi-quantification of dabrafenib metabolites. Compared to earlier methods the presented method represents a simpler and more cost-effective approach suitable for clinical studies. Graphical abstract Combined multi reaction monitoring transitions of dabrafenib and metabolites in a typical case sample.

[Identification of irradiated abalone by ESR spectroscopy].

PubMed

Song, Yeping; Wang, Chuanxian; Yang, Zhenyu; Zhong, Weike; Geng, Jinpei; Lu, Di; Ding, Zhuoping

2012-05-01

To establish an analytical method for the detection and identification of irradiated abalone by electron spin resonance spectroscopy. Electron spin resonance (ESR) was used to study the spectral characteristics of abalone and the characteristic peak for quantitation. There were obvious different ESR spectra between unirradiated and irradiated abalone. The g factor for unirradiated abalone was 2.0055-2.0060, the g1 and g2 factor for irradiated abalone were (2.0027 +/- 0.0001) and (1.9994 +/- 0.0001), respectively. The ESR signal intensity of characteristic peak was positively correlated with absorbed dose in the range of 0.5 - 10 kGy, left peak was the characteristic peak for quantitation and the detection limit was < or = 0.5 kGy. It was difficult to quantitate when the absorbed dose was over 10 kGy. ESR characteristic peak and g factor were able to qualitatively determine the irradiation of abalone. ESR spectroscopy is an effective method to determine whether the abalone being irradiated or not.

Enumeration of viable and non-viable larvated Ascaris eggs with quantitative PCR

EPA Science Inventory

Aims: The goal of the study was to further develop an incubation-qPCR method for quantifying viable Ascaris eggs. The specific objectives were to characterize the detection limit and number of template copies per egg, determine the specificity of the method, and test the method w...

Rapid quantitative analysis of individual anthocyanin content based on high-performance liquid chromatography with diode array detection with the pH differential method.

PubMed

Wang, Huayin

2014-09-01

A new quantitative technique for the simultaneous quantification of the individual anthocyanins based on the pH differential method and high-performance liquid chromatography with diode array detection is proposed in this paper. The six individual anthocyanins (cyanidin 3-glucoside, cyanidin 3-rutinoside, petunidin 3-glucoside, petunidin 3-rutinoside, and malvidin 3-rutinoside) from mulberry (Morus rubra) and Liriope platyphylla were used for demonstration and validation. The elution of anthocyanins was performed using a C18 column with stepwise gradient elution and individual anthocyanins were identified by high-performance liquid chromatography with tandem mass spectrometry. Based on the pH differential method, the high-performance liquid chromatography peak areas of maximum and reference absorption wavelengths of anthocyanin extracts were conducted to quantify individual anthocyanins. The calibration curves for these anthocyanins were linear within the range of 10-5500 mg/L. The correlation coefficients (r(2)) all exceeded 0.9972, and the limits of detection were in the range of 1-4 mg/L at a signal-to-noise ratio ≥5 for these anthocyanins. The proposed quantitative analysis was reproducible with good accuracy of all individual anthocyanins ranging from 96.3 to 104.2% and relative recoveries were in the range 98.4-103.2%. The proposed technique is performed without anthocyanin standards and is a simple, rapid, accurate, and economical method to determine individual anthocyanin contents. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detection of genetically modified organisms in foreign-made processed foods containing corn and potato.

PubMed

Monma, Kimio; Araki, Rie; Sagi, Naoki; Satoh, Masaki; Ichikawa, Hisatsugu; Satoh, Kazue; Tobe, Takashi; Kamata, Kunihiro; Hino, Akihiro; Saito, Kazuo

2005-06-01

Investigations of the validity of labeling regarding genetically modified (GM) products were conducted using polymerase chain reaction (PCR) methods for foreign-made processed foods made from corn and potato purchased in the Tokyo area and in the USA. Several kinds of GM crops were detected in 12 of 32 samples of processed corn samples. More than two GM events for which safety reviews have been completed in Japan were simultaneously detected in 10 samples. GM events MON810 and Bt11 were most frequently detected in the samples by qualitative PCR methods. MON810 was detected in 11 of the 12 samples, and Bt11 was detected in 6 of the 12 samples. In addition, Roundup Ready soy was detected in one of the 12 samples. On the other hand, CBH351, for which the safety assessment was withdrawn in Japan, was not detected in any of the 12 samples. A trial quantitative analysis was performed on six of the GM maize qualitatively positive samples. The estimated amounts of GM maize in these samples ranged from 0.2 to 2.8%, except for one sample, which contained 24.1%. For this sample, the total amount found by event-specific quantitative analysis was 23.8%. Additionally, Roundup Ready soy was detected in one sample of 21 potato-processed foods, although GM potatoes were not detected in any sample.

Probability of Detection (POD) as a statistical model for the validation of qualitative methods.

PubMed

Wehling, Paul; LaBudde, Robert A; Brunelle, Sharon L; Nelson, Maria T

2011-01-01

A statistical model is presented for use in validation of qualitative methods. This model, termed Probability of Detection (POD), harmonizes the statistical concepts and parameters between quantitative and qualitative method validation. POD characterizes method response with respect to concentration as a continuous variable. The POD model provides a tool for graphical representation of response curves for qualitative methods. In addition, the model allows comparisons between candidate and reference methods, and provides calculations of repeatability, reproducibility, and laboratory effects from collaborative study data. Single laboratory study and collaborative study examples are given.

Simultaneous detection and quantitation of organic impurities in methamphetamine by ultra-high-performance liquid chromatography-tandem mass spectrometry, a complementary technique for methamphetamine profiling.

PubMed

Li, Li; Brown, Jaclyn L; Toske, Steven G

2018-04-06

The analysis of organic impurities plays an important role in the impurity profiling of methamphetamine, which in turn provides valuable information about methamphetamine manufacturing, in particular its synthetic route, chemicals, and precursors used. Ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) is ideally suited for this purpose due to its excellent sensitivity, selectivity, and wide linear range in multiple reaction monitoring (MRM) mode. In this study, a dilute-and-shoot UHPLC-MS/MS method was developed for the simultaneous identification and quantitation of 23 organic manufacturing impurities in illicit methamphetamine. The developed method was validated in terms of stability, limit of detection (LOD), lower limit of quantification (LLOQ), accuracy, and precision. More than 100 illicitly prepared methamphetamine samples were analyzed. Due to its ability to detect ephedrine/pseudoephedrine and its high sensitivity for critical target markers (eg, chloro-pseudoephedrine, N-cyclohexylamphetamine, and compounds B and P), more impurities and precursor/pre-precursors were identified and quantified versus the current procedure by gas chromatography-mass spectrometry (GC-MS). Consequently, more samples could be classified by their synthetic routes. However, the UHPLC-MS/MS method has difficulty in detecting neutral and untargeted emerging manufacturing impurities and can therefore only serve as a complement to the current method. Despite this deficiency, the quantitative information acquired by the presented UHPLC-MS/MS methodology increased the sample discrimination power, thereby enhancing the capacity of methamphetamine profiling program (MPP) to conduct sample-sample comparisons. Published 2018. This article is a U.S. Government work and is in the public domain in the USA.

Quantifying spontaneous metastasis in a syngeneic mouse melanoma model using real time PCR.

PubMed

Deng, Wentao; McLaughlin, Sarah L; Klinke, David J

2017-08-07

Modeling metastasis in vivo with animals is a priority for both revealing mechanisms of tumor dissemination and developing therapeutic methods. While conventional intravenous injection of tumor cells provides an efficient and consistent system for studying tumor cell extravasation and colonization, studying spontaneous metastasis derived from orthotopic tumor sites has the advantage of modeling more aspects of the metastatic cascade, but is challenging as it is difficult to detect small numbers of metastatic cells. In this work, we developed an approach for quantifying spontaneous metastasis in the syngeneic mouse B16 system using real time PCR. We first transduced B16 cells with lentivirus expressing firefly luciferase Luc2 gene for bioluminescence imaging. Next, we developed a real time quantitative PCR (qPCR) method for the detection of luciferase-expressing, metastatic tumor cells in mouse lungs and other organs. To illustrate the approach, we quantified lung metastasis in both spontaneous and experimental scenarios using B16F0 and B16F10 cells in C57BL/6Ncrl and NOD-Scid Gamma (NSG) mice. We tracked B16 melanoma metastasis with both bioluminescence imaging and qPCR, which were found to be self-consistent. Using this assay, we can quantitatively detect one Luc2 positive tumor cell out of 10 4 tissue cells, which corresponds to a metastatic burden of 1.8 × 10 4 metastatic cells per whole mouse lung. More importantly, the qPCR method was at least a factor of 10 more sensitive in detecting metastatic cell dissemination and should be combined with bioluminescence imaging as a high-resolution, end-point method for final metastatic cell quantitation. Given the rapid growth of primary tumors in many mouse models, assays with improved sensitivity can provide better insight into biological mechanisms that underpin tumor metastasis.

A novel orellanine containing mushroom Cortinarius armillatus.

PubMed

Shao, Dahai; Tang, Shusheng; Healy, Rosanne A; Imerman, Paula M; Schrunk, Dwayne E; Rumbeiha, Wilson K

2016-05-01

Orellanine (3,3',4,4'-tetrahydroxy-2,2'-bipyridine-1,1'-dioxide) is a tetrahydroxylated di-N-oxidized bipyridine compound. The toxin, present in certain species of Cortinarius mushrooms, is structurally similar to herbicides Paraquat and Diquat. Cortinarius orellanus and Cortinarius rubellus are the major orellanine-containing mushrooms. Cortinarius mushrooms are widely reported in Europe where they have caused human poisoning and deaths through accidental ingestion of the poisonous species mistaken for the edible ones. In North America, Cortinarius orellanosus mushroom poisoning was recently reported to cause renal failure in a Michigan patient. Cortinarius mushroom poisoning is characterized by delayed acute renal failure, with some cases progressing to end-stage kidney disease. There is debate whether other Cortinarius mushroom contain orellanine or not, especially in North America. Currently, there are no veterinary diagnostic laboratories in North America with established test methods for detection and quantitation of orellanine. We have developed two diagnostic test methods based on HPLC and LC-MSMS for identification and quantitation of orellanine in mushrooms. Using these methods, we have identified Cortinarius armillatus as a novel orellanine-containing mushroom in North America. The mean toxin concentration of 145 ug/g was <1% of that of the more toxic C. rubellus. The HPLC method can detect orellanine at 17 μg g(-1) while the LC-MSMS method is almost 2000 times more sensitive and can detect orellanine at 30 ng g(-1). Both tests are quantitative, selective and are now available for veterinary diagnostic applications. Copyright © 2016 Elsevier Ltd. All rights reserved.

Comparative analysis of minimal residual disease detection using four-color flow cytometry, consensus IgH-PCR, and quantitative IgH PCR in CLL after allogeneic and autologous stem cell transplantation.

PubMed

Böttcher, S; Ritgen, M; Pott, C; Brüggemann, M; Raff, T; Stilgenbauer, S; Döhner, H; Dreger, P; Kneba, M

2004-10-01

The clinically most suitable method for minimal residual disease (MRD) detection in chronic lymphocytic leukemia is still controversial. We prospectively compared MRD assessment in 158 blood samples of 74 patients with CLL after stem cell transplantation (SCT) using four-color flow cytometry (MRD flow) in parallel with consensus IgH-PCR and ASO IgH real-time PCR (ASO IgH RQ-PCR). In 25 out of 106 samples (23.6%) with a polyclonal consensus IgH-PCR pattern, MRD flow still detected CLL cells, proving higher sensitivity of flow cytometry over PCR-genescanning with consensus IgH-primers. Of 92 samples, 14 (15.2%) analyzed in parallel by MRD flow and by ASO IgH RQ-PCR were negative by our flow cytometric assay but positive by PCR, thus demonstrating superior sensitivity of RQ-PCR with ASO primers. Quantitative MRD levels measured by both methods correlated well (r=0.93). MRD detection by flow and ASO IgH RQ-PCR were equally suitable to monitor MRD kinetics after allogeneic SCT, but the PCR method detected impending relapses after autologous SCT earlier. An analysis of factors that influence sensitivity and specificity of flow cytometry for MRD detection allowed to devise further improvements of this technique.

Assessment of Intrathecal Free Light Chain Synthesis: Comparison of Different Quantitative Methods with the Detection of Oligoclonal Free Light Chains by Isoelectric Focusing and Affinity-Mediated Immunoblotting

PubMed Central

Kušnierová, Pavlína; Švagera, Zdeněk; Všianský, František; Byrtusová, Monika; Hradílek, Pavel; Kurková, Barbora; Zapletalová, Olga; Bartoš, Vladimír

2016-01-01

Objectives We aimed to compare various methods for free light chain (fLC) quantitation in cerebrospinal fluid (CSF) and serum and to determine whether quantitative CSF measurements could reliably predict intrathecal fLC synthesis. In addition, we wished to determine the relationship between free kappa and free lambda light chain concentrations in CSF and serum in various disease groups. Methods We analysed 166 paired CSF and serum samples by at least one of the following methods: turbidimetry (Freelite™, SPAPLUS), nephelometry (N Latex FLC™, BN ProSpec), and two different (commercially available and in-house developed) sandwich ELISAs. The results were compared with oligoclonal fLC detected by affinity-mediated immunoblotting after isoelectric focusing. Results Although the correlations between quantitative methods were good, both proportional and systematic differences were discerned. However, no major differences were observed in the prediction of positive oligoclonal fLC test. Surprisingly, CSF free kappa/free lambda light chain ratios were lower than those in serum in about 75% of samples with negative oligoclonal fLC test. In about a half of patients with multiple sclerosis and clinically isolated syndrome, profoundly increased free kappa/free lambda light chain ratios were found in the CSF. Conclusions Our results show that using appropriate method-specific cut-offs, different methods of CSF fLC quantitation can be used for the prediction of intrathecal fLC synthesis. The reason for unexpectedly low free kappa/free lambda light chain ratios in normal CSFs remains to be elucidated. Whereas CSF free kappa light chain concentration is increased in most patients with multiple sclerosis and clinically isolated syndrome, CSF free lambda light chain values show large interindividual variability in these patients and should be investigated further for possible immunopathological and prognostic significance. PMID:27846293

Detection of nucleophosmin 1 mutations by quantitative real-time polymerase chain reaction versus capillary electrophoresis: a comparative study.

PubMed

Barakat, Fareed H; Luthra, Rajyalakshmi; Yin, C Cameron; Barkoh, Bedia A; Hai, Seema; Jamil, Waqar; Bhakta, Yaminiben I; Chen, Su; Medeiros, L Jeffrey; Zuo, Zhuang

2011-08-01

Nucleophosmin 1 (NPM1) is the most commonly mutated gene in acute myeloid leukemia. Detection of NPM1 mutations is useful for stratifying patients for therapy, predicting prognosis, and assessing for minimal residual disease. Several methods have been developed to rapidly detect NPM1 mutations in genomic DNA and/or messenger RNA specimens. To directly compare a quantitative real-time polymerase chain reaction (qPCR) assay with a widely used capillary electrophoresis assay for detecting NPM1 mutations. We adopted and modified a qPCR assay designed to detect the 6 most common NPM1 mutations and performed the assay in parallel with capillary electrophoresis assay in 207 bone marrow aspirate or peripheral blood samples from patients with a range of hematolymphoid neoplasms. The qPCR assay demonstrated a higher analytical sensitivity than the capillary electrophoresis 1/1000 versus 1/40, respectively. The capillary electrophoresis assay generated 10 equivocal results that needed to be repeated, whereas the qPCR assay generated only 1 equivocal result. After test conditions were optimized, the qPCR and capillary electrophoresis methods produced 100% concordant results, 85 positive and 122 negative. Given the higher analytical sensitivity and specificity of the qPCR assay, that assay is less likely to generate equivocal results than the capillary electrophoresis assay. Moreover, the qPCR assay is quantitative, faster, cheaper, less prone to contamination, and well suited for monitoring minimal residual disease.

Novel method for edge detection of retinal vessels based on the model of the retinal vascular network and mathematical morphology

NASA Astrophysics Data System (ADS)

Xu, Lei; Zheng, Xiaoxiang; Zhang, Hengyi; Yu, Yajun

1998-09-01

Accurate edge detection of retinal vessels is a prerequisite for quantitative analysis of subtle morphological changes of retinal vessels under different pathological conditions. A novel method for edge detection of retinal vessels is presented in this paper. Methods: (1) Wavelet-based image preprocessing. (2) The signed edge detection algorithm and mathematical morphological operation are applied to get the approximate regions that contain retinal vessels. (3) By convolving the preprocessed image with a LoG operator only on the detected approximate regions of retinal vessels, followed by edges refining, clear edge maps of the retinal vessels are fast obtained. Results: A detailed performance evaluation together with the existing techniques is given to demonstrate the strong features of our method. Conclusions: True edge locations of retinal vessels can be fast detected with continuous structures of retinal vessels, less non- vessel segments left and insensitivity to noise. The method is also suitable for other application fields such as road edge detection.

Quantitative kinetic analysis of lung nodules by temporal subtraction technique in dynamic chest radiography with a flat panel detector

NASA Astrophysics Data System (ADS)

Tsuchiya, Yuichiro; Kodera, Yoshie; Tanaka, Rie; Sanada, Shigeru

2007-03-01

Early detection and treatment of lung cancer is one of the most effective means to reduce cancer mortality; chest X-ray radiography has been widely used as a screening examination or health checkup. The new examination method and the development of computer analysis system allow obtaining respiratory kinetics by the use of flat panel detector (FPD), which is the expanded method of chest X-ray radiography. Through such changes functional evaluation of respiratory kinetics in chest has become available. Its introduction into clinical practice is expected in the future. In this study, we developed the computer analysis algorithm for the purpose of detecting lung nodules and evaluating quantitative kinetics. Breathing chest radiograph obtained by modified FPD was converted into 4 static images drawing the feature, by sequential temporal subtraction processing, morphologic enhancement processing, kinetic visualization processing, and lung region detection processing, after the breath synchronization process utilizing the diaphragmatic analysis of the vector movement. The artificial neural network used to analyze the density patterns detected the true nodules by analyzing these static images, and drew their kinetic tracks. For the algorithm performance and the evaluation of clinical effectiveness with 7 normal patients and simulated nodules, both showed sufficient detecting capability and kinetic imaging function without statistically significant difference. Our technique can quantitatively evaluate the kinetic range of nodules, and is effective in detecting a nodule on a breathing chest radiograph. Moreover, the application of this technique is expected to extend computer-aided diagnosis systems and facilitate the development of an automatic planning system for radiation therapy.

Application of Programmable Bio-Nano-Chip System for the Quantitative Detection of Drugs of Abuse in Oral Fluids*

PubMed Central

Christodoulides, Nicolaos; De La Garza, Richard; Simmons, Glennon W.; McRae, Michael P.; Wong, Jorge; Newton, Thomas F.; Smith, Regina; Mahoney, James J.; Hohenstein, Justin; Gomez, Sobeyda; Floriano, Pierre N.; Talavera, Humberto; Sloan, Daniel J.; Moody, David E.; Andrenyak, David M.; Kosten, Thomas R.; Haque, Ahmed; McDevitt, John T.

2015-01-01

Objective There is currently a gap in on-site drug of abuse monitoring. Current detection methods involve invasive sampling of blood and urine specimens, or collection of oral fluid, followed by qualitative screening tests using immunochromatographic cartridges. While remote laboratories then may provide confirmation and quantitative assessment of a presumptive positive, this instrumentation is expensive and decoupled from the initial sampling making the current drug-screening program inefficient and costly. The authors applied a noninvasive oral fluid sampling approach integrated with the in-development chip-based Programmable Bio-Nano-Chip (p-BNC) platform for the detection of drugs of abuse. Method The p-BNC assay methodology was applied for the detection of tetrahydrocannabinol, morphine, amphetamine, methamphetamine, cocaine, methadone and benzodiazepines, initially using spiked buffered samples and, ultimately, using oral fluid specimen collected from consented volunteers. Results Rapid (~10 minutes), sensitive detection (~ng/ml) and quantitation of 12 drugs of abuse was demonstrated on the p-BNC platform. Furthermore, the system provided visibility to time-course of select drug and metabolite profiles in oral fluids; for the drug cocaine, three regions of slope were observed that, when combined with concentration measurements from this and prior impairment studies, information about cocaine-induced impairment may be revealed. Conclusions This chip-based p-BNC detection modality has significant potential to be used in the future by law enforcement officers for roadside drug testing and to serve a variety of other settings, including outpatient and inpatient drug rehabilitation centers, emergency rooms, prisons, schools, and in the workplace. PMID:26048639

Detection limits of quantitative and digital PCR assays and their influence in presence-absence surveys of environmental DNA

USGS Publications Warehouse

Hunter, Margaret; Dorazio, Robert M.; Butterfield, John S.; Meigs-Friend, Gaia; Nico, Leo; Ferrante, Jason A.

2017-01-01

A set of universal guidelines is needed to determine the limit of detection (LOD) in PCR-based analyses of low concentration DNA. In particular, environmental DNA (eDNA) studies require sensitive and reliable methods to detect rare and cryptic species through shed genetic material in environmental samples. Current strategies for assessing detection limits of eDNA are either too stringent or subjective, possibly resulting in biased estimates of species’ presence. Here, a conservative LOD analysis grounded in analytical chemistry is proposed to correct for overestimated DNA concentrations predominantly caused by the concentration plateau, a nonlinear relationship between expected and measured DNA concentrations. We have used statistical criteria to establish formal mathematical models for both quantitative and droplet digital PCR. To assess the method, a new Grass Carp (Ctenopharyngodon idella) TaqMan assay was developed and tested on both PCR platforms using eDNA in water samples. The LOD adjustment reduced Grass Carp occupancy and detection estimates while increasing uncertainty – indicating that caution needs to be applied to eDNA data without LOD correction. Compared to quantitative PCR, digital PCR had higher occurrence estimates due to increased sensitivity and dilution of inhibitors at low concentrations. Without accurate LOD correction, species occurrence and detection probabilities based on eDNA estimates are prone to a source of bias that cannot be reduced by an increase in sample size or PCR replicates. Other applications also could benefit from a standardized LOD such as GMO food analysis, and forensic and clinical diagnostics.

Simultaneous Determination of Oxysterols, Cholesterol and 25-Hydroxy-Vitamin D3 in Human Plasma by LC-UV-MS

PubMed Central

Narayanaswamy, Rohini; Iyer, Vignesh; Khare, Prachi; Bodziak, Mary Lou; Badgett, Darlene; Zivadinov, Robert; Weinstock-Guttman, Bianca; Rideout, Todd C.; Ramanathan, Murali; Browne, Richard W.

2015-01-01

Background Oxysterols are promising biomarkers of neurodegenerative diseases that are linked with cholesterol and vitamin D metabolism. There is an unmet need for methods capable of sensitive, and simultaneous quantitation of multiple oxysterols, vitamin D and cholesterol pathway biomarkers. Methods A method for simultaneous determination of 5 major oxysterols, 25-hydroxy vitamin D3 and cholesterol in human plasma was developed. Total oxysterols were prepared by room temperature saponification followed by solid phase extraction from plasma spiked with deuterated internal standards. Oxysterols were resolved by reverse phase HPLC using a methanol/water/0.1% formic acid gradient. Oxysterols and 25-hydroxy vitamin D3 were detected with atmospheric pressure chemical ionization mass spectrometry in positive ion mode; in-series photodiode array detection at 204nm was used for cholesterol. Method validation studies were performed. Oxysterol levels in 220 plasma samples from healthy control subjects, multiple sclerosis and other neurological disorders patients were quantitated. Results Our method quantitated 5 oxysterols, cholesterol and 25-hydroxy vitamin D3 from 200 μL plasma in 35 minutes. Recoveries were >85% for all analytes and internal standards. The limits of detection were 3-10 ng/mL for oxysterols and 25-hydroxy vitamin D3 and 1 μg/mL for simultaneous detection of cholesterol. Analytical imprecision was <10 %CV for 24(S)-, 25-, 27-, 7α-hydroxycholesterol (HC) and cholesterol and ≤15 % for 7-keto-cholesterol. Multiple Sclerosis and other neurological disorder patients had lower 27-hydroxycholesterol levels compared to controls whereas 7α-hydroxycholesterol was lower specifically in Multiple Sclerosis. Conclusion The method is suitable for measuring plasma oxysterols levels in human health and disease. Analysis of human plasma indicates that the oxysterol, bile acid precursors 7α-hydroxycholesterol and 27-hydroxycholesterol are lower in Multiple Sclerosis and may serve as potential biomarkers of disease. PMID:25875771

A validated method for the quantitation of 1,1-difluoroethane using a gas in equilibrium method of calibration.

PubMed

Avella, Joseph; Lehrer, Michael; Zito, S William

2008-10-01

1,1-Difluoroethane (DFE), also known as Freon 152A, is a member of a class of compounds known as halogenated hydrocarbons. A number of these compounds have gained notoriety because of their ability to induce rapid onset of intoxication after inhalation exposure. Abuse of DFE has necessitated development of methods for its detection and quantitation in postmortem and human performance specimens. Furthermore, methodologies applicable to research studies are required as there have been limited toxicokinetic and toxicodynamic reports published on DFE. This paper describes a method for the quantitation of DFE using a gas chromatography-flame-ionization headspace technique that employs solventless standards for calibration. Two calibration curves using 0.5 mL whole blood calibrators which ranged from A: 0.225-1.350 to B: 9.0-180.0 mg/L were developed. These were evaluated for linearity (0.9992 and 0.9995), limit of detection of 0.018 mg/L, limit of quantitation of 0.099 mg/L (recovery 111.9%, CV 9.92%), and upper limit of linearity of 27,000.0 mg/L. Combined curve recovery results of a 98.0 mg/L DFE control that was prepared using an alternate technique was 102.2% with CV of 3.09%. No matrix interference was observed in DFE enriched blood, urine or brain specimens nor did analysis of variance detect any significant differences (alpha = 0.01) in the area under the curve of blood, urine or brain specimens at three identical DFE concentrations. The method is suitable for use in forensic laboratories because validation was performed on instrumentation routinely used in forensic labs and due to the ease with which the calibration range can be adjusted. Perhaps more importantly it is also useful for research oriented studies because the removal of solvent from standard preparation eliminates the possibility for solvent induced changes to the gas/liquid partitioning of DFE or chromatographic interference due to the presence of solvent in specimens.

Development of capillary electrophoresis methods for quantitative determination of taurine in vehicle system and biological media.

PubMed

da Silva, Dayse L P; Rüttinger, Hans H; Mrestani, Yahia; Baum, Walter F; Neubert, Reinhard H H

2006-06-01

CE methods have been developed for the determination of taurine in pharmaceutical formulation (microemulsion) and in biological media such as sweat. The CE system with end-column pulsed amperometric detection has been found to be an interesting method in comparison with UV and fluorescence detection for its simplicity and rapidity. A gold-disk electrode of 100 mm diameter was used as the working electrode. The effects of a field decoupler at the end of the capillary, separation voltage, injection and pressure times were investigated. A detection limit of 4 x 10(-5) mol/L was reached using integrated pulsed amperometric detection, a method successfully applied to taurine analysis of the biological samples such as sweat. For taurine analysis of oil-in-water microemulsion, fluorescence detector was the favored method, the detection limit of which was 4 x 10(-11) mol/L.

EVALUATION OF METHODS FOR SAMPLING, RECOVERY, AND ENUMERATION OF BACTERIA APPLIED TO THE PHYLLOPANE

EPA Science Inventory

Determining the fate and survival of genetically engineered microorganisms released into the environment requires the development and application of accurate and practical methods of detection and enumeration. everal experiments were performed to examine quantitative recovery met...

Semi-automated identification of cones in the human retina using circle Hough transform

PubMed Central

Bukowska, Danuta M.; Chew, Avenell L.; Huynh, Emily; Kashani, Irwin; Wan, Sue Ling; Wan, Pak Ming; Chen, Fred K

2015-01-01

A large number of human retinal diseases are characterized by a progressive loss of cones, the photoreceptors critical for visual acuity and color perception. Adaptive Optics (AO) imaging presents a potential method to study these cells in vivo. However, AO imaging in ophthalmology is a relatively new phenomenon and quantitative analysis of these images remains difficult and tedious using manual methods. This paper illustrates a novel semi-automated quantitative technique enabling registration of AO images to macular landmarks, cone counting and its radius quantification at specified distances from the foveal center. The new cone counting approach employs the circle Hough transform (cHT) and is compared to automated counting methods, as well as arbitrated manual cone identification. We explore the impact of varying the circle detection parameter on the validity of cHT cone counting and discuss the potential role of using this algorithm in detecting both cones and rods separately. PMID:26713186

The effects of tissue processing on markers for T and B cells from solid tissues.

PubMed

Millard, P R; Rabin, B S; Whiteside, T L; Hubbard, J D

1977-03-01

Suspensions of lymphoid cells from tissues have been used for the determination of the quantitative relationship between the T and B cell populations. The distribution of the lymphocytes within a given tissue, however, cannot be demonstrated once such a suspension has been prepared. Various methods of characterizing lymphocytes within tissues were evaluated. The method of tissue preparation can alter the capability of detecting the lymphocyte markers. Fluorescein-labeled anti-immunoglobulin sera reacted equally well with lymphocytes in tissue regardless of the method of tissue preparation. Complement-coated sheep erythrocytes were less effective in detecting lymphocyte markers in tissue sections than in cell suspensions. Quantitative assays of lymphocytes could be done in suspensions only. Unaltered sheep erythrocytes did not bind to T lymphocytes in tissue. T lymphocytes could be identified in tissue sections, however, by the use of anti-human T cell serum.

Clinical applications of a quantitative analysis of regional lift ventricular wall motion

NASA Technical Reports Server (NTRS)

Leighton, R. F.; Rich, J. M.; Pollack, M. E.; Altieri, P. I.

1975-01-01

Observations were summarized which may have clinical application. These were obtained from a quantitative analysis of wall motion that was used to detect both hypokinesis and tardokinesis in left ventricular cineangiograms. The method was based on statistical comparisons with normal values for regional wall motion derived from the cineangiograms of patients who were found not to have heart disease.

QUANTITATION OF PERCHLORATE ION BY ELECTROSPRAY IONIZATION MASS SPECTROMETRY (ESI-MS) USING STABLE ASSOCIATION COMPLEXES WITH ORGANIC CATIONS AND BASES TO ENHANCE SELECTIVITY

EPA Science Inventory

Quantitation of trace levels of perchlorate ion in water has become a key issue since this species was discovered in water supplies around the United States. Although ion chromatographic methods presently offer the lowest limit of detection, =40 nm (4ngm1-1), chromatographic ret...

[Qualitative and quantitative analysis of amygdalin and its metabolite prunasin in plasma by ultra-high performance liquid chromatography-tandem quadrupole time of flight mass spectrometry and ultra-high performance liquid chromatography-tandem triple quadrupole mass spectrometry].

PubMed

Gao, Meng; Wang, Yuesheng; Wei, Huizhen; Ouyang, Hui; He, Mingzhen; Zeng, Lianqing; Shen, Fengyun; Guo, Qiang; Rao, Yi

2014-06-01

A method was developed for the determination of amygdalin and its metabolite prunasin in rat plasma after intragastric administration of Maxing shigan decoction. The analytes were identified by ultra-high performance liquid chromatography-tandem quadrupole time of flight mass spectrometry and quantitatively determined by ultra-high performance liquid chromatography-tandem triple quadrupole mass spectrometry. After purified by liquid-liquid extraction, the qualitative analysis of amygdalin and prunasin in the plasma sample was performed on a Shim-pack XR-ODS III HPLC column (75 mm x 2.0 mm, 1.6 microm), using acetonitrile-0.1% (v/v) formic acid aqueous solution. The detection was performed on a Triple TOF 5600 quadrupole time of flight mass spectrometer. The quantitative analysis of amygdalin and prunasin in the plasma sample was performed by separation on an Agilent C18 HPLC column (50 mm x 2.1 mm, 1.7 microm), using acetonitrile-0.1% (v/v) formic acid aqueous solution. The detection was performed on an AB Q-TRAP 4500 triple quadrupole mass spectrometer utilizing electrospray ionization (ESI) interface operated in negative ion mode and multiple-reaction monitoring (MRM) mode. The qualitative analysis results showed that amygdalin and its metabolite prunasin were detected in the plasma sample. The quantitative analysis results showed that the linear range of amygdalin was 1.05-4 200 ng/mL with the correlation coefficient of 0.999 0 and the linear range of prunasin was 1.25-2 490 ng/mL with the correlation coefficient of 0.997 0. The method had a good precision with the relative standard deviations (RSDs) lower than 9.20% and the overall recoveries varied from 82.33% to 95.25%. The limits of detection (LODs) of amygdalin and prunasin were 0.50 ng/mL. With good reproducibility, the method is simple, fast and effective for the qualitative and quantitative analysis of the amygdalin and prunasin in plasma sample of rats which were administered by Maxing shigan decoction.

Use of local noise power spectrum and wavelet analysis in quantitative image quality assurance for EPIDs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Soyoung

Purpose: To investigate the use of local noise power spectrum (NPS) to characterize image noise and wavelet analysis to isolate defective pixels and inter-subpanel flat-fielding artifacts for quantitative quality assurance (QA) of electronic portal imaging devices (EPIDs). Methods: A total of 93 image sets including custom-made bar-pattern images and open exposure images were collected from four iViewGT a-Si EPID systems over three years. Global quantitative metrics such as modulation transform function (MTF), NPS, and detective quantum efficiency (DQE) were computed for each image set. Local NPS was also calculated for individual subpanels by sampling region of interests within each subpanelmore » of the EPID. The 1D NPS, obtained by radially averaging the 2D NPS, was fitted to a power-law function. The r-square value of the linear regression analysis was used as a singular metric to characterize the noise properties of individual subpanels of the EPID. The sensitivity of the local NPS was first compared with the global quantitative metrics using historical image sets. It was then compared with two commonly used commercial QA systems with images collected after applying two different EPID calibration methods (single-level gain and multilevel gain). To detect isolated defective pixels and inter-subpanel flat-fielding artifacts, Haar wavelet transform was applied on the images. Results: Global quantitative metrics including MTF, NPS, and DQE showed little change over the period of data collection. On the contrary, a strong correlation between the local NPS (r-square values) and the variation of the EPID noise condition was observed. The local NPS analysis indicated image quality improvement with the r-square values increased from 0.80 ± 0.03 (before calibration) to 0.85 ± 0.03 (after single-level gain calibration) and to 0.96 ± 0.03 (after multilevel gain calibration), while the commercial QA systems failed to distinguish the image quality improvement between the two calibration methods. With wavelet analysis, defective pixels and inter-subpanel flat-fielding artifacts were clearly identified as spikes after thresholding the inversely transformed images. Conclusions: The proposed local NPS (r-square values) showed superior sensitivity to the noise level variations of individual subpanels compared with global quantitative metrics such as MTF, NPS, and DQE. Wavelet analysis was effective in detecting isolated defective pixels and inter-subpanel flat-fielding artifacts. The proposed methods are promising for the early detection of imaging artifacts of EPIDs.« less

Dry-Enzyme Test For Gaseous Chemicals

NASA Technical Reports Server (NTRS)

Barzana, Eduardo; Karel, Marcus; Klibanov, Alexander

1990-01-01

Simple, dry-chemical test detects ethanol in human breath. Method of test also adapted to detection of such toxic chemicals as formaldehyde in airstreams. Used qualitatively to detect chemical compounds above present level; for example, ethanol above legal level for driving. Also used to indicate quantitatively concentrations of compounds. Involves dry enzyme and color indicator. Adapted to detect any gaseous compound transformed by enzymes to produce change evident to human eye or to instrument.

Development of a SYBR Green I real-time PCR for detection and quantitation of orthopoxvirus by using Ectromelia virus.

PubMed

Cheng, Wenyu; He, Xiaobing; Jia, Huaijie; Chen, Guohua; Wang, Cong; Zhang, Jun; Jing, Zhizhong

2018-04-01

Ectromelia virus (ECTV) is the causative agent of mousepox, which has devastating effects in laboratory-mouse colonies and causes economic loss in biomedical research. More importantly, ECTV has been extensively used as an excellent model for studies of the pathogenesis and immunobiology of human smallpox. A rapid and sensitive SYBR Green I-based real-time PCR assay was developed and used for the detection and quantitation of orthopoxvirus by using ECTV in this study. Primers targeted to the highly conserved region of major core protein P4b gene of orthopoxvirus were designed and the standard plasmid was constructed. This assay was able to detect a minimum of 10 copies of standard DNA and 5 TCID 50 units of ECTV. In addition, no cross-reactions were observed with two DNA viruses, such as herpes simplex virus and swine pseudorabies virus, and one RNA virus, vesicular stomatitis virus. Furthermore, intra- and inter-assay variability data showed that this method had a highly reproducibility and reliability. Moreover, the current assay was faster and had a higher sensitivity for detection of ECTV genomic DNA in cell cultured and clinical test samples. Therefore, the high sensitivity and reproducibility of this SYBR Green real-time PCR approach is a more effective method than the conventional PCR for ECTV diagnosis and quantitation. Copyright © 2017. Published by Elsevier Ltd.

Calculating Confidence, Uncertainty, and Numbers of Samples When Using Statistical Sampling Approaches to Characterize and Clear Contaminated Areas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piepel, Gregory F.; Matzke, Brett D.; Sego, Landon H.

2013-04-27

This report discusses the methodology, formulas, and inputs needed to make characterization and clearance decisions for Bacillus anthracis-contaminated and uncontaminated (or decontaminated) areas using a statistical sampling approach. Specifically, the report includes the methods and formulas for calculating the • number of samples required to achieve a specified confidence in characterization and clearance decisions • confidence in making characterization and clearance decisions for a specified number of samples for two common statistically based environmental sampling approaches. In particular, the report addresses an issue raised by the Government Accountability Office by providing methods and formulas to calculate the confidence that amore » decision area is uncontaminated (or successfully decontaminated) if all samples collected according to a statistical sampling approach have negative results. Key to addressing this topic is the probability that an individual sample result is a false negative, which is commonly referred to as the false negative rate (FNR). The two statistical sampling approaches currently discussed in this report are 1) hotspot sampling to detect small isolated contaminated locations during the characterization phase, and 2) combined judgment and random (CJR) sampling during the clearance phase. Typically if contamination is widely distributed in a decision area, it will be detectable via judgment sampling during the characterization phrase. Hotspot sampling is appropriate for characterization situations where contamination is not widely distributed and may not be detected by judgment sampling. CJR sampling is appropriate during the clearance phase when it is desired to augment judgment samples with statistical (random) samples. The hotspot and CJR statistical sampling approaches are discussed in the report for four situations: 1. qualitative data (detect and non-detect) when the FNR = 0 or when using statistical sampling methods that account for FNR > 0 2. qualitative data when the FNR > 0 but statistical sampling methods are used that assume the FNR = 0 3. quantitative data (e.g., contaminant concentrations expressed as CFU/cm2) when the FNR = 0 or when using statistical sampling methods that account for FNR > 0 4. quantitative data when the FNR > 0 but statistical sampling methods are used that assume the FNR = 0. For Situation 2, the hotspot sampling approach provides for stating with Z% confidence that a hotspot of specified shape and size with detectable contamination will be found. Also for Situation 2, the CJR approach provides for stating with X% confidence that at least Y% of the decision area does not contain detectable contamination. Forms of these statements for the other three situations are discussed in Section 2.2. Statistical methods that account for FNR > 0 currently only exist for the hotspot sampling approach with qualitative data (or quantitative data converted to qualitative data). This report documents the current status of methods and formulas for the hotspot and CJR sampling approaches. Limitations of these methods are identified. Extensions of the methods that are applicable when FNR = 0 to account for FNR > 0, or to address other limitations, will be documented in future revisions of this report if future funding supports the development of such extensions. For quantitative data, this report also presents statistical methods and formulas for 1. quantifying the uncertainty in measured sample results 2. estimating the true surface concentration corresponding to a surface sample 3. quantifying the uncertainty of the estimate of the true surface concentration. All of the methods and formulas discussed in the report were applied to example situations to illustrate application of the methods and interpretation of the results.« less

Mineral composition of urinary calculi from miniature schnauzer dogs.

PubMed

Klausner, J S; Osborne, C A; Clinton, C W; Stevens, J B; Griffith, D P

1981-05-15

The mineral composition of 150 calculi from the urinary tracts of Miniature Schnauzer dogs was determined by qualitative and quantitative methods. Struvite was the predominant mineral in 92% of the calculi. Other calculi contained predominantly apatite, calcium oxalate, ammonium urate, or silica. Most calculi were from the urinary bladder or urethra, or both. Four were from the renal pelves. Struvite calculi were more frequently encountered in females than males. The mean age of the dogs at the time of detection of calculi was 4.8 years. Qualitative analysis failed to detect some minerals that were identified by quantitative analysis.

Taqman real-time quantitative PCR for identification of western flower thrip (Frankliniella occidentalis) for plant quarantine

PubMed Central

Huang, K. S.; Lee, S. E.; Yeh, Y.; Shen, G. S.; Mei, E.; Chang, C. M.

2010-01-01

Western flower thrip (Frankliniella occidentalis) is a major global pest of agricultural products. It directly damages crops through feeding, oviposition activity or transmission of several plant viruses. We describe a Taqman real-time quantitative PCR detection system, which can rapidly identify F. occidentalis from thrips larvae to complement the traditional morphological identification. The data showed that our detection system targeted on the ribosomal RNA gene regions of F. occidentalis has high sensitivity and specificity. The rapid method can be used for on-site testing of samples at ports-of-entry in the future. PMID:20129946

Taqman real-time quantitative PCR for identification of western flower thrip (Frankliniella occidentalis) for plant quarantine.

PubMed

Huang, K S; Lee, S E; Yeh, Y; Shen, G S; Mei, E; Chang, C M

2010-08-23

Western flower thrip (Frankliniella occidentalis) is a major global pest of agricultural products. It directly damages crops through feeding, oviposition activity or transmission of several plant viruses. We describe a Taqman real-time quantitative PCR detection system, which can rapidly identify F. occidentalis from thrips larvae to complement the traditional morphological identification. The data showed that our detection system targeted on the ribosomal RNA gene regions of F. occidentalis has high sensitivity and specificity. The rapid method can be used for on-site testing of samples at ports-of-entry in the future.

Quantifying (dis)agreement between direct detection experiments in a halo-independent way

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feldstein, Brian; Kahlhoefer, Felix, E-mail: brian.feldstein@physics.ox.ac.uk, E-mail: felix.kahlhoefer@physics.ox.ac.uk

We propose an improved method to study recent and near-future dark matter direct detection experiments with small numbers of observed events. Our method determines in a quantitative and halo-independent way whether the experiments point towards a consistent dark matter signal and identifies the best-fit dark matter parameters. To achieve true halo independence, we apply a recently developed method based on finding the velocity distribution that best describes a given set of data. For a quantitative global analysis we construct a likelihood function suitable for small numbers of events, which allows us to determine the best-fit particle physics properties of darkmore » matter considering all experiments simultaneously. Based on this likelihood function we propose a new test statistic that quantifies how well the proposed model fits the data and how large the tension between different direct detection experiments is. We perform Monte Carlo simulations in order to determine the probability distribution function of this test statistic and to calculate the p-value for both the dark matter hypothesis and the background-only hypothesis.« less

Blue Whale Visual and Acoustic Encounter Rates in the Southern California Bight

DTIC Science & Technology

2007-07-01

blue whale (Balaenoptera musculus) visual and acoustic encounter rates was quantitatively evaluated using hourly counts of detected whales during...surveys occurring in April, there were visual and acoustic detections of blue whales in all surveyed months and regions. Encounter rate is...difference between acoustic encounters of singing whales and visual encounters suggest seasonal variation in the ability of each method to detect blue

High-throughput method for the quantitation of metabolites and co-factors from homocysteine-methionine cycle for nutritional status assessment.

PubMed

Da Silva, Laeticia; Collino, Sebastiano; Cominetti, Ornella; Martin, Francois-Pierre; Montoliu, Ivan; Moreno, Sergio Oller; Corthesy, John; Kaput, Jim; Kussmann, Martin; Monteiro, Jacqueline Pontes; Guiraud, Seu Ping

2016-09-01

There is increasing interest in the profiling and quantitation of methionine pathway metabolites for health management research. Currently, several analytical approaches are required to cover metabolites and co-factors. We report the development and the validation of a method for the simultaneous detection and quantitation of 13 metabolites in red blood cells. The method, validated in a cohort of healthy human volunteers, shows a high level of accuracy and reproducibility. This high-throughput protocol provides a robust coverage of central metabolites and co-factors in one single analysis and in a high-throughput fashion. In large-scale clinical settings, the use of such an approach will significantly advance the field of nutritional research in health and disease.

Blood Pyrrole-Protein Adducts--A Biomarker of Pyrrolizidine Alkaloid-Induced Liver Injury in Humans.

PubMed

Ruan, Jianqing; Gao, Hong; Li, Na; Xue, Junyi; Chen, Jie; Ke, Changqiang; Ye, Yang; Fu, Peter Pi-Cheng; Zheng, Jiang; Wang, Jiyao; Lin, Ge

2015-01-01

Pyrrolizidine alkaloids (PAs) induce liver injury (PA-ILI) and is very likely to contribute significantly to drug-induced liver injury (DILI). In this study we used a newly developed ultra-high performance liquid chromatography-triple quadrupole-mass spectrometry (UHPLC-MS)-based method to detect and quantitate blood pyrrole-protein adducts in DILI patients. Among the 46 suspected DILI patients, 15 were identified as PA-ILI by the identification of PA-containing herbs exposed. Blood pyrrole-protein adducts were detected in all PA-ILI patients (100%). These results confirm that PA-ILI is one of the major causes of DILI and that blood pyrrole-protein adducts quantitated by the newly developed UHPLC-MS method can serve as a specific biomarker of PA-ILI.

[Development of methods for determining acrylamide in food products by gas-liquid chromatography].

PubMed

Bessonov, V V; Malinkin, A D; Perederiaev, O I; Bogachuk, M N; Volkovich, S V; Medvedev, Iu V

2011-01-01

The method of determination of acrylamide in various food (milk powder, potato chips, instant coffee) by gas-liquid chromatography after pre-bromination was developed. Studies have shown the possibility of using bromination of acrylamide to give it the necessary properties for better extraction, purification and detection. Also revealed the possibility of qualitative and quantitative determine a acrylamide in food by gas-liquid chromatography with detection by electron capture detector.

Contribution of flow-volume curves to the detection of central airway obstruction*

PubMed Central

Raposo, Liliana Bárbara Perestrelo de Andrade e; Bugalho, António; Gomes, Maria João Marques

2013-01-01

OBJECTIVE: To assess the sensitivity and specificity of flow-volume curves in detecting central airway obstruction (CAO), and to determine whether their quantitative and qualitative criteria are associated with the location, type and degree of obstruction. METHODS: Over a four-month period, we consecutively evaluated patients with bronchoscopy indicated. Over a one-week period, all patients underwent clinical evaluation, flow-volume curve, bronchoscopy, and completed a dyspnea scale. Four reviewers, blinded to quantitative and clinical data, and bronchoscopy results, classified the morphology of the curves. A fifth reviewer determined the morphological criteria, as well as the quantitative criteria. RESULTS: We studied 82 patients, 36 (44%) of whom had CAO. The sensitivity and specificity of the flow-volume curves in detecting CAO were, respectively, 88.9% and 91.3% (quantitative criteria) and 30.6% and 93.5% (qualitative criteria). The most prevalent quantitative criteria in our sample were FEF50%/FIF50% ≥ 1, in 83% of patients, and FEV1/PEF ≥ 8 mL . L–1 . min–1, in 36%, both being associated with the type, location, and degree of obstruction (p < 0.05). There was concordance among the reviewers as to the presence of CAO. There is a relationship between the degree of obstruction and dyspnea. CONCLUSIONS: The quantitative criteria should always be calculated for flow-volume curves in order to detect CAO, because of the low sensitivity of the qualitative criteria. Both FEF50%/FIF50% ≥ 1 and FEV1/PEF ≥ 8 mL . L–1 . min–1 were associated with the location, type and degree of obstruction. PMID:24068266

Methods for threshold determination in multiplexed assays

DOEpatents

Tammero, Lance F. Bentley; Dzenitis, John M; Hindson, Benjamin J

2014-06-24

Methods for determination of threshold values of signatures comprised in an assay are described. Each signature enables detection of a target. The methods determine a probability density function of negative samples and a corresponding false positive rate curve. A false positive criterion is established and a threshold for that signature is determined as a point at which the false positive rate curve intersects the false positive criterion. A method for quantitative analysis and interpretation of assay results together with a method for determination of a desired limit of detection of a signature in an assay are also described.

Simultaneous quantitative determination of six active components in traditional Chinese medicinal preparation Cerebralcare Granule® by RP-HPLC coupled with diode array detection for quality control.

PubMed

Wang, Xiang-yang; Ma, Xiao-hui; Li, Wei; Chu, Yang; Guo, Jia-hua; Zhou, Shui-ping; Zhu, Yong-hong

2014-09-01

A simple, accurate and reliable method for the simultaneous separation and determination of six active components (protocatechuic acid, chlorogenic acid, caffeic acid, paeoniflorin, ferulic acid and rosmarinic acid) in traditional Chinese medicinal preparation Cerebralcare Granule(®) (CG) was developed using reverse-phase high-performance liquid chromatography coupled with diode array detector detection. The chromatographic separation was performed on a Hypersil GOLD C18 column with aqueous formic acid (0.1%, v/v) and acetonitrile as mobile phase at a flow rate of 0.2 ml/min at 30 °C. Because of the different UV characteristics of these components, change detection wavelength method was used for quantitative analysis. All of the analytes showed good linearity (r > 0.9992). The established method showed good precision and relative standard deviations (%) for intra-day and inter-day variations of 0.15-1.81 and 0.11-1.98%, respectively. The validated method was successfully applied to the simultaneously determination of six active components in CG from different batches. © The Author [2013]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Accurate inclusion mass screening: a bridge from unbiased discovery to targeted assay development for biomarker verification.

PubMed

Jaffe, Jacob D; Keshishian, Hasmik; Chang, Betty; Addona, Theresa A; Gillette, Michael A; Carr, Steven A

2008-10-01

Verification of candidate biomarker proteins in blood is typically done using multiple reaction monitoring (MRM) of peptides by LC-MS/MS on triple quadrupole MS systems. MRM assay development for each protein requires significant time and cost, much of which is likely to be of little value if the candidate biomarker is below the detection limit in blood or a false positive in the original discovery data. Here we present a new technology, accurate inclusion mass screening (AIMS), designed to provide a bridge from unbiased discovery to MS-based targeted assay development. Masses on the software inclusion list are monitored in each scan on the Orbitrap MS system, and MS/MS spectra for sequence confirmation are acquired only when a peptide from the list is detected with both the correct accurate mass and charge state. The AIMS experiment confirms that a given peptide (and thus the protein from which it is derived) is present in the plasma. Throughput of the method is sufficient to qualify up to a hundred proteins/week. The sensitivity of AIMS is similar to MRM on a triple quadrupole MS system using optimized sample preparation methods (low tens of ng/ml in plasma), and MS/MS data from the AIMS experiments on the Orbitrap can be directly used to configure MRM assays. The method was shown to be at least 4-fold more efficient at detecting peptides of interest than undirected LC-MS/MS experiments using the same instrumentation, and relative quantitation information can be obtained by AIMS in case versus control experiments. Detection by AIMS ensures that a quantitative MRM-based assay can be configured for that protein. The method has the potential to qualify large number of biomarker candidates based on their detection in plasma prior to committing to the time- and resource-intensive steps of establishing a quantitative assay.

A quantitative headspace-solid-phase microextraction-gas chromatography-flame ionization detector method to analyze short chain free fatty acids in rat feces.

PubMed

Fiorini, Dennis; Boarelli, Maria Chiara; Gabbianelli, Rosita; Ballini, Roberto; Pacetti, Deborah

2016-09-01

This study sought to develop and validate a quantitative method to analyze short chain free fatty acids (SCFAs) in rat feces by solid-phase microextraction and gas chromatography (SPME-GC) using the salt mixture ammonium sulfate and sodium dihydrogen phosphate as salting out agent. Conditioning and extraction time, linearity, limits of detection and quantification, repeatability, and recovery were evaluated. The proposed method allows quantification with improved sensitivity as compared with other methods exploiting SPME-GC. The method has been applied to analyze rat fecal samples, quantifying acetic, propionic, isobutyric, butyric, isopentanoic, pentanoic, and hexanoic acids. Copyright © 2016 Elsevier Inc. All rights reserved.

Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

PubMed

Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

2014-12-10

A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

Surface-Enhanced Raman Scattering Active Plasmonic Nanoparticles with Ultrasmall Interior Nanogap for Multiplex Quantitative Detection and Cancer Cell Imaging.

PubMed

Li, Jiuxing; Zhu, Zhi; Zhu, Bingqing; Ma, Yanli; Lin, Bingqian; Liu, Rudi; Song, Yanling; Lin, Hui; Tu, Song; Yang, Chaoyong

2016-08-02

Due to its large enhancement effect, nanostructure-based surface-enhanced Raman scattering (SERS) technology had been widely applied for bioanalysis and cell imaging. However, most SERS nanostructures suffer from poor signal reproducibility, which hinders the application of SERS nanostructures in quantitative detection. We report an etching-assisted approach to synthesize SERS-active plasmonic nanoparticles with 1 nm interior nanogap for multiplex quantitative detection and cancer cell imaging. Raman dyes and methoxy poly(ethylene glycol) thiol (mPEG-SH) were attached to gold nanoparticles (AuNPs) to prepare gold cores. Next, Ag atoms were deposited on gold cores in the presence of Pluronic F127 to form a Ag shell. HAuCl4 was used to etch the Ag shell and form an interior nanogap in Au@AgAuNPs, leading to increased Raman intensity of dyes. SERS intensity distribution of Au@AgAuNPs was found to be more uniform than that of aggregated AuNPs. Finally, Au@AgAuNPs were used for multiplex quantitative detection and cancer cell imaging. With the advantages of simple and rapid preparation of Au@AgAuNPs with highly uniform, stable, and reproducible Raman intensity, the method reported here will widen the applications of SERS-active nanoparticles in diagnostics and imaging.

Pungency Quantitation of Hot Pepper Sauces Using HPLC

NASA Astrophysics Data System (ADS)

Betts, Thomas A.

1999-02-01

A class of compounds known as capsaicinoids are responsible for the "heat" of hot peppers. To determine the pungency of a particular pepper or pepper product, one may quantify the capsaicinoids and relate those concentrations to the perceived heat. The format of the laboratory described here allows students to collectively develop an HPLC method for the quantitation of the two predominant capsaicinoids (capsaicin and dihydrocapsaicin) in hot-pepper products. Each small group of students investigated one of the following aspects of the method: detector wavelength, mobile-phase composition, extraction of capsaicinoids, calibration, and quantitation. The format of the lab forced students to communicate and cooperate to develop this method. The resulting HPLC method involves extraction with acetonitrile followed by solid-phase extraction clean-up, an isocratic 80:20 methanol-water mobile phase, a 4.6 mm by 25 cm C-18 column, and UV absorbance detection at 284 nm. The method developed by the students was then applied to the quantitation of capsaicinoids in a variety of hot pepper sauces. Editor's Note on Hazards in our April 2000 issue addresses the above.

A novel quantitative real-time polymerase chain reaction method for detecting toxigenic Pasteurella multocida in nasal swabs from swine.

PubMed

Scherrer, Simone; Frei, Daniel; Wittenbrink, Max Michael

2016-12-01

Progressive atrophic rhinitis (PAR) in pigs is caused by toxigenic Pasteurella multocida. In Switzerland, PAR is monitored by selective culture of nasal swabs and subsequent polymerase chain reaction (PCR) screening of bacterial colonies for the P. multocida toxA gene. A panel of 203 nasal swabs from a recent PAR outbreak were used to evaluate a novel quantitative real-time PCR for toxigenic P. multocida in porcine nasal swabs. In comparison to the conventional PCR with a limit of detection of 100 genome equivalents per PCR reaction, the real-time PCR had a limit of detection of 10 genome equivalents. The real-time PCR detected toxA-positive P. multocida in 101 samples (49.8%), whereas the conventional PCR was less sensitive with 90 toxA-positive samples (44.3%). In comparison to the real-time PCR, 5.4% of the toxA-positive samples revealed unevaluable results by conventional PCR. The approach of culture-coupled toxA PCR for the monitoring of PAR in pigs is substantially improved by a novel quantitative real-time PCR.

SU-F-J-112: Clinical Feasibility Test of An RF Pulse-Based MRI Method for the Quantitative Fat-Water Segmentation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yee, S; Wloch, J; Pirkola, M

Purpose: Quantitative fat-water segmentation is important not only because of the clinical utility of fat-suppressed MRI images in better detecting lesions of clinical significance (in the midst of bright fat signal) but also because of the possible physical need, in which CT-like images based on the materials’ photon attenuation properties may have to be generated from MR images; particularly, as in the case of MR-only radiation oncology environment to obtain radiation dose calculation or as in the case of hybrid PET/MR modality to obtain attenuation correction map for the quantitative PET reconstruction. The majority of such fat-water quantitative segmentations havemore » been performed by utilizing the Dixon’s method and its variations, which have to enforce the proper settings (often predefined) of echo time (TE) in the pulse sequences. Therefore, such methods have been unable to be directly combined with those ultrashort TE (UTE) sequences that, taking the advantage of very low TE values (∼ 10’s microsecond), might be beneficial to directly detect bones. Recently, an RF pulse-based method (http://dx.doi.org/10.1016/j.mri.2015.11.006), termed as PROD pulse method, was introduced as a method of quantitative fat-water segmentation that does not have to depend on predefined TE settings. Here, the clinical feasibility of this method is verified in brain tumor patients by combining the PROD pulse with several sequences. Methods: In a clinical 3T MRI, the PROD pulse was combined with turbo spin echo (e.g. TR=1500, TE=16 or 60, ETL=15) or turbo field echo (e.g. TR=5.6, TE=2.8, ETL=12) sequences without specifying TE values. Results: The fat-water segmentation was possible without having to set specific TE values. Conclusion: The PROD pulse method is clinically feasible. Although not yet combined with UTE sequences in our laboratory, the method is potentially compatible with UTE sequences, and thus, might be useful to directly segment fat, water, bone and air.« less

Highly Reproducible Label Free Quantitative Proteomic Analysis of RNA Polymerase Complexes*

PubMed Central

Mosley, Amber L.; Sardiu, Mihaela E.; Pattenden, Samantha G.; Workman, Jerry L.; Florens, Laurence; Washburn, Michael P.

2011-01-01

The use of quantitative proteomics methods to study protein complexes has the potential to provide in-depth information on the abundance of different protein components as well as their modification state in various cellular conditions. To interrogate protein complex quantitation using shotgun proteomic methods, we have focused on the analysis of protein complexes using label-free multidimensional protein identification technology and studied the reproducibility of biological replicates. For these studies, we focused on three highly related and essential multi-protein enzymes, RNA polymerase I, II, and III from Saccharomyces cerevisiae. We found that label-free quantitation using spectral counting is highly reproducible at the protein and peptide level when analyzing RNA polymerase I, II, and III. In addition, we show that peptide sampling does not follow a random sampling model, and we show the need for advanced computational models to predict peptide detection probabilities. In order to address these issues, we used the APEX protocol to model the expected peptide detectability based on whole cell lysate acquired using the same multidimensional protein identification technology analysis used for the protein complexes. Neither method was able to predict the peptide sampling levels that we observed using replicate multidimensional protein identification technology analyses. In addition to the analysis of the RNA polymerase complexes, our analysis provides quantitative information about several RNAP associated proteins including the RNAPII elongation factor complexes DSIF and TFIIF. Our data shows that DSIF and TFIIF are the most highly enriched RNAP accessory factors in Rpb3-TAP purifications and demonstrate our ability to measure low level associated protein abundance across biological replicates. In addition, our quantitative data supports a model in which DSIF and TFIIF interact with RNAPII in a dynamic fashion in agreement with previously published reports. PMID:21048197

Development of a chemiluminescence competitive PCR for the detection and quantification of parvovirus B19 DNA using a microplate luminometer.

PubMed

Fini, F; Gallinella, G; Girotti, S; Zerbini, M; Musiani, M

1999-09-01

Quantitative PCR of viral nucleic acids can be useful clinically in diagnosis, risk assessment, and monitoring of antiviral therapy. We wished to develop a chemiluminescence competitive PCR (cPCR) for parvovirus B19. Parvovirus DNA target sequences and competitor sequences were coamplified and directly labeled. Amplified products were then separately hybridized by specific biotin-labeled probes, captured onto streptavidin-coated ELISA microplates, and detected immunoenzymatically using chemiluminescent substrates of peroxidase. Chemiluminescent signals were quantitatively analyzed by a microplate luminometer and were correlated to the amounts of amplified products. Luminol-based systems displayed constant emission but had a higher detection limit (100-1000 genome copies) than the acridan-based system (20 genome copies). The detection limit of chemiluminescent substrates was lower (20 genome copies) than colorimetric substrates (50 genome copies). In chemiluminescence cPCR, the titration curves showed linear correlation above 100 target genome copies. Chemiluminescence cPCR was positive in six serum samples from patients with parvovirus infections and negative in six control sera. The chemiluminescence cPCR appears to be a sensitive and specific method for the quantitative detection of viral DNAs.

Highlight on Bottlenecks in Food Allergen Analysis: Detection and Quantification by Mass Spectrometry.

PubMed

Planque, Mélanie; Arnould, Thierry; Renard, Patricia; Delahaut, Philippe; Dieu, Marc; Gillard, Nathlie

2017-07-01

Food laboratories have developed methods for testing allergens in foods. The efficiency of qualitative and quantitative methods is of prime importance in protecting allergic populations. Unfortunately, food laboratories encounter barriers to developing efficient methods. Bottlenecks include the lack of regulatory thresholds, delays in the emergence of reference materials and guidelines, and the need to detect processed allergens. In this study, ultra-HPLC coupled to tandem MS was used to illustrate difficulties encountered in determining method performances. We measured the major influences of both processing and matrix effects on the detection of egg, milk, soy, and peanut allergens in foodstuffs. The main goals of this work were to identify difficulties that food laboratories still encounter in detecting and quantifying allergens and to sensitize researchers to them.

[Detection of recombinant-DNA in foods from stacked genetically modified plants].

PubMed

Sorokina, E Iu; Chernyshova, O N

2012-01-01

A quantitative real-time multiplex polymerase chain reaction method was applied to the detection and quantification of MON863 and MON810 in stacked genetically modified maize MON 810xMON 863. The limit of detection was approximately 0,1%. The accuracy of the quantification, measured as bias from the accepted value and the relative repeatability standard deviation, which measures the intra-laboratory variability, were within 25% at each GM-level. A method verification has demonstrated that the MON 863 and the MON810 methods can be equally applied in quantification of the respective events in stacked MON810xMON 863.

Development of an innovative immunoassay for CP4EPSPS and Cry1AB genetically modified protein detection and quantification.

PubMed

Ermolli, M; Prospero, A; Balla, B; Querci, M; Mazzeo, A; Van Den Eede, G

2006-09-01

An innovative immunoassay, called enzyme-linked immunoabsorbant assay (ELISA) Reverse, based on a new conformation of the solid phase, was developed. The solid support was expressly designed to be immersed directly in liquid samples to detect the presence of protein targets. Its application is proposed in those cases where a large number of samples have to be screened simultaneously or when the simultaneous detection of different proteins is required. As a first application, a quantitative immunoassay for Cry1AB protein in genetically modified maize was optimized. The method was tested using genetically modified organism concentrations from 0.1 to 2.0%. The limit of detection and limit of quantitation of the method were determined as 0.0056 and 0.0168 (expressed as the percentage of genetically modified organisms content), respectively. A qualitative multiplex assay to assess the presence of two genetically modified proteins simultaneously was also established for the case of the Cry1AB and the CP4EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) present in genetically modified maize and soy, respectively.

In-house validation of a method for determination of silver nanoparticles in chicken meat based on asymmetric flow field-flow fractionation and inductively coupled plasma mass spectrometric detection.

PubMed

Loeschner, Katrin; Navratilova, Jana; Grombe, Ringo; Linsinger, Thomas P J; Købler, Carsten; Mølhave, Kristian; Larsen, Erik H

2015-08-15

Nanomaterials are increasingly used in food production and packaging, and validated methods for detection of nanoparticles (NPs) in foodstuffs need to be developed both for regulatory purposes and product development. Asymmetric flow field-flow fractionation with inductively coupled plasma mass spectrometric detection (AF(4)-ICP-MS) was applied for quantitative analysis of silver nanoparticles (AgNPs) in a chicken meat matrix following enzymatic sample preparation. For the first time an analytical validation of nanoparticle detection in a food matrix by AF(4)-ICP-MS has been carried out and the results showed repeatable and intermediately reproducible determination of AgNP mass fraction and size. The findings demonstrated the potential of AF(4)-ICP-MS for quantitative analysis of NPs in complex food matrices for use in food monitoring and control. The accurate determination of AgNP size distribution remained challenging due to the lack of certified size standards. Copyright © 2015 Elsevier Ltd. All rights reserved.

Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

PubMed

Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

2008-07-23

A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

Ratiometric Raman Spectroscopy for Quantification of Protein Oxidative Damage

PubMed Central

Jiang, Dongping; Yanney, Michael; Zou, Sige; Sygula, Andrzej

2009-01-01

A novel ratiometric Raman spectroscopic (RMRS) method has been developed for quantitative determination of protein carbonyl levels. Oxidized bovine serum albumin (BSA) and oxidized lysozyme were used as model proteins to demonstrate this method. The technique involves conjugation of protein carbonyls with dinitrophenyl hydrazine (DNPH), followed by drop coating deposition Raman spectral acquisition (DCDR). The RMRS method is easy to implement as it requires only one conjugation reaction, a single spectral acquisition, and does not require sample calibration. Characteristic peaks from both protein and DNPH moieties are obtained in a single spectral acquisition, allowing the protein carbonyl level to be calculated from the peak intensity ratio. Detection sensitivity for the RMRS method is ~0.33 pmol carbonyl/measurement. Fluorescence and/or immunoassay based techniques only detect a signal from the labeling molecule and thus yield no structural or quantitative information for the modified protein while the RMRS technique provides for protein identification and protein carbonyl quantification in a single experiment. PMID:19457432

Simultaneous determination of seven multiclass veterinary antibiotics in surface water samples in the Republic of Korea using liquid chromatography with tandem mass spectrometry.

PubMed

Chung, Hyung Suk; Choi, Jeong-Heui; Abd El-Aty, A M; Lee, Young-Jun; Lee, Han Sol; Kim, Sangdon; Jung, Hee-Jung; Kang, Tae-Woo; Shin, Ho-Chul; Shim, Jae-Han

2016-12-01

A simultaneous determination method using solid-phase extraction and liquid chromatography with tandem mass spectrometry was developed to detect and quantify the presence of seven multiclass veterinary antibiotics (13 compounds in total) in surface water samples, which included the effluents of livestock wastewater and sewage treatment plants, as well as the reservoir drainage areas from dense animal farms. The pH of all water samples was adjusted to 2 or 6 before solid-phase extraction using Oasis HLB cartridges. The developed method was fully validated in terms of linearity, method detection limit, method quantitation limit, accuracy, and precision. The linearity of all tested drugs was good, with R 2 determination coefficients ≥ 0.9931. The method detection limits and method quantitation limits were 0.1-74.3 and 0.5-236.6 ng/L, respectively. Accuracy and precision values were 71-120 and 1-17%, respectively. The determination method was successfully applied for monitoring water samples obtained from the Yeongsan River in 2015. The most frequently detected antibiotics were lincomycin (96%), sulfamethazine (90%), sulfamethoxazole (88%), and sulfathiazole (50%); the maximum concentrations of which were 398.9, 1151.3, 533.1, and 307.4 ng/L, respectively. Overall, the greatest numbers and concentrations of detected antibiotics were found in samples from the effluents of livestock wastewater, sewage treatment plants, and reservoir drainage areas. Diverse veterinary antibiotics were present, and their presence was dependent upon the commercial sales and environmental properties of the analytes, the geographical positions of the sampling points, and the origin of the water. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An overview of recent developments and current status of gluten ELISA methods

USDA-ARS?s Scientific Manuscript database

ELISA methods for detecting and quantitating allergens have been around for some time and they are continuously improved. In this context, the development of gluten methods is no exception. Around the turn of the millennium, doubts were raised whether the existing “Skerritt-ELISA” would meet the 20 ...

High-throughput detection and screening of plants modified by gene editing using quantitative real-time polymerase chain reaction.

PubMed

Peng, Cheng; Wang, Hua; Xu, Xiaoli; Wang, Xiaofu; Chen, Xiaoyun; Wei, Wei; Lai, Yongmin; Liu, Guoquan; Godwin, Ian Douglas; Li, Jieqin; Zhang, Ling; Xu, Junfeng

2018-05-15

Gene editing techniques are becoming powerful tools for modifying target genes in organisms. Although several methods have been developed to detect gene-edited organisms, these techniques are time and labour intensive. Meanwhile, few studies have investigated high-throughput detection and screening strategies for plants modified by gene editing. In this study, we developed a simple, sensitive and high-throughput quantitative real-time (qPCR)-based method. The qPCR-based method exploits two differently labelled probes that are placed within one amplicon at the gene editing target site to simultaneously detect the wild-type and a gene-edited mutant. We showed that the qPCR-based method can accurately distinguish CRISPR/Cas9-induced mutants from the wild-type in several different plant species, such as Oryza sativa, Arabidopsis thaliana, Sorghum bicolor, and Zea mays. Moreover, the method can subsequently determine the mutation type by direct sequencing of the qPCR products of mutations due to gene editing. The qPCR-based method is also sufficiently sensitive to distinguish between heterozygous and homozygous mutations in T 0 transgenic plants. In a 384-well plate format, the method enabled the simultaneous analysis of up to 128 samples in three replicates without handling the post-polymerase chain reaction (PCR) products. Thus, we propose that our method is an ideal choice for screening plants modified by gene editing from many candidates in T 0 transgenic plants, which will be widely used in the area of plant gene editing. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.

Light scattering application for quantitative estimation of apoptosis

NASA Astrophysics Data System (ADS)

Bilyy, Rostyslav O.; Stoika, Rostyslav S.; Getman, Vasyl B.; Bilyi, Olexander I.

2004-05-01

Estimation of cell proliferation and apoptosis are in focus of instrumental methods used in modern biomedical sciences. Present study concerns monitoring of functional state of cells, specifically the development of their programmed death or apoptosis. The available methods for such purpose are either very expensive, or require time-consuming operations. Their specificity and sensitivity are frequently not sufficient for making conclusions which could be used in diagnostics or treatment monitoring. We propose a novel method for apoptosis measurement based on quantitative determination of cellular functional state taking into account their physical characteristics. This method uses the patented device -- laser microparticle analyser PRM-6 -- for analyzing light scattering by the microparticles, including cells. The method gives an opportunity for quick, quantitative, simple (without complicated preliminary cell processing) and relatively cheap measurement of apoptosis in cellular population. The elaborated method was used for studying apoptosis expression in murine leukemia cells of L1210 line and human lymphoblastic leukemia cells of K562 line. The results obtained by the proposed method permitted measuring cell number in tested sample, detecting and quantitative characterization of functional state of cells, particularly measuring the ratio of the apoptotic cells in suspension.

A further component analysis for illicit drugs mixtures with THz-TDS

NASA Astrophysics Data System (ADS)

Xiong, Wei; Shen, Jingling; He, Ting; Pan, Rui

2009-07-01

A new method for quantitative analysis of mixtures of illicit drugs with THz time domain spectroscopy was proposed and verified experimentally. In traditional method we need fingerprints of all the pure chemical components. In practical as only the objective components in a mixture and their absorption features are known, it is necessary and important to present a more practical technique for the detection and identification. Our new method of quantitatively inspect of the mixtures of illicit drugs is developed by using derivative spectrum. In this method, the ratio of objective components in a mixture can be obtained on the assumption that all objective components in the mixture and their absorption features are known but the unknown components are not needed. Then methamphetamine and flour, a illicit drug and a common adulterant, were selected for our experiment. The experimental result verified the effectiveness of the method, which suggested that it could be an effective method for quantitative identification of illicit drugs. This THz spectroscopy technique is great significant in the real-world applications of illicit drugs quantitative analysis. It could be an effective method in the field of security and pharmaceuticals inspection.

Brain Injury Lesion Imaging Using Preconditioned Quantitative Susceptibility Mapping without Skull Stripping.

PubMed

Soman, S; Liu, Z; Kim, G; Nemec, U; Holdsworth, S J; Main, K; Lee, B; Kolakowsky-Hayner, S; Selim, M; Furst, A J; Massaband, P; Yesavage, J; Adamson, M M; Spincemallie, P; Moseley, M; Wang, Y

2018-04-01

Identifying cerebral microhemorrhage burden can aid in the diagnosis and management of traumatic brain injury, stroke, hypertension, and cerebral amyloid angiopathy. MR imaging susceptibility-based methods are more sensitive than CT for detecting cerebral microhemorrhage, but methods other than quantitative susceptibility mapping provide results that vary with field strength and TE, require additional phase maps to distinguish blood from calcification, and depict cerebral microhemorrhages as bloom artifacts. Quantitative susceptibility mapping provides universal quantification of tissue magnetic property without these constraints but traditionally requires a mask generated by skull-stripping, which can pose challenges at tissue interphases. We evaluated the preconditioned quantitative susceptibility mapping MR imaging method, which does not require skull-stripping, for improved depiction of brain parenchyma and pathology. Fifty-six subjects underwent brain MR imaging with a 3D multiecho gradient recalled echo acquisition. Mask-based quantitative susceptibility mapping images were created using a commonly used mask-based quantitative susceptibility mapping method, and preconditioned quantitative susceptibility images were made using precondition-based total field inversion. All images were reviewed by a neuroradiologist and a radiology resident. Ten subjects (18%), all with traumatic brain injury, demonstrated blood products on 3D gradient recalled echo imaging. All lesions were visible on preconditioned quantitative susceptibility mapping, while 6 were not visible on mask-based quantitative susceptibility mapping. Thirty-one subjects (55%) demonstrated brain parenchyma and/or lesions that were visible on preconditioned quantitative susceptibility mapping but not on mask-based quantitative susceptibility mapping. Six subjects (11%) demonstrated pons artifacts on preconditioned quantitative susceptibility mapping and mask-based quantitative susceptibility mapping; they were worse on preconditioned quantitative susceptibility mapping. Preconditioned quantitative susceptibility mapping MR imaging can bring the benefits of quantitative susceptibility mapping imaging to clinical practice without the limitations of mask-based quantitative susceptibility mapping, especially for evaluating cerebral microhemorrhage-associated pathologies, such as traumatic brain injury. © 2018 by American Journal of Neuroradiology.

Simultaneous determination of rhamnose, xylitol, arabitol, fructose, glucose, inositol, sucrose, maltose in jujube (Zizyphus jujube Mill.) extract: comparison of HPLC-ELSD, LC-ESI-MS/MS and GC-MS.

PubMed

Sun, Shihao; Wang, Hui; Xie, Jianping; Su, Yue

2016-01-01

Jujube extract is commonly used as a food additive and flavoring. The sensory properties of the extract, especially sweetness, are a critical factor determining the product quality and therefore affecting consumer acceptability. Small molecular carbohydrates make major contribution to the sweetness of the jujube extract, and their types and contents in the extract have direct influence on quality of the product. So, an appropriate qualitative and quantitative method for determination of the carbohydrates is vitally important for quality control of the product. High performance liquid chromatography-evaporative light scattering detection (HPLC-ELSD), liquid chromatography-electronic spay ionization tandem mass spectrometry (LC-ESI-MS/MS), and gas chromatography-mass spectrometry (GC-MS) methods have been developed and applied to determining small molecular carbohydrates in jujube extract, respectively. Eight sugars and alditols were identified from the extract, including rhamnose, xylitol, arabitol, fructose, glucose, inositol, sucrose, and maltose. Comparisons were carried out to investigate the performance of the methods. Although the methods have been found to perform satisfactorily, only three sugars (fructose, glucose and inositol) could be detected by all these methods. Meanwhile, a similar quantitative result for the three sugars can be obtained by the methods. Eight sugars and alditols in the jujube extract were determined by HPLC-ELSD, LC-ESI-MS/MS and GC-MS, respectively. The LC-ELSD method and the LC-ESI-MS/MS method with good precision and accuracy were suitable for quantitative analysis of carbohydrates in jujube extract; although the performance of the GC-MS method for quantitative analysis was inferior to the other methods, it has a wider scope in qualitative analysis. A multi-analysis technique should be adopted in order to obtain complete constituents of about the carbohydrates in jujube extract, and the methods should be employed according to the purpose of analysis.

Quantitation of N-ethyl-3,4-methylenedioxyamphetamine and its major metabolites in human plasma by high-performance liquid chromatography and fluorescence detection.

PubMed

Brunnenberg, M; Lindenblatt, H; Gouzoulis-Mayfrank, E; Kovar, K A

1998-11-20

A HPLC method has been developed for the analogue of Ecstasy MDE and its major metabolites N-ethyl-4-hydroxy-3-methoxyamphetamine (HME) and 3,4-methylenedioxyamphetamine (MDA) in human plasma. In the course of our investigations we found that the methylenedioxyamphetamines and HME exhibit fluorescence at 322 nm. Therefore the detection could be carried out with a fluorescence (FL) detector. Solid-phase extraction was used for sample preparation and yielded high recovery rates greater than 95%. The limit of quantitation for MDE and its metabolites in the extracts was between 1.5 and 8.9 ng/ml and the method standard deviations were less than 5%. This sensitive, rapid and reliable analytical method has been used successfully in the quantitation of the substances in plasma samples obtained from 14 volunteers in two clinical studies after p.o. administration of 100 to 140 mg MDE*HCI. The maximum plasma concentrations were 235-465 ng/ml (MDE), 67-673 ng/ml (HME) and 7-33 ng/ml (MDA), respectively. Pharmacokinetic parameters have been investigated using the plasma concentration curves.

Efficient quantitative assessment of facial paralysis using iris segmentation and active contour-based key points detection with hybrid classifier.

PubMed

Barbosa, Jocelyn; Lee, Kyubum; Lee, Sunwon; Lodhi, Bilal; Cho, Jae-Gu; Seo, Woo-Keun; Kang, Jaewoo

2016-03-12

Facial palsy or paralysis (FP) is a symptom that loses voluntary muscles movement in one side of the human face, which could be very devastating in the part of the patients. Traditional methods are solely dependent to clinician's judgment and therefore time consuming and subjective in nature. Hence, a quantitative assessment system becomes apparently invaluable for physicians to begin the rehabilitation process; and to produce a reliable and robust method is challenging and still underway. We introduce a novel approach for a quantitative assessment of facial paralysis that tackles classification problem for FP type and degree of severity. Specifically, a novel method of quantitative assessment is presented: an algorithm that extracts the human iris and detects facial landmarks; and a hybrid approach combining the rule-based and machine learning algorithm to analyze and prognosticate facial paralysis using the captured images. A method combining the optimized Daugman's algorithm and Localized Active Contour (LAC) model is proposed to efficiently extract the iris and facial landmark or key points. To improve the performance of LAC, appropriate parameters of initial evolving curve for facial features' segmentation are automatically selected. The symmetry score is measured by the ratio between features extracted from the two sides of the face. Hybrid classifiers (i.e. rule-based with regularized logistic regression) were employed for discriminating healthy and unhealthy subjects, FP type classification, and for facial paralysis grading based on House-Brackmann (H-B) scale. Quantitative analysis was performed to evaluate the performance of the proposed approach. Experiments show that the proposed method demonstrates its efficiency. Facial movement feature extraction on facial images based on iris segmentation and LAC-based key point detection along with a hybrid classifier provides a more efficient way of addressing classification problem on facial palsy type and degree of severity. Combining iris segmentation and key point-based method has several merits that are essential for our real application. Aside from the facial key points, iris segmentation provides significant contribution as it describes the changes of the iris exposure while performing some facial expressions. It reveals the significant difference between the healthy side and the severe palsy side when raising eyebrows with both eyes directed upward, and can model the typical changes in the iris region.

Optical demodulation system for digitally encoded suspension array in fluoroimmunoassay

NASA Astrophysics Data System (ADS)

He, Qinghua; Li, Dongmei; He, Yonghong; Guan, Tian; Zhang, Yilong; Shen, Zhiyuan; Chen, Xuejing; Liu, Siyu; Lu, Bangrong; Ji, Yanhong

2017-09-01

A laser-induced breakdown spectroscopy and fluorescence spectroscopy-coupled optical system is reported to demodulate digitally encoded suspension array in fluoroimmunoassay. It takes advantage of the plasma emissions of assembled elemental materials to digitally decode the suspension array, providing a more stable and accurate recognition to target biomolecules. By separating the decoding procedure of suspension array and adsorption quantity calculation of biomolecules into two independent channels, the cross talk between decoding and label signals in traditional methods had been successfully avoided, which promoted the accuracy of both processes and realized more sensitive quantitative detection of target biomolecules. We carried a multiplexed detection of several types of anti-IgG to verify the quantitative analysis performance of the system. A limit of detection of 1.48×10-10 M was achieved, demonstrating the detection sensitivity of the optical demodulation system.

Indirect competitive assays on DVD for direct multiplex detection of drugs of abuse in oral fluids.

PubMed

Zhang, Lingling; Li, Xiaochun; Li, Yunchao; Shi, Xiaoli; Yu, Hua-Zhong

2015-02-03

On-site oral fluid testing for drugs of abuse has become prominent in order to take immediate administrative action in an enforcement process. Herein, we report a DVD technology-based indirect competitive immunoassay platform for the quantitative detection of drugs of abuse. A microfluidic approach was adapted to prepare multiplex immunoassays on a standard DVD-R, an unmodified multimode DVD/Blu-Ray drive to read signal, and a free disc-quality analysis software program to process the data. The DVD assay platform was successfully demonstrated for the simultaneous, quantitative detection of drug candidates (morphine and cocaine) in oral fluids with high selectivity. The detection limit achieved was as low as 1.0 ppb for morphine and 5.0 ppb for cocaine, comparable with that of standard mass spectrometry and ELISA methods.

Theory and Application of Magnetic Flux Leakage Pipeline Detection.

PubMed

Shi, Yan; Zhang, Chao; Li, Rui; Cai, Maolin; Jia, Guanwei

2015-12-10

Magnetic flux leakage (MFL) detection is one of the most popular methods of pipeline inspection. It is a nondestructive testing technique which uses magnetic sensitive sensors to detect the magnetic leakage field of defects on both the internal and external surfaces of pipelines. This paper introduces the main principles, measurement and processing of MFL data. As the key point of a quantitative analysis of MFL detection, the identification of the leakage magnetic signal is also discussed. In addition, the advantages and disadvantages of different identification methods are analyzed. Then the paper briefly introduces the expert systems used. At the end of this paper, future developments in pipeline MFL detection are predicted.

Theory and Application of Magnetic Flux Leakage Pipeline Detection

PubMed Central

Shi, Yan; Zhang, Chao; Li, Rui; Cai, Maolin; Jia, Guanwei

2015-01-01

Magnetic flux leakage (MFL) detection is one of the most popular methods of pipeline inspection. It is a nondestructive testing technique which uses magnetic sensitive sensors to detect the magnetic leakage field of defects on both the internal and external surfaces of pipelines. This paper introduces the main principles, measurement and processing of MFL data. As the key point of a quantitative analysis of MFL detection, the identification of the leakage magnetic signal is also discussed. In addition, the advantages and disadvantages of different identification methods are analyzed. Then the paper briefly introduces the expert systems used. At the end of this paper, future developments in pipeline MFL detection are predicted. PMID:26690435

A competitive chemiluminescence enzyme immunoassay method for β-defensin-2 detection in transgenic mice.

PubMed

Yang, Xi; Zhou, Tao; Yu, Lei; Tan, Wenwen; Zhou, Rui; Hu, Yonggang

2015-03-01

A competitive chemiluminescence enzyme immunoassay (CLEIA) method for porcine β-defensin-2 (pBD-2) detection in transgenic mice was established. Several factors that affect detection, including luminol, p-iodophenol and hydrogen peroxide concentrations, as well as pH, were studied and optimized. The linear range of the proposed method for pBD-2 detection under optimal conditions was 0.05-80 ng/mL with a correlation coefficient of 0.9960. Eleven detections of a 30 ng/mL pBD-2 standard sample were performed. Reproducible results were obtained with a relative standard deviation of 3.94%. The limit of detection of the method for pBD-2 was 3.5 pg/mL (3σ). The proposed method was applied to determine pBD-2 expression levels in the tissues of pBD-2 transgenic mice, and compared with LC-MS/MS and quantitative real-time reverse-transcriptase polymerase chain reaction. This suggests that the CLEIA can be used as a valuable method to detect and quantify pBD-2. Copyright © 2014 John Wiley & Sons, Ltd.

Development of a pressurized liquid extraction-solid-phase extraction followed by liquid chromatography-electrospray ionization tandem mass spectrometry method for the quantitative determination of benzoxazolinones and their degradation products in agricultural soil.

PubMed

Villagrasa, M; Guillamón, M; Navarro, A; Eljarrat, E; Barceló, D

2008-02-01

A new analytical method for the quantitative determination of benzoxazolinones and their degradation products in agricultural soils based on the use of pressurized liquid extraction (PLE) followed by solid-phase extraction (SPE) and then instrumental determination using liquid chromatography-electrospray ionization tandem mass spectrometry (LC-ESI-MS-MS) is described. Using this method, the characterization, separation and quantitative detection of a mixture of two benzoxazolinones, benzoxazolin-2-one (BOA) and 6-methoxybenzoxazolin-2-one (MBOA) and their degradation products, 2-aminophenol (APH), N-(2-hydroxyphenyl)malonamic acid (HMPMA), 2-amino-3-H-phenoxazin-3-one (APO), 9-methoxy-2-amino-3-H-phenoxazin-3-one (AMPO), 2-acetylamino-3-H-phenoxazin-3-one (AAPO) and 2-acetylamino-9-methoxy-2-amino-3-H-phenoxazin-3-one (AAMPO) was achieved. The complete LC-ESI-MS-MS precursor-product ion fragmentation pathways for the degradation products of benzoxazolinones are described for the first time. Quantitative analysis was done in the multiple reaction mode using two specific combinations of precursor-product ion transitions for each compound. The optimized method was quality assessed by the measure of parameter as recovery, linearity, sensitivity, repeatability and reproducibility. Recoveries of the analytes ranged from 53 to 123%. The developed method offered improvements to the sensitivity as compared with our previously LC-MS method, with detection limits down to 2.4-21 ng/g of dry weight. This achievement allows us to identify and quantify for the first time degradation products of benzoxazolinones in real agricultural soil samples. Analytes were found in the range of 20.6-149 ng/g dry weight.

Clinical neurophysiology and quantitative sensory testing in the investigation of orofacial pain and sensory function.

PubMed

Jääskeläinen, Satu K

2004-01-01

Chronic orofacial pain represents a diagnostic and treatment challenge for the clinician. Some conditions, such as atypical facial pain, still lack proper diagnostic criteria, and their etiology is not known. The recent development of neurophysiological methods and quantitative sensory testing for the examination of the trigeminal somatosensory system offers several tools for diagnostic and etiological investigation of orofacial pain. This review presents some of these techniques and the results of their application in studies on orofacial pain and sensory dysfunction. Clinical neurophysiological investigation has greater diagnostic accuracy and sensitivity than clinical examination in the detection of the neurogenic abnormalities of either peripheral or central origin that may underlie symptoms of orofacial pain and sensory dysfunction. Neurophysiological testing may also reveal trigeminal pathology when magnetic resonance imaging has failed to detect it, so these methods should be considered complementary to each other in the investigation of orofacial pain patients. The blink reflex, corneal reflex, jaw jerk, sensory neurography of the inferior alveolar nerve, and the recording of trigeminal somatosensory-evoked potentials with near-nerve stimulation have all proved to be sensitive and reliable in the detection of dysfunction of the myelinated sensory fibers of the trigeminal nerve or its central connections within the brainstem. With appropriately small thermodes, thermal quantitative sensory testing is useful for the detection of trigeminal small-fiber dysfunction (Adelta and C). In neuropathic conditions, it is most sensitive to lesions causing axonal injury. By combining different techniques for investigation of the trigeminal system, an accurate topographical diagnosis and profile of sensory fiber pathology can be determined. Neurophysiological and quantitative sensory tests have already highlighted some similarities among various orofacial pain conditions and have shown heterogeneity within clinical diagnostic categories. With the aid of neurophysiological recordings and quantitative sensory testing, it is possible to approach a mechanism-based classification of orofacial pain.

Evaluation of a combined triple method to detect causative HPV in oral and oropharyngeal squamous cell carcinomas: p16 Immunohistochemistry, Consensus PCR HPV-DNA, and In Situ Hybridization

PubMed Central

2012-01-01

Background Recent emerging evidences identify Human Papillomavirus (HPV) related Head and Neck squamous cell carcinomas (HN-SCCs) as a separate subgroup among Head and Neck Cancers with different epidemiology, histopathological characteristics, therapeutic response to chemo-radiation treatment and clinical outcome. However, there is not a worldwide consensus on the methods to be used in clinical practice. The endpoint of this study was to demonstrate the reliability of a triple method which combines evaluation of: 1. p16 protein expression by immunohistochemistry (p16-IHC); 2. HPV-DNA genotyping by consensus HPV-DNA PCR methods (Consensus PCR); and 3 viral integration into the host by in situ hybridization method (ISH). This triple method has been applied to HN-SCC originated from oral cavity (OSCC) and oropharynx (OPSCC), the two anatomical sites in which high risk (HR) HPVs have been clearly implicated as etiologic factors. Methylation-Specific PCR (MSP) was performed to study inactivation of p16-CDKN2a locus by epigenetic events. Reliability of multiple methods was measured by Kappa statistics. Results All the HN-SCCs confirmed HPV positive by PCR and/or ISH were also p16 positive by IHC, with the latter showing a very high level of sensitivity as single test (100% in both OSCC and OPSCC) but lower specificity level (74% in OSCC and 93% in OPSCC). Concordance analysis between ISH and Consensus PCR showed a faint agreement in OPSCC (κ = 0.38) and a moderate agreement in OSCC (κ = 0.44). Furthermore, the addition of double positive score (ISHpositive and Consensus PCR positive) increased significantly the specificity of HR-HPV detection on formalin-fixed paraffin embedded (FFPE) samples (100% in OSCC and 78.5% in OPSCC), but reduced the sensitivity (33% in OSCC and 60% in OPSCC). The significant reduction of sensitivity by the double method was compensated by a very high sensitivity of p16-IHC detection in the triple approach. Conclusions Although HR-HPVs detection is of utmost importance in clinical settings for the Head and Neck Cancer patients, there is no consensus on which to consider the 'golden standard' among the numerous detection methods available either as single test or combinations. Until recently, quantitative E6 RNA PCR has been considered the 'golden standard' since it was demonstrated to have very high accuracy level and very high statistical significance associated with prognostic parameters. In contrast, quantitative E6 DNA PCR has proven to have very high level of accuracy but lesser prognostic association with clinical outcome than the HPV E6 oncoprotein RNA PCR. However, although it is theoretically possible to perform quantitative PCR detection methods also on FFPE samples, they reach the maximum of accuracy on fresh frozen tissue. Furthermore, worldwide diagnostic laboratories have not all the same ability to analyze simultaneously both FFPE and fresh tissues with these quantitative molecular detection methods. Therefore, in the current clinical practice a p16-IHC test is considered as sufficient for HPV diagnostic in accordance with the recently published Head and Neck Cancer international guidelines. Although p16-IHC may serve as a good prognostic indicator, our study clearly demonstrated that it is not satisfactory when used exclusively as the only HPV detecting method. Adding ISH, although known as less sensitive than PCR-based detection methods, has the advantage to preserve the morphological context of HPV-DNA signals in FFPE samples and, thus increase the overall specificity of p16/Consensus PCR combination tests. PMID:22376902

Simultaneous determination of eight major steroids from Polyporus umbellatus by high-performance liquid chromatography coupled with mass spectrometry detections.

PubMed

Zhao, Ying-yong; Cheng, Xian-long; Zhang, Yongmin; Zhao, Ye; Lin, Rui-chao; Sun, Wen-ji

2010-02-01

Polyporus umbellatus is a widely used diuretic herbal medicine. In this study, a high-performance liquid chromatography coupled with atmospheric pressure chemical ionization-mass spectrometric detection (HPLC-APCI-MS) method was developed for qualitative and quantitative analysis of steroids, as well as for the quality control of Polyporus umbellatus. The selectivity, reproducibility and sensitivity were compared with HPLC with photodiode array detection and evaporative light scattering detection (ELSD). Selective ion monitoring in positive mode was used for qualitative and quantitative analysis of eight major components and beta-ecdysterone was used as the internal standard. Limits of detection and quantification fell in the ranges 7-21 and 18-63 ng/mL for the eight analytes with an injection of 10 microL samples, and all calibration curves showed good linear regression (r(2) > 0.9919) within the test range. The quantitative results demonstrated that samples from different localities showed different qualities. Advantages, in comparison with conventional HPLC-diode array detection and HPLC-ELSD, are that reliable identification of target compounds could be achieved by accurate mass measurements along with characteristic retention time, and the great enhancement in selectivity and sensitivity allows identification and quantification of low levels of constituents in complex Polyporus umbellatus matrixes. (c) 2009 John Wiley & Sons, Ltd.

A meta-classifier for detecting prostate cancer by quantitative integration of in vivo magnetic resonance spectroscopy and magnetic resonance imaging

NASA Astrophysics Data System (ADS)

Viswanath, Satish; Tiwari, Pallavi; Rosen, Mark; Madabhushi, Anant

2008-03-01

Recently, in vivo Magnetic Resonance Imaging (MRI) and Magnetic Resonance Spectroscopy (MRS) have emerged as promising new modalities to aid in prostate cancer (CaP) detection. MRI provides anatomic and structural information of the prostate while MRS provides functional data pertaining to biochemical concentrations of metabolites such as creatine, choline and citrate. We have previously presented a hierarchical clustering scheme for CaP detection on in vivo prostate MRS and have recently developed a computer-aided method for CaP detection on in vivo prostate MRI. In this paper we present a novel scheme to develop a meta-classifier to detect CaP in vivo via quantitative integration of multimodal prostate MRS and MRI by use of non-linear dimensionality reduction (NLDR) methods including spectral clustering and locally linear embedding (LLE). Quantitative integration of multimodal image data (MRI and PET) involves the concatenation of image intensities following image registration. However multimodal data integration is non-trivial when the individual modalities include spectral and image intensity data. We propose a data combination solution wherein we project the feature spaces (image intensities and spectral data) associated with each of the modalities into a lower dimensional embedding space via NLDR. NLDR methods preserve the relationships between the objects in the original high dimensional space when projecting them into the reduced low dimensional space. Since the original spectral and image intensity data are divorced from their original physical meaning in the reduced dimensional space, data at the same spatial location can be integrated by concatenating the respective embedding vectors. Unsupervised consensus clustering is then used to partition objects into different classes in the combined MRS and MRI embedding space. Quantitative results of our multimodal computer-aided diagnosis scheme on 16 sets of patient data obtained from the ACRIN trial, for which corresponding histological ground truth for spatial extent of CaP is known, show a marginally higher sensitivity, specificity, and positive predictive value compared to corresponding CAD results with the individual modalities.

Sensitive and selective determination of methylenedioxylated amphetamines by high-performance liquid chromatography with fluorimetric detection.

PubMed

Sadeghipour, F; Veuthey, J L

1997-11-07

A rapid, sensitive and selective liquid chromatographic method with fluorimetric detection was developed for the separation and quantification of four methylenedioxylated amphetamines without interference of other drugs of abuse and common substances found in illicit tablets. The method was validated by examining linearity, precision and accuracy as well as detection and quantification limits. Methylenedioxylated amphetamines were quantified in eight tablets from illicit drug seizures and results were quantitatively compared to HPLC-UV analyses. To demonstrate the better sensitivity of the fluorimetric detection, methylenedioxylated amphetamines were analyzed in serum after a liquid-liquid extraction procedure and results were also compared to HPLC-UV analyses.

A simple and highly sensitive colorimetric detection method for gaseous formaldehyde.

PubMed

Feng, Liang; Musto, Christopher J; Suslick, Kenneth S

2010-03-31

A colorimetric detection method using amine-functionalized polymer films doped with a pH indicator has been developed for the rapid, sensitive, and quantitative detection of gaseous formaldehyde at concentrations well below the immediately dangerous to life or health (IDLH) limit. In 1 min, visible color changes are easily observed, even down to the permissible exposure limit (PEL) at 750 ppb. The limit of detection is below 50 ppb (7% of the PEL) after 10 min of exposure. This sensor is essentially unaffected by changes in humidity or temperature (4 to 50 degrees C) and is not sensitive to common interferents.

High-throughput quantitation of amino acids in rat and mouse biological matrices using stable isotope labeling and UPLC-MS/MS analysis.

PubMed

Takach, Edward; O'Shea, Thomas; Liu, Hanlan

2014-08-01

Quantifying amino acids in biological matrices is typically performed using liquid chromatography (LC) coupled with fluorescent detection (FLD), requiring both derivatization and complete baseline separation of all amino acids. Due to its high specificity and sensitivity, the use of UPLC-MS/MS eliminates the derivatization step and allows for overlapping amino acid retention times thereby shortening the analysis time. Furthermore, combining UPLC-MS/MS with stable isotope labeling (e.g., isobaric tag for relative and absolute quantitation, i.e., iTRAQ) of amino acids enables quantitation while maintaining sensitivity, selectivity and speed of analysis. In this study, we report combining UPLC-MS/MS analysis with iTRAQ labeling of amino acids resulting in the elution and quantitation of 44 amino acids within 5 min demonstrating the speed and convenience of this assay over established approaches. This chromatographic analysis time represented a 5-fold improvement over the conventional HPLC-MS/MS method developed in our laboratory. In addition, the UPLC-MS/MS method demonstrated improvements in both specificity and sensitivity without loss of precision. In comparing UPLC-MS/MS and HPLC-MS/MS results of 32 detected amino acids, only 2 amino acids exhibited imprecision (RSD) >15% using UPLC-MS/MS, while 9 amino acids exhibited RSD >15% using HPLC-MS/MS. Evaluating intra- and inter-assay precision over 3 days, the quantitation range for 32 detected amino acids in rat plasma was 0.90-497 μM, with overall mean intra-day precision of less than 15% and mean inter-day precision of 12%. This UPLC-MS/MS assay was successfully implemented for the quantitative analysis of amino acids in rat and mouse plasma, along with mouse urine and tissue samples, resulting in the following concentration ranges: 0.98-431 μM in mouse plasma for 32 detected amino acids; 0.62-443 μM in rat plasma for 32 detected amino acids; 0.44-8590μM in mouse liver for 33 detected amino acids; 0.61-1241 μM in mouse kidney for 37 detected amino acids; and 1.39-1,681 μM in rat urine for 34 detected amino acids. The utility of the assay was further demonstrated by measuring and comparing plasma amino acid levels between pre-diabetic Zucker diabetic fatty rats (ZDF/Gmi fa/fa) and their lean littermates (ZDF/Gmi fa/?). Significant differences (P<0.001) in 9 amino acid concentrations were observed, with the majority ranging from a 2- to 5-fold increase in pre-diabetic ZDF rats on comparison with ZDF lean rats, consistent with previous literature reports. Copyright © 2014 Elsevier B.V. All rights reserved.

A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load.

PubMed

Kidd, I M; Clark, D A; Emery, V C

2000-06-01

Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.

Quality evaluation of moluodan concentrated pill using high-performance liquid chromatography fingerprinting coupled with chemometrics.

PubMed

Tao, Lingyan; Zhang, Qing; Wu, Yongjiang; Liu, Xuesong

2016-12-01

In this study, a fast and effective high-performance liquid chromatography method was developed to obtain a fingerprint chromatogram and quantitative analysis simultaneously of four indexes including gallic acid, chlorogenic acid, albiflorin and paeoniflorin of the traditional Chinese medicine Moluodan Concentrated Pill. The method was performed by using a Waters X-bridge C 18 reversed phase column on an Agilent 1200S high-performance liquid chromatography system coupled with diode array detection. The mobile phase of the high-performance liquid chromatography method was composed of 20 mmol/L phosphate solution and acetonitrile with a 1 mL/min eluent velocity, under a detection temperature of 30°C and a UV detection wavelength of 254 nm. After the methodology validation, 16 batches of Moluodan Concentrated Pill were analyzed by this high-performance liquid chromatography method and both qualitative and quantitative evaluation results were achieved by similarity analysis, principal component analysis and hierarchical cluster analysis. The results of these three chemometrics were in good agreement and all indicated that batch 10 and batch 16 showed significant differences with the other 14 batches. This suggested that the developed high-performance liquid chromatography method could be applied in the quality evaluation of Moluodan Concentrated Pill. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Sensing cocaine in saliva with attenuated total reflection infrared (ATR-IR) spectroscopy combined with a one-step extraction method

NASA Astrophysics Data System (ADS)

Hans, Kerstin M.-C.; Gianella, Michele; Sigrist, Markus W.

2012-03-01

On-site drug tests have gained importance, e.g., for protecting the society from impaired drivers. Since today's drug tests are majorly only positive/negative, there is a great need for a reliable, portable and preferentially quantitative drug test. In the project IrSens we aim to bridge this gap with the development of an optical sensor platform based on infrared spectroscopy and focus on cocaine detection in saliva. We combine a one-step extraction method, a sample drying technique and infrared attenuated total reflection (ATR) spectroscopy. As a first step we have developed an extraction technique that allows us to extract cocaine from saliva to an almost infrared-transparent solvent and to record ATR spectra with a commercially available Fourier Transform-infrared spectrometer. To the best of our knowledge this is the first time that such a simple and easy-to-use one-step extraction method is used to transfer cocaine from saliva into an organic solvent and detect it quantitatively. With this new method we are able to reach a current limit of detection around 10 μg/ml. This new extraction method could also be applied to waste water monitoring and controlling caffeine content in beverages.

The Edge Detectors Suitable for Retinal OCT Image Segmentation

PubMed Central

Yang, Jing; Gao, Qian; Zhou, Sheng

2017-01-01

Retinal layer thickness measurement offers important information for reliable diagnosis of retinal diseases and for the evaluation of disease development and medical treatment responses. This task critically depends on the accurate edge detection of the retinal layers in OCT images. Here, we intended to search for the most suitable edge detectors for the retinal OCT image segmentation task. The three most promising edge detection algorithms were identified in the related literature: Canny edge detector, the two-pass method, and the EdgeFlow technique. The quantitative evaluation results show that the two-pass method outperforms consistently the Canny detector and the EdgeFlow technique in delineating the retinal layer boundaries in the OCT images. In addition, the mean localization deviation metrics show that the two-pass method caused the smallest edge shifting problem. These findings suggest that the two-pass method is the best among the three algorithms for detecting retinal layer boundaries. The overall better performance of Canny and two-pass methods over EdgeFlow technique implies that the OCT images contain more intensity gradient information than texture changes along the retinal layer boundaries. The results will guide our future efforts in the quantitative analysis of retinal OCT images for the effective use of OCT technologies in the field of ophthalmology. PMID:29065594

Standard Reference Line Combined with One-Point Calibration-Free Laser-Induced Breakdown Spectroscopy (CF-LIBS) to Quantitatively Analyze Stainless and Heat Resistant Steel.

PubMed

Fu, Hongbo; Wang, Huadong; Jia, Junwei; Ni, Zhibo; Dong, Fengzhong

2018-01-01

Due to the influence of major elements' self-absorption, scarce observable spectral lines of trace elements, and relative efficiency correction of experimental system, accurate quantitative analysis with calibration-free laser-induced breakdown spectroscopy (CF-LIBS) is in fact not easy. In order to overcome these difficulties, standard reference line (SRL) combined with one-point calibration (OPC) is used to analyze six elements in three stainless-steel and five heat-resistant steel samples. The Stark broadening and Saha - Boltzmann plot of Fe are used to calculate the electron density and the plasma temperature, respectively. In the present work, we tested the original SRL method, the SRL with the OPC method, and intercept with the OPC method. The final calculation results show that the latter two methods can effectively improve the overall accuracy of quantitative analysis and the detection limits of trace elements.

Method for measuring the size distribution of airborne rhinovirus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Russell, M.L.; Goth-Goldstein, R.; Apte, M.G.

About 50% of viral-induced respiratory illnesses are caused by the human rhinovirus (HRV). Measurements of the concentrations and sizes of bioaerosols are critical for research on building characteristics, aerosol transport, and mitigation measures. We developed a quantitative reverse transcription-coupled polymerase chain reaction (RT-PCR) assay for HRV and verified that this assay detects HRV in nasal lavage samples. A quantitation standard was used to determine a detection limit of 5 fg of HRV RNA with a linear range over 1000-fold. To measure the size distribution of HRV aerosols, volunteers with a head cold spent two hours in a ventilated research chamber.more » Airborne particles from the chamber were collected using an Andersen Six-Stage Cascade Impactor. Each stage of the impactor was analyzed by quantitative RT-PCR for HRV. For the first two volunteers with confirmed HRV infection, but with mild symptoms, we were unable to detect HRV on any stage of the impactor.« less

Development and validation of a generic high-performance liquid chromatography for the simultaneous separation and determination of six cough ingredients: Robustness study on core-shell particles.

PubMed

Yehia, Ali Mohamed; Essam, Hebatallah Mohamed

2016-09-01

A generally applicable high-performance liquid chromatographic method for the qualitative and quantitative determination of pharmaceutical preparations containing phenylephrine hydrochloride, paracetamol, ephedrine hydrochloride, guaifenesin, doxylamine succinate, and dextromethorphan hydrobromide is developed. Optimization of chromatographic conditions was performed for the gradient elution using different buffer pH values, flow rates and two C18 stationary phases. The method was developed using a Kinetex® C18 column as a core-shell stationary phase with a gradient profile using buffer pH 5.0 and acetonitrile at 2.0 mL/min flow rate. Detection was carried out at 220 nm and linear calibrations were obtained for all components within the studied ranges. The method was fully validated in agreement with ICH guidelines. The proposed method is specific, accurate and precise (RSD% < 3%). Limits of detection are lower than 2.0 μg/mL. Qualitative and quantitative responses were evaluated using experimental design to assist the method robustness. The method was proved to be highly robust against 10% change in buffer pH and flow rate (RSD% < 10%), however, the flow rate may significantly influence the quantitative responses of phenylephrine, paracetamol, and doxylamine (RSD% > 10%). Satisfactory results were obtained for commercial combinations analyses. Statistical comparison between the proposed chromatographic and official methods revealed no significant difference. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Highly sensitive quantitative PCR for the detection and differentiation of Pseudogymnoascus destructans and other Pseudogymnoascus species.

PubMed

Shuey, Megan M; Drees, Kevin P; Lindner, Daniel L; Keim, Paul; Foster, Jeffrey T

2014-03-01

White-nose syndrome is a fungal disease that has decimated bat populations across eastern North America. Identification of the etiologic agent, Pseudogymnoascus destructans (formerly Geomyces destructans), in environmental samples is essential to proposed management plans. A major challenge is the presence of closely related species, which are ubiquitous in many soils and cave sediments and often present in high abundance. We present a dual-probe real-time quantitative PCR assay capable of detecting and differentiating P. destructans from closely related fungi in environmental samples from North America. The assay, based on a single nucleotide polymorphism (SNP) specific to P. destructans, is capable of rapid low-level detection from various sampling media, including sediment, fecal samples, wing biopsy specimens, and skin swabs. This method is a highly sensitive, high-throughput method for identifying P. destructans, other Pseudogymnoascus spp., and Geomyces spp. in the environment, providing a fundamental component of research and risk assessment for addressing this disease, as well as other ecological and mycological work on related fungi.

STATISTICAL ANALYSIS OF SPECTROPHOTOMETRIC DETERMINATIONS OF BORON; Estudo Estatistico de Determinacoes Espectrofotometricas de Boro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lima, F.W.; Pagano, C.; Schneiderman, B.

1959-07-01

Boron can be determined quantitatively by absorption spectrophotometry of solutions of the red compound formed by the reaction of boric acid with curcumin. This reaction is affected by various factors, some of which can be detected easily in the data interpretation. Others, however, provide more difficulty. The application of modern statistical method to the study of the influence of these factors on the quantitative determination of boron is presented. These methods provide objective ways of establishing significant effects of the factors involved. (auth)

Rapid and Highly Sensitive Detection of Lead Ions in Drinking Water Based on a Strip Immunosensor

PubMed Central

Kuang, Hua; Xing, Changrui; Hao, Changlong; Liu, Liqiang; Wang, Libing; Xu, Chuanlai

2013-01-01

In this study, we have first developed a rapid and sensitive strip immunosensor based on two heterogeneously-sized gold nanoparticles (Au NPs) probes for the detection of trace lead ions in drinking water. The sensitivity was 4-fold higher than that of the conventional LFA under the optimized conditions. The visual limit of detection (LOD) of the amplified method for qualitative detection lead ions was 2 ng/mL and the LOD for semi-quantitative detection could go down to 0.19 ng/mL using a scanning reader. The method suffered from no interference from other metal ions and could be used to detect trace lead ions in drinking water without sample enrichment. The recovery of the test samples ranged from 96% to 103%. As the detection method could be accomplished within 15 min, this method could be used as a potential tool for preliminary monitoring of lead contamination in drinking water. PMID:23539028

Fast liquid chromatographic-tandem mass spectrometric method using mixed-mode phase chromatography and solid phase extraction for the determination of 12 mono-hydroxylated brominated diphenyl ethers in human serum.

PubMed

Petropoulou, Syrago-Styliani E; Duong, Wendy; Petreas, Myrto; Park, June-Soo

2014-08-22

Hydroxylated polybrominated diphenyl ethers (OH-PBDEs) are formed from the oxidative metabolism of polybrominated diphenyl ethers (PBDEs) in humans, rats and mice, but their quantitation in human blood and other matrices with liquid chromatography-mass spectrometric techniques has been a challenge. In this study, a novel analytical method was developed and validated using only 250 μL of human serum for the quantitation of twelve OH-PBDEs, fully chromatographically separated in a 15 min analytical run. This method includes two novel approaches: an enzymatic hydrolysis procedure and a chromatographic separation using a mixed mode chromatography column. The enzymatic hydrolysis (EH) was found critical for 4'-OH-BDE17, which was not detectable without it. For the sample clean up, a solid phase extraction protocol was developed and validated for the extraction of the 12 congeners from human serum. In addition, for the first time baseline resolution of two components was achieved that correspond to a single peak previously identified as 6'-OH-BDE99. The method was validated for linearity, accuracy, precision, matrix effects, limit of quantification, limit of detection, sample stability and overall efficiency. Recoveries (absolute and relative) ranged from 66 to 130% with relative standard deviations <21% for all analytes. Limit of detection and quantitation ranged from 4 to 90 pg mL(-1) and 6-120 pg mL(-1), respectively, with no carry over effects. This method was applied in ten commercially available human serum samples from the general US population. The mean values of the congeners detected in all samples are 4'-OH-BDE17 (34.2 pg mL(-1)), 4-OH-BDE42 (33.9 pg mL(-1)), 5-OH-BDE47 (17.5 pg mL(-1)) and 4'-OH-BDE49 (12.4 pg mL(-1)). Copyright © 2014 Elsevier B.V. All rights reserved.

A Simple and Rapid UPLC-PDA Method for Quality Control of Nardostachys jatamansi.

PubMed

Zhang, Weize; Nan, Guo; Wu, Hong-Hua; Jiang, Miaomiao; Li, Tian-Xiang; Wang, Meng; Gao, Xiu-Mei; Zhu, Yan; Song, Yun Seon; Wang, Jiaming; Xu, Yan-Tong

2018-05-01

Nardostachys jatamansi is a well-documented herbal agent used to treat digestive and neuropsychiatric disorders in oriental medicinal systems. However, few simple, rapid, and comprehensive methods were reported for quality assessment and control of N. jatamansi . Herein, a UPLC with photodiode array detection method was developed for both fingerprint investigation of N. jatamansi and simultaneous quantitative analysis of the six serotonin transporter modulatory constituents in N. jatamansi . For chromatographic fingerprinting, 24 common peaks were selected as characteristic peaks to assess the consistency of N. jatamansi samples from different retail sources. Six of the common peaks (5, 7, 12: , and 16:  - 18: ) were identified as desoxo-narchinol A, buddleoside, isonardosinone, nardosinone, kanshone H, and (-)-aristolone, respectively, by phytochemical investigation. Five of the six compounds significantly either enhanced or inhibited serotonin transporter activity, while (-)-aristolone (18: ) didn't show any serotonin transporter activity. In quantitative analysis, the six compounds showed good linearity ( r  > 0.999) within test ranges. The precision, expressed as relative standard deviation, was in the range of 0.25 - 2.77%, and the recovery of the method was in the range of 92 - 105%. The UPLC-photodiode array detection-based fingerprint analysis and quantitative methods reported here could be used for routine quality control of N. jatamansi . Georg Thieme Verlag KG Stuttgart · New York.

The use of experimental design for the development of a capillary zone electrophoresis method for the quantitation of captopril.

PubMed

Mukozhiwa, S Y; Khamanga, S M M; Walker, R B

2017-09-01

A capillary zone electrophoresis (CZE) method for the quantitation of captopril (CPT) using UV detection was developed. Influence of electrolyte concentration and system variables on electrophoretic separation was evaluated and a central composite design (CCD) was used to optimize the method. Variables investigated were pH, molarity, applied voltage and capillary length. The influence of sodium metabisulphite on the stability of test solutions was also investigated. The use of sodium metabisulphite prevented degradation of CPT over 24 hours. A fused uncoated silica capillary of 67.5cm total and 57.5 cm effective length was used for analysis. The applied voltage and capillary length affected the migration time of CPT significantly. A 20 mM phosphate buffer adjusted to pH 7.0 was used as running buffer and an applied voltage of 23.90 kV was suitable to effect a separation. The optimized electrophoretic conditions produced sharp, well-resolved peaks for CPT and sodium metabisulphite. Linear regression analysis of the response for CPT standards revealed the method was linear (R2 = 0.9995) over the range 5-70 μg/mL. The limits of quantitation and detection were 5 and 1.5 μg/mL. A simple, rapid and reliable CZE method has been developed and successfully applied to the analysis of commercially available CPT products.

Advanced forensic validation for human spermatozoa identification using SPERM HY-LITER™ Express with quantitative image analysis.

PubMed

Takamura, Ayari; Watanabe, Ken; Akutsu, Tomoko

2017-07-01

Identification of human semen is indispensable for the investigation of sexual assaults. Fluorescence staining methods using commercial kits, such as the series of SPERM HY-LITER™ kits, have been useful to detect human sperm via strong fluorescence. These kits have been examined from various forensic aspects. However, because of a lack of evaluation methods, these studies did not provide objective, or quantitative, descriptions of the results nor clear criteria for the decisions reached. In addition, the variety of validations was considerably limited. In this study, we conducted more advanced validations of SPERM HY-LITER™ Express using our established image analysis method. Use of this method enabled objective and specific identification of fluorescent sperm's spots and quantitative comparisons of the sperm detection performance under complex experimental conditions. For body fluid mixtures, we examined interference with the fluorescence staining from other body fluid components. Effects of sample decomposition were simulated in high humidity and high temperature conditions. Semen with quite low sperm concentrations, such as azoospermia and oligospermia samples, represented the most challenging cases in application of the kit. Finally, the tolerance of the kit against various acidic and basic environments was analyzed. The validations herein provide useful information for the practical applications of the SPERM HY-LITER™ Express kit, which were previously unobtainable. Moreover, the versatility of our image analysis method toward various complex cases was demonstrated.

Terahertz wave electro-optic measurements with optical spectral filtering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ilyakov, I. E., E-mail: igor-ilyakov@mail.ru; Shishkin, B. V.; Kitaeva, G. Kh.

We propose electro-optic detection techniques based on variations of the laser pulse spectrum induced during pulse co-propagation with terahertz wave radiation in a nonlinear crystal. Quantitative comparison with two other detection methods is made. Substantial improvement of the sensitivity compared to the standard electro-optic detection technique (at high frequencies) and to the previously shown technique based on laser pulse energy changes is demonstrated in experiment.

Preparation of surface enhanced Raman substrate and its characterization

NASA Astrophysics Data System (ADS)

Liu, Y.; Wang, J. Y.; Wang, J. Q.

2017-10-01

Surface enhanced Raman spectroscopy (SERS) is a fast, convenient and highly sensitive detection technique, and preparing the good effect and repeatable substrate is the key to realize the trace amount and quantitative detection in the field of food safety detection. In this paper, a surface enhanced Raman substrate based on submicrometer silver particles structure was prepared by chemical deposition method, and characterized its structure and optical properties.

Food Forensics: Using Mass Spectrometry To Detect Foodborne Protein Contaminants, as Exemplified by Shiga Toxin Variants and Prion Strains.

PubMed

Silva, Christopher J

2018-06-13

Food forensicists need a variety of tools to detect the many possible food contaminants. As a result of its analytical flexibility, mass spectrometry is one of those tools. Use of the multiple reaction monitoring (MRM) method expands its use to quantitation as well as detection of infectious proteins (prions) and protein toxins, such as Shiga toxins. The sample processing steps inactivate prions and Shiga toxins; the proteins are digested with proteases to yield peptides suitable for MRM-based analysis. Prions are detected by their distinct physicochemical properties and differential covalent modification. Shiga toxin analysis is based on detecting peptides derived from the five identical binding B subunits comprising the toxin. 15 N-labeled internal standards are prepared from cloned proteins. These examples illustrate the power of MRM, in that the same instrument can be used to safely detect and quantitate protein toxins, prions, and small molecules that might contaminate our food.

Detection of biological molecules using chemical amplification and optical sensors

DOEpatents

Van Antwerp, William Peter; Mastrototaro, John Joseph

2000-01-01

Methods are provided for the determination of the concentration of biological levels of polyhydroxylated compounds, particularly glucose. The methods utilize an amplification system that is an analyte transducer immobilized in a polymeric matrix, where the system is implantable and biocompatible. Upon interrogation by an optical system, the amplification system produces a signal capable of detection external to the skin of the patient. Quantitation of the analyte of interest is achieved by measurement of the emitted signal.

Detection of biological molecules using chemical amplification and optical sensors

DOEpatents

Van Antwerp, William Peter; Mastrototaro, John Joseph

2004-10-12

Methods are provided for the determination of the concentration of biological levels of polyhydroxylated compounds, particularly glucose. The methods utilize an amplification system that is an analyte transducer immobilized in a polymeric matrix, where the system is implantable and biocompatible. Upon interrogation by an optical system, the amplification system produces a signal capable of detection external to the skin of the patient. Quantitation of the analyte of interest is achieved by measurement of the emitted signal.

Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods.

PubMed

Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi

2015-10-19

We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples.

Investigation of Legionella Contamination in Bath Water Samples by Culture, Amoebic Co-Culture, and Real-Time Quantitative PCR Methods

PubMed Central

Edagawa, Akiko; Kimura, Akio; Kawabuchi-Kurata, Takako; Adachi, Shinichi; Furuhata, Katsunori; Miyamoto, Hiroshi

2015-01-01

We investigated Legionella contamination in bath water samples, collected from 68 bathing facilities in Japan, by culture, culture with amoebic co-culture, real-time quantitative PCR (qPCR), and real-time qPCR with amoebic co-culture. Using the conventional culture method, Legionella pneumophila was detected in 11 samples (11/68, 16.2%). Contrary to our expectation, the culture method with the amoebic co-culture technique did not increase the detection rate of Legionella (4/68, 5.9%). In contrast, a combination of the amoebic co-culture technique followed by qPCR successfully increased the detection rate (57/68, 83.8%) compared with real-time qPCR alone (46/68, 67.6%). Using real-time qPCR after culture with amoebic co-culture, more than 10-fold higher bacterial numbers were observed in 30 samples (30/68, 44.1%) compared with the same samples without co-culture. On the other hand, higher bacterial numbers were not observed after propagation by amoebae in 32 samples (32/68, 47.1%). Legionella was not detected in the remaining six samples (6/68, 8.8%), irrespective of the method. These results suggest that application of the amoebic co-culture technique prior to real-time qPCR may be useful for the sensitive detection of Legionella from bath water samples. Furthermore, a combination of amoebic co-culture and real-time qPCR might be useful to detect viable and virulent Legionella because their ability to invade and multiply within free-living amoebae is considered to correlate with their pathogenicity for humans. This is the first report evaluating the efficacy of the amoebic co-culture technique for detecting Legionella in bath water samples. PMID:26492259

UHPLC determination of catechins for the quality control of green tea.

PubMed

Naldi, Marina; Fiori, Jessica; Gotti, Roberto; Périat, Aurélie; Veuthey, Jean-Luc; Guillarme, Davy; Andrisano, Vincenza

2014-01-01

An ultra-high performance liquid chromatography (UHPLC) with UV detection method was developed for the fast quantitation of the most represented and biologically important green tea catechins and caffeine. UHPLC system was equipped with C18 analytical column (50mm×2.1mm, 1.8μm), utilizing a mobile phase composed of pH 2.5 triethanolamine phosphate buffer (0.1M) and acetonitrile in a gradient elution mode; under these conditions six major catechins and caffeine were separated in a 3min run. The method was fully validated in terms of precision, detection and quantification limits, linearity, accuracy, and it was applied to the identification and quantification of catechins and caffeine present in green tea infusions. In particular, commercially available green tea leaves samples of different geographical origin (Sencha, Ceylon Green and Lung Ching) were used for infusion preparations (water at 85°C for 15min). The selectivity of the developed UHPLC method was confirmed by comparison with UHPLC-MS/MS analysis. The recovery of the main six catechins and caffeine on the three analyzed commercial tea samples ranged from 94 to 108% (n=3). Limits of detection (LOD) were comprised in the range 0.1-0.4μgmL(-1). An orthogonal micellar electrokinetic (MEKC) method was applied for comparative purposes on selectivity and quantitative data. The combined use of the results obtained by the two techniques allowed for a fast confirmation on quantitative characterization of commercial samples. Copyright © 2013 Elsevier B.V. All rights reserved.

Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

PubMed

Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

2018-06-01

The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

Characterization of copy numbers of 16S rDNA and 16S rRNA of Candidatus Liberibacter asiaticus and the implication in detection in planta using quantitative PCR.

PubMed

Kim, Jeong-Soon; Wang, Nian

2009-03-06

Citrus Huanglongbing (HLB) is one of the most devastating diseases on citrus and is associated with Candidatus Liberibacter spp.. The pathogens are phloem limited and have not been cultured in vitro. The current management strategy of HLB is to remove infected citrus trees and reduce psyllid populations with insecticides to prevent the spreading. This strategy requires sensitive and reliable diagnostic methods for early detection. We investigated the copy numbers of the 16S rDNA and 16S rRNA of the HLB pathogen and the implication of improving the diagnosis of HLB for early detection using Quantitative PCR. We compared the detection of HLB with different Quantitative PCR based methods with primers/probe targeting either 16S rDNA, beta-operon DNA, 16S rRNA, or beta-operon RNA. The 16S rDNA copy number of Ca. Liberibacter asiaticus was estimated to be three times of that of the beta-operon region, thus allowing detection of lower titer of Ca. L. asiaticus. Quantitative reverse transcriptional PCR (QRT-PCR) indicated that the 16S rRNA averaged 7.83 times more than that of 16S rDNA for the same samples. Dilution analysis also indicates that QRT-PCR targeting 16S rRNA is 10 time more sensitive than QPCR targeting 16S rDNA. Thus QRT-PCR was able to increase the sensitivity of detection by targeting 16S rRNA. Our result indicates that Candidatus Liberibacter asiaticus contains three copies of 16S rDNA. The copy number of 16S rRNA of Ca. L. asiaticus in planta averaged about 7.8 times of 16S rDNA for the same set of samples tested in this study. Detection sensitivity of HLB could be improved through the following approaches: using 16S rDNA based primers/probe in the QPCR assays; and using QRT-PCR assays targeting 16S rRNA.

Quantitative Surface Chirality Detection with Sum Frequency Generation Vibrational Spectroscopy: Twin Polarization Angle Approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, Feng; Xu, Yanyan; Guo, Yuan

2009-12-27

Here we report a novel twin polarization angle (TPA) approach in the quantitative chirality detection with the surface sum-frequency generation vibrational spectroscopy (SFG-VS). Generally, the achiral contribution dominates the surface SFG-VS signal, and the pure chiral signal is usually two or three orders of magnitude smaller. Therefore, it has been difficult to make quantitative detection and analysis of the chiral contributions to the surface SFG- VS signal. In the TPA method, by varying together the polarization angles of the incoming visible light and the sum frequency signal at fixed s or p polarization of the incoming infrared beam, the polarizationmore » dependent SFG signal can give not only direct signature of the chiral contribution in the total SFG-VS signal, but also the accurate measurement of the chiral and achiral components in the surface SFG signal. The general description of the TPA method is presented and the experiment test of the TPA approach is also presented for the SFG-VS from the S- and R-limonene chiral liquid surfaces. The most accurate degree of chiral excess values thus obtained for the 2878 cm⁻¹ spectral peak of the S- and R-limonene liquid surfaces are (23.7±0.4)% and ({25.4±1.3)%, respectively.« less

Establishment of analysis method for methane detection by gas chromatography

NASA Astrophysics Data System (ADS)

Liu, Xinyuan; Yang, Jie; Ye, Tianyi; Han, Zeyu

2018-02-01

The study focused on the establishment of analysis method for methane determination by gas chromatography. Methane was detected by hydrogen flame ionization detector, and the quantitative relationship was determined by working curve of y=2041.2x+2187 with correlation coefficient of 0.9979. The relative standard deviation of 2.60-6.33% and the recovery rate of 96.36%∼105.89% were obtained during the parallel determination of standard gas. This method was not quite suitable for biogas content analysis because methane content in biogas would be over the measurement range in this method.

Detection limits of quantitative and digital PCR assays and their influence in presence-absence surveys of environmental DNA.

PubMed

Hunter, Margaret E; Dorazio, Robert M; Butterfield, John S S; Meigs-Friend, Gaia; Nico, Leo G; Ferrante, Jason A

2017-03-01

A set of universal guidelines is needed to determine the limit of detection (LOD) in PCR-based analyses of low-concentration DNA. In particular, environmental DNA (eDNA) studies require sensitive and reliable methods to detect rare and cryptic species through shed genetic material in environmental samples. Current strategies for assessing detection limits of eDNA are either too stringent or subjective, possibly resulting in biased estimates of species' presence. Here, a conservative LOD analysis grounded in analytical chemistry is proposed to correct for overestimated DNA concentrations predominantly caused by the concentration plateau, a nonlinear relationship between expected and measured DNA concentrations. We have used statistical criteria to establish formal mathematical models for both quantitative and droplet digital PCR. To assess the method, a new Grass Carp (Ctenopharyngodon idella) TaqMan assay was developed and tested on both PCR platforms using eDNA in water samples. The LOD adjustment reduced Grass Carp occupancy and detection estimates while increasing uncertainty-indicating that caution needs to be applied to eDNA data without LOD correction. Compared to quantitative PCR, digital PCR had higher occurrence estimates due to increased sensitivity and dilution of inhibitors at low concentrations. Without accurate LOD correction, species occurrence and detection probabilities based on eDNA estimates are prone to a source of bias that cannot be reduced by an increase in sample size or PCR replicates. Other applications also could benefit from a standardized LOD such as GMO food analysis and forensic and clinical diagnostics. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

Risk assessment of false-positive quantitative real-time PCR results in food, due to detection of DNA originating from dead cells.

PubMed

Wolffs, Petra; Norling, Börje; Rådström, Peter

2005-03-01

Real-time PCR technology is increasingly used for detection and quantification of pathogens in food samples. A main disadvantage of nucleic acid detection is the inability to distinguish between signals originating from viable cells and DNA released from dead cells. In order to gain knowledge concerning risks of false-positive results due to detection of DNA originating from dead cells, quantitative PCR (qPCR) was used to investigate the degradation kinetics of free DNA in four types of meat samples. Results showed that the fastest degradation rate was observed (1 log unit per 0.5 h) in chicken homogenate, whereas the slowest rate was observed in pork rinse (1 log unit per 120.5 h). Overall results indicated that degradation occurred faster in chicken samples than in pork samples and faster at higher temperatures. Based on these results, it was concluded that, especially in pork samples, there is a risk of false-positive PCR results. This was confirmed in a quantitative study on cell death and signal persistence over a period of 28 days, employing three different methods, i.e. viable counts, direct qPCR, and finally floatation, a recently developed discontinuous density centrifugation method, followed by qPCR. Results showed that direct qPCR resulted in an overestimation of up to 10 times of the amount of cells in the samples compared to viable counts, due to detection of DNA from dead cells. However, after using floatation prior to qPCR, results resembled the viable count data. This indicates that by using of floatation as a sample treatment step prior to qPCR, the risk of false-positive PCR results due to detection of dead cells, can be minimized.

Recommended Mass Spectrometry-Based Strategies to Identify Ricin-Containing Samples.

PubMed

Kalb, Suzanne R; Schieltz, David M; Becher, François; Astot, Crister; Fredriksson, Sten-Åke; Barr, John R

2015-11-25

Ricin is a protein toxin produced by the castor bean plant (Ricinus communis) together with a related protein known as R. communis agglutinin (RCA120). Mass spectrometric (MS) assays have the capacity to unambiguously identify ricin and to detect ricin's activity in samples with complex matrices. These qualitative and quantitative assays enable detection and differentiation of ricin from the less toxic RCA120 through determination of the amino acid sequence of the protein in question, and active ricin can be monitored by MS as the release of adenine from the depurination of a nucleic acid substrate. In this work, we describe the application of MS-based methods to detect, differentiate and quantify ricin and RCA120 in nine blinded samples supplied as part of the EQuATox proficiency test. Overall, MS-based assays successfully identified all samples containing ricin or RCA120 with the exception of the sample spiked with the lowest concentration (0.414 ng/mL). In fact, mass spectrometry was the most successful method for differentiation of ricin and RCA120 based on amino acid determination. Mass spectrometric methods were also successful at ranking the functional activities of the samples, successfully yielding semi-quantitative results. These results indicate that MS-based assays are excellent techniques to detect, differentiate, and quantify ricin and RCA120 in complex matrices.

Detection and analysis of tupaia hepatocytes via mAbs against tupaia serum albumin.

PubMed

Liu, Xuan; Yuan, Lunzhi; Yuan, Quan; Zhang, Yali; Wu, Kun; Zhang, Tianying; Wu, Yong; Hou, Wangheng; Wang, Tengyun; Liu, Pingguo; Shih, James Wai Kuo; Cheng, Tong; Xia, Ningshao

2016-05-20

On the basis of its close phylogenetic relationship with primates, the development of Tupaia belangeri as an infection animal model and drug metabolism model could provide a new option for preclinical studies, especially in hepatitis virus research. As a replacement for primary human hepatocytes (PHHs), primary tupaia hepatocytes (PTHs) have been widely used. Similar to human serum albumin, tupaia serum albumin (TSA) is the most common liver synthesis protein and is an important biomarker for PTHs and liver function. However, no detection or quantitative method for TSA has been reported. In this study, mouse monoclonal antibodies (mAbs) 4G5 and 9H3 against TSA were developed to recognize PTHs, and they did not show cross-reactivity with serum albumin from common experimental animals, such as the mouse, rat, cow, rabbit, goat, monkey, and chicken. The two mAbs also exhibited good performance in fluorescence activated cell sorting (FACS) analysis and immunofluorescence (IF) detection of PTHs. A chemiluminescent enzyme immune assay method using the two mAbs, with a linear range from 96.89 pg/ml to 49,609.38 pg/ml, was developed for the quantitative detection of TSA. The mAbs and the CLEIA method provide useful tools for research on TSA and PTHs.

A Complementary Isothermal Amplification Method to the U.S. EPA Quantitative Polymerase Chain Reaction Approach for the Detection of Enterococci in Environmental Waters

PubMed Central

2017-01-01

We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring. PMID:28541661

CNV-RF Is a Random Forest-Based Copy Number Variation Detection Method Using Next-Generation Sequencing.

PubMed

Onsongo, Getiria; Baughn, Linda B; Bower, Matthew; Henzler, Christine; Schomaker, Matthew; Silverstein, Kevin A T; Thyagarajan, Bharat

2016-11-01

Simultaneous detection of small copy number variations (CNVs) (<0.5 kb) and single-nucleotide variants in clinically significant genes is of great interest for clinical laboratories. The analytical variability in next-generation sequencing (NGS) and artifacts in coverage data because of issues with mappability along with lack of robust bioinformatics tools for CNV detection have limited the utility of targeted NGS data to identify CNVs. We describe the development and implementation of a bioinformatics algorithm, copy number variation-random forest (CNV-RF), that incorporates a machine learning component to identify CNVs from targeted NGS data. Using CNV-RF, we identified 12 of 13 deletions in samples with known CNVs, two cases with duplications, and identified novel deletions in 22 additional cases. Furthermore, no CNVs were identified among 60 genes in 14 cases with normal copy number and no CNVs were identified in another 104 patients with clinical suspicion of CNVs. All positive deletions and duplications were confirmed using a quantitative PCR method. CNV-RF also detected heterozygous deletions and duplications with a specificity of 50% across 4813 genes. The ability of CNV-RF to detect clinically relevant CNVs with a high degree of sensitivity along with confirmation using a low-cost quantitative PCR method provides a framework for providing comprehensive NGS-based CNV/single-nucleotide variant detection in a clinical molecular diagnostics laboratory. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

The agony of choice in dermatophyte diagnostics-performance of different molecular tests and culture in the detection of Trichophyton rubrum and Trichophyton interdigitale.

PubMed

Kupsch, C; Ohst, T; Pankewitz, F; Nenoff, P; Uhrlaß, S; Winter, I; Gräser, Y

2016-08-01

Dermatophytosis caused by dermatophytes of the genera Trichophyton and Microsporum belong to the most frequent mycoses worldwide. Molecular detection methods proved to be highly sensitive and enable rapid and accurate detection of dermatophyte species from clinical specimens. For the first time, we compare the performance of different molecular methods with each other and with conventional diagnostics in the detection of dermatophytoses caused by Trichophyton rubrum and Trichophyton interdigitale in clinical specimens (nail, skin and hair). The compared molecular methods comprise two already published PCR-ELISAs, a published quantitative RT-PCR as well as a newly developed PCR-ELISA targeting the internal transcribed spacer region. We investigated the sensitivity of the assays by analysing 375 clinical samples. In 148 specimens (39.5%) a positive result was gained in at least one of the four molecular tests or by culture, but the number of detected agents differed significantly between some of the assays. The most sensitive assay, a PCR-ELISA targeting a microsatellite region, detected 81 T. rubrum infections followed by an internal transcribed spacer PCR-ELISA (60), quantitative RT-PCR (52) and a topoisomerase II PCR-ELISA (51), whereas cultivation resulted in T. rubrum identification in 37 samples. The pros and cons of all four tests in routine diagnostics are discussed. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

A differential mobility spectrometry/mass spectrometry platform for the rapid detection and quantitation of DNA adduct dG-ABP.

PubMed

Kafle, Amol; Klaene, Joshua; Hall, Adam B; Glick, James; Coy, Stephen L; Vouros, Paul

2013-07-15

There is continued interest in exploring new analytical technologies for the detection and quantitation of DNA adducts, biomarkers which provide direct evidence of exposure and genetic damage in cells. With the goal of reducing clean-up steps and improving sample throughput, a Differential Mobility Spectrometry/Mass Spectrometry (DMS/MS) platform has been introduced for adduct analysis. A DMS/MS platform has been utilized for the analysis of dG-ABP, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl (4-ABP). After optimization of the DMS parameters, each sample was analyzed in just 30 s following a simple protein precipitation step of the digested DNA. A detection limit of one modification in 10^6 nucleosides has been achieved using only 2 µg of DNA. A brief comparison (quantitative and qualitative) with liquid chromatography/mass spectrometry is also presented highlighting the advantages of using the DMS/MS method as a high-throughput platform. The data presented demonstrate the successful application of a DMS/MS/MS platform for the rapid quantitation of DNA adducts using, as a model analyte, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl. Copyright © 2013 John Wiley & Sons, Ltd.

Assay Development for the Determination of Phosphorylation Stoichiometry using MRM methods with and without Phosphatase Treatment: Application to Breast Cancer Signaling Pathways

PubMed Central

Domanski, Dominik; Murphy, Leigh C.; Borchers, Christoph H.

2010-01-01

We have developed a phosphatase-based phosphopeptide quantitation (PPQ) method for determining phosphorylation stoichiometry in complex biological samples. This PPQ method is based on enzymatic dephosphorylation, combined with specific and accurate peptide identification and quantification by multiple reaction monitoring (MRM) detection with stable-isotope-labeled standard peptides. In contrast with the classical MRM methods for the quantitation of phosphorylation stoichiometry, the PPQ-MRM method needs only one non-phosphorylated SIS (stable isotope-coded standard) and two analyses (one for the untreated and one for the phosphatase-treated sample), from which the expression and modification levels can accurately be determined. From these analyses, the % phosphorylation can be determined. In this manuscript, we compare the PPQ-MRM method with an MRM method without phosphatase, and demonstrate the application of these methods to the detection and quantitation of phosphorylation of the classic phosphorylated breast cancer biomarkers (ERα and HER2), and for phosphorylated RAF and ERK1, which also contain phosphorylation sites with important biological implications. Using synthetic peptides spiked into a complex protein digest, we were able to use our PPQ-MRM method to accurately determine the total phosphorylation stoichiometry on specific peptides, as well as the absolute amount of the peptide and phosphopeptide present. Analyses of samples containing ERα protein revealed that the PPQ-MRM is capable of determining phosphorylation stoichiometry in proteins from cell lines, and is in good agreement with determinations obtained using the direct MRM approach in terms of phosphorylation and total protein amount. PMID:20524616

Automated detection of videotaped neonatal seizures based on motion segmentation methods.

PubMed

Karayiannis, Nicolaos B; Tao, Guozhi; Frost, James D; Wise, Merrill S; Hrachovy, Richard A; Mizrahi, Eli M

2006-07-01

This study was aimed at the development of a seizure detection system by training neural networks using quantitative motion information extracted by motion segmentation methods from short video recordings of infants monitored for seizures. The motion of the infants' body parts was quantified by temporal motion strength signals extracted from video recordings by motion segmentation methods based on optical flow computation. The area of each frame occupied by the infants' moving body parts was segmented by direct thresholding, by clustering of the pixel velocities, and by clustering the motion parameters obtained by fitting an affine model to the pixel velocities. The computational tools and procedures developed for automated seizure detection were tested and evaluated on 240 short video segments selected and labeled by physicians from a set of video recordings of 54 patients exhibiting myoclonic seizures (80 segments), focal clonic seizures (80 segments), and random infant movements (80 segments). The experimental study described in this paper provided the basis for selecting the most effective strategy for training neural networks to detect neonatal seizures as well as the decision scheme used for interpreting the responses of the trained neural networks. Depending on the decision scheme used for interpreting the responses of the trained neural networks, the best neural networks exhibited sensitivity above 90% or specificity above 90%. The best among the motion segmentation methods developed in this study produced quantitative features that constitute a reliable basis for detecting myoclonic and focal clonic neonatal seizures. The performance targets of this phase of the project may be achieved by combining the quantitative features described in this paper with those obtained by analyzing motion trajectory signals produced by motion tracking methods. A video system based upon automated analysis potentially offers a number of advantages. Infants who are at risk for seizures could be monitored continuously using relatively inexpensive and non-invasive video techniques that supplement direct observation by nursery personnel. This would represent a major advance in seizure surveillance and offers the possibility for earlier identification of potential neurological problems and subsequent intervention.

Automated image analysis for quantification of reactive oxygen species in plant leaves.

PubMed

Sekulska-Nalewajko, Joanna; Gocławski, Jarosław; Chojak-Koźniewska, Joanna; Kuźniak, Elżbieta

2016-10-15

The paper presents an image processing method for the quantitative assessment of ROS accumulation areas in leaves stained with DAB or NBT for H 2 O 2 and O 2 - detection, respectively. Three types of images determined by the combination of staining method and background color are considered. The method is based on the principle of supervised machine learning with manually labeled image patterns used for training. The method's algorithm is developed as a JavaScript macro in the public domain Fiji (ImageJ) environment. It allows to select the stained regions of ROS-mediated histochemical reactions, subsequently fractionated according to the weak, medium and intense staining intensity and thus ROS accumulation. It also evaluates total leaf blade area. The precision of ROS accumulation area detection is validated by the Dice Similarity Coefficient in the case of manual patterns. The proposed framework reduces the computation complexity, once prepared, requires less image processing expertise than the competitive methods and represents a routine quantitative imaging assay for a general histochemical image classification. Copyright © 2016 Elsevier Inc. All rights reserved.

Antibodies against toluene diisocyanate protein conjugates. Three methods of measurement.

PubMed

Patterson, R; Harris, K E; Zeiss, C R

1983-12-01

With the use of canine antisera against toluene diisocyanate (TDI)-dog serum albumin (DSA), techniques for measuring antibody against TDI-DSA were evaluated. The use of an ammonium sulfate precipitation assay showed suggestive evidence of antibody binding but high levels of TDI-DSA precipitation in the absence of antibody limit any usefulness of this technique. Double-antibody co-precipitation techniques will measure total antibody or Ig class antibody against 125I-TDI-DSA. These techniques are quantitative. The polystyrene tube radioimmunoassay is a highly sensitive method of detecting and quantitatively estimating IgG antibody. The enzyme linked immunosorbent assay is a rapidly adaptable method for the quantitative estimation of IgG, IgA, and IgM against TDI-homologous proteins. All these techniques were compared and results are demonstrated by using the same serum sample for analysis.

Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

PubMed

Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

2007-02-01

In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

Method for assaying clustered DNA damages

DOEpatents

Sutherland, Betsy M.

2004-09-07

Disclosed is a method for detecting and quantifying clustered damages in DNA. In this method, a first aliquot of the DNA to be tested for clustered damages with one or more lesion-specific cleaving reagents under conditions appropriate for cleavage of the DNA to produce single-strand nicks in the DNA at sites of damage lesions. The number average molecular length (Ln) of double stranded DNA is then quantitatively determined for the treated DNA. The number average molecular length (Ln) of double stranded DNA is also quantitatively determined for a second, untreated aliquot of the DNA. The frequency of clustered damages (.PHI..sub.c) in the DNA is then calculated.

Relationship between Effective Application of Machine Learning and Malware Detection: A Quantitative Study

ERIC Educational Resources Information Center

Enfinger, Kerry Wayne

2016-01-01

The number of malicious files present in the public domain continues to rise at a substantial rate. Current anti-malware software utilizes a signature-based method to detect the presence of malicious software. Generating these pattern signatures is time consuming due to malicious code complexity and the need for expert analysis, however, by making…

Quantitative Species Measurements In Microgravity Combustion Flames

NASA Technical Reports Server (NTRS)

Chen, Shin-Juh; Pilgrim, Jeffrey S.; Silver, Joel A.; Piltch, Nancy D.

2003-01-01

The capability of models and theories to accurately predict and describe the behavior of low gravity flames can only be verified by quantitative measurements. Although video imaging, simple temperature measurements, and velocimetry methods have provided useful information in many cases, there is still a need for quantitative species measurements. Over the past decade, we have been developing high sensitivity optical absorption techniques to permit in situ, non-intrusive, absolute concentration measurements for both major and minor flames species using diode lasers. This work has helped to establish wavelength modulation spectroscopy (WMS) as an important method for species detection within the restrictions of microgravity-based measurements. More recently, in collaboration with Prof. Dahm at the University of Michigan, a new methodology combining computed flame libraries with a single experimental measurement has allowed us to determine the concentration profiles for all species in a flame. This method, termed ITAC (Iterative Temperature with Assumed Chemistry) was demonstrated for a simple laminar nonpremixed methane-air flame at both 1-g and at 0-g in a vortex ring flame. In this paper, we report additional normal and microgravity experiments which further confirm the usefulness of this approach. We also present the development of a new type of laser. This is an external cavity diode laser (ECDL) which has the unique capability of high frequency modulation as well as a very wide tuning range. This will permit the detection of multiple species with one laser while using WMS detection.

Automated measurement of estrogen receptor in breast cancer: a comparison of fluorescent and chromogenic methods of measurement

PubMed Central

Zarrella, Elizabeth; Coulter, Madeline; Welsh, Allison; Carvajal, Daniel; Schalper, Kurt; Harigopal, Malini; Rimm, David; Neumeister, Veronique

2016-01-01

While FDA approved methods of assessment of Estrogen Receptor (ER) are “fit for purpose”, they represent a 30-year-old technology. New quantitative methods, both chromogenic and fluorescent, have been developed and studies have shown that these methods increase the accuracy of assessment of ER. Here, we compare three methods of ER detection and assessment on two retrospective tissue microarray cohorts of breast cancer patients: estimates of percent nuclei positive by pathologists and by Aperio’s nuclear algorithm (standard chromogenic immunostaining), and immunofluorescence as quantified with the AQUA® method of quantitative immunofluorescence (QIF). Reproducibility was excellent (R2 > 0.95) between users for both automated analysis methods, and the Aperio and QIF scoring results were also highly correlated, despite the different detection systems. The subjective readings show lower levels of reproducibility and a discontinuous, bimodal distribution of scores not seen by either mechanized method. Kaplan-Meier analysis of 10-year disease-free survival was significant for each method (Pathologist, P=0.0019; Aperio, P=0.0053, AQUA, P=0.0026), but there were discrepancies in patient classification in 19 out of 233 cases analyzed. Out of these, 11 were visually positive by both chromogenic and fluorescent detection. In 10 cases, the Aperio nuclear algorithm labeled the nuclei as negative, in 1 case, the AQUA score was just under the cutoff for positivity (determined by an Index TMA). In contrast, 8 out of 19 discrepant cases had clear nuclear positivity by fluorescence that was unable to be visualized by chromogenic detection, perhaps due to low positivity masked by the hematoxylin counterstain. These results demonstrate that automated systems enable objective, precise quantification of ER. Furthermore immunofluorescence detection offers the additional advantage of a signal that cannot be masked by a counterstaining agent. These data support the usage of automated methods for measurement of this and other biomarkers that may be used in companion diagnostic tests. PMID:27348626

Critical temperature: A quantitative method of assessing cold tolerance

Treesearch

D.H. DeHayes; M.W., Jr. Williams

1989-01-01

Critical temperature (Tc), defined as the highest temperature at which freezing injury to plant tissues can be detected, provides a biologically meaningful and statistically defined assessment of the relative cold tolerance of plant tissues. A method is described for calculating critical temperatures in laboratory freezing studies that use...

Novel multiplex qualitative detection using universal primer-multiplex-PCR combined with pyrosequencing.

PubMed

Shang, Ying; Xu, Wentao; Wang, Yong; Xu, Yuancong; Huang, Kunlun

2017-12-15

This study described a novel multiplex qualitative detection method using pyrosequencing. Based on the principle of the universal primer-multiplex-PCR, only one sequencing primer was employed to realize the detection of the multiple targets. Samples containing three genetically modified (GM) crops in different proportions were used to validate the method. The dNTP dispensing order was designed based on the product sequences. Only 12 rounds (ATCTGATCGACT) of dNTPs addition and, often, as few as three rounds (CAT) under ideal conditions, were required to detect the GM events qualitatively, and sensitivity was as low as 1% of a mixture. However, when considering a mixture, calculating signal values allowed the proportion of each GM to be estimated. Based on these results, we concluded that our novel method not only realized detection but also allowed semi-quantitative detection of individual events. Copyright © 2017. Published by Elsevier Ltd.

Improved Quantitation of Gluten in Wheat Starch for Celiac Disease Patients by Gel-Permeation High-Performance Liquid Chromatography with Fluorescence Detection (GP-HPLC-FLD).

PubMed

Scherf, Katharina Anne; Wieser, Herbert; Koehler, Peter

2016-10-12

Purified wheat starch (WSt) is commonly used in gluten-free products for celiac disease (CD) patients. It is mostly well-tolerated, but doubts about its safety for CD patients persist. One reason may be that most ELISA kits primarily recognize the alcohol-soluble gliadin fraction of gluten, but insufficiently target the alcohol-insoluble glutenin fraction. To address this problem, a new sensitive method based on the sequential extraction of gliadins, glutenins, and gluten from WSt followed by gel-permeation high-performance liquid chromatography with fluorescence detection (GP-HPLC-FLD) was developed. It revealed that considerable amounts of glutenins were present in most WSt. The gluten contents quantitated by GP-HPLC-FLD as sum of gliadins and glutenins were higher than those by R5 ELISA (gluten as gliadin content multiplied by a factor of 2) in 19 out of 26 WSt. Despite its limited selectivity, GP-HPLC-FLD may be applied as confirmatory method to ELISA to quantitate gluten in WSt.

Magnetic Flux Leakage Sensing and Artificial Neural Network Pattern Recognition-Based Automated Damage Detection and Quantification for Wire Rope Non-Destructive Evaluation.

PubMed

Kim, Ju-Won; Park, Seunghee

2018-01-02

In this study, a magnetic flux leakage (MFL) method, known to be a suitable non-destructive evaluation (NDE) method for continuum ferromagnetic structures, was used to detect local damage when inspecting steel wire ropes. To demonstrate the proposed damage detection method through experiments, a multi-channel MFL sensor head was fabricated using a Hall sensor array and magnetic yokes to adapt to the wire rope. To prepare the damaged wire-rope specimens, several different amounts of artificial damages were inflicted on wire ropes. The MFL sensor head was used to scan the damaged specimens to measure the magnetic flux signals. After obtaining the signals, a series of signal processing steps, including the enveloping process based on the Hilbert transform (HT), was performed to better recognize the MFL signals by reducing the unexpected noise. The enveloped signals were then analyzed for objective damage detection by comparing them with a threshold that was established based on the generalized extreme value (GEV) distribution. The detected MFL signals that exceed the threshold were analyzed quantitatively by extracting the magnetic features from the MFL signals. To improve the quantitative analysis, damage indexes based on the relationship between the enveloped MFL signal and the threshold value were also utilized, along with a general damage index for the MFL method. The detected MFL signals for each damage type were quantified by using the proposed damage indexes and the general damage indexes for the MFL method. Finally, an artificial neural network (ANN) based multi-stage pattern recognition method using extracted multi-scale damage indexes was implemented to automatically estimate the severity of the damage. To analyze the reliability of the MFL-based automated wire rope NDE method, the accuracy and reliability were evaluated by comparing the repeatedly estimated damage size and the actual damage size.

Dual color fluorescence quantitative detection of specific single-stranded DNA with molecular beacons and nucleic acid dye SYBR Green I.

PubMed

Xiang, Dong-Shan; Zhou, Guo-Hua; Luo, Ming; Ji, Xing-Hu; He, Zhi-Ke

2012-08-21

We have developed a dual color fluorescence quantitative detection method for specific single-stranded DNA with molecular beacons (MBs) and nucleic acid dye SYBR Green I by synchronous scanning fluorescence spectrometry. It is demonstrated by a reverse-transcription oligonucleotide sequence (target DNA, 33 bases) of RNA fragment of human immunodeficiency virus (HIV) as a model system. In the absence of target DNA, the MBs are in the stem-closed state, the fluorescence of 5-carboxy-X-rhodamine (ROX) is quenched by black hole quencher-2 (BHQ-2), and the interaction between SYBR Green I and the MBs is very weak. At this time the fluorescence signals of ROX and SYBR Green I are all very weak. In the presence of target DNA, MBs hybridize with target DNA and form a double-strand structure, the fluorophore ROX is separated from the quencher BHQ-2, and the fluorescence of ROX recovers. At the same time, SYBR Green I binds to hybridized dsDNA, whose fluorescence intensity is significantly enhanced. Thus, dual color fluorescence quantitative detection for the target DNA can be realized by synchronous scanning fluorescence spectrometry. In this strategy, the fluorescence signal of SYBR Green I is far larger than that of ROX, so the quantitative analysis of target DNA with the fluorescence intensity of SYBR Green I can significantly improve the detection sensitivity. In addition, the false-positive signals of MBs do not affect the fluorescence signals of nucleic acid dye SYBR Green I. Thereby, in the analysis of complex samples, quantitative analysis of target DNA with SYBR Green I can avoid the false-positive signals of MBs and improve the detection accuracy.

Detection methods and performance criteria for genetically modified organisms.

PubMed

Bertheau, Yves; Diolez, Annick; Kobilinsky, André; Magin, Kimberly

2002-01-01

Detection methods for genetically modified organisms (GMOs) are necessary for many applications, from seed purity assessment to compliance of food labeling in several countries. Numerous analytical methods are currently used or under development to support these needs. The currently used methods are bioassays and protein- and DNA-based detection protocols. To avoid discrepancy of results between such largely different methods and, for instance, the potential resulting legal actions, compatibility of the methods is urgently needed. Performance criteria of methods allow evaluation against a common standard. The more-common performance criteria for detection methods are precision, accuracy, sensitivity, and specificity, which together specifically address other terms used to describe the performance of a method, such as applicability, selectivity, calibration, trueness, precision, recovery, operating range, limit of quantitation, limit of detection, and ruggedness. Performance criteria should provide objective tools to accept or reject specific methods, to validate them, to ensure compatibility between validated methods, and be used on a routine basis to reject data outside an acceptable range of variability. When selecting a method of detection, it is also important to consider its applicability, its field of applications, and its limitations, by including factors such as its ability to detect the target analyte in a given matrix, the duration of the analyses, its cost effectiveness, and the necessary sample sizes for testing. Thus, the current GMO detection methods should be evaluated against a common set of performance criteria.

Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

PubMed

Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

2017-04-01

Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for the final evaluation. After the second evaluation, the final amplification curves and melting curves have been achieved.

Towards quantitative magnetic particle imaging: A comparison with magnetic particle spectroscopy

NASA Astrophysics Data System (ADS)

Paysen, Hendrik; Wells, James; Kosch, Olaf; Steinhoff, Uwe; Trahms, Lutz; Schaeffter, Tobias; Wiekhorst, Frank

2018-05-01

Magnetic Particle Imaging (MPI) is a quantitative imaging modality with promising features for several biomedical applications. Here, we study quantitatively the raw data obtained during MPI measurements. We present a method for the calibration of the MPI scanner output using measurements from a magnetic particle spectrometer (MPS) to yield data in units of magnetic moments. The calibration technique is validated in a simplified MPI mode with a 1D excitation field. Using the calibrated results from MPS and MPI, we determine and compare the detection limits for each system. The detection limits were found to be 5.10-12 Am2 for MPS and 3.6.10-10 Am2 for MPI. Finally, the quantitative information contained in a standard MPI measurement with a 3D excitation is analyzed and compared to the previous results, showing a decrease in signal amplitudes of the odd harmonics related to the case of 1D excitation. We propose physical explanations for all acquired results; and discuss the possible benefits for the improvement of MPI technology.

Molecular characterization of G6PD deficiency in Cyprus.

PubMed

Drousiotou, Anthi; Touma, Elias H; Andreou, Nicoletta; Loiselet, Jacques; Angastiniotis, Michalis; Verrelli, Brian C; Tishkoff, Sarah A

2004-01-01

In the present study, we determined the frequency of glucose-6-phosphate dehydrogenase (G6PD) deficiency in Cyprus using two different procedures in two separate adult population groups: a semiquantitative fluorescence test on blood spotted on filter paper and a quantitative spectrophotometric test on liquid blood. The frequency of G6PD deficiency among healthy adult males was found to be 5.1% using the semiquantitative procedure and 6.4% using the quantitative procedure. Neither method was able to detect all the expected female heterozygotes (5.3% and 47.1% of the expected number, respectively). A total of 21 male hemizygotes, 1 female homozygote and 9 female heterozygotes that tested positive for G6PD deficiency were studied at the molecular level. All 32 chromosomes were genotyped and five different mutations were identified. The Mediterranean mutation in exon 6 (563C-->T) (Ser188Phe) was found to be the most common variant in the Cypriot population, accounting for 52.6% of the deficient alleles. In the remaining chromosomes, four different mutations were identified: three known mutations, Kaiping 1388G-->A (Arg463His), Chatham 1003G-->A (Ala335Thr) and Acrokorinthos 463C-->G (His155Asp), and one previously undescribed mutation in exon 3, 148C-->T (Pro50Ser), which we called G6PD Kambos. We conclude that the frequency of G6PD deficiency in Cypriot males is 6.4%, and that this deficiency is the result of several different mutations. Although all the individuals carrying the Mediterranean variant can be detected using a semiquantitative screening method, a quantitative enzyme measurement is required to detect the G6PD variants with less severe enzyme deficiencies, while the most appropriate method for heterozygote detection is DNA analysis.