Development of a quantitative fluorescence single primer isothermal amplification-based method for the detection of Salmonella.

PubMed

Wang, Jianchang; Li, Rui; Hu, Lianxia; Sun, Xiaoxia; Wang, Jinfeng; Li, Jing

2016-02-16

Food-borne disease caused by Salmonella has long been, and continues to be, an important global public health problem, necessitating rapid and accurate detection of Salmonella in food. Real time PCR is the most recently developed approach for Salmonella detection. Single primer isothermal amplification (SPIA), a novel gene amplification technique, has emerged as an attractive microbiological testing method. SPIA is performed under a constant temperature, eliminating the need for an expensive thermo-cycler. In addition, SPIA reactions can be accomplished in 30 min, faster than real time PCR that usually takes over 2h. We developed a quantitative fluorescence SPIA-based method for the detection of Salmonella. Using Salmonella Typhimurium genomic DNA as template and a primer targeting Salmonella invA gene, we showed the detection limit of SPIA was 2.0 × 10(1)fg DNA. Its successful amplification of different serotypic Salmonella genomic DNA but not non-Salmonella bacterial DNA demonstrated the specificity of SPIA. Furthermore, this method was validated with artificially contaminated beef. In conclusion, we showed high sensitivity and specificity of SPIA in the detection of Salmonella, comparable to real time PCR. In addition, SPIA is faster and more cost-effective (non-use of expensive cyclers), making it a potential alternative for field detection of Salmonella in resource-limited settings that are commonly encountered in developing countries. Copyright © 2015 Elsevier B.V. All rights reserved.

Influence analysis in quantitative trait loci detection.

PubMed

Dou, Xiaoling; Kuriki, Satoshi; Maeno, Akiteru; Takada, Toyoyuki; Shiroishi, Toshihiko

2014-07-01

This paper presents systematic methods for the detection of influential individuals that affect the log odds (LOD) score curve. We derive general formulas of influence functions for profile likelihoods and introduce them into two standard quantitative trait locus detection methods-the interval mapping method and single marker analysis. Besides influence analysis on specific LOD scores, we also develop influence analysis methods on the shape of the LOD score curves. A simulation-based method is proposed to assess the significance of the influence of the individuals. These methods are shown useful in the influence analysis of a real dataset of an experimental population from an F2 mouse cross. By receiver operating characteristic analysis, we confirm that the proposed methods show better performance than existing diagnostics. © 2014 The Author. Biometrical Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Target-responsive DNAzyme cross-linked hydrogel for visual quantitative detection of lead.

PubMed

Huang, Yishun; Ma, Yanli; Chen, Yahong; Wu, Xuemeng; Fang, Luting; Zhu, Zhi; Yang, Chaoyong James

2014-11-18

Because of the severe health risks associated with lead pollution, rapid, sensitive, and portable detection of low levels of Pb(2+) in biological and environmental samples is of great importance. In this work, a Pb(2+)-responsive hydrogel was prepared using a DNAzyme and its substrate as cross-linker for rapid, sensitive, portable, and quantitative detection of Pb(2+). Gold nanoparticles (AuNPs) were first encapsulated in the hydrogel as an indicator for colorimetric analysis. In the absence of lead, the DNAzyme is inactive, and the substrate cross-linker maintains the hydrogel in the gel form. In contrast, the presence of lead activates the DNAzyme to cleave the substrate, decreasing the cross-linking density of the hydrogel and resulting in dissolution of the hydrogel and release of AuNPs for visual detection. As low as 10 nM Pb(2+) can be detected by the naked eye. Furthermore, to realize quantitative visual detection, a volumetric bar-chart chip (V-chip) was used for quantitative readout of the hydrogel system by replacing AuNPs with gold-platinum core-shell nanoparticles (Au@PtNPs). The Au@PtNPs released from the hydrogel upon target activation can efficiently catalyze the decomposition of H2O2 to generate a large volume of O2. The gas pressure moves an ink bar in the V-chip for portable visual quantitative detection of lead with a detection limit less than 5 nM. The device was able to detect lead in digested blood with excellent accuracy. The method developed can be used for portable lead quantitation in many applications. Furthermore, the method can be further extended to portable visual quantitative detection of a variety of targets by replacing the lead-responsive DNAzyme with other DNAzymes.

Detection of Legionella species in environmental water by the quantitative PCR method in combination with ethidium monoazide treatment.

PubMed

Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio

2015-01-01

We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.

Chemoenzymatic method for glycomics: isolation, identification, and quantitation

PubMed Central

Yang, Shuang; Rubin, Abigail; Eshghi, Shadi Toghi; Zhang, Hui

2015-01-01

Over the past decade, considerable progress has been made with respect to the analytical methods for analysis of glycans from biological sources. Regardless of the specific methods that are used, glycan analysis includes isolation, identification, and quantitation. Derivatization is indispensable to increase their identification. Derivatization of glycans can be performed by permethylation or carbodiimide coupling / esterification. By introducing a fluorophore or chromophore at their reducing end, glycans can be separated by electrophoresis or chromatography. The fluorogenically labeled glycans can be quantitated using fluorescent detection. The recently developed approaches using solid-phase such as glycoprotein immobilization for glycan extraction and on-tissue glycan mass spectrometry imaging demonstrate advantages over methods performed in solution. Derivatization of sialic acids is favorably implemented on the solid support using carbodiimide coupling, and the released glycans can be further modified at the reducing end or permethylated for quantitative analysis. In this review, methods for glycan isolation, identification, and quantitation are discussed. PMID:26390280

An effective method for the quantitative detection of porcine endogenous retrovirus in pig tissues.

PubMed

Zhang, Peng; Yu, Ping; Wang, Wei; Zhang, Li; Li, Shengfu; Bu, Hong

2010-05-01

Xenotransplantation shows great promise for providing a virtually limitless supply of cells, tissues, and organs for a variety of therapeutical procedures. However, the potential of porcine endogenous retrovirus (PERV) as a human-tropic pathogen, particularly as a public health risk, is a major concern for xenotransplantation. This study focus on the detection of copy number in various tissues and organs in Banna Minipig Inbreed (BMI) from 2006 to 2007 in West China Hospital, Sichuan University. Real-time quantitative polymerase chain reaction (SYBR Green I) was performed in this study. The results showed that the pol gene had the most copy number in tissues compared with gag, envA, and envB. Our experiment will offer a rapid and accurate method for the detection of the copy number in various tissues and was especially suitable for the selection of tissues or organs in future clinical xenotransplantation.

Quantitative detection of bovine and porcine gelatin difference using surface plasmon resonance based biosensor

NASA Astrophysics Data System (ADS)

Wardani, Devy P.; Arifin, Muhammad; Suharyadi, Edi; Abraha, Kamsul

2015-05-01

Gelatin is a biopolymer derived from collagen that is widely used in food and pharmaceutical products. Due to some religion restrictions and health issues regarding the gelatin consumption which is extracted from certain species, it is necessary to establish a robust, reliable, sensitive and simple quantitative method to detect gelatin from different parent collagen species. To the best of our knowledge, there has not been a gelatin differentiation method based on optical sensor that could detect gelatin from different species quantitatively. Surface plasmon resonance (SPR) based biosensor is known to be a sensitive, simple and label free optical method for detecting biomaterials that is able to do quantitative detection. Therefore, we have utilized SPR-based biosensor to detect the differentiation between bovine and porcine gelatin in various concentration, from 0% to 10% (w/w). Here, we report the ability of SPR-based biosensor to detect difference between both gelatins, its sensitivity toward the gelatin concentration change, its reliability and limit of detection (LOD) and limit of quantification (LOQ) of the sensor. The sensor's LOD and LOQ towards bovine gelatin concentration are 0.38% and 1.26% (w/w), while towards porcine gelatin concentration are 0.66% and 2.20% (w/w), respectively. The results show that SPR-based biosensor is a promising tool for detecting gelatin from different raw materials quantitatively.

Detection of sex chromosome aneuploidies using quantitative fluorescent PCR in the Hungarian population.

PubMed

Nagy, Balint; Nagy, Richard Gyula; Lazar, Levente; Schonleber, Julianna; Papp, Csaba; Rigo, Janos

2015-05-20

Aneuploidies are the most frequent chromosomal abnormalities at birth. Autosomal aneuploidies cause serious malformations like trisomy 21, trisomy 18 and trisomy 13. However sex chromosome aneuploidies are causing less severe syndromes. For the detection of these aneuploidies, the "gold standard" method is the cytogenetic analysis of fetal cells, karyograms show all numerical and structural abnormalities, but it takes 2-4 weeks to get the reports. Molecular biological methods were developed to overcome the long culture time, thus, FISH and quantitative fluorescent PCR were introduced. In this work we show our experience with a commercial kit for the detection of sex chromosome aneuploidies. We analyzed 20.173 amniotic fluid samples for the period of 2006-2013 in our department. A conventional cytogenetic analysis was performed on the samples. We checked the reliability of quantitative fluorescent PCR and DNA fragment analysis on those samples where sex chromosomal aneuploidy was diagnosed. From the 20.173 amniotic fluid samples we found 50 samples with sex chromosome aneuploidy. There were 19 samples showing 46, XO, 17 samples with 46, XXY, 9 samples with 47, XXX and 5 samples with 47, XYY karyotypes. The applied quantitative fluorescent PCR and DNA fragment analyses method are suitable to detect all abnormal sex chromosome aneuploidies. Quantitative fluorescent PCR is a fast and reliable method for detection of sex chromosome aneuploidies. Copyright © 2015. Published by Elsevier B.V.

Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

PubMed

Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

2015-01-01

The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

Development and application of absolute quantitative detection by duplex chamber-based digital PCR of genetically modified maize events without pretreatment steps.

PubMed

Zhu, Pengyu; Fu, Wei; Wang, Chenguang; Du, Zhixin; Huang, Kunlun; Zhu, Shuifang; Xu, Wentao

2016-04-15

The possibility of the absolute quantitation of GMO events by digital PCR was recently reported. However, most absolute quantitation methods based on the digital PCR required pretreatment steps. Meanwhile, singleplex detection could not meet the demand of the absolute quantitation of GMO events that is based on the ratio of foreign fragments and reference genes. Thus, to promote the absolute quantitative detection of different GMO events by digital PCR, we developed a quantitative detection method based on duplex digital PCR without pretreatment. Moreover, we tested 7 GMO events in our study to evaluate the fitness of our method. The optimized combination of foreign and reference primers, limit of quantitation (LOQ), limit of detection (LOD) and specificity were validated. The results showed that the LOQ of our method for different GMO events was 0.5%, while the LOD is 0.1%. Additionally, we found that duplex digital PCR could achieve the detection results with lower RSD compared with singleplex digital PCR. In summary, the duplex digital PCR detection system is a simple and stable way to achieve the absolute quantitation of different GMO events. Moreover, the LOQ and LOD indicated that this method is suitable for the daily detection and quantitation of GMO events. Copyright © 2016 Elsevier B.V. All rights reserved.

Competitor internal standards for quantitative detection of mycoplasma DNA.

PubMed

Sidhu, M K; Rashidbaigi, A; Testa, D; Liao, M J

1995-05-01

Homologous internal controls were used as competitor DNA in the polymerase chain reaction for the quantitative detection of mycoplasma DNA. PCR primer sets were designed on the basis of the most conserved nucleotide sequences of the 16S rRNA gene of mycoplasma species. Amplification of this gene was examined in five different mycoplasma species: Mycoplasma orale, M. hyorhinus, M. synoviae, M. gallisepticum and M. pneumoniae. To evaluate the primers, a number of different cell lines were assayed for the detection of mycoplasma infections. All positive cell lines showed a distinct product on agarose gels while uninfected cells showed no DNA amplification. Neither bacterial nor eukaryotic DNA produced any cross-reaction with the primers used, thus confirming their specificity. Internal control DNA to be used for quantitation was constructed by modifying the sizes of the wild-type amplified products and cloning them in plasmid vectors. These controls used the same primer binding sites as the wild-type and the amplified products were differentiated by a size difference. The detection limits for all the mycoplasma species by competitive quantitative PCR were estimated to range from 4 to 60 genome copies per assay as determined by ethidium bromide-stained agarose gels. These internal standards also serve as positive controls in PCR-based detection of mycoplasma DNA, and therefore accidental contamination of test samples with wild-type positive controls can be eliminated. The quantitative PCR method developed will be useful in monitoring the progression and significance of mycoplasma in the disease process.

Detection of linkage between a quantitative trait and a marker locus by the lod score method: sample size and sampling considerations.

PubMed

Demenais, F; Lathrop, G M; Lalouel, J M

1988-07-01

A simulation study is here conducted to measure the power of the lod score method to detect linkage between a quantitative trait and a marker locus in various situations. The number of families necessary to detect such linkage with 80% power is assessed for different sets of parameters at the trait locus and different values of the recombination fraction. The effects of varying the mode of sampling families and the sibship size are also evaluated.

Optimization of Statistical Methods Impact on Quantitative Proteomics Data.

PubMed

Pursiheimo, Anna; Vehmas, Anni P; Afzal, Saira; Suomi, Tomi; Chand, Thaman; Strauss, Leena; Poutanen, Matti; Rokka, Anne; Corthals, Garry L; Elo, Laura L

2015-10-02

As tools for quantitative label-free mass spectrometry (MS) rapidly develop, a consensus about the best practices is not apparent. In the work described here we compared popular statistical methods for detecting differential protein expression from quantitative MS data using both controlled experiments with known quantitative differences for specific proteins used as standards as well as "real" experiments where differences in protein abundance are not known a priori. Our results suggest that data-driven reproducibility-optimization can consistently produce reliable differential expression rankings for label-free proteome tools and are straightforward in their application.

Criteria For Evaluation of Proposed Protozoan Detection Methods

EPA Science Inventory

Currently, the only EPA approved method for detection and quantitation of protozoan cysts and oöcysts in source and drinking water, is the “ICR Protozoan Method for Detecting Giardia Cysts and Cryptosporidium Oöcysts in Water by a Fluorescent Antibody Procedure (ICR Microbial La...

Hypersensitive Detection and Quantitation of BoNT/A by IgY Antibody against Substrate Linear-Peptide

PubMed Central

Li, Tao; Liu, Hao; Cai, Kun; Tian, Maoren; Wang, Qin; Shi, Jing; Gao, Xiang; Wang, Hui

2013-01-01

Botulinum neurotoxin A (BoNT/A), the most acutely poisonous substance to humans known, cleave its SNAP-25 substrate with high specificity. Based on the endopeptidase activity, different methods have been developed to detect BoNT/A, but most lack ideal reproducibility or sensitivity, or suffer from long-term or unwanted interferences. In this study, we developed a simple method to detect and quantitate trace amounts of botulinum neurotoxin A using the IgY antibody against a linear-peptide substrate. The effects of reaction buffer, time, and temperature were analyzed and optimized. When the optimized assay was used to detect BoNT/A, the limit of detection of the assay was 0.01 mouse LD50 (0.04 pg), and the limit of quantitation was 0.12 mouse LD50/ml (0.48 pg). The findings also showed favorable specificity of detecting BoNT/A. When used to detect BoNT/A in milk or human serum, the proposed assay exhibited good quantitative accuracy (88% < recovery < 111%; inter- and intra-assay CVs < 18%). This method of detection took less than 3 h to complete, indicating that it can be a valuable method of detecting BoNT/A in food or clinical diagnosis. PMID:23555605

Hypersensitive detection and quantitation of BoNT/A by IgY antibody against substrate linear-peptide.

PubMed

Li, Tao; Liu, Hao; Cai, Kun; Tian, Maoren; Wang, Qin; Shi, Jing; Gao, Xiang; Wang, Hui

2013-01-01

Botulinum neurotoxin A (BoNT/A), the most acutely poisonous substance to humans known, cleave its SNAP-25 substrate with high specificity. Based on the endopeptidase activity, different methods have been developed to detect BoNT/A, but most lack ideal reproducibility or sensitivity, or suffer from long-term or unwanted interferences. In this study, we developed a simple method to detect and quantitate trace amounts of botulinum neurotoxin A using the IgY antibody against a linear-peptide substrate. The effects of reaction buffer, time, and temperature were analyzed and optimized. When the optimized assay was used to detect BoNT/A, the limit of detection of the assay was 0.01 mouse LD50 (0.04 pg), and the limit of quantitation was 0.12 mouse LD50/ml (0.48 pg). The findings also showed favorable specificity of detecting BoNT/A. When used to detect BoNT/A in milk or human serum, the proposed assay exhibited good quantitative accuracy (88% < recovery < 111%; inter- and intra-assay CVs < 18%). This method of detection took less than 3 h to complete, indicating that it can be a valuable method of detecting BoNT/A in food or clinical diagnosis.

Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

PubMed

Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

2017-04-01

Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

Method and apparatus for chromatographic quantitative analysis

DOEpatents

Fritz, James S.; Gjerde, Douglas T.; Schmuckler, Gabriella

1981-06-09

An improved apparatus and method for the quantitative analysis of a solution containing a plurality of anion species by ion exchange chromatography which utilizes a single eluent and a single ion exchange bed which does not require periodic regeneration. The solution containing the anions is added to an anion exchange resin bed which is a low capacity macroreticular polystyrene-divinylbenzene resin containing quarternary ammonium functional groups, and is eluted therefrom with a dilute solution of a low electrical conductance organic acid salt. As each anion species is eluted from the bed, it is quantitatively sensed by conventional detection means such as a conductivity cell.

A Label-Free, Quantitative Fecal Hemoglobin Detection Platform for Colorectal Cancer Screening

PubMed Central

Soraya, Gita V.; Nguyen, Thanh C.; Abeyrathne, Chathurika D.; Huynh, Duc H.; Chan, Jianxiong; Nguyen, Phuong D.; Nasr, Babak; Chana, Gursharan; Kwan, Patrick; Skafidas, Efstratios

2017-01-01

The early detection of colorectal cancer is vital for disease management and patient survival. Fecal hemoglobin detection is a widely-adopted method for screening and early diagnosis. Fecal Immunochemical Test (FIT) is favored over the older generation chemical based Fecal Occult Blood Test (FOBT) as it does not require dietary or drug restrictions, and is specific to human blood from the lower digestive tract. To date, no quantitative FIT platforms are available for use in the point-of-care setting. Here, we report proof of principle data of a novel low cost quantitative fecal immunochemical-based biosensor platform that may be further developed into a point-of-care test in low-resource settings. The label-free prototype has a lower limit of detection (LOD) of 10 µg hemoglobin per gram (Hb/g) of feces, comparable to that of conventional laboratory based quantitative FIT diagnostic systems. PMID:28475117

Quantitative photoacoustic elasticity and viscosity imaging for cirrhosis detection

NASA Astrophysics Data System (ADS)

Wang, Qian; Shi, Yujiao; Yang, Fen; Yang, Sihua

2018-05-01

Elasticity and viscosity assessments are essential for understanding and characterizing the physiological and pathological states of tissue. In this work, by establishing a photoacoustic (PA) shear wave model, an approach for quantitative PA elasticity imaging based on measurement of the rise time of the thermoelastic displacement was developed. Thus, using an existing PA viscoelasticity imaging method that features a phase delay measurement, quantitative PA elasticity imaging and viscosity imaging can be obtained in a simultaneous manner. The method was tested and validated by imaging viscoelastic agar phantoms prepared at different agar concentrations, and the imaging data were in good agreement with rheometry results. Ex vivo experiments on liver pathological models demonstrated the capability for cirrhosis detection, and the results were consistent with the corresponding histological results. This method expands the scope of conventional PA imaging and has potential to become an important alternative imaging modality.

Quantitative detection of the colloidal gold immunochromatographic strip in HSV color space

NASA Astrophysics Data System (ADS)

Wu, Yuanshu; Gao, Yueming; Du, Min

2014-09-01

In this paper, a fast, reliable and accurate quantitative detection method for the colloidal gold immunochromatographic strip(GICA) is presented. An image acquisition device which is mainly composed of annular LED source, zoom ratio lens, and 10bit CMOS image sensors with 54.5dB SNR is designed for the detection. Firstly, the test line is extracted from the strip window through using the H component peak points of the HSV space as the clustering centers via the Fuzzy C-Means(FCM) clustering method. Then, a two dimensional eigenvalue composed with the hue(H) and saturation(S) of HSV space was proposed to improve the accuracy of the quantitative detection. At last, the experiment of human chorionic gonadotropin(HCG) with the concentration range 0-500mIU/mL is carried out. The results show that the linear correlation coefficient between this method and optical density(OD) values measured by the fiber optical sensor reach 96.74%. Meanwhile, the linearity of fitting curve constructed with concentration was greater than 95.00%.

Sensitive method for the quantitation of droloxifene in plasma and serum by high-performance liquid chromatography employing fluorimetric detection.

PubMed

Tess, D A; Cole, R O; Toler, S M

1995-12-15

A simple and highly sensitive reversed-phase fluorimetric HPLC method for the quantitation of droloxifene from rat, monkey, and human plasma as well as human serum is described. This assay employs solid-phase extraction and has a dynamic range of 25 to 10,000 pg/ml. Sample extraction (efficiencies > 86%) was accomplished using a benzenesulfonic acid (SCX) column with water and methanol rinses. Droloxifene and internal standard were eluted with 1 ml of 3.5% (v/v) ammonium hydroxide (30%) in methanol. Samples were quantitated using post-column UV-photochemical cyclization coupled with fluorimetric detection with excitation and emission wavelengths of 260 nm and 375 nm, respectively. Relative ease of sample extraction and short run times allow for the analysis of approximately 100 samples per day.

A gold nanoparticle-based semi-quantitative and quantitative ultrasensitive paper sensor for the detection of twenty mycotoxins

NASA Astrophysics Data System (ADS)

Kong, Dezhao; Liu, Liqiang; Song, Shanshan; Suryoprabowo, Steven; Li, Aike; Kuang, Hua; Wang, Libing; Xu, Chuanlai

2016-02-01

A semi-quantitative and quantitative multi-immunochromatographic (ICA) strip detection assay was developed for the simultaneous detection of twenty types of mycotoxins from five classes, including zearalenones (ZEAs), deoxynivalenols (DONs), T-2 toxins (T-2s), aflatoxins (AFs), and fumonisins (FBs), in cereal food samples. Sensitive and specific monoclonal antibodies were selected for this assay. The semi-quantitative results were obtained within 20 min by the naked eye, with visual limits of detection for ZEAs, DONs, T-2s, AFs and FBs of 0.1-0.5, 2.5-250, 0.5-1, 0.25-1 and 2.5-10 μg kg-1, and cut-off values of 0.25-1, 5-500, 1-10, 0.5-2.5 and 5-25 μg kg-1, respectively. The quantitative results were obtained using a hand-held strip scan reader, with the calculated limits of detection for ZEAs, DONs, T-2s, AFs and FBs of 0.04-0.17, 0.06-49, 0.15-0.22, 0.056-0.49 and 0.53-1.05 μg kg-1, respectively. The analytical results of spiked samples were in accordance with the accurate content in the simultaneous detection analysis. This newly developed ICA strip assay is suitable for the on-site detection and rapid initial screening of mycotoxins in cereal samples, facilitating both semi-quantitative and quantitative determination.A semi-quantitative and quantitative multi-immunochromatographic (ICA) strip detection assay was developed for the simultaneous detection of twenty types of mycotoxins from five classes, including zearalenones (ZEAs), deoxynivalenols (DONs), T-2 toxins (T-2s), aflatoxins (AFs), and fumonisins (FBs), in cereal food samples. Sensitive and specific monoclonal antibodies were selected for this assay. The semi-quantitative results were obtained within 20 min by the naked eye, with visual limits of detection for ZEAs, DONs, T-2s, AFs and FBs of 0.1-0.5, 2.5-250, 0.5-1, 0.25-1 and 2.5-10 μg kg-1, and cut-off values of 0.25-1, 5-500, 1-10, 0.5-2.5 and 5-25 μg kg-1, respectively. The quantitative results were obtained using a hand-held strip scan

A Spectral Method for Color Quantitation of a Protein Drug Solution.

PubMed

Swartz, Trevor E; Yin, Jian; Patapoff, Thomas W; Horst, Travis; Skieresz, Susan M; Leggett, Gordon; Morgan, Charles J; Rahimi, Kimia; Marhoul, Joseph; Kabakoff, Bruce

2016-01-01

Color is an important quality attribute for biotherapeutics. In the biotechnology industry, a visual method is most commonly utilized for color characterization of liquid drug protein solutions. The color testing method is used for both batch release and on stability testing for quality control. Using that method, an analyst visually determines the color of the sample by choosing the closest matching European Pharmacopeia reference color solution. The requirement to judge the best match makes it a subjective method. Furthermore, the visual method does not capture data on hue or chroma that would allow for improved product characterization and the ability to detect subtle differences between samples. To overcome these challenges, we describe a quantitative method for color determination that greatly reduces the variability in measuring color and allows for a more precise understanding of color differences. Following color industry standards established by International Commission on Illumination, this method converts a protein solution's visible absorption spectra to L*a*b* color space. Color matching is achieved within the L*a*b* color space, a practice that is already widely used in other industries. The work performed here is to facilitate the adoption and transition for the traditional visual assessment method to a quantitative spectral method. We describe here the algorithm used such that the quantitative spectral method correlates with the currently used visual method. In addition, we provide the L*a*b* values for the European Pharmacopeia reference color solutions required for the quantitative method. We have determined these L*a*b* values by gravimetrically preparing and measuring multiple lots of the reference color solutions. We demonstrate that the visual assessment and the quantitative spectral method are comparable using both low- and high-concentration antibody solutions and solutions with varying turbidity. In the biotechnology industry, a visual

Quantitative detection of type A staphylococcal enterotoxin by Laurell electroimmunodiffusion.

PubMed

Gasper, E; Heimsch, R C; Anderson, A W

1973-03-01

The detection of staphylococcal enterotoxin A by the quantitative technique of electroimmunodiffusion is described. High dilutions of type-specific rabbit antiserum were used in 1% agarose gels, 1 mm thick, and prepared in 0.05-mug barbital buffer, pH 8.6. Volumes of 10 muliters containing 1.5 to 10 ng of toxin were electrophoresed out of 4-mm diameter wells at 5 mA/cm width of gel. The precipitin cones formed were made visible by first immersing the agarose gels in 0.2 M NaCl and then overlaying the surface with the purified globulin fraction of sheep serum against rabbit globulin, followed by soaking of the gels in 1% aqueous cadmium acetate and staining with 0.1% thiazine red in 1% glacial acetic acid. Fully extended cones, 4 to 23 mm in length depending on toxin concentration and antiserum dilution, were developed in 2 to 5 h of electrophoresis, and visualization was achieved within 2 to 3 h. Because the method is qualitative, quantitative, simple, rapid, and sensitive, it offers a practical tool for the detection of small amounts of bacterial toxins in contaminated foods. The method should also qualify as a sensitive detection device in biochemical procedures which attempt to trace, detect, and identify biological substances in nanogram quantities, provided these substances are antigenic and capable of forming a precipitate with their specific antibodies.

An event-specific method for the detection and quantification of ML01, a genetically modified Saccharomyces cerevisiae wine strain, using quantitative PCR.

PubMed

Vaudano, Enrico; Costantini, Antonella; Garcia-Moruno, Emilia

2016-10-03

The availability of genetically modified (GM) yeasts for winemaking and, in particular, transgenic strains based on the integration of genetic constructs deriving from other organisms into the genome of Saccharomyces cerevisiae, has been a reality for several years. Despite this, their use is only authorized in a few countries and limited to two strains: ML01, able to convert malic acid into lactic acid during alcoholic fermentation, and ECMo01 suitable for reducing the risk of carbamate production. In this work we propose a quali-quantitative culture-independent method for the detection of GM yeast ML01 in commercial preparations of ADY (Active Dry Yeast) consisting of efficient extraction of DNA and qPCR (quantitative PCR) analysis based on event-specific assay targeting MLC (malolactic cassette), and a taxon-specific S. cerevisiae assay detecting the MRP2 gene. The ADY DNA extraction methodology has been shown to provide good purity DNA suitable for subsequent qPCR. The MLC and MRP2 qPCR assay showed characteristics of specificity, dynamic range, limit of quantification (LOQ) limit of detection (LOD), precision and trueness, which were fully compliant with international reference guidelines. The method has been shown to reliably detect 0.005% (mass/mass) of GM ML01 S. cerevisiae in commercial preparations of ADY. Copyright © 2016 Elsevier B.V. All rights reserved.

Semi-Quantitative Method for Streptococci Magnetic Detection in Raw Milk.

PubMed

Duarte, Carla; Costa, Tiago; Carneiro, Carla; Soares, Rita; Jitariu, Andrei; Cardoso, Susana; Piedade, Moisés; Bexiga, Ricardo; Freitas, Paulo

2016-04-27

Bovine mastitis is the most costly disease for dairy farmers and the most frequent reason for the use of antibiotics in dairy cattle; thus, control measures to detect and prevent mastitis are crucial for dairy farm sustainability. The aim of this study was to develop and validate a sensitive method to magnetically detect Streptococcus agalactiae (a Group B streptococci) and Streptococcus uberis in raw milk samples. Mastitic milk samples were collected aseptically from 44 cows with subclinical mastitis, from 11 Portuguese dairy farms. Forty-six quarter milk samples were selected based on bacterial identification by conventional microbiology. All samples were submitted to PCR analysis. In parallel, these milk samples were mixed with a solution combining specific antibodies and magnetic nanoparticles, to be analyzed using a lab-on-a-chip magnetoresistive cytometer, with microfluidic sample handling. This paper describes a point of care methodology used for detection of bacteria, including analysis of false positive/negative results. This immunological recognition was able to detect bacterial presence in samples spiked above 100 cfu/mL, independently of antibody and targeted bacteria used in this work. Using PCR as a reference, this method correctly identified 73% of positive samples for streptococci species with an anti-S. agalactiae antibody, and 41% of positive samples for an anti-GB streptococci antibody.

A RAPID METHOD FOR THE EXTRACTION OF FUNGAL DNA FROM ENVIRONMENTAL SAMPLES: EVALUATION IN THE QUANTITATIVE ANALYSIS OF MEMNONIELLA ECHINATA CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS

EPA Science Inventory

New technologies are creating the potential for using nucleic acid sequence detection to perform routine microbiological analyses of environmental samples. Our laboratory has recently reported on the development of a method for the quantitative detection of Stachybotrys chartarum...

The fragmented testis method: development and its advantages of a new quantitative evaluation technique for detection of testis-ova in male fish.

PubMed

Lin, Bin-Le; Hagino, Satoshi; Kagoshima, Michio; Iwamatsu, Takashi

2009-02-01

A new quantitative evaluation technique, termed the fragmented testis method, has been developed for the detection of testis-ova in genotypic male fish using the medaka (Oryzias latipes). The routine traditional histological method for detection of testis-ova in male fish exposed to estrogens or suspected endocrine-disrupting chemicals has several disadvantages, including possible oversight of testis-ova due to limited sampling of selected tissue sections. The method we have developed here allows for the accurate determination of the developmental stages and the number and the size of testis-ova in a whole testis. Each testis was removed from the fish specimen, fixed with 10% buffered formalin solution, and then divided into small fragments on a glass slide with a dissecting needle or scalpel and aciform forceps in glycerin solution containing a small amount of methylene blue or toluidine blue. If present, all developing testis-ova of various sizes in fragmented testicular tissues were clearly stained and were observable under a dissecting microscope. Testis-ova occurred in controls were ascertained, while spermatozoa were also distinguishable using this method. This proved to be a convenient and cost-effective method for quantitatively evaluating testis-ova appearance in fish, and it may help to clarify the mechanism of testis-ova formation and the biological significance of testis-ova in future studies of endocrine disruption.

A new method to evaluate image quality of CBCT images quantitatively without observers

PubMed Central

Shimizu, Mayumi; Okamura, Kazutoshi; Yoshida, Shoko; Weerawanich, Warangkana; Tokumori, Kenji; Jasa, Gainer R; Yoshiura, Kazunori

2017-01-01

Objectives: To develop an observer-free method for quantitatively evaluating the image quality of CBCT images by applying just-noticeable difference (JND). Methods: We used two test objects: (1) a Teflon (polytetrafluoroethylene) plate phantom attached to a dry human mandible; and (2) a block phantom consisting of a Teflon step phantom and an aluminium step phantom. These phantoms had holes with different depths. They were immersed in water and scanned with a CB MercuRay (Hitachi Medical Corporation, Tokyo, Japan) at tube voltages of 120 kV, 100 kV, 80 kV and 60 kV. Superimposed images of the phantoms with holes were used for evaluation. The number of detectable holes was used as an index of image quality. In detecting holes quantitatively, the threshold grey value (ΔG), which differentiated holes from the background, was calculated using a specific threshold (the JND), and we extracted the holes with grey values above ΔG. The indices obtained by this quantitative method (the extracted hole values) were compared with the observer evaluations (the observed hole values). In addition, the contrast-to-noise ratio (CNR) of the shallowest detectable holes and the deepest undetectable holes were measured to evaluate the contribution of CNR to detectability. Results: The results of this evaluation method corresponded almost exactly with the evaluations made by observers. The extracted hole values reflected the influence of different tube voltages. All extracted holes had an area with a CNR of ≥1.5. Conclusions: This quantitative method of evaluating CBCT image quality may be more useful and less time-consuming than evaluation by observation. PMID:28045343

Quantitative analysis of PEG-functionalized colloidal gold nanoparticles using charged aerosol detection.

PubMed

Smith, Mackensie C; Crist, Rachael M; Clogston, Jeffrey D; McNeil, Scott E

2015-05-01

Surface characteristics of a nanoparticle, such as functionalization with polyethylene glycol (PEG), are critical to understand and achieve optimal biocompatibility. Routine physicochemical characterization such as UV-vis spectroscopy (for gold nanoparticles), dynamic light scattering, and zeta potential are commonly used to assess the presence of PEG. However, these techniques are merely qualitative and are not sensitive enough to distinguish differences in PEG quantity, density, or presentation. As an alternative, two methods are described here which allow for quantitative measurement of PEG on PEGylated gold nanoparticles. The first, a displacement method, utilizes dithiothreitol to displace PEG from the gold surface. The dithiothreitol-coated gold nanoparticles are separated from the mixture via centrifugation, and the excess dithiothreitol and dissociated PEG are separated through reversed-phase high-performance liquid chromatography (RP-HPLC). The second, a dissolution method, utilizes potassium cyanide to dissolve the gold nanoparticles and liberate PEG. Excess CN(-), Au(CN)2 (-), and free PEG are separated using RP-HPLC. In both techniques, the free PEG can be quantified against a standard curve using charged aerosol detection. The displacement and dissolution methods are validated here using 2-, 5-, 10-, and 20-kDa PEGylated 30-nm colloidal gold nanoparticles. Further value in these techniques is demonstrated not only by quantitating the total PEG fraction but also by being able to be adapted to quantitate the free unbound PEG and the bound PEG fractions. This is an important distinction, as differences in the bound and unbound PEG fractions can affect biocompatibility, which would not be detected in techniques that only quantitate the total PEG fraction.

Semi-Quantitative Method for Streptococci Magnetic Detection in Raw Milk

PubMed Central

Duarte, Carla; Costa, Tiago; Carneiro, Carla; Soares, Rita; Jitariu, Andrei; Cardoso, Susana; Piedade, Moisés; Bexiga, Ricardo; Freitas, Paulo

2016-01-01

Bovine mastitis is the most costly disease for dairy farmers and the most frequent reason for the use of antibiotics in dairy cattle; thus, control measures to detect and prevent mastitis are crucial for dairy farm sustainability. The aim of this study was to develop and validate a sensitive method to magnetically detect Streptococcus agalactiae (a Group B streptococci) and Streptococcus uberis in raw milk samples. Mastitic milk samples were collected aseptically from 44 cows with subclinical mastitis, from 11 Portuguese dairy farms. Forty-six quarter milk samples were selected based on bacterial identification by conventional microbiology. All samples were submitted to PCR analysis. In parallel, these milk samples were mixed with a solution combining specific antibodies and magnetic nanoparticles, to be analyzed using a lab-on-a-chip magnetoresistive cytometer, with microfluidic sample handling. This paper describes a point of care methodology used for detection of bacteria, including analysis of false positive/negative results. This immunological recognition was able to detect bacterial presence in samples spiked above 100 cfu/mL, independently of antibody and targeted bacteria used in this work. Using PCR as a reference, this method correctly identified 73% of positive samples for streptococci species with an anti-S. agalactiae antibody, and 41% of positive samples for an anti-GB streptococci antibody. PMID:27128950

Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985.

PubMed

Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing

2010-02-01

To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.

Improved method and apparatus for chromatographic quantitative analysis

DOEpatents

Fritz, J.S.; Gjerde, D.T.; Schmuckler, G.

An improved apparatus and method are described for the quantitative analysis of a solution containing a plurality of anion species by ion exchange chromatography which utilizes a single element and a single ion exchange bed which does not require periodic regeneration. The solution containing the anions is added to an anion exchange resin bed which is a low capacity macroreticular polystyrene-divinylbenzene resin containing quarternary ammonium functional groups, and is eluted therefrom with a dilute solution of a low electrical conductance organic acid salt. As each anion species is eluted from the bed, it is quantitatively sensed by conventional detection means such as a conductivity cell.

Novel method for quantitative ANA measurement using near-infrared imaging.

PubMed

Peterson, Lisa K; Wells, Daniel; Shaw, Laura; Velez, Maria-Gabriela; Harbeck, Ronald; Dragone, Leonard L

2009-09-30

Antinuclear antibodies (ANA) have been detected in patients with systemic rheumatic diseases and are used in the screening and/or diagnosis of autoimmunity in patients as well as mouse models of systemic autoimmunity. Indirect immunofluorescence (IIF) on HEp-2 cells is the gold standard for ANA screening. However, its usefulness is limited in diagnosis, prognosis and monitoring of disease activity due to the lack of standardization in performing the technique, subjectivity in interpreting the results and the fact that it is only semi-quantitative. Various immunological techniques have been developed in an attempt to improve upon the method to quantify ANA, including enzyme-linked immunosorbent assays (ELISAs), line immunoassays (LIAs), multiplexed bead immunoassays and IIF on substrates other than HEp-2 cells. Yet IIF on HEp-2 cells remains the most common screening method for ANA. In this study, we describe a simple quantitative method to detect ANA which combines IIF on HEp-2 coated slides with analysis using a near-infrared imaging (NII) system. Using NII to determine ANA titer, 86.5% (32 of 37) of the titers for human patient samples were within 2 dilutions of those determined by IIF, which is the acceptable range for proficiency testing. Combining an initial screening for nuclear staining using microscopy with titration by NII resulted in 97.3% (36 of 37) of the titers detected to be within two dilutions of those determined by IIF. The NII method for quantitative ANA measurements using serum from both patients and mice with autoimmunity provides a fast, relatively simple, objective, sensitive and reproducible assay, which could easily be standardized for comparison between laboratories.

Quantitative and multiplexed detection for blood typing based on quantum dot-magnetic bead assay.

PubMed

Xu, Ting; Zhang, Qiang; Fan, Ya-Han; Li, Ru-Qing; Lu, Hua; Zhao, Shu-Ming; Jiang, Tian-Lun

2017-01-01

Accurate and reliable blood grouping is essential for safe blood transfusion. However, conventional methods are qualitative and use only single-antigen detection. We overcame these limitations by developing a simple, quantitative, and multiplexed detection method for blood grouping using quantum dots (QDs) and magnetic beads. In the QD fluorescence assay (QFA), blood group A and B antigens were quantified using QD labeling and magnetic beads, and the blood groups were identified according to the R value (the value was calculated with the fluorescence intensity from dual QD labeling) of A and B antigens. The optimized performance of QFA was established by blood typing 791 clinical samples. Quantitative and multiplexed detection for blood group antigens can be completed within 35 min with more than 10 5 red blood cells. When conditions are optimized, the assay performance is satisfactory for weak samples. The coefficients of variation between and within days were less than 10% and the reproducibility was good. The ABO blood groups of 791 clinical samples were identified by QFA, and the accuracy obtained was 100% compared with the tube test. Receiver-operating characteristic curves revealed that the QFA has high sensitivity and specificity toward clinical samples, and the cutoff points of the R value of A and B antigens were 1.483 and 1.576, respectively. In this study, we reported a novel quantitative and multiplexed method for the identification of ABO blood groups and presented an effective alternative for quantitative blood typing. This method can be used as an effective tool to improve blood typing and further guarantee clinical transfusion safety.

Quantitative real-time in vivo detection of magnetic nanoparticles by their nonlinear magnetization

NASA Astrophysics Data System (ADS)

Nikitin, M. P.; Torno, M.; Chen, H.; Rosengart, A.; Nikitin, P. I.

2008-04-01

A novel method of highly sensitive quantitative detection of magnetic nanoparticles (MP) in biological tissues and blood system has been realized and tested in real time in vivo experiments. The detection method is based on nonlinear magnetic properties of MP and the related device can record a very small relative variation of nonlinear magnetic susceptibility up to 10-8 at room temperature, providing sensitivity of several nanograms of MP in 0.1ml volume. Real-time quantitative in vivo measurements of dynamics of MP concentration in blood flow have been performed. A catheter that carried the blood flow of a rat passed through the measuring device. After an MP injection, the quantity of MP in the circulating blood was continuously recorded. The method has also been used to evaluate the MP distribution between rat's organs. Its sensitivity was compared with detection of the radioactive MP based on isotope of Fe59. The comparison of magnetic and radioactive signals in the rat's blood and organ samples demonstrated similar sensitivity for both methods. However, the proposed magnetic method is much more convenient as it is safe, less expensive, and provides real-time measurements in vivo. Moreover, the sensitivity of the method can be further improved by optimization of the device geometry.

Quantitative detection method for Roundup Ready soybean in food using duplex real-time PCR MGB chemistry.

PubMed

Samson, Maria Cristina; Gullì, Mariolina; Marmiroli, Nelson

2010-07-01

Methodologies that enable the detection of genetically modified organisms (GMOs) (authorized and non-authorized) in food and feed strongly influence the potential for adequate updating and implementation of legislation together with labeling requirements. Quantitative polymerase chain reaction (qPCR) systems were designed to boost the sensitivity and specificity on the identification of GMOs in highly degraded DNA samples; however, such testing will become economically difficult to cope with due to increasing numbers of approved genetically modified (GM) lines. Multiplexing approaches are therefore in development to provide cost-efficient solution. Construct-specific primers and probe were developed for quantitative analysis of Roundup Ready soybean (RRS) event glyphosate-tolerant soybean (GTS) 40-3-2. The lectin gene (Le1) was used as a reference gene, and its specificity was verified. RRS- and Le1-specific quantitative real-time PCR (qRTPCR) were optimized in a duplex platform that has been validated with respect to limit of detection (LOD) and limit of quantification (LOQ), as well as accuracy. The analysis of model processed food samples showed that the degradation of DNA has no adverse or little effects on the performance of quantification assay. In this study, a duplex qRTPCR using TaqMan minor groove binder-non-fluorescent quencher (MGB-NFQ) chemistry was developed for specific detection and quantification of RRS event GTS 40-3-2 that can be used for practical monitoring in processed food products.

Quantitation and detection of vanadium in biologic and pollution materials

NASA Technical Reports Server (NTRS)

Gordon, W. A.

1974-01-01

A review is presented of special considerations and methodology for determining vanadium in biological and air pollution materials. In addition to descriptions of specific analysis procedures, general sections are included on quantitation of analysis procedures, sample preparation, blanks, and methods of detection of vanadium. Most of the information presented is applicable to the determination of other trace elements in addition to vanadium.

Development and evaluation of a quantitative PCR assay for detection of Hepatozoon sp.

PubMed

Criado-Fornelio, A; Buling, A; Cunha-Filho, N A; Ruas, J L; Farias, N A R; Rey-Valeiron, C; Pingret, J L; Etievant, M; Barba-Carretero, J C

2007-12-25

With the aim to improve current molecular diagnostic techniques of Hepatozoon sp. in carnivore mammals, we developed a quantitative PCR (qPCR) assay with SYBR Green I((R)). The method, consisting of amplification of a 235bp fragment of the 18S rRNA gene, is able to detect at least 0.1fg of parasite DNA. Reproducible quantitative results were obtained over a range of 0.1ng-0.1fg of Hepatozoon sp. DNA. To assess the performance of the qPCR assay, DNA samples from dogs (140) and cats (50) were tested with either standard PCR or qPCR. Positive samples were always confirmed by partial sequencing of the 18S rRNA gene. Quantitative PCR was 15.8% more sensitive than standard PCR to detect H. canis in dogs. In cats, no infections were detected by standard PCR, compared to two positives by qPCR (which were infected by H. canis as shown by sequencing).

Quantitative method of measuring cancer cell urokinase and metastatic potential

NASA Technical Reports Server (NTRS)

Morrison, Dennis R. (Inventor)

1993-01-01

The metastatic potential of tumors can be evaluated by the quantitative detection of urokinase and DNA. The cell sample selected for examination is analyzed for the presence of high levels of urokinase and abnormal DNA using analytical flow cytometry and digital image analysis. Other factors such as membrane associated urokinase, increased DNA synthesis rates and certain receptors can be used in the method for detection of potentially invasive tumors.

Accounting for imperfect detection in ecology: a quantitative review.

PubMed

Kellner, Kenneth F; Swihart, Robert K

2014-01-01

Detection in studies of species abundance and distribution is often imperfect. Assuming perfect detection introduces bias into estimation that can weaken inference upon which understanding and policy are based. Despite availability of numerous methods designed to address this assumption, many refereed papers in ecology fail to account for non-detection error. We conducted a quantitative literature review of 537 ecological articles to measure the degree to which studies of different taxa, at various scales, and over time have accounted for imperfect detection. Overall, just 23% of articles accounted for imperfect detection. The probability that an article incorporated imperfect detection increased with time and varied among taxa studied; studies of vertebrates were more likely to incorporate imperfect detection. Among articles that reported detection probability, 70% contained per-survey estimates of detection that were less than 0.5. For articles in which constancy of detection was tested, 86% reported significant variation. We hope that our findings prompt more ecologists to consider carefully the detection process when designing studies and analyzing results, especially for sub-disciplines where incorporation of imperfect detection in study design and analysis so far has been lacking.

Using multiple PCR and CE with chemiluminescence detection for simultaneous qualitative and quantitative analysis of genetically modified organism.

PubMed

Guo, Longhua; Qiu, Bin; Chi, Yuwu; Chen, Guonan

2008-09-01

In this paper, an ultrasensitive CE-CL detection system coupled with a novel double-on-column coaxial flow detection interface was developed for the detection of PCR products. A reliable procedure based on this system had been demonstrated for qualitative and quantitative analysis of genetically modified organism-the detection of Roundup Ready Soy (RRS) samples was presented as an example. The promoter, terminator, function and two reference genes of RRS were amplified with multiplex PCR simultaneously. After that, the multiplex PCR products were labeled with acridinium ester at the 5'-terminal through an amino modification and then analyzed by the proposed CE-CL system. Reproducibility of analysis times and peak heights for the CE-CL analysis were determined to be better than 0.91 and 3.07% (RSD, n=15), respectively, for three consecutive days. It was shown that this method could accurately and qualitatively detect RRS standards and the simulative samples. The evaluation in terms of quantitative analysis of RRS provided by this new method was confirmed by comparing our assay results with those of the standard real-time quantitative PCR (RT-QPCR) using SYBR Green I dyes. The results showed a good coherence between the two methods. This approach demonstrated the possibility for accurate qualitative and quantitative detection of GM plants in a single run.

Detecting Genetic Interactions for Quantitative Traits Using m-Spacing Entropy Measure

PubMed Central

Yee, Jaeyong; Kwon, Min-Seok; Park, Taesung; Park, Mira

2015-01-01

A number of statistical methods for detecting gene-gene interactions have been developed in genetic association studies with binary traits. However, many phenotype measures are intrinsically quantitative and categorizing continuous traits may not always be straightforward and meaningful. Association of gene-gene interactions with an observed distribution of such phenotypes needs to be investigated directly without categorization. Information gain based on entropy measure has previously been successful in identifying genetic associations with binary traits. We extend the usefulness of this information gain by proposing a nonparametric evaluation method of conditional entropy of a quantitative phenotype associated with a given genotype. Hence, the information gain can be obtained for any phenotype distribution. Because any functional form, such as Gaussian, is not assumed for the entire distribution of a trait or a given genotype, this method is expected to be robust enough to be applied to any phenotypic association data. Here, we show its use to successfully identify the main effect, as well as the genetic interactions, associated with a quantitative trait. PMID:26339620

[Methods of quantitative proteomics].

PubMed

Kopylov, A T; Zgoda, V G

2007-01-01

In modern science proteomic analysis is inseparable from other fields of systemic biology. Possessing huge resources quantitative proteomics operates colossal information on molecular mechanisms of life. Advances in proteomics help researchers to solve complex problems of cell signaling, posttranslational modification, structure and functional homology of proteins, molecular diagnostics etc. More than 40 various methods have been developed in proteomics for quantitative analysis of proteins. Although each method is unique and has certain advantages and disadvantages all these use various isotope labels (tags). In this review we will consider the most popular and effective methods employing both chemical modifications of proteins and also metabolic and enzymatic methods of isotope labeling.

Detection and quantitation of Kaposi's sarcoma-associated herpesvirus (KSHV) by a single competitive-quantitative polymerase chain reaction.

PubMed

Curreli, Francesca; Robles, Monica A; Friedman-Kien, Alvin E; Flore, Ornella

2003-02-01

Kaposi's sarcoma-associated herpesvirus is a novel herpesvirus linked to AIDS-related neoplasms. Currently it is difficult to evaluate the number of virions in viral preparation or in samples obtained from patients with Kaposi's sarcoma (KS), since no protocol for determining the plaque forming units of KSHV exists. We constructed a fragment of a different size than the target viral DNA to carry out a competitive-quantitative PCR. Both fragment and viral DNA were added to a single PCR reaction to compete for the same set of primers. By knowing the amount of the competitor added to the reaction, we could determine the number of viral DNA molecules. We used this assay successfully to detect and quantify KSHV genomes from KS skin biopsies and pleural effusion lymphoma, and from different viral preparations. To date, this is the most convenient and economic method that allows an accurate and fast viral detection/quantitation with a single PCR.

Quantitative multiplex detection of pathogen biomarkers

DOEpatents

Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.

2016-02-09

The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

Quantitative multiplex detection of pathogen biomarkers

DOEpatents

Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I; Martinez, Jennifer; Grace, Wynne K

2014-10-14

The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.

Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR

PubMed Central

2010-01-01

Background Human papillomaviruses (HPVs) remain a serious world health problem due to their association with anogenital/oral cancers and warts. While over 100 HPV types have been identified, a subset is associated with malignancy. HPV16 and 18 are the most prevalent oncogenic types, while HPV6 and 11 are most commonly responsible for anogenital warts. While other quantitative PCR (qPCR) assays detect oncogenic HPV, there is no single tube assay distinguishing the most frequent oncogenic types and the most common types found in warts. Results A Sybr Green-based qPCR assay was developed utilizing degenerate primers to the highly conserved HPV E1 theoretically detecting any HPV type. A single tube multiplex qPCR assay was also developed using type-specific primer pairs and TaqMan probes that allowed for detection and quantitation of HPV6,11,16,18. Each HPV type was detected over a range from 2 × 101 to 2 × 106copies/reaction providing a reliable method of quantitating type-specific HPV in 140 anogenital/cutaneous/oral benign and malignant specimens. 35 oncogenic and low risk alpha genus HPV types were detected. Concordance was detected in previously typed specimens. Comparisons to the gold standard detected an overall sensitivity of 89% (95% CI: 77% - 96%) and specificity of 90% (95%CI: 52% - 98%). Conclusion There was good agreement between the ability of the qPCR assays described here to identify HPV types in malignancies previously typed using standard methods. These novel qPCR assays will allow rapid detection and quantitation of HPVs to assess their role in viral pathogenesis. PMID:20723234

Augmenting Amyloid PET Interpretations With Quantitative Information Improves Consistency of Early Amyloid Detection.

PubMed

Harn, Nicholas R; Hunt, Suzanne L; Hill, Jacqueline; Vidoni, Eric; Perry, Mark; Burns, Jeffrey M

2017-08-01

Establishing reliable methods for interpreting elevated cerebral amyloid-β plaque on PET scans is increasingly important for radiologists, as availability of PET imaging in clinical practice increases. We examined a 3-step method to detect plaque in cognitively normal older adults, focusing on the additive value of quantitative information during the PET scan interpretation process. Fifty-five F-florbetapir PET scans were evaluated by 3 experienced raters. Scans were first visually interpreted as having "elevated" or "nonelevated" plaque burden ("Visual Read"). Images were then processed using a standardized quantitative analysis software (MIMneuro) to generate whole brain and region of interest SUV ratios. This "Quantitative Read" was considered elevated if at least 2 of 6 regions of interest had an SUV ratio of more than 1.1. The final interpretation combined both visual and quantitative data together ("VisQ Read"). Cohen kappa values were assessed as a measure of interpretation agreement. Plaque was elevated in 25.5% to 29.1% of the 165 total Visual Reads. Interrater agreement was strong (kappa = 0.73-0.82) and consistent with reported values. Quantitative Reads were elevated in 45.5% of participants. Final VisQ Reads changed from initial Visual Reads in 16 interpretations (9.7%), with most changing from "nonelevated" Visual Reads to "elevated." These changed interpretations demonstrated lower plaque quantification than those initially read as "elevated" that remained unchanged. Interrater variability improved for VisQ Reads with the addition of quantitative information (kappa = 0.88-0.96). Inclusion of quantitative information increases consistency of PET scan interpretations for early detection of cerebral amyloid-β plaque accumulation.

Quantitative PCR for Detection and Enumeration of Genetic Markers of Bovine Fecal Pollution

EPA Science Inventory

Accurate assessment of health risks associated with bovine (cattle) fecal pollution requires a reliable host-specific genetic marker and a rapid quantification method. We report the development of quantitative PCR assays for the detection of two recently described cow feces-spec...

Intra-laboratory validation of chronic bee paralysis virus quantitation using an accredited standardised real-time quantitative RT-PCR method.

PubMed

Blanchard, Philippe; Regnault, Julie; Schurr, Frank; Dubois, Eric; Ribière, Magali

2012-03-01

Chronic bee paralysis virus (CBPV) is responsible for chronic bee paralysis, an infectious and contagious disease in adult honey bees (Apis mellifera L.). A real-time RT-PCR assay to quantitate the CBPV load is now available. To propose this assay as a reference method, it was characterised further in an intra-laboratory study during which the reliability and the repeatability of results and the performance of the assay were confirmed. The qPCR assay alone and the whole quantitation method (from sample RNA extraction to analysis) were both assessed following the ISO/IEC 17025 standard and the recent XP U47-600 standard issued by the French Standards Institute. The performance of the qPCR assay and of the overall CBPV quantitation method were validated over a 6 log range from 10(2) to 10(8) with a detection limit of 50 and 100 CBPV RNA copies, respectively, and the protocol of the real-time RT-qPCR assay for CBPV quantitation was approved by the French Accreditation Committee. Copyright © 2011 Elsevier B.V. All rights reserved.

[A new method of processing quantitative PCR data].

PubMed

Ke, Bing-Shen; Li, Guang-Yun; Chen, Shi-Min; Huang, Xiang-Yan; Chen, Ying-Jian; Xu, Jun

2003-05-01

Today standard PCR can't satisfy the need of biotechnique development and clinical research any more. After numerous dynamic research, PE company found there is a linear relation between initial template number and cycling time when the accumulating fluorescent product is detectable.Therefore,they developed a quantitative PCR technique to be used in PE7700 and PE5700. But the error of this technique is too great to satisfy the need of biotechnique development and clinical research. A better quantitative PCR technique is needed. The mathematical model submitted here is combined with the achievement of relative science,and based on the PCR principle and careful analysis of molecular relationship of main members in PCR reaction system. This model describes the function relation between product quantity or fluorescence intensity and initial template number and other reaction conditions, and can reflect the accumulating rule of PCR product molecule accurately. Accurate quantitative PCR analysis can be made use this function relation. Accumulated PCR product quantity can be obtained from initial template number. Using this model to do quantitative PCR analysis,result error is only related to the accuracy of fluorescence intensity or the instrument used. For an example, when the fluorescence intensity is accurate to 6 digits and the template size is between 100 to 1,000,000, the quantitative result accuracy will be more than 99%. The difference of result error is distinct using same condition,same instrument but different analysis method. Moreover,if the PCR quantitative analysis system is used to process data, it will get result 80 times of accuracy than using CT method.

Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water

USGS Publications Warehouse

Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.

2007-01-01

The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.

Reproducibility and quantitation of amplicon sequencing-based detection

PubMed Central

Zhou, Jizhong; Wu, Liyou; Deng, Ye; Zhi, Xiaoyang; Jiang, Yi-Huei; Tu, Qichao; Xie, Jianping; Van Nostrand, Joy D; He, Zhili; Yang, Yunfeng

2011-01-01

To determine the reproducibility and quantitation of the amplicon sequencing-based detection approach for analyzing microbial community structure, a total of 24 microbial communities from a long-term global change experimental site were examined. Genomic DNA obtained from each community was used to amplify 16S rRNA genes with two or three barcode tags as technical replicates in the presence of a small quantity (0.1% wt/wt) of genomic DNA from Shewanella oneidensis MR-1 as the control. The technical reproducibility of the amplicon sequencing-based detection approach is quite low, with an average operational taxonomic unit (OTU) overlap of 17.2%±2.3% between two technical replicates, and 8.2%±2.3% among three technical replicates, which is most likely due to problems associated with random sampling processes. Such variations in technical replicates could have substantial effects on estimating β-diversity but less on α-diversity. A high variation was also observed in the control across different samples (for example, 66.7-fold for the forward primer), suggesting that the amplicon sequencing-based detection approach could not be quantitative. In addition, various strategies were examined to improve the comparability of amplicon sequencing data, such as increasing biological replicates, and removing singleton sequences and less-representative OTUs across biological replicates. Finally, as expected, various statistical analyses with preprocessed experimental data revealed clear differences in the composition and structure of microbial communities between warming and non-warming, or between clipping and non-clipping. Taken together, these results suggest that amplicon sequencing-based detection is useful in analyzing microbial community structure even though it is not reproducible and quantitative. However, great caution should be taken in experimental design and data interpretation when the amplicon sequencing-based detection approach is used for quantitative

Micro-vibration detection with heterodyne holography based on time-averaged method

NASA Astrophysics Data System (ADS)

Qin, XiaoDong; Pan, Feng; Chen, ZongHui; Hou, XueQin; Xiao, Wen

2017-02-01

We propose a micro-vibration detection method by introducing heterodyne interferometry to time-averaged holography. This method compensates for the deficiency of time-average holography in quantitative measurements and widens its range of application effectively. Acousto-optic modulators are used to modulate the frequencies of the reference beam and the object beam. Accurate detection of the maximum amplitude of each point in the vibration plane is performed by altering the frequency difference of both beams. The range of amplitude detection of plane vibration is extended. In the stable vibration mode, the distribution of the maximum amplitude of each point is measured and the fitted curves are plotted. Hence the plane vibration mode of the object is demonstrated intuitively and detected quantitatively. We analyzed the method in theory and built an experimental system with a sine signal as the excitation source and a typical piezoelectric ceramic plate as the target. The experimental results indicate that, within a certain error range, the detected vibration mode agrees with the intrinsic vibration characteristics of the object, thus proving the validity of this method.

Quantitative method for gait pattern detection based on fiber Bragg grating sensors

NASA Astrophysics Data System (ADS)

Ding, Lei; Tong, Xinglin; Yu, Lie

2017-03-01

This paper presents a method that uses fiber Bragg grating (FBG) sensors to distinguish the temporal gait patterns in gait cycles. Unlike most conventional methods that focus on electronic sensors to collect those physical quantities (i.e., strains, forces, pressure, displacements, velocity, and accelerations), the proposed method utilizes the backreflected peak wavelength from FBG sensors to describe the motion characteristics in human walking. Specifically, the FBG sensors are sensitive to external strain with the result that their backreflected peak wavelength will be shifted according to the extent of the influence of external strain. Therefore, when subjects walk in different gait patterns, the strains on FBG sensors will be different such that the magnitude of the backreflected peak wavelength varies. To test the reliability of the FBG sensor platform for gait pattern detection, the gold standard method using force-sensitive resistors (FSRs) for defining gait patterns is introduced as a reference platform. The reliability of the FBG sensor platform is determined by comparing the detection results between the FBG sensors and FSRs platforms. The experimental results show that the FBG sensor platform is reliable in gait pattern detection and gains high reliability when compared with the reference platform.

Immunoliposome-PCR: a generic ultrasensitive quantitative antigen detection system

PubMed Central

2012-01-01

Background The accurate quantification of antigens at low concentrations over a wide dynamic range is needed for identifying biomarkers associated with disease and detecting protein interactions in high-throughput microarrays used in proteomics. Here we report the development of an ultrasensitive quantitative assay format called immunoliposome polymerase chain reaction (ILPCR) that fulfills these requirements. This method uses a liposome, with reporter DNA encapsulated inside and biotin-labeled polyethylene glycol (PEG) phospholipid conjugates incorporated into the outer surface of the liposome, as a detection reagent. The antigenic target is immobilized in the well of a microplate by a capture antibody and the liposome detection reagent is then coupled to a biotin-labeled second antibody through a NeutrAvidin bridge. The liposome is ruptured to release the reporter DNA, which serves as a surrogate to quantify the protein target using real-time PCR. Results A liposome detection reagent was prepared, which consisted of a population of liposomes ~120 nm in diameter with each liposome possessing ~800 accessible biotin receptors and ~220 encapsulated reporters. This liposome detection reagent was used in an assay to quantify the concentration of carcinoembryonic antigen (CEA) in human serum. This ILPCR assay exhibited a linear dose–response curve from 10-10 M to 10-16 M CEA. Within this range the assay coefficient of variance was <6 % for repeatability and <2 % for reproducibility. The assay detection limit was 13 fg/mL, which is 1,500-times more sensitive than current clinical assays for CEA. An ILPCR assay to quantify HIV-1 p24 core protein in buffer was also developed. Conclusions The ILPCR assay has several advantages over other immuno-PCR methods. The reporter DNA and biotin-labeled PEG phospholipids spontaneously incorporate into the liposomes as they form, simplifying preparation of the detection reagent. Encapsulation of the reporter inside the

Comparative analysis of techniques for detection of quiescent Botrytis cinerea in grapes by quantitative PCR

USDA-ARS?s Scientific Manuscript database

Quantitative PCR (qPCR) can be used to detect and monitor pathogen colonization, but early attempts to apply the technology to quiescent Botrytis cinerea infections of grape berries identified some specific limitations. In this study, four DNA extraction methods, two tissue-grinding methods, two gra...

Detection methods for biotech cotton MON 15985 and MON 88913 by PCR.

PubMed

Lee, Seong-Hun; Kim, Jin-Kug; Yi, Bu-Young

2007-05-02

Plants derived through agricultural biotechnology, or genetically modified organisms (GMOs), may affect human health and ecological environment. A living GMO is also called a living modified organism (LMO). Biotech cotton is a GMO in food or feed and also an LMO in the environment. Recently, two varieties of biotech cotton, MON 15985 and MON 88913, were developed by Monsanto Co. The detection method is an essential element for the GMO labeling system or LMO management of biotech plants. In this paper, two primer pairs and probes were designed for specific amplification of 116 and 120 bp PCR products from MON 15985 and MON 88913, respectively, with no amplification from any other biotech cotton. Limits of detection of the qualitative method were all 0.05% for MON 15985 and MON 88913. The quantitative method was developed using a TaqMan real-time PCR. A synthetic plasmid, as a reference molecule, was constructed from a taxon-specific DNA sequence of cotton and two construct-specific DNA sequences of MON 15985 and MON 88913. The quantitative method was validated using six samples that contained levels of biotech cotton mixed with conventional cotton ranging from 0.1 to 10.0%. As a result, the biases from the true value and the relative deviations were all within the range of +/-20%. Limits of quantitation of the quantitative method were all 0.1%. Consequently, it is reported that the proposed detection methods were applicable for qualitative and quantitative analyses for biotech cotton MON 15985 and MON 88913.

A globotetraosylceramide (Gb₄) receptor-based ELISA for quantitative detection of Shiga toxin 2e.

PubMed

Togashi, Katsuhiro; Sasaki, Shiho; Sato, Wataru

2015-08-01

Currently, no simple assays are available for routine quantitative detection of Escherichia coli-produced Shiga toxin 2e (Stx2e) that causes porcine edema disease. Here, we present a novel quantitative detection method for Stx2e based on the measurement of Stx2e binding to the specific globotetraosylceramide (Gb4) receptor by ELISA (Gb4-ELISA). No cross-reactivity was found with the other Shiga toxins Stx1 and Stx2, indicating high specificity. When the recombinant Stx2e B subunit (Stx2eB) was used, the absorbance measured by Gb4-ELISA increased linearly with Stx2eB concentration in the range of 20-2,500 ng/ml. The Gb4-ELISA method can be easily performed, suggesting that it would be a useful diagnostic tool for porcine edema disease.

Enhanced Detection of Surface-Associated Bacteria in Indoor Environments by Quantitative PCR

PubMed Central

Buttner, Mark P.; Cruz-Perez, Patricia; Stetzenbach, Linda D.

2001-01-01

Methods for detecting microorganisms on surfaces are needed to locate biocontamination sources and to relate surface and airborne concentrations. Research was conducted in an experimental room to evaluate surface sampling methods and quantitative PCR (QPCR) for enhanced detection of a target biocontaminant present on flooring materials. QPCR and culture analyses were used to quantitate Bacillus subtilis (Bacillus globigii) endospores on vinyl tile, commercial carpet, and new and soiled residential carpet with samples obtained by four surface sampling methods: a swab kit, a sponge swipe, a cotton swab, and a bulk method. The initial data showed that greater overall sensitivity was obtained with the QPCR than with culture analysis; however, the QPCR results for bulk samples from residential carpet were negative. The swab kit and the sponge swipe methods were then tested with two levels of background biological contamination consisting of Penicillium chrysogenum spores. The B. subtilis values obtained by the QPCR method were greater than those obtained by culture analysis. The differences between the QPCR and culture data were significant for the samples obtained with the swab kit for all flooring materials except soiled residential carpet and with the sponge swipe for commercial carpet. The QPCR data showed that there were no significant differences between the swab kit and sponge swipe sampling methods for any of the flooring materials. Inhibition of QPCR due solely to biological contamination of flooring materials was not evident. However, some degree of inhibition was observed with the soiled residential carpet, which may have been caused by the presence of abiotic contaminants, alone or in combination with biological contaminants. The results of this research demonstrate the ability of QPCR to enhance detection and enumeration of biocontaminants on surface materials and provide information concerning the comparability of currently available surface sampling

Quantitative detection of melamine based on terahertz time-domain spectroscopy

NASA Astrophysics Data System (ADS)

Zhao, Xiaojing; Wang, Cuicui; Liu, Shangjian; Zuo, Jian; Zhou, Zihan; Zhang, Cunlin

2018-01-01

Melamine is an organic base and a trimer of cyanamide, with a 1, 3, 5-triazine skeleton. It is usually used for the production of plastics, glue and flame retardants. Melamine combines with acid and related compounds to form melamine cyanurate and related crystal structures, which have been implicated as contaminants or biomarkers in protein adulterations by lawbreakers, especially in milk powder. This paper is focused on developing an available method for quantitative detection of melamine in the fields of security inspection and nondestructive testing based on THz-TDS. Terahertz (THz) technology has promising applications for the detection and identification of materials because it exhibits the properties of spectroscopy, good penetration and safety. Terahertz time-domain spectroscopy (THz-TDS) is a key technique that is applied to spectroscopic measurement of materials based on ultrafast femtosecond laser. In this study, the melamine and its mixture with polyethylene powder in different consistence are measured using the transmission THz-TDS. And we obtained the refractive index spectra and the absorption spectrum of different concentrations of melamine on 0.2-2.8THz. In the refractive index spectra, it is obvious to see that decline trend with the decrease of concentration; and in the absorption spectrum, two peaks of melamine at 1.98THz and 2.28THz can be obtained. Based on the experimental result, the absorption coefficient and the consistence of the melamine in the mixture are determined. Finally, methods for quantitative detection of materials in the fields of nondestructive testing and quality control based on THz-TDS have been studied.

A new molecular diagnostic tool for quantitatively detecting and genotyping “Candidatus Liberibacter species”

USDA-ARS?s Scientific Manuscript database

A new molecular diagnostic method was developed for quantitative detection of “Candidatus Liberibacter” species associated with citrus Huanglongbing (“Ca. Liberibacter asiaticus”, “Ca. Liberibacter africanus” and “Ca. Liberibacter americanus”) and potato zebra chip disorder (“Ca. Liberibacter solana...

Single Fluorescence Channel-based Multiplex Detection of Avian Influenza Virus by Quantitative PCR with Intercalating Dye

PubMed Central

Ahberg, Christian D.; Manz, Andreas; Neuzil, Pavel

2015-01-01

Since its invention in 1985 the polymerase chain reaction (PCR) has become a well-established method for amplification and detection of segments of double-stranded DNA. Incorporation of fluorogenic probe or DNA intercalating dyes (such as SYBR Green) into the PCR mixture allowed real-time reaction monitoring and extraction of quantitative information (qPCR). Probes with different excitation spectra enable multiplex qPCR of several DNA segments using multi-channel optical detection systems. Here we show multiplex qPCR using an economical EvaGreen-based system with single optical channel detection. Previously reported non quantitative multiplex real-time PCR techniques based on intercalating dyes were conducted once the PCR is completed by performing melting curve analysis (MCA). The technique presented in this paper is both qualitative and quantitative as it provides information about the presence of multiple DNA strands as well as the number of starting copies in the tested sample. Besides important internal control, multiplex qPCR also allows detecting concentrations of more than one DNA strand within the same sample. Detection of the avian influenza virus H7N9 by PCR is a well established method. Multiplex qPCR greatly enhances its specificity as it is capable of distinguishing both haemagglutinin (HA) and neuraminidase (NA) genes as well as their ratio. PMID:26088868

Real-time quantitative PCR detection of genetically modified Maximizer maize and Roundup Ready soybean in some representative foods.

PubMed

Vaïtilingom, M; Pijnenburg, H; Gendre, F; Brignon, P

1999-12-01

A fast and quantitative method was developed to detect transgenic "Maximizer" maize "event 176" (Novartis) and "Roundup Ready" soybean (Monsanto) in food by real-time quantitative PCR. The use of the ABI Prism 7700 sequence detection system allowed the determination of the amplified product accumulation through a fluorogenic probe (TaqMan). Fluorescent dyes were chosen in such a way as to coamplify total and transgenic DNA in the same tube. Using real-time quantitative PCR, 2 pg of transgenic or total DNA per gram of starting sample was detected in 3 h after DNA extraction and the relative amounts of "Maximizer" maize and "Roundup Ready" soybean in some representative food products were quantified.

[Progress in stable isotope labeled quantitative proteomics methods].

PubMed

Zhou, Yuan; Shan, Yichu; Zhang, Lihua; Zhang, Yukui

2013-06-01

Quantitative proteomics is an important research field in post-genomics era. There are two strategies for proteome quantification: label-free methods and stable isotope labeling methods which have become the most important strategy for quantitative proteomics at present. In the past few years, a number of quantitative methods have been developed, which support the fast development in biology research. In this work, we discuss the progress in the stable isotope labeling methods for quantitative proteomics including relative and absolute quantitative proteomics, and then give our opinions on the outlook of proteome quantification methods.

Temporal Lobe Epilepsy: Quantitative MR Volumetry in Detection of Hippocampal Atrophy

PubMed Central

Farid, Nikdokht; Girard, Holly M.; Kemmotsu, Nobuko; Smith, Michael E.; Magda, Sebastian W.; Lim, Wei Y.; Lee, Roland R.

2012-01-01

Purpose: To determine the ability of fully automated volumetric magnetic resonance (MR) imaging to depict hippocampal atrophy (HA) and to help correctly lateralize the seizure focus in patients with temporal lobe epilepsy (TLE). Materials and Methods: This study was conducted with institutional review board approval and in compliance with HIPAA regulations. Volumetric MR imaging data were analyzed for 34 patients with TLE and 116 control subjects. Structural volumes were calculated by using U.S. Food and Drug Administration–cleared software for automated quantitative MR imaging analysis (NeuroQuant). Results of quantitative MR imaging were compared with visual detection of atrophy, and, when available, with histologic specimens. Receiver operating characteristic analyses were performed to determine the optimal sensitivity and specificity of quantitative MR imaging for detecting HA and asymmetry. A linear classifier with cross validation was used to estimate the ability of quantitative MR imaging to help lateralize the seizure focus. Results: Quantitative MR imaging–derived hippocampal asymmetries discriminated patients with TLE from control subjects with high sensitivity (86.7%–89.5%) and specificity (92.2%–94.1%). When a linear classifier was used to discriminate left versus right TLE, hippocampal asymmetry achieved 94% classification accuracy. Volumetric asymmetries of other subcortical structures did not improve classification. Compared with invasive video electroencephalographic recordings, lateralization accuracy was 88% with quantitative MR imaging and 85% with visual inspection of volumetric MR imaging studies but only 76% with visual inspection of clinical MR imaging studies. Conclusion: Quantitative MR imaging can depict the presence and laterality of HA in TLE with accuracy rates that may exceed those achieved with visual inspection of clinical MR imaging studies. Thus, quantitative MR imaging may enhance standard visual analysis, providing a

Single Laboratory Comparison of Quantitative Real-Time PCR Assays for the Detection of Human Fecal Pollution

EPA Science Inventory

There are numerous quantitative real-time PCR (qPCR) methods available to detect and enumerate human fecal pollution in ambient waters. Each assay employs distinct primers and/or probes and many target different genes and microorganisms leading to potential variations in method ...

Rapid quantitative detection of glucose content in glucose injection by reaction headspace gas chromatography.

PubMed

Xie, Wei-Qi; Gong, Yi-Xian; Yu, Kong-Xian

2017-10-20

This work investigates an automated technique for rapid detecting the glucose content in glucose injection by reaction headspace gas chromatography (HS-GC). This method is based on the oxidation reaction of glucose in glucose injection with potassium dichromate. The carbon dioxide (CO 2 ) formed from the oxidation reaction can be quantitatively detected by GC. The results show that the relative standard deviation (RSD) of the present method was within 2.91%, and the measured glucose contents in glucose injection closely match those quantified by the reference method (relative differences <6.45%). The new HS-GC technique is rapid, practical and can be used to the batch detection of the glucose content in glucose injection related applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Qualitative versus quantitative methods in psychiatric research.

PubMed

Razafsha, Mahdi; Behforuzi, Hura; Azari, Hassan; Zhang, Zhiqun; Wang, Kevin K; Kobeissy, Firas H; Gold, Mark S

2012-01-01

Qualitative studies are gaining their credibility after a period of being misinterpreted as "not being quantitative." Qualitative method is a broad umbrella term for research methodologies that describe and explain individuals' experiences, behaviors, interactions, and social contexts. In-depth interview, focus groups, and participant observation are among the qualitative methods of inquiry commonly used in psychiatry. Researchers measure the frequency of occurring events using quantitative methods; however, qualitative methods provide a broader understanding and a more thorough reasoning behind the event. Hence, it is considered to be of special importance in psychiatry. Besides hypothesis generation in earlier phases of the research, qualitative methods can be employed in questionnaire design, diagnostic criteria establishment, feasibility studies, as well as studies of attitude and beliefs. Animal models are another area that qualitative methods can be employed, especially when naturalistic observation of animal behavior is important. However, since qualitative results can be researcher's own view, they need to be statistically confirmed, quantitative methods. The tendency to combine both qualitative and quantitative methods as complementary methods has emerged over recent years. By applying both methods of research, scientists can take advantage of interpretative characteristics of qualitative methods as well as experimental dimensions of quantitative methods.

Method for the Simultaneous Quantitation of Apolipoprotein E Isoforms using Tandem Mass Spectrometry

PubMed Central

Wildsmith, Kristin R.; Han, Bomie; Bateman, Randall J.

2009-01-01

Using Apolipoprotein E (ApoE) as a model protein, we developed a protein isoform analysis method utilizing Stable Isotope Labeling Tandem Mass Spectrometry (SILT MS). ApoE isoforms are quantitated using the intensities of the b and y ions of the 13C-labeled tryptic isoform-specific peptides versus unlabeled tryptic isoform-specific peptides. The ApoE protein isoform analysis using SILT allows for the simultaneous detection and relative quantitation of different ApoE isoforms from the same sample. This method provides a less biased assessment of ApoE isoforms compared to antibody-dependent methods, and may lead to a better understanding of the biological differences between isoforms. PMID:19653990

Novel Quantitative Real-Time LCR for the Sensitive Detection of SNP Frequencies in Pooled DNA: Method Development, Evaluation and Application

PubMed Central

Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios

2011-01-01

Background Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. Methods The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. Conclusions The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. Significance The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food. PMID:21283808

Study on the Simultaneously Quantitative Detection for β-Lactoglobulin and Lactoferrin of Cow Milk by Using Protein Chip Technique.

PubMed

Yin, Ji Yong; Huo, Jun Sheng; Ma, Xin Xin; Sun, Jing; Huang, Jian

2017-12-01

To research a protein chip method which can simultaneously quantitative detect β-Lactoglobulin (β-L) and Lactoferrin (Lf) at one time. Protein chip printer was used to print both anti-β-L antibodies and anti-Lf antibodies on each block of protein chip. And then an improved sandwich detection method was applied while the other two detecting antibodies for the two antigens were added in the block after they were mixed. The detection conditions of the quantitative detection for simultaneous measurement of β-L and Lf with protein chip were optimized and evaluated. Based on these detected conditions, two standard curves of the two proteins were simultaneously established on one protein chip. Finally, the new detection method was evaluated by using the analysis of precision and accuracy. By comparison experiment, mouse monoclonal antibodies of the two antigens were chosen as the printing probe. The concentrations of β-L and Lf probes were 0.5 mg/mL and 0.5 mg/mL, respectively, while the titers of detection antibodies both of β-L and Lf were 1:2,000. Intra- and inter-assay variability was between 4.88% and 38.33% for all tests. The regression coefficients of protein chip comparing with ELISA for β-L and Lf were better than 0.734, and both of the two regression coefficients were statistically significant (r = 0.734, t = 2.644, P = 0.038; and r = 0.774, t = 2.998, P = 0.024). A protein chip method of simultaneously quantitative detection for β-L and Lf has been established and this method is worthy in further application. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Rapid quantitative analysis of individual anthocyanin content based on high-performance liquid chromatography with diode array detection with the pH differential method.

PubMed

Wang, Huayin

2014-09-01

A new quantitative technique for the simultaneous quantification of the individual anthocyanins based on the pH differential method and high-performance liquid chromatography with diode array detection is proposed in this paper. The six individual anthocyanins (cyanidin 3-glucoside, cyanidin 3-rutinoside, petunidin 3-glucoside, petunidin 3-rutinoside, and malvidin 3-rutinoside) from mulberry (Morus rubra) and Liriope platyphylla were used for demonstration and validation. The elution of anthocyanins was performed using a C18 column with stepwise gradient elution and individual anthocyanins were identified by high-performance liquid chromatography with tandem mass spectrometry. Based on the pH differential method, the high-performance liquid chromatography peak areas of maximum and reference absorption wavelengths of anthocyanin extracts were conducted to quantify individual anthocyanins. The calibration curves for these anthocyanins were linear within the range of 10-5500 mg/L. The correlation coefficients (r(2)) all exceeded 0.9972, and the limits of detection were in the range of 1-4 mg/L at a signal-to-noise ratio ≥5 for these anthocyanins. The proposed quantitative analysis was reproducible with good accuracy of all individual anthocyanins ranging from 96.3 to 104.2% and relative recoveries were in the range 98.4-103.2%. The proposed technique is performed without anthocyanin standards and is a simple, rapid, accurate, and economical method to determine individual anthocyanin contents. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Novel quantitative real-time LCR for the sensitive detection of SNP frequencies in pooled DNA: method development, evaluation and application.

PubMed

Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios

2011-01-19

Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food.

Apricot DNA as an indicator for persipan: detection and quantitation in marzipan using ligation-dependent probe amplification.

PubMed

Luber, Florian; Demmel, Anja; Hosken, Anne; Busch, Ulrich; Engel, Karl-Heinz

2012-06-13

The confectionery ingredient marzipan is exclusively prepared from almond kernels and sugar. The potential use of apricot kernels, so-called persipan, is an important issue for the quality assessment of marzipan. Therefore, a ligation-dependent probe amplification (LPA) assay was developed that enables a specific and sensitive detection of apricot DNA, as an indicator for the presence of persipan. The limit of detection was determined to be 0.1% persipan in marzipan. The suitability of the method was confirmed by the analysis of 20 commercially available food samples. The integration of a Prunus -specific probe in the LPA assay as a reference allowed for the relative quantitation of persipan in marzipan. The limit of quantitation was determined to be 0.5% persipan in marzipan. The analysis of two self-prepared mixtures of marzipan and persipan demonstrated the applicability of the quantitation method at concentration levels of practical relevance for quality control.

New Performance Metrics for Quantitative Polymerase Chain Reaction-Based Microbial Source Tracking Methods

EPA Science Inventory

Binary sensitivity and specificity metrics are not adequate to describe the performance of quantitative microbial source tracking methods because the estimates depend on the amount of material tested and limit of detection. We introduce a new framework to compare the performance ...

Methods for detection of GMOs in food and feed.

PubMed

Marmiroli, Nelson; Maestri, Elena; Gullì, Mariolina; Malcevschi, Alessio; Peano, Clelia; Bordoni, Roberta; De Bellis, Gianluca

2008-10-01

This paper reviews aspects relevant to detection and quantification of genetically modified (GM) material within the feed/food chain. The GM crop regulatory framework at the international level is evaluated with reference to traceability and labelling. Current analytical methods for the detection, identification, and quantification of transgenic DNA in food and feed are reviewed. These methods include quantitative real-time PCR, multiplex PCR, and multiplex real-time PCR. Particular attention is paid to methods able to identify multiple GM events in a single reaction and to the development of microdevices and microsensors, though they have not been fully validated for application.

Quantitative evaluation methods of skin condition based on texture feature parameters.

PubMed

Pang, Hui; Chen, Tianhua; Wang, Xiaoyi; Chang, Zhineng; Shao, Siqi; Zhao, Jing

2017-03-01

In order to quantitatively evaluate the improvement of the skin condition after using skin care products and beauty, a quantitative evaluation method for skin surface state and texture is presented, which is convenient, fast and non-destructive. Human skin images were collected by image sensors. Firstly, the median filter of the 3 × 3 window is used and then the location of the hairy pixels on the skin is accurately detected according to the gray mean value and color information. The bilinear interpolation is used to modify the gray value of the hairy pixels in order to eliminate the negative effect of noise and tiny hairs on the texture. After the above pretreatment, the gray level co-occurrence matrix (GLCM) is calculated. On the basis of this, the four characteristic parameters, including the second moment, contrast, entropy and correlation, and their mean value are calculated at 45 ° intervals. The quantitative evaluation model of skin texture based on GLCM is established, which can calculate the comprehensive parameters of skin condition. Experiments show that using this method evaluates the skin condition, both based on biochemical indicators of skin evaluation methods in line, but also fully consistent with the human visual experience. This method overcomes the shortcomings of the biochemical evaluation method of skin damage and long waiting time, also the subjectivity and fuzziness of the visual evaluation, which achieves the non-destructive, rapid and quantitative evaluation of skin condition. It can be used for health assessment or classification of the skin condition, also can quantitatively evaluate the subtle improvement of skin condition after using skin care products or stage beauty.

Detection of Prostate Cancer: Quantitative Multiparametric MR Imaging Models Developed Using Registered Correlative Histopathology.

PubMed

Metzger, Gregory J; Kalavagunta, Chaitanya; Spilseth, Benjamin; Bolan, Patrick J; Li, Xiufeng; Hutter, Diane; Nam, Jung W; Johnson, Andrew D; Henriksen, Jonathan C; Moench, Laura; Konety, Badrinath; Warlick, Christopher A; Schmechel, Stephen C; Koopmeiners, Joseph S

2016-06-01

Purpose To develop multiparametric magnetic resonance (MR) imaging models to generate a quantitative, user-independent, voxel-wise composite biomarker score (CBS) for detection of prostate cancer by using coregistered correlative histopathologic results, and to compare performance of CBS-based detection with that of single quantitative MR imaging parameters. Materials and Methods Institutional review board approval and informed consent were obtained. Patients with a diagnosis of prostate cancer underwent multiparametric MR imaging before surgery for treatment. All MR imaging voxels in the prostate were classified as cancer or noncancer on the basis of coregistered histopathologic data. Predictive models were developed by using more than one quantitative MR imaging parameter to generate CBS maps. Model development and evaluation of quantitative MR imaging parameters and CBS were performed separately for the peripheral zone and the whole gland. Model accuracy was evaluated by using the area under the receiver operating characteristic curve (AUC), and confidence intervals were calculated with the bootstrap procedure. The improvement in classification accuracy was evaluated by comparing the AUC for the multiparametric model and the single best-performing quantitative MR imaging parameter at the individual level and in aggregate. Results Quantitative T2, apparent diffusion coefficient (ADC), volume transfer constant (K(trans)), reflux rate constant (kep), and area under the gadolinium concentration curve at 90 seconds (AUGC90) were significantly different between cancer and noncancer voxels (P < .001), with ADC showing the best accuracy (peripheral zone AUC, 0.82; whole gland AUC, 0.74). Four-parameter models demonstrated the best performance in both the peripheral zone (AUC, 0.85; P = .010 vs ADC alone) and whole gland (AUC, 0.77; P = .043 vs ADC alone). Individual-level analysis showed statistically significant improvement in AUC in 82% (23 of 28) and 71% (24 of 34

Radiometric Method for the Detection of Coliform Organisms in Water

PubMed Central

Bachrach, Uriel; Bachrach, Zelilah

1974-01-01

A new radiometric method for the detection of coliform bacteria in water has been described. The method is based on the release of 14CO2 from [14C]lactose by bacteria suspended in growth medium and incubated at 37 C. The evolved 14CO2 is trapped by hyamine hydroxide and counted in a liquid scintillation spectrometer. The method permits the detection of 1 to 10 organisms within 6 h of incubation. Coliform bacteria suspended in water for several days recover from starvation and may be quantitated by the proposed method. Bacteria from water samples may also be concentrated by filtration through membrane filters and detected by the radiometric assay. PMID:4605007

Hepatitis C Virus RNA Real-Time Quantitative RT-PCR Method Based on a New Primer Design Strategy.

PubMed

Chen, Lida; Li, Wenli; Zhang, Kuo; Zhang, Rui; Lu, Tian; Hao, Mingju; Jia, Tingting; Sun, Yu; Lin, Guigao; Wang, Lunan; Li, Jinming

2016-01-01

Viral nucleic acids are unstable when improperly collected, handled, and stored, resulting in decreased sensitivity of currently available commercial quantitative nucleic acid testing kits. Using known unstable hepatitis C virus RNA, we developed a quantitative RT-PCR method based on a new primer design strategy to reduce the impact of nucleic acid instability on nucleic acid testing. The performance of the method was evaluated for linearity, limit of detection, precision, specificity, and agreement with commercial hepatitis C virus assays. Its clinical application was compared to that of two commercial kits--Cobas AmpliPrep/Cobas TaqMan (CAP/CTM) and Kehua. The quantitative RT-PCR method delivered a good performance, with a linearity of R(2) = 0.99, a total limit of detection (genotypes 1 to 6) of 42.6 IU/mL (95% CI, 32.84 to 67.76 IU/mL), a CV of 1.06% to 3.34%, a specificity of 100%, and a high concordance with the CAP/CTM assay (R(2) = 0.97), with a means ± SD value of -0.06 ± 1.96 log IU/mL (range, -0.38 to 0.25 log IU/mL). The method was superior to commercial assays in detecting unstable hepatitis C virus RNA (P < 0.05). This quantitative RT-PCR method can effectively eliminate the influence of RNA instability on nucleic acid testing. The principle of primer design strategy may be applied to the detection of other RNA or DNA viruses. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Quantitative Urine Culture Method Using a Plastic „Paddle” Containing Dual Media

PubMed Central

Craig, William A.; Kunin, Calvin M.

1972-01-01

A new dip-inoculum method for quantitative urine culture is described which utilizes a dual-chambered plastic „paddle” housing both a general purpose and differential medium. Comparative bacterial counts of 1,000 clinical specimens using the pour plate and this device were identical in 82.9% and within a factor of five in 95.6%. The „paddle” detected all but 19 of 258 specimens (92.6%) with 100,000 or greater colonies per ml. This simple, convenient method should allow more extensive use of quantitative urine culture in the diagnosis and follow-up of patients with urinary tract infections in office practice. It should not be considered as a substitute for the more definitive pour plate method or for standard methods for characterization of bacteriological species when more exact information is required. PMID:4555636

Quantitative detection method of Enterocytozoon hepatopenaei using TaqMan probe real-time PCR.

PubMed

Liu, Ya-Mei; Qiu, Liang; Sheng, An-Zhi; Wan, Xiao-Yuan; Cheng, Dong-Yuan; Huang, Jie

2018-01-01

A TaqMan probe and a pair of specific primers were selected from the small subunit ribosomal DNA (SSU rDNA) sequence of Enterocytozoon hepatopenaei (EHP); this real-time PCR assay was developed and optimized. It showed a good linearity in detecting standards of EHP SSU rDNA fragments from 4 × 10 2 to 4 × 10 8 copies/reaction using the established method. The detection limit of the qPCR method was as low as 4 × 10 1 copies per reaction, which was higher than the conventional PCR and SYBR Green I-based EHP qPCR reported. Using the qPCR assay, EHP was detected in four batches of slow-growing Penaeus vannamei specimens collected from Tianjin and Zhejiang Province in China was detected using qPCR. The results showed that all the hepatopancreas from the slow-growing P. vannamei specimens were detected as EHP-positive. EHP copies of hepatopancreas in some batches had a negative correlation with the body mass index (BMI) of shrimps; however, not all batches of specimens had this negative correlation between EHP copies of hepatopancreas and BMI. This qPCR technique is sensitive, specific and easy to perform (96 tests in <3 h), which provides technical support for the detection and prevention of EHP. Copyright © 2017 Elsevier Inc. All rights reserved.

Single Laboratory Comparison of Quantitative Real-Time PCR Assays for the Detection of Human Fecal Pollution - Poster

EPA Science Inventory

There are numerous quantitative real-time PCR (qPCR) methods available to detect and enumerate human fecal pollution in ambient waters. Each assay employs distinct primers and/or probes and many target different genes and microorganisms leading to potential variations in method p...

Quantitative and Sensitive Detection of Chloramphenicol by Surface-Enhanced Raman Scattering

PubMed Central

Ding, Yufeng; Yin, Hongjun; Meng, Qingyun; Zhao, Yongmei; Liu, Luo; Wu, Zhenglong; Xu, Haijun

2017-01-01

We used surface-enhanced Raman scattering (SERS) for the quantitative and sensitive detection of chloramphenicol (CAP). Using 30 nm colloidal Au nanoparticles (NPs), a low detection limit for CAP of 10−8 M was obtained. The characteristic Raman peak of CAP centered at 1344 cm−1 was used for the rapid quantitative detection of CAP in three different types of CAP eye drops, and the accuracy of the measurement result was verified by high-performance liquid chromatography (HPLC). The experimental results reveal that the SERS technique based on colloidal Au NPs is accurate and sensitive, and can be used for the rapid detection of various antibiotics. PMID:29261161

A novel quantitative real-time polymerase chain reaction method for detecting toxigenic Pasteurella multocida in nasal swabs from swine.

PubMed

Scherrer, Simone; Frei, Daniel; Wittenbrink, Max Michael

2016-12-01

Progressive atrophic rhinitis (PAR) in pigs is caused by toxigenic Pasteurella multocida. In Switzerland, PAR is monitored by selective culture of nasal swabs and subsequent polymerase chain reaction (PCR) screening of bacterial colonies for the P. multocida toxA gene. A panel of 203 nasal swabs from a recent PAR outbreak were used to evaluate a novel quantitative real-time PCR for toxigenic P. multocida in porcine nasal swabs. In comparison to the conventional PCR with a limit of detection of 100 genome equivalents per PCR reaction, the real-time PCR had a limit of detection of 10 genome equivalents. The real-time PCR detected toxA-positive P. multocida in 101 samples (49.8%), whereas the conventional PCR was less sensitive with 90 toxA-positive samples (44.3%). In comparison to the real-time PCR, 5.4% of the toxA-positive samples revealed unevaluable results by conventional PCR. The approach of culture-coupled toxA PCR for the monitoring of PAR in pigs is substantially improved by a novel quantitative real-time PCR.

Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

PubMed

Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

2002-01-01

Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.

Laboratory Evaluations of the Enterococcus qPCR Method for Recreational Water Quality Testing: Method Performance and Sources of Uncertainty in Quantitative Measurements

EPA Science Inventory

The BEACH Act of 2000 directed the U.S. EPA to establish more expeditious methods for the detection of pathogen indicators in coastal waters, as well as new water quality criteria based on these methods. Progress has been made in developing a quantitative PCR (qPCR) method for en...

Real-time label-free quantitative fluorescence microscopy-based detection of ATP using a tunable fluorescent nano-aptasensor platform

NASA Astrophysics Data System (ADS)

Shrivastava, Sajal; Sohn, Il-Yung; Son, Young-Min; Lee, Won-Il; Lee, Nae-Eung

2015-11-01

Although real-time label-free fluorescent aptasensors based on nanomaterials are increasingly recognized as a useful strategy for the detection of target biomolecules with high fidelity, the lack of an imaging-based quantitative measurement platform limits their implementation with biological samples. Here we introduce an ensemble strategy for a real-time label-free fluorescent graphene (Gr) aptasensor platform. This platform employs aptamer length-dependent tunability, thus enabling the reagentless quantitative detection of biomolecules through computational processing coupled with real-time fluorescence imaging data. We demonstrate that this strategy effectively delivers dose-dependent quantitative readouts of adenosine triphosphate (ATP) concentration on chemical vapor deposited (CVD) Gr and reduced graphene oxide (rGO) surfaces, thereby providing cytotoxicity assessment. Compared with conventional fluorescence spectrometry methods, our highly efficient, universally applicable, and rational approach will facilitate broader implementation of imaging-based biosensing platforms for the quantitative evaluation of a range of target molecules.Although real-time label-free fluorescent aptasensors based on nanomaterials are increasingly recognized as a useful strategy for the detection of target biomolecules with high fidelity, the lack of an imaging-based quantitative measurement platform limits their implementation with biological samples. Here we introduce an ensemble strategy for a real-time label-free fluorescent graphene (Gr) aptasensor platform. This platform employs aptamer length-dependent tunability, thus enabling the reagentless quantitative detection of biomolecules through computational processing coupled with real-time fluorescence imaging data. We demonstrate that this strategy effectively delivers dose-dependent quantitative readouts of adenosine triphosphate (ATP) concentration on chemical vapor deposited (CVD) Gr and reduced graphene oxide (r

[Development of sample pretreatment techniques-rapid detection coupling methods for food security analysis].

PubMed

Huang, Yichun; Ding, Weiwei; Zhang, Zhuomin; Li, Gongke

2013-07-01

This paper summarizes the recent developments of the rapid detection methods for food security, such as sensors, optical techniques, portable spectral analysis, enzyme-linked immunosorbent assay, portable gas chromatograph, etc. Additionally, the applications of these rapid detection methods coupled with sample pretreatment techniques in real food security analysis are reviewed. The coupling technique has the potential to provide references to establish the selective, precise and quantitative rapid detection methods in food security analysis.

Developing the Quantitative Histopathology Image Ontology (QHIO): A case study using the hot spot detection problem.

PubMed

Gurcan, Metin N; Tomaszewski, John; Overton, James A; Doyle, Scott; Ruttenberg, Alan; Smith, Barry

2017-02-01

Interoperability across data sets is a key challenge for quantitative histopathological imaging. There is a need for an ontology that can support effective merging of pathological image data with associated clinical and demographic data. To foster organized, cross-disciplinary, information-driven collaborations in the pathological imaging field, we propose to develop an ontology to represent imaging data and methods used in pathological imaging and analysis, and call it Quantitative Histopathological Imaging Ontology - QHIO. We apply QHIO to breast cancer hot-spot detection with the goal of enhancing reliability of detection by promoting the sharing of data between image analysts. Copyright © 2016 Elsevier Inc. All rights reserved.

Quantitative naturalistic methods for detecting change points in psychotherapy research: an illustration with alliance ruptures.

PubMed

Eubanks-Carter, Catherine; Gorman, Bernard S; Muran, J Christopher

2012-01-01

Analysis of change points in psychotherapy process could increase our understanding of mechanisms of change. In particular, naturalistic change point detection methods that identify turning points or breakpoints in time series data could enhance our ability to identify and study alliance ruptures and resolutions. This paper presents four categories of statistical methods for detecting change points in psychotherapy process: criterion-based methods, control chart methods, partitioning methods, and regression methods. Each method's utility for identifying shifts in the alliance is illustrated using a case example from the Beth Israel Psychotherapy Research program. Advantages and disadvantages of the various methods are discussed.

Comprehensive methods for earlier detection and monitoring of forest decline

Treesearch

Jennifer Pontius; Richard Hallett

2014-01-01

Forested ecosystems are threatened by invasive pests, pathogens, and unusual climatic events brought about by climate change. Earlier detection of incipient forest health problems and a quantitatively rigorous assessment method is increasingly important. Here, we describe a method that is adaptable across tree species and stress agents and practical for use in the...

Detection methods and performance criteria for genetically modified organisms.

PubMed

Bertheau, Yves; Diolez, Annick; Kobilinsky, André; Magin, Kimberly

2002-01-01

Detection methods for genetically modified organisms (GMOs) are necessary for many applications, from seed purity assessment to compliance of food labeling in several countries. Numerous analytical methods are currently used or under development to support these needs. The currently used methods are bioassays and protein- and DNA-based detection protocols. To avoid discrepancy of results between such largely different methods and, for instance, the potential resulting legal actions, compatibility of the methods is urgently needed. Performance criteria of methods allow evaluation against a common standard. The more-common performance criteria for detection methods are precision, accuracy, sensitivity, and specificity, which together specifically address other terms used to describe the performance of a method, such as applicability, selectivity, calibration, trueness, precision, recovery, operating range, limit of quantitation, limit of detection, and ruggedness. Performance criteria should provide objective tools to accept or reject specific methods, to validate them, to ensure compatibility between validated methods, and be used on a routine basis to reject data outside an acceptable range of variability. When selecting a method of detection, it is also important to consider its applicability, its field of applications, and its limitations, by including factors such as its ability to detect the target analyte in a given matrix, the duration of the analyses, its cost effectiveness, and the necessary sample sizes for testing. Thus, the current GMO detection methods should be evaluated against a common set of performance criteria.

Parallel evaluation of broad virus detection methods.

PubMed

Modrof, Jens; Berting, Andreas; Kreil, Thomas R

2014-01-01

The testing for adventitious viruses is of critical importance during development and production of biological products. The recent emergence and ongoing development of broad virus detection methods calls for an evaluation of whether these methods can appropriately be implemented into current adventitious agent testing procedures. To assess the suitability of several broad virus detection methods, a comparative experimental study was conducted: four virus preparations, which were spiked at two different concentrations each into two different cell culture media, were sent to four investigators in a blinded fashion for analysis with broad virus detection methods such as polymerase chain reaction-electrospray ionization mass spectrometry (PCR-ESI/MS), microarray, and two approaches utilizing massively parallel sequencing. The results that were reported by the investigators revealed that all methods were able to identify the majority of samples correctly (mean 83%), with a surprisingly narrow range among the methods, that is, between 72% (PCR-ESI/MS) and 95% (microarray). In addition to the correct results, a variety of unexpected assignments were reported for a minority of samples, again with little variation regarding the methods used (range 20-45%), while false negatives were reported for 0-25% of the samples. Regarding assay sensitivity, the viruses were detected by all methods included in this study at concentrations of about 4-5 log10 quantitative PCR copies/mL, and probably with higher sensitivity in some cases. In summary, the broad virus detection methods investigated were shown to be suitable even for detection of relatively low virus concentrations. However, there is also some potential for the production of false-positive as well as false-negative assignments, which indicates the requirement for further improvements before these methods can be considered for routine use. © PDA, Inc. 2014.

Quantitative Detection of Trace Explosive Vapors by Programmed Temperature Desorption Gas Chromatography-Electron Capture Detector

PubMed Central

Field, Christopher R.; Lubrano, Adam; Woytowitz, Morgan; Giordano, Braden C.; Rose-Pehrsson, Susan L.

2014-01-01

The direct liquid deposition of solution standards onto sorbent-filled thermal desorption tubes is used for the quantitative analysis of trace explosive vapor samples. The direct liquid deposition method yields a higher fidelity between the analysis of vapor samples and the analysis of solution standards than using separate injection methods for vapors and solutions, i.e., samples collected on vapor collection tubes and standards prepared in solution vials. Additionally, the method can account for instrumentation losses, which makes it ideal for minimizing variability and quantitative trace chemical detection. Gas chromatography with an electron capture detector is an instrumentation configuration sensitive to nitro-energetics, such as TNT and RDX, due to their relatively high electron affinity. However, vapor quantitation of these compounds is difficult without viable vapor standards. Thus, we eliminate the requirement for vapor standards by combining the sensitivity of the instrumentation with a direct liquid deposition protocol to analyze trace explosive vapor samples. PMID:25145416

Quantitative detection of trace explosive vapors by programmed temperature desorption gas chromatography-electron capture detector.

PubMed

Field, Christopher R; Lubrano, Adam; Woytowitz, Morgan; Giordano, Braden C; Rose-Pehrsson, Susan L

2014-07-25

The direct liquid deposition of solution standards onto sorbent-filled thermal desorption tubes is used for the quantitative analysis of trace explosive vapor samples. The direct liquid deposition method yields a higher fidelity between the analysis of vapor samples and the analysis of solution standards than using separate injection methods for vapors and solutions, i.e., samples collected on vapor collection tubes and standards prepared in solution vials. Additionally, the method can account for instrumentation losses, which makes it ideal for minimizing variability and quantitative trace chemical detection. Gas chromatography with an electron capture detector is an instrumentation configuration sensitive to nitro-energetics, such as TNT and RDX, due to their relatively high electron affinity. However, vapor quantitation of these compounds is difficult without viable vapor standards. Thus, we eliminate the requirement for vapor standards by combining the sensitivity of the instrumentation with a direct liquid deposition protocol to analyze trace explosive vapor samples.

Use of Quantitative Real-Time PCR for Direct Detection of Serratia marcescens in Marine and Other Aquatic Environments

PubMed Central

Joyner, Jessica; Wanless, David; Sinigalliano, Christopher D.

2014-01-01

Serratia marcescens is the etiological agent of acroporid serratiosis, a distinct form of white pox disease in the threatened coral Acropora palmata. The pathogen is commonly found in untreated human waste in the Florida Keys, which may contaminate both nearshore and offshore waters. Currently there is no direct method for detection of this bacterium in the aquatic or reef environment, and culture-based techniques may underestimate its abundance in marine waters. A quantitative real-time PCR assay was developed to detect S. marcescens directly from environmental samples, including marine water, coral mucus, sponge tissue, and wastewater. The assay targeted the luxS gene and was able to distinguish S. marcescens from other Serratia species with a reliable quantitative limit of detection of 10 cell equivalents (CE) per reaction. The method could routinely discern the presence of S. marcescens for as few as 3 CE per reaction, but it could not be reliably quantified at this level. The assay detected environmental S. marcescens in complex sewage influent samples at up to 761 CE ml−1 and in septic system-impacted residential canals in the Florida Keys at up to 4.1 CE ml−1. This detection assay provided rapid quantitative abilities and good sensitivity and specificity, which should offer an important tool for monitoring this ubiquitous pathogen that can potentially impact both human health and coral health. PMID:24375136

Use of quantitative real-time PCR for direct detection of serratia marcescens in marine and other aquatic environments.

PubMed

Joyner, Jessica; Wanless, David; Sinigalliano, Christopher D; Lipp, Erin K

2014-03-01

Serratia marcescens is the etiological agent of acroporid serratiosis, a distinct form of white pox disease in the threatened coral Acropora palmata. The pathogen is commonly found in untreated human waste in the Florida Keys, which may contaminate both nearshore and offshore waters. Currently there is no direct method for detection of this bacterium in the aquatic or reef environment, and culture-based techniques may underestimate its abundance in marine waters. A quantitative real-time PCR assay was developed to detect S. marcescens directly from environmental samples, including marine water, coral mucus, sponge tissue, and wastewater. The assay targeted the luxS gene and was able to distinguish S. marcescens from other Serratia species with a reliable quantitative limit of detection of 10 cell equivalents (CE) per reaction. The method could routinely discern the presence of S. marcescens for as few as 3 CE per reaction, but it could not be reliably quantified at this level. The assay detected environmental S. marcescens in complex sewage influent samples at up to 761 CE ml(-1) and in septic system-impacted residential canals in the Florida Keys at up to 4.1 CE ml(-1). This detection assay provided rapid quantitative abilities and good sensitivity and specificity, which should offer an important tool for monitoring this ubiquitous pathogen that can potentially impact both human health and coral health.

Design and synthesis of target-responsive aptamer-cross-linked hydrogel for visual quantitative detection of ochratoxin A.

PubMed

Liu, Rudi; Huang, Yishun; Ma, Yanli; Jia, Shasha; Gao, Mingxuan; Li, Jiuxing; Zhang, Huimin; Xu, Dunming; Wu, Min; Chen, Yan; Zhu, Zhi; Yang, Chaoyong

2015-04-01

A target-responsive aptamer-cross-linked hydrogel was designed and synthesized for portable and visual quantitative detection of the toxin Ochratoxin A (OTA), which occurs in food and beverages. The hydrogel network forms by hybridization between one designed DNA strand containing the OTA aptamer and two complementary DNA strands grafting on linear polyacrylamide chains. Upon the introduction of OTA, the aptamer binds with OTA, leading to the dissociation of the hydrogel, followed by release of the preloaded gold nanoparticles (AuNPs), which can be observed by the naked eye. To enable sensitive visual and quantitative detection, we encapsulated Au@Pt core-shell nanoparticles (Au@PtNPs) in the hydrogel to generate quantitative readout in a volumetric bar-chart chip (V-Chip). In the V-Chip, Au@PtNPs catalyzes the oxidation of H2O2 to generate O2, which induces movement of an ink bar to a concentration-dependent distance for visual quantitative readout. Furthermore, to improve the detection limit in complex real samples, we introduced an immunoaffinity column (IAC) of OTA to enrich OTA from beer. After the enrichment, as low as 1.27 nM (0.51 ppb) OTA can be detected by the V-Chip, which satisfies the test requirement (2.0 ppb) by the European Commission. The integration of a target-responsive hydrogel with portable enrichment by IAC, as well as signal amplification and quantitative readout by a simple microfluidic device, offers a new method for portable detection of food safety hazard toxin OTA.

Detection and quantitation of trace phenolphthalein (in pharmaceutical preparations and in forensic exhibits) by liquid chromatography-tandem mass spectrometry, a sensitive and accurate method.

PubMed

Sharma, Kakali; Sharma, Shiba P; Lahiri, Sujit C

2013-01-01

Phenolphthalein, an acid-base indicator and laxative, is important as a constituent of widely used weight-reducing multicomponent food formulations. Phenolphthalein is an useful reagent in forensic science for the identification of blood stains of suspected victims and for apprehending erring officials accepting bribes in graft or trap cases. The pink-colored alkaline hand washes originating from the phenolphthalein-smeared notes can easily be determined spectrophotometrically. But in many cases, colored solution turns colorless with time, which renders the genuineness of bribe cases doubtful to the judiciary. No method is known till now for the detection and identification of phenolphthalein in colorless forensic exhibits with positive proof. Liquid chromatography-tandem mass spectrometry had been found to be most sensitive, accurate method capable of detection and quantitation of trace phenolphthalein in commercial formulations and colorless forensic exhibits with positive proof. The detection limit of phenolphthalein was found to be 1.66 pg/L or ng/mL, and the calibration curve shows good linearity (r(2) = 0.9974). © 2012 American Academy of Forensic Sciences.

Emergency First Responders' Experience with Colorimetric Detection Methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sandra L. Fox; Keith A. Daum; Carla J. Miller

2007-10-01

Nationwide, first responders from state and federal support teams respond to hazardous materials incidents, industrial chemical spills, and potential weapons of mass destruction (WMD) attacks. Although first responders have sophisticated chemical, biological, radiological, and explosive detectors available for assessment of the incident scene, simple colorimetric detectors have a role in response actions. The large number of colorimetric chemical detection methods available on the market can make the selection of the proper methods difficult. Although each detector has unique aspects to provide qualitative or quantitative data about the unknown chemicals present, not all detectors provide consistent, accurate, and reliable results. Includedmore » here, in a consumer-report-style format, we provide “boots on the ground” information directly from first responders about how well colorimetric chemical detection methods meet their needs in the field and how they procure these methods.« less

Real time quantitative phase microscopy based on single-shot transport of intensity equation (ssTIE) method

NASA Astrophysics Data System (ADS)

Yu, Wei; Tian, Xiaolin; He, Xiaoliang; Song, Xiaojun; Xue, Liang; Liu, Cheng; Wang, Shouyu

2016-08-01

Microscopy based on transport of intensity equation provides quantitative phase distributions which opens another perspective for cellular observations. However, it requires multi-focal image capturing while mechanical and electrical scanning limits its real time capacity in sample detections. Here, in order to break through this restriction, real time quantitative phase microscopy based on single-shot transport of the intensity equation method is proposed. A programmed phase mask is designed to realize simultaneous multi-focal image recording without any scanning; thus, phase distributions can be quantitatively retrieved in real time. It is believed the proposed method can be potentially applied in various biological and medical applications, especially for live cell imaging.

[Influence of Spectral Pre-Processing on PLS Quantitative Model of Detecting Cu in Navel Orange by LIBS].

PubMed

Li, Wen-bing; Yao, Lin-tao; Liu, Mu-hua; Huang, Lin; Yao, Ming-yin; Chen, Tian-bing; He, Xiu-wen; Yang, Ping; Hu, Hui-qin; Nie, Jiang-hui

2015-05-01

Cu in navel orange was detected rapidly by laser-induced breakdown spectroscopy (LIBS) combined with partial least squares (PLS) for quantitative analysis, then the effect on the detection accuracy of the model with different spectral data ptetreatment methods was explored. Spectral data for the 52 Gannan navel orange samples were pretreated by different data smoothing, mean centralized and standard normal variable transform. Then 319~338 nm wavelength section containing characteristic spectral lines of Cu was selected to build PLS models, the main evaluation indexes of models such as regression coefficient (r), root mean square error of cross validation (RMSECV) and the root mean square error of prediction (RMSEP) were compared and analyzed. Three indicators of PLS model after 13 points smoothing and processing of the mean center were found reaching 0. 992 8, 3. 43 and 3. 4 respectively, the average relative error of prediction model is only 5. 55%, and in one word, the quality of calibration and prediction of this model are the best results. The results show that selecting the appropriate data pre-processing method, the prediction accuracy of PLS quantitative model of fruits and vegetables detected by LIBS can be improved effectively, providing a new method for fast and accurate detection of fruits and vegetables by LIBS.

Evaluation of Two Surface Sampling Methods for Detection of Erwinia herbicola on a Variety of Materials by Culture and Quantitative PCR▿

PubMed Central

Buttner, Mark P.; Cruz, Patricia; Stetzenbach, Linda D.; Cronin, Tracy

2007-01-01

This research was designed to evaluate surface sampling protocols for use with culture and quantitative PCR (QPCR) amplification assay for detection of the gram-negative bacterial biothreat simulant Erwinia herbicola on a variety of surface materials. Surfaces selected for evaluation were wood laminate, glass and computer monitor screens, metal file cabinets, plastic arena seats, nylon seat cushions, finished concrete flooring, and vinyl tile flooring. Laboratory and test chamber studies were performed to evaluate two sampling methods, a sponge and a macrofoam swab, for detection of E. herbicola on surface materials. In laboratory trials, seven materials were inoculated with a known concentration of E. herbicola cells and samples were collected from the surfaces of the materials to determine sampling efficiencies. Culture analysis was ineffective for assessing E. herbicola collection efficiency because very few culturable cells were obtained from surface samples. QPCR demonstrated that E. herbicola DNA was present in high concentrations on all of the surface samples, and sampling efficiencies ranged from 0.7 to 52.2%, depending on the sampling method and the surface material. The swab was generally more efficient than the sponge for collection of E. herbicola from surfaces. Test chamber trials were also performed in which E. herbicola was aerosolized into the chamber and allowed to settle onto test materials. Surface sampling results supported those obtained in laboratory trials. The results of this study demonstrate the capabilities of QPCR to enhance the detection and enumeration of biocontaminants on surface materials and provide information on the comparability of sampling methods. PMID:17416685

Evaluation of two surface sampling methods for detection of Erwinia herbicola on a variety of materials by culture and quantitative PCR.

PubMed

Buttner, Mark P; Cruz, Patricia; Stetzenbach, Linda D; Cronin, Tracy

2007-06-01

This research was designed to evaluate surface sampling protocols for use with culture and quantitative PCR (QPCR) amplification assay for detection of the gram-negative bacterial biothreat simulant Erwinia herbicola on a variety of surface materials. Surfaces selected for evaluation were wood laminate, glass and computer monitor screens, metal file cabinets, plastic arena seats, nylon seat cushions, finished concrete flooring, and vinyl tile flooring. Laboratory and test chamber studies were performed to evaluate two sampling methods, a sponge and a macrofoam swab, for detection of E. herbicola on surface materials. In laboratory trials, seven materials were inoculated with a known concentration of E. herbicola cells and samples were collected from the surfaces of the materials to determine sampling efficiencies. Culture analysis was ineffective for assessing E. herbicola collection efficiency because very few culturable cells were obtained from surface samples. QPCR demonstrated that E. herbicola DNA was present in high concentrations on all of the surface samples, and sampling efficiencies ranged from 0.7 to 52.2%, depending on the sampling method and the surface material. The swab was generally more efficient than the sponge for collection of E. herbicola from surfaces. Test chamber trials were also performed in which E. herbicola was aerosolized into the chamber and allowed to settle onto test materials. Surface sampling results supported those obtained in laboratory trials. The results of this study demonstrate the capabilities of QPCR to enhance the detection and enumeration of biocontaminants on surface materials and provide information on the comparability of sampling methods.

Methods for Quantitative Creatinine Determination.

PubMed

Moore, John F; Sharer, J Daniel

2017-04-06

Reliable measurement of creatinine is necessary to assess kidney function, and also to quantitate drug levels and diagnostic compounds in urine samples. The most commonly used methods are based on the Jaffe principal of alkaline creatinine-picric acid complex color formation. However, other compounds commonly found in serum and urine may interfere with Jaffe creatinine measurements. Therefore, many laboratories have made modifications to the basic method to remove or account for these interfering substances. This appendix will summarize the basic Jaffe method, as well as a modified, automated version. Also described is a high performance liquid chromatography (HPLC) method that separates creatinine from contaminants prior to direct quantification by UV absorption. Lastly, a liquid chromatography-tandem mass spectrometry (LC-MS/MS) method is described that uses stable isotope dilution to reliably quantify creatinine in any sample. This last approach has been recommended by experts in the field as a means to standardize all quantitative creatinine methods against an accepted reference. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

A novel statistical method for quantitative comparison of multiple ChIP-seq datasets.

PubMed

Chen, Li; Wang, Chi; Qin, Zhaohui S; Wu, Hao

2015-06-15

ChIP-seq is a powerful technology to measure the protein binding or histone modification strength in the whole genome scale. Although there are a number of methods available for single ChIP-seq data analysis (e.g. 'peak detection'), rigorous statistical method for quantitative comparison of multiple ChIP-seq datasets with the considerations of data from control experiment, signal to noise ratios, biological variations and multiple-factor experimental designs is under-developed. In this work, we develop a statistical method to perform quantitative comparison of multiple ChIP-seq datasets and detect genomic regions showing differential protein binding or histone modification. We first detect peaks from all datasets and then union them to form a single set of candidate regions. The read counts from IP experiment at the candidate regions are assumed to follow Poisson distribution. The underlying Poisson rates are modeled as an experiment-specific function of artifacts and biological signals. We then obtain the estimated biological signals and compare them through the hypothesis testing procedure in a linear model framework. Simulations and real data analyses demonstrate that the proposed method provides more accurate and robust results compared with existing ones. An R software package ChIPComp is freely available at http://web1.sph.emory.edu/users/hwu30/software/ChIPComp.html. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Rapid detection methods for viable Mycobacterium avium subspecies paratuberculosis in milk and cheese.

PubMed

Botsaris, George; Slana, Iva; Liapi, Maria; Dodd, Christine; Economides, Constantinos; Rees, Catherine; Pavlik, Ivo

2010-07-31

Mycobacterium avium subsp. paratuberculosis (MAP) may have a role in the development of Crohn's disease in humans via the consumption of contaminated milk and milk products. Detection of MAP from milk and dairy products has been reported from countries on the European continent, Argentina, the UK and Australia. In this study three different methods (quantitative real time PCR, combined phage IS900 PCR and conventional cultivation) were used to detect the presence of MAP in bulk tank milk (BTM) and cheese originating from sheep, goat and mixed milks from farms and products in Cyprus. During the first survey the presence of MAP was detected in 63 (28.6%) of cows' BTM samples by quantitative real time PCR. A second survey of BTM used a new combined phage IS900 PCR assay, and in this case MAP was detected in 50 (22.2%) samples showing a good level of agreement by both methods. None of the herds tested were known to be affected by Johne's disease and the presence of viable MAP was confirmed by conventional culture in only two cases of cows BTM. This suggests that either rapid method used is more sensitive than the conventional culture when testing raw milk samples for MAP. The two isolates recovered from BTM were identified by IS1311 PCR REA as cattle and sheep strains, respectively. In contrast when cheese samples were tested, MAP DNA was detected by quantitative real time PCR in seven (25.0%) samples (n=28). However no viable MAP was detected when either the combined phage IS900 PCR or conventional culture methods were used. Copyright 2010 Elsevier B.V. All rights reserved.

Quantitative Methods in Psychology: Inevitable and Useless

PubMed Central

Toomela, Aaro

2010-01-01

Science begins with the question, what do I want to know? Science becomes science, however, only when this question is justified and the appropriate methodology is chosen for answering the research question. Research question should precede the other questions; methods should be chosen according to the research question and not vice versa. Modern quantitative psychology has accepted method as primary; research questions are adjusted to the methods. For understanding thinking in modern quantitative psychology, two epistemologies should be distinguished: structural-systemic that is based on Aristotelian thinking, and associative-quantitative that is based on Cartesian–Humean thinking. The first aims at understanding the structure that underlies the studied processes; the second looks for identification of cause–effect relationships between the events with no possible access to the understanding of the structures that underlie the processes. Quantitative methodology in particular as well as mathematical psychology in general, is useless for answering questions about structures and processes that underlie observed behaviors. Nevertheless, quantitative science is almost inevitable in a situation where the systemic-structural basis of behavior is not well understood; all sorts of applied decisions can be made on the basis of quantitative studies. In order to proceed, psychology should study structures; methodologically, constructive experiments should be added to observations and analytic experiments. PMID:21833199

Quantitative methods in psychology: inevitable and useless.

PubMed

Toomela, Aaro

2010-01-01

Science begins with the question, what do I want to know? Science becomes science, however, only when this question is justified and the appropriate methodology is chosen for answering the research question. Research question should precede the other questions; methods should be chosen according to the research question and not vice versa. Modern quantitative psychology has accepted method as primary; research questions are adjusted to the methods. For understanding thinking in modern quantitative psychology, two epistemologies should be distinguished: structural-systemic that is based on Aristotelian thinking, and associative-quantitative that is based on Cartesian-Humean thinking. The first aims at understanding the structure that underlies the studied processes; the second looks for identification of cause-effect relationships between the events with no possible access to the understanding of the structures that underlie the processes. Quantitative methodology in particular as well as mathematical psychology in general, is useless for answering questions about structures and processes that underlie observed behaviors. Nevertheless, quantitative science is almost inevitable in a situation where the systemic-structural basis of behavior is not well understood; all sorts of applied decisions can be made on the basis of quantitative studies. In order to proceed, psychology should study structures; methodologically, constructive experiments should be added to observations and analytic experiments.

Rapid Detection of Ceratocystis platani Inoculum by Quantitative Real-Time PCR Assay

PubMed Central

Ghelardini, Luisa; Belbahri, Lassaâd; Quartier, Marion; Santini, Alberto

2013-01-01

Ceratocystis platani is the causal agent of canker stain of plane trees, a lethal disease able to kill mature trees in one or two successive growing seasons. The pathogen is a quarantine organism and has a negative impact on anthropogenic and natural populations of plane trees. Contaminated sawdust produced during pruning and sanitation fellings can contribute to disease spread. The goal of this study was to design a rapid, real-time quantitative PCR assay to detect a C. platani airborne inoculum. Airborne inoculum traps (AITs) were placed in an urban setting in the city of Florence, Italy, where the disease was present. Primers and TaqMan minor groove binder (MGB) probes were designed to target cerato-platanin (CP) and internal transcribed spacer 2 (ITS2) genes. The detection limits of the assay were 0.05 pg/μl and 2 fg/μl of fungal DNA for CP and ITS, respectively. Pathogen detection directly from AITs demonstrated specificity and high sensitivity for C. platani, detecting DNA concentrations as low as 1.2 × 10−2 to 1.4 × 10−2 pg/μl, corresponding to ∼10 conidia per ml. Airborne inoculum traps were able to detect the C. platani inoculum within 200 m of the closest symptomatic infected plane tree. The combination of airborne trapping and real-time quantitative PCR assay provides a rapid and sensitive method for the specific detection of a C. platani inoculum. This technique may be used to identify the period of highest risk of pathogen spread in a site, thus helping disease management. PMID:23811499

Detection of human herpesvirus 8 by quantitative polymerase chain reaction: development and standardisation of methods.

PubMed

Speicher, David J; Johnson, Newell W

2012-09-11

Human herpesvirus 8 (HHV-8), the aetiological agent of Kaposi's sarcoma (KS), multicentric Castleman's disease (MCD), and primary effusion lymphoma (PEL) is rare in Australia, but endemic in Sub-Saharan Africa, parts of South-east Asia and Oceania. While the treatment of external KS lesions can be monitored by clinical observation, the internal lesions of KS, MCD and PEL require extensive and expensive internal imaging, or autopsy. In patients with MCD and PEL, if HHV-8 viraemia is not reduced quickly, ~50% die within 24 months. HHV-8 qPCR is a valuable tool for monitoring HHV-8 viraemia, but is not available in many parts of the world, including those with high prevalence of KS and HHV-8. A new molecular facility with stringent three-phase workflow was established, adhering to NPAAC and CLSI guidelines. Three fully validated quantitative assays were developed: two for detection and quantification of HHV-8; one for GAPDH, necessary for normalisation of viral loads in tissue and peripheral blood. The HHV-8 ORF73 and ORF26 qPCR assays were 100% specific. All qPCR assays, displayed a broad dynamic range (102 to 1010 copies/μL TE Buffer) with a limit of detection of 4.85x103, 5.61x102, and 2.59x102 copies/μL TE Buffer and a limit of quantification of 4.85x103, 3.01x102, and 1.38x102 copies/μL TE Buffer for HHV-8 ORF73, HHV-8 ORF26, and GAPDH respectively.The assays were tested on a panel of 35 KS biopsies from Queensland. All were HHV-8 qPCR positive with average viral load of 2.96x105 HHV-8 copies/μL DNA extract (range: 4.37x103 to 1.47x106 copies/μL DNA extract): When normalised these equate to an average viral load of 2.44x104 HHV-8 copies/103 cells (range: 2.20x102 to 7.38x105 HHV-8 copies/103 cells). These are the first fully optimised, validated and MIQE compliant HHV-8 qPCR assays established in Australia. They worked well for qualitative detection of HHV-8 in archival tissue, and are well-suited for quantitative detection in whole blood. They are now

Real-time label-free quantitative fluorescence microscopy-based detection of ATP using a tunable fluorescent nano-aptasensor platform.

PubMed

Shrivastava, Sajal; Sohn, Il-Yung; Son, Young-Min; Lee, Won-Il; Lee, Nae-Eung

2015-12-14

Although real-time label-free fluorescent aptasensors based on nanomaterials are increasingly recognized as a useful strategy for the detection of target biomolecules with high fidelity, the lack of an imaging-based quantitative measurement platform limits their implementation with biological samples. Here we introduce an ensemble strategy for a real-time label-free fluorescent graphene (Gr) aptasensor platform. This platform employs aptamer length-dependent tunability, thus enabling the reagentless quantitative detection of biomolecules through computational processing coupled with real-time fluorescence imaging data. We demonstrate that this strategy effectively delivers dose-dependent quantitative readouts of adenosine triphosphate (ATP) concentration on chemical vapor deposited (CVD) Gr and reduced graphene oxide (rGO) surfaces, thereby providing cytotoxicity assessment. Compared with conventional fluorescence spectrometry methods, our highly efficient, universally applicable, and rational approach will facilitate broader implementation of imaging-based biosensing platforms for the quantitative evaluation of a range of target molecules.

Measurement issues associated with quantitative molecular biology analysis of complex food matrices for the detection of food fraud.

PubMed

Burns, Malcolm; Wiseman, Gordon; Knight, Angus; Bramley, Peter; Foster, Lucy; Rollinson, Sophie; Damant, Andrew; Primrose, Sandy

2016-01-07

Following a report on a significant amount of horse DNA being detected in a beef burger product on sale to the public at a UK supermarket in early 2013, the Elliott report was published in 2014 and contained a list of recommendations for helping ensure food integrity. One of the recommendations included improving laboratory testing capacity and capability to ensure a harmonised approach for testing for food authenticity. Molecular biologists have developed exquisitely sensitive methods based on the polymerase chain reaction (PCR) or mass spectrometry for detecting the presence of particular nucleic acid or peptide/protein sequences. These methods have been shown to be specific and sensitive in terms of lower limits of applicability, but they are largely qualitative in nature. Historically, the conversion of these qualitative techniques into reliable quantitative methods has been beset with problems even when used on relatively simple sample matrices. When the methods are applied to complex sample matrices, as found in many foods, the problems are magnified resulting in a high measurement uncertainty associated with the result which may mean that the assay is not fit for purpose. However, recent advances in the technology and the understanding of molecular biology approaches have further given rise to the re-assessment of these methods for their quantitative potential. This review focuses on important issues for consideration when validating a molecular biology assay and the various factors that can impact on the measurement uncertainty of a result associated with molecular biology approaches used in detection of food fraud, with a particular focus on quantitative PCR-based and proteomics assays.

The applicability of TaqMan-based quantitative real-time PCR assays for detecting and enumeratIng Cryptosporidium spp. oocysts in the environment

EPA Science Inventory

Molecular detection methods such as PCR have been extensively used to type Cryptosporidium oocysts detected in the environment. More recently, studies have developed quantitative real-time PCR assays for detection and quantification of microbial contaminants in water as well as ...

Reproducibility of CSF quantitative culture methods for estimating rate of clearance in cryptococcal meningitis.

PubMed

Dyal, Jonathan; Akampurira, Andrew; Rhein, Joshua; Morawski, Bozena M; Kiggundu, Reuben; Nabeta, Henry W; Musubire, Abdu K; Bahr, Nathan C; Williams, Darlisha A; Bicanic, Tihana; Larsen, Robert A; Meya, David B; Boulware, David R

2016-05-01

Quantitative cerebrospinal fluid (CSF) cultures provide a measure of disease severity in cryptococcal meningitis. The fungal clearance rate by quantitative cultures has become a primary endpoint for phase II clinical trials. This study determined the inter-assay accuracy of three different quantitative culture methodologies. Among 91 participants with meningitis symptoms in Kampala, Uganda, during August-November 2013, 305 CSF samples were prospectively collected from patients at multiple time points during treatment. Samples were simultaneously cultured by three methods: (1) St. George's 100 mcl input volume of CSF with five 1:10 serial dilutions, (2) AIDS Clinical Trials Group (ACTG) method using 1000, 100, 10 mcl input volumes, and two 1:100 dilutions with 100 and 10 mcl input volume per dilution on seven agar plates; and (3) 10 mcl calibrated loop of undiluted and 1:100 diluted CSF (loop). Quantitative culture values did not statistically differ between St. George-ACTG methods (P= .09) but did for St. George-10 mcl loop (P< .001). Repeated measures pairwise correlation between any of the methods was high (r≥0.88). For detecting sterility, the ACTG-method had the highest negative predictive value of 97% (91% St. George, 60% loop), but the ACTG-method had occasional (∼10%) difficulties in quantification due to colony clumping. For CSF clearance rate, St. George-ACTG methods did not differ overall (mean -0.05 ± 0.07 log10CFU/ml/day;P= .14) on a group level; however, individual-level clearance varied. The St. George and ACTG quantitative CSF culture methods produced comparable but not identical results. Quantitative cultures can inform treatment management strategies. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Composite Interval Mapping Based on Lattice Design for Error Control May Increase Power of Quantitative Trait Locus Detection.

PubMed

He, Jianbo; Li, Jijie; Huang, Zhongwen; Zhao, Tuanjie; Xing, Guangnan; Gai, Junyi; Guan, Rongzhan

2015-01-01

Experimental error control is very important in quantitative trait locus (QTL) mapping. Although numerous statistical methods have been developed for QTL mapping, a QTL detection model based on an appropriate experimental design that emphasizes error control has not been developed. Lattice design is very suitable for experiments with large sample sizes, which is usually required for accurate mapping of quantitative traits. However, the lack of a QTL mapping method based on lattice design dictates that the arithmetic mean or adjusted mean of each line of observations in the lattice design had to be used as a response variable, resulting in low QTL detection power. As an improvement, we developed a QTL mapping method termed composite interval mapping based on lattice design (CIMLD). In the lattice design, experimental errors are decomposed into random errors and block-within-replication errors. Four levels of block-within-replication errors were simulated to show the power of QTL detection under different error controls. The simulation results showed that the arithmetic mean method, which is equivalent to a method under random complete block design (RCBD), was very sensitive to the size of the block variance and with the increase of block variance, the power of QTL detection decreased from 51.3% to 9.4%. In contrast to the RCBD method, the power of CIMLD and the adjusted mean method did not change for different block variances. The CIMLD method showed 1.2- to 7.6-fold higher power of QTL detection than the arithmetic or adjusted mean methods. Our proposed method was applied to real soybean (Glycine max) data as an example and 10 QTLs for biomass were identified that explained 65.87% of the phenotypic variation, while only three and two QTLs were identified by arithmetic and adjusted mean methods, respectively.

Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

PubMed

Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

2014-01-01

Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

Effective Heart Disease Detection Based on Quantitative Computerized Traditional Chinese Medicine Using Representation Based Classifiers.

PubMed

Shu, Ting; Zhang, Bob; Tang, Yuan Yan

2017-01-01

At present, heart disease is the number one cause of death worldwide. Traditionally, heart disease is commonly detected using blood tests, electrocardiogram, cardiac computerized tomography scan, cardiac magnetic resonance imaging, and so on. However, these traditional diagnostic methods are time consuming and/or invasive. In this paper, we propose an effective noninvasive computerized method based on facial images to quantitatively detect heart disease. Specifically, facial key block color features are extracted from facial images and analyzed using the Probabilistic Collaborative Representation Based Classifier. The idea of facial key block color analysis is founded in Traditional Chinese Medicine. A new dataset consisting of 581 heart disease and 581 healthy samples was experimented by the proposed method. In order to optimize the Probabilistic Collaborative Representation Based Classifier, an analysis of its parameters was performed. According to the experimental results, the proposed method obtains the highest accuracy compared with other classifiers and is proven to be effective at heart disease detection.

Simple, Rapid, and Highly Sensitive Detection of Diphosgene and Triphosgene by Spectrophotometric Methods

PubMed Central

Joy, Abraham; Anim-Danso, Emmanuel; Kohn, Joachim

2009-01-01

Methods for the detection and estimation of diphosgene and triphosgene are described. These compounds are widely used phosgene precursors which produce an intensely colored purple pentamethine oxonol dye when reacted with 1,3-dimethylbarbituric acid (DBA) and pyridine (or a pyridine derivative). Two quantitative methods are described, based on either UV absorbance or fluorescence of the oxonol dye. Detection limits are ~ 4 µmol/L by UV and <0.4 µmol/L by fluorescence. The third method is a test strip for the simple and rapid detection and semi-quantitative estimation of diphosgene and triphosgene, using a filter paper embedded with dimethylbarbituric acid and poly(4-vinylpyridine). Addition of a test solution to the paper causes a color change from white to light blue at low concentrations and to pink at higher concentrations of triphosgene. The test strip is useful for quick on-site detection of triphosgene and diphosgene in reaction mixtures. The test strip is easy to perform and provides clear signal readouts indicative of the presence of phosgene precursors. The utility of this method was demonstrated by the qualitative determination of residual triphosgene during the production of poly(Bisphenol A carbonate). PMID:19782219

Improving membrane based multiplex immunoassays for semi-quantitative detection of multiple cytokines in a single sample

PubMed Central

2014-01-01

Background Inflammatory mediators can serve as biomarkers for the monitoring of the disease progression or prognosis in many conditions. In the present study we introduce an adaptation of a membrane-based technique in which the level of up to 40 cytokines and chemokines can be determined in both human and rodent blood in a semi-quantitative way. The planar assay was modified using the LI-COR (R) detection system (fluorescence based) rather than chemiluminescence and semi-quantitative outcomes were achieved by normalizing the outcomes using the automated exposure settings of the Odyssey readout device. The results were compared to the gold standard assay, namely ELISA. Results The improved planar assay allowed the detection of a considerably higher number of analytes (n = 30 and n = 5 for fluorescent and chemiluminescent detection, respectively). The improved planar method showed high sensitivity up to 17 pg/ml and a linear correlation of the normalized fluorescence intensity with the results from the ELISA (r = 0.91). Conclusions The results show that the membrane-based technique is a semi-quantitative assay that correlates satisfactorily to the gold standard when enhanced by the use of fluorescence and subsequent semi-quantitative analysis. This promising technique can be used to investigate inflammatory profiles in multiple conditions, particularly in studies with constraints in sample sizes and/or budget. PMID:25022797

From themes to hypotheses: following up with quantitative methods.

PubMed

Morgan, David L

2015-06-01

One important category of mixed-methods research designs consists of quantitative studies that follow up on qualitative research. In this case, the themes that serve as the results from the qualitative methods generate hypotheses for testing through the quantitative methods. That process requires operationalization to translate the concepts from the qualitative themes into quantitative variables. This article illustrates these procedures with examples that range from simple operationalization to the evaluation of complex models. It concludes with an argument for not only following up qualitative work with quantitative studies but also the reverse, and doing so by going beyond integrating methods within single projects to include broader mutual attention from qualitative and quantitative researchers who work in the same field. © The Author(s) 2015.

Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

PubMed

Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

2014-01-01

A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

Quantitative measures detect sensory and motor impairments in multiple sclerosis

PubMed Central

Newsome, Scott D.; Wang, Joseph I.; Kang, Jonathan Y.; Calabresi, Peter A.; Zackowski, Kathleen M.

2011-01-01

Background Sensory and motor dysfunction in multiple sclerosis (MS) is often assessed with rating scales which rely heavily on clinical judgment. Quantitative devices may be more precise than rating scales. Objective To quantify lower extremity sensorimotor measures in individuals with MS, evaluate the extent to which they can detect functional systems impairments, and determine their relationship to global disability measures. Methods We tested 145 MS subjects and 58 controls. Vibration thresholds were quantified using a Vibratron-II device. Strength was quantified by a hand-held dynamometer. We also recorded Expanded Disability Status Scale (EDSS) and timed 25-foot walk (T25FW). T-tests and Wilcoxon-rank sum were used to compare group data. Spearman correlations were used to assess relationships between each measure. We also used a step-wise linear regression model to determine how much the quantitative measures explain the variance in the respective functional systems scores (FSS). Results EDSS scores ranged from 0-7.5, mean disease duration was 10.4±9.6 years, and 66% were female. In RRMS, but not progressive MS, poorer vibration sensation correlated with a worse EDSS score, whereas progressive groups’ ankle/hip strength changed significantly with EDSS progression. Interestingly, not only did sensorimotor measures significantly correlate with global disability measures (EDSS), but they had improved sensitivity, as they detected impairments in up to 32% of MS subjects with normal sensory FSS. Conclusions Sensory and motor deficits can be quantified using clinically accessible tools and distinguish differences among MS subtypes. We show that quantitative sensorimotor measures are more sensitive than FSS from the EDSS. These tools have the potential to be used as clinical outcome measures in practice and for future MS clinical trials of neurorehabilitative and neuroreparative interventions. PMID:21458828

The detection of Yersinia enterocolitica in surface water by quantitative PCR amplification of the ail and yadA genes.

PubMed

Cheyne, Bo M; Van Dyke, Michele I; Anderson, William B; Huck, Peter M

2010-09-01

Yersinia enterocolitica has been detected in surface water, and drinking untreated water is a risk factor for infection. PCR-based methods have been used to detect Y. enterocolitica in various sample types, but quantitative studies have not been conducted in water. In this study, quantitative PCR (qPCR)-based methods targeting the Yersinia virulence genes ail and yadA were used to survey the Grand River watershed in southern Ontario, Canada. Initial testing of reference strains showed that ail and yadA PCR assays were specific for pathogenic biotypes of Y. enterocolitica; however the genes were also detected in one clinical Yersinia intermedia isolate. A survey of surface water from the Grand River watershed showed that both genes were detected at five sampling locations, with the ail and yadA genes detected in 38 and 21% of samples, respectively. Both genes were detected more frequently at colder water temperatures. A screening of Yersinia strains isolated from the watershed showed that the ail gene was detected in three Y. enterocolitica 1A/O:5 isolates. Results of this study show that Yersinia virulence genes were commonly detected in a watershed used as a source of drinking water, and that the occurrence of these genes was seasonal.

Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods

PubMed Central

Wu, Yuhua; Wang, Yulei; Li, Jun; Li, Wei; Zhang, Li; Li, Yunjing; Li, Xiaofei; Li, Jun; Zhu, Li; Wu, Gang

2014-01-01

The Cauliflower mosaic virus (CaMV) 35S promoter (P35S) is a commonly used target for detection of genetically modified organisms (GMOs). There are currently 24 reported detection methods, targeting different regions of the P35S promoter. Initial assessment revealed that due to the absence of primer binding sites in the P35S sequence, 19 of the 24 reported methods failed to detect P35S in MON88913 cotton, and the other two methods could only be applied to certain GMOs. The rest three reported methods were not suitable for measurement of P35S in some testing events, because SNPs in binding sites of the primer/probe would result in abnormal amplification plots and poor linear regression parameters. In this study, we discovered a conserved region in the P35S sequence through sequencing of P35S promoters from multiple transgenic events, and developed new qualitative and quantitative detection systems targeting this conserved region. The qualitative PCR could detect the P35S promoter in 23 unique GMO events with high specificity and sensitivity. The quantitative method was suitable for measurement of P35S promoter, exhibiting good agreement between the amount of template and Ct values for each testing event. This study provides a general P35S screening method, with greater coverage than existing methods. PMID:25483893

A Complementary Isothermal Amplification Method to the U.S. EPA Quantitative Polymerase Chain Reaction Approach for the Detection of Enterococci in Environmental Waters

PubMed Central

2017-01-01

We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring. PMID:28541661

Comparison of propidium monoazide-quantitative PCR and reverse transcription quantitative PCR for viability detection of fresh Cryptosporidium oocysts following disinfection and after long-term storage in water samples

EPA Science Inventory

Purified oocysts of Cryptosporidium parvum were used to evaluate applicability of two quantitative PCR (qPCR) viability detection methods in raw surface water and disinfection treated water. Propidium monoazide-qPCR targeting hsp70 gene was compared to reverse transcription (RT)-...

Improved Methods for Capture, Extraction, and Quantitative Assay of Environmental DNA from Asian Bigheaded Carp (Hypophthalmichthys spp.)

PubMed Central

Turner, Cameron R.; Miller, Derryl J.; Coyne, Kathryn J.; Corush, Joel

2014-01-01

Indirect, non-invasive detection of rare aquatic macrofauna using aqueous environmental DNA (eDNA) is a relatively new approach to population and biodiversity monitoring. As such, the sensitivity of monitoring results to different methods of eDNA capture, extraction, and detection is being investigated in many ecosystems and species. One of the first and largest conservation programs with eDNA-based monitoring as a central instrument focuses on Asian bigheaded carp (Hypophthalmichthys spp.), an invasive fish spreading toward the Laurentian Great Lakes. However, the standard eDNA methods of this program have not advanced since their development in 2010. We developed new, quantitative, and more cost-effective methods and tested them against the standard protocols. In laboratory testing, our new quantitative PCR (qPCR) assay for bigheaded carp eDNA was one to two orders of magnitude more sensitive than the existing endpoint PCR assays. When applied to eDNA samples from an experimental pond containing bigheaded carp, the qPCR assay produced a detection probability of 94.8% compared to 4.2% for the endpoint PCR assays. Also, the eDNA capture and extraction method we adapted from aquatic microbiology yielded five times more bigheaded carp eDNA from the experimental pond than the standard method, at a per sample cost over forty times lower. Our new, more sensitive assay provides a quantitative tool for eDNA-based monitoring of bigheaded carp, and the higher-yielding eDNA capture and extraction method we describe can be used for eDNA-based monitoring of any aquatic species. PMID:25474207

Improved methods for capture, extraction, and quantitative assay of environmental DNA from Asian bigheaded carp (Hypophthalmichthys spp.).

PubMed

Turner, Cameron R; Miller, Derryl J; Coyne, Kathryn J; Corush, Joel

2014-01-01

Indirect, non-invasive detection of rare aquatic macrofauna using aqueous environmental DNA (eDNA) is a relatively new approach to population and biodiversity monitoring. As such, the sensitivity of monitoring results to different methods of eDNA capture, extraction, and detection is being investigated in many ecosystems and species. One of the first and largest conservation programs with eDNA-based monitoring as a central instrument focuses on Asian bigheaded carp (Hypophthalmichthys spp.), an invasive fish spreading toward the Laurentian Great Lakes. However, the standard eDNA methods of this program have not advanced since their development in 2010. We developed new, quantitative, and more cost-effective methods and tested them against the standard protocols. In laboratory testing, our new quantitative PCR (qPCR) assay for bigheaded carp eDNA was one to two orders of magnitude more sensitive than the existing endpoint PCR assays. When applied to eDNA samples from an experimental pond containing bigheaded carp, the qPCR assay produced a detection probability of 94.8% compared to 4.2% for the endpoint PCR assays. Also, the eDNA capture and extraction method we adapted from aquatic microbiology yielded five times more bigheaded carp eDNA from the experimental pond than the standard method, at a per sample cost over forty times lower. Our new, more sensitive assay provides a quantitative tool for eDNA-based monitoring of bigheaded carp, and the higher-yielding eDNA capture and extraction method we describe can be used for eDNA-based monitoring of any aquatic species.

Qualitative and Quantitative Detection of Botulinum Neurotoxins from Complex Matrices: Results of the First International Proficiency Test

PubMed Central

Worbs, Sylvia; Fiebig, Uwe; Zeleny, Reinhard; Schimmel, Heinz; Rummel, Andreas; Luginbühl, Werner; Dorner, Brigitte G.

2015-01-01

In the framework of the EU project EQuATox, a first international proficiency test (PT) on the detection and quantification of botulinum neurotoxins (BoNT) was conducted. Sample materials included BoNT serotypes A, B and E spiked into buffer, milk, meat extract and serum. Different methods were applied by the participants combining different principles of detection, identification and quantification. Based on qualitative assays, 95% of all results reported were correct. Successful strategies for BoNT detection were based on a combination of complementary immunological, MS-based and functional methods or on suitable functional in vivo/in vitro approaches (mouse bioassay, hemidiaphragm assay and Endopep-MS assay). Quantification of BoNT/A, BoNT/B and BoNT/E was performed by 48% of participating laboratories. It turned out that precise quantification of BoNT was difficult, resulting in a substantial scatter of quantitative data. This was especially true for results obtained by the mouse bioassay which is currently considered as “gold standard” for BoNT detection. The results clearly demonstrate the urgent need for certified BoNT reference materials and the development of methods replacing animal testing. In this context, the BoNT PT provided the valuable information that both the Endopep-MS assay and the hemidiaphragm assay delivered quantitative results superior to the mouse bioassay. PMID:26703724

Quantitative imaging methods in osteoporosis.

PubMed

Oei, Ling; Koromani, Fjorda; Rivadeneira, Fernando; Zillikens, M Carola; Oei, Edwin H G

2016-12-01

Osteoporosis is characterized by a decreased bone mass and quality resulting in an increased fracture risk. Quantitative imaging methods are critical in the diagnosis and follow-up of treatment effects in osteoporosis. Prior radiographic vertebral fractures and bone mineral density (BMD) as a quantitative parameter derived from dual-energy X-ray absorptiometry (DXA) are among the strongest known predictors of future osteoporotic fractures. Therefore, current clinical decision making relies heavily on accurate assessment of these imaging features. Further, novel quantitative techniques are being developed to appraise additional characteristics of osteoporosis including three-dimensional bone architecture with quantitative computed tomography (QCT). Dedicated high-resolution (HR) CT equipment is available to enhance image quality. At the other end of the spectrum, by utilizing post-processing techniques such as the trabecular bone score (TBS) information on three-dimensional architecture can be derived from DXA images. Further developments in magnetic resonance imaging (MRI) seem promising to not only capture bone micro-architecture but also characterize processes at the molecular level. This review provides an overview of various quantitative imaging techniques based on different radiological modalities utilized in clinical osteoporosis care and research.

Event-specific qualitative and quantitative detection of five genetically modified rice events using a single standard reference molecule.

PubMed

Kim, Jae-Hwan; Park, Saet-Byul; Roh, Hyo-Jeong; Shin, Min-Ki; Moon, Gui-Im; Hong, Jin-Hwan; Kim, Hae-Yeong

2017-07-01

One novel standard reference plasmid, namely pUC-RICE5, was constructed as a positive control and calibrator for event-specific qualitative and quantitative detection of genetically modified (GM) rice (Bt63, Kemingdao1, Kefeng6, Kefeng8, and LLRice62). pUC-RICE5 contained fragments of a rice-specific endogenous reference gene (sucrose phosphate synthase) as well as the five GM rice events. An existing qualitative PCR assay approach was modified using pUC-RICE5 to create a quantitative method with limits of detection correlating to approximately 1-10 copies of rice haploid genomes. In this quantitative PCR assay, the square regression coefficients ranged from 0.993 to 1.000. The standard deviation and relative standard deviation values for repeatability ranged from 0.02 to 0.22 and 0.10% to 0.67%, respectively. The Ministry of Food and Drug Safety (Korea) validated the method and the results suggest it could be used routinely to identify five GM rice events. Copyright © 2017 Elsevier Ltd. All rights reserved.

Simple and cost-effective liquid chromatography-mass spectrometry method to measure dabrafenib quantitatively and six metabolites semi-quantitatively in human plasma.

PubMed

Vikingsson, Svante; Dahlberg, Jan-Olof; Hansson, Johan; Höiom, Veronica; Gréen, Henrik

2017-06-01

Dabrafenib is an inhibitor of BRAF V600E used for treating metastatic melanoma but a majority of patients experience adverse effects. Methods to measure the levels of dabrafenib and major metabolites during treatment are needed to allow development of individualized dosing strategies to reduce the burden of such adverse events. In this study, an LC-MS/MS method capable of measuring dabrafenib quantitatively and six metabolites semi-quantitatively is presented. The method is fully validated with regard to dabrafenib in human plasma in the range 5-5000 ng/mL. The analytes were separated on a C18 column after protein precipitation and detected in positive electrospray ionization mode using a Xevo TQ triple quadrupole mass spectrometer. As no commercial reference standards are available, the calibration curve of dabrafenib was used for semi-quantification of dabrafenib metabolites. Compared to earlier methods the presented method represents a simpler and more cost-effective approach suitable for clinical studies. Graphical abstract Combined multi reaction monitoring transitions of dabrafenib and metabolites in a typical case sample.

[Multiplex real-time PCR method for rapid detection of Marburg virus and Ebola virus].

PubMed

Yang, Yu; Bai, Lin; Hu, Kong-Xin; Yang, Zhi-Hong; Hu, Jian-Ping; Wang, Jing

2012-08-01

Marburg virus and Ebola virus are acute infections with high case fatality rates. A rapid, sensitive detection method was established to detect Marburg virus and Ebola virus by multiplex real-time fluorescence quantitative PCR. Designing primers and Taqman probes from highly conserved sequences of Marburg virus and Ebola virus through whole genome sequences alignment, Taqman probes labeled by FAM and Texas Red, the sensitivity of the multiplex real-time quantitative PCR assay was optimized by evaluating the different concentrations of primers and Probes. We have developed a real-time PCR method with the sensitivity of 30.5 copies/microl for Marburg virus positive plasmid and 28.6 copies/microl for Ebola virus positive plasmids, Japanese encephalitis virus, Yellow fever virus, Dengue virus were using to examine the specificity. The Multiplex real-time PCR assays provide a sensitive, reliable and efficient method to detect Marburg virus and Ebola virus simultaneously.

Caries Detection Methods Based on Changes in Optical Properties between Healthy and Carious Tissue

PubMed Central

Karlsson, Lena

2010-01-01

A conservative, noninvasive or minimally invasive approach to clinical management of dental caries requires diagnostic techniques capable of detecting and quantifying lesions at an early stage, when progression can be arrested or reversed. Objective evidence of initiation of the disease can be detected in the form of distinct changes in the optical properties of the affected tooth structure. Caries detection methods based on changes in a specific optical property are collectively referred to as optically based methods. This paper presents a simple overview of the feasibility of three such technologies for quantitative or semiquantitative assessment of caries lesions. Two of the techniques are well-established: quantitative light-induced fluorescence, which is used primarily in caries research, and laser-induced fluorescence, a commercially available method used in clinical dental practice. The third technique, based on near-infrared transillumination of dental enamel is in the developmental stages. PMID:20454579

Quantitative detection of powdered activated carbon in wastewater treatment plant effluent by thermogravimetric analysis (TGA).

PubMed

Krahnstöver, Therese; Plattner, Julia; Wintgens, Thomas

2016-09-15

For the elimination of potentially harmful micropollutants, powdered activated carbon (PAC) adsorption is applied in many wastewater treatment plants (WWTP). This holds the risk of PAC leakage into the WWTP effluent and desorption of contaminants into natural water bodies. In order to assess a potential PAC leakage, PAC concentrations below several mg/L have to be detected in the WWTP effluent. None of the methods that are used for water analysis today are able to differentiate between activated carbon and solid background matrix. Thus, a selective, quantitative and easily applicable method is still needed for the detection of PAC residues in wastewater. In the present study, a method was developed to quantitatively measure the PAC content in wastewater by using filtration and thermogravimetric analysis (TGA), which is a well-established technique for the distinction between different solid materials. For the sample filtration, quartz filters with a temperature stability up to 950 °C were used. This allowed for sensitive and well reproducible measurements, as the TGA was not affected by the presence of the filter. The sample's mass fractions were calculated by integrating the mass decrease rate obtained by TGA in specific, clearly identifiable peak areas. A two-step TGA heating method consisting of N2 and O2 atmospheres led to a good differentiation between PAC and biological background matrix, thanks to the reduction of peak overlapping. A linear correlation was found between a sample's PAC content and the corresponding peak areas under N2 and O2, the sample volume and the solid mass separated by filtration. Based on these findings, various wastewater samples from different WWTPs were then analyzed by TGA with regard to their PAC content. It was found that, compared to alternative techniques such as measurement of turbidity or total suspended solids, the newly developed TGA method allows for a quantitative and selective detection of PAC concentrations down to 0

Assessment of Intrathecal Free Light Chain Synthesis: Comparison of Different Quantitative Methods with the Detection of Oligoclonal Free Light Chains by Isoelectric Focusing and Affinity-Mediated Immunoblotting

PubMed Central

Kušnierová, Pavlína; Švagera, Zdeněk; Všianský, František; Byrtusová, Monika; Hradílek, Pavel; Kurková, Barbora; Zapletalová, Olga; Bartoš, Vladimír

2016-01-01

Objectives We aimed to compare various methods for free light chain (fLC) quantitation in cerebrospinal fluid (CSF) and serum and to determine whether quantitative CSF measurements could reliably predict intrathecal fLC synthesis. In addition, we wished to determine the relationship between free kappa and free lambda light chain concentrations in CSF and serum in various disease groups. Methods We analysed 166 paired CSF and serum samples by at least one of the following methods: turbidimetry (Freelite™, SPAPLUS), nephelometry (N Latex FLC™, BN ProSpec), and two different (commercially available and in-house developed) sandwich ELISAs. The results were compared with oligoclonal fLC detected by affinity-mediated immunoblotting after isoelectric focusing. Results Although the correlations between quantitative methods were good, both proportional and systematic differences were discerned. However, no major differences were observed in the prediction of positive oligoclonal fLC test. Surprisingly, CSF free kappa/free lambda light chain ratios were lower than those in serum in about 75% of samples with negative oligoclonal fLC test. In about a half of patients with multiple sclerosis and clinically isolated syndrome, profoundly increased free kappa/free lambda light chain ratios were found in the CSF. Conclusions Our results show that using appropriate method-specific cut-offs, different methods of CSF fLC quantitation can be used for the prediction of intrathecal fLC synthesis. The reason for unexpectedly low free kappa/free lambda light chain ratios in normal CSFs remains to be elucidated. Whereas CSF free kappa light chain concentration is increased in most patients with multiple sclerosis and clinically isolated syndrome, CSF free lambda light chain values show large interindividual variability in these patients and should be investigated further for possible immunopathological and prognostic significance. PMID:27846293

A validated method for the quantitation of 1,1-difluoroethane using a gas in equilibrium method of calibration.

PubMed

Avella, Joseph; Lehrer, Michael; Zito, S William

2008-10-01

1,1-Difluoroethane (DFE), also known as Freon 152A, is a member of a class of compounds known as halogenated hydrocarbons. A number of these compounds have gained notoriety because of their ability to induce rapid onset of intoxication after inhalation exposure. Abuse of DFE has necessitated development of methods for its detection and quantitation in postmortem and human performance specimens. Furthermore, methodologies applicable to research studies are required as there have been limited toxicokinetic and toxicodynamic reports published on DFE. This paper describes a method for the quantitation of DFE using a gas chromatography-flame-ionization headspace technique that employs solventless standards for calibration. Two calibration curves using 0.5 mL whole blood calibrators which ranged from A: 0.225-1.350 to B: 9.0-180.0 mg/L were developed. These were evaluated for linearity (0.9992 and 0.9995), limit of detection of 0.018 mg/L, limit of quantitation of 0.099 mg/L (recovery 111.9%, CV 9.92%), and upper limit of linearity of 27,000.0 mg/L. Combined curve recovery results of a 98.0 mg/L DFE control that was prepared using an alternate technique was 102.2% with CV of 3.09%. No matrix interference was observed in DFE enriched blood, urine or brain specimens nor did analysis of variance detect any significant differences (alpha = 0.01) in the area under the curve of blood, urine or brain specimens at three identical DFE concentrations. The method is suitable for use in forensic laboratories because validation was performed on instrumentation routinely used in forensic labs and due to the ease with which the calibration range can be adjusted. Perhaps more importantly it is also useful for research oriented studies because the removal of solvent from standard preparation eliminates the possibility for solvent induced changes to the gas/liquid partitioning of DFE or chromatographic interference due to the presence of solvent in specimens.

Quantitative method of medication system interface evaluation.

PubMed

Pingenot, Alleene Anne; Shanteau, James; Pingenot, James D F

2007-01-01

The objective of this study was to develop a quantitative method of evaluating the user interface for medication system software. A detailed task analysis provided a description of user goals and essential activity. A structural fault analysis was used to develop a detailed description of the system interface. Nurses experienced with use of the system under evaluation provided estimates of failure rates for each point in this simplified fault tree. Means of estimated failure rates provided quantitative data for fault analysis. Authors note that, although failures of steps in the program were frequent, participants reported numerous methods of working around these failures so that overall system failure was rare. However, frequent process failure can affect the time required for processing medications, making a system inefficient. This method of interface analysis, called Software Efficiency Evaluation and Fault Identification Method, provides quantitative information with which prototypes can be compared and problems within an interface identified.

Automated Quantitative Nuclear Cardiology Methods

PubMed Central

Motwani, Manish; Berman, Daniel S.; Germano, Guido; Slomka, Piotr J.

2016-01-01

Quantitative analysis of SPECT and PET has become a major part of nuclear cardiology practice. Current software tools can automatically segment the left ventricle, quantify function, establish myocardial perfusion maps and estimate global and local measures of stress/rest perfusion – all with minimal user input. State-of-the-art automated techniques have been shown to offer high diagnostic accuracy for detecting coronary artery disease, as well as predict prognostic outcomes. This chapter briefly reviews these techniques, highlights several challenges and discusses the latest developments. PMID:26590779

Gold Nanoparticle Labeling Based ICP-MS Detection/Measurement of Bacteria, and Their Quantitative Photothermal Destruction

PubMed Central

Lin, Yunfeng

2015-01-01

Bacteria such as Salmonella and E. coli present a great challenge in public health care in today’s society. Protection of public safety against bacterial contamination and rapid diagnosis of infection require simple and fast assays for the detection and elimination of bacterial pathogens. After utilizing Salmonella DT104 as an example bacterial strain for our investigation, we report a rapid and sensitive assay for the qualitative and quantitative detection of bacteria by using antibody affinity binding, popcorn shaped gold nanoparticle (GNPOPs) labeling, surfance enchanced Raman spectroscopy (SERS), and inductively coupled plasma mass spectrometry (ICP-MS) detection. For qualitative analysis, our assay can detect Salmonella within 10 min by Raman spectroscopy; for quantitative analysis, our assay has the ability to measure as few as 100 Salmonella DT104 in a 1 mL sample (100 CFU/mL) within 40 min. Based on the quantitative detection, we investigated the quantitative destruction of Salmonella DT104, and the assay’s photothermal efficiency in order to reduce the amount of GNPOPs in the assay to ultimately to eliminate any potential side effects/toxicity to the surrounding cells in vivo. Results suggest that our assay may serve as a promising candidate for qualitative and quantitative detection and elimination of a variety of bacterial pathogens. PMID:26417447

QDMR: a quantitative method for identification of differentially methylated regions by entropy

PubMed Central

Zhang, Yan; Liu, Hongbo; Lv, Jie; Xiao, Xue; Zhu, Jiang; Liu, Xiaojuan; Su, Jianzhong; Li, Xia; Wu, Qiong; Wang, Fang; Cui, Ying

2011-01-01

DNA methylation plays critical roles in transcriptional regulation and chromatin remodeling. Differentially methylated regions (DMRs) have important implications for development, aging and diseases. Therefore, genome-wide mapping of DMRs across various temporal and spatial methylomes is important in revealing the impact of epigenetic modifications on heritable phenotypic variation. We present a quantitative approach, quantitative differentially methylated regions (QDMRs), to quantify methylation difference and identify DMRs from genome-wide methylation profiles by adapting Shannon entropy. QDMR was applied to synthetic methylation patterns and methylation profiles detected by methylated DNA immunoprecipitation microarray (MeDIP-chip) in human tissues/cells. This approach can give a reasonable quantitative measure of methylation difference across multiple samples. Then DMR threshold was determined from methylation probability model. Using this threshold, QDMR identified 10 651 tissue DMRs which are related to the genes enriched for cell differentiation, including 4740 DMRs not identified by the method developed by Rakyan et al. QDMR can also measure the sample specificity of each DMR. Finally, the application to methylation profiles detected by reduced representation bisulphite sequencing (RRBS) in mouse showed the platform-free and species-free nature of QDMR. This approach provides an effective tool for the high-throughput identification of potential functional regions involved in epigenetic regulation. PMID:21306990

Qualification of a Quantitative Method for Monitoring Aspartate Isomerization of a Monoclonal Antibody by Focused Peptide Mapping.

PubMed

Cao, Mingyan; Mo, Wenjun David; Shannon, Anthony; Wei, Ziping; Washabaugh, Michael; Cash, Patricia

Aspartate (Asp) isomerization is a common post-translational modification of recombinant therapeutic proteins that can occur during manufacturing, storage, or administration. Asp isomerization in the complementarity-determining regions of a monoclonal antibody may affect the target binding and thus a sufficiently robust quality control method for routine monitoring is desirable. In this work, we utilized a liquid chromatography-mass spectrometry (LC/MS)-based approach to identify the Asp isomerization in the complementarity-determining regions of a therapeutic monoclonal antibody. To quantitate the site-specific Asp isomerization of the monoclonal antibody, a UV detection-based quantitation assay utilizing the same LC platform was developed. The assay was qualified and implemented for routine monitoring of this product-specific modification. Compared with existing methods, this analytical paradigm is applicable to identify Asp isomerization (or other modifications) and subsequently develop a rapid, sufficiently robust quality control method for routine site-specific monitoring and quantitation to ensure product quality. This approach first identifies and locates a product-related impurity (a critical quality attribute) caused by isomerization, deamidation, oxidation, or other post-translational modifications, and then utilizes synthetic peptides and MS to assist the development of a LC-UV-based chromatographic method that separates and quantifies the product-related impurities by UV peaks. The established LC-UV method has acceptable peak specificity, precision, linearity, and accuracy; it can be validated and used in a good manufacturing practice environment for lot release and stability testing. Aspartate isomerization is a common post-translational modification of recombinant proteins during manufacture process and storage. Isomerization in the complementarity-determining regions (CDRs) of a monoclonal antibody A (mAb-A) has been detected and has been shown to

Comparative performance of two quantitative safety signalling methods: implications for use in a pharmacovigilance department.

PubMed

Almenoff, June S; LaCroix, Karol K; Yuen, Nancy A; Fram, David; DuMouchel, William

2006-01-01

There is increasing interest in using disproportionality-based signal detection methods to support postmarketing safety surveillance activities. Two commonly used methods, empirical Bayes multi-item gamma Poisson shrinker (MGPS) and proportional reporting ratio (PRR), perform differently with respect to the number and types of signals detected. The goal of this study was to compare and analyse the performance characteristics of these two methods, to understand why they differ and to consider the practical implications of these differences for a large, industry-based pharmacovigilance department. We compared the numbers and types of signals of disproportionate reporting (SDRs) obtained with MGPS and PRR using two postmarketing safety databases and a simulated database. We recorded signal counts and performed a qualitative comparison of the drug-event combinations signalled by the two methods as well as a sensitivity analysis to better understand how the thresholds commonly used for these methods impact their performance. PRR detected more SDRs than MGPS. We observed that MGPS is less subject to confounding by demographic factors because it employs stratification and is more stable than PRR when report counts are low. Simulation experiments performed using published empirical thresholds demonstrated that PRR detected false-positive signals at a rate of 1.1%, while MGPS did not detect any statistical false positives. In an attempt to separate the effect of choice of signal threshold from more fundamental methodological differences, we performed a series of experiments in which we modified the conventional threshold values for each method so that each method detected the same number of SDRs for the example drugs studied. This analysis, which provided quantitative examples of the relationship between the published thresholds for the two methods, demonstrates that the signalling criterion published for PRR has a higher signalling frequency than that published for MGPS

Single-Plex Quantitative Assays for the Detection and Quantification of Most Pneumococcal Serotypes

PubMed Central

Chochua, Sopio; Satzke, Catherine; Dunne, Eileen M.; Mulholland, Kim; Klugman, Keith P.

2015-01-01

Streptococcus pneumoniae globally kills more children than any other infectious disease every year. A prerequisite for pneumococcal disease and transmission is colonization of the nasopharynx. While the introduction of pneumococcal conjugate vaccines has reduced the burden of pneumococcal disease, understanding the impact of vaccination on nasopharyngeal colonization has been hampered by the lack of sensitive quantitative methods for the detection of >90 known S. pneumoniae serotypes. In this work, we developed 27 new quantitative (q)PCR reactions and optimized 26 for a total of 53 qPCR reactions targeting pneumococcal serotypes or serogroups, including all vaccine types. Reactions proved to be target-specific with a limit of detection of 2 genome equivalents per reaction. Given the number of probes required for these assays and their unknown shelf-life, the stability of cryopreserved reagents was evaluated. Our studies demonstrate that two-year cryopreserved probes had similar limit of detection as freshly-diluted probes. Moreover, efficiency and limit of detection of 1-month cryopreserved, ready-to-use, qPCR reaction mixtures were similar to those of freshly prepared mixtures. Using these reactions, our proof-of-concept studies utilizing nasopharyngeal samples (N=30) collected from young children detected samples containing ≥2 serotypes/serogroups. Samples colonized by multiple serotypes/serogroups always had a serotype that contributes at least 50% of the pneumococcal load. In addition, a molecular approach called S6-q(PCR)2 was developed and proven to individually detect and quantify epidemiologically-important serogroup 6 strains including 6A, 6B, 6C and 6D. This technology will be useful for epidemiological studies, diagnostic platforms and to study the pneumobiome. PMID:25798884

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

PubMed

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

A New Kinetic Spectrophotometric Method for the Quantitation of Amorolfine.

PubMed

Soto, César; Poza, Cristian; Contreras, David; Yáñez, Jorge; Nacaratte, Fallon; Toral, M Inés

2017-01-01

Amorolfine (AOF) is a compound with fungicide activity based on the dual inhibition of growth of the fungal cell membrane, the biosynthesis and accumulation of sterols, and the reduction of ergosterol. In this work a sensitive kinetic and spectrophotometric method for the AOF quantitation based on the AOF oxidation by means of KMnO 4 at 30 min (fixed time), pH alkaline, and ionic strength controlled was developed. Measurements of changes in absorbance at 610 nm were used as criterion of the oxidation progress. In order to maximize the sensitivity, different experimental reaction parameters were carefully studied via factorial screening and optimized by multivariate method. The linearity, intraday, and interday assay precision and accuracy were determined. The absorbance-concentration plot corresponding to tap water spiked samples was rectilinear, over the range of 7.56 × 10 -6 -3.22 × 10 -5  mol L -1 , with detection and quantitation limits of 2.49 × 10 -6  mol L -1 and 7.56 × 10 -6  mol L -1 , respectively. The proposed method was successfully validated for the application of the determination of the drug in the spiked tap water samples and the percentage recoveries were 94.0-105.0%. The method is simple and does not require expensive instruments or complicated extraction steps of the reaction product.

ICP-MS as a novel detection system for quantitative element-tagged immunoassay of hidden peanut allergens in foods.

PubMed

Careri, Maria; Elviri, Lisa; Mangia, Alessandro; Mucchino, Claudio

2007-03-01

A novel ICP-MS-based ELISA immunoassay via element-tagged determination was devised for quantitative analysis of hidden allergens in food. The method was able to detect low amounts of peanuts (down to approximately 2 mg peanuts kg(-1) cereal-based matrix) by using a europium-tagged antibody. Selectivity was proved by the lack of detectable cross-reaction with a number of protein-rich raw materials.

Assessment of Intrathecal Free Light Chain Synthesis: Comparison of Different Quantitative Methods with the Detection of Oligoclonal Free Light Chains by Isoelectric Focusing and Affinity-Mediated Immunoblotting.

PubMed

Zeman, David; Kušnierová, Pavlína; Švagera, Zdeněk; Všianský, František; Byrtusová, Monika; Hradílek, Pavel; Kurková, Barbora; Zapletalová, Olga; Bartoš, Vladimír

2016-01-01

We aimed to compare various methods for free light chain (fLC) quantitation in cerebrospinal fluid (CSF) and serum and to determine whether quantitative CSF measurements could reliably predict intrathecal fLC synthesis. In addition, we wished to determine the relationship between free kappa and free lambda light chain concentrations in CSF and serum in various disease groups. We analysed 166 paired CSF and serum samples by at least one of the following methods: turbidimetry (Freelite™, SPAPLUS), nephelometry (N Latex FLC™, BN ProSpec), and two different (commercially available and in-house developed) sandwich ELISAs. The results were compared with oligoclonal fLC detected by affinity-mediated immunoblotting after isoelectric focusing. Although the correlations between quantitative methods were good, both proportional and systematic differences were discerned. However, no major differences were observed in the prediction of positive oligoclonal fLC test. Surprisingly, CSF free kappa/free lambda light chain ratios were lower than those in serum in about 75% of samples with negative oligoclonal fLC test. In about a half of patients with multiple sclerosis and clinically isolated syndrome, profoundly increased free kappa/free lambda light chain ratios were found in the CSF. Our results show that using appropriate method-specific cut-offs, different methods of CSF fLC quantitation can be used for the prediction of intrathecal fLC synthesis. The reason for unexpectedly low free kappa/free lambda light chain ratios in normal CSFs remains to be elucidated. Whereas CSF free kappa light chain concentration is increased in most patients with multiple sclerosis and clinically isolated syndrome, CSF free lambda light chain values show large interindividual variability in these patients and should be investigated further for possible immunopathological and prognostic significance.

High-resolution mass spectrometry method for the detection, characterization and quantitation of pharmaceuticals in water.

PubMed

Pinhancos, Rebeca; Maass, Sara; Ramanathan, Dil M

2011-11-01

The presence of pharmaceuticals in drinking water is an emerging environmental concern. In most environmental testing laboratories, LC-MS/MS assays based on selected reaction monitoring are used as part of a battery of tests used to assure water quality. Although LC-MS/MS continues to be the best tool for detecting pharmaceuticals in water, the combined use of hybrid high-resolution mass spectrometry (HRMS) and ultrahigh pressure liquid chromatography (UHPLC) is starting to become a practical tool to study emerging environmental contaminants. The hybrid LTQ-orbitrap mass spectrometer is suitable for integrated quantitative and qualitative bioanalysis because of the following reasons: (1) the ability to collect full-scan HRMS spectra with scan speeds suitable for UHPLC separations, (2) routine measurement of mass with less than 5 ppm mass accuracy, (3) high mass resolving power, and (4) ability to perform on-the-fly polarity switching in the linear ion trap (LTQ). In the present work, we provide data demonstrating the application of UHPLC-LTQ-orbitrap for the detection, characterization and quantification of pharmaceuticals and their metabolites in drinking water. Copyright © 2011 John Wiley & Sons, Ltd.

The efficacy of semi-quantitative urine protein-to-creatinine (P/C) ratio for the detection of significant proteinuria in urine specimens in health screening settings.

PubMed

Chang, Chih-Chun; Su, Ming-Jang; Ho, Jung-Li; Tsai, Yu-Hui; Tsai, Wei-Ting; Lee, Shu-Jene; Yen, Tzung-Hai; Chu, Fang-Yeh

2016-01-01

Urine protein detection could be underestimated using the conventional dipstick method because of variations in urine aliquots. This study aimed to assess the efficacy of the semi-quantitative urine protein-to-creatinine (P/C) ratio compared with other laboratory methods. Random urine samples were requested from patients undergoing chronic kidney disease screening. Significant proteinuria was determined by the quantitative P/C ratio of at least 150 mg protein/g creatinine. The semi-quantitative P/C ratio, dipstick protein and quantitative protein concentrations were compared and analyzed. In the 2932 urine aliquots, 156 (5.3 %) urine samples were considered as diluted and 60 (39.2 %) were found as significant proteinuria. The semi-quantitative P/C ratio testing had the best sensitivity (70.0 %) and specificity (95.9 %) as well as the lowest underestimation rate (0.37 %) when compared to other laboratory methods in the study. In the semi-quantitative P/C ratio test, 19 (12.2 %) had positive, 52 (33.3 %) had diluted, and 85 (54.5 %) had negative results. Of those with positive results, 7 (36.8 %) were positive detected by traditional dipstick urine protein test, and 9 (47.4 %) were positive detected by quantitative urine protein test. Additionally, of those with diluted results, 25 (48.1 %) had significant proteinuria, and all were assigned as no significant proteinuria by both tests. The semi-quantitative urine P/C ratio is clinically applicable based on its better sensitivity and screening ability for significant proteinuria than other laboratory methods, particularly in diluted urine samples. To establish an effective strategy for CKD prevention, urine protein screening with semi-quantitative P/C ratio could be considered.

Quantitative Surface Chirality Detection with Sum Frequency Generation Vibrational Spectroscopy: Twin Polarization Angle Approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, Feng; Xu, Yanyan; Guo, Yuan

2009-12-27

Here we report a novel twin polarization angle (TPA) approach in the quantitative chirality detection with the surface sum-frequency generation vibrational spectroscopy (SFG-VS). Generally, the achiral contribution dominates the surface SFG-VS signal, and the pure chiral signal is usually two or three orders of magnitude smaller. Therefore, it has been difficult to make quantitative detection and analysis of the chiral contributions to the surface SFG- VS signal. In the TPA method, by varying together the polarization angles of the incoming visible light and the sum frequency signal at fixed s or p polarization of the incoming infrared beam, the polarizationmore » dependent SFG signal can give not only direct signature of the chiral contribution in the total SFG-VS signal, but also the accurate measurement of the chiral and achiral components in the surface SFG signal. The general description of the TPA method is presented and the experiment test of the TPA approach is also presented for the SFG-VS from the S- and R-limonene chiral liquid surfaces. The most accurate degree of chiral excess values thus obtained for the 2878 cm⁻¹ spectral peak of the S- and R-limonene liquid surfaces are (23.7±0.4)% and ({25.4±1.3)%, respectively.« less

A new improved graphical and quantitative method for detecting bias in meta-analysis.

PubMed

Furuya-Kanamori, Luis; Barendregt, Jan J; Doi, Suhail A R

2018-04-04

Detection of publication and related biases remains suboptimal and threatens the validity and interpretation of meta-analytical findings. When bias is present, it usually differentially affects small and large studies manifesting as an association between precision and effect size and therefore visual asymmetry of conventional funnel plots. This asymmetry can be quantified and Egger's regression is, by far, the most widely used statistical measure for quantifying funnel plot asymmetry. However, concerns have been raised about both the visual appearance of funnel plots and the sensitivity of Egger's regression to detect such asymmetry, particularly when the number of studies is small. In this article, we propose a new graphical method, the Doi plot, to visualize asymmetry and also a new measure, the LFK index, to detect and quantify asymmetry of study effects in Doi plots. We demonstrate that the visual representation of asymmetry was better for the Doi plot when compared with the funnel plot. We also show that the diagnostic accuracy of the LFK index in discriminating between asymmetry due to simulated publication bias versus chance or no asymmetry was also better with the LFK index which had areas under the receiver operating characteristic curve of 0.74-0.88 with simulations of meta-analyses with five, 10, 15, and 20 studies. The Egger's regression result had lower areas under the receiver operating characteristic curve values of 0.58-0.75 across the same simulations. The LFK index also had a higher sensitivity (71.3-72.1%) than the Egger's regression result (18.5-43.0%). We conclude that the methods proposed in this article can markedly improve the ability of researchers to detect bias in meta-analysis.

Automated detection of videotaped neonatal seizures based on motion segmentation methods.

PubMed

Karayiannis, Nicolaos B; Tao, Guozhi; Frost, James D; Wise, Merrill S; Hrachovy, Richard A; Mizrahi, Eli M

2006-07-01

This study was aimed at the development of a seizure detection system by training neural networks using quantitative motion information extracted by motion segmentation methods from short video recordings of infants monitored for seizures. The motion of the infants' body parts was quantified by temporal motion strength signals extracted from video recordings by motion segmentation methods based on optical flow computation. The area of each frame occupied by the infants' moving body parts was segmented by direct thresholding, by clustering of the pixel velocities, and by clustering the motion parameters obtained by fitting an affine model to the pixel velocities. The computational tools and procedures developed for automated seizure detection were tested and evaluated on 240 short video segments selected and labeled by physicians from a set of video recordings of 54 patients exhibiting myoclonic seizures (80 segments), focal clonic seizures (80 segments), and random infant movements (80 segments). The experimental study described in this paper provided the basis for selecting the most effective strategy for training neural networks to detect neonatal seizures as well as the decision scheme used for interpreting the responses of the trained neural networks. Depending on the decision scheme used for interpreting the responses of the trained neural networks, the best neural networks exhibited sensitivity above 90% or specificity above 90%. The best among the motion segmentation methods developed in this study produced quantitative features that constitute a reliable basis for detecting myoclonic and focal clonic neonatal seizures. The performance targets of this phase of the project may be achieved by combining the quantitative features described in this paper with those obtained by analyzing motion trajectory signals produced by motion tracking methods. A video system based upon automated analysis potentially offers a number of advantages. Infants who are at risk for

A quantitative method for optimized placement of continuous air monitors.

PubMed

Whicker, Jeffrey J; Rodgers, John C; Moxley, John S

2003-11-01

Alarming continuous air monitors (CAMs) are a critical component for worker protection in facilities that handle large amounts of hazardous materials. In nuclear facilities, continuous air monitors alarm when levels of airborne radioactive materials exceed alarm thresholds, thus prompting workers to exit the room to reduce inhalation exposures. To maintain a high level of worker protection, continuous air monitors are required to detect radioactive aerosol clouds quickly and with good sensitivity. This requires that there are sufficient numbers of continuous air monitors in a room and that they are well positioned. Yet there are no published methodologies to quantitatively determine the optimal number and placement of continuous air monitors in a room. The goal of this study was to develop and test an approach to quantitatively determine optimal number and placement of continuous air monitors in a room. The method we have developed uses tracer aerosol releases (to simulate accidental releases) and the measurement of the temporal and spatial aspects of the dispersion of the tracer aerosol through the room. The aerosol dispersion data is then analyzed to optimize continuous air monitor utilization based on simulated worker exposure. This method was tested in a room within a Department of Energy operated plutonium facility at the Savannah River Site in South Carolina, U.S. Results from this study show that the value of quantitative airflow and aerosol dispersion studies is significant and that worker protection can be significantly improved while balancing the costs associated with CAM programs.

Temporal lobe epilepsy: quantitative MR volumetry in detection of hippocampal atrophy.

PubMed

Farid, Nikdokht; Girard, Holly M; Kemmotsu, Nobuko; Smith, Michael E; Magda, Sebastian W; Lim, Wei Y; Lee, Roland R; McDonald, Carrie R

2012-08-01

To determine the ability of fully automated volumetric magnetic resonance (MR) imaging to depict hippocampal atrophy (HA) and to help correctly lateralize the seizure focus in patients with temporal lobe epilepsy (TLE). This study was conducted with institutional review board approval and in compliance with HIPAA regulations. Volumetric MR imaging data were analyzed for 34 patients with TLE and 116 control subjects. Structural volumes were calculated by using U.S. Food and Drug Administration-cleared software for automated quantitative MR imaging analysis (NeuroQuant). Results of quantitative MR imaging were compared with visual detection of atrophy, and, when available, with histologic specimens. Receiver operating characteristic analyses were performed to determine the optimal sensitivity and specificity of quantitative MR imaging for detecting HA and asymmetry. A linear classifier with cross validation was used to estimate the ability of quantitative MR imaging to help lateralize the seizure focus. Quantitative MR imaging-derived hippocampal asymmetries discriminated patients with TLE from control subjects with high sensitivity (86.7%-89.5%) and specificity (92.2%-94.1%). When a linear classifier was used to discriminate left versus right TLE, hippocampal asymmetry achieved 94% classification accuracy. Volumetric asymmetries of other subcortical structures did not improve classification. Compared with invasive video electroencephalographic recordings, lateralization accuracy was 88% with quantitative MR imaging and 85% with visual inspection of volumetric MR imaging studies but only 76% with visual inspection of clinical MR imaging studies. Quantitative MR imaging can depict the presence and laterality of HA in TLE with accuracy rates that may exceed those achieved with visual inspection of clinical MR imaging studies. Thus, quantitative MR imaging may enhance standard visual analysis, providing a useful and viable means for translating volumetric analysis into

Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

PubMed

Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

2013-06-01

A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

Rapid, On-Site, Ultrasensitive Melamine Quantitation Method for Protein Beverages Using Time-Resolved Fluorescence Detection Paper.

PubMed

Li, Guanghua; Wang, Du; Zhou, Aijun; Sun, Yimin; Zhang, Qi; Poapolathep, Amnart; Zhang, Li; Fan, Zhiyong; Zhang, Zhaowei; Li, Peiwu

2018-06-06

To ensure protein beverage safety and prevent illegal melamine use to artificially increase protein content, a rapid, on-site, ultrasensitive detection method for melamine must be developed because melamine is detrimental to human health. Herein, an ultrasensitive time-resolved fluorescence detection paper (TFDP) was developed to detect melamine in protein beverages within 15 min using a one-step sample preparation. The lower limits of detection were 0.89, 0.94, and 1.05 ng/mL, and the linear ranges were 2.67-150, 2.82-150, and 3.15-150 ng/mL (R 2 > 0.982) for peanut, walnut, and coconut beverages, respectively. The recovery rates were 85.86-110.60% with a coefficient of variation <7.80% in the spiking experiment. A high specificity was observed in the interferent experiment. When detecting real protein beverage samples, the TFDP and ultraperformance liquid chromatography-tandem mass spectrometer (UPLC-MS/MS) results were consistent. This method is a promising alternative for rapid, on-site detection of melamine in beverages.

[Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].

PubMed

Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu

2005-07-01

To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.

Development of liquid chromatography-tandem mass spectrometry methods for the quantitation of Anisakis simplex proteins in fish.

PubMed

Fæste, Christiane Kruse; Moen, Anders; Schniedewind, Björn; Haug Anonsen, Jan; Klawitter, Jelena; Christians, Uwe

2016-02-05

The parasite Anisakis simplex is present in many marine fish species that are directly used as food or in processed products. The anisakid larvae infect mostly the gut and inner organs of fish but have also been shown to penetrate into the fillet. Thus, human health can be at risk, either by contracting anisakiasis through the consumption of raw or under-cooked fish, or by sensitisation to anisakid proteins in processed food. A number of different methods for the detection of A. simplex in fish and products thereof have been developed, including visual techniques and PCR for larvae tracing, and immunological assays for the determination of proteins. The recent identification of a number of anisakid proteins by mass spectrometry-based proteomics has laid the groundwork for the development of two quantitative liquid chromatography-tandem mass spectrometry methods for the detection of A. simplex in fish that are described in the present study. Both, the label-free semi-quantitative nLC-nESI-Orbitrap-MS/MS (MS1) and the heavy peptide-applying absolute-quantitative (AQUA) LC-TripleQ-MS/MS (MS2) use unique reporter peptides derived from anisakid hemoglobin and SXP/RAL-2 protein as analytes. Standard curves in buffer and in salmon matrix showed limits of detection at 1μg/mL and 10μg/mL for MS1 and 0.1μg/mL and 2μg/mL for MS2. Preliminary method validation included the assessment of sensitivity, repeatability, reproducibility, and applicability to incurred and naturally-contaminated samples for both assays. By further optimization and full validation in accordance with current recommendations the LC-MS/MS methods could be standardized and used generally as confirmative techniques for the detection of A. simplex protein in fish. Copyright © 2016 Elsevier B.V. All rights reserved.

Supramolecular assembly affording a ratiometric two-photon fluorescent nanoprobe for quantitative detection and bioimaging.

PubMed

Wang, Peng; Zhang, Cheng; Liu, Hong-Wen; Xiong, Mengyi; Yin, Sheng-Yan; Yang, Yue; Hu, Xiao-Xiao; Yin, Xia; Zhang, Xiao-Bing; Tan, Weihong

2017-12-01

Fluorescence quantitative analyses for vital biomolecules are in great demand in biomedical science owing to their unique detection advantages with rapid, sensitive, non-damaging and specific identification. However, available fluorescence strategies for quantitative detection are usually hard to design and achieve. Inspired by supramolecular chemistry, a two-photon-excited fluorescent supramolecular nanoplatform ( TPSNP ) was designed for quantitative analysis with three parts: host molecules (β-CD polymers), a guest fluorophore of sensing probes (Np-Ad) and a guest internal reference (NpRh-Ad). In this strategy, the TPSNP possesses the merits of (i) improved water-solubility and biocompatibility; (ii) increased tissue penetration depth for bioimaging by two-photon excitation; (iii) quantitative and tunable assembly of functional guest molecules to obtain optimized detection conditions; (iv) a common approach to avoid the limitation of complicated design by adjustment of sensing probes; and (v) accurate quantitative analysis by virtue of reference molecules. As a proof-of-concept, we utilized the two-photon fluorescent probe NHS-Ad-based TPSNP-1 to realize accurate quantitative analysis of hydrogen sulfide (H 2 S), with high sensitivity and good selectivity in live cells, deep tissues and ex vivo -dissected organs, suggesting that the TPSNP is an ideal quantitative indicator for clinical samples. What's more, TPSNP will pave the way for designing and preparing advanced supramolecular sensors for biosensing and biomedicine.

Universal and specific quantitative detection of botulinum neurotoxin genes

PubMed Central

2010-01-01

Background Clostridium botulinum, an obligate anaerobic spore-forming bacterium, produces seven antigenic variants of botulinum toxin that are distinguished serologically and termed "serotypes". Botulinum toxin blocks the release of acetylcholine at neuromuscular junctions resulting in flaccid paralysis. The potential lethality of the disease warrants a fast and accurate means of diagnosing suspected instances of food contamination or human intoxication. Currently, the Food and Drug Administration (FDA)-accepted assay to detect and type botulinum neurotoxins (BoNTs) is the mouse protection bioassay. While specific and sensitive, this assay requires the use of laboratory animals, may take up to four days to achieve a diagnosis, and is unsuitable for high-throughput analysis. We report here a two-step PCR assay that identifies all toxin types, that achieves the specificity of the mouse bioassay while surpassing it in equivalent sensitivity, that has capability for high-throughput analysis, and that provides quantitative results within hours. The first step of our assay consists of a conventional PCR that detects the presence of C. botulinum regardless of the neurotoxin type. The second step uses quantitative PCR (qPCR) technology to determine the specific serotype of the neurotoxin. Results We assayed purified C. botulinum DNA and crude toxin preparations, as well as food and stool from healthy individuals spiked with purified BoNT DNA, and one stool sample from a case of infant botulism for the presence of the NTNH gene, which is part of the BoNT gene cluster, and for the presence of serotype-specific BoNT genes. The PCR surpassed the mouse bioassay both in specificity and sensitivity, detecting positive signals in BoNT preparations containing well below the 1 LD50 required for detection via the mouse bioassay. These results were type-specific and we were reliably able to quantify as few as 10 genomic copies. Conclusions While other studies have reported

Mapcurves: a quantitative method for comparing categorical maps.

Treesearch

William W. Hargrove; M. Hoffman Forrest; Paul F. Hessburg

2006-01-01

We present Mapcurves, a quantitative goodness-of-fit (GOF) method that unambiguously shows the degree of spatial concordance between two or more categorical maps. Mapcurves graphically and quantitatively evaluate the degree of fit among any number of maps and quantify a GOF for each polygon, as well as the entire map. The Mapcurve method indicates a perfect fit even if...

Uncertainty of quantitative microbiological methods of pharmaceutical analysis.

PubMed

Gunar, O V; Sakhno, N G

2015-12-30

The total uncertainty of quantitative microbiological methods, used in pharmaceutical analysis, consists of several components. The analysis of the most important sources of the quantitative microbiological methods variability demonstrated no effect of culture media and plate-count techniques in the estimation of microbial count while the highly significant effect of other factors (type of microorganism, pharmaceutical product and individual reading and interpreting errors) was established. The most appropriate method of statistical analysis of such data was ANOVA which enabled not only the effect of individual factors to be estimated but also their interactions. Considering all the elements of uncertainty and combining them mathematically the combined relative uncertainty of the test results was estimated both for method of quantitative examination of non-sterile pharmaceuticals and microbial count technique without any product. These data did not exceed 35%, appropriated for a traditional plate count methods. Copyright © 2015 Elsevier B.V. All rights reserved.

A quantitative PCR assay for the detection and quantification of Babesia bovis and B. bigemina.

PubMed

Buling, A; Criado-Fornelio, A; Asenzo, G; Benitez, D; Barba-Carretero, J C; Florin-Christensen, M

2007-06-20

The haemoparasites Babesia bovis and Babesia bigemina affect cattle over vast areas of the tropics and temperate parts of the world. Microscopic examination of blood smears allows the detection of clinical cases of babesiosis, but this procedure lacks sensitivity when parasitaemia levels are low. In addition, differentiating between similar haemoparasites can be very difficult. Molecular diagnostic procedures can, however, overcome these problems. This paper reports a quantitative PCR (qPCR) assay involving the use of SYBR Green. Based on the amplification of a small fragment of the cytochrome b gene, this method shows both high sensitivity and specificity, and allows quantification of parasite DNA. In tests, reproducible quantitative results were obtained over the range of 0.1 ng to 0.1 fg of parasite DNA. Melting curve analysis differentiated between B. bovis and B. bigemina. To assess the performance of the new qPCR procedure it was used to screen for babesiosis in 40 cows and 80 horses. B. bigemina was detected in five cows (three of these were also found to be positive by standard PCR techniques targeting the 18S rRNA gene). In addition, B. bovis was detected in one horse and B. bigemina in two horses using the proposed method, while none was found positive by ribosomal standard PCR. The sequences of the B. bigemina cytochrome b and 18S rRNA genes were completely conserved in isolates from Spain and Argentina, while those of B. bovis showed moderate polymorphism.

Rapid and Quantitative Detection of Vibrio parahemolyticus by the Mixed-Dye-Based Loop-Mediated Isothermal Amplification Assay on a Self-Priming Compartmentalization Microfluidic Chip.

PubMed

Pang, Bo; Ding, Xiong; Wang, Guoping; Zhao, Chao; Xu, Yanan; Fu, Kaiyue; Sun, Jingjing; Song, Xiuling; Wu, Wenshuai; Liu, Yushen; Song, Qi; Hu, Jiumei; Li, Juan; Mu, Ying

2017-12-27

Vibrio parahemolyticus (VP) mostly isolated from aquatic products is one of the major causes of bacterial food-poisoning events worldwide, which could be reduced using a promising on-site detection method. Herein, a rapid and quantitative method for VP detection was developed by applying a mixed-dye-loaded loop-mediated isothermal amplification (LAMP) assay on a self-priming compartmentalization (SPC) microfluidic chip, termed on-chip mixed-dye-based LAMP (CMD-LAMP). In comparison to conventional approaches, CMD-LAMP was advantageous on the limit of detection, which reached down to 1 × 10 3 CFU/mL in food-contaminated samples without the pre-enrichment of bacteria. Additionally, as a result of the use of a mixed dye and SPC chip, the quantitative result could be easily acquired, avoiding the requirement of sophisticated instruments and tedious operation. Also, CMD-LAMP was rapid and cost-effective. Conclusively, CMD-LAMP has great potential in realizing the on-site quantitative analysis of VP for food safety.

A novel Alu-based real-time PCR method for the quantitative detection of plasma circulating cell-free DNA: Sensitivity and specificity for the diagnosis of myocardial infarction

PubMed Central

LOU, XIAOLI; HOU, YANQIANG; LIANG, DONGYU; PENG, LIANG; CHEN, HONGWEI; MA, SHANYUAN; ZHANG, LURONG

2015-01-01

In the present study, we aimed to develop and validate a rapid and sensitive, Alu-based real-time PCR method for the detection of circulating cell-free DNA (cfDNA). This method targeted repetitive elements of the Alu reduplicative elements in the human genome, followed by signal amplification using fluorescence quantification. Standard Alu-puc57 vectors were constructed and 5 pairs of specific primers were designed. Valuation was conducted concerning linearity, variation and recovery. We found 5 linear responses (R1–5=0.998–0.999). The average intra- and inter-assay coefficients of variance were 12.98 and 10.75%, respectively. The recovery was 82.33–114.01%, with a mean recovery index of 101.26%. This Alu-based assay was reliable, accurate and sensitive for the quantitative detection of cfDNA. Plasma from normal controls and patients with myocardial infarction (MI) were analyzed, and the baseline levels of cfDNA were higher in the MI group. The area under the receiver operating characteristic (ROC) curve for Alu1, Alu2, Alu3, Alu4, Alu5 and Alu (Alu1 + Alu2 + Alu3 + Alu4 + Alu5) was 0.887, 0.758, 0.857, 0.940, 0.968 and 0.933, respectively. The optimal cut-off value for Alu1, Alu2, Alu3, Alu4, Alu5 and Alu to predict MI was 3.71, 1.93, 0.22, 3.73, 6.13 and 6.40 log copies/ml. We demonstrate that this new method is a reliable, accurate and sensitive method for the quantitative detection of cfDNA and that it is useful for studying the regulation of cfDNA in certain pathological conditions. Alu4, Alu5 and Alu showed better sensitivity and specificity for the diagnosis of MI compared with cardiac troponin I (cTnI), creatine kinase MB (CK-MB) isoenzyme and lactate dehydrogenase (LDH). Alu5 had the best prognostic ability. PMID:25374065

A simple and rapid DNA extraction method from whole blood for highly sensitive detection and quantitation of HIV-1 proviral DNA by real-time PCR.

PubMed

McFall, Sally M; Wagner, Robin L; Jangam, Sujit R; Yamada, Douglas H; Hardie, Diana; Kelso, David M

2015-03-01

Early diagnosis and access to treatment for infants with human immunodeficiency virus-1 (HIV-1) is critical to reduce infant mortality. The lack of simple point-of-care tests impedes the timely initiation of antiretroviral therapy. The development of FINA, filtration isolation of nucleic acids, a novel DNA extraction method that can be performed by clinic personnel in less than 2 min has been reported previously. In this report, significant improvements in the DNA extraction and amplification methods are detailed that allow sensitive quantitation of as little as 10 copies of HIV-1 proviral DNA and detection of 3 copies extracted from 100 μl of whole blood. An internal control to detect PCR inhibition was also incorporated. In a preliminary field evaluation of 61 South African infants, the FINA test demonstrated 100% sensitivity and specificity. The proviral copy number of the infant specimens was quantified, and it was established that 100 microliters of whole blood is required for sensitive diagnosis of infants. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Development and evaluation of event-specific quantitative PCR method for genetically modified soybean A2704-12.

PubMed

Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2011-01-01

A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.

A double-label time-resolved fluorescent strip for rapidly quantitative detection of carbofuran residues in agro-products.

PubMed

Zhang, Qi; Qu, Qiaoyu; Chen, Shanshan; Liu, Xiaowei; Li, Peiwu

2017-09-15

A rapid and quantitative time-resolved fluorescent immunochromatographic assay (TRFICA) for detecting carbofuran residues in agro-products was reported in this paper. This assay was developed based on double-label immunoprobes, one of which was a carbofuran-specific antibody coupled with europium microbeads for the test (T) line signal while the other was mouse IgG coupled with europium microbeads for the control (C) line signal. Quantitative relationships between carbofuran concentrations and T/C ratios were established to determine the analyte concentration. To increase assay accuracy, four standard curves were established for the agro-products (green bean, cabbage, apple, and pear). The limits of detection (LODs) ranged from 0.04 to 0.76mgL -1 . The spiked recoveries of carbofuran in the agro-products were in the range of 81-103%, which was in good agreement with a standard HPLC method. Therefore, we provided a new and reliable method for determination of N-methylcarbamate pesticide carbofuran residues in agro-products including vegetables and fruits. Copyright © 2017. Published by Elsevier Ltd.

Validation of the Mass-Extraction-Window for Quantitative Methods Using Liquid Chromatography High Resolution Mass Spectrometry.

PubMed

Glauser, Gaétan; Grund, Baptiste; Gassner, Anne-Laure; Menin, Laure; Henry, Hugues; Bromirski, Maciej; Schütz, Frédéric; McMullen, Justin; Rochat, Bertrand

2016-03-15

A paradigm shift is underway in the field of quantitative liquid chromatography-mass spectrometry (LC-MS) analysis thanks to the arrival of recent high-resolution mass spectrometers (HRMS). The capability of HRMS to perform sensitive and reliable quantifications of a large variety of analytes in HR-full scan mode is showing that it is now realistic to perform quantitative and qualitative analysis with the same instrument. Moreover, HR-full scan acquisition offers a global view of sample extracts and allows retrospective investigations as virtually all ionized compounds are detected with a high sensitivity. In time, the versatility of HRMS together with the increasing need for relative quantification of hundreds of endogenous metabolites should promote a shift from triple-quadrupole MS to HRMS. However, a current "pitfall" in quantitative LC-HRMS analysis is the lack of HRMS-specific guidance for validated quantitative analyses. Indeed, false positive and false negative HRMS detections are rare, albeit possible, if inadequate parameters are used. Here, we investigated two key parameters for the validation of LC-HRMS quantitative analyses: the mass accuracy (MA) and the mass-extraction-window (MEW) that is used to construct the extracted-ion-chromatograms. We propose MA-parameters, graphs, and equations to calculate rational MEW width for the validation of quantitative LC-HRMS methods. MA measurements were performed on four different LC-HRMS platforms. Experimentally determined MEW values ranged between 5.6 and 16.5 ppm and depended on the HRMS platform, its working environment, the calibration procedure, and the analyte considered. The proposed procedure provides a fit-for-purpose MEW determination and prevents false detections.

Highly sensitive fluorescence quantitative detection of specific DNA sequences with molecular beacons and nucleic acid dye SYBR Green I.

PubMed

Xiang, Dongshan; Zhai, Kun; Xiang, Wenjun; Wang, Lianzhi

2014-11-01

A highly sensitive fluorescence method of quantitative detection for specific DNA sequence is developed based on molecular beacon (MB) and nucleic acid dye SYBR Green I by synchronous fluorescence analysis. It is demonstrated by an oligonucleotide sequence of wild-type HBV (target DNA) as a model system. In this strategy, the fluorophore of MB is designed to be 6-carboxyfluorescein group (FAM), and the maximum excitation wavelength and maximum emission wavelength are both very close to that of SYBR Green I. In the presence of targets DNA, the MBs hybridize with the targets DNA and form double-strand DNA (dsDNA), the fluorophore FAM is separated from the quencher BHQ-1, thus the fluorophore emit fluorescence. At the same time, SYBR Green I binds to dsDNA, the fluorescence intensity of SYBR Green I is significantly enhanced. When targets DNA are detected by synchronous fluorescence analysis, the fluorescence peaks of FAM and SYBR Green I overlap completely, so the fluorescence signal of system will be significantly enhanced. Thus, highly sensitive fluorescence quantitative detection for DNA can be realized. Under the optimum conditions, the total fluorescence intensity of FAM and SYBR Green I exhibits good linear dependence on concentration of targets DNA in the range from 2×10(-11) to 2.5×10(-9)M. The detection limit of target DNA is estimated to be 9×10(-12)M (3σ). Compared with previously reported methods of detection DNA with MB, the proposed method can significantly enhance the detection sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

Applying Quantitative Genetic Methods to Primate Social Behavior

PubMed Central

Brent, Lauren J. N.

2013-01-01

Increasingly, behavioral ecologists have applied quantitative genetic methods to investigate the evolution of behaviors in wild animal populations. The promise of quantitative genetics in unmanaged populations opens the door for simultaneous analysis of inheritance, phenotypic plasticity, and patterns of selection on behavioral phenotypes all within the same study. In this article, we describe how quantitative genetic techniques provide studies of the evolution of behavior with information that is unique and valuable. We outline technical obstacles for applying quantitative genetic techniques that are of particular relevance to studies of behavior in primates, especially those living in noncaptive populations, e.g., the need for pedigree information, non-Gaussian phenotypes, and demonstrate how many of these barriers are now surmountable. We illustrate this by applying recent quantitative genetic methods to spatial proximity data, a simple and widely collected primate social behavior, from adult rhesus macaques on Cayo Santiago. Our analysis shows that proximity measures are consistent across repeated measurements on individuals (repeatable) and that kin have similar mean measurements (heritable). Quantitative genetics may hold lessons of considerable importance for studies of primate behavior, even those without a specific genetic focus. PMID:24659839

Improved assay to detect Plasmodium falciparum using an uninterrupted, semi-nested PCR and quantitative lateral flow analysis

PubMed Central

2013-01-01

Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to < two hours. Analysis of the PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252

Sensitive and quantitative detection of botulinum neurotoxin in neurons derived from mouse embryonic stem cells.

PubMed

Pellett, Sabine; Du, Zhong-wei; Pier, Christina L; Tepp, William H; Zhang, Su-chun; Johnson, Eric A

2011-01-07

Botulinum neurotoxins (BoNTs), the most poisonous protein toxins known, represent a serious bioterrorism threat but are also used as a unique and important bio-pharmaceutical to treat an increasing myriad of neurological disorders. The only currently accepted detection method by the United States Food and Drug Administration for biological activity of BoNTs and for potency determination of pharmaceutical preparations is the mouse bioassay (MBA). Recent advances have indicated that cell-based assays using primary neuronal cells can provide an equally sensitive and robust detection platform as the MBA to reliably and quantitatively detect biologically active BoNTs. This study reports for the first time a BoNT detection assay using mouse embryonic stem cells to produce a neuronal cell culture. The data presented indicate that this assay can reliably detect BoNT/A with a similar sensitivity as the MBA. Published by Elsevier Inc.

A simple and highly sensitive colorimetric detection method for gaseous formaldehyde.

PubMed

Feng, Liang; Musto, Christopher J; Suslick, Kenneth S

2010-03-31

A colorimetric detection method using amine-functionalized polymer films doped with a pH indicator has been developed for the rapid, sensitive, and quantitative detection of gaseous formaldehyde at concentrations well below the immediately dangerous to life or health (IDLH) limit. In 1 min, visible color changes are easily observed, even down to the permissible exposure limit (PEL) at 750 ppb. The limit of detection is below 50 ppb (7% of the PEL) after 10 min of exposure. This sensor is essentially unaffected by changes in humidity or temperature (4 to 50 degrees C) and is not sensitive to common interferents.

On the detection of early osteoarthritis by quantitative microscopic imaging

NASA Astrophysics Data System (ADS)

Mittelstaedt, Daniel John

Articular cartilage is a thin layer of connective tissue that protects the ends of bones in diarthroidal joints. Cartilage distributes mechanical forces during daily movement throughout its unique depth-dependent structure. The extracellular matrix (ECM) of cartilage primarily contains water, collagen, and glycosaminoglycan (GAG). The collagen fibers are intertwined with negatively charged GAG and surround the cells (i.e. chondrocytes) in cartilage. Degradation to the ECM reduces the load bearing properties of cartilage which can be initiated by injury (e.g. anterior cruciate ligament (ACL) rupture) or disease (e.g. osteoarthritis (OA)). Magnetic resonance imaging (MRI) and x-ray computed tomography (CT) are noninvasive imaging techniques that are increasingly being used in the clinical detection of cartilage degradation. The aim of the first project in this dissertation was to quantify and compare the depth-dependent GAG concentration from healthy and biochemically degraded humeral ex vivo articular cartilage using quantitative contrast enhanced micro-computed tomography (qCECT) at high resolution. The second project in this dissertation was aimed to measure the topographical and depth-dependent GAG concentration using qCECT and delayed gadolinium enhanced magnetic resonance imaging of cartilage (dGEMRIC) from the medial tibia cartilage three weeks after unilateral ACL transection which is an animal model of OA (i.e. modified Pond-Nuki model). These GAG measurements were correlated with a biochemical method, inductively couple plasma optical emission spectrometry, to compare the degradation on the medial tibia between the OA and contralateral cartilage. The third project in this dissertation used the same cartilage specimens as in project two to investigate the change in T2 due to OA and the effect on T2 from a contrast agent. Furthermore, the change in T2 relaxation was investigated from static unconfined compression with correlations by biomechanical

Quantitative detection of RASSF1A DNA promoter methylation in tumors and serum of patients with serous epithelial ovarian cancer.

PubMed

Bondurant, Amy E; Huang, Zhiqing; Whitaker, Regina S; Simel, Lauren R; Berchuck, Andrew; Murphy, Susan K

2011-12-01

Detection of cell free tumor-specific DNA methylation has been proposed as a potentially useful noninvasive mechanism to detect malignancies, including ovarian cancer, and to monitor response to treatment. However, there are few easily implemented quantitative approaches available for DNA methylation analysis. Our objectives were to develop an absolute quantitative method for detection of DNA methylation using RASSF1A, a known target of promoter methylation in ovarian cancer, and test the ability to detect RASSF1A methylation in tumors and serum specimens of women with ovarian cancer. Bisulfite modified DNAs were subjected to real time PCR using nondiscriminatory PCR primers and a probe with sequence containing a single CpG site, theoretically able to capture the methylation status of that CpG for every allele within a given specimen. Input DNA was normalized to ACTB levels detected simultaneously by assay multiplexing. Methylation levels were established by comparison to results obtained from universally methylated DNA. The assay was able to detect one methylated RASSF1A allele in 100,000 unmethylated alleles. RASSF1A was methylated in 54 of 106 (51%) invasive serous ovarian cancers analyzed and methylation status was concordant in 20/20 matched preoperative serum-tumor pairs. Serial serum specimens taken over the course of treatment for 8 of 9 patients showed fluctuations in RASSF1A methylation concomitant with disease status. This novel assay provides a real-time PCR-based method for absolute quantitation of DNA methylation. Our results support feasibility of monitoring RASSF1A methylation from serum samples taken over the course of treatment from women with ovarian cancer. Copyright © 2011 Elsevier Inc. All rights reserved.

Waterborne Pathogens: Detection Methods and Challenges

PubMed Central

Ramírez-Castillo, Flor Yazmín; Loera-Muro, Abraham; Jacques, Mario; Garneau, Philippe; Avelar-González, Francisco Javier; Harel, Josée; Guerrero-Barrera, Alma Lilián

2015-01-01

Waterborne pathogens and related diseases are a major public health concern worldwide, not only by the morbidity and mortality that they cause, but by the high cost that represents their prevention and treatment. These diseases are directly related to environmental deterioration and pollution. Despite the continued efforts to maintain water safety, waterborne outbreaks are still reported globally. Proper assessment of pathogens on water and water quality monitoring are key factors for decision-making regarding water distribution systems’ infrastructure, the choice of best water treatment and prevention waterborne outbreaks. Powerful, sensitive and reproducible diagnostic tools are developed to monitor pathogen contamination in water and be able to detect not only cultivable pathogens but also to detect the occurrence of viable but non-culturable microorganisms as well as the presence of pathogens on biofilms. Quantitative microbial risk assessment (QMRA) is a helpful tool to evaluate the scenarios for pathogen contamination that involve surveillance, detection methods, analysis and decision-making. This review aims to present a research outlook on waterborne outbreaks that have occurred in recent years. This review also focuses in the main molecular techniques for detection of waterborne pathogens and the use of QMRA approach to protect public health. PMID:26011827

Quantitative detection of pathogens in centrifugal microfluidic disks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory Jon

A system and methods for detection of a nucleic acid including forming a plurality of nucleic acid detection complexes are described, each of the complexes including a nucleic acid analyte, a detection agent and a functionalized probe. The method further including binding the nucleic acid detection complexes to a plurality of functionalized particles in a fluid sample and separating the functionalized particles having the nucleic acid detection complexes bound thereto from the fluid sample using a density media. The nucleic acid analyte is detected by detecting the detection agent.

Detection of expression quantitative trait Loci in complex mouse crosses: impact and alleviation of data quality and complex population substructure.

PubMed

Iancu, Ovidiu D; Darakjian, Priscila; Kawane, Sunita; Bottomly, Daniel; Hitzemann, Robert; McWeeney, Shannon

2012-01-01

Complex Mus musculus crosses, e.g., heterogeneous stock (HS), provide increased resolution for quantitative trait loci detection. However, increased genetic complexity challenges detection methods, with discordant results due to low data quality or complex genetic architecture. We quantified the impact of theses factors across three mouse crosses and two different detection methods, identifying procedures that greatly improve detection quality. Importantly, HS populations have complex genetic architectures not fully captured by the whole genome kinship matrix, calling for incorporating chromosome specific relatedness information. We analyze three increasingly complex crosses, using gene expression levels as quantitative traits. The three crosses were an F(2) intercross, a HS formed by crossing four inbred strains (HS4), and a HS (HS-CC) derived from the eight lines found in the collaborative cross. Brain (striatum) gene expression and genotype data were obtained using the Illumina platform. We found large disparities between methods, with concordance varying as genetic complexity increased; this problem was more acute for probes with distant regulatory elements (trans). A suite of data filtering steps resulted in substantial increases in reproducibility. Genetic relatedness between samples generated overabundance of detected eQTLs; an adjustment procedure that includes the kinship matrix attenuates this problem. However, we find that relatedness between individuals is not evenly distributed across the genome; information from distinct chromosomes results in relatedness structure different from the whole genome kinship matrix. Shared polymorphisms from distinct chromosomes collectively affect expression levels, confounding eQTL detection. We suggest that considering chromosome specific relatedness can result in improved eQTL detection.

Sequential (step-by-step) detection, identification and quantitation of extra virgin olive oil adulteration by chemometric treatment of chromatographic profiles.

PubMed

Capote, F Priego; Jiménez, J Ruiz; de Castro, M D Luque

2007-08-01

An analytical method for the sequential detection, identification and quantitation of extra virgin olive oil adulteration with four edible vegetable oils--sunflower, corn, peanut and coconut oils--is proposed. The only data required for this method are the results obtained from an analysis of the lipid fraction by gas chromatography-mass spectrometry. A total number of 566 samples (pure oils and samples of adulterated olive oil) were used to develop the chemometric models, which were designed to accomplish, step-by-step, the three aims of the method: to detect whether an olive oil sample is adulterated, to identify the type of adulterant used in the fraud, and to determine how much aldulterant is in the sample. Qualitative analysis was carried out via two chemometric approaches--soft independent modelling of class analogy (SIMCA) and K nearest neighbours (KNN)--both approaches exhibited prediction abilities that were always higher than 91% for adulterant detection and 88% for type of adulterant identification. Quantitative analysis was based on partial least squares regression (PLSR), which yielded R2 values of >0.90 for calibration and validation sets and thus made it possible to determine adulteration with excellent precision according to the Shenk criteria.

Detection of Mycobacterium avium subsp. paratuberculosis in Drinking Water and Biofilms by Quantitative PCR ▿ †

PubMed Central

Beumer, Amy; King, Dawn; Donohue, Maura; Mistry, Jatin; Covert, Terry; Pfaller, Stacy

2010-01-01

It has been suggested that Mycobacterium avium subspecies paratuberculosis has a role in Crohn's disease. The organism may be acquired but is difficult to culture from the environment. We describe a quantitative PCR (qPCR) method to detect M. avium subsp. paratuberculosis in drinking water and the results of its application to drinking water and faucet biofilm samples collected in the United States. PMID:20817803

Cellular phone-based image acquisition and quantitative ratiometric method for detecting cocaine and benzoylecgonine for biological and forensic applications.

PubMed

Cadle, Brian A; Rasmus, Kristin C; Varela, Juan A; Leverich, Leah S; O'Neill, Casey E; Bachtell, Ryan K; Cooper, Donald C

2010-01-01

Here we describe the first report of using low-cost cellular or web-based digital cameras to image and quantify standardized rapid immunoassay strips as a new point-of-care diagnostic and forensics tool with health applications. Quantitative ratiometric pixel density analysis (QRPDA) is an automated method requiring end-users to utilize inexpensive (∼ $1 USD/each) immunotest strips, a commonly available web or mobile phone camera or scanner, and internet or cellular service. A model is described whereby a central computer server and freely available IMAGEJ image analysis software records and analyzes the incoming image data with time-stamp and geo-tag information and performs the QRPDA using custom JAVA based macros (http://www.neurocloud.org). To demonstrate QRPDA we developed a standardized method using rapid immunotest strips directed against cocaine and its major metabolite, benzoylecgonine. Images from standardized samples were acquired using several devices, including a mobile phone camera, web cam, and scanner. We performed image analysis of three brands of commercially available dye-conjugated anti-cocaine/benzoylecgonine (COC/BE) antibody test strips in response to three different series of cocaine concentrations ranging from 0.1 to 300 ng/ml and BE concentrations ranging from 0.003 to 0.1 ng/ml. This data was then used to create standard curves to allow quantification of COC/BE in biological samples. Across all devices, QRPDA quantification of COC and BE proved to be a sensitive, economical, and faster alternative to more costly methods, such as gas chromatography-mass spectrometry, tandem mass spectrometry, or high pressure liquid chromatography. The limit of detection was determined to be between 0.1 and 5 ng/ml. To simulate conditions in the field, QRPDA was found to be robust under a variety of image acquisition and testing conditions that varied temperature, lighting, resolution, magnification and concentrations of biological fluid in a sample. To

Targeted methods for quantitative analysis of protein glycosylation

PubMed Central

Goldman, Radoslav; Sanda, Miloslav

2018-01-01

Quantification of proteins by LC-MS/MS-MRM has become a standard method with broad projected clinical applicability. MRM quantification of protein modifications is, however, far less utilized, especially in the case of glycoproteins. This review summarizes current methods for quantitative analysis of protein glycosylation with a focus on MRM methods. We describe advantages of this quantitative approach, analytical parameters that need to be optimized to achieve reliable measurements, and point out the limitations. Differences between major classes of N- and O-glycopeptides are described and class-specific glycopeptide assays are demonstrated. PMID:25522218

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Automated detection of hospital outbreaks: A systematic review of methods

PubMed Central

Buckeridge, David L.; Lepelletier, Didier

2017-01-01

Objectives Several automated algorithms for epidemiological surveillance in hospitals have been proposed. However, the usefulness of these methods to detect nosocomial outbreaks remains unclear. The goal of this review was to describe outbreak detection algorithms that have been tested within hospitals, consider how they were evaluated, and synthesize their results. Methods We developed a search query using keywords associated with hospital outbreak detection and searched the MEDLINE database. To ensure the highest sensitivity, no limitations were initially imposed on publication languages and dates, although we subsequently excluded studies published before 2000. Every study that described a method to detect outbreaks within hospitals was included, without any exclusion based on study design. Additional studies were identified through citations in retrieved studies. Results Twenty-nine studies were included. The detection algorithms were grouped into 5 categories: simple thresholds (n = 6), statistical process control (n = 12), scan statistics (n = 6), traditional statistical models (n = 6), and data mining methods (n = 4). The evaluation of the algorithms was often solely descriptive (n = 15), but more complex epidemiological criteria were also investigated (n = 10). The performance measures varied widely between studies: e.g., the sensitivity of an algorithm in a real world setting could vary between 17 and 100%. Conclusion Even if outbreak detection algorithms are useful complementary tools for traditional surveillance, the heterogeneity in results among published studies does not support quantitative synthesis of their performance. A standardized framework should be followed when evaluating outbreak detection methods to allow comparison of algorithms across studies and synthesis of results. PMID:28441422

Validation of a Spectral Method for Quantitative Measurement of Color in Protein Drug Solutions.

PubMed

Yin, Jian; Swartz, Trevor E; Zhang, Jian; Patapoff, Thomas W; Chen, Bartolo; Marhoul, Joseph; Shih, Norman; Kabakoff, Bruce; Rahimi, Kimia

2016-01-01

A quantitative spectral method has been developed to precisely measure the color of protein solutions. In this method, a spectrophotometer is utilized for capturing the visible absorption spectrum of a protein solution, which can then be converted to color values (L*a*b*) that represent human perception of color in a quantitative three-dimensional space. These quantitative values (L*a*b*) allow for calculating the best match of a sample's color to a European Pharmacopoeia reference color solution. In order to qualify this instrument and assay for use in clinical quality control, a technical assessment was conducted to evaluate the assay suitability and precision. Setting acceptance criteria for this study required development and implementation of a unique statistical method for assessing precision in 3-dimensional space. Different instruments, cuvettes, protein solutions, and analysts were compared in this study. The instrument accuracy, repeatability, and assay precision were determined. The instrument and assay are found suitable for use in assessing color of drug substances and drug products and is comparable to the current European Pharmacopoeia visual assessment method. In the biotechnology industry, a visual assessment is the most commonly used method for color characterization, batch release, and stability testing of liquid protein drug solutions. Using this method, an analyst visually determines the color of the sample by choosing the closest match to a standard color series. This visual method can be subjective because it requires an analyst to make a judgment of the best match of color of the sample to the standard color series, and it does not capture data on hue and chroma that would allow for improved product characterization and the ability to detect subtle differences between samples. To overcome these challenges, we developed a quantitative spectral method for color determination that greatly reduces the variability in measuring color and allows

Portable and sensitive quantitative detection of DNA based on personal glucose meters and isothermal circular strand-displacement polymerization reaction.

PubMed

Xu, Xue-tao; Liang, Kai-yi; Zeng, Jia-ying

2015-02-15

A portable and sensitive quantitative DNA detection method based on personal glucose meters and isothermal circular strand-displacement polymerization reaction was developed. The target DNA triggered target recycling process, which opened capture DNA. The released target then found another capture DNA to trigger another polymerization cycle, which was repeated for many rounds, resulting in the multiplication of the DNA-invertase conjugation on the surface of Streptavidin-MNBs. The DNA-invertase was used to catalyze the hydrolysis of sucrose into glucose for PGM readout. There was a liner relationship between the signal of PGM and the concentration of target DNA in the range of 5.0 to 1000 fM, which is lower than some DNA detection method. In addition, the method exhibited excellent sequence selectivity and there was almost no effect of biological complex to the detection performance, which suggested our method can be successfully applied to DNA detection in real biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.

A volumetric meter chip for point-of-care quantitative detection of bovine catalase for food safety control.

PubMed

Cui, Xingye; Hu, Jie; Choi, Jane Ru; Huang, Yalin; Wang, Xuemin; Lu, Tian Jian; Xu, Feng

2016-09-07

A volumetric meter chip was developed for quantitative point-of-care (POC) analysis of bovine catalase, a bioindicator of bovine mastitis, in milk samples. The meter chip displays multiplexed quantitative results by presenting the distance of ink bar advancement that is detectable by the naked eye. The meter chip comprises a poly(methyl methacrylate) (PMMA) layer, a double-sided adhesive (DSA) layer and a glass slide layer fabricated by the laser-etching method, which is typically simple, rapid (∼3 min per chip), and cost effective (∼$0.2 per chip). Specially designed "U shape" reaction cells are covered by an adhesive tape that serves as an on-off switch, enabling the simple operation of the assay. As a proof of concept, we employed the developed meter chip for the quantification of bovine catalase in raw milk samples to detect catalase concentrations as low as 20 μg/mL. The meter chip has great potential to detect various target analytes for a wide range of POC applications. Copyright © 2016 Elsevier B.V. All rights reserved.

Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

PubMed

Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

2012-04-27

To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions.

PubMed

Belmonte, Frances R; Martin, James L; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A; Kaufman, Brett A

2016-04-28

Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error.

Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions

PubMed Central

Belmonte, Frances R.; Martin, James L.; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A.; Kaufman, Brett A.

2016-01-01

Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error. PMID:27122135

Revisiting the Quantitative-Qualitative Debate: Implications for Mixed-Methods Research

PubMed Central

SALE, JOANNA E. M.; LOHFELD, LYNNE H.; BRAZIL, KEVIN

2015-01-01

Health care research includes many studies that combine quantitative and qualitative methods. In this paper, we revisit the quantitative-qualitative debate and review the arguments for and against using mixed-methods. In addition, we discuss the implications stemming from our view, that the paradigms upon which the methods are based have a different view of reality and therefore a different view of the phenomenon under study. Because the two paradigms do not study the same phenomena, quantitative and qualitative methods cannot be combined for cross-validation or triangulation purposes. However, they can be combined for complementary purposes. Future standards for mixed-methods research should clearly reflect this recommendation. PMID:26523073

Establishment of analysis method for methane detection by gas chromatography

NASA Astrophysics Data System (ADS)

Liu, Xinyuan; Yang, Jie; Ye, Tianyi; Han, Zeyu

2018-02-01

The study focused on the establishment of analysis method for methane determination by gas chromatography. Methane was detected by hydrogen flame ionization detector, and the quantitative relationship was determined by working curve of y=2041.2x+2187 with correlation coefficient of 0.9979. The relative standard deviation of 2.60-6.33% and the recovery rate of 96.36%∼105.89% were obtained during the parallel determination of standard gas. This method was not quite suitable for biogas content analysis because methane content in biogas would be over the measurement range in this method.

MethylMeter(®): bisulfite-free quantitative and sensitive DNA methylation profiling and mutation detection in FFPE samples.

PubMed

McCarthy, David; Pulverer, Walter; Weinhaeusel, Andreas; Diago, Oscar R; Hogan, Daniel J; Ostertag, Derek; Hanna, Michelle M

2016-06-01

Development of a sensitive method for DNA methylation profiling and associated mutation detection in clinical samples. Formalin-fixed and paraffin-embedded tumors received by clinical laboratories often contain insufficient DNA for analysis with bisulfite or methylation sensitive restriction enzymes-based methods. To increase sensitivity, methyl-CpG DNA capture and Coupled Abscription PCR Signaling detection were combined in a new assay, MethylMeter(®). Gliomas were analyzed for MGMT methylation, glioma CpG island methylator phenotype and IDH1 R132H. MethylMeter had 100% assay success rate measuring all five biomarkers in formalin-fixed and paraffin-embedded tissue. MGMT methylation results were supported by survival and mRNA expression data. MethylMeter is a sensitive and quantitative method for multitarget DNA methylation profiling and associated mutation detection. The MethylMeter-based GliomaSTRAT assay measures methylation of four targets and one mutation to simultaneously grade gliomas and predict their response to temozolomide. This information is clinically valuable in management of gliomas.

A triplex quantitative real-time PCR assay for differential detection of human adenovirus serotypes 2, 3 and 7.

PubMed

Qiu, Fang-Zhou; Shen, Xin-Xin; Zhao, Meng-Chuan; Zhao, Li; Duan, Su-Xia; Chen, Chen; Qi, Ju-Ju; Li, Gui-Xia; Wang, Le; Feng, Zhi-Shan; Ma, Xue-Jun

2018-05-02

Human adenovirus (HAdV) serotypes 2, 3 and 7 are more prevalent than other serotypes and have been associated with severe pneumonia in pediatric children. Molecular typing of HAdV is not routinely performed in clinical diagnostic laboratories as it is time-consuming and labor-intensive. In the present study, we developed a triplex quantitative real-time PCR assay (tq-PCR) in a single closed tube for differential detection and quantitative analysis of HAdV serotypes 2, 3 and 7. The sensitivity, specificity, reproducibility and clinical performance of tq-PCR were evaluated. The analytical sensitivity of the tq-PCR was 100 copies/reaction for each of HAdV serotypes 2, 3 and 7, and no cross-reaction with other common respiratory viruses or HAdV serotypes 1,4,5,6,31,55 and 57 was observed. The coefficients of variation (CV) of intra-assay and inter-assay were between 0.6% to 3.6%. Of 138 previously-defined HAdV-positive nasopharyngeal aspirates samples tested, the detection agreement between tq-PCR and nested PCR was 96.38% (133/138). The proposed tq-PCR assay is a sensitive, specific and reproducible method and has the potential for clinical use in the rapid and differential detection and quantitation of HAdV serotypes 2, 3 and 7.

Mathematical modelling and quantitative methods.

PubMed

Edler, L; Poirier, K; Dourson, M; Kleiner, J; Mileson, B; Nordmann, H; Renwick, A; Slob, W; Walton, K; Würtzen, G

2002-01-01

The present review reports on the mathematical methods and statistical techniques presently available for hazard characterisation. The state of the art of mathematical modelling and quantitative methods used currently for regulatory decision-making in Europe and additional potential methods for risk assessment of chemicals in food and diet are described. Existing practices of JECFA, FDA, EPA, etc., are examined for their similarities and differences. A framework is established for the development of new and improved quantitative methodologies. Areas for refinement, improvement and increase of efficiency of each method are identified in a gap analysis. Based on this critical evaluation, needs for future research are defined. It is concluded from our work that mathematical modelling of the dose-response relationship would improve the risk assessment process. An adequate characterisation of the dose-response relationship by mathematical modelling clearly requires the use of a sufficient number of dose groups to achieve a range of different response levels. This need not necessarily lead to an increase in the total number of animals in the study if an appropriate design is used. Chemical-specific data relating to the mode or mechanism of action and/or the toxicokinetics of the chemical should be used for dose-response characterisation whenever possible. It is concluded that a single method of hazard characterisation would not be suitable for all kinds of risk assessments, and that a range of different approaches is necessary so that the method used is the most appropriate for the data available and for the risk characterisation issue. Future refinements to dose-response characterisation should incorporate more clearly the extent of uncertainty and variability in the resulting output.

Highly sensitive and quantitative detection of rare pathogens through agarose droplet microfluidic emulsion PCR at the single-cell level.

PubMed

Zhu, Zhi; Zhang, Wenhua; Leng, Xuefei; Zhang, Mingxia; Guan, Zhichao; Lu, Jiangquan; Yang, Chaoyong James

2012-10-21

Genetic alternations can serve as highly specific biomarkers to distinguish fatal bacteria or cancer cells from their normal counterparts. However, these mutations normally exist in very rare amount in the presence of a large excess of non-mutated analogs. Taking the notorious pathogen E. coli O157:H7 as the target analyte, we have developed an agarose droplet-based microfluidic ePCR method for highly sensitive, specific and quantitative detection of rare pathogens in the high background of normal bacteria. Massively parallel singleplex and multiplex PCR at the single-cell level in agarose droplets have been successfully established. Moreover, we challenged the system with rare pathogen detection and realized the sensitive and quantitative analysis of a single E. coli O157:H7 cell in the high background of 100,000 excess normal K12 cells. For the first time, we demonstrated rare pathogen detection through agarose droplet microfluidic ePCR. Such a multiplex single-cell agarose droplet amplification method enables ultra-high throughput and multi-parameter genetic analysis of large population of cells at the single-cell level to uncover the stochastic variations in biological systems.

Comparison of sampling methods for the detection of human rhinovirus RNA.

PubMed

Waris, Matti; Österback, Riikka; Lahti, Elina; Vuorinen, Tytti; Ruuskanen, Olli; Peltola, Ville

2013-09-01

Obtaining a nasal swab (NS) from a child for human rhinovirus (HRV) RNA detection is simple and well tolerated even for repeated sampling, but only few studies have compared them qualitatively and quantitatively with other sampling methods. Real-time PCR was used to study the stability of HRV genomes in swabs, and to compare different swabs and induced sputum specimens with nasopharyngeal aspirates (NPAs). Replicate swabs in a dry test tube were stored at room temperature or mailed to the laboratory before freezing, and compared to freshly frozen specimens. To compare sampling methods, paediatric patients had NPA, NS and throat swab collected. In paired sputum and NPA specimens, viral load was correlated to the amount of β-actin mRNA. Specimens were stable at room temperature for at least 4 days and survived mailing without loss of HRV detectability. As compared to NPA, NS had an equal diagnostic sensitivity, with no significant quantitative difference using flocked nylon swabs and a 2.2-fold drop in the average copy number using cotton swabs. The diagnostic sensitivity of cotton swab-collected throat specimens was 97%, with a 26-fold lower mean copy number. Sputum specimens had higher HRV RNA (2.3-fold) and β-actin mRNA (1.6-fold) copy numbers than NPAs, but there was a poor correlation between HRV RNA and β-actin mRNA. HRV remains well detectable by PCR in specimens mailed to the laboratory. The diagnostic efficacy of NPA can be obtained with NS, quantitative comparison and patient comfort favouring flocked nylon-tipped over cotton-tipped swabs. Copyright © 2013 Elsevier B.V. All rights reserved.

Culture-free, highly sensitive, quantitative detection of bacteria from minimally processed samples using fluorescence imaging by smartphone.

PubMed

Shrivastava, Sajal; Lee, Won-Il; Lee, Nae-Eung

2018-06-30

A critical unmet need in the diagnosis of bacterial infections, which remain a major cause of human morbidity and mortality, is the detection of scarce bacterial pathogens in a variety of samples in a rapid and quantitative manner. Herein, we demonstrate smartphone-based detection of Staphylococcus aureus in a culture-free, rapid, quantitative manner from minimally processed liquid samples using aptamer-functionalized fluorescent magnetic nanoparticles. The tagged S. aureus cells were magnetically captured in a detection cassette, and then fluorescence was imaged using a smartphone camera with a light-emitting diode as the excitation source. Our results showed quantitative detection capability with a minimum detectable concentration as low as 10 cfu/ml by counting individual bacteria cells, efficiently capturing S. aureus cells directly from a peanut milk sample within 10 min. When the selectivity of detection was investigated using samples spiked with other pathogenic bacteria, no significant non-specific detection occurred. Furthermore, strains of S. aureus from various origins showed comparable results, ensuring that the approach can be widely adopted. Therefore, the quantitative fluorescence imaging platform on a smartphone could allow on-site detection of bacteria, providing great potential assistance during major infectious disease outbreaks in remote and resource-limited settings. Copyright © 2018 Elsevier B.V. All rights reserved.

MethylMeter®: bisulfite-free quantitative and sensitive DNA methylation profiling and mutation detection in FFPE samples

PubMed Central

McCarthy, David; Pulverer, Walter; Weinhaeusel, Andreas; Diago, Oscar R; Hogan, Daniel J; Ostertag, Derek; Hanna, Michelle M

2016-01-01

Aim: Development of a sensitive method for DNA methylation profiling and associated mutation detection in clinical samples. Materials & methods: Formalin-fixed and paraffin-embedded tumors received by clinical laboratories often contain insufficient DNA for analysis with bisulfite or methylation sensitive restriction enzymes-based methods. To increase sensitivity, methyl-CpG DNA capture and Coupled Abscription PCR Signaling detection were combined in a new assay, MethylMeter®. Gliomas were analyzed for MGMT methylation, glioma CpG island methylator phenotype and IDH1 R132H. Results: MethylMeter had 100% assay success rate measuring all five biomarkers in formalin-fixed and paraffin-embedded tissue. MGMT methylation results were supported by survival and mRNA expression data. Conclusion: MethylMeter is a sensitive and quantitative method for multitarget DNA methylation profiling and associated mutation detection. The MethylMeter-based GliomaSTRAT assay measures methylation of four targets and one mutation to simultaneously grade gliomas and predict their response to temozolomide. This information is clinically valuable in management of gliomas. PMID:27337298

Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods.

PubMed

Seo, K H; Valentin-Bon, I E; Brackett, R E

2006-03-01

Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.

Automated detection of hospital outbreaks: A systematic review of methods.

PubMed

Leclère, Brice; Buckeridge, David L; Boëlle, Pierre-Yves; Astagneau, Pascal; Lepelletier, Didier

2017-01-01

Several automated algorithms for epidemiological surveillance in hospitals have been proposed. However, the usefulness of these methods to detect nosocomial outbreaks remains unclear. The goal of this review was to describe outbreak detection algorithms that have been tested within hospitals, consider how they were evaluated, and synthesize their results. We developed a search query using keywords associated with hospital outbreak detection and searched the MEDLINE database. To ensure the highest sensitivity, no limitations were initially imposed on publication languages and dates, although we subsequently excluded studies published before 2000. Every study that described a method to detect outbreaks within hospitals was included, without any exclusion based on study design. Additional studies were identified through citations in retrieved studies. Twenty-nine studies were included. The detection algorithms were grouped into 5 categories: simple thresholds (n = 6), statistical process control (n = 12), scan statistics (n = 6), traditional statistical models (n = 6), and data mining methods (n = 4). The evaluation of the algorithms was often solely descriptive (n = 15), but more complex epidemiological criteria were also investigated (n = 10). The performance measures varied widely between studies: e.g., the sensitivity of an algorithm in a real world setting could vary between 17 and 100%. Even if outbreak detection algorithms are useful complementary tools for traditional surveillance, the heterogeneity in results among published studies does not support quantitative synthesis of their performance. A standardized framework should be followed when evaluating outbreak detection methods to allow comparison of algorithms across studies and synthesis of results.

An Quantitative Analysis Method Of Trabecular Pattern In A Bone

NASA Astrophysics Data System (ADS)

Idesawa, Masanor; Yatagai, Toyohiko

1982-11-01

Orientation and density of trabecular pattern observed in a bone is closely related to its mechanical properties and deseases of a bone are appeared as changes of orientation and/or density distrbution of its trabecular patterns. They have been treated from a qualitative point of view so far because quantitative analysis method has not be established. In this paper, the authors proposed and investigated some quantitative analysis methods of density and orientation of trabecular patterns observed in a bone. These methods can give an index for evaluating orientation of trabecular pattern quantitatively and have been applied to analyze trabecular pattern observed in a head of femur and their availabilities are confirmed. Key Words: Index of pattern orientation, Trabecular pattern, Pattern density, Quantitative analysis

Detection of Head and Neck Cancer in Surgical Specimens Using Quantitative Hyperspectral Imaging.

PubMed

Lu, Guolan; Little, James V; Wang, Xu; Zhang, Hongzheng; Patel, Mihir R; Griffith, Christopher C; El-Deiry, Mark W; Chen, Amy Y; Fei, Baowei

2017-09-15

Purpose: This study intends to investigate the feasibility of using hyperspectral imaging (HSI) to detect and delineate cancers in fresh, surgical specimens of patients with head and neck cancers. Experimental Design: A clinical study was conducted in order to collect and image fresh, surgical specimens from patients ( N = 36) with head and neck cancers undergoing surgical resection. A set of machine-learning tools were developed to quantify hyperspectral images of the resected tissue in order to detect and delineate cancerous regions which were validated by histopathologic diagnosis. More than two million reflectance spectral signatures were obtained by HSI and analyzed using machine-learning methods. The detection results of HSI were compared with autofluorescence imaging and fluorescence imaging of two vital-dyes of the same specimens. Results: Quantitative HSI differentiated cancerous tissue from normal tissue in ex vivo surgical specimens with a sensitivity and specificity of 91% and 91%, respectively, and which was more accurate than autofluorescence imaging ( P < 0.05) or fluorescence imaging of 2-NBDG ( P < 0.05) and proflavine ( P < 0.05). The proposed quantification tools also generated cancer probability maps with the tumor border demarcated and which could provide real-time guidance for surgeons regarding optimal tumor resection. Conclusions: This study highlights the feasibility of using quantitative HSI as a diagnostic tool to delineate the cancer boundaries in surgical specimens, and which could be translated into the clinic application with the hope of improving clinical outcomes in the future. Clin Cancer Res; 23(18); 5426-36. ©2017 AACR . ©2017 American Association for Cancer Research.

Quantitative thermal sensory testing -- value of testing for both cold and warm sensation detection in evaluation of small fiber neuropathy.

PubMed

Shukla, Garima; Bhatia, Manvir; Behari, Madhuri

2005-10-01

Small fiber neuropathy is a common neurological disorder, often missed or ignored by physicians, since examination and routine nerve conduction studies are usually normal in this condition. Many methods including quantitative thermal sensory testing are currently being used for early detection of this condition, so as to enable timely investigation and treatment. This study was conducted to assess the yield of quantitative thermal sensory testing in diagnosis of small fiber neuropathy. We included patients presenting with history suggestive of positive and/or negative sensory symptoms, with normal examination findings, clinically suggestive of small fiber neuropathy, with normal or minimally abnormal routine nerve conduction studies. These patients were subjected to quantitative thermal sensory testing using a Medoc TSA-II Neurosensory analyser at two sites and for two modalities. QST data were compared with those in 120 normal healthy controls. Twenty-five patients (16 males, 9 females) with mean age 46.8+/-16.6 years (range: 21-75 years) were included in the study. The mean duration of symptoms was 1.6+/-1.6 years (range: 3 months-6 years). Eighteen patients (72%) had abnormal thresholds in at least one modality. Thermal thresholds were normal in 7 out of the 25 patients. This study demonstrates that quantitative thermal sensory testing is a fairly sensitive method for detection of small fiber neuropathy especially in patients with normal routine nerve conduction studies.

Quantitative analysis of ginger components in commercial products using liquid chromatography with electrochemical array detection

PubMed Central

Shao, Xi; Lv, Lishuang; Parks, Tiffany; Wu, Hou; Ho, Chi-Tang; Sang, Shengmin

2010-01-01

For the first time, a sensitive reversed-phase HPLC electrochemical array method has been developed for the quantitative analysis of eight major ginger components ([6]-, [8]-, and [10]-gingerol, [6]-, [8]-, and [10]-shogaol, [6]-paradol, and [1]-dehydrogingerdione) in eleven ginger-containing commercial products. This method was valid with unrivaled sensitivity as low as 7.3 – 20.2 pg of limit of detection and a range of 14.5 to 40.4 pg of limit of quantification. Using this method, we quantified the levels of eight ginger components in eleven different commercial products. Our results found that both levels and ratios among the eight compounds vary greatly in commercial products. PMID:21090746

Quantitative Detection of Trace Malachite Green in Aquiculture Water Samples by Extractive Electrospray Ionization Mass Spectrometry

PubMed Central

Fang, Xiaowei; Yang, Shuiping; Chingin, Konstantin; Zhu, Liang; Zhang, Xinglei; Zhou, Zhiquan; Zhao, Zhanfeng

2016-01-01

Exposure to malachite green (MG) may pose great health risks to humans; thus, it is of prime importance to develop fast and robust methods to quantitatively screen the presence of malachite green in water. Herein the application of extractive electrospray ionization mass spectrometry (EESI-MS) has been extended to the trace detection of MG within lake water and aquiculture water, due to the intensive use of MG as a biocide in fisheries. This method has the advantage of obviating offline liquid-liquid extraction or tedious matrix separation prior to the measurement of malachite green in native aqueous medium. The experimental results indicate that the extrapolated detection limit for MG was ~3.8 μg·L−1 (S/N = 3) in lake water samples and ~0.5 μg·L−1 in ultrapure water under optimized experimental conditions. The signal intensity of MG showed good linearity over the concentration range of 10–1000 μg·L−1. Measurement of practical water samples fortified with MG at 0.01, 0.1 and 1.0 mg·L−1 gave a good validation of the established calibration curve. The average recoveries and relative standard deviation (RSD) of malachite green in lake water and Carassius carassius fish farm effluent water were 115% (6.64% RSD), 85.4% (9.17% RSD) and 96.0% (7.44% RSD), respectively. Overall, the established EESI-MS/MS method has been demonstrated suitable for sensitive and rapid (<2 min per sample) quantitative detection of malachite green in various aqueous media, indicating its potential for online real-time monitoring of real life samples. PMID:27529262

Quantitative Detection of Trace Malachite Green in Aquiculture Water Samples by Extractive Electrospray Ionization Mass Spectrometry.

PubMed

Fang, Xiaowei; Yang, Shuiping; Chingin, Konstantin; Zhu, Liang; Zhang, Xinglei; Zhou, Zhiquan; Zhao, Zhanfeng

2016-08-11

Exposure to malachite green (MG) may pose great health risks to humans; thus, it is of prime importance to develop fast and robust methods to quantitatively screen the presence of malachite green in water. Herein the application of extractive electrospray ionization mass spectrometry (EESI-MS) has been extended to the trace detection of MG within lake water and aquiculture water, due to the intensive use of MG as a biocide in fisheries. This method has the advantage of obviating offline liquid-liquid extraction or tedious matrix separation prior to the measurement of malachite green in native aqueous medium. The experimental results indicate that the extrapolated detection limit for MG was ~3.8 μg·L(-1) (S/N = 3) in lake water samples and ~0.5 μg·L(-1) in ultrapure water under optimized experimental conditions. The signal intensity of MG showed good linearity over the concentration range of 10-1000 μg·L(-1). Measurement of practical water samples fortified with MG at 0.01, 0.1 and 1.0 mg·L(-1) gave a good validation of the established calibration curve. The average recoveries and relative standard deviation (RSD) of malachite green in lake water and Carassius carassius fish farm effluent water were 115% (6.64% RSD), 85.4% (9.17% RSD) and 96.0% (7.44% RSD), respectively. Overall, the established EESI-MS/MS method has been demonstrated suitable for sensitive and rapid (<2 min per sample) quantitative detection of malachite green in various aqueous media, indicating its potential for online real-time monitoring of real life samples.

A competitive chemiluminescence enzyme immunoassay method for β-defensin-2 detection in transgenic mice.

PubMed

Yang, Xi; Zhou, Tao; Yu, Lei; Tan, Wenwen; Zhou, Rui; Hu, Yonggang

2015-03-01

A competitive chemiluminescence enzyme immunoassay (CLEIA) method for porcine β-defensin-2 (pBD-2) detection in transgenic mice was established. Several factors that affect detection, including luminol, p-iodophenol and hydrogen peroxide concentrations, as well as pH, were studied and optimized. The linear range of the proposed method for pBD-2 detection under optimal conditions was 0.05-80 ng/mL with a correlation coefficient of 0.9960. Eleven detections of a 30 ng/mL pBD-2 standard sample were performed. Reproducible results were obtained with a relative standard deviation of 3.94%. The limit of detection of the method for pBD-2 was 3.5 pg/mL (3σ). The proposed method was applied to determine pBD-2 expression levels in the tissues of pBD-2 transgenic mice, and compared with LC-MS/MS and quantitative real-time reverse-transcriptase polymerase chain reaction. This suggests that the CLEIA can be used as a valuable method to detect and quantify pBD-2. Copyright © 2014 John Wiley & Sons, Ltd.

Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

PubMed

Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

2005-11-30

Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

Optimal Hotspots of Dynamic Surfaced-Enhanced Raman Spectroscopy for Drugs Quantitative Detection.

PubMed

Yan, Xiunan; Li, Pan; Zhou, Binbin; Tang, Xianghu; Li, Xiaoyun; Weng, Shizhuang; Yang, Liangbao; Liu, Jinhuai

2017-05-02

Surface-enhanced Raman spectroscopy (SERS) as a powerful qualitative analysis method has been widely applied in many fields. However, SERS for quantitative analysis still suffers from several challenges partially because of the absence of stable and credible analytical strategy. Here, we demonstrate that the optimal hotspots created from dynamic surfaced-enhanced Raman spectroscopy (D-SERS) can be used for quantitative SERS measurements. In situ small-angle X-ray scattering was carried out to in situ real-time monitor the formation of the optimal hotspots, where the optimal hotspots with the most efficient hotspots were generated during the monodisperse Au-sol evaporating process. Importantly, the natural evaporation of Au-sol avoids the nanoparticles instability of salt-induced, and formation of ordered three-dimensional hotspots allows SERS detection with excellent reproducibility. Considering SERS signal variability in the D-SERS process, 4-mercaptopyridine (4-mpy) acted as internal standard to validly correct and improve stability as well as reduce fluctuation of signals. The strongest SERS spectra at the optimal hotspots of D-SERS have been extracted to statistics analysis. By using the SERS signal of 4-mpy as a stable internal calibration standard, the relative SERS intensity of target molecules demonstrated a linear response versus the negative logarithm of concentrations at the point of strongest SERS signals, which illustrates the great potential for quantitative analysis. The public drugs 3,4-methylenedioxymethamphetamine and α-methyltryptamine hydrochloride obtained precise analysis with internal standard D-SERS strategy. As a consequence, one has reason to believe our approach is promising to challenge quantitative problems in conventional SERS analysis.

Low angle light scattering analysis: a novel quantitative method for functional characterization of human and murine platelet receptors.

PubMed

Mindukshev, Igor; Gambaryan, Stepan; Kehrer, Linda; Schuetz, Claudia; Kobsar, Anna; Rukoyatkina, Natalia; Nikolaev, Viacheslav O; Krivchenko, Alexander; Watson, Steve P; Walter, Ulrich; Geiger, Joerg

2012-07-01

Determinations of platelet receptor functions are indispensable diagnostic indicators of cardiovascular and hemostatic diseases including hereditary and acquired receptor defects and receptor responses to drugs. However, presently available techniques for assessing platelet function have some disadvantages, such as low sensitivity and the requirement of large sample sizes and unphysiologically high agonist concentrations. Our goal was to develop and initially characterize a new technique designed to quantitatively analyze platelet receptor activation and platelet function on the basis of measuring changes in low angle light scattering. We developed a novel technique based on low angle light scattering registering changes in light scattering at a range of different angles in platelet suspensions during activation. The method proved to be highly sensitive for simultaneous real time detection of changes in size and shape of platelets during activation. Unlike commonly-used methods, the light scattering method could detect platelet shape change and aggregation in response to nanomolar concentrations of extracellular nucleotides. Furthermore, our results demonstrate that the advantages of the light scattering method make it a choice method for platelet receptor monitoring and for investigation of both murine and human platelets in disease models. Our data demonstrate the suitability and superiority of this new low angle light scattering method for comprehensive analyses of platelet receptors and functions. This highly sensitive, quantitative, and online detection of essential physiological, pathophysiological and pharmacological-response properties of human and mouse platelets is a significant improvement over conventional techniques.

Quantitative multiplex detection of biomarkers on a waveguide-based biosensor using quantum dots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Hongzhi; Mukundan, Harshini; Martinez, Jennifer S

2009-01-01

multiple color imaging of live cells using QD-bioconjugates [Jaiswal 2003]. Gao [Gao 2004] and So [So 2006] have used QDs as probes for in-vivo cancer targeting and imaging. Medintz et al. reported self-assembled QD-based biosensors for detection of analytes based on energy transfer [Medintz 2003]. Others have developed an approach for multiplex optical encoding of biomolecules using QDs [Han 2001]. Immunoassays have also benefited from the advantages of QDs. Recently, dihydrolipoic acid (DHLA) capped-QDs have been attached to antibodies and used as fluorescence reporters in plate-based multiplex immunoassays [Goodman 2004]. However, DHLA-QDs are associated with low quantum efficiency and are unstable at neutral pH. These problems limit the application of this technology to the sensitive detection of biomolecules, especially in complex biological samples. Thus, the development of a rapid, sensitive, quantitative, and specific multiplex platform for the detection of biomarkers in difficult samples remains an elusive target. The goal stated above has applications in many fields including medical diagnostics, biological research, and threat reduction. The current decade alone has seen the development of a need to rapidly and accurately detect potential biological warfare agents. For example, current methods for the detection of anthrax are grossly inadequate for a variety of reasons including long incubation time (5 days from time of exposure to onset of symptoms) and non-specific ('flu-like') symptoms. When five employees of the United State Senate were exposed to B. anthracis in the mail (2001), only one patient had a confirmed diagnosis before death. Since then, sandwich immunoassays using both colorimetric and fluorescence detectors have been developed for key components of the anthrax lethal toxin, namely protective antigen (PA), lethal factor (LF), and the edema factor [Mourez 2001]. While these platforms were successful in assays against anthrax toxins, the sensitivity

Automatic detection and quantitative analysis of cells in the mouse primary motor cortex

NASA Astrophysics Data System (ADS)

Meng, Yunlong; He, Yong; Wu, Jingpeng; Chen, Shangbin; Li, Anan; Gong, Hui

2014-09-01

Neuronal cells play very important role on metabolism regulation and mechanism control, so cell number is a fundamental determinant of brain function. Combined suitable cell-labeling approaches with recently proposed three-dimensional optical imaging techniques, whole mouse brain coronal sections can be acquired with 1-μm voxel resolution. We have developed a completely automatic pipeline to perform cell centroids detection, and provided three-dimensional quantitative information of cells in the primary motor cortex of C57BL/6 mouse. It involves four principal steps: i) preprocessing; ii) image binarization; iii) cell centroids extraction and contour segmentation; iv) laminar density estimation. Investigations on the presented method reveal promising detection accuracy in terms of recall and precision, with average recall rate 92.1% and average precision rate 86.2%. We also analyze laminar density distribution of cells from pial surface to corpus callosum from the output vectorizations of detected cell centroids in mouse primary motor cortex, and find significant cellular density distribution variations in different layers. This automatic cell centroids detection approach will be beneficial for fast cell-counting and accurate density estimation, as time-consuming and error-prone manual identification is avoided.

Application of Programmable Bio-Nano-Chip System for the Quantitative Detection of Drugs of Abuse in Oral Fluids*

PubMed Central

Christodoulides, Nicolaos; De La Garza, Richard; Simmons, Glennon W.; McRae, Michael P.; Wong, Jorge; Newton, Thomas F.; Smith, Regina; Mahoney, James J.; Hohenstein, Justin; Gomez, Sobeyda; Floriano, Pierre N.; Talavera, Humberto; Sloan, Daniel J.; Moody, David E.; Andrenyak, David M.; Kosten, Thomas R.; Haque, Ahmed; McDevitt, John T.

2015-01-01

Objective There is currently a gap in on-site drug of abuse monitoring. Current detection methods involve invasive sampling of blood and urine specimens, or collection of oral fluid, followed by qualitative screening tests using immunochromatographic cartridges. While remote laboratories then may provide confirmation and quantitative assessment of a presumptive positive, this instrumentation is expensive and decoupled from the initial sampling making the current drug-screening program inefficient and costly. The authors applied a noninvasive oral fluid sampling approach integrated with the in-development chip-based Programmable Bio-Nano-Chip (p-BNC) platform for the detection of drugs of abuse. Method The p-BNC assay methodology was applied for the detection of tetrahydrocannabinol, morphine, amphetamine, methamphetamine, cocaine, methadone and benzodiazepines, initially using spiked buffered samples and, ultimately, using oral fluid specimen collected from consented volunteers. Results Rapid (~10 minutes), sensitive detection (~ng/ml) and quantitation of 12 drugs of abuse was demonstrated on the p-BNC platform. Furthermore, the system provided visibility to time-course of select drug and metabolite profiles in oral fluids; for the drug cocaine, three regions of slope were observed that, when combined with concentration measurements from this and prior impairment studies, information about cocaine-induced impairment may be revealed. Conclusions This chip-based p-BNC detection modality has significant potential to be used in the future by law enforcement officers for roadside drug testing and to serve a variety of other settings, including outpatient and inpatient drug rehabilitation centers, emergency rooms, prisons, schools, and in the workplace. PMID:26048639

Detection limits of quantitative and digital PCR assays and their influence in presence-absence surveys of environmental DNA

USGS Publications Warehouse

Hunter, Margaret; Dorazio, Robert M.; Butterfield, John S.; Meigs-Friend, Gaia; Nico, Leo; Ferrante, Jason A.

2017-01-01

A set of universal guidelines is needed to determine the limit of detection (LOD) in PCR-based analyses of low concentration DNA. In particular, environmental DNA (eDNA) studies require sensitive and reliable methods to detect rare and cryptic species through shed genetic material in environmental samples. Current strategies for assessing detection limits of eDNA are either too stringent or subjective, possibly resulting in biased estimates of species’ presence. Here, a conservative LOD analysis grounded in analytical chemistry is proposed to correct for overestimated DNA concentrations predominantly caused by the concentration plateau, a nonlinear relationship between expected and measured DNA concentrations. We have used statistical criteria to establish formal mathematical models for both quantitative and droplet digital PCR. To assess the method, a new Grass Carp (Ctenopharyngodon idella) TaqMan assay was developed and tested on both PCR platforms using eDNA in water samples. The LOD adjustment reduced Grass Carp occupancy and detection estimates while increasing uncertainty – indicating that caution needs to be applied to eDNA data without LOD correction. Compared to quantitative PCR, digital PCR had higher occurrence estimates due to increased sensitivity and dilution of inhibitors at low concentrations. Without accurate LOD correction, species occurrence and detection probabilities based on eDNA estimates are prone to a source of bias that cannot be reduced by an increase in sample size or PCR replicates. Other applications also could benefit from a standardized LOD such as GMO food analysis, and forensic and clinical diagnostics.

Comparison of different approaches to quantitative adenovirus detection in stool specimens of hematopoietic stem cell transplant recipients.

PubMed

Kosulin, K; Dworzak, S; Lawitschka, A; Matthes-Leodolter, S; Lion, T

2016-12-01

Adenoviruses almost invariably proliferate in the gastrointestinal tract prior to dissemination, and critical threshold concentrations in stool correlate with the risk of viremia. Monitoring of adenovirus loads in stool may therefore be important for timely initiation of treatment in order to prevent invasive infection. Comparison of a manual DNA extraction kit in combination with a validated in-house PCR assay with automated extraction on the NucliSENS-EasyMAG device coupled with the Adenovirus R-gene kit (bioMérieux) for quantitative adenovirus analysis in stool samples. Stool specimens spiked with adenovirus concentrations in a range from 10E2-10E11 copies/g and 32 adenovirus-positive clinical stool specimens from pediatric stem cell transplant recipients were tested along with appropriate negative controls. Quantitative analysis of viral load in adenovirus-positive stool specimens revealed a median difference of 0.5 logs (range 0.1-2.2) between the detection systems tested and a difference of 0.3 logs (range 0.0-1.7) when the comparison was restricted to the PCR assays only. Spiking experiments showed a detection limit of 10 2 -10 3 adenovirus copies/g stool revealing a somewhat higher sensitivity offered by the automated extraction. The dynamic range of accurate quantitative analysis by both systems investigated was between 10 3 and 10 8 virus copies/g. The differences in quantitative analysis of adenovirus copy numbers between the systems tested were primarily attributable to the DNA extraction method used, while the qPCR assays revealed a high level of concordance. Both systems showed adequate performance for detection and monitoring of adenoviral load in stool specimens. Copyright © 2016 Elsevier B.V. All rights reserved.

CdSe/ZnS Quantum Dot-Labeled Lateral Flow Strips for Rapid and Quantitative Detection of Gastric Cancer Carbohydrate Antigen 72-4

NASA Astrophysics Data System (ADS)

Yan, Xinyu; Wang, Kan; Lu, Wenting; Qin, Weijian; Cui, Daxiang; He, Jinghua

2016-03-01

Carbohydrate antigen 72-4 (CA72-4) is an important biomarker associated closely with diagnosis and prognosis of early gastric cancer. How to realize quick, sensitive, specific, and quantitative detection of CA72-4 in clinical specimens has become a great requirement. Herein, we reported a CdSe/ZnS quantum dot-labeled lateral flow test strip combined with a charge-coupled device (CCD)-based reader was developed for rapid, sensitive, and quantitative detection of CA72-4. Two mouse monoclonal antibodies (mAbs) against CA72-4 were employed. One of them was coated as a test line, while another mAb was labeled with quantum dots and coated onto conjugate pad. The goat anti-mouse IgG was immobilized as a control line. After sample was added, a sandwich structure was formed with CA72-4 and these two mAbs. The fluorescent signal from quantum dots (QD)-labeled mAb in sandwich structure was related to the amount of detected CA72-4. A CCD-based reader was used to realize quantitative detection of CA72-4. Results showed that developed QD-labeled lateral flow strips to detect CA72-4 biomarker with the sensitivity of 2 IU/mL and 10 min detection time. One hundred sera samples from clinical patients with gastric cancer and healthy people were used to confirm specificity of this strip method; results showed that established strip method own 100 % reproducibility and 100 % specificity compared with Roche electrochemiluminescence assay results. In conclusion, CdSe/ZnS quantum dot-labeled lateral flow strips for detection of CA72-4 could realize rapid, sensitive, and specific detection of clinical samples and could own great potential in clinical translation in near future.

[Reconstituting evaluation methods based on both qualitative and quantitative paradigms].

PubMed

Miyata, Hiroaki; Okubo, Suguru; Yoshie, Satoru; Kai, Ichiro

2011-01-01

Debate about the relationship between quantitative and qualitative paradigms is often muddled and confusing and the clutter of terms and arguments has resulted in the concepts becoming obscure and unrecognizable. In this study we conducted content analysis regarding evaluation methods of qualitative healthcare research. We extracted descriptions on four types of evaluation paradigm (validity/credibility, reliability/credibility, objectivity/confirmability, and generalizability/transferability), and classified them into subcategories. In quantitative research, there has been many evaluation methods based on qualitative paradigms, and vice versa. Thus, it might not be useful to consider evaluation methods of qualitative paradigm are isolated from those of quantitative methods. Choosing practical evaluation methods based on the situation and prior conditions of each study is an important approach for researchers.

Detection of proximal caries using quantitative light-induced fluorescence-digital and laser fluorescence: a comparative study.

PubMed

Yoon, Hyung-In; Yoo, Min-Jeong; Park, Eun-Jin

2017-12-01

The purpose of this study was to evaluate the in vitro validity of quantitative light-induced fluorescence-digital (QLF-D) and laser fluorescence (DIAGNOdent) for assessing proximal caries in extracted premolars, using digital radiography as reference method. A total of 102 extracted premolars with similar lengths and shapes were used. A single operator conducted all the examinations using three different detection methods (bitewing radiography, QLF-D, and DIAGNOdent). The bitewing x-ray scale, QLF-D fluorescence loss (ΔF), and DIAGNOdent peak readings were compared and statistically analyzed. Each method showed an excellent reliability. The correlation coefficient between bitewing radiography and QLF-D, DIAGNOdent were -0.644 and 0.448, respectively, while the value between QLF-D and DIAGNOdent was -0.382. The kappa statistics for bitewing radiography and QLF-D had a higher diagnosis consensus than those for bitewing radiography and DIAGNOdent. The QLF-D was moderately to highly accurate (AUC = 0.753 - 0.908), while DIAGNOdent was moderately to less accurate (AUC = 0.622 - 0.784). All detection methods showed statistically significant correlation and high correlation between the bitewing radiography and QLF-D. QLF-D was found to be a valid and reliable alternative diagnostic method to digital bitewing radiography for in vitro detection of proximal caries.

Quantitative mass spectrometry methods for pharmaceutical analysis

PubMed Central

Loos, Glenn; Van Schepdael, Ann

2016-01-01

Quantitative pharmaceutical analysis is nowadays frequently executed using mass spectrometry. Electrospray ionization coupled to a (hybrid) triple quadrupole mass spectrometer is generally used in combination with solid-phase extraction and liquid chromatography. Furthermore, isotopically labelled standards are often used to correct for ion suppression. The challenges in producing sensitive but reliable quantitative data depend on the instrumentation, sample preparation and hyphenated techniques. In this contribution, different approaches to enhance the ionization efficiencies using modified source geometries and improved ion guidance are provided. Furthermore, possibilities to minimize, assess and correct for matrix interferences caused by co-eluting substances are described. With the focus on pharmaceuticals in the environment and bioanalysis, different separation techniques, trends in liquid chromatography and sample preparation methods to minimize matrix effects and increase sensitivity are discussed. Although highly sensitive methods are generally aimed for to provide automated multi-residue analysis, (less sensitive) miniaturized set-ups have a great potential due to their ability for in-field usage. This article is part of the themed issue ‘Quantitative mass spectrometry’. PMID:27644982

Aptasensors for quantitative detection of Salmonella Typhimurium.

PubMed

Ansari, Najmeh; Yazdian-Robati, Rezvan; Shahdordizadeh, Mahin; Wang, Zhouping; Ghazvini, Kiarash

2017-09-15

Salmonella is one of the most frequent causes of food borne infectious disease. Among nearly 2500 documented serotypes are reported, Salmonella Typhimurium is the number one serotype associated with salmonellosis worldwide. Many different methods have been developed for the detection and quantification of S. typhimurium. Most of these assays are usually expensive, time consuming and require difficult sample preparation steps. Therefore, it is necessary to develop rapid, robust, cost-effective and sensitive alternative detection methods. In the last years, aptasensors, used for detection of S. typhimurium in different samples. In this review, recent advances and applications of aptasensors for the detection and quantification of S. typhimurium in details have been summarized. Copyright © 2017 Elsevier Inc. All rights reserved.

A General Method for Targeted Quantitative Cross-Linking Mass Spectrometry.

PubMed

Chavez, Juan D; Eng, Jimmy K; Schweppe, Devin K; Cilia, Michelle; Rivera, Keith; Zhong, Xuefei; Wu, Xia; Allen, Terrence; Khurgel, Moshe; Kumar, Akhilesh; Lampropoulos, Athanasios; Larsson, Mårten; Maity, Shuvadeep; Morozov, Yaroslav; Pathmasiri, Wimal; Perez-Neut, Mathew; Pineyro-Ruiz, Coriness; Polina, Elizabeth; Post, Stephanie; Rider, Mark; Tokmina-Roszyk, Dorota; Tyson, Katherine; Vieira Parrine Sant'Ana, Debora; Bruce, James E

2016-01-01

Chemical cross-linking mass spectrometry (XL-MS) provides protein structural information by identifying covalently linked proximal amino acid residues on protein surfaces. The information gained by this technique is complementary to other structural biology methods such as x-ray crystallography, NMR and cryo-electron microscopy[1]. The extension of traditional quantitative proteomics methods with chemical cross-linking can provide information on the structural dynamics of protein structures and protein complexes. The identification and quantitation of cross-linked peptides remains challenging for the general community, requiring specialized expertise ultimately limiting more widespread adoption of the technique. We describe a general method for targeted quantitative mass spectrometric analysis of cross-linked peptide pairs. We report the adaptation of the widely used, open source software package Skyline, for the analysis of quantitative XL-MS data as a means for data analysis and sharing of methods. We demonstrate the utility and robustness of the method with a cross-laboratory study and present data that is supported by and validates previously published data on quantified cross-linked peptide pairs. This advance provides an easy to use resource so that any lab with access to a LC-MS system capable of performing targeted quantitative analysis can quickly and accurately measure dynamic changes in protein structure and protein interactions.

Detection of nucleophosmin 1 mutations by quantitative real-time polymerase chain reaction versus capillary electrophoresis: a comparative study.

PubMed

Barakat, Fareed H; Luthra, Rajyalakshmi; Yin, C Cameron; Barkoh, Bedia A; Hai, Seema; Jamil, Waqar; Bhakta, Yaminiben I; Chen, Su; Medeiros, L Jeffrey; Zuo, Zhuang

2011-08-01

Nucleophosmin 1 (NPM1) is the most commonly mutated gene in acute myeloid leukemia. Detection of NPM1 mutations is useful for stratifying patients for therapy, predicting prognosis, and assessing for minimal residual disease. Several methods have been developed to rapidly detect NPM1 mutations in genomic DNA and/or messenger RNA specimens. To directly compare a quantitative real-time polymerase chain reaction (qPCR) assay with a widely used capillary electrophoresis assay for detecting NPM1 mutations. We adopted and modified a qPCR assay designed to detect the 6 most common NPM1 mutations and performed the assay in parallel with capillary electrophoresis assay in 207 bone marrow aspirate or peripheral blood samples from patients with a range of hematolymphoid neoplasms. The qPCR assay demonstrated a higher analytical sensitivity than the capillary electrophoresis 1/1000 versus 1/40, respectively. The capillary electrophoresis assay generated 10 equivocal results that needed to be repeated, whereas the qPCR assay generated only 1 equivocal result. After test conditions were optimized, the qPCR and capillary electrophoresis methods produced 100% concordant results, 85 positive and 122 negative. Given the higher analytical sensitivity and specificity of the qPCR assay, that assay is less likely to generate equivocal results than the capillary electrophoresis assay. Moreover, the qPCR assay is quantitative, faster, cheaper, less prone to contamination, and well suited for monitoring minimal residual disease.

mcrA-Targeted Real-Time Quantitative PCR Method To Examine Methanogen Communities▿

PubMed Central

Steinberg, Lisa M.; Regan, John M.

2009-01-01

Methanogens are of great importance in carbon cycling and alternative energy production, but quantitation with culture-based methods is time-consuming and biased against methanogen groups that are difficult to cultivate in a laboratory. For these reasons, methanogens are typically studied through culture-independent molecular techniques. We developed a SYBR green I quantitative PCR (qPCR) assay to quantify total numbers of methyl coenzyme M reductase α-subunit (mcrA) genes. TaqMan probes were also designed to target nine different phylogenetic groups of methanogens in qPCR assays. Total mcrA and mcrA levels of different methanogen phylogenetic groups were determined from six samples: four samples from anaerobic digesters used to treat either primarily cow or pig manure and two aliquots from an acidic peat sample stored at 4°C or 20°C. Only members of the Methanosaetaceae, Methanosarcina, Methanobacteriaceae, and Methanocorpusculaceae and Fen cluster were detected in the environmental samples. The three samples obtained from cow manure digesters were dominated by members of the genus Methanosarcina, whereas the sample from the pig manure digester contained detectable levels of only members of the Methanobacteriaceae. The acidic peat samples were dominated by both Methanosarcina spp. and members of the Fen cluster. In two of the manure digester samples only one methanogen group was detected, but in both of the acidic peat samples and two of the manure digester samples, multiple methanogen groups were detected. The TaqMan qPCR assays were successfully able to determine the environmental abundance of different phylogenetic groups of methanogens, including several groups with few or no cultivated members. PMID:19447957

Quantitative Ultrasound Assessment of Duchenne Muscular Dystrophy Using Edge Detection Analysis.

PubMed

Koppaka, Sisir; Shklyar, Irina; Rutkove, Seward B; Darras, Basil T; Anthony, Brian W; Zaidman, Craig M; Wu, Jim S

2016-09-01

The purpose of this study was to investigate the ability of quantitative ultrasound (US) using edge detection analysis to assess patients with Duchenne muscular dystrophy (DMD). After Institutional Review Board approval, US examinations with fixed technical parameters were performed unilaterally in 6 muscles (biceps, deltoid, wrist flexors, quadriceps, medial gastrocnemius, and tibialis anterior) in 19 boys with DMD and 21 age-matched control participants. The muscles of interest were outlined by a tracing tool, and the upper third of the muscle was used for analysis. Edge detection values for each muscle were quantified by the Canny edge detection algorithm and then normalized to the number of edge pixels in the muscle region. The edge detection values were extracted at multiple sensitivity thresholds (0.01-0.99) to determine the optimal threshold for distinguishing DMD from normal. Area under the receiver operating curve values were generated for each muscle and averaged across the 6 muscles. The average age in the DMD group was 8.8 years (range, 3.0-14.3 years), and the average age in the control group was 8.7 years (range, 3.4-13.5 years). For edge detection, a Canny threshold of 0.05 provided the best discrimination between DMD and normal (area under the curve, 0.96; 95% confidence interval, 0.84-1.00). According to a Mann-Whitney test, edge detection values were significantly different between DMD and controls (P < .0001). Quantitative US imaging using edge detection can distinguish patients with DMD from healthy controls at low Canny thresholds, at which discrimination of small structures is best. Edge detection by itself or in combination with other tests can potentially serve as a useful biomarker of disease progression and effectiveness of therapy in muscle disorders.

Development of a comprehensive analytical platform for the detection and quantitation of food fraud using a biomarker approach. The oregano adulteration case study.

PubMed

Wielogorska, Ewa; Chevallier, Olivier; Black, Connor; Galvin-King, Pamela; Delêtre, Marc; Kelleher, Colin T; Haughey, Simon A; Elliott, Christopher T

2018-01-15

Due to increasing number of food fraud incidents, there is an inherent need for the development and implementation of analytical platforms enabling detection and quantitation of adulteration. In this study a set of unique biomarkers of commonly found oregano adulterants became the targets in the development of a LC-MS/MS method which underwent a rigorous in-house validation. The method presented very high selectivity and specificity, excellent linearity (R 2 >0.988) low decision limits and detection capabilities (<2%), acceptable accuracy (intra-assay 92-113%, inter-assay 69-138%) and precision (CV<20%). The method was compared with an established FTIR screening assay and revealed a good correlation of quali- and quantitative results (R 2 >0.81). An assessment of 54 suspected adulterated oregano samples revealed that almost 90% of them contained at least one bulking agent, with a median level of adulteration of 50%. Such innovative methodologies need to be established as routine testing procedures to detect and ultimately deter food fraud. Copyright © 2017 Elsevier Ltd. All rights reserved.

Automated Detection of P. falciparum Using Machine Learning Algorithms with Quantitative Phase Images of Unstained Cells.

PubMed

Park, Han Sang; Rinehart, Matthew T; Walzer, Katelyn A; Chi, Jen-Tsan Ashley; Wax, Adam

2016-01-01

Malaria detection through microscopic examination of stained blood smears is a diagnostic challenge that heavily relies on the expertise of trained microscopists. This paper presents an automated analysis method for detection and staging of red blood cells infected by the malaria parasite Plasmodium falciparum at trophozoite or schizont stage. Unlike previous efforts in this area, this study uses quantitative phase images of unstained cells. Erythrocytes are automatically segmented using thresholds of optical phase and refocused to enable quantitative comparison of phase images. Refocused images are analyzed to extract 23 morphological descriptors based on the phase information. While all individual descriptors are highly statistically different between infected and uninfected cells, each descriptor does not enable separation of populations at a level satisfactory for clinical utility. To improve the diagnostic capacity, we applied various machine learning techniques, including linear discriminant classification (LDC), logistic regression (LR), and k-nearest neighbor classification (NNC), to formulate algorithms that combine all of the calculated physical parameters to distinguish cells more effectively. Results show that LDC provides the highest accuracy of up to 99.7% in detecting schizont stage infected cells compared to uninfected RBCs. NNC showed slightly better accuracy (99.5%) than either LDC (99.0%) or LR (99.1%) for discriminating late trophozoites from uninfected RBCs. However, for early trophozoites, LDC produced the best accuracy of 98%. Discrimination of infection stage was less accurate, producing high specificity (99.8%) but only 45.0%-66.8% sensitivity with early trophozoites most often mistaken for late trophozoite or schizont stage and late trophozoite and schizont stage most often confused for each other. Overall, this methodology points to a significant clinical potential of using quantitative phase imaging to detect and stage malaria infection

Automated Detection of P. falciparum Using Machine Learning Algorithms with Quantitative Phase Images of Unstained Cells

PubMed Central

Park, Han Sang; Rinehart, Matthew T.; Walzer, Katelyn A.; Chi, Jen-Tsan Ashley; Wax, Adam

2016-01-01

Malaria detection through microscopic examination of stained blood smears is a diagnostic challenge that heavily relies on the expertise of trained microscopists. This paper presents an automated analysis method for detection and staging of red blood cells infected by the malaria parasite Plasmodium falciparum at trophozoite or schizont stage. Unlike previous efforts in this area, this study uses quantitative phase images of unstained cells. Erythrocytes are automatically segmented using thresholds of optical phase and refocused to enable quantitative comparison of phase images. Refocused images are analyzed to extract 23 morphological descriptors based on the phase information. While all individual descriptors are highly statistically different between infected and uninfected cells, each descriptor does not enable separation of populations at a level satisfactory for clinical utility. To improve the diagnostic capacity, we applied various machine learning techniques, including linear discriminant classification (LDC), logistic regression (LR), and k-nearest neighbor classification (NNC), to formulate algorithms that combine all of the calculated physical parameters to distinguish cells more effectively. Results show that LDC provides the highest accuracy of up to 99.7% in detecting schizont stage infected cells compared to uninfected RBCs. NNC showed slightly better accuracy (99.5%) than either LDC (99.0%) or LR (99.1%) for discriminating late trophozoites from uninfected RBCs. However, for early trophozoites, LDC produced the best accuracy of 98%. Discrimination of infection stage was less accurate, producing high specificity (99.8%) but only 45.0%-66.8% sensitivity with early trophozoites most often mistaken for late trophozoite or schizont stage and late trophozoite and schizont stage most often confused for each other. Overall, this methodology points to a significant clinical potential of using quantitative phase imaging to detect and stage malaria infection

Detection of KIT Genotype in Pigs by TaqMan MGB Real-Time Quantitative Polymerase Chain Reaction.

PubMed

Li, Xiuxiu; Li, Xiaoning; Luo, Rongrong; Wang, Wenwen; Wang, Tao; Tang, Hui

2018-05-01

The dominant white phenotype in domestic pigs is caused by two mutations in the KIT gene: a 450 kb duplication containing the entire KIT gene together with flanking sequences and one splice mutation with a G:A substitution in intron 17. The purpose of this study was to establish a simple, rapid method to determine KIT genotype in pigs. First, to detect KIT copy number variation (CNV), primers for exon 2 of the KIT gene, along with a TaqMan minor groove binder (MGB) probe, were designed. The single-copy gene, estrogen receptor (ESR), was used as an internal control. A real-time fluorescence-based quantitative PCR (FQ-PCR) protocol was developed to accurately detect KIT CNVs. Second, to detect the splice mutation ratio of the G:A substitution in intron 17, a 175 bp region, including the target mutation, was amplified from genomic DNA. Based on the sequence of the resulting amplified fragment, an MGB probe set was designed to detect the ratio of splice mutation to normal using FQ-PCR. A series of parallel amplification curves with the same internal distances were obtained using gradually diluted DNA as templates. The CT values among dilutions were significantly different (p < 0.001) and the coefficients of variation from each dilution were low (from 0.13% to 0.26%). The amplification efficiencies for KIT and ESR were approximately equal, indicating ESR was an appropriate control gene. Furthermore, use of the MGB probe set resulted in detection of the target mutation at a high resolution and stability; standard curves illustrated that the amplification efficiencies of KIT1 (G) and KIT2 (A) were approximately equal (98.8% and 97.2%). In conclusion, a simple, rapid method, with high specificity and stability, for the detection of the KIT genotype in pigs was established using TaqMan MGB probe real-time quantitative PCR.

Semi-quantitative methods yield greater inter- and intraobserver agreement than subjective methods for interpreting 99m technetium-hydroxymethylene-diphosphonate uptake in equine thoracic processi spinosi.

PubMed

van Zadelhoff, Claudia; Ehrle, Anna; Merle, Roswitha; Jahn, Werner; Lischer, Christoph

2018-05-09

Scintigraphy is a standard diagnostic method for evaluating horses with back pain due to suspected thoracic processus spinosus pathology. Lesion detection is based on subjective or semi-quantitative assessments of increased uptake. This retrospective, analytical study is aimed to compare semi-quantitative and subjective methods in the evaluation of scintigraphic images of the processi spinosi in the equine thoracic spine. Scintigraphic images of 20 Warmblood horses, presented for assessment of orthopedic conditions between 2014 and 2016, were included in the study. Randomized, blinded image evaluation was performed by 11 veterinarians using subjective and semi-quantitative methods. Subjective grading was performed for the analysis of red-green-blue and grayscale scintigraphic images, which were presented in full-size or as masked images. For the semi-quantitative assessment, observers placed regions of interest over each processus spinosus. The uptake ratio of each processus spinosus in comparison to a reference region of interest was determined. Subsequently, a modified semi-quantitative calculation was developed whereby only the highest counts-per-pixel for a specified number of pixels was processed. Inter- and intraobserver agreement was calculated using intraclass correlation coefficients. Inter- and intraobserver intraclass correlation coefficients were 41.65% and 71.39%, respectively, for the subjective image assessment. Additionally, a correlation between intraobserver agreement, experience, and grayscale images was identified. The inter- and intraobserver agreement was significantly increased when using semi-quantitative analysis (97.35% and 98.36%, respectively) or the modified semi-quantitative calculation (98.61% and 98.82%, respectively). The proposed modified semi-quantitative technique showed a higher inter- and intraobserver agreement when compared to other methods, which makes it a useful tool for the analysis of scintigraphic images. The

Surface-Enhanced Raman Scattering Active Plasmonic Nanoparticles with Ultrasmall Interior Nanogap for Multiplex Quantitative Detection and Cancer Cell Imaging.

PubMed

Li, Jiuxing; Zhu, Zhi; Zhu, Bingqing; Ma, Yanli; Lin, Bingqian; Liu, Rudi; Song, Yanling; Lin, Hui; Tu, Song; Yang, Chaoyong

2016-08-02

Due to its large enhancement effect, nanostructure-based surface-enhanced Raman scattering (SERS) technology had been widely applied for bioanalysis and cell imaging. However, most SERS nanostructures suffer from poor signal reproducibility, which hinders the application of SERS nanostructures in quantitative detection. We report an etching-assisted approach to synthesize SERS-active plasmonic nanoparticles with 1 nm interior nanogap for multiplex quantitative detection and cancer cell imaging. Raman dyes and methoxy poly(ethylene glycol) thiol (mPEG-SH) were attached to gold nanoparticles (AuNPs) to prepare gold cores. Next, Ag atoms were deposited on gold cores in the presence of Pluronic F127 to form a Ag shell. HAuCl4 was used to etch the Ag shell and form an interior nanogap in Au@AgAuNPs, leading to increased Raman intensity of dyes. SERS intensity distribution of Au@AgAuNPs was found to be more uniform than that of aggregated AuNPs. Finally, Au@AgAuNPs were used for multiplex quantitative detection and cancer cell imaging. With the advantages of simple and rapid preparation of Au@AgAuNPs with highly uniform, stable, and reproducible Raman intensity, the method reported here will widen the applications of SERS-active nanoparticles in diagnostics and imaging.

Detection of Extraterrestrial Life. Method II- Optical Rotatory Dispersion

NASA Technical Reports Server (NTRS)

1963-01-01

The object of this study is to develop polarimetric methods to detect the presence of DNA (deoxyribonucleic acid) or its congeners in soil suspensions, and through these methods determine the existence of life (as known terrestrially) on other planets. The cotton region associated with optically active organic compounds is being used to detect and characterize the compounds above. An apparatus has been designed and assembled which can measure optical rotations in systems which strongly attenuate incident-polarized, monochromatic light. This instrument was used to measure the optical rotatory dispersion spectra of nucleosides, a polynucleotide, and proteins whose optical density at 260 microns approached 1.0. This work is discussed in the final report on Contract NASR-85, Detection of Extraterrestrial Life, Method II: Optical Rotatory Dispersion. Recent work in Melpar laboratories has reaffirmed these rotatory dispersion spectra. Based upon the analysis of the optical components associated with this apparatus, however, these measurements must be considered as qualitative rather than quantitative. The reason for this is discussed in greater detail subsequently in this report. In addition, an evaluation of the theoretical and instrumental aspects of making rotatory-dispersion measurements in the cotton region has resulted in a procedure for measuring optical rotation.

Detection and correction of laser induced breakdown spectroscopy spectral background based on spline interpolation method

NASA Astrophysics Data System (ADS)

Tan, Bing; Huang, Min; Zhu, Qibing; Guo, Ya; Qin, Jianwei

2017-12-01

Laser-induced breakdown spectroscopy (LIBS) is an analytical technique that has gained increasing attention because of many applications. The production of continuous background in LIBS is inevitable because of factors associated with laser energy, gate width, time delay, and experimental environment. The continuous background significantly influences the analysis of the spectrum. Researchers have proposed several background correction methods, such as polynomial fitting, Lorenz fitting and model-free methods. However, less of them apply these methods in the field of LIBS Technology, particularly in qualitative and quantitative analyses. This study proposes a method based on spline interpolation for detecting and estimating the continuous background spectrum according to its smooth property characteristic. Experiment on the background correction simulation indicated that, the spline interpolation method acquired the largest signal-to-background ratio (SBR) over polynomial fitting, Lorenz fitting and model-free method after background correction. These background correction methods all acquire larger SBR values than that acquired before background correction (The SBR value before background correction is 10.0992, whereas the SBR values after background correction by spline interpolation, polynomial fitting, Lorentz fitting, and model-free methods are 26.9576, 24.6828, 18.9770, and 25.6273 respectively). After adding random noise with different kinds of signal-to-noise ratio to the spectrum, spline interpolation method acquires large SBR value, whereas polynomial fitting and model-free method obtain low SBR values. All of the background correction methods exhibit improved quantitative results of Cu than those acquired before background correction (The linear correlation coefficient value before background correction is 0.9776. Moreover, the linear correlation coefficient values after background correction using spline interpolation, polynomial fitting, Lorentz

Quantitative analysis of fracture surface by roughness and fractal method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, X.W.; Tian, J.F.; Kang, Y.

1995-09-01

In recent years there has been extensive research and great development in Quantitative Fractography, which acts as an integral part of fractographic analysis. A prominent technique for studying the fracture surface is based on fracture profile generation and the major means for characterizing the profile quantitatively are roughness and fractal methods. By this way, some quantitative indexes such as the roughness parameters R{sub L} for profile and R{sub S} for surface, fractal dimensions D{sub L} for profile and D{sub S} for surface can be measured. Given the relationships between the indexes and the mechanical properties of materials, it is possiblemore » to achieve the goal of protecting materials from fracture. But, as the case stands, the theory and experimental technology of quantitative fractography are still imperfect and remain to be studied further. Recently, Gokhale and Underwood et al have proposed an assumption-free method for estimating the surface roughness by vertically sectioning the fracture surface with sections at an angle of 120 deg with each other, which could be expressed as follows: R{sub S} = {ovr R{sub L}{center_dot}{Psi}} where {Psi} is the profile structure factor. This method is based on the classical sterological principles and verified with the aid of computer simulations for some ruled surfaces. The results are considered to be applicable to fracture surfaces with any arbitrary complexity and anisotropy. In order to extend the detail applications to this method in quantitative fractography, the authors made a study on roughness and fractal methods dependent on this method by performing quantitative measurements on some typical low-temperature impact fractures.« less

Spectroscopic characterization and quantitative determination of atorvastatin calcium impurities by novel HPLC method

NASA Astrophysics Data System (ADS)

Gupta, Lokesh Kumar

2012-11-01

Seven process related impurities were identified by LC-MS in the atorvastatin calcium drug substance. These impurities were identified by LC-MS. The structure of impurities was confirmed by modern spectroscopic techniques like 1H NMR and IR and physicochemical studies conducted by using synthesized authentic reference compounds. The synthesized reference samples of the impurity compounds were used for the quantitative HPLC determination. These impurities were detected by newly developed gradient, reverse phase high performance liquid chromatographic (HPLC) method. The system suitability of HPLC analysis established the validity of the separation. The analytical method was validated according to International Conference of Harmonization (ICH) with respect to specificity, precision, accuracy, linearity, robustness and stability of analytical solutions to demonstrate the power of newly developed HPLC method.

Retinal status analysis method based on feature extraction and quantitative grading in OCT images.

PubMed

Fu, Dongmei; Tong, Hejun; Zheng, Shuang; Luo, Ling; Gao, Fulin; Minar, Jiri

2016-07-22

Optical coherence tomography (OCT) is widely used in ophthalmology for viewing the morphology of the retina, which is important for disease detection and assessing therapeutic effect. The diagnosis of retinal diseases is based primarily on the subjective analysis of OCT images by trained ophthalmologists. This paper describes an OCT images automatic analysis method for computer-aided disease diagnosis and it is a critical part of the eye fundus diagnosis. This study analyzed 300 OCT images acquired by Optovue Avanti RTVue XR (Optovue Corp., Fremont, CA). Firstly, the normal retinal reference model based on retinal boundaries was presented. Subsequently, two kinds of quantitative methods based on geometric features and morphological features were proposed. This paper put forward a retinal abnormal grading decision-making method which was used in actual analysis and evaluation of multiple OCT images. This paper showed detailed analysis process by four retinal OCT images with different abnormal degrees. The final grading results verified that the analysis method can distinguish abnormal severity and lesion regions. This paper presented the simulation of the 150 test images, where the results of analysis of retinal status showed that the sensitivity was 0.94 and specificity was 0.92.The proposed method can speed up diagnostic process and objectively evaluate the retinal status. This paper aims on studies of retinal status automatic analysis method based on feature extraction and quantitative grading in OCT images. The proposed method can obtain the parameters and the features that are associated with retinal morphology. Quantitative analysis and evaluation of these features are combined with reference model which can realize the target image abnormal judgment and provide a reference for disease diagnosis.

Quantitative prediction of perceptual decisions during near-threshold fear detection

NASA Astrophysics Data System (ADS)

Pessoa, Luiz; Padmala, Srikanth

2005-04-01

A fundamental goal of cognitive neuroscience is to explain how mental decisions originate from basic neural mechanisms. The goal of the present study was to investigate the neural correlates of perceptual decisions in the context of emotional perception. To probe this question, we investigated how fluctuations in functional MRI (fMRI) signals were correlated with behavioral choice during a near-threshold fear detection task. fMRI signals predicted behavioral choice independently of stimulus properties and task accuracy in a network of brain regions linked to emotional processing: posterior cingulate cortex, medial prefrontal cortex, right inferior frontal gyrus, and left insula. We quantified the link between fMRI signals and behavioral choice in a whole-brain analysis by determining choice probabilities by means of signal-detection theory methods. Our results demonstrate that voxel-wise fMRI signals can reliably predict behavioral choice in a quantitative fashion (choice probabilities ranged from 0.63 to 0.78) at levels comparable to neuronal data. We suggest that the conscious decision that a fearful face has been seen is represented across a network of interconnected brain regions that prepare the organism to appropriately handle emotionally challenging stimuli and that regulate the associated emotional response. decision making | emotion | functional MRI

Studying learning in the healthcare setting: the potential of quantitative diary methods.

PubMed

Ciere, Yvette; Jaarsma, Debbie; Visser, Annemieke; Sanderman, Robbert; Snippe, Evelien; Fleer, Joke

2015-08-01

Quantitative diary methods are longitudinal approaches that involve the repeated measurement of aspects of peoples' experience of daily life. In this article, we outline the main characteristics and applications of quantitative diary methods and discuss how their use may further research in the field of medical education. Quantitative diary methods offer several methodological advantages, such as measuring aspects of learning with great detail, accuracy and authenticity. Moreover, they enable researchers to study how and under which conditions learning in the health care setting occurs and in which way learning can be promoted. Hence, quantitative diary methods may contribute to theory development and the optimization of teaching methods in medical education.

Multifunctional sample preparation kit and on-chip quantitative nucleic acid sequence-based amplification tests for microbial detection.

PubMed

Zhao, Xinyan; Dong, Tao

2012-10-16

This study reports a quantitative nucleic acid sequence-based amplification (Q-NASBA) microfluidic platform composed of a membrane-based sampling module, a sample preparation cassette, and a 24-channel Q-NASBA chip for environmental investigations on aquatic microorganisms. This low-cost and highly efficient sampling module, having seamless connection with the subsequent steps of sample preparation and quantitative detection, is designed for the collection of microbial communities from aquatic environments. Eight kinds of commercial membrane filters are relevantly analyzed using Saccharomyces cerevisiae, Escherichia coli, and Staphylococcus aureus as model microorganisms. After the microorganisms are concentrated on the membrane filters, the retentate can be easily conserved in a transport medium (TM) buffer and sent to a remote laboratory. A Q-NASBA-oriented sample preparation cassette is originally designed to extract DNA/RNA molecules directly from the captured cells on the membranes. Sequentially, the extract is analyzed within Q-NASBA chips that are compatible with common microplate readers in laboratories. Particularly, a novel analytical algorithmic method is developed for simple but robust on-chip Q-NASBA assays. The reported multifunctional microfluidic system could detect a few microorganisms quantitatively and simultaneously. Further research should be conducted to simplify and standardize ecological investigations on aquatic environments.

Sensitive and specific miRNA detection method using SplintR Ligase

PubMed Central

Jin, Jingmin; Vaud, Sophie; Zhelkovsky, Alexander M.; Posfai, Janos; McReynolds, Larry A.

2016-01-01

We describe a simple, specific and sensitive microRNA (miRNA) detection method that utilizes Chlorella virus DNA ligase (SplintR® Ligase). This two-step method involves ligation of adjacent DNA oligonucleotides hybridized to a miRNA followed by real-time quantitative PCR (qPCR). SplintR Ligase is 100X faster than either T4 DNA Ligase or T4 RNA Ligase 2 for RNA splinted DNA ligation. Only a 4–6 bp overlap between a DNA probe and miRNA was required for efficient ligation by SplintR Ligase. This property allows more flexibility in designing miRNA-specific ligation probes than methods that use reverse transcriptase for cDNA synthesis of miRNA. The qPCR SplintR ligation assay is sensitive; it can detect a few thousand molecules of miR-122. For miR-122 detection the SplintR qPCR assay, using a FAM labeled double quenched DNA probe, was at least 40× more sensitive than the TaqMan assay. The SplintR method, when coupled with NextGen sequencing, allowed multiplex detection of miRNAs from brain, kidney, testis and liver. The SplintR qPCR assay is specific; individual let-7 miRNAs that differ by one nucleotide are detected. The rapid kinetics and ability to ligate DNA probes hybridized to RNA with short complementary sequences makes SplintR Ligase a useful enzyme for miRNA detection. PMID:27154271

A web-based quantitative signal detection system on adverse drug reaction in China.

PubMed

Li, Chanjuan; Xia, Jielai; Deng, Jianxiong; Chen, Wenge; Wang, Suzhen; Jiang, Jing; Chen, Guanquan

2009-07-01

To establish a web-based quantitative signal detection system for adverse drug reactions (ADRs) based on spontaneous reporting to the Guangdong province drug-monitoring database in China. Using Microsoft Visual Basic and Active Server Pages programming languages and SQL Server 2000, a web-based system with three software modules was programmed to perform data preparation and association detection, and to generate reports. Information component (IC), the internationally recognized measure of disproportionality for quantitative signal detection, was integrated into the system, and its capacity for signal detection was tested with ADR reports collected from 1 January 2002 to 30 June 2007 in Guangdong. A total of 2,496 associations including known signals were mined from the test database. Signals (e.g., cefradine-induced hematuria) were found early by using the IC analysis. In addition, 291 drug-ADR associations were alerted for the first time in the second quarter of 2007. The system can be used for the detection of significant associations from the Guangdong drug-monitoring database and could be an extremely useful adjunct to the expert assessment of very large numbers of spontaneously reported ADRs for the first time in China.

Detection limits of quantitative and digital PCR assays and their influence in presence-absence surveys of environmental DNA.

PubMed

Hunter, Margaret E; Dorazio, Robert M; Butterfield, John S S; Meigs-Friend, Gaia; Nico, Leo G; Ferrante, Jason A

2017-03-01

A set of universal guidelines is needed to determine the limit of detection (LOD) in PCR-based analyses of low-concentration DNA. In particular, environmental DNA (eDNA) studies require sensitive and reliable methods to detect rare and cryptic species through shed genetic material in environmental samples. Current strategies for assessing detection limits of eDNA are either too stringent or subjective, possibly resulting in biased estimates of species' presence. Here, a conservative LOD analysis grounded in analytical chemistry is proposed to correct for overestimated DNA concentrations predominantly caused by the concentration plateau, a nonlinear relationship between expected and measured DNA concentrations. We have used statistical criteria to establish formal mathematical models for both quantitative and droplet digital PCR. To assess the method, a new Grass Carp (Ctenopharyngodon idella) TaqMan assay was developed and tested on both PCR platforms using eDNA in water samples. The LOD adjustment reduced Grass Carp occupancy and detection estimates while increasing uncertainty-indicating that caution needs to be applied to eDNA data without LOD correction. Compared to quantitative PCR, digital PCR had higher occurrence estimates due to increased sensitivity and dilution of inhibitors at low concentrations. Without accurate LOD correction, species occurrence and detection probabilities based on eDNA estimates are prone to a source of bias that cannot be reduced by an increase in sample size or PCR replicates. Other applications also could benefit from a standardized LOD such as GMO food analysis and forensic and clinical diagnostics. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

Flow cytometric immunobead assay for quantitative detection of platelet autoantibodies in immune thrombocytopenia patients.

PubMed

Zhai, Juping; Ding, Mengyuan; Yang, Tianjie; Zuo, Bin; Weng, Zhen; Zhao, Yunxiao; He, Jun; Wu, Qingyu; Ruan, Changgeng; He, Yang

2017-10-23

Platelet autoantibody detection is critical for immune thrombocytopenia (ITP) diagnosis and prognosis. Therefore, we aimed to establish a quantitative flow cytometric immunobead assay (FCIA) for ITP platelet autoantibodies evaluation. Capture microbeads coupled with anti-GPIX, -GPIb, -GPIIb, -GPIIIa and P-selectin antibodies were used to bind the platelet-bound autoantibodies complex generated from plasma samples of 250 ITP patients, 163 non-ITP patients and 243 healthy controls, a fluorescein isothiocyanate (FITC)-conjugated secondary antibody was the detector reagent and mean fluorescence intensity (MFI) signals were recorded by flow cytometry. Intra- and inter-assay variations of the quantitative FCIA assay were assessed. Comparisons of the specificity, sensitivity and accuracy between quantitative and qualitative FCIA or monoclonal antibody immobilization of platelet antigen (MAIPA) assay were performed. Finally, treatment process was monitored by our quantitative FCIA in 8 newly diagnosed ITPs. The coefficient of variations (CV) of the quantitative FCIA assay were respectively 9.4, 3.8, 5.4, 5.1 and 5.8% for anti-GPIX, -GPIb, -GPIIIa, -GPIIb and -P-selectin autoantibodies. Elevated levels of autoantibodies against platelet glycoproteins GPIX, GPIb, GPIIIa, GPIIb and P-selectin were detected by our quantitative FCIA in ITP patients compared to non-ITP patients or healthy controls. The sensitivity, specificity and accuracy of our quantitative assay were respectively 73.13, 81.98 and 78.65% when combining all 5 autoantibodies, while the sensitivity, specificity and accuracy of MAIPA assay were respectively 41.46, 90.41 and 72.81%. A quantitative FCIA assay was established. Reduced levels of platelet autoantibodies could be confirmed by our quantitative FCIA in ITP patients after corticosteroid treatment. Our quantitative assay is not only good for ITP diagnosis but also for ITP treatment monitoring.

Comparative Evaluation of Quantitative Test Methods for Gases on a Hard Surface

DTIC Science & Technology

2017-02-01

COMPARATIVE EVALUATION OF QUANTITATIVE TEST METHODS FOR GASES ON A HARD SURFACE ECBC-TR-1426 Vipin Rastogi...1 COMPARATIVE EVALUATION OF QUANTITATIVE TEST METHODS FOR GASES ON A HARD SURFACE 1. INTRODUCTION Members of the U.S. Environmental...Generator 4 2.4 Experimental Design Each quantitative method was performed three times on three consecutive days. For the CD runs, three

Detection, monitoring, and quantitative analysis of wildfires with the BIRD satellite

NASA Astrophysics Data System (ADS)

Oertel, Dieter A.; Briess, Klaus; Lorenz, Eckehard; Skrbek, Wolfgang; Zhukov, Boris

2004-02-01

Increasing concern about environment and interest to avoid losses led to growing demands on space borne fire detection, monitoring and quantitative parameter estimation of wildfires. The global change research community intends to quantify the amount of gaseous and particulate matter emitted from vegetation fires, peat fires and coal seam fires. The DLR Institute of Space Sensor Technology and Planetary Exploration (Berlin-Adlershof) developed a small satellite called BIRD (Bi-spectral Infrared Detection) which carries a sensor package specially designed for fire detection. BIRD was launched as a piggy-back satellite on October 22, 2001 with ISRO"s Polar Satellite Launch Vehicle (PSLV). It is circling the Earth on a polar and sun-synchronous orbit at an altitude of 572 km and it is providing unique data for detailed analysis of high temperature events on Earth surface. The BIRD sensor package is dedicated for high resolution and reliable fire recognition. Active fire analysis is possible in the sub-pixel domain. The leading channel for fire detection and monitoring is the MIR channel at 3.8 μm. The rejection of false alarms is based on procedures using MIR/NIR (Middle Infra Red/Near Infra Red) and MIR/TIR (Middle Infra Red/Thermal Infra Red) radiance ratio thresholds. Unique results of BIRD wildfire detection and analysis over fire prone regions in Australia and Asia will be presented. BIRD successfully demonstrates innovative fire recognition technology for small satellites which permit to retrieve quantitative characteristics of active burning wildfires, such as the equivalent fire temperature, fire area, radiative energy release, fire front length and fire front strength.

Sample normalization methods in quantitative metabolomics.

PubMed

Wu, Yiman; Li, Liang

2016-01-22

To reveal metabolomic changes caused by a biological event in quantitative metabolomics, it is critical to use an analytical tool that can perform accurate and precise quantification to examine the true concentration differences of individual metabolites found in different samples. A number of steps are involved in metabolomic analysis including pre-analytical work (e.g., sample collection and storage), analytical work (e.g., sample analysis) and data analysis (e.g., feature extraction and quantification). Each one of them can influence the quantitative results significantly and thus should be performed with great care. Among them, the total sample amount or concentration of metabolites can be significantly different from one sample to another. Thus, it is critical to reduce or eliminate the effect of total sample amount variation on quantification of individual metabolites. In this review, we describe the importance of sample normalization in the analytical workflow with a focus on mass spectrometry (MS)-based platforms, discuss a number of methods recently reported in the literature and comment on their applicability in real world metabolomics applications. Sample normalization has been sometimes ignored in metabolomics, partially due to the lack of a convenient means of performing sample normalization. We show that several methods are now available and sample normalization should be performed in quantitative metabolomics where the analyzed samples have significant variations in total sample amounts. Copyright © 2015 Elsevier B.V. All rights reserved.

Electric Field Quantitative Measurement System and Method

NASA Technical Reports Server (NTRS)

Generazio, Edward R. (Inventor)

2016-01-01

A method and system are provided for making a quantitative measurement of an electric field. A plurality of antennas separated from one another by known distances are arrayed in a region that extends in at least one dimension. A voltage difference between at least one selected pair of antennas is measured. Each voltage difference is divided by the known distance associated with the selected pair of antennas corresponding thereto to generate a resulting quantity. The plurality of resulting quantities defined over the region quantitatively describe an electric field therein.

Micro-Droplet Detection Method for Measuring the Concentration of Alkaline Phosphatase-Labeled Nanoparticles in Fluorescence Microscopy

PubMed Central

Li, Rufeng; Wang, Yibei; Xu, Hong; Fei, Baowei; Qin, Binjie

2017-01-01

This paper developed and evaluated a quantitative image analysis method to measure the concentration of the nanoparticles on which alkaline phosphatase (AP) was immobilized. These AP-labeled nanoparticles are widely used as signal markers for tagging biomolecules at nanometer and sub-nanometer scales. The AP-labeled nanoparticle concentration measurement can then be directly used to quantitatively analyze the biomolecular concentration. Micro-droplets are mono-dispersed micro-reactors that can be used to encapsulate and detect AP-labeled nanoparticles. Micro-droplets include both empty micro-droplets and fluorescent micro-droplets, while fluorescent micro-droplets are generated from the fluorescence reaction between the APs adhering to a single nanoparticle and corresponding fluorogenic substrates within droplets. By detecting micro-droplets and calculating the proportion of fluorescent micro-droplets to the overall micro-droplets, we can calculate the AP-labeled nanoparticle concentration. The proposed micro-droplet detection method includes the following steps: (1) Gaussian filtering to remove the noise of overall fluorescent targets, (2) a contrast-limited, adaptive histogram equalization processing to enhance the contrast of weakly luminescent micro-droplets, (3) an red maximizing inter-class variance thresholding method (OTSU) to segment the enhanced image for getting the binary map of the overall micro-droplets, (4) a circular Hough transform (CHT) method to detect overall micro-droplets and (5) an intensity-mean-based thresholding segmentation method to extract the fluorescent micro-droplets. The experimental results of fluorescent micro-droplet images show that the average accuracy of our micro-droplet detection method is 0.9586; the average true positive rate is 0.9502; and the average false positive rate is 0.0073. The detection method can be successfully applied to measure AP-labeled nanoparticle concentration in fluorescence microscopy. PMID:29160812

Micro-Droplet Detection Method for Measuring the Concentration of Alkaline Phosphatase-Labeled Nanoparticles in Fluorescence Microscopy.

PubMed

Li, Rufeng; Wang, Yibei; Xu, Hong; Fei, Baowei; Qin, Binjie

2017-11-21

This paper developed and evaluated a quantitative image analysis method to measure the concentration of the nanoparticles on which alkaline phosphatase (AP) was immobilized. These AP-labeled nanoparticles are widely used as signal markers for tagging biomolecules at nanometer and sub-nanometer scales. The AP-labeled nanoparticle concentration measurement can then be directly used to quantitatively analyze the biomolecular concentration. Micro-droplets are mono-dispersed micro-reactors that can be used to encapsulate and detect AP-labeled nanoparticles. Micro-droplets include both empty micro-droplets and fluorescent micro-droplets, while fluorescent micro-droplets are generated from the fluorescence reaction between the APs adhering to a single nanoparticle and corresponding fluorogenic substrates within droplets. By detecting micro-droplets and calculating the proportion of fluorescent micro-droplets to the overall micro-droplets, we can calculate the AP-labeled nanoparticle concentration. The proposed micro-droplet detection method includes the following steps: (1) Gaussian filtering to remove the noise of overall fluorescent targets, (2) a contrast-limited, adaptive histogram equalization processing to enhance the contrast of weakly luminescent micro-droplets, (3) an red maximizing inter-class variance thresholding method (OTSU) to segment the enhanced image for getting the binary map of the overall micro-droplets, (4) a circular Hough transform (CHT) method to detect overall micro-droplets and (5) an intensity-mean-based thresholding segmentation method to extract the fluorescent micro-droplets. The experimental results of fluorescent micro-droplet images show that the average accuracy of our micro-droplet detection method is 0.9586; the average true positive rate is 0.9502; and the average false positive rate is 0.0073. The detection method can be successfully applied to measure AP-labeled nanoparticle concentration in fluorescence microscopy.

Detection of Echinoderm Microtubule Associated Protein Like 4-Anaplastic Lymphoma Kinase Fusion Genes in Non-small Cell Lung Cancer Clinical Samples by a Real-time Quantitative Reverse Transcription Polymerase Chain Reaction Method.

PubMed

Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao

2016-12-20

Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.

Performance of two quantitative PCR methods for microbial source tracking of human sewage and implications for microbial risk assessment in recreational waters

EPA Science Inventory

Before new, rapid quantitative PCR (qPCR) methods for recreational water quality assessment and microbial source tracking (MST) can be useful in a regulatory context, an understanding of the ability of the method to detect a DNA target (marker) when the contaminant soure has been...

A probe-based quantitative PCR assay for detecting Tetracapsuloides bryosalmonae in fish tissue and environmental DNA water samples

USGS Publications Warehouse

Hutchins, Patrick; Sepulveda, Adam; Martin, Renee; Hopper, Lacey

2017-01-01

A probe-based quantitative real-time PCR assay was developed to detect Tetracapsuloides bryosalmonae, which causes proliferative kidney disease in salmonid fish, in kidney tissue and environmental DNA (eDNA) water samples. The limits of detection and quantification were 7 and 100 DNA copies for calibration standards and T. bryosalmonae was reliably detected down to 100 copies in tissue and eDNA samples. The assay presented here is a highly sensitive and quantitative tool for detecting T. bryosalmonae with potential applications for tissue diagnostics and environmental detection.

On the Agreement between Manual and Automated Methods for Single-Trial Detection and Estimation of Features from Event-Related Potentials

PubMed Central

Biurrun Manresa, José A.; Arguissain, Federico G.; Medina Redondo, David E.; Mørch, Carsten D.; Andersen, Ole K.

2015-01-01

The agreement between humans and algorithms on whether an event-related potential (ERP) is present or not and the level of variation in the estimated values of its relevant features are largely unknown. Thus, the aim of this study was to determine the categorical and quantitative agreement between manual and automated methods for single-trial detection and estimation of ERP features. To this end, ERPs were elicited in sixteen healthy volunteers using electrical stimulation at graded intensities below and above the nociceptive withdrawal reflex threshold. Presence/absence of an ERP peak (categorical outcome) and its amplitude and latency (quantitative outcome) in each single-trial were evaluated independently by two human observers and two automated algorithms taken from existing literature. Categorical agreement was assessed using percentage positive and negative agreement and Cohen’s κ, whereas quantitative agreement was evaluated using Bland-Altman analysis and the coefficient of variation. Typical values for the categorical agreement between manual and automated methods were derived, as well as reference values for the average and maximum differences that can be expected if one method is used instead of the others. Results showed that the human observers presented the highest categorical and quantitative agreement, and there were significantly large differences between detection and estimation of quantitative features among methods. In conclusion, substantial care should be taken in the selection of the detection/estimation approach, since factors like stimulation intensity and expected number of trials with/without response can play a significant role in the outcome of a study. PMID:26258532

Detection and quantification of ginsenoside Re in ginseng samples by a chromatographic immunostaining method using monoclonal antibody against ginsenoside Re.

PubMed

Morinaga, Osamu; Tanaka, Hiroyuki; Shoyama, Yukihiro

2006-01-02

A chromatographic immunostaining method has been developed for the determination of ginsenoside Re (G-Re) in ginseng samples on a polyethersulphone (PES) membrane. G-Re standard and the extracts of ginseng roots were applied to a PES membrane and developed by methanol-water-acetic acid (45:55:1, by volume). G-Re was clearly detected by an immunostaining method using a monoclonal antibody against G-Re. The coloring spots of G-Re were analyzed quantitatively using NIH Image software indicating at least 0.125 microg of G-Re was detectable. G-Re can be analyzed quantitatively between 0.25 and 4.0 microg.

Efficient quantitative assessment of facial paralysis using iris segmentation and active contour-based key points detection with hybrid classifier.

PubMed

Barbosa, Jocelyn; Lee, Kyubum; Lee, Sunwon; Lodhi, Bilal; Cho, Jae-Gu; Seo, Woo-Keun; Kang, Jaewoo

2016-03-12

Facial palsy or paralysis (FP) is a symptom that loses voluntary muscles movement in one side of the human face, which could be very devastating in the part of the patients. Traditional methods are solely dependent to clinician's judgment and therefore time consuming and subjective in nature. Hence, a quantitative assessment system becomes apparently invaluable for physicians to begin the rehabilitation process; and to produce a reliable and robust method is challenging and still underway. We introduce a novel approach for a quantitative assessment of facial paralysis that tackles classification problem for FP type and degree of severity. Specifically, a novel method of quantitative assessment is presented: an algorithm that extracts the human iris and detects facial landmarks; and a hybrid approach combining the rule-based and machine learning algorithm to analyze and prognosticate facial paralysis using the captured images. A method combining the optimized Daugman's algorithm and Localized Active Contour (LAC) model is proposed to efficiently extract the iris and facial landmark or key points. To improve the performance of LAC, appropriate parameters of initial evolving curve for facial features' segmentation are automatically selected. The symmetry score is measured by the ratio between features extracted from the two sides of the face. Hybrid classifiers (i.e. rule-based with regularized logistic regression) were employed for discriminating healthy and unhealthy subjects, FP type classification, and for facial paralysis grading based on House-Brackmann (H-B) scale. Quantitative analysis was performed to evaluate the performance of the proposed approach. Experiments show that the proposed method demonstrates its efficiency. Facial movement feature extraction on facial images based on iris segmentation and LAC-based key point detection along with a hybrid classifier provides a more efficient way of addressing classification problem on facial palsy type and degree

[A quantitative real time polymerase chain reaction for detection of HBV covalently closed circular DNA in livers of the HBV infected patients].

PubMed

Wang, Mei-Rong; Qiu, Ning; Lu, Shi-Chun; Xiu, Dian-Rong; Yu, Jian-Guo; Li, Tong; Liu, Xue-En; Zhuang, Hui

2011-05-01

To establish and optimize a sensitive and specific quantitative real-time polymerase chain reaction (PCR) method for detection of hepatitis B virus covalently closed circular DNA (HBV cccDNA) in liver tissue. Specific primers and probes were designed to detect HBV DNA (tDNA) and cccDNA. A series of plasmids (3.44 × 10(0) - 3.44 × 10(9) copies/µl) containing a full double-stranded copies of HBV genome (genotype C) were used to establish the standard curve of real-time PCR. Liver samples of 33 patients with HBV related hepatocellular carcinoma (HCC), 13 Chronic hepatitis B patients (CHB) and 10 non-HBV patients were collected to verify the sensitivity and specificity of the assay. A fraction of extracted DNA was digested with a Plasmid-Safe ATP-dependent Dnase (PSAD) for HBV cccDNA detection and the remaining was used for tDNA and β-globin detection. The amount (copies/cell) of HBV cccDNA and tDNA were measured by a real-time PCR, using β-globin housekeeping gene as a quantitation standard. The standard curves of real-time PCR with a linear range of 3.44 × 10(0) to 3.44 × 10(9) copies/µl were established for detecting HBV cccDNA and tDNA, and both of the lowest detection limits of HBV cccDNA and tDNA were 3.44 × 10(0) copies/µl. The lowest quantitation levels of HBV cccDNA in liver tissues tested in 33 HBV related HCC patients and 13 CHB patients were 0.003 copies/cell and 0.031 copies/cell, respectively. HBV cccDNA and tDNA in liver tissue of 10 non-HBV patient appeared to be negative. The true positive rate was increasing through the digestion of HBV DNA by PSAD, and the analytic specificity of cccDNA detection improved by 7.24 × 10(2) times. Liver tissues of 2 patients were retested 5 times in the PCR for detecting cccDNA and the coefficient of variations on cycle threshold (Ct) were between 0.224% - 0.609%. A highly sensitive and specific quantitative real time PCR method for the detection of HBV cccDNA in liver tissue was established and could be used

Validation of a simple liquid chromatographic method for determination and quantitation of residual ivermectin and doramectin in pig liver.

PubMed

Knold, Lone; Reitov, Marianne; Mortensen, Anna Birthe; Hansen-Møller, Jens

2002-01-01

A rapid and quantitative method for the extraction, derivatization, and liquid chromatography with fluorescence detection of ivermectin (IVM) and doramectin (DOM) residues in porcine liver was developed and validated. IVM and DOM were extracted from the liver samples with acetonitrile, the supernatant was evaporated to dryness at 37 degrees C under nitrogen, and the residue was reconstituted in 1-methylimidazole solution. After 2 min at room temperature, IVM and DOM were converted to a fluorescent derivative and then separated on a Hypersil ODS column. The derivatives of IVM and DOM were detected and quantitated with high specificity by fluorescence (excitation: 365 nm, emission: 475 nm). Abamectin was used as an internal standard. The mean extraction efficiencies from fortified samples (15 ng/g) were 75% for IVM and 70% for DOM. The limit of detection was 0.8 ng/g for both IVM and DOM.

A meta-classifier for detecting prostate cancer by quantitative integration of in vivo magnetic resonance spectroscopy and magnetic resonance imaging

NASA Astrophysics Data System (ADS)

Viswanath, Satish; Tiwari, Pallavi; Rosen, Mark; Madabhushi, Anant

2008-03-01

Recently, in vivo Magnetic Resonance Imaging (MRI) and Magnetic Resonance Spectroscopy (MRS) have emerged as promising new modalities to aid in prostate cancer (CaP) detection. MRI provides anatomic and structural information of the prostate while MRS provides functional data pertaining to biochemical concentrations of metabolites such as creatine, choline and citrate. We have previously presented a hierarchical clustering scheme for CaP detection on in vivo prostate MRS and have recently developed a computer-aided method for CaP detection on in vivo prostate MRI. In this paper we present a novel scheme to develop a meta-classifier to detect CaP in vivo via quantitative integration of multimodal prostate MRS and MRI by use of non-linear dimensionality reduction (NLDR) methods including spectral clustering and locally linear embedding (LLE). Quantitative integration of multimodal image data (MRI and PET) involves the concatenation of image intensities following image registration. However multimodal data integration is non-trivial when the individual modalities include spectral and image intensity data. We propose a data combination solution wherein we project the feature spaces (image intensities and spectral data) associated with each of the modalities into a lower dimensional embedding space via NLDR. NLDR methods preserve the relationships between the objects in the original high dimensional space when projecting them into the reduced low dimensional space. Since the original spectral and image intensity data are divorced from their original physical meaning in the reduced dimensional space, data at the same spatial location can be integrated by concatenating the respective embedding vectors. Unsupervised consensus clustering is then used to partition objects into different classes in the combined MRS and MRI embedding space. Quantitative results of our multimodal computer-aided diagnosis scheme on 16 sets of patient data obtained from the ACRIN trial, for which

Mapping quantitative trait loci for traits defined as ratios.

PubMed

Yang, Runqing; Li, Jiahan; Xu, Shizhong

2008-03-01

Many traits are defined as ratios of two quantitative traits. Methods of QTL mapping for regular quantitative traits are not optimal when applied to ratios due to lack of normality for traits defined as ratios. We develop a new method of QTL mapping for traits defined as ratios. The new method uses a special linear combination of the two component traits, and thus takes advantage of the normal property of the new variable. Simulation study shows that the new method can substantially increase the statistical power of QTL detection relative to the method which treats ratios as regular quantitative traits. The new method also outperforms the method that uses Box-Cox transformed ratio as the phenotype. A real example of QTL mapping for relative growth rate in soybean demonstrates that the new method can detect more QTL than existing methods of QTL mapping for traits defined as ratios.

Quantitative detection of astaxanthin and cantaxanthin in Atlantic salmon by resonance Raman spectroscopy

NASA Astrophysics Data System (ADS)

Ermakov, Igor V.; Ermakova, Maia R.; Gellermann, Werner

2006-02-01

Two major carotenoids species found in salmonids muscle tissues are astaxanthin and cantaxanthin. They are taken up from fish food and are responsible for the attractive red-orange color of salmon filet. Since carotenoids are powerful antioxidants and biomarkers of nutrient consumption, they are thought to indicate fish health and resistance to diseases in fish farm environments. Therefore, a rapid, accurate, quantitative optical technique for measuring carotenoid content in salmon tissues is of economic interest. We demonstrate the possibility of using fast, selective, quantitative detection of astaxanthin and cantaxanthin in salmon muscle tissues, employing resonance Raman spectroscopy. Analyzing strong Raman signals originating from the carbon-carbon double bond stretch vibrations of the carotenoid molecules under blue laser excitation, we are able to characterize quantitatively the concentrations of carotenoids in salmon muscle tissue. To validate the technique, we compared Raman data with absorption measurements of carotenoid extracts in acetone. A close correspondence was observed in absorption spectra for tissue extract in acetone and a pure astaxanthin solution. Raman results show a linear dependence between Raman and absorption data. The proposed technique holds promise as a method of rapid screening of carotenoid levels in fish muscle tissues and may be attractive for the fish farm industry to assess the dietary status of salmon, risk for infective diseases, and product quality control.

Dual color fluorescence quantitative detection of specific single-stranded DNA with molecular beacons and nucleic acid dye SYBR Green I.

PubMed

Xiang, Dong-Shan; Zhou, Guo-Hua; Luo, Ming; Ji, Xing-Hu; He, Zhi-Ke

2012-08-21

We have developed a dual color fluorescence quantitative detection method for specific single-stranded DNA with molecular beacons (MBs) and nucleic acid dye SYBR Green I by synchronous scanning fluorescence spectrometry. It is demonstrated by a reverse-transcription oligonucleotide sequence (target DNA, 33 bases) of RNA fragment of human immunodeficiency virus (HIV) as a model system. In the absence of target DNA, the MBs are in the stem-closed state, the fluorescence of 5-carboxy-X-rhodamine (ROX) is quenched by black hole quencher-2 (BHQ-2), and the interaction between SYBR Green I and the MBs is very weak. At this time the fluorescence signals of ROX and SYBR Green I are all very weak. In the presence of target DNA, MBs hybridize with target DNA and form a double-strand structure, the fluorophore ROX is separated from the quencher BHQ-2, and the fluorescence of ROX recovers. At the same time, SYBR Green I binds to hybridized dsDNA, whose fluorescence intensity is significantly enhanced. Thus, dual color fluorescence quantitative detection for the target DNA can be realized by synchronous scanning fluorescence spectrometry. In this strategy, the fluorescence signal of SYBR Green I is far larger than that of ROX, so the quantitative analysis of target DNA with the fluorescence intensity of SYBR Green I can significantly improve the detection sensitivity. In addition, the false-positive signals of MBs do not affect the fluorescence signals of nucleic acid dye SYBR Green I. Thereby, in the analysis of complex samples, quantitative analysis of target DNA with SYBR Green I can avoid the false-positive signals of MBs and improve the detection accuracy.

Validation of quantitative light-induced fluorescence-digital (QLF-D) for the detection of approximal caries in vitro.

PubMed

Ko, Hae-Youn; Kang, Si-Mook; Kim, Hee Eun; Kwon, Ho-Keun; Kim, Baek-Il

2015-05-01

Detection of approximal caries lesions can be difficult due to their anatomical position. This study aimed to assess the ability of the quantitative light-induced fluorescence-digital (QLF-D) in detecting approximal caries, and to compare the performance with those of the International Caries Detection and Assessment System II (ICDAS II) and digital radiography (DR). Extracted permanent teeth (n=100) were selected and mounted in pairs. The simulation pairs were assessed by one calibrated dentist using each detection method. After all the examinations, the teeth (n=95) were sectioned and examined histologically as gold standard. The modalities were compared in terms of sensitivity, specificity, areas under receiver operating characteristic curves (AUROC) for enamel (D1) and dentine (D3) levels. The intra-examiner reliability was assessed for all modalities. At D1 threshold, the ICDAS II presented the highest sensitivity (0.80) while the DR showed the highest specificity (0.89); however, the methods with the greatest AUC values at D1 threshold were DR and QLF-D (0.80 and 0.80 respectively). At D3 threshold, the methods with the highest sensitivity were ICDAS II and QLF-D (0.64 and 0.64 respectively) while the method with the lowest sensitivity was DR (0.50). However, with regard to the AUC values at D3 threshold, the QLF-D presented the highest value (0.76). All modalities showed to have excellent intra-examiner reliability. The newly developed QLF-D was not only able to detect proximal caries, but also showed to have comparable performance to the visual inspection and radiography in detecting proximal caries. QLF-D has the potential to be a useful detection method for proximal caries. Copyright © 2015 Elsevier Ltd. All rights reserved.

A quantitative strategy to detect changes in accessibility of protein regions to chemical modification on heterodimerization

PubMed Central

Dreger, Mathias; Leung, Bo Wah; Brownlee, George G; Deng, Tao

2009-01-01

We describe a method for studying quantitative changes in accessibility of surface lysine residues of the PB1 subunit of the influenza RNA polymerase as a result of association with the PA subunit to form a PB1-PA heterodimer. Our method combines two established methods: (i) the chemical modification of surface lysine residues of native proteins by N-hydroxysuccinimidobiotin (NHS-biotin) and (ii) the stable isotope labeling of amino acids in cell culture (SILAC) followed by tryptic digestion and mass spectrometry. By linking the chemical modification with the SILAC methodology for the first time, we obtain quantitative data on chemical modification allowing subtle changes in accessibility to be described. Five regions in the PB1 monomer showed altered reactivity to NHS-biotin when compared with the [PB1-PA] heterodimer. Mutational analysis of residues in two such regions—at K265 and K481 of PB1, which were about three- and twofold, respectively, less accessible to biotinylation in the PB1-PA heterodimer compared with the PB1 monomer, demonstrated that both K265 and K481 were crucial for polymerase function. This novel assay of quantitative profiling of biotinylation patterns (Q-POP assay) highlights likely conformational changes at important functional sites, as observed here for PB1, and may provide information on protein–protein interaction interfaces. The Q-POP assay should be a generally applicable approach and may detect novel functional sites suitable for targeting by drugs. PMID:19517532

A subagging regression method for estimating the qualitative and quantitative state of groundwater

NASA Astrophysics Data System (ADS)

Jeong, J.; Park, E.; Choi, J.; Han, W. S.; Yun, S. T.

2016-12-01

A subagging regression (SBR) method for the analysis of groundwater data pertaining to the estimation of trend and the associated uncertainty is proposed. The SBR method is validated against synthetic data competitively with other conventional robust and non-robust methods. From the results, it is verified that the estimation accuracies of the SBR method are consistent and superior to those of the other methods and the uncertainties are reasonably estimated where the others have no uncertainty analysis option. To validate further, real quantitative and qualitative data are employed and analyzed comparatively with Gaussian process regression (GPR). For all cases, the trend and the associated uncertainties are reasonably estimated by SBR, whereas the GPR has limitations in representing the variability of non-Gaussian skewed data. From the implementations, it is determined that the SBR method has potential to be further developed as an effective tool of anomaly detection or outlier identification in groundwater state data.

Originality Detection Software in a Graduate Policy Course: A Mixed-Methods Evaluation of Plagiarism

ERIC Educational Resources Information Center

Dreuth Zeman, Laura; Steen, Julie A.; Metz Zeman, Natalie

2011-01-01

The authors used a mixed-methods approach to evaluate the use of Turnitin originality detection software in a graduate social work course. Qualitative analysis of student responses revealed positive and negative spent completing assignments, and the tone of the class. Quantitative analysis of students' originality scores indicated a short-term…

A differential mobility spectrometry/mass spectrometry platform for the rapid detection and quantitation of DNA adduct dG-ABP.

PubMed

Kafle, Amol; Klaene, Joshua; Hall, Adam B; Glick, James; Coy, Stephen L; Vouros, Paul

2013-07-15

There is continued interest in exploring new analytical technologies for the detection and quantitation of DNA adducts, biomarkers which provide direct evidence of exposure and genetic damage in cells. With the goal of reducing clean-up steps and improving sample throughput, a Differential Mobility Spectrometry/Mass Spectrometry (DMS/MS) platform has been introduced for adduct analysis. A DMS/MS platform has been utilized for the analysis of dG-ABP, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl (4-ABP). After optimization of the DMS parameters, each sample was analyzed in just 30 s following a simple protein precipitation step of the digested DNA. A detection limit of one modification in 10^6 nucleosides has been achieved using only 2 µg of DNA. A brief comparison (quantitative and qualitative) with liquid chromatography/mass spectrometry is also presented highlighting the advantages of using the DMS/MS method as a high-throughput platform. The data presented demonstrate the successful application of a DMS/MS/MS platform for the rapid quantitation of DNA adducts using, as a model analyte, the deoxyguanosine adduct of the bladder carcinogen 4-aminobiphenyl. Copyright © 2013 John Wiley & Sons, Ltd.

Development of a quantitative PCR for detection of Lactobacillus plantarum starters during wine malolactic fermentation.

PubMed

Cho, Gyu-Sung; Krauss, Sabrina; Huch, Melanie; Du Toit, Maret; Franz, Charles M A P

2011-12-01

A quantitative, real-time PCR method was developed to enumerate Lactobacillus plantarum IWBT B 188 during the malolactic fermentation (MLF) in Grauburgunder wine. The qRT-PCR was strain-specific, as it was based on primers targeting a plasmid DNA sequence, or it was L. plantarum-specific, as it targeted a chromosomally located plantaricin gene sequence. Two 50 l wine fermentations were prepared. One was inoculated with 15 g/hl Saccharomyces cerevisiae, followed by L. plantarum IWBT B 188 at 3.6 × 10(6) CFU/ml, whereas the other was not inoculated (control). Viable cell counts were performed for up to 25 days on MRS agar, and the same cells were enumerated by qRT-PCR with both the plasmid or chromosomally encoded gene primers. The L. plantarum strain survived under the harsh conditions in the wine fermentation at levels above 10(5)/ml for approx. 10 days, after which cell numbers decreased to levels of 10(3) CFU/ml at day 25, and to below the detection limit after day 25. In the control, no lactic acid bacteria could be detected throughout the fermentation, with the exception of two sampling points where ca. 1 × 10(2) CFU/ml was detected. The minimum detection level for quantitative PCR in this study was 1 × 10(2) to 1 × 10(3) CFU/ml. The qRT-PCR results determined generally overestimated the plate count results by about 1 log unit, probably as a result of the presence of DNA from dead cells. Overall, qRT-PCR appeared to be well suited for specifically enumerating Lactobacillus plantarum starter cultures in the MLF in wine.

QUANTITATIVE DETECTION OF ENVIRONMENTALLY IMPORTANT DYES USING DIODE LASER/FIBER-OPTIC RAMAN

EPA Science Inventory

A compact diode laser/fiber-optic Raman spectrometer is used for quantitative detection of environmentally important dyes. This system is based on diode laser excitation at 782 mm, fiber optic probe technology, an imaging spectrometer, and state-of-the-art scientific CCD camera. ...

Development of a SYBR Green I real-time PCR for detection and quantitation of orthopoxvirus by using Ectromelia virus.

PubMed

Cheng, Wenyu; He, Xiaobing; Jia, Huaijie; Chen, Guohua; Wang, Cong; Zhang, Jun; Jing, Zhizhong

2018-04-01

Ectromelia virus (ECTV) is the causative agent of mousepox, which has devastating effects in laboratory-mouse colonies and causes economic loss in biomedical research. More importantly, ECTV has been extensively used as an excellent model for studies of the pathogenesis and immunobiology of human smallpox. A rapid and sensitive SYBR Green I-based real-time PCR assay was developed and used for the detection and quantitation of orthopoxvirus by using ECTV in this study. Primers targeted to the highly conserved region of major core protein P4b gene of orthopoxvirus were designed and the standard plasmid was constructed. This assay was able to detect a minimum of 10 copies of standard DNA and 5 TCID 50 units of ECTV. In addition, no cross-reactions were observed with two DNA viruses, such as herpes simplex virus and swine pseudorabies virus, and one RNA virus, vesicular stomatitis virus. Furthermore, intra- and inter-assay variability data showed that this method had a highly reproducibility and reliability. Moreover, the current assay was faster and had a higher sensitivity for detection of ECTV genomic DNA in cell cultured and clinical test samples. Therefore, the high sensitivity and reproducibility of this SYBR Green real-time PCR approach is a more effective method than the conventional PCR for ECTV diagnosis and quantitation. Copyright © 2017. Published by Elsevier Ltd.

[Investigation of quantitative detection of water quality using spectral fluorescence signature].

PubMed

He, Jun-hua; Cheng, Yong-jin; Han, Yan-ling; Zhang, Hao; Yang, Tao

2008-08-01

A method of spectral analysis, which can simultaneously detect dissolved organic matter (DOM) and chlorophyll a (Chl-a) in natural water, was developed in the present paper with the intention of monitoring water quality fast and quantitatively. Firstly, the total luminescence spectra (TLS) of water sample from East Lake in Wuhan city were measured by the use of laser (532 nm) induced fluorescence (LIF). There were obvious peaks of relative intensity at the wavelength value of 580, 651 and 687 nm in the TLS of the sample, which correspond respectively to spectra of DOM, and the Raman scattering of water and Chl-a in the water. Then the spectral fluorescence signature (SFS) technique was adopted to analyze and distinguish spectral characteristics of DOM and Chl-a in natural water. The calibration curves and function expressions, which indicate the relation between the normalized fluorescence intensities of DOM and Chl-a in water and their concentrations, were obtained respectively under the condition of low concentration(< 40 mg x L(-1))by using normalization of Raman scattering spectrum of water. The curves have a high linearity. When the concentration of the solution with humic acid is large (> 40 mg x L(-1)), the Raman scattering signal is totally absorbed by the molecules of humic acid being on the ground state, so the normalization technique can not be adopted. However the function expression between the concentration of the solution with humic acid and its relative fluorescence peak intensity can be acquired directly with the aid of experiment of fluorescence spectrum. It is concluded that although the expression is non-linearity as a whole, there is a excellent linear relation between the fluorescence intensity and concentration of DOM when the concentration is less than 200 mg x L(-1). The method of measurement based on spectral fluorescence signature technique and the calibration curves gained will have prospects of broad application. It can recognize fast

SU-F-J-112: Clinical Feasibility Test of An RF Pulse-Based MRI Method for the Quantitative Fat-Water Segmentation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yee, S; Wloch, J; Pirkola, M

Purpose: Quantitative fat-water segmentation is important not only because of the clinical utility of fat-suppressed MRI images in better detecting lesions of clinical significance (in the midst of bright fat signal) but also because of the possible physical need, in which CT-like images based on the materials’ photon attenuation properties may have to be generated from MR images; particularly, as in the case of MR-only radiation oncology environment to obtain radiation dose calculation or as in the case of hybrid PET/MR modality to obtain attenuation correction map for the quantitative PET reconstruction. The majority of such fat-water quantitative segmentations havemore » been performed by utilizing the Dixon’s method and its variations, which have to enforce the proper settings (often predefined) of echo time (TE) in the pulse sequences. Therefore, such methods have been unable to be directly combined with those ultrashort TE (UTE) sequences that, taking the advantage of very low TE values (∼ 10’s microsecond), might be beneficial to directly detect bones. Recently, an RF pulse-based method (http://dx.doi.org/10.1016/j.mri.2015.11.006), termed as PROD pulse method, was introduced as a method of quantitative fat-water segmentation that does not have to depend on predefined TE settings. Here, the clinical feasibility of this method is verified in brain tumor patients by combining the PROD pulse with several sequences. Methods: In a clinical 3T MRI, the PROD pulse was combined with turbo spin echo (e.g. TR=1500, TE=16 or 60, ETL=15) or turbo field echo (e.g. TR=5.6, TE=2.8, ETL=12) sequences without specifying TE values. Results: The fat-water segmentation was possible without having to set specific TE values. Conclusion: The PROD pulse method is clinically feasible. Although not yet combined with UTE sequences in our laboratory, the method is potentially compatible with UTE sequences, and thus, might be useful to directly segment fat, water, bone and air.« less

Detection of Microcystin-Producing Cyanobacteria in Missisquoi Bay, Quebec, Canada, Using Quantitative PCR▿

PubMed Central

Fortin, Nathalie; Aranda-Rodriguez, Rocio; Jing, Hongmei; Pick, Frances; Bird, David; Greer, Charles W.

2010-01-01

Toxic cyanobacterial blooms, as well as their increasing global occurrence, pose a serious threat to public health, domestic animals, and livestock. In Missisquoi Bay, Lake Champlain, public health advisories have been issued from 2001 to 2009, and local microcystin concentrations found in the lake water regularly exceeded the Canadian drinking water guideline of 1.5 μg liter−1. A quantitative PCR (Q-PCR) approach was developed for the detection of blooms formed by microcystin-producing cyanobacteria. Primers were designed for the β-ketoacyl synthase (mcyDKS) and the first dehydratase domain (mcyDDH) of the mcyD gene, involved in microcystin synthesis. The Q-PCR method was used to track the toxigenic cyanobacteria in Missisquoi Bay during the summers of 2006 and 2007. Two toxic bloom events were detected in 2006: more than 6.5 × 104 copies of the mcyDKS gene ml−1 were detected in August, and an average of 4.0 × 104 copies ml−1 were detected in September, when microcystin concentrations were more than 4 μg liter−1 and approximately 2 μg liter−1, respectively. Gene copy numbers and total microcystin concentrations (determined by enzyme-linked immunosorbent assay [ELISA]) were highly correlated in the littoral (r = 0.93, P < 0.001) and the pelagic station (r = 0.87, P < 0.001) in 2006. In contrast to the situation in 2006, a cyanobacterial bloom occurred only in late summer-early fall of 2007, reaching only 3 × 102 mcyDKS copies ml−1, while the microcystin concentration was barely detectable. The Q-PCR method allowed the detection of microcystin-producing cyanobacteria when toxins and toxigenic cyanobacterial abundance were still below the limit of detection by high-pressure liquid chromatography (HPLC) and microscopy. Toxin gene copy numbers grew exponentially at a steady rate over a period of 7 weeks. Onshore winds selected for cells with a higher cell quota of microcystin. This technique could be an effective approach for the routine monitoring

Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

PubMed

Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

2017-08-01

The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

An image overall complexity evaluation method based on LSD line detection

NASA Astrophysics Data System (ADS)

Li, Jianan; Duan, Jin; Yang, Xu; Xiao, Bo

2017-04-01

In the artificial world, whether it is the city's traffic roads or engineering buildings contain a lot of linear features. Therefore, the research on the image complexity of linear information has become an important research direction in digital image processing field. This paper, by detecting the straight line information in the image and using the straight line as the parameter index, establishing the quantitative and accurate mathematics relationship. In this paper, we use LSD line detection algorithm which has good straight-line detection effect to detect the straight line, and divide the detected line by the expert consultation strategy. Then we use the neural network to carry on the weight training and get the weight coefficient of the index. The image complexity is calculated by the complexity calculation model. The experimental results show that the proposed method is effective. The number of straight lines in the image, the degree of dispersion, uniformity and so on will affect the complexity of the image.

Advancing the study of violence against women using mixed methods: integrating qualitative methods into a quantitative research program.

PubMed

Testa, Maria; Livingston, Jennifer A; VanZile-Tamsen, Carol

2011-02-01

A mixed methods approach, combining quantitative with qualitative data methods and analysis, offers a promising means of advancing the study of violence. Integrating semi-structured interviews and qualitative analysis into a quantitative program of research on women's sexual victimization has resulted in valuable scientific insight and generation of novel hypotheses for testing. This mixed methods approach is described and recommendations for integrating qualitative data into quantitative research are provided.

Stable isotope labelling methods in mass spectrometry-based quantitative proteomics.

PubMed

Chahrour, Osama; Cobice, Diego; Malone, John

2015-09-10

Mass-spectrometry based proteomics has evolved as a promising technology over the last decade and is undergoing a dramatic development in a number of different areas, such as; mass spectrometric instrumentation, peptide identification algorithms and bioinformatic computational data analysis. The improved methodology allows quantitative measurement of relative or absolute protein amounts, which is essential for gaining insights into their functions and dynamics in biological systems. Several different strategies involving stable isotopes label (ICAT, ICPL, IDBEST, iTRAQ, TMT, IPTL, SILAC), label-free statistical assessment approaches (MRM, SWATH) and absolute quantification methods (AQUA) are possible, each having specific strengths and weaknesses. Inductively coupled plasma mass spectrometry (ICP-MS), which is still widely recognised as elemental detector, has recently emerged as a complementary technique to the previous methods. The new application area for ICP-MS is targeting the fast growing field of proteomics related research, allowing absolute protein quantification using suitable elemental based tags. This document describes the different stable isotope labelling methods which incorporate metabolic labelling in live cells, ICP-MS based detection and post-harvest chemical label tagging for protein quantification, in addition to summarising their pros and cons. Copyright © 2015 Elsevier B.V. All rights reserved.

Highly sensitive quantitative PCR for the detection and differentiation of Pseudogymnoascus destructans and other Pseudogymnoascus species.

PubMed

Shuey, Megan M; Drees, Kevin P; Lindner, Daniel L; Keim, Paul; Foster, Jeffrey T

2014-03-01

White-nose syndrome is a fungal disease that has decimated bat populations across eastern North America. Identification of the etiologic agent, Pseudogymnoascus destructans (formerly Geomyces destructans), in environmental samples is essential to proposed management plans. A major challenge is the presence of closely related species, which are ubiquitous in many soils and cave sediments and often present in high abundance. We present a dual-probe real-time quantitative PCR assay capable of detecting and differentiating P. destructans from closely related fungi in environmental samples from North America. The assay, based on a single nucleotide polymorphism (SNP) specific to P. destructans, is capable of rapid low-level detection from various sampling media, including sediment, fecal samples, wing biopsy specimens, and skin swabs. This method is a highly sensitive, high-throughput method for identifying P. destructans, other Pseudogymnoascus spp., and Geomyces spp. in the environment, providing a fundamental component of research and risk assessment for addressing this disease, as well as other ecological and mycological work on related fungi.

High-throughput method for the quantitation of metabolites and co-factors from homocysteine-methionine cycle for nutritional status assessment.

PubMed

Da Silva, Laeticia; Collino, Sebastiano; Cominetti, Ornella; Martin, Francois-Pierre; Montoliu, Ivan; Moreno, Sergio Oller; Corthesy, John; Kaput, Jim; Kussmann, Martin; Monteiro, Jacqueline Pontes; Guiraud, Seu Ping

2016-09-01

There is increasing interest in the profiling and quantitation of methionine pathway metabolites for health management research. Currently, several analytical approaches are required to cover metabolites and co-factors. We report the development and the validation of a method for the simultaneous detection and quantitation of 13 metabolites in red blood cells. The method, validated in a cohort of healthy human volunteers, shows a high level of accuracy and reproducibility. This high-throughput protocol provides a robust coverage of central metabolites and co-factors in one single analysis and in a high-throughput fashion. In large-scale clinical settings, the use of such an approach will significantly advance the field of nutritional research in health and disease.

Rapid and Inexpensive Screening of Genomic Copy Number Variations Using a Novel Quantitative Fluorescent PCR Method

PubMed Central

Han, Joan C.; Elsea, Sarah H.; Pena, Heloísa B.; Pena, Sérgio Danilo Junho

2013-01-01

Detection of human microdeletion and microduplication syndromes poses significant burden on public healthcare systems in developing countries. With genome-wide diagnostic assays frequently inaccessible, targeted low-cost PCR-based approaches are preferred. However, their reproducibility depends on equally efficient amplification using a number of target and control primers. To address this, the recently described technique called Microdeletion/Microduplication Quantitative Fluorescent PCR (MQF-PCR) was shown to reliably detect four human syndromes by quantifying DNA amplification in an internally controlled PCR reaction. Here, we confirm its utility in the detection of eight human microdeletion syndromes, including the more common WAGR, Smith-Magenis, and Potocki-Lupski syndromes with 100% sensitivity and 100% specificity. We present selection, design, and performance evaluation of detection primers using variety of approaches. We conclude that MQF-PCR is an easily adaptable method for detection of human pathological chromosomal aberrations. PMID:24288428

Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

EPA Science Inventory

A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

Rapid Quantitative Detection of Lactobacillus sakei in Meat and Fermented Sausages by Real-Time PCR

PubMed Central

Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa

2006-01-01

A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages. PMID:16957227

Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by real-time PCR.

PubMed

Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa

2006-09-01

A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages.

Probability of Detection (POD) as a statistical model for the validation of qualitative methods.

PubMed

Wehling, Paul; LaBudde, Robert A; Brunelle, Sharon L; Nelson, Maria T

2011-01-01

A statistical model is presented for use in validation of qualitative methods. This model, termed Probability of Detection (POD), harmonizes the statistical concepts and parameters between quantitative and qualitative method validation. POD characterizes method response with respect to concentration as a continuous variable. The POD model provides a tool for graphical representation of response curves for qualitative methods. In addition, the model allows comparisons between candidate and reference methods, and provides calculations of repeatability, reproducibility, and laboratory effects from collaborative study data. Single laboratory study and collaborative study examples are given.

A novel sulfate-reducing bacteria detection method based on inhibition of cysteine protease activity.

PubMed

Qi, Peng; Zhang, Dun; Wan, Yi

2014-11-01

Sulfate-reducing bacteria (SRB) have been extensively studied in corrosion and environmental science. However, fast enumeration of SRB population is still a difficult task. This work presents a novel specific SRB detection method based on inhibition of cysteine protease activity. The hydrolytic activity of cysteine protease was inhibited by taking advantage of sulfide, the characteristic metabolic product of SRB, to attack active cysteine thiol group in cysteine protease catalytic sites. The active thiol S-sulfhydration process could be used for SRB detection, since the amount of sulfide accumulated in culture medium was highly related with initial bacterial concentration. The working conditions of cysteine protease have been optimized to obtain better detection capability, and the SRB detection performances have been evaluated in this work. The proposed SRB detection method based on inhibition of cysteine protease activity avoided the use of biological recognition elements. In addition, compared with the widely used most probable number (MPN) method which would take up to at least 15days to accomplish whole detection process, the method based on inhibition of papain activity could detect SRB in 2 days, with a detection limit of 5.21×10(2) cfu mL(-1). The detection time for SRB population quantitative analysis was greatly shortened. Copyright © 2014 Elsevier B.V. All rights reserved.

Rapid Trace Detection and Isomer Quantitation of Pesticide Residues via Matrix-Assisted Laser Desorption/Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectrometry.

PubMed

Wu, Xinzhou; Li, Weifeng; Guo, Pengran; Zhang, Zhixiang; Xu, Hanhong

2018-04-18

Matrix-assisted laser desorption/ionization Fourier transform ion cyclotron resonance mass spectrometry (MALDI-FTICR-MS) has been applied for rapid, sensitive, undisputed, and quantitative detection of pesticide residues on fresh leaves with little sample pretreatment. Various pesticides (insecticides, bactericides, herbicides, and acaricides) are detected directly in the complex matrix with excellent limits of detection down to 4 μg/L. FTICR-MS could unambiguously identify pesticides with tiny mass differences (∼0.017 75 Da), thereby avoiding false-positive results. Remarkably, pesticide isomers can be totally discriminated by use of diagnostic fragments, and quantitative analysis of pesticide isomers is demonstrated. The present results expand the horizons of the MALDI-FTICR-MS platform in the reliable determination of pesticides, with integrated advantages of ultrahigh mass resolution and accuracy. This method provides growing evidence for the resultant detrimental effects of pesticides, expediting the identification and evaluation of innovative pesticides.

Multiresidue method for detection of pesticides in beef meat using liquid chromatography coupled to mass spectrometry detection (LC-MS) after QuEChERS extraction.

PubMed

Oliveira, Fabiano Aurélio da Silva; Pereira, Elba Nathália Corrêa; Gobbi, Jennifer Mattedi; Soto-Blanco, Benito; Melo, Marília Martins

2018-01-01

Beef meat is an important food that can be contaminated by pesticides. This study aimed to optimize a multiresidue method for identification and quantification of pesticides in beef meat by liquid chromatography coupled to mass spectrometry detection (LC-MS). The extraction and clean-up procedures were adapted from the QuECHERS method. From the 188 analytes tested, the method was validated as qualitative method for 19 compounds and as quantitative method for 152 compounds. The results were satisfactory, yielding coefficients of variation of less than 20% and recoveries ranging from 70% to 120% and expanded uncertainty of less than 50%. The quantification limit was typically 10 µg kg -1 (but 25 µg kg -1 for 12 of the compounds) and the detection limit was 5.0 µg kg -1 . Thirty-two real samples of commercialized beef meat were analyzed without any residual pesticide being found. Thus, the results showed that the multiresidue method for detecting 171 pesticides, using adapted QuECHERS for extraction and LC-MS for detection, is suitable for analyzing beef meat.

A competitive enzyme immunoassay for the quantitative detection of cocaine from banknotes and latent fingermarks.

PubMed

van der Heide, Susan; Garcia Calavia, Paula; Hardwick, Sheila; Hudson, Simon; Wolff, Kim; Russell, David A

2015-05-01

A sensitive and versatile competitive enzyme immunoassay (cEIA) has been developed for the quantitative detection of cocaine in complex forensic samples. Polyclonal anti-cocaine antibody was purified from serum and deposited onto microtiter plates. The concentration of the cocaine antibody adsorbed onto the plates, and the dilution of the cocaine-HRP hapten were both studied to achieve an optimised immunoassay. The method was successfully used to quantify cocaine in extracts taken from both paper currency and latent fingermarks. The limit of detection (LOD) of 0.162ngmL(-1) achieved with the assay compares favourably to that of conventional chromatography-mass spectroscopy techniques, with an appropriate sensitivity for the quantification of cocaine at the low concentrations present in some forensic samples. The cEIA was directly compared to LC-MS for the analysis of ten UK banknote samples. The results obtained from both techniques were statistically similar, suggesting that the immunoassay was unaffected by cross-reactivity with potentially interfering compounds. The cEIA was used also for the detection of cocaine in extracts from latent fingermarks. The results obtained were compared to the cocaine concentrations detected in oral fluid sampled from the same individual. Using the cEIA, we have shown, for the first time, that endogeneously excreted cocaine can be detected and quantified from a single latent fingermark. Additionally, it has been shown that the presence of cocaine, at similar concentrations, in more than one latent fingermark from the same individual can be linked with those concentrations found in oral fluid. These results show that detection of drugs in latent fingermarks could directly indicate whether an individual has consumed the drug. The specificity and feasibility of measuring low concentrations of cocaine in complex forensic samples demonstrate the effectiveness and robustness of the assay. The immunoassay presents a simple and cost

Enamel microcracks in terms of orthodontic treatment: A novel method for their detection and evaluation.

PubMed

Dumbryte, Irma; Linkeviciene, Laura; Linkevicius, Tomas; Malinauskas, Mangirdas

2017-07-26

The study aimed at introducing current available techniques for enamel microcracks (EMCs) detection, and presenting a method for direct quantitative analysis of an individual EMC. Measurements of the detailed EMCs characteristics (location, length, and width) were taken from the reconstructed images of the buccal tooth surface (teeth extracted from two age groups of patients) employing a scanning electron microscopy (SEM) and our derived formulas before and after ceramic brackets removal. Measured parameters of EMCs for younger age group were 2.41 µm (width), 3.68 mm (length) before and 2.73 µm, 3.90 mm after debonding; for older -4.03 µm, 4.35 mm before and 4.80 µm, 4.37 mm after brackets removal. Following debonding EMCs increased for both groups, however the changes in width and length were statistically insignificant. Regardless of the age group, proposed method enabled precise detection of the same EMC before and after debonding, and quantitative examination of its characteristics.

Collection of quantitative chemical release field data.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Demirgian, J.; Macha, S.; Loyola Univ.

1999-01-01

Detection and quantitation of chemicals in the environment requires Fourier-transform infrared (FTIR) instruments that are properly calibrated and tested. This calibration and testing requires field testing using matrices that are representative of actual instrument use conditions. Three methods commonly used for developing calibration files and training sets in the field are a closed optical cell or chamber, a large-scale chemical release, and a small-scale chemical release. There is no best method. The advantages and limitations of each method should be considered in evaluating field results. Proper calibration characterizes the sensitivity of an instrument, its ability to detect a component inmore » different matrices, and the quantitative accuracy and precision of the results.« less

A liquid chromatography–tandem mass spectrometric method for quantitative determination of native 5-methyltetrahydrofolate and its polyglutamyl derivatives in raw vegetables

PubMed Central

Wang, Chao; Riedl, Ken M.; Schwartz, Steven J.

2013-01-01

Folate deficiency is a prevalent phenomenon worldwide especially in underprivileged countries. Polyglutamyl 5-methyltetrahydrofolate (5MTHF) species are the naturally occurring principle folate in store-bought vegetables. Here we report a simple and complete extraction method for the determination of native polyglutamyl 5-methyltetrahydrofolate in vegetables using high performance liquid chromatography with tandem mass spectrometric detection (HPLC–MS/MS). Coarsely chopped samples (18 different vegetables) were steamed to inactivate glutamylase enzymes and liberate folate from binding proteins and extracted in a reducing buffer with 13C5 5MTHF stable isotope added as internal standard. The polyglutamyl 5-methyltetrahydrofolate species were separated in 9 min on a C18 column using a reversed phase system. HPLC eluate was interfaced with a triple quadrupole mass spectrometer operated in electrospray positive mode. The respective pseudomolecular cation of each polyglutamyl 5-methyltetrahydrofolate species was selected for fragmentation to a common daughter ion for detection. We quantitated polyglutamyl 5-methyltetrahydrofolate in store-bought vegetables from families Brassicaceae, Asteraceae and Amaranthaceae (including mustard greens, romaine lettuce and Swiss chard) of which most have not been quantitated previously. Most vegetables from Asteraceae and those from Amaranthaceae contained similar amounts of monoglutamyl 5MTHF and polyglutamyl 5MTHF while Brassicaceae were dominated by polyglutamyls and endive species (Asteraceae) contained mainly monoglutamyl 5MTHF. The precision of the method for the various polyglutamyl 5-methyltetrahydrofolate forms was 1–9% RSD, recovery 84–91%, limit of detection 64–658 fmol and limit of quantitation 193–1994 fmol. Herein we describe a rapid, sensitive and selective HPLC–MS/MS technique to quantitate polyglutamyl 5-methyltetrahydrofolate species. This method may be suitable for analyzing the polyglutamyl 5

ADVANCING THE STUDY OF VIOLENCE AGAINST WOMEN USING MIXED METHODS: INTEGRATING QUALITATIVE METHODS INTO A QUANTITATIVE RESEARCH PROGRAM

PubMed Central

Testa, Maria; Livingston, Jennifer A.; VanZile-Tamsen, Carol

2011-01-01

A mixed methods approach, combining quantitative with qualitative data methods and analysis, offers a promising means of advancing the study of violence. Integrating semi-structured interviews and qualitative analysis into a quantitative program of research on women’s sexual victimization has resulted in valuable scientific insight and generation of novel hypotheses for testing. This mixed methods approach is described and recommendations for integrating qualitative data into quantitative research are provided. PMID:21307032

Qualitative and quantitative analysis of the diuretic component ergone in Polyporus umbellatus by HPLC with fluorescence detection and HPLC-APCI-MS/MS.

PubMed

Zhao, Ying-Yong; Zhao, Ye; Zhang, Yong-Min; Lin, Rui-Chao; Sun, Wen-Ji

2009-06-01

Polyporus umbellatus is a widely used anti-aldosteronic diuretic in Traditional Chinese medicine (TCM). A new, sensitive and selective high-performance liquid chromatography-fluorescence detector (HPLC-FLD) and high-performance liquid chromatography-atmospheric pressure chemical ionization-mass spectrometry (HPLC-APCI-MS/MS) method for quantitative and qualitative determination of ergosta-4,6,8(14),22-tetraen-3-one(ergone), which is the main diuretic component, was provided for quality control of P. umbellatus crude drug. The ergone in the ethanolic extract of P. umbellatus was unambiguously characterized by HPLC-APCI, and further confirmed by comparing with a standard compound. The trace ergone was detected by the sensitive and selective HPLC-FLD. Linearity (r2 > 0.9998) and recoveries of low, medium and high concentration (100.5%, 100.2% and 100.4%) were consistent with the experimental criteria. The limit of detection (LOD) of ergone was around 0.2 microg/mL. Our results indicated that the content of ergone in P. umbellatus varied significantly from habitat to habitat with contents ranging from 2.13 +/- 0.02 to 59.17 +/- 0.05 microg/g. Comparison among HPLC-FLD and HPLC-UV or HPLC-APCI-MS/MS demonstrated that the HPLC-FLD and HPLC-APCI-MS/MS methods gave similar quantitative results for the selected herb samples, the HPLC-UV methods gave lower quantitative results than HPLC-FLD and HPLC-APCI-MS/MS methods. The established new HPLC-FLD method has the advantages of being rapid, simple, selective and sensitive, and could be used for the routine analysis of P. umbellatus crude drug.

Methodological Reporting in Qualitative, Quantitative, and Mixed Methods Health Services Research Articles

PubMed Central

Wisdom, Jennifer P; Cavaleri, Mary A; Onwuegbuzie, Anthony J; Green, Carla A

2012-01-01

Objectives Methodologically sound mixed methods research can improve our understanding of health services by providing a more comprehensive picture of health services than either method can alone. This study describes the frequency of mixed methods in published health services research and compares the presence of methodological components indicative of rigorous approaches across mixed methods, qualitative, and quantitative articles. Data Sources All empirical articles (n = 1,651) published between 2003 and 2007 from four top-ranked health services journals. Study Design All mixed methods articles (n = 47) and random samples of qualitative and quantitative articles were evaluated to identify reporting of key components indicating rigor for each method, based on accepted standards for evaluating the quality of research reports (e.g., use of p-values in quantitative reports, description of context in qualitative reports, and integration in mixed method reports). We used chi-square tests to evaluate differences between article types for each component. Principal Findings Mixed methods articles comprised 2.85 percent (n = 47) of empirical articles, quantitative articles 90.98 percent (n = 1,502), and qualitative articles 6.18 percent (n = 102). There was a statistically significant difference (χ2(1) = 12.20, p = .0005, Cramer's V = 0.09, odds ratio = 1.49 [95% confidence interval = 1,27, 1.74]) in the proportion of quantitative methodological components present in mixed methods compared to quantitative papers (21.94 versus 47.07 percent, respectively) but no statistically significant difference (χ2(1) = 0.02, p = .89, Cramer's V = 0.01) in the proportion of qualitative methodological components in mixed methods compared to qualitative papers (21.34 versus 25.47 percent, respectively). Conclusion Few published health services research articles use mixed methods. The frequency of key methodological components is variable. Suggestions are provided to increase the

Static headspace gas chromatographic method for quantitative determination of residual solvents in pharmaceutical drug substances according to european pharmacopoeia requirements.

PubMed

Otero, Raquel; Carrera, Guillem; Dulsat, Joan Francesc; Fábregas, José Luís; Claramunt, Juan

2004-11-19

A static headspace (HS) gas chromatographic method for quantitative determination of residual solvents in a drug substance has been developed according to European Pharmacopoeia general procedure. A water-dimethylformamide mixture is proposed as sample solvent to obtain good sensitivity and recovery. The standard addition technique with internal standard quantitation was used for ethanol, tetrahydrofuran and toluene determination. Validation was performed within the requirements of ICH validation guidelines Q2A and Q2B. Selectivity was tested for 36 solvents, and system suitability requirements described in the European Pharmacopoeia were checked. Limits of detection and quantitation, precision, linearity, accuracy, intermediate precision and robustness were determined, and excellent results were obtained.

A selective and sensitive method for quantitation of lysergic acid diethylamide (LSD) in whole blood by gas chromatography-ion trap tandem mass spectrometry.

PubMed

Libong, Danielle; Bouchonnet, Stéphane; Ricordel, Ivan

2003-01-01

A gas chromatography-ion trap tandem mass spectrometry (GC-ion trap MS-MS) method for detection and quantitation of LSD in whole blood is presented. The sample preparation process, including a solid-phase extraction step with Bond Elut cartridges, was performed with 2 mL of whole blood. Eight microliters of the purified extract was injected with a cold on-column injection method. Positive chemical ionization was performed using acetonitrile as reagent gas; LSD was detected in the MS-MS mode. The chromatograms obtained from blood extracts showed the great selectivity of the method. GC-MS quantitation was performed using lysergic acid methylpropylamide as the internal standard. The response of the MS was linear for concentrations ranging from 0.02 ng/mL (detection threshold) to 10.0 ng/mL. Several parameters such as the choice of the capillary column, the choice of the internal standard and that of the ionization mode (positive CI vs. EI) were rationalized. Decomposition pathways under both ionization modes were studied. Within-day and between-day stability were evaluated.

Quantitative detection of pork in commercial meat products by TaqMan® real-time PCR assay targeting the mitochondrial D-loop region.

PubMed

Kim, Miju; Yoo, Insuk; Lee, Shin-Young; Hong, Yeun; Kim, Hae-Yeong

2016-11-01

The TaqMan® real-time PCR assay using the mitochondrial D-loop region was developed for the quantitative detection of pork in processed meat products. The newly designed primers and probe specifically amplified pork without any cross-reactivity with non-target animal species. The limit of detection of the real-time PCR assay was 0.1pg of heat-treated pork meat and 0.1% (w/w) pork meat in beef and chicken meat mixtures. The quantitative real-time PCR assay was applied to analyze the pork meat content in 22 commercial processed meat products including jerkies, press hams, sausages, hamburger patties and steaks, grilled short rib patties, and nuggets. The developed real-time PCR method was able to detect pork meat in various types of processed meat products that declared the use of pork meat on their label. All processed meat products that declared no use of pork meat showed a negative result in the assay. The method developed in this study showed sensitivity and specificity in the quantification of pork meat in commercial processed meat products. Copyright © 2016 Elsevier Ltd. All rights reserved.

High Sensitivity Detection of Broadband Acoustic Vibration Using Optical Demodulation Method

NASA Astrophysics Data System (ADS)

Zhang, Zhen

Measuring the high frequency acoustic vibrations represents the fundamental interest in revealing the intrinsic dynamic characteristic of board range of systems, such as the growth of the fetus, blood flow in human palms, and vibrations of carbon nanotube. However, the acoustic wave detection capability is limited by the detection bandwidth and sensitivity of the commonly used piezoelectric based ultrasound detectors. To overcome these limitations, this thesis focuses on exploring the optical demodulation method for highly sensitive detection of broadband acoustic vibration. First, a transparent optical ultrasonic detector has been developed using micro-ring resonator (MRR) made of soft polymeric materials. It outperforms the traditional piezoelectric detectors with broader detection bandwidth, miniaturized size and wide angular sensitivity. Its ease of integration into photoacoustic microscopy system has resulted in the great improvement of the imaging resolution. A theoretic framework has been developed to establish the quantitative understanding of its unique distance and angular dependent detection characteristics and was subsequently validated experimentally. The developed theoretic framework provides a guideline to fully accounts for the trade-offs between axial and lateral resolution, working distance, and the field of view in developing optimal imaging performance for a wide range of biological and clinical applications. MRR-based ultrasonic detector is further integrated into confocal fluorescence microscopy to realize the simultaneous imaging of fluorescence and optical absorption of retinal pigment epithelium, achieving multi-contrast imaging at sub-cellular level. The needs to resolve the fine details of the biological specimen with the resolution beyond the diffraction limit further motivate the development of optical demodulated ultrasonic detection method based on near-field scanning optical microscopy (NSOM). The nano-focusing probe was developed

Quantum dots assisted laser desorption/ionization mass spectrometric detection of carbohydrates: qualitative and quantitative analysis.

PubMed

Bibi, Aisha; Ju, Huangxian

2016-04-01

A quantum dots (QDs) assisted laser desorption/ionization mass spectrometric (QDA-LDI-MS) strategy was proposed for qualitative and quantitative analysis of a series of carbohydrates. The adsorption of carbohydrates on the modified surface of different QDs as the matrices depended mainly on the formation of hydrogen bonding, which led to higher MS intensity than those with conventional organic matrix. The effects of QDs concentration and sample preparation method were explored for improving the selective ionization process and the detection sensitivity. The proposed approach offered a new dimension to the application of QDs as matrices for MALDI-MS research of carbohydrates. It could be used for quantitative measurement of glucose concentration in human serum with good performance. The QDs served as a matrix showed the advantages of low background, higher sensitivity, convenient sample preparation and excellent stability under vacuum. The QDs assisted LDI-MS approach has promising application to the analysis of carbohydrates in complex biological samples. Copyright © 2016 John Wiley & Sons, Ltd.

Real-time quantitative PCR detection of circulating tumor cells using tag DNA mediated signal amplification strategy.

PubMed

Mei, Ting; Lu, Xuewen; Sun, Ning; Li, Xiaomei; Chen, Jitao; Liang, Min; Zhou, Xinke; Fang, Zhiyuan

2018-06-05

The level of circulating tumor cell (CTCs) is a reliable marker for tumor burden and malignant progression. Quantification of CTCs remains technically challenging due to the rarity of these cells in peripheral blood. In the present study, we established a real-time quantitative PCR (Q-PCR) based method for sensitive detection of CTCs without DNA extraction. Blood sample was first turned to erythrocyte lyses and then incubated with two antibodies, tag-DNA modified CK-19 antibody and magnetic beads conjugated EpCAM antibody. Tumor cells were further enriched by magnetic separation. Tag-DNA that immobilized on tumor cells through CK-19 antibodies were also retrieved, which was further quantified by Q-PCR. This assay was able to detect single tumor cell in a 5 mL blood sample. The detection rate of clinical tumor blood sample was 92.3%. Furthermore, CTC count in patient was correlated with tumor stage and tumor status. The signal amplification was based on tag DNA rather than tumor gene, which was independent of nucleic acid extraction. With high sensitivity and convenience, this method can be a good alternative for the determination of cancer progress. Copyright © 2018 Elsevier B.V. All rights reserved.

Single-Tubed Wild-Type Blocking Quantitative PCR Detection Assay for the Sensitive Detection of Codon 12 and 13 KRAS Mutations

PubMed Central

Duan, Guang-Jie; Shi, Yan; Deng, Guo-Hong; Xia, Han; Xu, Han-Qing; Zhao, Na; Fu, Wei-Ling; Huang, Qing

2015-01-01

The high degree of intra-tumor heterogeneity has meant that it is important to develop sensitive and selective assays to detect low-abundance KRAS mutations in metastatic colorectal carcinoma (mCRC) patients. As a major potential source of tumor DNA in the aforementioned genotyping assays, it was necessary to conduct an analysis on both the quality and quantity of DNA extracted from formalin-fixed paraffin-embedded (FFPE). Therefore, four commercial FFPE DNA extraction kits were initially compared with respect to their ability to facilitate extraction of amplifiable DNA. The results showed that TrimGen kits showed the greatest performance in relation to the quality and quantity of extracted FFPE DNA solutions. Using DNA extracted by TrimGen kits as a template for tumor genotyping, a real-time wild-type blocking PCR (WTB-PCR) assay was subsequently developed to detect the aforementioned KRAS mutations in mCRC patients. The results showed that WTB-PCR facilitated the detection of mutated alleles at a ratio of 1:10,000 (i.e. 0.01%) wild-type alleles. When the assay was subsequently used to test 49 mCRC patients, the results showed that the mutation detection levels of the WTB-PCR assay (61.8%; 30/49) were significantly higher than that of traditional PCR (38.8%; 19/49). Following the use of the real-time WTB-PCR assay, the ΔC q method was used to quantitatively analyze the mutation levels associated with KRAS in each FFPE sample. The results showed that the mutant levels ranged from 53.74 to 0.12% in the patients analyzed. In conclusion, the current real-time WTB-PCR is a rapid, simple, and low-cost method that permits the detection of trace amounts of the mutated KRAS gene. PMID:26701781

Quantitation of heparosan with heparin lyase III and spectrophotometry.

PubMed

Huang, Haichan; Zhao, Yingying; Lv, Shencong; Zhong, Weihong; Zhang, Fuming; Linhardt, Robert J

2014-02-15

Heparosan is Escherichia coli K5 capsule polysaccharide, which is the key precursor for preparing bioengineered heparin. A rapid and effective quantitative method for detecting heparosan is important in the large-scale production of heparosan. Heparin lyase III (Hep III) effectively catalyzes the heparosan depolymerization, forming unsaturated disaccharides that are measurable using a spectrophotometer at 232 nm. We report a new method for the quantitative detection of heparosan with heparin lyase III and spectrophotometry that is safer and more specific than the traditional carbazole assay. In an optimized detection system, heparosan at a minimum concentration of 0.60 g/L in fermentation broth can be detected. Copyright © 2013 Elsevier Inc. All rights reserved.

An iterative method for airway segmentation using multiscale leakage detection

NASA Astrophysics Data System (ADS)

Nadeem, Syed Ahmed; Jin, Dakai; Hoffman, Eric A.; Saha, Punam K.

2017-02-01

There are growing applications of quantitative computed tomography for assessment of pulmonary diseases by characterizing lung parenchyma as well as the bronchial tree. Many large multi-center studies incorporating lung imaging as a study component are interested in phenotypes relating airway branching patterns, wall-thickness, and other morphological measures. To our knowledge, there are no fully automated airway tree segmentation methods, free of the need for user review. Even when there are failures in a small fraction of segmentation results, the airway tree masks must be manually reviewed for all results which is laborious considering that several thousands of image data sets are evaluated in large studies. In this paper, we present a CT-based novel airway tree segmentation algorithm using iterative multi-scale leakage detection, freezing, and active seed detection. The method is fully automated requiring no manual inputs or post-segmentation editing. It uses simple intensity based connectivity and a new leakage detection algorithm to iteratively grow an airway tree starting from an initial seed inside the trachea. It begins with a conservative threshold and then, iteratively shifts toward generous values. The method was applied on chest CT scans of ten non-smoking subjects at total lung capacity and ten at functional residual capacity. Airway segmentation results were compared to an expert's manually edited segmentations. Branch level accuracy of the new segmentation method was examined along five standardized segmental airway paths (RB1, RB4, RB10, LB1, LB10) and two generations beyond these branches. The method successfully detected all branches up to two generations beyond these segmental bronchi with no visual leakages.

Development of real-time PCR for detection and quantitation of Streptococcus parauberis.

PubMed

Nguyen, T L; Lim, Y J; Kim, D-H; Austin, B

2016-01-01

Streptococcus parauberis is an increasing threat to aquaculture of olive flounder, Paralichthys olivaceus Temminck & Schlegel, in South Korea. We developed a real-time polymerase chain reaction (PCR) method using the TaqMan probe assay to detect and quantify S. parauberis by targeting the gyrB gene sequences, which are effective for molecular analysis of the genus Streptococcus. Our real-time PCR assay is capable of detecting 10 fg of genomic DNA per reaction. The intra- and interassay coefficient of variation (CV) values ranged from 0.42-1.95%, demonstrating that the assay has good reproducibility. There was not any cross-reactivity to Streptococcus iniae or to other streptococcal/lactococcal fish pathogens, such as S. agalactiae and Lactococcus garvieae, indicating that the assay is highly specific to S. parauberis. The results of the real-time PCR assay corresponded well to those of conventional culture assays for S. parauberis from inoculated tissue homogenates (r = 0.957; P < 0.05). Hence, this sensitive and specific real-time PCR is a valuable tool for diagnostic quantitation of S. parauberis in clinical samples. © 2014 John Wiley & Sons Ltd.

PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples.

PubMed Central

Wang, R F; Cao, W W; Cerniglia, C E

1996-01-01

PCR procedures based on 16S rRNA gene sequences specific for 12 anaerobic bacteria that predominate in the human intestinal tract were developed and used for quantitative detection of these species in human (adult and baby) feces and animal (rat, mouse, cat, dog, monkey, and rabbit) feces. Fusobacterium prausnitzii, Peptostreptococcus productus, and Clostridium clostridiiforme had high PCR titers (the maximum dilutions for positive PCR results ranged from 10(-3) to 10(-8)) in all of the human and animal fecal samples tested. Bacteroides thetaiotaomicron, Bacteroides vulgatus, and Eubacterium limosum also showed higher PCR titers (10(-2) to 10(-6)) in adult human feces. The other bacteria tested, including Escherichia coli, Bifidobacterium adolescentis, Bifidobacterium longum, Lactobacillus acidophilus, Eubacterium biforme, and Bacteroides distasonis, were either at low PCR titers (less than 10(-2)) or not detected by PCR. The reported PCR procedure including the fecal sample preparation method is simplified and rapid and eliminates the DNA isolation steps. PMID:8919784

Apparatuses and methods for detecting, identifying and quantitating radioactive nuclei and methods of distinguishing neutron stimulation of a radiation particle detector from gamma-ray stimulation of a detector

DOEpatents

Cole, Jerald D.; Drigert, Mark W.; Reber, Edward L.; Aryaeinejad, Rahmat

2001-01-01

In one aspect, the invention encompasses a method of detecting radioactive decay, comprising: a) providing a sample comprising a radioactive material, the radioactive material generating decay particles; b)providing a plurality of detectors proximate the sample, the detectors comprising a first set and a second set, the first set of the detectors comprising liquid state detectors utilizing liquid scintillation material coupled with photo tubes to generate a first electrical signal in response to decay particles stimulating the liquid scintillation material, the second set of the detectors comprising solid state detectors utilizing a crystalline solid to generate a second electrical signal in response to decay particles stimulating the crystalline solid; c) stimulating at least one of the detectors to generate at least one of the first and second electrical signals, the at least one of the first and second electrical signals being indicative of radioactive decay in the sample. In another aspect, the invention encompasses an apparatus for identifying and quantitating radioactive nuclei of a sample comprising radioactive material that decays to generate neutrons and high-energy .gamma.-rays.

Multigrid contact detection method

NASA Astrophysics Data System (ADS)

He, Kejing; Dong, Shoubin; Zhou, Zhaoyao

2007-03-01

Contact detection is a general problem of many physical simulations. This work presents a O(N) multigrid method for general contact detection problems (MGCD). The multigrid idea is integrated with contact detection problems. Both the time complexity and memory consumption of the MGCD are O(N) . Unlike other methods, whose efficiencies are influenced strongly by the object size distribution, the performance of MGCD is insensitive to the object size distribution. We compare the MGCD with the no binary search (NBS) method and the multilevel boxing method in three dimensions for both time complexity and memory consumption. For objects with similar size, the MGCD is as good as the NBS method, both of which outperform the multilevel boxing method regarding memory consumption. For objects with diverse size, the MGCD outperform both the NBS method and the multilevel boxing method. We use the MGCD to solve the contact detection problem for a granular simulation system based on the discrete element method. From this granular simulation, we get the density property of monosize packing and binary packing with size ratio equal to 10. The packing density for monosize particles is 0.636. For binary packing with size ratio equal to 10, when the number of small particles is 300 times as the number of big particles, the maximal packing density 0.824 is achieved.

Hyperspectral Imaging and SPA-LDA Quantitative Analysis for Detection of Colon Cancer Tissue

NASA Astrophysics Data System (ADS)

Yuan, X.; Zhang, D.; Wang, Ch.; Dai, B.; Zhao, M.; Li, B.

2018-05-01

Hyperspectral imaging (HSI) has been demonstrated to provide a rapid, precise, and noninvasive method for cancer detection. However, because HSI contains many data, quantitative analysis is often necessary to distill information useful for distinguishing cancerous from normal tissue. To demonstrate that HSI with our proposed algorithm can make this distinction, we built a Vis-NIR HSI setup and made many spectral images of colon tissues, and then used a successive projection algorithm (SPA) to analyze the hyperspectral image data of the tissues. This was used to build an identification model based on linear discrimination analysis (LDA) using the relative reflectance values of the effective wavelengths. Other tissues were used as a prediction set to verify the reliability of the identification model. The results suggest that Vis-NIR hyperspectral images, together with the spectroscopic classification method, provide a new approach for reliable and safe diagnosis of colon cancer and could lead to advances in cancer diagnosis generally.

Quantitative measures detect sensory and motor impairments in multiple sclerosis.

PubMed

Newsome, Scott D; Wang, Joseph I; Kang, Jonathan Y; Calabresi, Peter A; Zackowski, Kathleen M

2011-06-15

Sensory and motor dysfunction in multiple sclerosis (MS) is often assessed with rating scales which rely heavily on clinical judgment. Quantitative devices may be more precise than rating scales. To quantify lower extremity sensorimotor measures in individuals with MS, evaluate the extent to which they can detect functional systems impairments, and determine their relationship to global disability measures. We tested 145 MS subjects and 58 controls. Vibration thresholds were quantified using a Vibratron-II device. Strength was quantified by a hand-held dynamometer. We also recorded Expanded Disability Status Scale (EDSS) and Timed 25-Foot Walk (T25FW). t-tests and Wilcoxon-rank sum were used to compare group data. Spearman correlations were used to assess relationships between each measure. We also used a step-wise linear regression model to determine how much the quantitative measures explain the variance in the respective functional systems scores (FSS). EDSS scores ranged from 0-7.5, mean disease duration was 10.4 ± 9.6 years, and 66% were female. In relapsing-remitting MS, but not progressive MS, poorer vibration sensation correlated with a worse EDSS score, whereas progressive groups' ankle/hip strength changed significantly with EDSS progression. Interestingly, not only did sensorimotor measures significantly correlate with global disability measures (i.e., EDSS), but they had improved sensitivity, as they detected impairments in up to 32% of MS subjects with normal sensory and pyramidal FSS. Sensory and motor deficits in MS can be quantified using clinically accessible tools and distinguish differences among MS subtypes. We show that quantitative sensorimotor measures are more sensitive than FSS from the EDSS. These tools have the potential to be used as clinical outcome measures in practice and for future MS clinical trials of neurorehabilitative and neuroreparative interventions. Copyright © 2011 Elsevier B.V. All rights reserved.

Differential plating medium for quantitative detection of histamine-producing bacteria.

PubMed Central

Niven, C F; Jeffrey, M B; Corlett, D A

1981-01-01

A histidine-containing agar medium has been devised for quantitative detection of histamine-producing bacteria that are alleged to be associated with scombroid fish poisoning outbreaks. The responsible bacteria produce a marked pH change in the agar, with attendant color change of pH indicator adjacent to the colonies, thus facilitating their recognition. Proteus morganii and Klebsiella pneumoniae were the two most common histidine-decarboxylating species isolated from scombroid fish and mahi mahi. PMID:7013698

Methods of DNA methylation detection

NASA Technical Reports Server (NTRS)

Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)

2010-01-01

The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.

Performance of Two Quantitative PCR Methods for Microbial Source Tracking of Human Sewage and Implications for Microbial Risk Assessment in Recreational Waters

PubMed Central

Staley, Christopher; Gordon, Katrina V.; Schoen, Mary E.

2012-01-01

Before new, rapid quantitative PCR (qPCR) methods for assessment of recreational water quality and microbial source tracking (MST) can be useful in a regulatory context, an understanding of the ability of the method to detect a DNA target (marker) when the contaminant source has been diluted in environmental waters is needed. This study determined the limits of detection and quantification of the human-associated Bacteroides sp. (HF183) and human polyomavirus (HPyV) qPCR methods for sewage diluted in buffer and in five ambient, Florida water types (estuarine, marine, tannic, lake, and river). HF183 was quantifiable in sewage diluted up to 10−6 in 500-ml ambient-water samples, but HPyVs were not quantifiable in dilutions of >10−4. Specificity, which was assessed using fecal composites from dogs, birds, and cattle, was 100% for HPyVs and 81% for HF183. Quantitative microbial risk assessment (QMRA) estimated the possible norovirus levels in sewage and the human health risk at various sewage dilutions. When juxtaposed with the MST marker detection limits, the QMRA analysis revealed that HF183 was detectable when the modeled risk of gastrointestinal (GI) illness was at or below the benchmark of 10 illnesses per 1,000 exposures, but the HPyV method was generally not sensitive enough to detect potential health risks at the 0.01 threshold for frequency of illness. The tradeoff between sensitivity and specificity in the MST methods indicates that HF183 data should be interpreted judiciously, preferably in conjunction with a more host-specific marker, and that better methods of concentrating HPyVs from environmental waters are needed if this method is to be useful in a watershed management or monitoring context. PMID:22885746

Image change detection using paradoxical theory for patient follow-up quantitation and therapy assessment.

PubMed

David, Simon; Visvikis, Dimitris; Quellec, Gwénolé; Le Rest, Catherine Cheze; Fernandez, Philippe; Allard, Michèle; Roux, Christian; Hatt, Mathieu

2012-09-01

In clinical oncology, positron emission tomography (PET) imaging can be used to assess therapeutic response by quantifying the evolution of semi-quantitative values such as standardized uptake value, early during treatment or after treatment. Current guidelines do not include metabolically active tumor volume (MATV) measurements and derived parameters such as total lesion glycolysis (TLG) to characterize the response to the treatment. To achieve automatic MATV variation estimation during treatment, we propose an approach based on the change detection principle using the recent paradoxical theory, which models imprecision, uncertainty, and conflict between sources. It was applied here simultaneously to pre- and post-treatment PET scans. The proposed method was applied to both simulated and clinical datasets, and its performance was compared to adaptive thresholding applied separately on pre- and post-treatment PET scans. On simulated datasets, the adaptive threshold was associated with significantly higher classification errors than the developed approach. On clinical datasets, the proposed method led to results more consistent with the known partial responder status of these patients. The method requires accurate rigid registration of both scans which can be obtained only in specific body regions and does not explicitly model uptake heterogeneity. In further investigations, the change detection of intra-MATV tracer uptake heterogeneity will be developed by incorporating textural features into the proposed approach.

Cross-linking gold nanoparticles aggregation method based on localised surface plasmon resonance for quantitative detection of miR-155.

PubMed

Esmaeili-Bandboni, Aghil; Amini, Seyed Mohammad; Faridi-Majidi, Reza; Bagheri, Jamshid; Mohammadnejad, Javad; Sadroddiny, Esmaeil

2018-06-01

MiR-155 plays a critical role in the formation of cancers and other diseases. In this study, the authors aimed to design and fabricate a biosensor based on cross-linking gold nanoparticles (AuNPs) aggregation for the detection and quantification of miR-155. Also, they intended to compare this method with SYBR Green real-time polymerase chain reaction (PCR). Primers for real-time PCR, and two thiolated capture probes for biosensor, complementary with miR-155, were designed. Citrate capped AuNPs (18.7 ± 3.6 nm) were synthesised and thiolated capture probes immobilised to AuNPs. The various concentrations of synthetic miR-155 were measured by this biosensor and real-time PCR method. Colorimetric changes were studied, and the calibration curves were plotted. Results showed the detection limit of 10 nM for the fabricated biosensor and real-time PCR. Also, eye detection using colour showed the weaker detection limit (1 µM), for this biosensor. MiR-133b as the non-complementary target could not cause a change in both colour and UV-visible spectrum. The increase in hydrodynamic diameter and negative zeta potential of AuNPs after the addition of probes verified the biosensor accurately fabricated. This fabricated biosensor could detect miR-155 simpler and faster than previous methods.

Traumatic Brain Injury Detection Using Electrophysiological Methods

PubMed Central

Rapp, Paul E.; Keyser, David O.; Albano, Alfonso; Hernandez, Rene; Gibson, Douglas B.; Zambon, Robert A.; Hairston, W. David; Hughes, John D.; Krystal, Andrew; Nichols, Andrew S.

2015-01-01

Measuring neuronal activity with electrophysiological methods may be useful in detecting neurological dysfunctions, such as mild traumatic brain injury (mTBI). This approach may be particularly valuable for rapid detection in at-risk populations including military service members and athletes. Electrophysiological methods, such as quantitative electroencephalography (qEEG) and recording event-related potentials (ERPs) may be promising; however, the field is nascent and significant controversy exists on the efficacy and accuracy of the approaches as diagnostic tools. For example, the specific measures derived from an electroencephalogram (EEG) that are most suitable as markers of dysfunction have not been clearly established. A study was conducted to summarize and evaluate the statistical rigor of evidence on the overall utility of qEEG as an mTBI detection tool. The analysis evaluated qEEG measures/parameters that may be most suitable as fieldable diagnostic tools, identified other types of EEG measures and analysis methods of promise, recommended specific measures and analysis methods for further development as mTBI detection tools, identified research gaps in the field, and recommended future research and development thrust areas. The qEEG study group formed the following conclusions: (1) Individual qEEG measures provide limited diagnostic utility for mTBI. However, many measures can be important features of qEEG discriminant functions, which do show significant promise as mTBI detection tools. (2) ERPs offer utility in mTBI detection. In fact, evidence indicates that ERPs can identify abnormalities in cases where EEGs alone are non-disclosing. (3) The standard mathematical procedures used in the characterization of mTBI EEGs should be expanded to incorporate newer methods of analysis including non-linear dynamical analysis, complexity measures, analysis of causal interactions, graph theory, and information dynamics. (4) Reports of high specificity in q

Traumatic brain injury detection using electrophysiological methods.

PubMed

Rapp, Paul E; Keyser, David O; Albano, Alfonso; Hernandez, Rene; Gibson, Douglas B; Zambon, Robert A; Hairston, W David; Hughes, John D; Krystal, Andrew; Nichols, Andrew S

2015-01-01

Measuring neuronal activity with electrophysiological methods may be useful in detecting neurological dysfunctions, such as mild traumatic brain injury (mTBI). This approach may be particularly valuable for rapid detection in at-risk populations including military service members and athletes. Electrophysiological methods, such as quantitative electroencephalography (qEEG) and recording event-related potentials (ERPs) may be promising; however, the field is nascent and significant controversy exists on the efficacy and accuracy of the approaches as diagnostic tools. For example, the specific measures derived from an electroencephalogram (EEG) that are most suitable as markers of dysfunction have not been clearly established. A study was conducted to summarize and evaluate the statistical rigor of evidence on the overall utility of qEEG as an mTBI detection tool. The analysis evaluated qEEG measures/parameters that may be most suitable as fieldable diagnostic tools, identified other types of EEG measures and analysis methods of promise, recommended specific measures and analysis methods for further development as mTBI detection tools, identified research gaps in the field, and recommended future research and development thrust areas. The qEEG study group formed the following conclusions: (1) Individual qEEG measures provide limited diagnostic utility for mTBI. However, many measures can be important features of qEEG discriminant functions, which do show significant promise as mTBI detection tools. (2) ERPs offer utility in mTBI detection. In fact, evidence indicates that ERPs can identify abnormalities in cases where EEGs alone are non-disclosing. (3) The standard mathematical procedures used in the characterization of mTBI EEGs should be expanded to incorporate newer methods of analysis including non-linear dynamical analysis, complexity measures, analysis of causal interactions, graph theory, and information dynamics. (4) Reports of high specificity in q

Methodological reporting in qualitative, quantitative, and mixed methods health services research articles.

PubMed

Wisdom, Jennifer P; Cavaleri, Mary A; Onwuegbuzie, Anthony J; Green, Carla A

2012-04-01

Methodologically sound mixed methods research can improve our understanding of health services by providing a more comprehensive picture of health services than either method can alone. This study describes the frequency of mixed methods in published health services research and compares the presence of methodological components indicative of rigorous approaches across mixed methods, qualitative, and quantitative articles. All empirical articles (n = 1,651) published between 2003 and 2007 from four top-ranked health services journals. All mixed methods articles (n = 47) and random samples of qualitative and quantitative articles were evaluated to identify reporting of key components indicating rigor for each method, based on accepted standards for evaluating the quality of research reports (e.g., use of p-values in quantitative reports, description of context in qualitative reports, and integration in mixed method reports). We used chi-square tests to evaluate differences between article types for each component. Mixed methods articles comprised 2.85 percent (n = 47) of empirical articles, quantitative articles 90.98 percent (n = 1,502), and qualitative articles 6.18 percent (n = 102). There was a statistically significant difference (χ(2) (1) = 12.20, p = .0005, Cramer's V = 0.09, odds ratio = 1.49 [95% confidence interval = 1,27, 1.74]) in the proportion of quantitative methodological components present in mixed methods compared to quantitative papers (21.94 versus 47.07 percent, respectively) but no statistically significant difference (χ(2) (1) = 0.02, p = .89, Cramer's V = 0.01) in the proportion of qualitative methodological components in mixed methods compared to qualitative papers (21.34 versus 25.47 percent, respectively). Few published health services research articles use mixed methods. The frequency of key methodological components is variable. Suggestions are provided to increase the transparency of mixed methods studies and

Quantitative PCR: an appropriate tool to detect viable but not culturable Brettanomyces bruxellensis in wine.

PubMed

Willenburg, Elize; Divol, Benoit

2012-11-15

Quantitative PCR as a tool has been used to detect Brettanomyces bruxellensis directly from wine samples. Accurate and timely detection of this yeast is important to prevent unwanted spoilage of wines and beverages. The aim of this study was to distinguish differences between DNA and mRNA as template for the detection of this yeast. The study was also used to determine if it is possible to accurately detect cells in the viable but not culturable (VBNC) state of B. bruxellensis by qPCR. Several methods including traditional plating, epifluorescence counts and qPCR were used to amplify DNA and mRNA. It was observed that mRNA was a better template for the detection in terms of standard curve analysis and qPCR efficiencies. Various primers previously published were tested for their specificity, qPCR efficiency and accuracy of enumeration. A single primer set was selected which amplified a region of the actin-encoding gene. The detection limit for this assay was 10cellsmL(-1). B. bruxellensis could also be quantified in naturally contaminated wines with this assay. The mRNA gave a better indication of the viability of the cells which compared favourably to fluorescent microscopy and traditional cell counts. The ability of the assay to accurately estimate the number of cells in the VBNC state was also demonstrated. Copyright © 2012 Elsevier B.V. All rights reserved.

Allelic-based gene-gene interaction associated with quantitative traits.

PubMed

Jung, Jeesun; Sun, Bin; Kwon, Deukwoo; Koller, Daniel L; Foroud, Tatiana M

2009-05-01

Recent studies have shown that quantitative phenotypes may be influenced not only by multiple single nucleotide polymorphisms (SNPs) within a gene but also by the interaction between SNPs at unlinked genes. We propose a new statistical approach that can detect gene-gene interactions at the allelic level which contribute to the phenotypic variation in a quantitative trait. By testing for the association of allelic combinations at multiple unlinked loci with a quantitative trait, we can detect the SNP allelic interaction whether or not it can be detected as a main effect. Our proposed method assigns a score to unrelated subjects according to their allelic combination inferred from observed genotypes at two or more unlinked SNPs, and then tests for the association of the allelic score with a quantitative trait. To investigate the statistical properties of the proposed method, we performed a simulation study to estimate type I error rates and power and demonstrated that this allelic approach achieves greater power than the more commonly used genotypic approach to test for gene-gene interaction. As an example, the proposed method was applied to data obtained as part of a candidate gene study of sodium retention by the kidney. We found that this method detects an interaction between the calcium-sensing receptor gene (CaSR), the chloride channel gene (CLCNKB) and the Na, K, 2Cl cotransporter gene (CLC12A1) that contributes to variation in diastolic blood pressure.

A novel multi-walled carbon nanotube-based antibody conjugate for quantitative and semi-quantitative lateral flow assays.

PubMed

Sun, Wenjuan; Hu, Xiaolong; Liu, Jia; Zhang, Yurong; Lu, Jianzhong; Zeng, Libo

2017-10-01

In this study, the multi-walled carbon nanotubes (MWCNTs) were applied in lateral flow strips (LFS) for semi-quantitative and quantitative assays. Firstly, the solubility of MWCNTs was improved using various surfactants to enhance their biocompatibility for practical application. The dispersed MWCNTs were conjugated with the methamphetamine (MET) antibody in a non-covalent manner and then manufactured into the LFS for the quantitative detection of MET. The MWCNTs-based lateral flow assay (MWCNTs-LFA) exhibited an excellent linear relationship between the values of test line and MET when its concentration ranges from 62.5 to 1500 ng/mL. The sensitivity of the LFS was evaluated by conjugating MWCNTs with HCG antibody and the MWCNTs conjugated method is 10 times more sensitive than the one conjugated with classical colloidal gold nanoparticles. Taken together, our data demonstrate that MWCNTs-LFA is a more sensitive and reliable assay for semi-quantitative and quantitative detection which can be used in forensic analysis.

A sensitive one-step method for quantitative detection of α-amylase in serum and urine using a personal glucose meter.

PubMed

Wang, Qing; Wang, Hui; Yang, Xiaohai; Wang, Kemin; Liu, Rongjuan; Li, Qing; Ou, Jinqing

2015-02-21

Assays of α-amylase (AMS) activity in serum and urine constitute the important indicator for the diagnosis of acute pancreatitis, mumps, renal disease and abdominal disorders. Since these diseases confer a heavy financial burden on the health care system, AMS detection in point-of-care is fundamental. Here, a one-step assay for direct determination of the AMS activity was developed using a portable personal glucose meter (PGM). In this assay, maltopentaose was used as a substrate for sensitive detection of AMS with the assistance of α-glucosidase. In the presence of AMS, maltopentaose can be readily hydrolyzed to form maltotriose and maltose quickly. With the enzymatic hydrolysis of α-glucosidase, maltotriose and maltose can be turned into glucose rapidly, which can be quantitatively measured using a portable PGM. This assay did not require any cumbersome and time consuming operations, such as surface modification, synthesis of invertase conjugate, washing and centrifugation. Detection of AMS can be achieved using only a one-step mixture, and the limit of detection was 20 U L(-1) which was lower than the clinical cutoff for AMS. More importantly, this sensitive and selective assay was also used for the detection of AMS in human serum/urine samples. The results showed that the recovery of AMS from human serum/urine samples was 91-107%. The rapid and easy-to-operate assay may have potential application in the fields of point-of-care (POC) clinical diagnosis, particularly in rural and remote areas where lab equipment may be limited.

Application of programmable bio-nano-chip system for the quantitative detection of drugs of abuse in oral fluids.

PubMed

Christodoulides, Nicolaos; De La Garza, Richard; Simmons, Glennon W; McRae, Michael P; Wong, Jorge; Newton, Thomas F; Smith, Regina; Mahoney, James J; Hohenstein, Justin; Gomez, Sobeyda; Floriano, Pierre N; Talavera, Humberto; Sloan, Daniel J; Moody, David E; Andrenyak, David M; Kosten, Thomas R; Haque, Ahmed; McDevitt, John T

2015-08-01

There is currently a gap in on-site drug of abuse monitoring. Current detection methods involve invasive sampling of blood and urine specimens, or collection of oral fluid, followed by qualitative screening tests using immunochromatographic cartridges. While remote laboratories then may provide confirmation and quantitative assessment of a presumptive positive, this instrumentation is expensive and decoupled from the initial sampling making the current drug-screening program inefficient and costly. The authors applied a noninvasive oral fluid sampling approach integrated with the in-development chip-based Programmable bio-nano-chip (p-BNC) platform for the detection of drugs of abuse. The p-BNC assay methodology was applied for the detection of tetrahydrocannabinol, morphine, amphetamine, methamphetamine, cocaine, methadone and benzodiazepines, initially using spiked buffered samples and, ultimately, using oral fluid specimen collected from consented volunteers. Rapid (∼10min), sensitive detection (∼ng/mL) and quantitation of 12 drugs of abuse was demonstrated on the p-BNC platform. Furthermore, the system provided visibility to time-course of select drug and metabolite profiles in oral fluids; for the drug cocaine, three regions of slope were observed that, when combined with concentration measurements from this and prior impairment studies, information about cocaine-induced impairment may be revealed. This chip-based p-BNC detection modality has significant potential to be used in the future by law enforcement officers for roadside drug testing and to serve a variety of other settings, including outpatient and inpatient drug rehabilitation centers, emergency rooms, prisons, schools, and in the workplace. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Linear Quantitative Profiling Method Fast Monitors Alkaloids of Sophora Flavescens That Was Verified by Tri-Marker Analyses.

PubMed

Hou, Zhifei; Sun, Guoxiang; Guo, Yong

2016-01-01

The present study demonstrated the use of the Linear Quantitative Profiling Method (LQPM) to evaluate the quality of Alkaloids of Sophora flavescens (ASF) based on chromatographic fingerprints in an accurate, economical and fast way. Both linear qualitative and quantitative similarities were calculated in order to monitor the consistency of the samples. The results indicate that the linear qualitative similarity (LQLS) is not sufficiently discriminating due to the predominant presence of three alkaloid compounds (matrine, sophoridine and oxymatrine) in the test samples; however, the linear quantitative similarity (LQTS) was shown to be able to obviously identify the samples based on the difference in the quantitative content of all the chemical components. In addition, the fingerprint analysis was also supported by the quantitative analysis of three marker compounds. The LQTS was found to be highly correlated to the contents of the marker compounds, indicating that quantitative analysis of the marker compounds may be substituted with the LQPM based on the chromatographic fingerprints for the purpose of quantifying all chemicals of a complex sample system. Furthermore, once reference fingerprint (RFP) developed from a standard preparation in an immediate detection way and the composition similarities calculated out, LQPM could employ the classical mathematical model to effectively quantify the multiple components of ASF samples without any chemical standard.

Linear Quantitative Profiling Method Fast Monitors Alkaloids of Sophora Flavescens That Was Verified by Tri-Marker Analyses

PubMed Central

Hou, Zhifei; Sun, Guoxiang; Guo, Yong

2016-01-01

The present study demonstrated the use of the Linear Quantitative Profiling Method (LQPM) to evaluate the quality of Alkaloids of Sophora flavescens (ASF) based on chromatographic fingerprints in an accurate, economical and fast way. Both linear qualitative and quantitative similarities were calculated in order to monitor the consistency of the samples. The results indicate that the linear qualitative similarity (LQLS) is not sufficiently discriminating due to the predominant presence of three alkaloid compounds (matrine, sophoridine and oxymatrine) in the test samples; however, the linear quantitative similarity (LQTS) was shown to be able to obviously identify the samples based on the difference in the quantitative content of all the chemical components. In addition, the fingerprint analysis was also supported by the quantitative analysis of three marker compounds. The LQTS was found to be highly correlated to the contents of the marker compounds, indicating that quantitative analysis of the marker compounds may be substituted with the LQPM based on the chromatographic fingerprints for the purpose of quantifying all chemicals of a complex sample system. Furthermore, once reference fingerprint (RFP) developed from a standard preparation in an immediate detection way and the composition similarities calculated out, LQPM could employ the classical mathematical model to effectively quantify the multiple components of ASF samples without any chemical standard. PMID:27529425

Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

PubMed

Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

2008-05-15

Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.

Quantitative detection of nitric oxide in exhaled human breath by extractive electrospray ionization mass spectrometry

NASA Astrophysics Data System (ADS)

Pan, Susu; Tian, Yong; Li, Ming; Zhao, Jiuyan; Zhu, Lanlan; Zhang, Wei; Gu, Haiwei; Wang, Haidong; Shi, Jianbo; Fang, Xiang; Li, Penghui; Chen, Huanwen

2015-03-01

Exhaled nitric oxide (eNO) is a useful biomarker of various physiological conditions, including asthma and other pulmonary diseases. Herein a fast and sensitive analytical method has been developed for the quantitative detection of eNO based on extractive electrospray ionization mass spectrometry (EESI-MS). Exhaled NO molecules selectively reacted with 2-phenyl-4, 4, 5, 5-tetramethylimidazoline-1-oxyl-3-oxide (PTIO) reagent, and eNO concentration was derived based on the EESI-MS response of 1-oxyl-2-phenyl-4, 4, 5, 5-tetramethylimidazoline (PTI) product. The method allowed quantification of eNO below ppb level (~0.02 ppbv) with a relative standard deviation (RSD) of 11.6%. In addition, eNO levels of 20 volunteers were monitored by EESI-MS over the time period of 10 hrs. Long-term eNO response to smoking a cigarette was recorded, and the observed time-dependent profile was discussed. This work extends the application of EESI-MS to small molecules (<30 Da) with low proton affinity and collision-induced dissociation efficiency, which are usually poorly visible by conventional ion trap mass spectrometers. Long-term quantitative profiling of eNO by EESI-MS opens new possibilities for the research of human metabolism and clinical diagnosis.

New quantitative method for evaluation of motor functions applicable to spinal muscular atrophy.

PubMed

Matsumaru, Naoki; Hattori, Ryo; Ichinomiya, Takashi; Tsukamoto, Katsura; Kato, Zenichiro

2018-03-01

The aim of this study was to develop and introduce new method to quantify motor functions of the upper extremity. The movement was recorded using a three-dimensional motion capture system, and the movement trajectory was analyzed using newly developed two indices, which measure precise repeatability and directional smoothness. Our target task was shoulder flexion repeated ten times. We applied our method to a healthy adult without and with a weight, simulating muscle impairment. We also applied our method to assess the efficacy of a drug therapy for amelioration of motor functions in a non-ambulatory patient with spinal muscular atrophy. Movement trajectories before and after thyrotropin-releasing hormone therapy were analyzed. In the healthy adult, we found the values of both indices increased significantly when holding a weight so that the weight-induced deterioration in motor function was successfully detected. From the efficacy assessment of drug therapy in the patient, the directional smoothness index successfully detected improvements in motor function, which were also clinically observed by the patient's doctors. We have developed a new quantitative evaluation method of motor functions of the upper extremity. Clinical usability of this method is also greatly enhanced by reducing the required number of body-attached markers to only one. This simple but universal approach to quantify motor functions will provide additional insights into the clinical phenotypes of various neuromuscular diseases and developmental disorders. Copyright © 2017 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Development and validation of a reverse transcription quantitative polymerase chain reaction for tilapia lake virus detection in clinical samples and experimentally challenged fish.

PubMed

Tattiyapong, P; Sirikanchana, K; Surachetpong, W

2018-02-01

Tilapia lake virus (TiLV) is an emerging pathogen associated with high mortalities of wild and farm-raised tilapia in different countries. In this study, a SYBR green-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay targeting segment three of the virus was developed to detect and quantify TiLV in clinical samples and experimentally challenged fish. All 30 field samples with clinical signs and history consistent with TiLV infection were positive for TiLV as detected by the developed RT-qPCR method. The RT-qPCR technique provided 100 and 10,000 times more sensitive for virus detection than those offered by the RT-PCR and virus isolation in cell culture methods, respectively. The detection limit of the RT-qPCR method was as low as two viral copies/μl. Moreover, the RT-qPCR technique could be applied for TiLV detection in various fish tissues including gills, liver, brain, heart, anterior kidney and spleen. Significantly, this study delivered an accurate and reliable method for rapid detection of TiLV viruses that facilitates active surveillance programme and disease containment. © 2017 John Wiley & Sons Ltd.

Highly Sensitive Quantitative PCR for the Detection and Differentiation of Pseudogymnoascus destructans and Other Pseudogymnoascus Species

PubMed Central

Shuey, Megan M.; Drees, Kevin P.; Lindner, Daniel L.; Keim, Paul

2014-01-01

White-nose syndrome is a fungal disease that has decimated bat populations across eastern North America. Identification of the etiologic agent, Pseudogymnoascus destructans (formerly Geomyces destructans), in environmental samples is essential to proposed management plans. A major challenge is the presence of closely related species, which are ubiquitous in many soils and cave sediments and often present in high abundance. We present a dual-probe real-time quantitative PCR assay capable of detecting and differentiating P. destructans from closely related fungi in environmental samples from North America. The assay, based on a single nucleotide polymorphism (SNP) specific to P. destructans, is capable of rapid low-level detection from various sampling media, including sediment, fecal samples, wing biopsy specimens, and skin swabs. This method is a highly sensitive, high-throughput method for identifying P. destructans, other Pseudogymnoascus spp., and Geomyces spp. in the environment, providing a fundamental component of research and risk assessment for addressing this disease, as well as other ecological and mycological work on related fungi. PMID:24375140

Quantitative detection of settled coal dust over green canopy

NASA Astrophysics Data System (ADS)

Brook, Anna; Sahar, Nir

2017-04-01

The main task of environmental and geoscience applications are efficient and accurate quantitative classification of earth surfaces and spatial phenomena. In the past decade, there has been a significant interest in employing spectral unmixing in order to retrieve accurate quantitative information latent in in situ data. Recently, the ground-truth and laboratory measured spectral signatures promoted by advanced algorithms are proposed as a new path toward solving the unmixing problem in semi-supervised fashion. This study presents a practical implementation of field spectroscopy as a quantitative tool to detect settled coal dust over green canopy in free/open environment. Coal dust is a fine powdered form of coal, which is created by the crushing, grinding, and pulverizing of coal. Since the inelastic nature of coal, coal dust can be created during transportation, or by mechanically handling coal. Coal dust, categorized at silt-clay particle size, of particular concern due to heavy metals (lead, mercury, nickel, tin, cadmium, mercury, antimony, arsenic, isotopes of thorium and strontium) which are toxic also at low concentrations. This hazard exposes risk on both environment and public health. It has been identified by medical scientist around the world as causing a range of diseases and health problems, mainly heart and respiratory diseases like asthma and lung cancer. It is due to the fact that the fine invisible coal dust particles (less than 2.5 microns) long lodge in the lungs and are not naturally expelled, so long-term exposure increases the risk of health problems. Numerus studies reported that data to conduct study of geographic distribution of the very fine coal dust (smaller than PM 2.5) and related health impacts from coal exports, is not being collected. Sediment dust load in an indoor environment can be spectrally assessed using reflectance spectroscopy (Chudnovsky and Ben-Dor, 2009). Small amounts of particulate pollution that may carry a signature

Quantitative Tagless Copurification: A Method to Validate and Identify Protein-Protein Interactions

DOE PAGES

Shatsky, Maxim; Dong, Ming; Liu, Haichuan; ...

2016-04-20

Identifying protein-protein interactions (PPIs) at an acceptable false discovery rate (FDR) is challenging. Previously we identified several hundred PPIs from affinity purification - mass spectrometry (AP-MS) data for the bacteria Escherichia coli and Desulfovibrio vulgaris. These two interactomes have lower FDRs than any of the nine interactomes proposed previously for bacteria and are more enriched in PPIs validated by other data than the nine earlier interactomes. To more thoroughly determine the accuracy of ours or other interactomes and to discover further PPIs de novo, here we present a quantitative tagless method that employs iTRAQ MS to measure the copurification ofmore » endogenous proteins through orthogonal chromatography steps. 5273 fractions from a four-step fractionation of a D. vulgaris protein extract were assayed, resulting in the detection of 1242 proteins. Protein partners from our D. vulgaris and E. coli AP-MS interactomes copurify as frequently as pairs belonging to three benchmark data sets of well-characterized PPIs. In contrast, the protein pairs from the nine other bacterial interactomes copurify two- to 20-fold less often. We also identify 200 high confidence D. vulgaris PPIs based on tagless copurification and colocalization in the genome. These PPIs are as strongly validated by other data as our AP-MS interactomes and overlap with our AP-MS interactome for D.vulgaris within 3% of expectation, once FDRs and false negative rates are taken into account. Finally, we reanalyzed data from two quantitative tagless screens of human cell extracts. We estimate that the novel PPIs reported in these studies have an FDR of at least 85% and find that less than 7% of the novel PPIs identified in each screen overlap. Our results establish that a quantitative tagless method can be used to validate and identify PPIs, but that such data must be analyzed carefully to minimize the FDR.« less

Quantitative Tagless Copurification: A Method to Validate and Identify Protein-Protein Interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shatsky, Maxim; Dong, Ming; Liu, Haichuan

Identifying protein-protein interactions (PPIs) at an acceptable false discovery rate (FDR) is challenging. Previously we identified several hundred PPIs from affinity purification - mass spectrometry (AP-MS) data for the bacteria Escherichia coli and Desulfovibrio vulgaris. These two interactomes have lower FDRs than any of the nine interactomes proposed previously for bacteria and are more enriched in PPIs validated by other data than the nine earlier interactomes. To more thoroughly determine the accuracy of ours or other interactomes and to discover further PPIs de novo, here we present a quantitative tagless method that employs iTRAQ MS to measure the copurification ofmore » endogenous proteins through orthogonal chromatography steps. 5273 fractions from a four-step fractionation of a D. vulgaris protein extract were assayed, resulting in the detection of 1242 proteins. Protein partners from our D. vulgaris and E. coli AP-MS interactomes copurify as frequently as pairs belonging to three benchmark data sets of well-characterized PPIs. In contrast, the protein pairs from the nine other bacterial interactomes copurify two- to 20-fold less often. We also identify 200 high confidence D. vulgaris PPIs based on tagless copurification and colocalization in the genome. These PPIs are as strongly validated by other data as our AP-MS interactomes and overlap with our AP-MS interactome for D.vulgaris within 3% of expectation, once FDRs and false negative rates are taken into account. Finally, we reanalyzed data from two quantitative tagless screens of human cell extracts. We estimate that the novel PPIs reported in these studies have an FDR of at least 85% and find that less than 7% of the novel PPIs identified in each screen overlap. Our results establish that a quantitative tagless method can be used to validate and identify PPIs, but that such data must be analyzed carefully to minimize the FDR.« less

Industrial ecology: Quantitative methods for exploring a lower carbon future

NASA Astrophysics Data System (ADS)

Thomas, Valerie M.

2015-03-01

Quantitative methods for environmental and cost analyses of energy, industrial, and infrastructure systems are briefly introduced and surveyed, with the aim of encouraging broader utilization and development of quantitative methods in sustainable energy research. Material and energy flow analyses can provide an overall system overview. The methods of engineering economics and cost benefit analysis, such as net present values, are the most straightforward approach for evaluating investment options, with the levelized cost of energy being a widely used metric in electricity analyses. Environmental lifecycle assessment has been extensively developed, with both detailed process-based and comprehensive input-output approaches available. Optimization methods provide an opportunity to go beyond engineering economics to develop detailed least-cost or least-impact combinations of many different choices.

Quantitative SERS detection of low-concentration aromatic polychlorinated biphenyl-77 and 2,4,6-trinitrotoluene.

PubMed

Bao, Zhi Yong; Liu, Xin; Chen, Y; Wu, Yucheng; Chan, Helen L W; Dai, Jiyan; Lei, Dang Yuan

2014-09-15

This paper reports a simple label-free high-sensitive method for detecting low-concentration persistent organic pollutants and explosive materials. The proposed method combines surface-enhanced Raman spectroscopy (SERS) and magnetomotive enrichment of the target molecules on the surface of Ag nanoparticles (NPs). This structure can be achieved through self-assembling integration of Ag NPs with ferromagnetic Fe3O4 microspheres, forming a hybrid SERS nanoprobe with both optical and magnetic properties. Moreover, the magnetic response of ferromagnetic Fe3O4 microspheres can be used to dynamically modulate the optical property of Ag NPs through controlling their geometric arrangement on the substrate by applying an external magnetic field. It is also demonstrated from the full-wave numerical simulation results that the maximum electromagnetic field enhancement can be greatly increased by shortening the distance of neighboring Ag NPs and therefore resulting in an improved SERS detecting limit. More importantly, by using the prepared substrate, the SERS signals from organic pollution substances, i.e. aromatic polychlorinated biphenyl-77 and 2,4,6-trinitrotoluene, were quantitatively analyzed. Copyright © 2014 Elsevier B.V. All rights reserved.

A comparison of quantitative methods for clinical imaging with hyperpolarized (13)C-pyruvate.

PubMed

Daniels, Charlie J; McLean, Mary A; Schulte, Rolf F; Robb, Fraser J; Gill, Andrew B; McGlashan, Nicholas; Graves, Martin J; Schwaiger, Markus; Lomas, David J; Brindle, Kevin M; Gallagher, Ferdia A

2016-04-01

Dissolution dynamic nuclear polarization (DNP) enables the metabolism of hyperpolarized (13)C-labelled molecules, such as the conversion of [1-(13)C]pyruvate to [1-(13)C]lactate, to be dynamically and non-invasively imaged in tissue. Imaging of this exchange reaction in animal models has been shown to detect early treatment response and correlate with tumour grade. The first human DNP study has recently been completed, and, for widespread clinical translation, simple and reliable methods are necessary to accurately probe the reaction in patients. However, there is currently no consensus on the most appropriate method to quantify this exchange reaction. In this study, an in vitro system was used to compare several kinetic models, as well as simple model-free methods. Experiments were performed using a clinical hyperpolarizer, a human 3 T MR system, and spectroscopic imaging sequences. The quantitative methods were compared in vivo by using subcutaneous breast tumours in rats to examine the effect of pyruvate inflow. The two-way kinetic model was the most accurate method for characterizing the exchange reaction in vitro, and the incorporation of a Heaviside step inflow profile was best able to describe the in vivo data. The lactate time-to-peak and the lactate-to-pyruvate area under the curve ratio were simple model-free approaches that accurately represented the full reaction, with the time-to-peak method performing indistinguishably from the best kinetic model. Finally, extracting data from a single pixel was a robust and reliable surrogate of the whole region of interest. This work has identified appropriate quantitative methods for future work in the analysis of human hyperpolarized (13)C data. © 2016 The Authors. NMR in Biomedicine published by John Wiley & Sons Ltd.

Advances in methods for detection of anaerobic ammonium oxidizing (anammox) bacteria.

PubMed

Li, Meng; Gu, Ji-Dong

2011-05-01

Anaerobic ammonium oxidation (anammox), the biochemical process oxidizing ammonium into dinitrogen gas using nitrite as an electron acceptor, has only been recognized for its significant role in the global nitrogen cycle not long ago, and its ubiquitous distribution in a wide range of environments has changed our knowledge about the contributors to the global nitrogen cycle. Currently, several groups of methods are used in detection of anammox bacteria based on their physiological and biochemical characteristics, cellular chemical composition, and both 16S rRNA gene and selective functional genes as biomarkers, including hydrazine oxidoreductase and nitrite reductase encoding genes hzo and nirS, respectively. Results from these methods coupling with advances in quantitative PCR, reverse transcription of mRNA genes and stable isotope labeling have improved our understanding on the distribution, diversity, and activity of anammox bacteria in different environments both natural and engineered ones. In this review, we summarize these methods used in detection of anammox bacteria from various environments, highlight the strengths and weakness of these methods, and also discuss the new development potentials on the existing and new techniques in the future.

The efficiency of concentration methods used to detect enteric viruses in anaerobically digested sludge

PubMed Central

Prado, Tatiana; Guilayn, Wilma de Carvalho Pereira Bonet; Gaspar, Ana Maria Coimbra; Miagostovich, Marize Pereira

2013-01-01

The presence of enteric viruses in biosolids can be underestimated due to the inefficient methods (mainly molecular methods) used to recover the viruses from these matrices. Therefore, the goal of this study was to evaluate the different methods used to recover adenoviruses (AdV), rotavirus species A (RVA), norovirus genogroup II (NoV GII) and the hepatitis A virus (HAV) from biosolid samples at a large urban wastewater treatment plant in Brazil after they had been treated by mesophilic anaerobic digestion. Quantitative polymerase chain reaction (PCR) was used for spiking experiments to compare the detection limits of feasible methods, such as beef extract elution and ultracentrifugation. Tests were performed to detect the inhibition levels and the bacteriophage PP7 was used as an internal control. The results showed that the inhibitors affected the efficiency of the PCR reaction and that beef extract elution is a suitable method for detecting enteric viruses, mainly AdV from biosolid samples. All of the viral groups were detected in the biosolid samples: AdV (90%), RVA, NoV GII (45%) and HAV (18%), indicating the viruses' resistance to the anaerobic treatment process. This is the first study in Brazil to detect the presence of RVA, AdV, NoV GII and HAV in anaerobically digested sludge, highlighting the importance of adequate waste management. PMID:23440119

A general method for bead-enhanced quantitation by flow cytometry

PubMed Central

Montes, Martin; Jaensson, Elin A.; Orozco, Aaron F.; Lewis, Dorothy E.; Corry, David B.

2009-01-01

Flow cytometry provides accurate relative cellular quantitation (percent abundance) of cells from diverse samples, but technical limitations of most flow cytometers preclude accurate absolute quantitation. Several quantitation standards are now commercially available which, when added to samples, permit absolute quantitation of CD4+ T cells. However, these reagents are limited by their cost, technical complexity, requirement for additional software and/or limited applicability. Moreover, few studies have validated the use of such reagents in complex biological samples, especially for quantitation of non-T cells. Here we show that addition to samples of known quantities of polystyrene fluorescence standardization beads permits accurate quantitation of CD4+ T cells from complex cell samples. This procedure, here termed single bead-enhanced cytofluorimetry (SBEC), was equally capable of enumerating eosinophils as well as subcellular fragments of apoptotic cells, moieties with very different optical and fluorescent characteristics. Relative to other proprietary products, SBEC is simple, inexpensive and requires no special software, suggesting that the method is suitable for the routine quantitation of most cells and other particles by flow cytometry. PMID:17067632

The use of experimental design for the development of a capillary zone electrophoresis method for the quantitation of captopril.

PubMed

Mukozhiwa, S Y; Khamanga, S M M; Walker, R B

2017-09-01

A capillary zone electrophoresis (CZE) method for the quantitation of captopril (CPT) using UV detection was developed. Influence of electrolyte concentration and system variables on electrophoretic separation was evaluated and a central composite design (CCD) was used to optimize the method. Variables investigated were pH, molarity, applied voltage and capillary length. The influence of sodium metabisulphite on the stability of test solutions was also investigated. The use of sodium metabisulphite prevented degradation of CPT over 24 hours. A fused uncoated silica capillary of 67.5cm total and 57.5 cm effective length was used for analysis. The applied voltage and capillary length affected the migration time of CPT significantly. A 20 mM phosphate buffer adjusted to pH 7.0 was used as running buffer and an applied voltage of 23.90 kV was suitable to effect a separation. The optimized electrophoretic conditions produced sharp, well-resolved peaks for CPT and sodium metabisulphite. Linear regression analysis of the response for CPT standards revealed the method was linear (R2 = 0.9995) over the range 5-70 μg/mL. The limits of quantitation and detection were 5 and 1.5 μg/mL. A simple, rapid and reliable CZE method has been developed and successfully applied to the analysis of commercially available CPT products.

Breast tumour visualization using 3D quantitative ultrasound methods

NASA Astrophysics Data System (ADS)

Gangeh, Mehrdad J.; Raheem, Abdul; Tadayyon, Hadi; Liu, Simon; Hadizad, Farnoosh; Czarnota, Gregory J.

2016-04-01

Breast cancer is one of the most common cancer types accounting for 29% of all cancer cases. Early detection and treatment has a crucial impact on improving the survival of affected patients. Ultrasound (US) is non-ionizing, portable, inexpensive, and real-time imaging modality for screening and quantifying breast cancer. Due to these attractive attributes, the last decade has witnessed many studies on using quantitative ultrasound (QUS) methods in tissue characterization. However, these studies have mainly been limited to 2-D QUS methods using hand-held US (HHUS) scanners. With the availability of automated breast ultrasound (ABUS) technology, this study is the first to develop 3-D QUS methods for the ABUS visualization of breast tumours. Using an ABUS system, unlike the manual 2-D HHUS device, the whole patient's breast was scanned in an automated manner. The acquired frames were subsequently examined and a region of interest (ROI) was selected in each frame where tumour was identified. Standard 2-D QUS methods were used to compute spectral and backscatter coefficient (BSC) parametric maps on the selected ROIs. Next, the computed 2-D parameters were mapped to a Cartesian 3-D space, interpolated, and rendered to provide a transparent color-coded visualization of the entire breast tumour. Such 3-D visualization can potentially be used for further analysis of the breast tumours in terms of their size and extension. Moreover, the 3-D volumetric scans can be used for tissue characterization and the categorization of breast tumours as benign or malignant by quantifying the computed parametric maps over the whole tumour volume.

Highly sensitive electrochemical detection of human telomerase activity based on bio-barcode method.

PubMed

Li, Ying; Liu, Bangwei; Li, Xia; Wei, Qingli

2010-07-15

In the present study, an electrochemical method for highly sensitive detection of human telomerase activity was developed based on bio-barcode amplification assay. Telomerase was extracted from HeLa cells, then the extract was mixed with telomerase substrate (TS) primer to perform extension reaction. The extension product was hybridized with the capture DNA immobilized on the Au electrode and then reacted with the signal DNA on Au nanoparticles to form a sandwich hybridization mode. Electrochemical signals were generated by chronocoulometric interrogation of [Ru(NH(3))(6)](3+) that quantitatively binds to the DNA on Au nanoparticles via electrostatic interaction. This method can detect the telomerase activity from as little as 10 cultured cancer cells without the polymerase chain reaction (PCR) amplification of telomerase extension product. Copyright (c) 2010 Elsevier B.V. All rights reserved.

A novel quantitative analysis method of three-dimensional fluorescence spectra for vegetable oils contents in edible blend oil

NASA Astrophysics Data System (ADS)

Xu, Jing; Wang, Yu-Tian; Liu, Xiao-Fei

2015-04-01

Edible blend oil is a mixture of vegetable oils. Eligible blend oil can meet the daily need of two essential fatty acids for human to achieve the balanced nutrition. Each vegetable oil has its different composition, so vegetable oils contents in edible blend oil determine nutritional components in blend oil. A high-precision quantitative analysis method to detect the vegetable oils contents in blend oil is necessary to ensure balanced nutrition for human being. Three-dimensional fluorescence technique is high selectivity, high sensitivity, and high-efficiency. Efficiency extraction and full use of information in tree-dimensional fluorescence spectra will improve the accuracy of the measurement. A novel quantitative analysis is proposed based on Quasi-Monte-Carlo integral to improve the measurement sensitivity and reduce the random error. Partial least squares method is used to solve nonlinear equations to avoid the effect of multicollinearity. The recovery rates of blend oil mixed by peanut oil, soybean oil and sunflower are calculated to verify the accuracy of the method, which are increased, compared the linear method used commonly for component concentration measurement.

[A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].

PubMed

Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan

2015-04-01

To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.

Detection of Nanophyetus salmincola in water, snails, and fish tissues by quantitative polymerase chain reaction

USGS Publications Warehouse

Purcell, Maureen K.; Powers, Rachel L.; Besijn, Bonnie; Hershberger, Paul K.

2017-01-01

We report the development and validation of two quantitative PCR (qPCR) assays to detect Nanophyetus salmincola DNA in water samples and in fish and snail tissues. Analytical and diagnostic validation demonstrated good sensitivity, specificity, and repeatability of both qPCR assays. The N. salmincola DNA copy number in kidney tissue was significantly correlated with metacercaria counts based on microscopy. Extraction methods were optimized for the sensitive qPCR detection of N. salmincola DNA in settled water samples. Artificially spiked samples suggested that the 1-cercaria/L threshold corresponded to an estimated log10 copies per liter ≥ 6.0. Significant correlation of DNA copy number per liter and microscopic counts indicated that the estimated qPCR copy number was a good predictor of the number of waterborne cercariae. However, the detection of real-world samples below the estimated 1-cercaria/L threshold suggests that the assays may also detect other N. salmincola life stages, nonintact cercariae, or free DNA that settles with the debris. In summary, the qPCR assays reported here are suitable for identifying and quantifying all life stages of N. salmincola that occur in fish tissues, snail tissues, and water.

Blending quantitative and qualitative methods in language research and intervention.

PubMed

Brinton, Bonnie; Fujiki, Martin

2003-05-01

Best practice in speech-language pathology should be informed by current research findings. Traditional research methods are not always geared to address some of the complex, individual questions that arise in clinical intervention, however. Qualitative research methods may provide useful tools for bridging the gap from research to practice. Combinations of qualitative and quantitative procedures may be particularly helpful in sorting out some of the important issues surrounding language intervention in both clinical and research contexts. Examples of research blending qualitative and quantitative methods, as well as the case study of Sid, an 11-year-old boy with specific language impairment, are presented to illustrate how a combination of procedures can be used to enhance language research and intervention.