Sample records for quantitative differential expression

  1. Quantitative Proteomic Analysis of Differentially Expressed Protein Profiles Involved in Pancreatic Ductal Adenocarcinoma

    PubMed Central

    Kuo, Kung-Kai; Kuo, Chao-Jen; Chiu, Chiang-Yen; Liang, Shih-Shin; Huang, Chun-Hao; Chi, Shu-Wen; Tsai, Kun-Bow; Chen, Chiao-Yun; Hsi, Edward; Cheng, Kuang-Hung; Chiou, Shyh-Horng


    Objectives The aim of this study was to identify differentially expressed proteins among various stages of pancreatic ductal adenocarcinoma (PDAC) by shotgun proteomics using nano-liquid chromatography coupled tandem mass spectrometry and stable isotope dimethyl labeling. Methods Differentially expressed proteins were identified and compared based on the mass spectral differences of their isotope-labeled peptide fragments generated from protease digestion. Results Our quantitative proteomic analysis of the differentially expressed proteins with stable isotope (deuterium/hydrogen ratio, ≥2) identified a total of 353 proteins, with at least 5 protein biomarker proteins that were significantly differentially expressed between cancer and normal mice by at least a 2-fold alteration. These 5 protein biomarker candidates include α-enolase, α-catenin, 14-3-3 β, VDAC1, and calmodulin with high confidence levels. The expression levels were also found to be in agreement with those examined by Western blot and histochemical staining. Conclusions The systematic decrease or increase of these identified marker proteins may potentially reflect the morphological aberrations and diseased stages of pancreas carcinoma throughout progressive developments leading to PDAC. The results would form a firm foundation for future work concerning validation and clinical translation of some identified biomarkers into targeted diagnosis and therapy for various stages of PDAC. PMID:26262590

  2. Quantitative Analysis of Differential Proteome Expression in Bladder Cancer vs. Normal Bladder Cells Using SILAC Method

    PubMed Central

    Yang, Ganglong; Xu, Zhipeng; Lu, Wei; Li, Xiang; Sun, Chengwen; Guo, Jia; Xue, Peng; Guan, Feng


    The best way to increase patient survival rate is to identify patients who are likely to progress to muscle-invasive or metastatic disease upfront and treat them more aggressively. The human cell lines HCV29 (normal bladder epithelia), KK47 (low grade nonmuscle invasive bladder cancer, NMIBC), and YTS1 (metastatic bladder cancer) have been widely used in studies of molecular mechanisms and cell signaling during bladder cancer (BC) progression. However, little attention has been paid to global quantitative proteome analysis of these three cell lines. We labeled HCV29, KK47, and YTS1 cells by the SILAC method using three stable isotopes each of arginine and lysine. Labeled proteins were analyzed by 2D ultrahigh-resolution liquid chromatography LTQ Orbitrap mass spectrometry. Among 3721 unique identified and annotated proteins in KK47 and YTS1 cells, 36 were significantly upregulated and 74 were significantly downregulated with >95% confidence. Differential expression of these proteins was confirmed by western blotting, quantitative RT-PCR, and cell staining with specific antibodies. Gene ontology (GO) term and pathway analysis indicated that the differentially regulated proteins were involved in DNA replication and molecular transport, cell growth and proliferation, cellular movement, immune cell trafficking, and cell death and survival. These proteins and the advanced proteome techniques described here will be useful for further elucidation of molecular mechanisms in BC and other types of cancer. PMID:26230496

  3. Identification and validation of differentially expressed proteins in epithelial ovarian cancers using quantitative proteomics

    PubMed Central

    Cao, Guangming; Liu, Chongdong; Xu, Jiatong; Deng, Haiteng; Zhang, Zhenyu


    Ovarian cancer is the most lethal gynecological malignant tumor because of its high recurrence rate. In the present work, in order to find new therapeutic targets, we identified 8480 proteins in thirteen pairs of ovarian cancer tissues and normal ovary tissues through quantitative proteomics. 498 proteins were found to be differentially expressed in ovarian cancer, which involved in various cellular processes, including metabolism, response to stimulus and biosynthetic process. The expression levels of chloride intracellular channel protein 1 (CLIC1) and lectin galactoside-binding soluble 3 binding protein (LGALS3BP) in epithelial ovarian cancer tissues were significantly higher than those in normal ovary tissues as confirmed by western blotting and immunohistochemistry. The knockdown of CLIC1 in A2780 cell line downregulated expression of CTPS1, leading to the decrease of CTP and an arrest of cell cycle G1 phase, which results into a slower proliferation. CLIC1-knockdown can also slow down the tumor growth in vivo. Besides, CLIC1-knockdown cells showed an increased sensitivity to hydrogen peroxide and cisplatin, suggesting that CLIC1 was involved in regulation of redox and drug resistance in ovarian cancer cells. These results indicate CLIC1 promotes tumorgenesis, and is a potential therapeutic target in epithelial ovarian cancer treatment. PMID:27825122

  4. Quantitative proteomics reveals differential regulation of protein expression in recipient myocardium after trilineage cardiovascular cell transplantation

    PubMed Central

    Chang, Ying-Hua; Ye, Lei; Cai, Wenxuan; Lee, Yoonkyu; Guner, Huseyin; Lee, Youngsook; Kamp, Timothy J.; Zhang, Jianyi; Ge, Ying


    Intramyocardial transplantation of cardiomyocytes (CMs), endothelial cells (ECs), and smooth muscle cells (SMCs) derived from human induced pluripotent stem cells (hiPSCs) has beneficial effects on the post-infarction heart. However, the mechanisms underlying the functional improvements remain undefined. We employed large-scale label-free quantitative proteomics to identify proteins that were differentially regulated following cellular transplantation in a swine model of myocardial infarction (MI). We identified 22 proteins that were significantly up-regulated after trilineage cell transplantation compared to both MI and Sham groups. Among them, 12 proteins, including adenylyl cyclase-associated protein 1 and tropomodulin-1, are associated with positive regulation of muscular contraction whereas 11 proteins, such as desmoplakin and zyxin, are involved in embryonic and muscular development and regeneration. Moreover, we identified 21 proteins up-regulated and another 21 down-regulated in MI, but reversed after trilineage cell transplantation. Proteins up-regulated after MI but reversed by transplantation are related to fibrosis and apoptosis. Conversely, proteins down-regulated in MI but restored after cell therapy are regulators of protein nitrosylation. Our results show that the functionally beneficial effects of trilineage cell therapy are accompanied by differential regulation of protein expression in the recipient myocardium, which may contribute to the improved cardiac function. PMID:26033914

  5. Quantitative proteomics reveals differential regulation of protein expression in recipient myocardium after trilineage cardiovascular cell transplantation.


    Chang, Ying-Hua; Ye, Lei; Cai, Wenxuan; Lee, Yoonkyu; Guner, Huseyin; Lee, Youngsook; Kamp, Timothy J; Zhang, Jianyi; Ge, Ying


    Intramyocardial transplantation of cardiomyocytes (CMs), endothelial cells (ECs), and smooth muscle cells (SMCs) derived from human induced pluripotent stem cells (hiPSCs) has beneficial effects on the post-infarction heart. However, the mechanisms underlying the functional improvements remain undefined. We employed large-scale label-free quantitative proteomics to identify proteins that were differentially regulated following cellular transplantation in a swine model of myocardial infarction (MI). We identified 22 proteins that were significantly up-regulated after trilineage cell transplantation compared to both MI and Sham groups. Among them, 12 proteins, including adenylyl cyclase-associated protein 1 and tropomodulin-1, are associated with positive regulation of muscular contraction whereas 11 proteins, such as desmoplakin and zyxin, are involved in embryonic and muscular development and regeneration. Moreover, we identified 21 proteins up-regulated and another 21 down-regulated in MI, but reversed after trilineage cell transplantation. Proteins up-regulated after MI but reversed by transplantation are related to fibrosis and apoptosis. Conversely, proteins down-regulated in MI but restored after cell therapy are regulators of protein nitrosylation. Our results show that the functionally beneficial effects of trilineage cell therapy are accompanied by differential regulation of protein expression in the recipient myocardium, which may contribute to the improved cardiac function.

  6. Proteomic analysis of cow, yak, buffalo, goat and camel milk whey proteins: quantitative differential expression patterns.


    Yang, Yongxin; Bu, Dengpan; Zhao, Xiaowei; Sun, Peng; Wang, Jiaqi; Zhou, Lingyun


    To aid in unraveling diverse genetic and biological unknowns, a proteomic approach was used to analyze the whey proteome in cow, yak, buffalo, goat, and camel milk based on the isobaric tag for relative and absolute quantification (iTRAQ) techniques. This analysis is the first to produce proteomic data for the milk from the above-mentioned animal species: 211 proteins have been identified and 113 proteins have been categorized according to molecular function, cellular components, and biological processes based on gene ontology annotation. The results of principal component analysis showed significant differences in proteomic patterns among goat, camel, cow, buffalo, and yak milk. Furthermore, 177 differentially expressed proteins were submitted to advanced hierarchical clustering. The resulting clustering pattern included three major sample clusters: (1) cow, buffalo, and yak milk; (2) goat, cow, buffalo, and yak milk; and (3) camel milk. Certain proteins were chosen as characterization traits for a given species: whey acidic protein and quinone oxidoreductase for camel milk, biglycan for goat milk, uncharacterized protein (Accession Number: F1MK50 ) for yak milk, clusterin for buffalo milk, and primary amine oxidase for cow milk. These results help reveal the quantitative milk whey proteome pattern for analyzed species. This provides information for evaluating adulteration of specific specie milk and may provide potential directions for application of specific milk protein production based on physiological differences among animal species.

  7. Identification of stromal differentially expressed proteins in the colon carcinoma by quantitative proteomics.


    Mu, Yibing; Chen, Yongheng; Zhang, Guiying; Zhan, Xianquan; Li, Yuanyuan; Liu, Ting; Li, Guoqing; Li, Maoyu; Xiao, Zhefeng; Gong, Xiaoxiang; Chen, Zhuchu


    Tumor microenvironment plays very important roles in the carcinogenesis. A variety of stromal cells in the microenvironment have been modified to support the unique needs of the malignant state. This study was to discover stromal differentially expressed proteins (DEPs) that were involved in colon carcinoma carcinogenesis. Laser capture microdissection (LCM) was captured and isolated the stromal cells from colon adenocarcinoma (CAC) and non-neoplastic colon mucosa (NNCM) tissues, respectively. Seventy DEPs were identified between the pooled LCM-enriched CAC and NNCM stroma samples by iTRAQ-based quantitative proteomics. Gene Ontology (GO) relationship analysis revealed that DEPs were hierarchically grouped into 10 clusters, and were involved in multiple biological functions that were altered during carcinogenesis, including extracellular matrix organization, cytoskeleton, transport, metabolism, inflammatory response, protein polymerization, and cell motility. Pathway network analysis revealed 6 networks and 56 network eligible proteins with Ingenuity pathway analysis. Four significant networks functioned in digestive system development and its function, inflammatory disease, and developmental disorder. Eight DEPs (DCN, FN1, PKM2, HSP90B1, S100A9, MYH9, TUBB, and YWHAZ) were validated by Western blotting, and four DEPs (DCN, FN1, PKM2, and HSP90B1) were validated by immunohistochemical analysis. It is the first report of stromal DEPs between CAC and NNCM tissues. It will be helpful to recognize the roles of stromas in the colon carcinoma microenvironment, and improve the understanding of carcinogenesis in colon carcinoma. The present data suggest that DCN, FN1, PKM2, HSP90B1, S100A9, MYH9, TUBB, and YWHAZ might be the potential targets for colon cancer prevention and therapy.

  8. TeratoScore: Assessing the Differentiation Potential of Human Pluripotent Stem Cells by Quantitative Expression Analysis of Teratomas

    PubMed Central

    Avior, Yishai; Biancotti, Juan Carlos; Benvenisty, Nissim


    Summary Teratoma formation is the gold standard assay for testing the capacity of human pluripotent stem cells to differentiate into all embryonic germ layers. Although widely used, little effort has been made to transform this qualitative assay into a quantitative one. Using gene expression data from a wide variety of cells, we created a scorecard representing tissues from all germ layers and extraembryonic tissues. TeratoScore, an online, open-source platform based on this scorecard, distinguishes pluripotent stem cell-derived teratomas from malignant tumors, translating cell potency into a quantitative measure ( The teratomas used for the algorithm also allowed us to examine gene expression differences between tumors with a diploid karyotype and those initiated by aneuploid cells. Chromosomally aberrant teratomas show a significantly different gene expression signature from that of teratomas originating from diploid cells, particularly in central nervous system-specific genes, congruent with human chromosomal syndromes. PMID:26070610

  9. Identification of genes differentially expressed during adventitious shoot induction in Pinus pinea cotyledons by subtractive hybridization and quantitative PCR.


    Alonso, Pablo; Cortizo, Millán; Cantón, Francisco R; Fernández, Belén; Rodríguez, Ana; Centeno, Maria L; Cánovas, Francisco M; Ordás, Ricardo J


    As part of a study aimed at understanding the physiological and molecular mechanisms involved in adventitious shoot bud formation in pine cotyledons, we conducted a transcriptome analysis to identify early-induced genes during the first phases of adventitious caulogenesis in Pinus pinea L. cotyledons cultured in the presence of benzyladenine. A subtractive cDNA library with more than 700 clones was constructed. Of these clones, 393 were sequenced, analyzed and grouped according to their putative function. Quantitative real-time PCR analysis was performed to confirm the differential expression of 30 candidate genes. Results are contrasted with available data for other species.

  10. Quantitative RT-PCR analysis of differentially expressed genes in Quercus suber in response to Phytophthora cinnamomi infection.


    Ebadzad, Ghazal; Cravador, Alfredo


    cDNA-AFLP methodology was used to gain insight into gene fragments differentially present in the mRNA profiles of Quercus suber roots infected with zoospores of Phytophthora cinnamomi at different post challenge time points. Fifty-three transcript-derived fragments (TDFs) were identified and sequenced. Six candidate genes were selected based on their expression patterns and homology to genes known to play a role in defence. They encode a cinnamyl alcohol dehydrogenase2 (QsCAD2), a protein disulphide isomerase (QsPDI), a CC-NBS-LRR resistance protein (QsRPc), a thaumatin-like protein (QsTLP), a chitinase (QsCHI) and a 1,3-β-glucanase (QsGlu). Evaluation of the expression of these genes by quantitative polymerase chain reaction (qPCR) revealed that transcript levels of QsRPc, QsCHI, QsCAD2 and QsPDI increased during the first 24 h post-inoculation, while those of thaumatin-like protein decreased. No differential expression was observed for 1,3-β-glucanase (QsGlu). Four candidate reference genes, polymerase II (QsRPII), eukaryotic translation initiation factor 5A (QsEIF-5A), β-tubulin (QsTUB) and a medium subunit family protein of clathrin adaptor complexes (QsCACs) were assessed to determine the most stable internal references for qRT-PCR normalization in the Phytophthora-Q. suber pathosystem in root tissues. Those found to be more stable, QsRPII and QsCACs, were used as internal reference in the present work. Knowledge on the Quercus defence mechanisms against biotic stress is scarce. This study provides an insight into the gene profiling of a few important genes of Q. suber in response to P. cinnamomi infection contributing to the knowledge of the molecular interactions involving Quercus and root pathogens that can be useful in the future to understand the mechanisms underlying oak resistance to soil-borne oomycetes.

  11. Identification of suitable reference genes for quantitative gene expression analysis in rat adipose stromal cells induced to trilineage differentiation.


    Santos, Bruno Paiva Dos; da Costa Diesel, Luciana Fraga; da Silva Meirelles, Lindolfo; Nardi, Nance Beyer; Camassola, Melissa


    This study was designed to (i) identify stable reference genes for the analysis of gene expression during in vitro differentiation of rat adipose stromal cells (rASCs), (ii) recommend stable genes for individual treatment conditions, and (iii) validate these genes by comparison with normalization results from stable and unstable reference genes. On the basis of a literature review, eight genes were selected: Actb, B2m, Hprt1, Ppia, Rplp0, Rpl13a, Rpl5, and Ywhaz. Genes were ranked according to their stability under different culture conditions as assessed using GenNorm, NormFinder, and RefFinder algorithms. Although the employed algorithms returned different rankings, the most frequently top-ranked genes were: B2m and/or Ppia for all 28day treatments (ALL28); Ppia and Hprt1 (adipogenic differentiation; A28), B2m (chondrogenic differentiation; C28), Rpl5 (controls maintained in complete culture medium; CCM), Rplp0 (osteogenic differentiation for 3days; O3), Rpl13a and Actb (osteogenic differentiation for 7days; O7), Rplp0 and Ppia (osteogenic differentiation for 14days; O14), Hprt1 and Ppia (osteogenic differentiation for 28days; O28), as well as Actb (all osteogenesis time points combined; ALLOSTEO). The obtained results indicate that the performance of reference genes depends on the differentiation protocol and on the analysis time, thus providing valuable information for the design of RT-PCR experiments.

  12. Differentiation of five body fluids from forensic samples by expression analysis of four microRNAs using quantitative PCR.


    Sauer, Eva; Reinke, Ann-Kathrin; Courts, Cornelius


    Applying molecular genetic approaches for the identification of forensically relevant body fluids, which often yield crucial information for the reconstruction of a potential crime, is a current topic of forensic research. Due to their body fluid specific expression patterns and stability against degradation, microRNAs (miRNA) emerged as a promising molecular species, with a range of candidate markers published. The analysis of miRNA via quantitative Real-Time PCR, however, should be based on a relevant strategy of normalization of non-biological variances to deliver reliable and biologically meaningful results. The herein presented work is the as yet most comprehensive study of forensic body fluid identification via miRNA expression analysis based on a thoroughly validated qPCR procedure and unbiased statistical decision making to identify single source samples.

  13. Proteomic analysis from haploid and diploid embryos of Quercus suber L. identifies qualitative and quantitative differential expression patterns.


    Gómez, Aranzazu; López, Juan Antonio; Pintos, Beatriz; Camafeita, Emilio; Bueno, Ma Angeles


    Quercus suber L. is a Mediterranean forest species with ecological, social and economic value. Clonal propagation of Q. suber elite trees has been successfully obtained from in vitro-derived somatic and gametic embryos. These clonal lines play a main role in breeding and genetic studies of Q. suber. To aid in unravelling diverse genetic and biological unknowns, a proteomic approach is proposed. The proteomic analysis of Q. suber somatic and gametic in vitro culture-derived embryos, based on DIGE and MALDI-MS, has produced for the first time proteomic data on this species. Seventeen differentially expressed proteins have been identified which display significantly altered levels between gametic and somatic embryos. These proteins are involved in a variety of cellular processes, most of which had been neither previously associated with embryo development nor identified in the genus Quercus. Some of these proteins are involved in stress and pollen development and others play a role in the metabolism of tannins and phenylpropanoids, which represent two of the major pathways for the synthesis of cork chemical components. Furthermore, the augmented expression levels found for specific proteins are probably related to the homozygous state of a doubled-haploid sample. Proteins involved in synthesis of cork components can be detected at such early stages of development, showing the potential of the method to be useful in searching for biomarkers related to cork quality.

  14. The differential expression of alternatively polyadenylated transcripts is a common stress-induced response mechanism that modulates mammalian mRNA expression in a quantitative and qualitative fashion.


    Hollerer, Ina; Curk, Tomaz; Haase, Bettina; Benes, Vladimir; Hauer, Christian; Neu-Yilik, Gabriele; Bhuvanagiri, Madhuri; Hentze, Matthias W; Kulozik, Andreas E


    Stress adaptation plays a pivotal role in biological processes and requires tight regulation of gene expression. In this study, we explored the effect of cellular stress on mRNA polyadenylation and investigated the implications of regulated polyadenylation site usage on mammalian gene expression. High-confidence polyadenylation site mapping combined with global pre-mRNA and mRNA expression profiling revealed that stress induces an accumulation of genes with differentially expressed polyadenylated mRNA isoforms in human cells. Specifically, stress provokes a global trend in polyadenylation site usage toward decreased utilization of promoter-proximal poly(A) sites in introns or ORFs and increased utilization of promoter-distal polyadenylation sites in intergenic regions. This extensively affects gene expression beyond regulating mRNA abundance by changing mRNA length and by altering the configuration of open reading frames. Our study highlights the impact of post-transcriptional mechanisms on stress-dependent gene regulation and reveals the differential expression of alternatively polyadenylated transcripts as a common stress-induced mechanism in mammalian cells.

  15. Differentially expressed genes of Tetrahymena thermophila in response to tributyltin (TBT) identified by suppression subtractive hybridization and real time quantitative PCR.


    Feng, Lifang; Miao, Wei; Wu, Yuxuan


    Tributyltin (TBT) is widely used as antifouling paints, agriculture biocides, and plastic stabilizers around the world, resulting in great pollution problem in aquatic environments. However, it has been short of the biomonitor to detect TBT in freshwater. We constructed the suppression subtractive hybridization library of Tetrahymena thermophila exposed to TBT, and screened out 101 Expressed Sequence Tags whose expressions were significantly up- or down-regulated with TBT treatment. From this, a series of genes related to the TBT toxicity were discovered, such as glutathione-S-transferase gene (down-regulated), plasma membrane Ca2+ ATPase isoforms 3 gene (up-regulated) and NgoA (up-regulated). Furthermore, their expressions under different concentrations of TBT treatment (0.5-40 ppb) were detected by real time fluorescent quantitative PCR. The differentially expressed genes of T. thermophila in response to TBT were identified, which provide the basic to make Tetrahymena as a sensitive, rapid and convenient TBT biomonitor in freshwater based on rDNA inducible expression system.

  16. Performing statistical analyses on quantitative data in Taverna workflows: An example using R and maxdBrowse to identify differentially-expressed genes from microarray data

    PubMed Central

    Li, Peter; Castrillo, Juan I; Velarde, Giles; Wassink, Ingo; Soiland-Reyes, Stian; Owen, Stuart; Withers, David; Oinn, Tom; Pocock, Matthew R; Goble, Carole A; Oliver, Stephen G; Kell, Douglas B


    Background There has been a dramatic increase in the amount of quantitative data derived from the measurement of changes at different levels of biological complexity during the post-genomic era. However, there are a number of issues associated with the use of computational tools employed for the analysis of such data. For example, computational tools such as R and MATLAB require prior knowledge of their programming languages in order to implement statistical analyses on data. Combining two or more tools in an analysis may also be problematic since data may have to be manually copied and pasted between separate user interfaces for each tool. Furthermore, this transfer of data may require a reconciliation step in order for there to be interoperability between computational tools. Results Developments in the Taverna workflow system have enabled pipelines to be constructed and enacted for generic and ad hoc analyses of quantitative data. Here, we present an example of such a workflow involving the statistical identification of differentially-expressed genes from microarray data followed by the annotation of their relationships to cellular processes. This workflow makes use of customised maxdBrowse web services, a system that allows Taverna to query and retrieve gene expression data from the maxdLoad2 microarray database. These data are then analysed by R to identify differentially-expressed genes using the Taverna RShell processor which has been developed for invoking this tool when it has been deployed as a service using the RServe library. In addition, the workflow uses Beanshell scripts to reconcile mismatches of data between services as well as to implement a form of user interaction for selecting subsets of microarray data for analysis as part of the workflow execution. A new plugin system in the Taverna software architecture is demonstrated by the use of renderers for displaying PDF files and CSV formatted data within the Taverna workbench. Conclusion Taverna can

  17. Mapping quantitative trait loci for expression abundance.


    Jia, Zhenyu; Xu, Shizhong


    Mendelian loci that control the expression levels of transcripts are called expression quantitative trait loci (eQTL). When mapping eQTL, we often deal with thousands of expression traits simultaneously, which complicates the statistical model and data analysis. Two simple approaches may be taken in eQTL analysis: (1) individual transcript analysis in which a single expression trait is mapped at a time and the entire eQTL mapping involves separate analysis of thousands of traits and (2) individual marker analysis where differentially expressed transcripts are detected on the basis of their association with the segregation pattern of an individual marker and the entire analysis requires scanning markers of the entire genome. Neither approach is optimal because data are not analyzed jointly. We develop a Bayesian clustering method that analyzes all expressed transcripts and markers jointly in a single model. A transcript may be simultaneously associated with multiple markers. Additionally, a marker may simultaneously alter the expression of multiple transcripts. This is a model-based method that combines a Gaussian mixture of expression data with segregation of multiple linked marker loci. Parameter estimation for each variable is obtained via the posterior mean drawn from a Markov chain Monte Carlo sample. The method allows a regular quantitative trait to be included as an expression trait and subject to the same clustering assignment. If an expression trait links to a locus where a quantitative trait also links, the expressed transcript is considered to be associated with the quantitative trait. The method is applied to a microarray experiment with 60 F(2) mice measured for 25 different obesity-related quantitative traits. In the experiment, approximately 40,000 transcripts and 145 codominant markers are investigated for their associations. A program written in SAS/IML is available from the authors on request.

  18. Quantitative proteomics analysis of differential protein expression and oxidative modification of specific proteins in the brains of old mice.


    Poon, H Fai; Vaishnav, Radhika A; Getchell, Thomas V; Getchell, Marilyn L; Butterfield, D Allan


    The brain is susceptible to oxidative stress, which is associated with age-related brain dysfunction, because of its high content of peroxidizable unsaturated fatty acids, high oxygen consumption per unit weight, high content of key components for oxidative damage, and the relative scarcity of antioxidant defense systems. Protein oxidation, which results in functional disruption, is not random but appears to be associated with increased oxidation in specific proteins. By using a proteomics approach, we have compared the protein levels and specific protein carbonyl levels, an index of oxidative damage in the brains of old mice, to these parameters in the brains of young mice and have identified specific proteins that are altered as a function of aging. We show here that the expression levels of dihydropyrimidinase-like 2 (DRP2), alpha-enolase (ENO1), dynamin-1 (DNM1), and lactate dehydrogenase 2 (LDH2) were significantly increased in the brains of old versus young mice; the expression levels of three unidentified proteins were significantly decreased. The specific carbonyl levels of beta-actin (ACTB), glutamine synthase (GS), and neurofilament 66 (NF-66) as well as a novel protein were significantly increased, indicating protein oxidation, in the brains of old versus young mice. These results were validated by immunochemistry. In addition, enzyme activity assays demonstrated that oxidation was associated with decreased GS activity, while the activity of lactate dehydrogenase was unchanged in spite of an up-regulation of LDH2 levels. Several of the up-regulated and oxidized proteins in the brains of old mice identified in this report are known to be oxidized in neurodegenerative diseases as well, suggesting that these proteins may be particularly susceptible to processes associated with neurodegeneration. Our results establish an initial basis for understanding protein alterations that may lead to age-related cellular dysfunction in the brain.

  19. Preliminary Quantitative Profile of Differential Expression between Rat L6 Myoblasts and Myotubes by Stable Isotope Labeling by Amino acids in Cell Culture

    PubMed Central

    Cui, Ziyou; Chen, Xiulan; Lu, Bingwen; Park, Sung Kyu; Xu, Tao; Xie, Zhensheng; Xue, Peng; Hou, Junjie; Hang, Haiying; Yates, John R.; Yang, Fuquan


    Defining the mechanisms governing myogenesis has advanced in recent years. Skeletal-muscle differentiation is a multi-step process controlled spatially and temporally by various factors at the transcription level. To explore those factors involved in myogenesis, stable isotope labeling with amino acids in cell culture (SILAC), coupled with high accuracy mass spectrometry (LTQ-Orbitrap), was applied successfully. Rat L6 cell line is an excellent model system for studying muslce myogenesis in vitro. When mononucleate L6 myoblast cells reach confluent in culture plate, they could transform into multinucleate myotubes by serum starvation. By comparing protein expression of L6 myoblasts and terminally differentiated multinucleated myotubes, 1170 proteins were quantified and 379 proteins changed significantly in fully differentiated myotubes in contrast to myoblasts. These differentially expressed proteins are mainly involved in inter-or intracellular signaling, protein synthesis and degradation, protein folding, cell adhesion and extracelluar matrix, cell structure and motility, metabolism, substance transportation, etc. These findings were supported by many previous studies on myogenic differentiation, of which many up-regulated proteins were found to be involved in promoting skeletal muscle differentiation for the first time in our study. In sum, our results provide new clues for understanding the mechanism of myogenesis. PMID:19253283

  20. Differential Expression Analysis for Pathways

    PubMed Central

    Haynes, Winston A.; Higdon, Roger; Stanberry, Larissa; Collins, Dwayne; Kolker, Eugene


    Life science technologies generate a deluge of data that hold the keys to unlocking the secrets of important biological functions and disease mechanisms. We present DEAP, Differential Expression Analysis for Pathways, which capitalizes on information about biological pathways to identify important regulatory patterns from differential expression data. DEAP makes significant improvements over existing approaches by including information about pathway structure and discovering the most differentially expressed portion of the pathway. On simulated data, DEAP significantly outperformed traditional methods: with high differential expression, DEAP increased power by two orders of magnitude; with very low differential expression, DEAP doubled the power. DEAP performance was illustrated on two different gene and protein expression studies. DEAP discovered fourteen important pathways related to chronic obstructive pulmonary disease and interferon treatment that existing approaches omitted. On the interferon study, DEAP guided focus towards a four protein path within the 26 protein Notch signalling pathway. PMID:23516350

  1. Quantitative proteomics of fractionated membrane and lumen exosome proteins from isogenic metastatic and nonmetastatic bladder cancer cells reveal differential expression of EMT factors.


    Jeppesen, Dennis Kjølhede; Nawrocki, Arkadiusz; Jensen, Steffen Grann; Thorsen, Kasper; Whitehead, Bradley; Howard, Kenneth A; Dyrskjøt, Lars; Ørntoft, Torben Falck; Larsen, Martin R; Ostenfeld, Marie Stampe


    Cancer cells secrete soluble factors and various extracellular vesicles, including exosomes, into their tissue microenvironment. The secretion of exosomes is speculated to facilitate local invasion and metastatic spread. Here, we used an in vivo metastasis model of human bladder carcinoma cell line T24 without metastatic capacity and its two isogenic derivate cell lines SLT4 and FL3, which form metastases in the lungs and liver of mice, respectively. Cultivation in CLAD1000 bioreactors rather than conventional culture flasks resulted in a 13- to 16-fold increased exosome yield and facilitated quantitative proteomics of fractionated exosomes. Exosomes from T24, SLT4, and FL3 cells were partitioned into membrane and luminal fractions and changes in protein abundance related to the gain of metastatic capacity were identified by quantitative iTRAQ proteomics. We identified several proteins linked to epithelial-mesenchymal transition, including increased abundance of vimentin and hepatoma-derived growth factor in the membrane, and casein kinase II α and annexin A2 in the lumen of exosomes, respectively, from metastatic cells. The change in exosome protein abundance correlated little, although significant for FL3 versus T24, with changes in cellular mRNA expression. Our proteomic approach may help identification of proteins in the membrane and lumen of exosomes potentially involved in the metastatic process.

  2. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.


    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  3. Differential gene expression in glaucoma.


    Jakobs, Tatjana C


    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  4. Differential Aminoacylase Expression in Neuroblastoma

    PubMed Central

    Long, Patrick M.; Stradecki, Holly M.; Minturn, Jane E.; Wesley, Umadevi V.; Jaworski, Diane M.


    Neuroblastoma, a cancer of the sympathetic nervous system, is the most common extracranial solid tumor in children. MYCN amplification and increased BDNF/TrkB signaling are features of high-risk tumors; yet, only ~25% of malignant tumors display these features. Thus, the identification of additional biomarkers and therapeutic targets is essential. Since aminoacylase 1 (ACY1), an amino acid deacetylase, is a putative tumor suppressor in small cell lung and renal cell carcinomas, we investigated whether it or the other family members aspartoacylase (ASPA, aminoacylase 2) or aminoacylase 3 (ACY3) could serve a similar function in neuroblastoma. Aminoacylase expression was examined in TrkB-positive, MYCN-amplified (SMS-KCNR and SK-N-BE) and TrkB-negative, non-MYCN amplified (SK-N-AS, SK-N-SH, SH-SY5Y, and SH-EP) neuroblastoma cell lines. Each aminoacylase exhibited distinct spatial localization (i.e., cytosolic ACY1, membrane-associated ASPA, and nuclear ACY3). When SK-N-SH cells were treated with neural differentiation agents (e.g., retinoic acid, cAMP) in media containing 10% serum ACY1 was the only aminoacylase whose expression was up-regulated. ASPA was primarily expressed in SH-EP cells of a glial sublineage. ACY3 was more highly expressed in the TrkB-positive, MYCN-amplified lines. All three aminoacylases were expressed in normal human adrenal gland, a common site of neuroblastoma origin, but only ACY1 and ACY3 displayed detectable expression in primary neuroblastoma tumor. Bioinformatics data mining of Kaplan-Meier survival revealed that high ACY3 expression is correlated with poor prognosis; while, low expression of ACY1 or ASPA is correlated with poor prognosis. These data suggest that aminoacylase expression is dysregulated in neuroblastoma. PMID:21128244

  5. Uncovering stem cell differentiation factors for salivary gland regeneration by quantitative analysis of differential proteomes

    PubMed Central

    Park, Yun-Jong; Koh, Jin; Kwon, Jin Teak; Park, Yong-Seok; Yang, Lijun; Cha, Seunghee


    Severe xerostomia (dry mouth) compromises the quality of life in patients with Sjögren’s syndrome or radiation therapy for head and neck cancer. A clinical management of xerostomia is often unsatisfactory as most interventions are palliative with limited efficacy. Following up our previous study demonstrating that mouse BM-MSCs are capable of differentiating into salivary epithelial cells in a co-culture system, we further explored the molecular basis that governs the MSC reprogramming by utilizing high-throughput iTRAQ-2D-LC-MS/MS-based proteomics. Our data revealed the novel induction of pancreas-specific transcription factor 1a (PTF1α), muscle, intestine and stomach expression-1 (MIST-1), and achaete-scute complex homolog 3 (ASCL3) in 7 day co-cultured MSCs but not in control MSCs. More importantly, a common notion of pancreatic-specific expression of PTF1 α was challenged for the first time by our verification of PTF1 α expression in the mouse salivary glands. Furthermore, a molecular network simulation of our selected putative MSC reprogramming factors demonstrated evidence for their perspective roles in salivary gland development. In conclusion, quantitative proteomics with extensive data analyses narrowed down a set of MSC reprograming factors potentially contributing to salivary gland regeneration. Identification of their differential/synergistic impact on MSC conversion warrants further investigation. PMID:28158262

  6. Uncovering stem cell differentiation factors for salivary gland regeneration by quantitative analysis of differential proteomes.


    Park, Yun-Jong; Koh, Jin; Kwon, Jin Teak; Park, Yong-Seok; Yang, Lijun; Cha, Seunghee


    Severe xerostomia (dry mouth) compromises the quality of life in patients with Sjögren's syndrome or radiation therapy for head and neck cancer. A clinical management of xerostomia is often unsatisfactory as most interventions are palliative with limited efficacy. Following up our previous study demonstrating that mouse BM-MSCs are capable of differentiating into salivary epithelial cells in a co-culture system, we further explored the molecular basis that governs the MSC reprogramming by utilizing high-throughput iTRAQ-2D-LC-MS/MS-based proteomics. Our data revealed the novel induction of pancreas-specific transcription factor 1a (PTF1α), muscle, intestine and stomach expression-1 (MIST-1), and achaete-scute complex homolog 3 (ASCL3) in 7 day co-cultured MSCs but not in control MSCs. More importantly, a common notion of pancreatic-specific expression of PTF1 α was challenged for the first time by our verification of PTF1 α expression in the mouse salivary glands. Furthermore, a molecular network simulation of our selected putative MSC reprogramming factors demonstrated evidence for their perspective roles in salivary gland development. In conclusion, quantitative proteomics with extensive data analyses narrowed down a set of MSC reprograming factors potentially contributing to salivary gland regeneration. Identification of their differential/synergistic impact on MSC conversion warrants further investigation.

  7. Identification of quantitative trait loci affecting ectomycorrhizal symbiosis in an interspecific F1 poplar cross and differential expression of genes in ectomycorrhizas of the two parents: Populus deltoides and Populus trichocarpa

    SciTech Connect

    Labbe, Jessy L; Jorge, Veronique; Vion, Patrice; Marcais, Benoit; Bastien, Catherine; Tuskan, Gerald A; Martin, Francis; Le Tacon, F


    A Populus deltoides Populus trichocarpa F1 pedigree was analyzed for quantitative trait loci (QTLs) affecting ectomycorrhizal development and for microarray characterization of gene networks involved in this symbiosis. A 300 genotype progeny set was evaluated for its ability to form ectomycorrhiza with the basidiomycete Laccaria bicolor. The percentage of mycorrhizal root tips was determined on the root systems of all 300 progeny and their two parents. QTL analysis identified four significant QTLs, one on the P. deltoides and three on the P. trichocarpa genetic maps. These QTLs were aligned to the P. trichocarpa genome and each contained several megabases and encompass numerous genes. NimbleGen whole-genome microarray, using cDNA from RNA extracts of ectomycorrhizal root tips from the parental genotypes P. trichocarpa and P. deltoides, was used to narrow the candidate gene list. Among the 1,543 differentially expressed genes (p value 0.05; 5.0-fold change in transcript level) having different transcript levels in mycorrhiza of the two parents, 41 transcripts were located in the QTL intervals: 20 in Myc_d1, 14 in Myc_t1, and seven in Myc_t2, while no significant differences among transcripts were found in Myc_t3. Among these 41 transcripts, 25 were overrepresented in P. deltoides relative to P. trichocarpa; 16 were overrepresented in P. trichocarpa. The transcript showing the highest overrepresentation in P. trichocarpa mycorrhiza libraries compared to P. deltoides mycorrhiza codes for an ethylene-sensitive EREBP-4 protein which may repress defense mechanisms in P. trichocarpa while the highest overrepresented transcripts in P. deltoides code for proteins/genes typically associated with pathogen resistance.

  8. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.


    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  9. Quantitative phosphoproteome analysis of embryonic stem cell differentiation toward blood

    PubMed Central

    Piazzi, Manuela; Williamson, Andrew; Lee, Chia-Fang; Pearson, Stella; Lacaud, Georges; Kouskoff, Valerie; McCubrey, James A.; Cocco, Lucio; Whetton, Anthony D.


    Murine embryonic stem (ES) cells can differentiate in vitro into three germ layers (endodermic, mesodermic, ectodermic). Studies on the differentiation of these cells to specific early differentiation stages has been aided by an ES cell line carrying the Green Fluorescent Protein (GFP) targeted to the Brachyury (Bry) locus which marks mesoderm commitment. Furthermore, expression of the Vascular Endothelial Growth Factor receptor 2 (Flk1) along with Bry defines hemangioblast commitment. Isobaric-tag for relative and absolute quantification (iTRAQTM) and phosphopeptide enrichment coupled to liquid chromatography separation and mass spectrometry allow the study of phosphorylation changes occurring at different stages of ES cell development using Bry and Flk1 expression respectively. We identified and relatively quantified 37 phosphoentities which are modulated during mesoderm-induced ES cells differentiation, comparing epiblast-like, early mesoderm and hemangioblast-enriched cells. Among the proteins differentially phosphorylated toward mesoderm differentiation were: the epigenetic regulator Dnmt3b, the protein kinase GSK3b, the chromatin remodeling factor Smarcc1, the transcription factor Utf1; as well as protein specifically related to stem cell differentiation, as Eomes, Hmga2, Ints1 and Rif1. As most key factors regulating early hematopoietic development have also been implicated in various types of leukemia, understanding the post-translational modifications driving their regulation during normal development could result in a better comprehension of their roles during abnormal hematopoiesis in leukemia. PMID:25890499

  10. From inverse problems in mathematical physiology to quantitative differential diagnoses.


    Zenker, Sven; Rubin, Jonathan; Clermont, Gilles


    The improved capacity to acquire quantitative data in a clinical setting has generally failed to improve outcomes in acutely ill patients, suggesting a need for advances in computer-supported data interpretation and decision making. In particular, the application of mathematical models of experimentally elucidated physiological mechanisms could augment the interpretation of quantitative, patient-specific information and help to better target therapy. Yet, such models are typically complex and nonlinear, a reality that often precludes the identification of unique parameters and states of the model that best represent available data. Hypothesizing that this non-uniqueness can convey useful information, we implemented a simplified simulation of a common differential diagnostic process (hypotension in an acute care setting), using a combination of a mathematical model of the cardiovascular system, a stochastic measurement model, and Bayesian inference techniques to quantify parameter and state uncertainty. The output of this procedure is a probability density function on the space of model parameters and initial conditions for a particular patient, based on prior population information together with patient-specific clinical observations. We show that multimodal posterior probability density functions arise naturally, even when unimodal and uninformative priors are used. The peaks of these densities correspond to clinically relevant differential diagnoses and can, in the simplified simulation setting, be constrained to a single diagnosis by assimilating additional observations from dynamical interventions (e.g., fluid challenge). We conclude that the ill-posedness of the inverse problem in quantitative physiology is not merely a technical obstacle, but rather reflects clinical reality and, when addressed adequately in the solution process, provides a novel link between mathematically described physiological knowledge and the clinical concept of differential diagnoses

  11. Quantitative proteomic analysis for high-throughput screening of differential glycoproteins in hepatocellular carcinoma serum

    PubMed Central

    Gao, Hua-Jun; Chen, Ya-Jing; Zuo, Duo; Xiao, Ming-Ming; Li, Ying; Guo, Hua; Zhang, Ning; Chen, Rui-Bing


    Objective Hepatocellular carcinoma (HCC) is a leading cause of cancer-related deaths. Novel serum biomarkers are required to increase the sensitivity and specificity of serum screening for early HCC diagnosis. This study employed a quantitative proteomic strategy to analyze the differential expression of serum glycoproteins between HCC and normal control serum samples. Methods Lectin affinity chromatography (LAC) was used to enrich glycoproteins from the serum samples. Quantitative mass spectrometric analysis combined with stable isotope dimethyl labeling and 2D liquid chromatography (LC) separations were performed to examine the differential levels of the detected proteins between HCC and control serum samples. Western blot was used to analyze the differential expression levels of the three serum proteins. Results A total of 2,280 protein groups were identified in the serum samples from HCC patients by using the 2D LC-MS/MS method. Up to 36 proteins were up-regulated in the HCC serum, whereas 19 proteins were down-regulated. Three differential glycoproteins, namely, fibrinogen gamma chain (FGG), FOS-like antigen 2 (FOSL2), and α-1,6-mannosylglycoprotein 6-β-N-acetylglucosaminyltransferase B (MGAT5B) were validated by Western blot. All these three proteins were up-regulated in the HCC serum samples. Conclusion A quantitative glycoproteomic method was established and proven useful to determine potential novel biomarkers for HCC. PMID:26487969

  12. Introducing Knowledge into Differential Expression Analysis

    PubMed Central

    Biecek, Przemysław; Tiuryn, Jerzy; Vingron, Martin


    Abstract Gene expression measurements allow determining sets of up- or down-regulated, or unchanged genes in a particular experimental condition. Additional biological knowledge can suggest examples of genes from one of these sets. For instance, known target genes of a transcriptional activator are expected, but are not certain to go down after this activator is knocked out. Available differential expression analysis tools do not take such imprecise examples into account. Here we put forward a novel partially supervised mixture modeling methodology for differential expression analysis. Our approach, guided by imprecise examples, clusters expression data into differentially expressed and unchanged genes. The partially supervised methodology is implemented by two methods: a newly introduced belief-based mixture modeling, and soft-label mixture modeling, a method proved efficient in other applications. We investigate on synthetic data the input example settings favorable for each method. In our tests, both belief-based and soft-label methods prove their advantage over semi-supervised mixture modeling in correcting for erroneous examples. We also compare them to alternative differential expression analysis approaches, showing that incorporation of knowledge yields better performance. We present a broad range of knowledge sources and data to which our partially supervised methodology can be applied. First, we determine targets of Ste12 based on yeast knockout data, guided by a Ste12 DNA-binding experiment. Second, we distinguish miR-1 from miR-124 targets in human by clustering expression data under transfection experiments of both microRNAs, using their computationally predicted targets as examples. Finally, we utilize literature knowledge to improve clustering of time-course expression profiles. PMID:20726790

  13. OakContigDF159.1, a reference library for studying differential gene expression in Quercus robur during controlled biotic interactions: use for quantitative transcriptomic profiling of oak roots in ectomycorrhizal symbiosis.


    Tarkka, Mika T; Herrmann, Sylvie; Wubet, Tesfaye; Feldhahn, Lasse; Recht, Sabine; Kurth, Florence; Mailänder, Sarah; Bönn, Markus; Neef, Maren; Angay, Oguzhan; Bacht, Michael; Graf, Marcel; Maboreke, Hazel; Fleischmann, Frank; Grams, Thorsten E E; Ruess, Liliane; Schädler, Martin; Brandl, Roland; Scheu, Stefan; Schrey, Silvia D; Grosse, Ivo; Buscot, François


    Oaks (Quercus spp.), which are major forest trees in the northern hemisphere, host many biotic interactions, but molecular investigation of these interactions is limited by fragmentary genome data. To date, only 75 oak expressed sequence tags (ESTs) have been characterized in ectomycorrhizal (EM) symbioses. We synthesized seven beneficial and detrimental biotic interactions between microorganisms and animals and a clone (DF159) of Quercus robur. Sixteen 454 and eight Illumina cDNA libraries from leaves and roots were prepared and merged to establish a reference for RNA-Seq transcriptomic analysis of oak EMs with Piloderma croceum. Using the Mimicking Intelligent Read Assembly (MIRA) and Trinity assembler, the OakContigDF159.1 hybrid assembly, containing 65 712 contigs with a mean length of 1003 bp, was constructed, giving broad coverage of metabolic pathways. This allowed us to identify 3018 oak contigs that were differentially expressed in EMs, with genes encoding proline-rich cell wall proteins and ethylene signalling-related transcription factors showing up-regulation while auxin and defence-related genes were down-regulated. In addition to the first report of remorin expression in EMs, the extensive coverage provided by the study permitted detection of differential regulation within large gene families (nitrogen, phosphorus and sugar transporters, aquaporins). This might indicate specific mechanisms of genome regulation in oak EMs compared with other trees.

  14. Expression of dystrophin Dp71 during PC12 cell differentiation.


    Cisneros, B; Rendon, A; Genty, V; Aranda, G; Marquez, F; Mornet, D; Montañez, C


    The expression of dystrophin-protein 71 (Dp71) was investigated during nerve growth factor (NGF) induced differentiation of PC12 cells. A semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) assay was designed to measure Dp71 mRNA, whereas the Dp71 protein amount was evaluated by immunoblot analysis using an anti-dystrophin monoclonal antibody. Comparison with control cultures showed that Dp71 mRNA and protein levels increased in parallel with NGF treatment peaking with increments of 60% and 1.4 times, respectively. The upregulation of Dp71 expression during PC12 cells differentiation point at PC12 cells as a suitable model for studying the function of Dp71 in neuronal cells.

  15. Differentially expressed genes in giant cell tumor of bone.


    Babeto, Erica; Conceição, André Luis Giacometti; Valsechi, Marina Curado; Peitl Junior, Paulo; de Campos Zuccari, Débora Aparecida Pires; de Lima, Luiz Guilherme Cernaglia Aureliano; Bonilha, Jane Lopes; de Freitas Calmon, Marília; Cordeiro, José Antônio; Rahal, Paula


    Giant cells tumors of bone (GCTB) are benign in nature but cause osteolytic destruction with a number of particular characteristics. These tumors can have uncertain biological behavior often contain a significant proportion of highly multinucleated cells, and may show aggressive behavior. We have studied differential gene expression in GCTB that may give a better understanding of their physiopathology, and might be helpful in prognosis and treatment. Rapid subtractive hybridization (RaSH) was used to identify and measure novel genes that appear to be differentially expressed, including KTN1, NEB, ROCK1, and ZAK using quantitative real-time polymerase chain reaction (qRT-PCR) and immunohistochemistry in the samples of GCTBs compared to normal bone tissue. Normal bone was used in the methodology RaSH for comparison with the GCTB in identification of differentially expressed genes. Functional annotation indicated that these genes are involved in cellular processes related to their tumor phenotype. The differential expression of KTN1, ROCK1, and ZAK was independently confirmed by qRT-PCR and immunohistochemistry. The expression of the KTN1 and ROCK1 genes were increased in samples by qRT-PCR and immunohistochemistry, and ZAK had reduced expression. Since ZAK have CpG islands in their promoter region and low expression in tumor tissue, their methylation pattern was analyzed by MSP-PCR. The genes identified KTN1, ROCK1, and ZAK may be responsible for loss of cellular homeostasis in GCTB since they are responsible for various functions related to tumorigenesis such as cell migration, cytoskeletal organization, apoptosis, and cell cycle control and thus may contribute at some stage in the process of formation and development of GCTB.

  16. Quantitative Proteomics Uncovers Novel Factors Involved in Developmental Differentiation of Trypanosoma brucei

    PubMed Central

    Dejung, Mario; Subota, Ines; Bucerius, Ferdinand; Dindar, Gülcin; Freiwald, Anja; Engstler, Markus; Boshart, Michael; Butter, Falk; Janzen, Christian J.


    Developmental differentiation is a universal biological process that allows cells to adapt to different environments to perform specific functions. African trypanosomes progress through a tightly regulated life cycle in order to survive in different host environments when they shuttle between an insect vector and a vertebrate host. Transcriptomics has been useful to gain insight into RNA changes during stage transitions; however, RNA levels are only a moderate proxy for protein abundance in trypanosomes. We quantified 4270 protein groups during stage differentiation from the mammalian-infective to the insect form and provide classification for their expression profiles during development. Our label-free quantitative proteomics study revealed previously unknown components of the differentiation machinery that are involved in essential biological processes such as signaling, posttranslational protein modifications, trafficking and nuclear transport. Furthermore, guided by our proteomic survey, we identified the cause of the previously observed differentiation impairment in the histone methyltransferase DOT1B knock-out strain as it is required for accurate karyokinesis in the first cell division during differentiation. This epigenetic regulator is likely involved in essential chromatin restructuring during developmental differentiation, which might also be important for differentiation in higher eukaryotic cells. Our proteome dataset will serve as a resource for detailed investigations of cell differentiation to shed more light on the molecular mechanisms of this process in trypanosomes and other eukaryotes. PMID:26910529

  17. Quantitative Proteomics Uncovers Novel Factors Involved in Developmental Differentiation of Trypanosoma brucei.


    Dejung, Mario; Subota, Ines; Bucerius, Ferdinand; Dindar, Gülcin; Freiwald, Anja; Engstler, Markus; Boshart, Michael; Butter, Falk; Janzen, Christian J


    Developmental differentiation is a universal biological process that allows cells to adapt to different environments to perform specific functions. African trypanosomes progress through a tightly regulated life cycle in order to survive in different host environments when they shuttle between an insect vector and a vertebrate host. Transcriptomics has been useful to gain insight into RNA changes during stage transitions; however, RNA levels are only a moderate proxy for protein abundance in trypanosomes. We quantified 4270 protein groups during stage differentiation from the mammalian-infective to the insect form and provide classification for their expression profiles during development. Our label-free quantitative proteomics study revealed previously unknown components of the differentiation machinery that are involved in essential biological processes such as signaling, posttranslational protein modifications, trafficking and nuclear transport. Furthermore, guided by our proteomic survey, we identified the cause of the previously observed differentiation impairment in the histone methyltransferase DOT1B knock-out strain as it is required for accurate karyokinesis in the first cell division during differentiation. This epigenetic regulator is likely involved in essential chromatin restructuring during developmental differentiation, which might also be important for differentiation in higher eukaryotic cells. Our proteome dataset will serve as a resource for detailed investigations of cell differentiation to shed more light on the molecular mechanisms of this process in trypanosomes and other eukaryotes.

  18. Differentiation among parkinsonisms using quantitative diffusion kurtosis imaging.


    Ito, Kenji; Sasaki, Makoto; Ohtsuka, Chigumi; Yokosawa, Suguru; Harada, Taisuke; Uwano, Ikuko; Yamashita, Fumio; Higuchi, Satomi; Terayama, Yasuo


    Differential diagnoses among Parkinson's disease (PD), multiple system atrophy (MSA), and progressive supranuclear palsy syndrome (PSPS) are often difficult. Hence, we investigated whether diffusion kurtosis imaging (DKI) could detect pathological changes that occur in these disorders and be used to differentiate between such patients. Fourteen patients (five with PD, four MSA, and five PSPS) and six healthy controls were examined using a 1.5-T scanner. Mean kurtosis (MK), fractional anisotropy, and mean diffusivity maps were generated, and these values of the midbrain tegmentum (MBT) and pontine crossing tract (PCT), as well as MBT/PCT ratios, were obtained. We found no significant differences in MBT and PCT values on DKI maps among the groups. In contrast, MBT/PCT ratios from MK maps were significantly increased in the MSA group and decreased in the PSPS group compared with the other groups. MBT/PCT ratios from mean diffusivity maps showed a significant increase in the PSPS group. Therefore, quantitative DKI analyses, particularly the MBT/PCT ratio from MK maps, can differentiate patients with parkinsonisms.

  19. Identification of differentially expressed genes associated with differential body size in mandarin fish (Siniperca chuatsi).


    Tian, Changxu; Li, Ling; Liang, Xu-Fang; He, Shan; Guo, Wenjie; Lv, Liyuan; Wang, Qingchao; Song, Yi


    Body size is an obvious and important characteristic of fish. Mandarin fish Siniperca chuatsi (Basilewsky) is one of the most valuable perciform species widely cultured in China. Individual differences in body size are common in mandarin fish and significantly influence the aquaculture production. However, little is currently known about its genetic control. In this study, digital gene expression profiling and transcriptome sequencing were performed in mandarin fish with differential body size at 30 and 180 days post-hatch (dph), respectively. Body weight, total length and body length of fish with big-size were significantly higher than those with small-size at both 30 and 180 dph (P < 0.05). 2171 and 2014 differentially expressed genes were identified between small-size and big-size fish at 30 and 180 dph, respectively. RT quantitative PCR (qPCR) analysis showed that the differential expression of 10 selected genes in mandarin fish that went through the same training procedure. The genes were involved in the growth hormone-insulin-like growth factor axis, cell proliferation and differentiation, appetite control, glucose metabolism, reproduction and sexual size dimorphism pathways. This study will help toward a comprehensive understanding of the complexity of regulation of body size in mandarin fish individuals and provide valuable information for future research.

  20. Cancer outlier differential gene expression detection.


    Wu, Baolin


    We study statistical methods to detect cancer genes that are over- or down-expressed in some but not all samples in a disease group. This has proven useful in cancer studies where oncogenes are activated only in a small subset of samples. We propose the outlier robust t-statistic (ORT), which is intuitively motivated from the t-statistic, the most commonly used differential gene expression detection method. Using real and simulation studies, we compare the ORT to the recently proposed cancer outlier profile analysis (Tomlins and others, 2005) and the outlier sum statistic of Tibshirani and Hastie (2006). The proposed method often has more detection power and smaller false discovery rates. Supplementary information can be found at

  1. Novel markers of osteogenic and adipogenic differentiation of human bone marrow stromal cells identified using a quantitative proteomics approach.


    Granéli, Cecilia; Thorfve, Anna; Ruetschi, Ulla; Brisby, Helena; Thomsen, Peter; Lindahl, Anders; Karlsson, Camilla


    Today, the tool that is most commonly used to evaluate the osteogenic differentiation of bone marrow stromal cells (BMSCs) in vitro is the demonstration of the expression of multiple relevant markers, such as ALP, RUNX2 and OCN. However, as yet, there is no single surface marker or panel of markers which clearly defines human BMSCs (hBMSCs) differentiating towards the osteogenic lineage. The aim of this study was therefore to examine this issue. Stable isotope labeling by amino acids in cell culture (SILAC)-based quantitative proteomics was utilized to investigate differently expressed surface markers in osteogenically differentiated and undifferentiated hBMSCs. Labeled membrane proteins were analyzed by mass spectrometry (MS) and 52 proteins with an expression ratio above 2, between osteogenically differentiated and undifferentiated cells, were identified. Subsequent validation, by flow cytometry and ELISA, of the SILAC expression ratios for a number of these proteins and investigations of the lineage specificity of three candidate markers were performed. The surface markers, CD10 and CD92, demonstrated significantly increased expression in hBMSCs differentiated towards the osteogenic and adipogenic lineages. In addition, there was a slight increase in CD10 expression during chondrogenic differentiation. Furthermore, the expression of the intracellular protein, crystalline-αB (CRYaB), was only significantly increased in osteogenically differentiated hBMSCs and not affected during differentiation towards the chondrogenic or adipogenic lineages. It has been concluded from the present results that CD10 and CD92 are potential markers of osteogenic and adipogenic differentiation and that CRYaB is a potential novel osteogenic marker specifically expressed during the osteogenic differentiation of hBMSCs in vitro.

  2. Towards quantitative atmospheric water vapor profiling with differential absorption lidar.


    Dinovitser, Alex; Gunn, Lachlan J; Abbott, Derek


    Differential Absorption Lidar (DIAL) is a powerful laser-based technique for trace gas profiling of the atmosphere. However, this technique is still under active development requiring precise and accurate wavelength stabilization, as well as accurate spectroscopic parameters of the specific resonance line and the effective absorption cross-section of the system. In this paper we describe a novel master laser system that extends our previous work for robust stabilization to virtually any number of multiple side-line laser wavelengths for the future probing to greater altitudes. In this paper, we also highlight the significance of laser spectral purity on DIAL accuracy, and illustrate a simple re-arrangement of a system for measuring effective absorption cross-section. We present a calibration technique where the laser light is guided to an absorption cell with 33 m path length, and a quantitative number density measurement is then used to obtain the effective absorption cross-section. The same absorption cell is then used for on-line laser stabilization, while microwave beat-frequencies are used to stabilize any number of off-line lasers. We present preliminary results using ∼300 nJ, 1 μs pulses at 3 kHz, with the seed laser operating as a nanojoule transmitter at 822.922 nm, and a receiver consisting of a photomultiplier tube (PMT) coupled to a 356 mm mirror.

  3. Quantitative EEG patterns of differential in-flight workload

    NASA Technical Reports Server (NTRS)

    Sterman, M. B.; Mann, C. A.; Kaiser, D. A.


    Four test pilots were instrumented for in-flight EEG recordings using a custom portable recording system. Each flew six, two minute tracking tasks in the Calspan NT-33 experimental trainer at Edwards AFB. With the canopy blacked out, pilots used a HUD display to chase a simulated aircraft through a random flight course. Three configurations of flight controls altered the flight characteristics to achieve low, moderate, and high workload, as determined by normative Cooper-Harper ratings. The test protocol was administered by a command pilot in the back seat. Corresponding EEG and tracking data were compared off-line. Tracking performance was measured as deviation from the target aircraft and combined with control difficulty to achieve an estimate of 'cognitive workload'. Trended patterns of parietal EEG activity at 8-12 Hz were sorted according to this classification. In all cases, high workload produced a significantly greater suppression of 8-12 Hz activity than low workload. Further, a clear differentiation of EEG trend patterns was obtained in 80 percent of the cases. High workload produced a sustained suppression of 8-12 Hz activity, while moderate workload resulted in an initial suppression followed by a gradual increment. Low workload was associated with a modulated pattern lacking any periods of marked or sustained suppression. These findings suggest that quantitative analysis of appropriate EEG measures may provide an objective and reliable in-flight index of cognitive effort that could facilitate workload assessment.

  4. Quantitative orientation-independent differential interference contrast (DIC) microscopy

    NASA Astrophysics Data System (ADS)

    Shribak, Michael; LaFountain, James; Biggs, David; Inoué, Shinya


    We describe a new DIC technique, which records phase gradients within microscopic specimens independently of their orientation. The proposed system allows the generation of images representing the distribution of dry mass (optical path difference) in the specimen. Unlike in other forms of interference microscopes, this approach does not require a narrow illuminating cone. The orientation-independent differential interference contrast (OI-DIC) system can also be combined with orientation-independent polarization (OI-Pol) measurements to yield two complementary images: one showing dry mass distribution (which is proportional to refractive index) and the other showing distribution of birefringence (due to structural or internal anisotropy). With a model specimen used for this work -- living spermatocytes from the crane fly, Nephrotoma suturalis --- the OI-DIC image clearly reveals the detailed shape of the chromosomes while the polarization image quantitatively depicts the distribution of the birefringent microtubules in the spindle, both without any need for staining or other modifications of the cell. We present examples of a pseudo-color combined image incorporating both orientation-independent DIC and polarization images of a spermatocyte at diakinesis and metaphase of meiosis I. Those images provide clear evidence that the proposed technique can reveal fine architecture and molecular organization in live cells without perturbation associated with staining or fluorescent labeling. The phase image was obtained using optics having a numerical aperture 1.4, thus achieving a level of resolution never before achieved with any interference microscope.

  5. Microarray data analysis for differential expression: a tutorial.


    Suárez, Erick; Burguete, Ana; Mclachlan, Geoffrey J


    DNA microarray is a technology that simultaneously evaluates quantitative measurements for the expression of thousands of genes. DNA microarrays have been used to assess gene expression between groups of cells of different organs or different populations. In order to understand the role and function of the genes, one needs the complete information about their mRNA transcripts and proteins. Unfortunately, exploring the protein functions is very difficult, due to their unique 3-dimentional complicated structure. To overcome this difficulty, one may concentrate on the mRNA molecules produced by the gene expression. In this paper, we describe some of the methods for preprocessing data for gene expression and for pairwise comparison from genomic experiments. Previous studies to assess the efficiency of different methods for pairwise comparisons have found little agreement in the lists of significant genes. Finally, we describe the procedures to control false discovery rates, sample size approach for these experiments, and available software for microarray data analysis. This paper is written for those professionals who are new in microarray data analysis for differential expression and want to have an overview of the specific steps or the different approaches for this sort of analysis.

  6. Differential gene expression in ripening banana fruit.


    Clendennen, S K; May, G D


    During banana (Musa acuminata L.) fruit ripening ethylene production triggers a developmental cascade that is accompanied by a massive conversion of starch to sugars, an associated burst of respiratory activity, and an increase in protein synthesis. Differential screening of cDNA libraries representing banana pulp at ripening stages 1 and 3 has led to the isolation of 11 nonredundant groups of differentially expressed mRNAs. Identification of these transcripts by partial sequence analysis indicates that two of the mRNAs encode proteins involved in carbohydrate metabolism, whereas others encode proteins thought to be associated with pathogenesis, senescence, or stress responses in plants. Their relative abundance in the pulp and tissue-specific distribution in greenhouse-grown banana plants were determined by northern-blot analyses. The relative abundance of transcripts encoding starch synthase, granule-bound starch synthase, chitinase, lectin, and a type-2 metallothionein decreased in pulp during ripening. Transcripts encoding endochitinase, beta-1,3-glucanase, a thaumatin-like protein, ascorbate peroxidase, metallothionein, and a putative senescence-related protein increased early in ripening. The elucidation of the molecular events associated with banana ripening will facilitate a better understanding and control of these processes, and will allow us to attain our long-term goal of producing candidate oral vaccines in transgenic banana plants.

  7. Building quantitative, three dimensional atlases of gene expression and morphology at cellular resolution

    PubMed Central

    Knowles, David W.; Biggin, Mark D.


    Animals comprise dynamic three-dimensional arrays of cells that express gene products in intricate spatial and temporal patterns that determine cellular differentiation and morphogenesis. A rigorous understanding of these developmental processes requires automated methods that quantitatively record and analyze complex morphologies and their associated patterns of gene expression at cellular resolution. Here we summarize light microscopy based approaches to establish permanent, quantitative datasets—atlases—that record this information. We focus on experiments that capture data for whole embryos or large areas of tissue in three dimensions, often at multiple time points. We compare and contrast the advantages and limitations of different methods and highlight some of the discoveries made. We emphasize the need for interdisciplinary collaborations and integrated experimental pipelines that link sample preparation, image acquisition, image analysis, database design, visualization and quantitative analysis. PMID:24123936

  8. Identification of differentially expressed genes in cutaneous squamous cell carcinoma by microarray expression profiling

    PubMed Central

    Nindl, Ingo; Dang, Chantip; Forschner, Tobias; Kuban, Ralf J; Meyer, Thomas; Sterry, Wolfram; Stockfleth, Eggert


    Background Carcinogenesis is a multi-step process indicated by several genes up- or down-regulated during tumor progression. This study examined and identified differentially expressed genes in cutaneous squamous cell carcinoma (SCC). Results Three different biopsies of 5 immunosuppressed organ-transplanted recipients each normal skin (all were pooled), actinic keratosis (AK) (two were pooled), and invasive SCC and additionally 5 normal skin tissues from immunocompetent patients were analyzed. Thus, total RNA of 15 specimens were used for hybridization with Affymetrix HG-U133A microarray technology containing 22,283 genes. Data analyses were performed by prediction analysis of microarrays using nearest shrunken centroids with the threshold 3.5 and ANOVA analysis was independently performed in order to identify differentially expressed genes (p < 0.05). Verification of 13 up- or down-regulated genes was performed by quantitative real-time reverse transcription (RT)-PCR and genes were additionally confirmed by sequencing. Broad coherent patterns in normal skin vs. AK and SCC were observed for 118 genes. Conclusion The majority of identified differentially expressed genes in cutaneous SCC were previously not described. PMID:16893473

  9. Reference genes for gene expression analysis in proliferating and differentiating human keratinocytes.


    Lanzafame, Manuela; Botta, Elena; Teson, Massimo; Fortugno, Paola; Zambruno, Giovanna; Stefanini, Miria; Orioli, Donata


    Abnormalities in keratinocyte growth and differentiation have a pathogenic significance in many skin disorders and result in gene expression alterations detectable by quantitative real-time RT-PCR (qRT-PCR). Relative quantification based on endogenous control (EC) genes is the commonly adopted approach, and the use of multiple reference genes from independent pathways is considered a best practice guideline, unless fully validated EC genes are available. The literature on optimal reference genes during in vitro calcium-induced differentiation of normal human epidermal keratinocytes (NHEK) is inconsistent. In many studies, the expression of target genes is compared to that of housekeeping genes whose expression, however, significantly varies during keratinocyte differentiation. Here, we report the results of our investigations on the expression stability of 15 candidate EC genes, including those commonly used as reference in expression analysis by qRT-PCR, during NHEK calcium-induced differentiation. We demonstrate that YWHAZ and UBC are extremely stable genes, and therefore, they represent optimal EC genes for expression studies in proliferating and calcium-induced differentiating NHEK. Furthermore, we demonstrate that YWHAZ/14-3-3-zeta is a suitable reference for quantitative comparison of both transcript and protein levels.

  10. Quantitative gene expression profiles in real time from expressed sequence tag databases.


    Funari, Vincent A; Voevodski, Konstantin; Leyfer, Dimitry; Yerkes, Laura; Cramer, Donald; Tolan, Dean R


    An accumulation of expressed sequence tag (EST) data in the public domain and the availability of bioinformatic programs have made EST gene expression profiling a common practice. However, the utility and validity of using EST databases (e.g., dbEST) has been criticized, particularly for quantitative assessment of gene expression. Problems with EST sequencing errors, library construction, EST annotation, and multiple paralogs make generation of specific and sensitive qualitative arid quantitative expression profiles a concern. In addition, most EST-derived expression data exists in previously assembled databases. The Virtual Northern Blot (VNB) (http: // allows generation, evaluation, and optimization of expression profiles in real time, which is especially important for alternatively spliced, novel, or poorly characterized genes. Representative gene families with variable nucleotide sequence identity, tissue specificity, and levels of expression (bcl-xl, aldoA, and cyp2d9) are used to assess the quality of VNB's output. The profiles generated by VNB are more sensitive and specific than those constructed with ESTs listed in preindexed databases at UCSC and NCBI. Moreover, quantitative expression profiles produced by VNB are comparable to quantization obtained from Northern blots and qPCR. The VNB pipeline generates real-time gene expression profiles for single-gene queries that are both qualitatively and quantitatively reliable.

  11. Quantitative Gene Expression Profiles in Real Time From Expressed Sequence Tag Databases

    PubMed Central



    An accumulation of expressed sequence tag (EST) data in the public domain and the availability of bioinformatic programs have made EST gene expression profiling a common practice. However, the utility and validity of using EST databases (e.g., dbEST) has been criticized, particularly for quantitative assessment of gene expression. Problems with EST sequencing errors, library construction, EST annotation, and multiple paralogs make generation of specific and sensitive qualitative and quantitative expression profiles a concern. In addition, most EST-derived expression data exists in previously assembled databases. The Virtual Northern Blot (VNB) ( allows generation, evaluation, and optimization of expression profiles in real time, which is especially important for alternatively spliced, novel, or poorly characterized genes. Representative gene families with variable nucleotide sequence identity, tissue specificity, and levels of expression (bcl-xl, aldoA, and cyp2d9) are used to assess the quality of VNB’s output. The profiles generated by VNB are more sensitive and specific than those constructed with ESTs listed in preindexed databases at UCSI and NCBI. Moreover, quantitative expression profiles produced by VNB are comparable to quantization obtained from Northern blots and qPCR. The VNB pipeline generates real-time gene expression profiles for single-gene queries that are both qualitatively and quantitatively reliable. PMID:20635574

  12. Profiling of differentially expressed genes in haemophilia A with inhibitor.


    Hwang, S H; Lim, J A; Kim, M J; Kim, H C; Lee, H W; Yoo, K Y; You, C W; Lee, K S; Kim, H S


    Inhibitor development is the most significant complication in the therapy of haemophilia A (HA) patients. In spite of many studies, not much is known regarding the mechanism underlying inhibitor development. To understand the mechanism, we analysed profiles of differentially expressed genes (DEGs) between inhibitor and non-inhibitor HA via a microarray technique. Twenty unrelated Korean HAs were studied: 11 were non-inhibitor and nine were HA with inhibitor (≥5 BU mL(-1)). Microarray analysis was conducted using a Human Ref-8 expression Beadchip system (Illumina) and the data were analysed using Beadstudio software. We identified 545 DEGs in inhibitor HA as compared with the non-inhibitor patients; 384 genes were up-regulated and 161 genes were down-regulated. Among them, 75 genes whose expressions were altered by at least two-fold (>+2 or <-2) were selected and classified via the PANTHER classification method. The expressions of signal transduction and immunity-related genes differed significantly in the two groups. For validation of the DEGs, semi-quantitative RT-PCR (semi-qRT-PCR) was conducted with the six selected DEGs. The results corresponded to the microarray data, with the exception of one gene. We also examined the expression of the genes associated with the antigen presentation process via real-time PCR. The average levels of IL10, CTLA4 and TNFα slightly reduced, whereas that of IFNγ increased in the inhibitor HA group. We are currently unable to explain whether this phenomenon is a function of the inhibitor-inducing factor or is an epiphenomenon of antibody production. Nevertheless, our results provide a possible explanation for inhibitor development.

  13. A Hybrid Approach to Protein Differential Expression in Mass Spectrometry-Based Proteomics

    SciTech Connect

    Wang, Xuan; Anderson, Gordon A.; Smith, Richard D.; Dabney, Alan R.


    Motivation: Quantitative mass spectrometry-based proteomics involves statistical inference on protein abundance, based on the intensities of each protein's associated spectral peaks. However, typical MS-based proteomics data sets have substantial proportions of missing observations, due at least in part to censoring of low intensities. This complicates intensity-based differential expression analysis. Results: We outline a statistical method for protein differential expression, based on a simple Binomial likelihood. By modeling peak intensities as binary, in terms of 'presence/ absence,' we enable the selection of proteins not typically amendable to quantitative analysis; e.g., 'one-state' proteins that are present in one condition but absent in another. In addition, we present an analysis protocol that combines quantitative and presence/ absence analysis of a given data set in a principled way, resulting in a single list of selected proteins with a single associated FDR.

  14. Differential proteomics analysis of liver failure in peripheral blood mononuclear cells using isobaric tags for relative and absolute quantitation

    PubMed Central

    Lin, Hua; Tan, Qiu-Pei; Sui, Wei-Guo; Chen, Wen-Biao; Peng, Wu-Jian; Liu, Xing-Chao; Dai, Yong


    The aim of the present study was to examine differentially expressed proteome profiles for candidate biomarkers in peripheral blood mononuclear cells (PBMCs) of liver failure (LF) patients. Ten patients were diagnosed as LF and 10 age- and gender-matched subjects were recruited as healthy controls. Isobaric tags for relative and absolute quantitation (iTRAQ)-based quantitative proteomic technology is efficiently applicable for identification and relative quantitation of the proteomes of PBMCs. Eight-plex iTRAQ coupled with strong cation exchange chromatography, and liquid chromatography coupled with tandem mass spectrometry were used to analyze total proteins in LF patients and healthy control subjects. Molecular variations were detected using the iTRAQ method, and western blotting was used to verify the results. LF is a complex type of medical emergency that evolves following a catastrophic insult to the liver, and its outcome remains the most ominous of all gastroenterologic diseases. Serious complications tend to occur during the course of the disease and further exacerbate the problems. Using the iTRAQ method, differentially expressed proteome profiles of LF patients were determined. In the present study, 627 proteins with different expression levels were identified in LF patients compared with the control subjects; with 409 proteins upregulated and 218 proteins downregulated. Among them, four proteins were significantly differentially expressed; acylaminoacyl-peptide hydrolase and WW domain binding protein 2 were upregulated, and resistin and tubulin β 2A class IIa were downregulated. These proteins demonstrated differences in their expression levels compared with other proteins with normal expression levels and the significant positive correlation with LF. The western blot results were consistent with the results from iTRAQ. Thus, investigation of the molecular mechanism of the proteins involved in LF may facilitate an improved understanding of the

  15. Screening of differentially expressed genes in pathological scar tissues using expression microarray.


    Huang, L P; Mao, Z; Zhang, L; Liu, X X; Huang, C; Jia, Z S


    Pathological scar tissues and normal skin tissues were differentiated by screening for differentially expressed genes in pathologic scar tissues via gene expression microarray. The differentially expressed gene data was analyzed by gene ontology and pathway analyses. There were 5001 up- or down-regulated genes in 2-fold differentially expressed genes, 956 up- or down-regulated genes in 5-fold differentially expressed genes, and 114 up- or down-regulated genes in 20-fold differentially expressed genes. Therefore, significant differences were observed in the gene expression in pathological scar tissues and normal foreskin tissues. The development of pathological scar tissues has been correlated to changes in multiple genes and pathways, which are believed to form a dynamic network connection.

  16. Gene expression kinetics in individual plasmodial cells reveal alternative programs of differential regulation during commitment and differentiation.


    Rätzel, Viktoria; Marwan, Wolfgang


    During its life cycle, the amoebozoon Physarum polycephalum forms multinucleate plasmodial cells that can grow to macroscopic size while maintaining a naturally synchronous population of nuclei. Sporulation-competent plasmodia were stimulated through photoactivation of the phytochrome photoreceptor and the expression of sporulation marker genes was analyzed quantitatively by repeatedly taking samples of the same plasmodial cell at successive time points after the stimulus pulse. Principal component analysis of the gene expression data revealed that plasmodial cells take different trajectories leading to cell fate decision and differentiation and suggested that averaging over individual cells is inappropriate. Queries for genes with pairwise correlated expression kinetics revealed qualitatively different patterns of co-regulation, indicating that alternative programs of differential regulation are operational in individual plasmodial cells. At the single cell level, the response to stimulation of a non-sporulating mutant was qualitatively different as compared to the wild type with respect to the differentially regulated genes and their patterns of co-regulation. The observation of individual differences during commitment and differentiation supports the concept of a Waddington-type quasipotential landscape for the regulatory control of cell differentiation. Comparison of wild type and sporulation mutant data further supports the idea that mutations may impact the topology of this landscape.

  17. Robust PCA based method for discovering differentially expressed genes.


    Liu, Jin-Xing; Wang, Yu-Tian; Zheng, Chun-Hou; Sha, Wen; Mi, Jian-Xun; Xu, Yong


    How to identify a set of genes that are relevant to a key biological process is an important issue in current molecular biology. In this paper, we propose a novel method to discover differentially expressed genes based on robust principal component analysis (RPCA). In our method, we treat the differentially and non-differentially expressed genes as perturbation signals S and low-rank matrix A, respectively. Perturbation signals S can be recovered from the gene expression data by using RPCA. To discover the differentially expressed genes associated with special biological progresses or functions, the scheme is given as follows. Firstly, the matrix D of expression data is decomposed into two adding matrices A and S by using RPCA. Secondly, the differentially expressed genes are identified based on matrix S. Finally, the differentially expressed genes are evaluated by the tools based on Gene Ontology. A larger number of experiments on hypothetical and real gene expression data are also provided and the experimental results show that our method is efficient and effective.

  18. Determining causality and consequence of expression quantitative trait loci

    PubMed Central

    Battle, A.J.; Montgomery, S.B.


    Expression quantitative trait loci (eQTLs) are currently the most abundant and systematically-surveyed class of functional consequence for genetic variation. Recent genetic studies of gene expression have identified thousands of eQTLs in diverse tissue types for the majority of human genes. Application of this large eQTL catalogue provides an important resource for understanding the molecular basis of common genetic diseases. However, only now has both the availability of individuals with full genomes and corresponding advances in functional genomics provided the opportunity to dissect eQTLs to identify causal regulatory variants. Resolving the properties of such causal regulatory variants is improving understanding of the molecular mechanisms that influence traits and guiding the development of new genome-scale approaches to variant interpretation. In this review, we provide an overview of current computational and experimental methods for identifying causal regulatory variants and predicting their phenotypic consequences. PMID:24770875

  19. Micro RNA expression pattern of undifferentiated and differentiated human embryonic stem cells

    PubMed Central

    Lakshmipathy, Uma; Love, Brad; Goff, Loyal A.; Jörnsten, Rebecka; Graichen, Ralph; Hart, Ronald P.; Chesnut, Jonathan D.


    Many of the currently established human embryonic stem cell lines have been characterized extensively in terms of their gene expression profiles and genetic stability in culture. Recent studies have indicated that miRNA, a class of non-coding small RNA that participate in the regulation of gene expression, may play a key role in stem cell self renewal and differentiation. Using both microarrays and quantitative PCR, we report here the differences in miRNA expression between undifferentiated human embryonic stem cells (hESC) and their corresponding differentiated cells that underwent differentiation in vitro over a period of two weeks. Our results confirm the identity of a signature miRNA profile in pluripotent cells, comprising a small subset of differentially expressed miRNAs in hESCs. Examining both mRNA and miRNA profiles under multiple conditions using cross-correlation, we find clusters of miRNAs grouped with specific, biologically-interpretable mRNAs. We identify patterns of expression in the progression from hESC to differentiated cells that suggest a role for selected miRNAs in maintenance of the undifferentiated, pluripotent state. Profiling of the hESC “miRNA-ome” provides an insight into molecules that control cellular differentiation and maintenance of the pluripotent state, findings that have broad implications in development, homeostasis and human disease states. PMID:18004940

  20. Random Monoallelic Gene Expression Increases upon Embryonic Stem Cell Differentiation

    PubMed Central

    Eckersley-Maslin, Mélanie A.; Thybert, David; Bergmann, Jan H.; Marioni, John C.; Flicek, Paul; Spector, David L.


    Summary Random autosomal monoallelic gene expression refers to the transcription of a gene from one of two homologous alleles. We assessed the dynamics of monoallelic expression during development through an allele-specific RNA sequencing screen in clonal populations of hybrid mouse embryonic stem cells (ESCs) and neural progenitor cells (NPCs). We identified 67 and 376 inheritable autosomal random monoallelically expressed genes in ESCs and NPCs respectively, a 5.6-fold increase upon differentiation. While DNA methylation and nuclear positioning did not distinguish the active and inactive alleles, specific histone modifications were differentially enriched between the two alleles. Interestingly, expression levels of 8% of the monoallelically expressed genes remained similar between monoallelic and biallelic clones. These results support a model in which random monoallelic expression occurs stochastically during differentiation, and for some genes is compensated for by the cell to maintain the required transcriptional output of these genes. PMID:24576421

  1. Rapid and robust association mapping of expression quantitative trait loci.


    Lam, Alex C; Schouten, Michael; Aulchenko, Yurii S; Haley, Chris S; de Koning, Dirk-Jan


    We applied a simple and efficient two-step method to analyze a family-based association study of gene expression quantitative trait loci (eQTL) in a mixed model framework. This two-step method produces very similar results to the full mixed model method, with our method being significantly faster than the full model. Using the Genetic Analysis Workshop 15 (GAW15) Problem 1 data, we demonstrated the value of data filtering for reducing the number of tests and controlling the number of false positives. Specifically, we showed that removing non-expressed genes by filtering on expression variability effectively reduced the number of tests by nearly 50%. Furthermore, we demonstrated that filtering on genotype counts substantially reduced spurious detection. Finally, we restricted our analysis to the markers and transcripts that were closely located. We found five times more signals in close proximity (cis-) to transcripts than in our genome-wide analysis. Our results suggest that careful pre-filtering and partitioning of data are crucial for controlling false positives and allowing detection of genuine effects in genetic analysis of gene expression.

  2. Identification of differentially expressed genes in uveal melanoma using suppressive subtractive hybridization

    PubMed Central

    Landreville, Solange; Lupien, Caroline B.; Vigneault, Francois; Gaudreault, Manon; Mathieu, Mélissa; Rousseau, Alain P.; Guérin, Sylvain L.


    Purpose Uveal melanoma (UM) is the most common primary cancer of the eye, resulting not only in vision loss, but also in metastatic death. This study attempts to identify changes in the patterns of gene expression that lead to malignant transformation and proliferation of normal uveal melanocytes (UVM) using the Suppressive Subtractive Hybridization (SSH) technique. Methods The SSH technique was used to isolate genes that are differentially expressed in the TP31 cell line derived from a primary UM compared to UVM. The expression level of selected genes was further validated by microarray, semi-quantitative RT–PCR and western blot analyses. Results Analysis of the subtracted libraries revealed that 37 and 36 genes were, respectively, up- and downregulated in TP31 cells compared to UVM. Differential expression of the majority of these genes was confirmed by comparing UM cells with UVM by microarray. The expression pattern of selected genes was analyzed by semi-quantitative RT–PCR and western blot, and was found to be consistent with the SSH findings. Conclusions We demonstrated that the SSH technique is efficient to detect differentially expressed genes in UM. The genes identified in this study represent valuable candidates for further functional analysis in UM and should be informative in studying the biology of this tumor. PMID:21647268

  3. Characterization and differentiation of three solid tumors using quantitative ultrasound

    NASA Astrophysics Data System (ADS)

    Oelze, Michael L.; O'Brien, William D.; Zachary, James F.


    Three kinds of solid tumors were acquired and scanned in vivo ultrasonically. The first tumor series (fibroadenoma) was acquired from tumors that had spontaneously developed in rats. The second tumor series was acquired by culturing a carcinoma cell line (4T1-MMT) in culture media and injecting the cells into Balb/c mice. The third tumor was acquired by transplanting a soft-tissue sarcoma cell line (EHS) into C57BL mice. The tumors were allowed to grow to 1 cm in size and then scanned ultrasonically. The scatterer properties of average scatterer diameter and acoustic concentration were estimated using a Gaussian form factor from the backscattered ultrasound measured from the tumors. Parametric images of the tumors were constructed utilizing estimated scatterer properties for regions of interest inside the tumors. The parametric images showed distinct differences between the various tumor types. Quantitatively, the tumors could be distinguished through feature analysis plots of average scatterer size versus acoustic concentration. Comparison with photomicrographs of the tumors showed structures similar in size to the ultrasound estimates. [Work supported by NIH Grant F32 CA96419 to MLO and by the University of Illinois Research Board.

  4. High throughput, quantitative analysis of human osteoclast differentiation and activity.


    Diepenhorst, Natalie A; Nowell, Cameron J; Rueda, Patricia; Henriksen, Kim; Pierce, Tracie; Cook, Anna E; Pastoureau, Philippe; Sabatini, Massimo; Charman, William N; Christopoulos, Arthur; Summers, Roger J; Sexton, Patrick M; Langmead, Christopher J


    Osteoclasts are multinuclear cells that degrade bone under both physiological and pathophysiological conditions. Osteoclasts are therefore a major target of osteoporosis therapeutics aimed at preserving bone. Consequently, analytical methods for osteoclast activity are useful for the development of novel biomarkers and/or pharmacological agents for the treatment of osteoporosis. The nucleation state of an osteoclast is indicative of its maturation and activity. To date, activity is routinely measured at the population level with only approximate consideration of the nucleation state (an 'osteoclast population' is typically defined as cells with ≥3 nuclei). Using a fluorescent substrate for tartrate-resistant acid phosphatase (TRAP), a routinely used marker of osteoclast activity, we developed a multi-labelled imaging method for quantitative measurement of osteoclast TRAP activity at the single cell level. Automated image analysis enables interrogation of large osteoclast populations in a high throughput manner using open source software. Using this methodology, we investigated the effects of receptor activator of nuclear factor kappa-B ligand (RANK-L) on osteoclast maturation and activity and demonstrated that TRAP activity directly correlates with osteoclast maturity (i.e. nuclei number). This method can be applied to high throughput screening of osteoclast-targeting compounds to determine changes in maturation and activity.

  5. Identification of suitable reference genes for quantitative RT-PCR during 3T3-L1 adipocyte differentiation.


    Zhang, Juan; Tang, Hongju; Zhang, Yuqing; Deng, Ruyuan; Shao, Li; Liu, Yun; Li, Fengying; Wang, Xiao; Zhou, Libin


    Quantitative reverse transcription PCR (qRT-PCR) is becoming increasingly important in the effort to gain insight into the molecular mechanisms underlying adipogenesis. However, the expression profile of a target gene may be misinterpreted due to the unstable expression of the reference genes under different experimental conditions. Therefore, in this study, we investigated the expression stability of 10 commonly used reference genes during 3T3-L1 adipocyte differentiation. The mRNA expression levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and transferrin receptor (TFRC) significantly increased during the course of 3T3-L1 adipocyte differentiation, which was decreased by berberine, an inhibitor of adipogenesis. Three popular algorithms, GeNorm, NormFinder and BestKeeper, identified 18 ribosomal RNA and hydroxymethylbilane synthase (HMBS) as the most stable reference genes, while GAPDH and TFRC were the least stable ones. Peptidylprolyl isomerase A [PIPA (cyclophilin A)], ribosomal protein, large, P0 (36-B4), beta-2-microglobulin (B2M), α1-tubulin, hypoxanthine-guanine phosphoribosyltransferase (HPRT) and β-actin showed relatively stable expression levels. The choice of reference genes with various expression stabilities exerted a profound influence on the expression profiles of 2 target genes, peroxisome proliferator-activated receptor (PPAR)γ2 and C/EBPα. In addition, western blot analysis revealed that the increased protein expression of GAPDH was markedly inhibited by berberine during adipocyte differentiation. This study highlights the importance of selecting suitable reference genes for qRT-PCR studies of gene expression during the process of adipogenesis.

  6. α-Syntrophin Modulates Myogenin Expression in Differentiating Myoblasts

    PubMed Central

    Kim, Min Jeong; Hwang, Sung Ho; Lim, Jeong A.; Froehner, Stanley C.; Adams, Marvin E.; Kim, Hye Sun


    Background α-Syntrophin is a scaffolding protein linking signaling proteins to the sarcolemmal dystrophin complex in mature muscle. However, α-syntrophin is also expressed in differentiating myoblasts during the early stages of muscle differentiation. In this study, we examined the relationship between the expression of α-syntrophin and myogenin, a key muscle regulatory factor. Methods and Findings The absence of α-syntrophin leads to reduced and delayed myogenin expression. This conclusion is based on experiments using muscle cells isolated from α-syntrophin null mice, muscle regeneration studies in α-syntrophin null mice, experiments in Sol8 cells (a cell line that expresses only low levels of α-syntrophin) and siRNA studies in differentiating C2 cells. In primary cultured myocytes isolated from α-syntrophin null mice, the level of myogenin was less than 50% that from wild type myocytes (p<0.005) 40 h after differentiation induction. In regenerating muscle, the expression of myogenin in the α-syntrophin null muscle was reduced to approximately 25% that of wild type muscle (p<0.005). Conversely, myogenin expression is enhanced in primary cultures of myoblasts isolated from a transgenic mouse over-expressing α-syntrophin and in Sol8 cells transfected with a vector to over-express α-syntrophin. Moreover, we find that myogenin mRNA is reduced in the absence of α-syntrophin and increased by α-syntrophin over-expression. Immunofluorescence microscopy shows that α-syntrophin is localized to the nuclei of differentiating myoblasts. Finally, immunoprecipitation experiments demonstrate that α-syntrophin associates with Mixed-Lineage Leukemia 5, a regulator of myogenin expression. Conclusions We conclude that α-syntrophin plays an important role in regulating myogenesis by modulating myogenin expression. PMID:21179410

  7. [Mechanism on differential gene expression and heterosis formation].


    Xu, Chen-Lu; Sun, Xiao-Mei; Zhang, Shou-Gong


    Despite the rediscovery of heterosis about a century ago and the suggestion of various genetic models to explain this phenomenon, little consensus has yet been reached about the genetic basis of heterosis. Following the genome organization variation and gene effects, an understanding of gene differential expression in hybrids and its parents provides a new opportunity to speculate on mechanisms that might lead to heterosis. Investigation on allele-specific gene expression in hybrid and gene differential expression between hybrids and its parents might contribute to improve our understanding of the molecular basis of heterosis and eventually guide breeding practices. In this review, we discussed the recent researches on allelic-specific expression in hybrid which was frequently observed in recent studies and analyzed its regulatory mechanism. All possible modes of gene action, including additivity, high- and low-parent dominance, underdominance, and over-dominance, were observed when investigating gene differential expression between hybrids and its parents. Data from transcriptomic studies screened several heterosis-associated genes and highlighted the importance of certain key biochemical pathways that may prove to be quintessential for the manifestation of heterosis. So far, no uniform global expression pat-terns were observed in these gene expression studies. Most heterosis-associated gene expression analyses have not revealed a predominant functional category to which differentially expressed genes belong. However, these gene expression profiling studies represent a first step towards the definition of the complex gene expression networks that might be relevant in the context of heterosis. New technique on gene expression profile and advancements in bioinformatics will facilitate our understanding of the genetic basis of heterosis at the gene-expression level.

  8. Gene expression during normal and malignant differentiation

    SciTech Connect

    Andersson, L.C.; Gahmberg, C.G.; Ekblom, P.


    This book contains 18 selections. Some of the titles are: Exploring Carcinogenesis with Retroviral and Cellular Oncogenes; Retroviruses, Oncogenes and Evolution; HTLV and Human Neoplasi; Modes of Activation of cMyc Oncogene in B and T Lymphoid Tumors; The Structure and Function of the Epidermal Growth Factor Receptor: Its Relationship to the Protein Product of the V-ERB-B Oncogene; and Expression of Human Retrovirus Genes in Normal and Neoplastic Epithelial Cells.

  9. Quantitative Proteomics Reveals GIMAP Family Proteins 1 and 4 to Be Differentially Regulated during Human T Helper Cell Differentiation *S⃞

    PubMed Central

    Filén, Jan-Jonas; Filén, Sanna; Moulder, Robert; Tuomela, Soile; Ahlfors, Helena; West, Anne; Kouvonen, Petri; Kantola, Suvi; Björkman, Mari; Katajamaa, Mikko; Rasool, Omid; Nyman, Tuula A.; Lahesmaa, Riitta


    T helper (Th) cells differentiate into functionally distinct effector cell subsets of which Th1 and Th2 cells are best characterized. Besides T cell receptor signaling, IL-12-induced STAT4 and T-bet- and IL-4-induced STAT6 and GATA3 signaling pathways are the major players regulating the Th1 and Th2 differentiation process, respectively. However, there are likely to be other yet unknown factors or pathways involved. In this study we used quantitative proteomics exploiting cleavable ICAT labeling and LC-MS/MS to identify IL-4-regulated proteins from the microsomal fractions of CD4+ cells extracted from umbilical cord blood. We were able to identify 557 proteins of which 304 were also quantified. This study resulted in the identification of the down-regulation of small GTPases GIMAP1 and GIMAP4 by IL-4 during Th2 differentiation. We also showed that both GIMAP1 and GIMAP4 genes are up-regulated by IL-12 and other Th1 differentiation-inducing cytokines in cells induced to differentiate toward Th1 lineage and down-regulated by IL-4 in cells induced to Th2. Our results indicate that the GIMAP (GTPase of the immunity-associated protein) family of proteins is differentially regulated during Th cell differentiation. PMID:18701445

  10. Quantitative analysis of the expression of ACAT genes in human tissues by real-time PCR.


    Smith, Jeffery L; Rangaraj, Kavitha; Simpson, Robert; Maclean, Donald J; Nathanson, Les K; Stuart, Katherine A; Scott, Shaun P; Ramm, Grant A; de Jersey, John


    ACAT (also called sterol o-acyltransferase) catalyzes the esterification of cholesterol by reaction with long-chain acyl-CoA derivatives and plays a pivotal role in the regulation of cholesterol homeostasis. Although two human ACAT genes termed ACAT-1 and ACAT-2 have been reported, prior research on differential tissue expression is qualitative and incomplete. We have developed a quantitative multiplex assay for each ACAT isoform after RT treatment of total RNA using TaqMan real-time quantitative PCR normalized to beta-actin in the same reaction tube. This enabled us to calculate the relative abundance of transcripts in several human tissues as an ACAT-2/ACAT-1 ratio. In liver (n = 17), ACAT-1 transcripts were on average 9-fold (range, 1.7- to 167-fold) more abundant than ACAT-2, whereas in duodenal samples (n = 10), ACAT-2 transcripts were on average 3-fold (range, 0.39- to 12.2-fold) more abundant than ACAT-1. ACAT-2 was detected for the first time in peripheral blood mononuclear cells. Interesting differences in ACAT-2 mRNA expression were evident in subgroup analysis of samples from different sources. These results demonstrate quantitatively that ACAT-1 transcripts predominate in human liver and ACAT-2 transcripts predominate in human duodenum and support the notion that ACAT-2 has an important regulatory role in liver and intestine.

  11. In-depth cDNA library sequencing provides quantitative gene expression profiling in cancer biomarker discovery.


    Yang, Wanling; Ying, Dingge; Lau, Yu-Lung


    Quantitative gene expression analysis plays an important role in identifying differentially expressed genes in various pathological states, gene expression regulation and co-regulation, shedding light on gene functions. Although microarray is widely used as a powerful tool in this regard, it is suboptimal quantitatively and unable to detect unknown gene variants. Here we demonstrated effective detection of differential expression and co-regulation of certain genes by expressed sequence tag analysis using a selected subset of cDNA libraries. We discussed the issues of sequencing depth and library preparation, and propose that increased sequencing depth and improved preparation procedures may allow detection of many expression features for less abundant gene variants. With the reduction of sequencing cost and the emerging of new generation sequencing technology, in-depth sequencing of cDNA pools or libraries may represent a better and powerful tool in gene expression profiling and cancer biomarker detection. We also propose using sequence-specific subtraction to remove hundreds of the most abundant housekeeping genes to increase sequencing depth without affecting relative expression ratio of other genes, as transcripts from as few as 300 most abundantly expressed genes constitute about 20% of the total transcriptome. In-depth sequencing also represents a unique advantage of detecting unknown forms of transcripts, such as alternative splicing variants, fusion genes, and regulatory RNAs, as well as detecting mutations and polymorphisms that may play important roles in disease pathogenesis.

  12. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.


    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  13. Regulation of mda-7 gene expression during human melanoma differentiation.


    Madireddi, M T; Dent, P; Fisher, P B


    Induction of irreversible growth arrest and terminal differentiation in human melanoma cells following treatment with recombinant human fibroblast interferon (IFN-beta) and mezerein (MEZ) results in elevated expression of a specific melanoma differentiation associated gene, mda-7. Experiments were conducted to define the mechanism involved in the regulation of mda-7 expression in differentiating human melanoma cells. The mda-7 gene is actively transcribed in uninduced HO-1 human melanoma cells and the rate of transcription of mda-7 is not significantly enhanced by treatment with IFN-beta, MEZ or IFN-beta+MEZ. The high basal activity of the mda-7 promoter in uninduced melanoma cells and the absence of enhancing effect upon treatment with differentiation inducers is corroborated by transfection studies using the promoter region of mda-7 linked to a luciferase reporter gene containing the SV40 polyadenylation signal sequence. RT - PCR analysis detects the presence of low levels of mda-7 transcripts in uninduced and concomitant increases in differentiation inducer treated HO-1 cells. However, steady-state mda-7 mRNA is detected only in IFN-beta+MEZ and to a lesser degree in MEZ treated cells. We show that induction of terminal differentiation of HO-1 cells with IFN-beta+MEZ dramatically increases the half-life of mda-7 mRNA while treatment with cycloheximide results in detectable mda-7 mRNA in control and inducer treated cells. These observations confirm constitutive activity of the mda-7 promoter in HO-1 cells irrespective of differentiation status suggesting posttranscriptional processes as important determinants of mda-7 expression during terminal differentiation. The 3' UTR region of mda-7 contains AU-rich elements (ARE) that contribute to rapid mda-7 mRNA turnover during proliferation and reversible differentiation, a process controlled by a labile protein factor(s). Substitution of the SV40 polyadenylation signal sequence in the luciferase reporter plasmid with

  14. An integrated analysis of differential miRNA and mRNA expressions in human gallstones.


    Yang, Bin; Liu, Bin; Bi, Pinduan; Wu, Tao; Wang, Qiang; Zhang, Jie


    Gallstone disease, including cholesterol precipitation in bile, increased bile salt hydrophobicity and gallbladder inflammation. Here, we investigated miRNA and mRNA involved in the formation of gallstones, and explored the molecular mechanisms in the development of gallstones. Differentially expressed 17 miRNAs and 525 mRNA were identified based on Illumina sequencing from gallbladder mucosa of patients with or without gallstones, and were validated by randomly selected 6 miRNAs and 8 genes using quantitative RT-PCR. 114 miRNA target genes were identified, whose functions and regulating pathways were related to gallstones. The differentially expressed genes were enriched upon lipoprotein binding and some metabolic pathways, and differentially expressed miRNAs enriched upon ABC transportation and cancer related pathways. A molecular regulatory network consisting of 17 differentially expressed miRNAs, inclusive of their target genes, was constructed. miR-210 and its potential target gene ATP11A were found to be differentially expressed in both miRNA and mRNA profiles. ATP11A was a direct target of miR-210, which was predicted to regulate the ABC-transporters pathway. The expression levels of ATP11A in the gallstone showed inverse correlation with miR-210 expression, and up-regulation of miR-210 could reduce ATP11A expression in HGBEC. This is the first report that indicates the existence of differences in miRNA and mRNA expression in patients with or without gallstones. Our data shed light on further investigating the mechanisms of gallstone formation.

  15. Differential expression of c-kit in mouse undifferentiated and differentiating type A spermatogonia.


    Schrans-Stassen, B H; van de Kant, H J; de Rooij, D G; van Pelt, A M


    The proto-oncogene c-kit is encoded at the white-spotting locus and in the mouse mutations at this locus affect the precursor cells of melanocytes, hematopoietic cells, and germ cells. c-kit is expressed in type A spermatogonia, but whether or not c-kit is present both in undifferentiated and differentiating type A spermatogonia or only in the latter cell type is still a matter of debate. Using the vitamin A-deficient mouse model, we studied messenger RNA (mRNA) and protein expression in undifferentiated and differentiating type A spermatogonia. Furthermore, we quantified the immuno-positive type A spermatogonia in the epithelial stages VI, VII, IX/X, and XII in normal mice to correlate c-kit expression in type A spermatogonia with the differentiation of these cells. Our results show that in the VAD situation undifferentiated type A spermatogonia express little c-kit mRNA. The A spermatogonia with a larger nucleus expressed c-Kit protein, whereas the A spermatogonia with a smaller one did not. After induction of differentiation of these cells into type A1 spermatogonia, c-kit mRNA was enhanced. The percentage of A spermatogonia expressing c-Kit protein did not change during this process, suggesting that A spermatogonia, which are committed to differentiate express c-kit. Under normal circumstances in epithelial stage VI 16%+/-2% (mean +/- SD), in VII 45%+/-15%, in IX/X 78%+/-14% and in XII 90%+/-1.9% of the type A spermatogonia were c-kit positive, suggesting that Aaligned spermatogonia gradually change from c-Kit negative to c-Kit positive cells before their differentiation into A1 spermatogonia. It is concluded that c-kit can be used as a marker for differentiation of undifferentiated into differentiating type A spermatogonia.

  16. Quantitative expression of the homeobox and integrin genes in human gastric carcinoma.


    Rossi Degl'Innocenti, Duccio; Castiglione, Francesca; Buccoliero, Anna Maria; Bechi, Paolo; Taddei, Gian Luigi; Freschi, Giancarlo; Taddei, Antonio


    The homeobox (HOX) genes are a large family of regulator genes involved in the control of developmental processes and cell differentiation. The HOX genes encode transcription factors, and an increasing number of studies have shown that these genes may be implicated in the growth and the progression of many types of tumours. The present study investigated the expression of the HOX and integrin genes and their relationships in gastric carcinoma. We analyzed the RNA expression of 13 HOX genes from HOXA, C and D clusters and alphaV, alpha5 and alpha8 integrin genes in 24 gastric cancer samples by quantitative real-time PCR. The results showed that the HOXA2 gene and the alpha8 integrin gene had a lower expression in tumour samples than in normal gastric mucosas. The comparison between the HOX and integrin genes showed that HOXA2 and alphaV integrin expression presented the same trend in 83% of the samples. Moreover, in cancer samples that expressed the HOXD11 gene, the expression of alphaV integrin was lower with respect to normal mucosas. The different roles of HOX and integrin genes in gastric carcinoma remain to be fully elucidated. These findings suggest that the HOX genes may play a critical role in the genesis, maintenance and diffusion of gastric carcinoma.

  17. Polyester: simulating RNA-seq datasets with differential transcript expression

    PubMed Central

    Frazee, Alyssa C.; Jaffe, Andrew E.; Langmead, Ben; Leek, Jeffrey T.


    Motivation: Statistical methods development for differential expression analysis of RNA sequencing (RNA-seq) requires software tools to assess accuracy and error rate control. Since true differential expression status is often unknown in experimental datasets, artificially constructed datasets must be utilized, either by generating costly spike-in experiments or by simulating RNA-seq data. Results: Polyester is an R package designed to simulate RNA-seq data, beginning with an experimental design and ending with collections of RNA-seq reads. Its main advantage is the ability to simulate reads indicating isoform-level differential expression across biological replicates for a variety of experimental designs. Data generated by Polyester is a reasonable approximation to real RNA-seq data and standard differential expression workflows can recover differential expression set in the simulation by the user. Availability and implementation: Polyester is freely available from Bioconductor ( Contact: Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25926345

  18. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy


    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  19. Differential Expression and Network Inferences through Functional Data Modeling

    PubMed Central

    Telesca, Donatello; Inoue, Lurdes Y.T.; Neira, Mauricio; Etzioni, Ruth; Gleave, Martin; Nelson, Colleen


    Time–course microarray data consist of mRNA expression from a common set of genes collected at different time points. Such data are thought to reflect underlying biological processes developing over time. In this article we propose a model that allows us to examine differential expression and gene network relationships using time course microarray data. We model each gene expression profile as a random functional transformation of the scale, amplitude and phase of a common curve. Inferences about the gene–specific amplitude parameters allow us to examine differential gene expression. Inferences about measures of functional similarity based on estimated time transformation functions allow us to examine gene networks while accounting for features of the gene expression profiles. We discuss applications to simulated data as well as to microarray data on prostate cancer progression. PMID:19053995

  20. Differential Expression of Cysteine Dioxygenase 1 in Complex Karyotype Liposarcomas

    PubMed Central

    Shaker, Mohammed; Pascarelli, Kara M; Plantinga, Matthew J; Love, Miles A; Lazar, Alexander J; Ingram, Davis R; von Mehren, Margaret; Lev, Dina; Kipling, David; Broccoli, Dominique


    Altered cysteine dioxygenase 1 (CDO1) gene expression has been observed in several cancers but has not yet been investigated in liposarcomas. The aim of this study was to evaluate CDO1 expression in a cohort of liposarcomas and to determine its association with clinicopathological features. Existing microarray data indicated variable CDO1 expression in liposarcoma subtypes. CDO1 mRNA from a larger cohort of liposarcomas was quantified by real time-PCR, and CDO1 protein expression was determined by immunohistochemistry (IHC) in more than 300 tumor specimens. Well-differentiated liposarcomas (WDLSs) had significantly higher CDO1 gene expression and protein levels than dedifferentiated liposarcomas (DDLSs) (P < 0.001). Location of the tumor was not predictive of the expression level of CDO1 mRNA in any histological subtype of liposarcoma. Recurrent tumors did not show any difference in CDO1 expression when compared to primary tumors. CDO1 expression was upregulated as human mesenchymal stem cells (hMSCs) undergo differentiation into mature adipocytes. Our results suggest that CDO1 is a marker of liposarcoma progression and adipogenic differentiation. PMID:24741338

  1. Quantitative Analysis of Protein Expression to Study Lineage Specification in Mouse Preimplantation Embryos

    PubMed Central

    Saiz, Nestor; Kang, Minjung; Schrode, Nadine; Lou, Xinghua; Hadjantonakis, Anna-Katerina


    This protocol presents a method to perform quantitative, single-cell in situ analyses of protein expression to study lineage specificationin mouse preimplantation embryos. The procedures necessary for embryo collection, immunofluorescence, imaging on a confocal microscope, and image segmentation and analysis are described. This method allows quantitation of the expression of multiple nuclear markers and the spatial (XYZ) coordinates of all cells in the embryo. It takes advantage of MINS, an image segmentation software tool specifically developed for the analysis of confocal images of preimplantation embryos and embryonic stem cell (ESC) colonies. MINS carries out unsupervised nuclear segmentation across the X, Y and Z dimensions, and produces information on cell position in three-dimensional space, as well as nuclear fluorescence levels for all channels with minimal user input. While this protocol has been optimized for the analysis of images of preimplantation stage mouse embryos, it can easily be adapted to the analysis of any other samples exhibiting a good signal-to-noise ratio and where high nuclear density poses a hurdle to image segmentation (e.g., expression analysis of embryonic stem cell (ESC) colonies, differentiating cells in culture, embryos of other species or stages, etc.). PMID:26967230

  2. Differentially expressed proteins underlying childhood cortical dysplasia with epilepsy identified by iTRAQ proteomic profiling

    PubMed Central

    Liu, Shiyong; Liu, Yi; Yang, Yixuan; Yang, Hui; Chen, Yangmei; Chen, Lifen


    Cortical dysplasia accounts for at least 14% of epilepsy cases, and is mostly seen in children. However, the understanding of molecular mechanisms and pathogenesis underlying cortical dysplasia is limited. The aim of this cross-sectional study is to identify potential key molecules in the mechanisms of cortical dysplasia by screening the proteins expressed in brain tissues of childhood cortical dysplasia patients with epilepsy using isobaric tags for relative and absolute quantitation-based tandem mass spectrometry compared to controls, and several differentially expressed proteins that are not reported to be associated with cortical dysplasia previously were selected for validation using real-time polymerase chain reaction, immunoblotting and immunohistochemistry. 153 out of 3340 proteins were identified differentially expressed between childhood cortical dysplasia patients and controls. And FSCN1, CRMP1, NDRG1, DPYSL5, MAP4, and FABP3 were selected for validation and identified to be increased in childhood cortical dysplasia patients, while PRDX6 and PSAP were identified decreased. This is the first report on differentially expressed proteins in childhood cortical dysplasia. We identified differential expression of FSCN1, CRMP1, NDRG1, DPYSL5, MAP4, FABP3, PRDX6 and PSAP in childhood cortical dysplasia patients, these proteins are involved in various processes and have various function. These results may provide new directions or targets for the research of childhood cortical dysplasia, and may be helpful in revealing molecular mechanisms and pathogenesis and/or pathophysiology of childhood cortical dysplasia if further investigated. PMID:28222113

  3. Identification of genes differentially expressed in ectomycorrhizal roots during the Pinus pinaster-Laccaria bicolor interaction.


    Flores-Monterroso, Aranzazu; Canales, Javier; de la Torre, Fernando; Ávila, Concepción; Cánovas, Francisco M


    Ectomycorrhizal associations are of major ecological importance in temperate and boreal forests. The development of a functional ectomycorrhiza requires many genetic and biochemical changes. In this study, suppressive subtraction hybridization was used to identify differentially expressed genes in the roots of maritime pine (Pinus pinaster Aiton) inoculated with Laccaria bicolor, a mycorrhizal fungus. A total number of 200 unigenes were identified as being differentially regulated in maritime pine roots during the development of mycorrhiza. These unigenes were classified into 10 categories according to the function of their homologues in the GenBank database. Approximately, 40 % of the differentially expressed transcripts were genes that coded for unknown proteins in the databases or that had no homology to known genes. A group of these differentially expressed genes was selected to validate the results using quantitative real-time PCR. The transcript levels of the representative genes were compared between the non-inoculated and inoculated plants at 1, 5, 15 and 30 days after inoculation. The observed expression patterns indicate (1) changes in the composition of the wall cell, (2) tight regulation of defence genes during the development of mycorrhiza and (3) changes in carbon and nitrogen metabolism. Ammonium excess or deficiency dramatically affected the stability of ectomycorrhiza and altered gene expression in maritime pine roots.

  4. Integration of amplified differential gene expression (ADGE) and DNA microarray.


    Chen, Zhijian J; Gaté, Laurent; Davis, Warren; Ile, Kristina E; Tew, Kenneth D


    Amplified Differential Gene Expression (ADGE) provides a new concept that the ratios of differentially expressed genes are magnified before detection in order to improve both sensitivity and accuracy. This technology is now implemented with integration of DNA reassociation and PCR. The ADGE technique can be used either as a stand-alone method or in series with DNA microarray. ADGE is used in sample preprocessing and DNA microarray is used as a displaying system in the series combination. These two techniques are mutually synergistic: the quadratic magnification of ratios of differential gene expression achieved by ADGE improves the detection sensitivity and accuracy; the PCR amplification of templates enhances the signal intensity and reduces the requirement for large amounts of starting material; the high throughput for DNA microarray is maintained.

  5. Differential expression of pancreatic protein and chemosensing receptor mRNAs in NKCC1-null intestine

    PubMed Central

    Bradford, Emily M; Vairamani, Kanimozhi; Shull, Gary E


    AIM: To investigate the intestinal functions of the NKCC1 Na+-K+-2Cl cotransporter (SLC12a2 gene), differential mRNA expression changes in NKCC1-null intestine were analyzed. METHODS: Microarray analysis of mRNA from intestines of adult wild-type mice and gene-targeted NKCC1-null mice (n = 6 of each genotype) was performed to identify patterns of differential gene expression changes. Differential expression patterns were further examined by Gene Ontology analysis using the online Gorilla program, and expression changes of selected genes were verified using northern blot analysis and quantitative real time-polymerase chain reaction. Histological staining and immunofluorescence were performed to identify cell types in which upregulated pancreatic digestive enzymes were expressed. RESULTS: Genes typically associated with pancreatic function were upregulated. These included lipase, amylase, elastase, and serine proteases indicative of pancreatic exocrine function, as well as insulin and regenerating islet genes, representative of endocrine function. Northern blot analysis and immunohistochemistry showed that differential expression of exocrine pancreas mRNAs was specific to the duodenum and localized to a subset of goblet cells. In addition, a major pattern of changes involving differential expression of olfactory receptors that function in chemical sensing, as well as other chemosensing G-protein coupled receptors, was observed. These changes in chemosensory receptor expression may be related to the failure of intestinal function and dependency on parenteral nutrition observed in humans with SLC12a2 mutations. CONCLUSION: The results suggest that loss of NKCC1 affects not only secretion, but also goblet cell function and chemosensing of intestinal contents via G-protein coupled chemosensory receptors. PMID:26909237

  6. Differential modulation of gene expression in the NMDA postsynaptic density of schizophrenic and control smokers.


    Mexal, S; Frank, M; Berger, R; Adams, C E; Ross, R G; Freedman, R; Leonard, S


    Nicotine is known to induce the release of multiple neurotransmitters, including glutamate and dopamine, through activation of nicotinic receptors. Gene expression in the N-methyl-d-aspartate postsynaptic density (NMDA-PSD), as well as other functional groups, was compared in postmortem hippocampus of schizophrenic and nonmentally ill smokers and nonsmokers utilizing a microarray and quantitative RT-PCR approach. The expression of 277 genes was significantly changed between all smokers and nonsmokers. Specific gene groups, most notably genes expressed in the NMDA-PSD, were prevalent among these transcripts. Analysis of the interaction between smoking and schizophrenia identified several genes in the NMDA-PSD that were differentially affected by smoking in patients. The present findings suggest that smoking may differentially modulate glutamatergic function in schizophrenic patients and control subjects. The biological mechanisms underlying chronic tobacco use are likely to differ substantially between these two groups.

  7. Assessing Differential Expression Measurements by Highly Parallel Pyrosequencing and DNA Microarrays: A Comparative Study

    PubMed Central

    Ariño, Joaquín; Casamayor, Antonio; Pérez, Julián Perez; Pedrola, Laia; Álvarez-Tejado, Miguel; Marbà, Martina; Santoyo, Javier


    Abstract To explore the feasibility of pyrosequencing for quantitative differential gene expression analysis we have performed a comparative study of the results of the sequencing experiments to those obtained by a conventional DNA microarray platform. A conclusion from our analysis is that, over a threshold of 35 normalized reads per gene, the measurements of gene expression display a good correlation with the references. The observed concordance between pyrosequencing and DNA microarray platforms beyond the threshold was of 0.8, measured as a Pearson's correlation coefficient. In differential gene expression the initial aim is the quantification the differences among transcripts when comparing experimental conditions. Thus, even in a scenario of low coverage the concordance in the measurements is quite acceptable. On the other hand, the comparatively longer read size obtained by pyrosequencing allows detecting unconventional splicing forms. PMID:21919703

  8. Differential network analysis from cross-platform gene expression data

    PubMed Central

    Zhang, Xiao-Fei; Ou-Yang, Le; Zhao, Xing-Ming; Yan, Hong


    Understanding how the structure of gene dependency network changes between two patient-specific groups is an important task for genomic research. Although many computational approaches have been proposed to undertake this task, most of them estimate correlation networks from group-specific gene expression data independently without considering the common structure shared between different groups. In addition, with the development of high-throughput technologies, we can collect gene expression profiles of same patients from multiple platforms. Therefore, inferring differential networks by considering cross-platform gene expression profiles will improve the reliability of network inference. We introduce a two dimensional joint graphical lasso (TDJGL) model to simultaneously estimate group-specific gene dependency networks from gene expression profiles collected from different platforms and infer differential networks. TDJGL can borrow strength across different patient groups and data platforms to improve the accuracy of estimated networks. Simulation studies demonstrate that TDJGL provides more accurate estimates of gene networks and differential networks than previous competing approaches. We apply TDJGL to the PI3K/AKT/mTOR pathway in ovarian tumors to build differential networks associated with platinum resistance. The hub genes of our inferred differential networks are significantly enriched with known platinum resistance-related genes and include potential platinum resistance-related genes. PMID:27677586

  9. Molecular and quantitative genetic differentiation in Sitobion avenae populations from both sides of the Qinling Mountains.


    Huang, Xianliang; Liu, Deguang; Wang, Da; Shi, Xiaoqin; Simon, Jean-Christophe


    Quantitative trait differences are often assumed to be correlated with molecular variation, but the relationship is not certain, and empirical evidence is still scarce. To address this issue, we sampled six populations of the cereal aphid Sitobion avenae from areas north and south of the Qinling Mountains, and characterized their molecular variation at seven microsatellite loci and quantitative variation at nine life-history traits. Our results demonstrated that southern populations had slightly longer developmental times of nymphs but much higher lifetime fecundity, compared to northern populations. Of the nine tested quantitative characters, eight differed significantly among populations within regions, as well as between northern and southern regions. Genetic differentiation in neutral markers was likely to have been caused by founder events and drift. Increased subdivision for quantitative characters was found in northern populations, but reduced in southern populations. This phenomenon was not found for molecular characters, suggesting the decoupling between molecular and quantitative variation. The pattern of relationships between FST and QST indicated divergent selection and suggested that local adaptation play a role in the differentiation of life-history traits in tested S. avenae populations, particularly in those traits closely related to reproduction. The main role of natural selection over genetic drift was also supported by strong structural differences in G-matrices among S. avenae populations. However, cluster analyses did not result in two groups corresponding to northern and southern regions. Genetic differentiation between northern and southern populations in neutral markers was low, indicating considerable gene flow between them. The relationship between molecular and quantitative variation, as well as its implications for differentiation and evolution of S. avenae populations, was discussed.

  10. Analysis of differentially expressed genes in human hepatocellular carcinoma using suppression subtractive hybridization

    PubMed Central

    Miyasaka, Y; Enomoto, N; Nagayama, K; Izumi, N; Marumo, F; Watanabe, M; Sato, C


    The genetic basis of hepatocellular carcinoma (HCC) has not yet been fully understood. Although various methods have been developed to detect differentially expressed genes in malignant diseases, efficient analysis from clinical specimens is generally difficult to perform due to the requirement of a large amount of samples. In the present study, we analysed differentially expressed genes with a small amount of human HCC samples using suppression subtractive hybridization (SSH). Total RNA were obtained from the hepatitis C virus-associated HCC and adjacent non-HCC liver tissues. cDNA was synthesized using modified RT-PCR, and then tester cDNA was ligated with 2 different kinds of adaptors and hybridized with an excess amount of driver cDNA. Tester specific cDNA was obtained by suppression PCR and the final PCR product was subcloned and sequenced. We identified 7 known genes (focal adhesion kinase, deleted in colon cancer, guanine binding inhibitory protein α, glutamine synthetase, ornithine aminotransferase, M130, and pepsinogen C) and 2 previously unknown genes as being overexpressed in HCC, and 1 gene (decorin) as suppressed in HCC. Quantitative analysis of gene expression using quantitative RT-PCR demonstrated the differential expression of these genes in the original and other HCC samples. These findings demonstrated that it is possible to identify the previously unknown, differential gene expression from a small amount of clinical samples. Information about such alterations in gene expression could be useful for elucidating the genetic events in HCC pathogenesis, developing the new diagnosic markers, or determining novel therapeutic targets. © 2001 Cancer Research Campaign PMID:11461082

  11. Expression of Molecular Differentiation Markers Does Not Correlate with Histological Differentiation Grade in Intrahepatic Cholangiocarcinoma

    PubMed Central

    Demarez, Céline; Hubert, Catherine; Sempoux, Christine; Lemaigre, Frédéric P.


    The differentiation status of tumor cells, defined by histomorphological criteria, is a prognostic factor for survival of patients affected with intrahepatic cholangiocarcinoma (ICC). To strengthen the value of morphological differentiation criteria, we wished to correlate histopathological differentiation grade with expression of molecular biliary differentiation markers and of microRNAs previously shown to be dysregulated in ICC. We analysed a series of tumors that were histologically classified as well, moderately or poorly differentiated, and investigated the expression of cytokeratin 7, 19 and 903 (CK7, CK19, CK903), SRY-related HMG box transcription factors 4 and 9 (SOX4, SOX9), osteopontin (OPN), Hepatocyte Nuclear Factor-1 beta (HNF1β), Yes-associated protein (YAP), Epithelial cell adhesion molecule (EPCAM), Mucin 1 (MUC1) and N-cadherin (NCAD) by qRT-PCR and immunostaining, and of miR-31, miR-135b, miR-132, miR-200c, miR-221 and miR-222. Unexpectedly, except for subcellular location of SOX9 and OPN, no correlation was found between the expression levels of these molecular markers and histopathological differentiation grade. Therefore, our data point toward necessary caution when investigating the evolution and prognosis of ICC on the basis of cell differentiation criteria. PMID:27280413

  12. Quantitative high-throughput gene expression profiling of human striatal development to screen stem cell–derived medium spiny neurons

    PubMed Central

    Straccia, Marco; Garcia-Diaz Barriga, Gerardo; Sanders, Phil; Bombau, Georgina; Carrere, Jordi; Mairal, Pedro Belio; Vinh, Ngoc-Nga; Yung, Sun; Kelly, Claire M; Svendsen, Clive N; Kemp, Paul J; Arjomand, Jamshid; Schoenfeld, Ryan C; Alberch, Jordi; Allen, Nicholas D; Rosser, Anne E; Canals, Josep M


    A systematic characterization of the spatio-temporal gene expression during human neurodevelopment is essential to understand brain function in both physiological and pathological conditions. In recent years, stem cell technology has provided an in vitro tool to recapitulate human development, permitting also the generation of human models for many diseases. The correct differentiation of human pluripotent stem cell (hPSC) into specific cell types should be evaluated by comparison with specific cells/tissue profiles from the equivalent adult in vivo organ. Here, we define by a quantitative high-throughput gene expression analysis the subset of specific genes of the whole ganglionic eminence (WGE) and adult human striatum. Our results demonstrate that not only the number of specific genes is crucial but also their relative expression levels between brain areas. We next used these gene profiles to characterize the differentiation of hPSCs. Our findings demonstrate a temporal progression of gene expression during striatal differentiation of hPSCs from a WGE toward an adult striatum identity. Present results establish a gene expression profile to qualitatively and quantitatively evaluate the telencephalic hPSC-derived progenitors eventually used for transplantation and mature striatal neurons for disease modeling and drug-screening. PMID:26417608

  13. Expression Differentiation Is Constrained to Low-Expression Proteins over Ecological Timescales.


    Margres, Mark J; Wray, Kenneth P; Seavy, Margaret; McGivern, James J; Herrera, Nathanael D; Rokyta, Darin R


    Protein expression level is one of the strongest predictors of protein sequence evolutionary rate, with high-expression protein sequences evolving at slower rates than low-expression protein sequences largely because of constraints on protein folding and function. Expression evolutionary rates also have been shown to be negatively correlated with expression level across human and mouse orthologs over relatively long divergence times (i.e., ∼100 million years). Long-term evolutionary patterns, however, often cannot be extrapolated to microevolutionary processes (and vice versa), and whether this relationship holds for traits evolving under directional selection within a single species over ecological timescales (i.e., <5000 years) is unknown and not necessarily expected. Expression is a metabolically costly process, and the expression level of a particular protein is predicted to be a tradeoff between the benefit of its function and the costs of its expression. Selection should drive the expression level of all proteins close to values that maximize fitness, particularly for high-expression proteins because of the increased energetic cost of production. Therefore, stabilizing selection may reduce the amount of standing expression variation for high-expression proteins, and in combination with physiological constraints that may place an upper bound on the range of beneficial expression variation, these constraints could severely limit the availability of beneficial expression variants. To determine whether rapid-expression evolution was restricted to low-expression proteins owing to these constraints on highly expressed proteins over ecological timescales, we compared venom protein expression levels across mainland and island populations for three species of pit vipers. We detected significant differentiation in protein expression levels in two of the three species and found that rapid-expression differentiation was restricted to low-expression proteins. Our

  14. Qualitative and quantitative analysis with a novel shear wave speed imaging for differential diagnosis of breast lesions

    PubMed Central

    Yang, Yu-Ping; Xu, Xiao-Hong; Guo, Le-Hang; He, Ya-Ping; Wang, Dan; Liu, Bo-Ji; Zhao, Chong-Ke; Chen, Bao-Ding; Xu, Hui-Xiong


    To evaluate the diagnostic performance of a new two-dimensional shear wave speed (SWS) imaging (i.e. Toshiba shear wave elastography, T-SWE) in differential diagnosis of breast lesions. 225 pathologically confirmed breast lesions in 218 patients were subject to conventional ultrasound and T-SWE examinations. The mean, standard deviation and ratio of SWS values (m/s) and elastic modulus (KPa) on T-SWE were computed. Besides, the 2D elastic images were classified into four color patterns. The area under the receiver operating characteristic (AUROC) curve analysis was performed to evaluate the diagnostic performance of T-SWE in differentiation of breast lesions. Compared with other quantitative T-SWE parameters, mean value expressed in KPa had the highest AUROC value (AUROC = 0.943), with corresponding cut-off value of 36.1 KPa, sensitivity of 85.1%, specificity of 96.6%, accuracy of 94.2%, PPV of 87.0%, and NPV of 96.1%. The AUROC of qualitative color patterns in this study obtained the best performance (AUROC = 0.957), while the differences were not significant except for that of Eratio expressed in m/s (AUROC = 0.863) (P = 0.03). In summary, qualitative color patterns of T-SWE obtained the best performance in all parameters, while mean stiffness (36.05 KPa) provided the best diagnostic performance in the quantitative parameters. PMID:28102328

  15. Differential Expression of CXCL12 and CXCR4 During Human Fetal Neural Progenitor Cell Differentiation

    PubMed Central

    Peng, Hui; Kolb, Ryan; Kennedy, J. E.


    Stromal cell-derived factor 1 alpha (SDF-1α, CXCL12) and its receptor CXCR4 play an important role in the central nervous system (CNS) development and adulthood by mediating cell migration, enhancing precursor cell proliferation, assisting in neuronal circuit formation, and possibly regulating migration during repair. The expression pattern of CXCR4 and CXCL12 during neurogenesis has not been thoroughly elucidated. In this study, we investigated the expression of CXCL12 and CXCR4 during neural progenitor cells (NPC) differentiation by microarray analysis and reverse transcriptase-polymerase chain reaction (RT-PCR) using human fetal NPC as a model system. The production of CXCL12 was measured by enzyme-linked immunosorbent assay (ELISA). CXCR4 expression was determined by florescence-activated cell sorting (FACS) analysis, immunocytochemical staining, and CXCR4-mediated inhibition of cyclic AMP (cAMP) accumulation. Our data demonstrated that CXCR4 expression is significantly upregulated when NPC are differentiated into neuronal precursors, whereas CXCL12 is upregulated when differentiated into astrocytes. We also provide evidence that CXCR4 localization changes as neurons mature. In neuronal precursors, CXCR4 is localized in both neuronal processes and the cell body, whereas in mature neurons, it is primarily expressed on axons and dendrites. This differential expression of CXCR4 and CXCL12 may be important for the temporal regulation of neuronal migration and circuit formation during development and possibly in adult neurogenesis and repair. PMID:18040858

  16. Differential Expression Profile of MicroRNAs during Differentiation of Cardiomyocytes Exposed to Polychlorinated Biphenyls

    PubMed Central

    Zhu, Chun; Yu, Zhang-Bin; Zhu, Jin-Gai; Hu, Xiao-Shan; Chen, Yu-Lin; Qiu, Yu-Fang; Xu, Zheng-Feng; Qian, Lin-Mei; Han, Shu-Ping


    Exposure to persistent environmental pollutants, such as polychlorinated biphenyls (PCBs), is a risk factor for the development of congenital heart defects. MicroRNAs (miRNAs) have been shown to be involved in cardiac development. The objective of this study was to investigate changes in miRNA expression profiles during the differentiation of cardiomyocytes exposed to PCBs. For that purpose, PCBs (Aroclor 1254) at a concentration of 2.5 μmol/L were added on day 0 of differentiation of P19 mouse embryonal carcinoma cells into cardiac myocytes. The relative expression of miRNA genes was determined by miRNA microarray and real-time reverse transcriptase polymerase chain reaction (real-time RT-PCR) analyses. The microarray results revealed that 45 miRNAs, of which 14 were upregulated and 31 were downregulated, were differentially expressed in P19 cells treated with PCBs compared with control cells. The miRNA expression data was validated with real-time RT-PCR. The expression of certain potential target genes (Wnt1) was found to be reduced in P19 cells treated with PCBs, whereas the expression of other potential predicted target genes (GSK3β) was increased. Our results demonstrate a critical role of miRNAs in mediating the effect of PCBs during the differentiation of P19 cells into cardiac myocytes. PMID:23443104

  17. Differential expression of androgen, estrogen, and progesterone receptors in benign prostatic hyperplasia

    PubMed Central

    Song, Lingmin; Shen, Wenhao; Zhang, Heng; Wang, Qiwu; Wang, Yongquan; Zhou, Zhansong


    This study aimed to identify the differential expression levels of androgen receptor (AR), estrogen receptors (ERα, ERβ), and progesterone receptor (PGR) between normal prostate and benign prostatic hyperplasia (BPH). The combination of immunohistochemistry, quantitative real-time reverse transcription polymerase chain reaction, and Western blotting assay was used to identify the distribution and differential expression of these receptors at the immunoactive biomarker, transcriptional, and protein levels between 5 normal human prostate tissues and 40 BPH tissues. The results were then validated in a rat model of BPH induced by testosterone propionate and estradiol benzoate. In both human and rat prostate tissues, AR was localized mainly to epithelial and stromal cell nuclei; ERα was distributed mainly to stromal cells, but not exclusively; ERβ was interspersed in the basal layer of epithelium, but sporadically in epithelial and stromal cells; PGR was expressed abundantly in cytoplasm of epithelial and stromal cells. There were decreased expression of ERα and increased expression of PGR, but no difference in the expression of ERβ in the BPH compared to the normal prostate of both human and rat. Increased expression of AR in the BPH compared to the normal prostate of human was observed, however, the expression of AR in the rat prostate tissue was decreased. This study identified the activation of AR and PGR and repression of ERα in BPH, which indicate a promoting role of AR and PGR and an inhibitory role of ERα in the pathogenesis of BPH. PMID:27294569

  18. Differential gene expression profiling and biological process analysis in proximal nerve segments after sciatic nerve transection.


    Li, Shiying; Liu, Qianqian; Wang, Yongjun; Gu, Yun; Liu, Dong; Wang, Chunming; Ding, Guohui; Chen, Jianping; Liu, Jie; Gu, Xiaosong


    After traumatic injury, peripheral nerves can spontaneously regenerate through highly sophisticated and dynamic processes that are regulated by multiple cellular elements and molecular factors. Despite evidence of morphological changes and of expression changes of a few regulatory genes, global knowledge of gene expression changes and related biological processes during peripheral nerve injury and regeneration is still lacking. Here we aimed to profile global mRNA expression changes in proximal nerve segments of adult rats after sciatic nerve transection. According to DNA microarray analysis, the huge number of genes was differentially expressed at different time points (0.5 h-14 d) post nerve transection, exhibiting multiple distinct temporal expression patterns. The expression changes of several genes were further validated by quantitative real-time RT-PCR analysis. The gene ontology enrichment analysis was performed to decipher the biological processes involving the differentially expressed genes. Collectively, our results highlighted the dynamic change of the important biological processes and the time-dependent expression of key regulatory genes after peripheral nerve injury. Interestingly, we, for the first time, reported the presence of olfactory receptors in sciatic nerves. Hopefully, this study may provide a useful platform for deeply studying peripheral nerve injury and regeneration from a molecular-level perspective.

  19. Differentially-Expressed Pseudogenes in HIV-1 Infection

    PubMed Central

    Gupta, Aditi; Brown, C. Titus; Zheng, Yong-Hui; Adami, Christoph


    Not all pseudogenes are transcriptionally silent as previously thought. Pseudogene transcripts, although not translated, contribute to the non-coding RNA pool of the cell that regulates the expression of other genes. Pseudogene transcripts can also directly compete with the parent gene transcripts for mRNA stability and other cell factors, modulating their expression levels. Tissue-specific and cancer-specific differential expression of these “functional” pseudogenes has been reported. To ascertain potential pseudogene:gene interactions in HIV-1 infection, we analyzed transcriptomes from infected and uninfected T-cells and found that 21 pseudogenes are differentially expressed in HIV-1 infection. This is interesting because parent genes of one-third of these differentially-expressed pseudogenes are implicated in HIV-1 life cycle, and parent genes of half of these pseudogenes are involved in different viral infections. Our bioinformatics analysis identifies candidate pseudogene:gene interactions that may be of significance in HIV-1 infection. Experimental validation of these interactions would establish that retroviruses exploit this newly-discovered layer of host gene expression regulation for their own benefit. PMID:26426037

  20. From 'differential expression' to 'differential networking' - identification of dysfunctional regulatory networks in diseases.


    de la Fuente, Alberto


    Understanding diseases requires identifying the differences between healthy and affected tissues. Gene expression data have revolutionized the study of diseases by making it possible to simultaneously consider thousands of genes. The identification of disease-associated genes requires studying the genes in the context of the regulatory systems they are involved in. A major goal is to identify specific regulatory networks that are dysfunctional in a given disease state. Although we still have not reached a stage where the elucidation of differential regulatory networks is commonly feasible, recent advances have described the first steps towards this goal - the identification of differential coexpression networks. This review describes the shift from differential gene expression to differential networking and outlines how this shift will affect the study of the genetic basis of disease.

  1. Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia.


    Li, Chun Ge; Wang, Hui; Chen, Hong Ju; Zhao, Yan; Fu, Pei Sheng; Ji, Xiang Shan


    Nowadays, high temperature effects on the molecular pathways during sex differentiation in teleosts need to be deciphered. In this study, a systematic differential expression analysis of genes involved in high temperature-induced sex differentiation was done in the Nile tilapia gonad and brain. Our results showed that high temperature caused significant down-regulation of CYP19A1A in the gonad of both sexes in induction group, and FOXL2 in the ovary of the induction group. The expressions of GTHα, LHβ and ERα were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. On the contrary, the expression of CYP11B2 was significantly up-regulated in the ovary, but not in the testis in both groups. Spearman rank correlation analysis showed that there are significant correlations between the expressions of CYP19A1A, FOXL2, or DMRT1 in the gonads and the expression of some genes in the brain. Another result in this study showed that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, and DNMT1 and DNMT3A in the female brain of both groups. The expression and correlation analysis of HSPs showed that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes in the gonads. These findings provide new insights on TSD and suggest that sex differentiation related genes, heat shock proteins, and DNA methylation genes are new candidates for studying TSD in fish species.

  2. Differential expression of Notch family members in astrocytomas and medulloblastomas.


    Xu, Peng; Yu, Shizhu; Jiang, Rongcai; Kang, Chunsheng; Wang, Guangxiu; Jiang, Hao; Pu, Peiyu


    Notch signaling pathway plays an integral role in determining cell fates in development. Growing evidence demonstrates that Notch signaling pathway has versatile effects in tumorigenesis depending on the tumor type, grade and stage. Notch signaling pathway is deregulated in some brain tumors. To examine the differential expression of Notch family members (Notch1, 2, 3, 4) in human astrocytomas and medulloblastomas, and to evaluate their roles in the development of both tumor types. Immunohistochemical staining and Western blot analysis were used to detect Notch1, 2, 3, 4 expression in tissue microarray and freshly resected tissue samples of normal brain, astrocytomas and medulloblastomas. Notch family members were not expressed or barely detectable in normal brain tissues. Notch1, 3, 4 were highly expressed but Notch2 was not expressed in astrocytomas. The percentage of immunopositive tumor cells and level of Notch1 expression was increased with tumor grade. In addition, overexpression of Notch2 was detected in medulloblastomas in contrast to low or no expression of Notch1, 3, 4. Differential expression of Notch1, 2, 3, 4 is detected in astrocytomas and medulloblastomas, that may be related to their different roles playing in the development of brain tumors.

  3. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.


    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang


    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  4. Isolation of differentially expressed cDNAs during ferret tracheal development: application of differential display PCR.


    Sehgal, A; Presente, A; Dudus, L; Engelhardt, J F


    The technique of differential display polymerase chain reaction (DD-PCR) was used to identify cDNA sequences, which are temporally expressed during ferret tracheal airway development. Such differentially expressed cDNAs may ultimately prove to be useful markers in elucidating mechanisms of epithelial differentiation and submucosal gland development in the airway. Using two sets of oligonucleotide primers 15 differentially amplified cDNAs were isolated by comparative reverse transcriptase (RT) PCR of 6-h and 3-day postnatal tracheal poly-A mRNA. In situ hybridization was used to assess the reliability of this method and confirm the differential mRNA expression patterns of cloned cDNAs. Results of in situ hybridization analysis demonstrated that 10 of the 15 cDNA sequences gave a temporally regulated pattern of expression, which was concordant with that of the differential display. Furthermore, sequence analysis of the 15 isolated cDNAs revealed that the majority of clones were amplified from two inverted decamer primers. These findings demonstrate the lack of poly-T priming in the differential display reaction, which suggests that this method may yield substantially more information regarding the coding sequence of cloned genes. In support of this observation, 6 of the 15 cDNA sequences contained one complete open reading frame. Although the majority of cDNAs demonstrated no homology to sequence data bases at the DNA or amino acid level, clone FT-4, which demonstrated a differential expression pattern limited to 3-day tracheal time points, was composed of a 10-amino acid repeat domain that was structurally similar to neuropeptide anthoRFamide and barley D hordein seed protein. A second interesting clone, FT-3, demonstrated an infrequent pattern of expression within a subset of epithelial cells limited to early developmental time points (6 h) and was dramatically reduced by 3 days postnatally. Several additional clones with no homologies to previously cloned genes

  5. Anatrophic nephrolithotomy: preservation of renal function demonstrated by differential quantitative radionuclide renal scans.


    Belis, J A; Morabito, R A; Kandzari, S J; Lai, J C; Gabriele, O F


    Differential quantitative radionuclide renal scans have been used to confirm that early removal of staghorn calculi by anatrophic nephrolithotomy preserves renal parenchyma without significant renal damage by the surgical procedure. The 99mtechnetium diethylenetriaminepentaacetic acid scan was useful in predicting recovery of function in the involved kidney, while the 131iodine orthoiodohippurate scan provided a quantitative evaluation of the effect of the surgical procedure on individual kidney function. All of 13 consecutive patients evaluated by 131iodine orthoiodohippurate renal scans had stable or improved effective renal plasma flow to the involved kidney and an unchanged or improved total excretory index 6 months after nephrolithotomy.

  6. Anatrophic nephrolithotomy: preservation of renal function demonstrated by differential quantitative radionuclide renal scans

    SciTech Connect

    Belis, J.A.; Morabito, R.A.; Kandzari, S.J.; Lai, J.C.; Gabriele, O.F.


    Differential quantitative radionuclide renal scans have been used to confirm that early removal of staghorn calculi by anatrophic nephrolithotomy preserves renal parenchyma without significant renal damage by the surgical procedure. The /sup 99m/technetium diethylenetriaminepentaacetic acid scan was useful in predicting recovery of function in the involved kidney, while the /sup 131/iodine orthoiodohippurate scan provided a quantitative evaluation of the effect of the surgical procedure on individual kidney function. All of 13 consecutive patients evaluated by /sup 131/iodine orthoiodohippurate renal scans had stable or improved effective renal plasma flow to the involved kidney and an unchanged or improved total excretory index 6 months after nephrolithotomy.

  7. Differential gene expression patterns between smokers and non-smokers: cause or consequence?


    Vink, Jacqueline M; Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H; Penninx, Brenda W; Boomsma, Dorret I


    The molecular mechanisms causing smoking-induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome-wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex-smokers were available from two population-based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty-two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10(-6) , Bonferroni correction). The most significant genes were G protein-coupled receptor 15 (P < 1 × 10(-150) ) and leucine-rich repeat neuronal 3 (P < 1 × 10(-44) ). The smoking-related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex-smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis-expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome-wide association meta-analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene expression.

  8. Differential gene expression patterns between smokers and non‐smokers: cause or consequence?

    PubMed Central

    Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H.; Penninx, Brenda W.; Boomsma, Dorret I.


    Abstract The molecular mechanisms causing smoking‐induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome‐wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex‐smokers were available from two population‐based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty‐two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10−6, Bonferroni correction). The most significant genes were G protein‐coupled receptor 15 (P < 1 × 10−150) and leucine‐rich repeat neuronal 3 (P < 1 × 10−44). The smoking‐related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex‐smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis‐expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome‐wide association meta‐analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene

  9. Quantitative expression analysis and prognostic significance of L-DOPA decarboxylase in colorectal adenocarcinoma

    PubMed Central

    Kontos, C K; Papadopoulos, I N; Fragoulis, E G; Scorilas, A


    Background: L-DOPA decarboxylase (DDC) is an enzyme that catalyses, mainly, the decarboxylation of L-DOPA to dopamine and was found to be involved in many malignancies. The aim of this study was to investigate the mRNA expression levels of the DDC gene and to evaluate its clinical utility in tissues with colorectal adenocarcinoma. Methods: Total RNA was isolated from colorectal adenocarcinoma tissues of 95 patients. After having tested RNA quality, we prepared cDNA by reverse transcription. Highly sensitive quantitative real-time PCR method for DDC mRNA quantification was developed using the SYBR Green chemistry. GAPDH served as a housekeeping gene. Relative quantification analysis was performed using the comparative CT method (2−ΔΔCT). Results: DDC mRNA expression varied remarkably among colorectal tumours examined in this study. High DDC mRNA expression levels were found in well-differentiated and Dukes' stage A and B tumours. Kaplan–Meier survival curves showed that patients with DDC-positive tumours have significantly longer disease-free survival (P=0.009) and overall survival (P=0.027). In Cox regression analysis of the entire cohort of patients, negative DDC proved to be a significant predictor of reduced disease-free (P=0.021) and overall survival (P=0.047). Conclusions: The results of the study suggest that DDC mRNA expression may be regarded as a novel potential tissue biomarker in colorectal adenocarcinoma. PMID:20424616

  10. Prion protein expression regulates embryonic stem cell pluripotency and differentiation.


    Miranda, Alberto; Pericuesta, Eva; Ramírez, Miguel Ángel; Gutierrez-Adan, Alfonso


    Cellular prion protein (PRNP) is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs). Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB) differentiation in mouse Prnp-null (KO) and WT embryonic stem cell (ESC) lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC) markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5) in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel) and SPRN (Shadoo), whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis.

  11. Differential expression of the fractalkine chemokine receptor (CX3CR1) in human monocytes during differentiation

    PubMed Central

    Panek, Cecilia Analia; Ramos, Maria Victoria; Mejias, Maria Pilar; Abrey-Recalde, Maria Jimena; Fernandez-Brando, Romina Jimena; Gori, Maria Soledad; Salamone, Gabriela Verónica; Palermo, Marina Sandra


    Circulating monocytes (Mos) may continuously repopulate macrophage (MAC) or dendritic cell (DC) populations to maintain homeostasis. MACs and DCs are specialized cells that play different and complementary immunological functions. Accordingly, they present distinct migratory properties. Specifically, whereas MACs largely remain in tissues, DCs are capable of migrating from peripheral tissues to lymphoid organs. The aim of this work was to analyze the expression of the fractalkine receptor (CX3CR1) during the monocytic differentiation process. Freshly isolated Mos express high levels of both CX3CR1 mRNA and protein. During the Mo differentiation process, CX3CR1 is downregulated in both DCs and MACs. However, MACs showed significantly higher CX3CR1 expression levels than did DC. We also observed an antagonistic CX3CR1 regulation by interferon (IFN)-γ and interleukin (IL)-4 during MAC activation through the classical and alternative MAC pathways, respectively. IFN-γ inhibited the loss of CX3CR1, but IL-4 induced it. Additionally, we demonstrated an association between CX3CR1 expression and apoptosis prevention by soluble fractalkine (sCX3CL1) in Mos, DCs and MACs. This is the first report demonstrating sequential and differential CX3CR1 modulation during Mo differentiation. Most importantly, we demonstrated a functional link between CX3CR1 expression and cell survival in the presence of sCX3CL1. PMID:25502213

  12. Differential expression of the fractalkine chemokine receptor (CX3CR1) in human monocytes during differentiation.


    Panek, Cecilia Analia; Ramos, Maria Victoria; Mejias, Maria Pilar; Abrey-Recalde, Maria Jimena; Fernandez-Brando, Romina Jimena; Gori, Maria Soledad; Salamone, Gabriela Verónica; Palermo, Marina Sandra


    Circulating monocytes (Mos) may continuously repopulate macrophage (MAC) or dendritic cell (DC) populations to maintain homeostasis. MACs and DCs are specialized cells that play different and complementary immunological functions. Accordingly, they present distinct migratory properties. Specifically, whereas MACs largely remain in tissues, DCs are capable of migrating from peripheral tissues to lymphoid organs. The aim of this work was to analyze the expression of the fractalkine receptor (CX3CR1) during the monocytic differentiation process. Freshly isolated Mos express high levels of both CX3CR1 mRNA and protein. During the Mo differentiation process, CX3CR1 is downregulated in both DCs and MACs. However, MACs showed significantly higher CX3CR1 expression levels than did DC. We also observed an antagonistic CX3CR1 regulation by interferon (IFN)-γ and interleukin (IL)-4 during MAC activation through the classical and alternative MAC pathways, respectively. IFN-γ inhibited the loss of CX3CR1, but IL-4 induced it. Additionally, we demonstrated an association between CX3CR1 expression and apoptosis prevention by soluble fractalkine (sCX3CL1) in Mos, DCs and MACs. This is the first report demonstrating sequential and differential CX3CR1 modulation during Mo differentiation. Most importantly, we demonstrated a functional link between CX3CR1 expression and cell survival in the presence of sCX3CL1.

  13. Digital Gene Expression Profiling to Explore Differentially Expressed Genes Associated with Terpenoid Biosynthesis during Fruit Development in Litsea cubeba.


    Gao, Ming; Lin, Liyuan; Chen, Yicun; Wang, Yangdong


    Mountain pepper (Litseacubeba (Lour.) Pers.) (Lauraceae) is an important industrial crop as an ingredient in cosmetics, pesticides, food additives and potential biofuels. These properties are attributed to monoterpenes and sesquiterpenes. However, there is still no integrated model describing differentially expressed genes (DEGs) involved in terpenoid biosynthesis during the fruit development of L. cubeba. Here, we performed digital gene expression (DGE) using the Illumina NGS platform to evaluated changes in gene expression during fruit development in L. cubeba. DGE generated expression data for approximately 19354 genes. Fruit at 60 days after flowering (DAF) served as the control, and a total of 415, 1255, 449 and 811 up-regulated genes and 505, 1351, 1823 and 1850 down-regulated genes were identified at 75, 90, 105 and 135 DAF, respectively. Pathway analysis revealed 26 genes involved in terpenoid biosynthesis pathways. Three DEGs had continued increasing or declining trends during the fruit development. The quantitative real-time PCR (qRT-PCR) results of five differentially expressed genes were consistent with those obtained from Illumina sequencing. These results provide a comprehensive molecular biology background for research on fruit development, and information that should aid in metabolic engineering to increase the yields of L. cubeba essential oil.

  14. WEBSAGE: a web tool for visual analysis of differentially expressed human SAGE tags.


    Pylouster, Jean; Sénamaud-Beaufort, Catherine; Saison-Behmoaras, Tula Ester


    The serial analysis of gene expression (SAGE) is a powerful method to compare gene expression of mRNA populations. To provide quantitative expression levels on a genome-wide scale, the Cancer Genome Anatomy Project (CGAP) uses SAGE. Over 7 million SAGE tags, from 171 human cell types have been assembled. The growing number of laboratories involved in SAGE research necessitates the use of software that provides statistical analysis of raw data, allowing the rapid visualization and interpretation of results. We have created the first simple tool that performs statistical analysis on SAGE data, identifies the tags differentially expressed and shows the results in a scatter plot. It is freely available and accessible at

  15. Identification of differentially expressed microRNAs involved in non-traumatic osteonecrosis through microRNA expression profiling.


    Wu, Xingjing; Zhang, Yongtao; Guo, Xiong; Xu, Hongguang; Xu, Zhujun; Duan, Dapeng; Wang, Kunzheng


    Accumulating evidence has recently indicated a vital role of microRNAs (miRNAs) in the development of various bone diseases. However, the biological role of miRNAs in the pathogenesis of non-traumatic osteonecrosis of femoral head (ONFH) has not yet been investigated. The present study aimed to profile the differential miRNA expression between non-traumatic ONFH and femoral neck fracture and to develop further understanding of the molecular mechanisms involved in the pathogenesis of non-traumatic ONFH. Femoral heads from 4 patients with non-traumatic ONFH and 4 with femoral neck fracture were used to analyze the miRNA expression profiles in bone tissue using the Exiqon miRCURY™ LNA Array (v.18.0). The results of miRNA microarray analysis were further confirmed by real-time quantitative polymerase chain reaction (qPCR). The differentially expressed miRNA target genes and signaling pathways involved were predicted by bioinformatics analysis. MiRNA microarray chip analysis revealed that 22 miRNAs were significantly up-regulated and 17 were significantly down-regulated in the non-traumatic ONFH samples compared with the femoral neck fracture samples. The real-time qPCR also confirmed the microarray data. Bioinformatics analysis demonstrated that toll-like receptor (TLR), neurotrophin and NOD-like receptor signaling pathway were most likely to be regulated by these differential miRNAs. This miRNA microarray study reveals significant differences in miRNA expression between patients with non-traumatic ONFH and those with femoral neck fracture. Our data also manifests that the signaling pathways regulated by these differentially expressed miRNAs might be important in the pathogenesis of non-traumatic ONFH.

  16. Proteomic analysis of differentially expressed proteins in the two developmental stages of Ichthyophthirius multifiliis.


    Yao, Jia-Yun; Xu, Yang; Yuan, Xue-Mei; Yin, Wen-Lin; Yang, Gui-Lian; Lin, Ling-Yun; Pan, Xiao-Yi; Wang, Chun-Feng; Shen, Jin-Yu


    Ichthyophthirius is a severe disease of farmed freshwater fish caused by the parasitic ciliate Ichthyophthirius multifiliis (Ich). This disease can lead to considerable economic loss, but the protein profiles in different developmental stages of the parasite remain unknown. In the present study, proteins from trophonts and theronts of Ich were identified by isobaric tags for relative and absolute quantitation (iTRAQ). A total of 2300 proteins were identified in the two developmental stages, of which 1520 proteins were differentially expressed. Among them, 84 proteins were uniquely expressed in the theronts stage, while 656 proteins were expressed only in trophonts. The differentially expressed proteins were catalogued (assorted) to various functions of Ich life cycle, including biological process, cellular component, and molecular function that occur at distinct stages. Using a 1.5-fold change in expression as a physiologically significant benchmark, a lot of differentially expressed proteins were reliably quantified by iTRAQ analysis. Two hundred forty upregulated and 57 downregulated proteins in the trophonts stage were identified as compared with theronts. The identified proteins were involved in various functions of the I. multifiliis life cycle, including binding, catalytic activity, structural molecule activity, and transporter activity. Further investigation of the transcriptional levels of periplasmic immunogenic protein, transketolase, zinc finger, isocitrate dehydrogenase, etc., from the different protein profiles using quantitative RT-PCR showed identical results to the iTRAQ analysis. This work provides an effective resource to further our understanding of Ich biology, and lays the groundwork for the identification of potential drug targets and vaccines candidates for the control of this devastating fish pathogen.

  17. A quantitative dynamical systems approach to differential learning: self-organization principle and order parameter equations.


    Frank, T D; Michelbrink, M; Beckmann, H; Schöllhorn, W I


    Differential learning is a learning concept that assists subjects to find individual optimal performance patterns for given complex motor skills. To this end, training is provided in terms of noisy training sessions that feature a large variety of between-exercises differences. In several previous experimental studies it has been shown that performance improvement due to differential learning is higher than due to traditional learning and performance improvement due to differential learning occurs even during post-training periods. In this study we develop a quantitative dynamical systems approach to differential learning. Accordingly, differential learning is regarded as a self-organized process that results in the emergence of subject- and context-dependent attractors. These attractors emerge due to noise-induced bifurcations involving order parameters in terms of learning rates. In contrast, traditional learning is regarded as an externally driven process that results in the emergence of environmentally specified attractors. Performance improvement during post-training periods is explained as an hysteresis effect. An order parameter equation for differential learning involving a fourth-order polynomial potential is discussed explicitly. New predictions concerning the relationship between traditional and differential learning are derived.

  18. Expression Quantitative Trait Loci Analysis Identifies Associations Between Genotype and Gene Expression in Human Intestine

    PubMed Central



    BACKGROUND & AIMS Genome-wide association studies have greatly increased our understanding of intestinal disease. However, little is known about how genetic variations result in phenotypic changes. Some polymorphisms have been shown to modulate quantifiable phenotypic traits; these are called quantitative trait loci. Quantitative trait loci that affect levels of gene expression are called expression quantitative trait loci (eQTL), which can provide insight into the biological relevance of data from genome-wide association studies. We performed a comprehensive eQTL scan of intestinal tissue. METHODS Total RNA was extracted from ileal biopsy specimens and genomic DNA was obtained from whole-blood samples from the same cohort of individuals. Cis- and trans-eQTL analyses were performed using a custom software pipeline for samples from 173 subjects. The analyses determined the expression levels of 19,047 unique autosomal genes listed in the US National Center for Biotechnology Information database and more than 580,000 variants from the Single Nucleotide Polymorphism database. RESULTS The presence of more than 15,000 cis- and trans-eQTL was detected with statistical significance. eQTL associated with the same expression trait were in high linkage disequilibrium. Comparative analysis with previous eQTL studies showed that 30% to 40% of genes identified as eQTL in monocytes, liver tissue, lymphoblastoid cell lines, T cells, and fibroblasts are also eQTL in ileal tissue. Conversely, most of the significant eQTL have not been previously identified and could be tissue specific. These are involved in many cell functions, including division and antigen processing and presentation. Our analysis confirmed that previously published cis-eQTL are single nucleotide polymorphisms associated with inflammatory bowel disease: rs2298428/UBE2L3, rs1050152/SLC22A4, and SLC22A5. We identified many new associations between inflammatory bowel disease susceptibility loci and gene expression

  19. 5' and 3' untranslated regions contribute to the differential expression of specific HLA-A alleles.


    René, Céline; Lozano, Claire; Villalba, Martin; Eliaou, Jean-François


    In hematopoietic stem cell transplantation (HSCT), when no HLA full-matched donor is available, alternative donors could include one HLA-mismatched donor. Recently, the low expressed HLA-C alleles have been identified as permissive mismatches for the best donor choice. Concerning HLA-A, the degree of variability of expression is poorly understood. Here, we evaluated HLA-A expression in healthy individuals carrying HLA-A*02 allele in different genotypes using flow cytometry and allele-specific quantitative RT-PCR. While an interindividual variability of HLA-A*02 cell surface expression, not due to the allele associated, was observed, no difference of the mRNA expression level was shown, suggesting the involvement of the posttranscriptional regulation. The results of qRT-PCR analyses exhibit a differential expression of HLA-A alleles with HLA-A*02 as the strongest expressed allele independently of the second allele. The associated non-HLA-A*02 alleles were differentially expressed, particularly the HLA-A*31 and HLA-A*33 alleles (strong expression) and the HLA-A*29 (low expression). The presence of specific polymorphisms in the 5' and 3' untranslated regions of the HLA-A*31 and HLA-A*33 alleles could contribute to this high level of expression. As previously described for HLA-C, low-expressed HLA-A alleles, such as HLA-A*29, could be considered as a permissive mismatch, although this needs to be confirmed by clinical studies.

  20. Differential expression of ferritin genes in response to abiotic stresses and hormones in pear (Pyrus pyrifolia).


    Xi, Li; Xu, Kuanyong; Qiao, Yushan; Qu, Shenchun; Zhang, Zhen; Dai, Wenhao


    In this study, the expression patterns of four ferritin genes (PpFer1, PpFer2, PpFer3, and PpFer4) in pear were investigated using quantitative real-time PCR. Analysis of tissue-specific expression revealed higher expression level of these genes in leaves than in other tested tissues. These ferritin genes were differentially expressed in response to various abiotic stresses and hormones treatments. The expression of ferritin wasn't affected by Fe(III)-citrate treatment. Abscisic acid significantly enhanced the expression of all four ferritin genes, especially PpFer2, followed by N-benzylyminopurine, gibberellic acid, and indole-3-acetic acid. The expression peaks of PpFer1 and PpFer3 in leaves appeared at 6, 6, and 12 h, respectively, after pear plant was exposed to oxidative stress (5 mM H(2)O(2)), salt stress (200 mM NaCl), and heat stress (40°C). A significant increase in PpFer4 expression was detected at 6 h after salt stress or heat stress. The expression of ferritin genes was not altered by cold stress. These results suggested that ferritin genes might be functionally important in acclimation of pear to salt and oxidative stresses. Hormone treatments had no significant effect on expression of ferritin genes compared to abiotic stresses. This showed accumulation of ferritin genes could be operated by different transduction pathways under abiotic stresses and hormones treatments.

  1. Single-shot quantitative phase microscopy with color-multiplexed differential phase contrast (cDPC)

    PubMed Central


    We present a new technique for quantitative phase and amplitude microscopy from a single color image with coded illumination. Our system consists of a commercial brightfield microscope with one hardware modification—an inexpensive 3D printed condenser insert. The method, color-multiplexed Differential Phase Contrast (cDPC), is a single-shot variant of Differential Phase Contrast (DPC), which recovers the phase of a sample from images with asymmetric illumination. We employ partially coherent illumination to achieve resolution corresponding to 2× the objective NA. Quantitative phase can then be used to synthesize DIC and phase contrast images or extract shape and density. We demonstrate amplitude and phase recovery at camera-limited frame rates (50 fps) for various in vitro cell samples and c. elegans in a micro-fluidic channel. PMID:28152023

  2. Quantitative Differentiation of Bloodstain Patterns Resulting from Gunshot and Blunt Force Impacts.


    Siu, Sonya; Pender, Jennifer; Springer, Faye; Tulleners, Frederic; Ristenpart, William


    Bloodstain pattern analysis (BPA) provides significant evidentiary value in crime scene interpretation and reconstruction. In this work, we develop a quantitative methodology using digital image analysis techniques to differentiate impact bloodstain patterns. The bloodstain patterns were digitally imaged and analyzed using image analysis algorithms. Our analysis of 72 unique bloodstain patterns, comprising more than 490,000 individual droplet stains, indicates that the mean drop size in a gunshot spatter pattern is at most 30% smaller than the mean drop stain size in blunt instrument patterns. In contrast, we demonstrate that the spatial distribution of the droplet stains-their density as a function of position in the pattern-significantly differs between gunshot and blunt instrument patterns, with densities as much as 400% larger for gunshot impacts. Thus, quantitative metrics involving the spatial distribution of droplet stains within a bloodstain pattern can be useful for objective differentiation between blunt instrument and gunshot bloodstain patterns.

  3. Single-shot quantitative phase microscopy with color-multiplexed differential phase contrast (cDPC).


    Phillips, Zachary F; Chen, Michael; Waller, Laura


    We present a new technique for quantitative phase and amplitude microscopy from a single color image with coded illumination. Our system consists of a commercial brightfield microscope with one hardware modification-an inexpensive 3D printed condenser insert. The method, color-multiplexed Differential Phase Contrast (cDPC), is a single-shot variant of Differential Phase Contrast (DPC), which recovers the phase of a sample from images with asymmetric illumination. We employ partially coherent illumination to achieve resolution corresponding to 2× the objective NA. Quantitative phase can then be used to synthesize DIC and phase contrast images or extract shape and density. We demonstrate amplitude and phase recovery at camera-limited frame rates (50 fps) for various in vitro cell samples and c. elegans in a micro-fluidic channel.

  4. Differential subtraction display: a unified approach for isolation of cDNAs from differentially expressed genes.


    Pardinas, J R; Combates, N J; Prouty, S M; Stenn, K S; Parimoo, S


    We have developed a novel efficient approach, termed differential subtraction display, for the identification of differentially expressed genes. Several critical parameters for the reproducibility and enhanced sensitivity of display, as well as steps to reduce the number of false positive cDNA species, have been defined. These include- (a) use of standardized oligo(dT)-primed cDNA pools rather than total RNA as the starting material for differential display, (b) critical role of optimal cDNA input for each distinct class of primers, (c) phenomena of primer dominance and interference, and (d) design of a novel set of enhanced specificity anchor primers. Introduction of an efficient subtractive hybridization step prior to cloning of cDNA species enriches the bona fide cDNA species that are either exclusively present in one sample (+/-) or show altered expression (up-/down-regulation) in RNA samples from two different tissues or cell types. This approach, in comparison to differential display, has several advantages in terms of reproducibility and enhanced sensitivity of display coupled to the cloning of enriched bona fide cDNA species corresponding to differentially expressed RNAs.

  5. Expression of YY1 in Differentiated Thyroid Cancer.


    Arribas, Jéssica; Castellví, Josep; Marcos, Ricard; Zafón, Carles; Velázquez, Antonia


    The transcription factor Yin Yang 1 (YY1) has an important regulatory role in tumorigenesis, but its implication in thyroid cancer has not been yet investigated. In the present study, we have analyzed the expression of YY1 in differentiated thyroid cancer and assessed the association of YY1 expression with clinical features. Expression of YY1 was evaluated in human thyroid cancer cell lines, a series of matched normal/tumor thyroid tissues and in a thyroid cancer tissue microarray, using real-time PCR, Western blot, and/or immunohistochemistry. YY1 was overexpressed in thyroid cancer cells, at transcription and protein levels. A significant increase of YY1 mRNA was also observed in tumor thyroid tissues. Moreover, immunohistochemical analysis of the thyroid cancer tissue microarray revealed that both papillary thyroid cancer (PTC) and follicular thyroid cancer (FTC) present increased YY1 protein levels (48 and 19%, respectively). After stratification by the level of YY1 protein, positive YY1 expression identifies 88% of patients with PTC. The association of YY1 expression with clinicopathological features in PTC and FTC showed that YY1 expression was related with age at diagnosis. Our data indicates for the first time overexpression of YY1 in differentiated thyroid cancer, with YY1 being more frequently overexpressed in the PTC subtype.

  6. New differentially expressed genes and differential DNA methylation underlying refractory epilepsy

    PubMed Central

    Xu, Tao; Liu, Shiyong; Yuan, Jinxian; Huang, Hao; Qin, Lu; Yang, Hui; Chen, Lifen; Tan, Xinjie; Chen, Yangmei


    Epigenetics underlying refractory epilepsy is poorly understood, especially in patients without distinctive genetic alterations. DNA methylation may affect gene expression in epilepsy without affecting DNA sequences. Herein, we analyzed genome-wide DNA methylation and gene expression in brain tissues of 10 patients with refractory epilepsy using methylated DNA immunoprecipitation linked with sequencing and mRNA Sequencing. Diverse distribution of differentially methylated genes was found in X chromosome, while differentially methylated genes appeared rarely in Y chromosome. 62 differentially expressed genes, such as MMP19, AZGP1, DES, and LGR6 were correlated with refractory epilepsy for the first time. Although general trends of differentially enriched gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways in this study are consistent with previous researches, differences also exist in many specific gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways. These findings provide a new genome-wide profiling of DNA methylation and gene expression in brain tissues of patients with refractory epilepsy, which may provide a basis for further study on the etiology and mechanisms of refractory epilepsy. PMID:27903967

  7. Defining Developmental Potency and Cell Lineage Trajectories by Expression Profiling of Differentiating Mouse Embryonic Stem Cells

    PubMed Central

    Aiba, Kazuhiro; Nedorezov, Timur; Piao, Yulan; Nishiyama, Akira; Matoba, Ryo; Sharova, Lioudmila V.; Sharov, Alexei A.; Yamanaka, Shinya; Niwa, Hitoshi; Ko, Minoru S. H.


    Biologists rely on morphology, function and specific markers to define the differentiation status of cells. Transcript profiling has expanded the repertoire of these markers by providing the snapshot of cellular status that reflects the activity of all genes. However, such data have been used only to assess relative similarities and differences of these cells. Here we show that principal component analysis of global gene expression profiles map cells in multidimensional transcript profile space and the positions of differentiating cells progress in a stepwise manner along trajectories starting from undifferentiated embryonic stem (ES) cells located in the apex. We present three ‘cell lineage trajectories’, which represent the differentiation of ES cells into the first three lineages in mammalian development: primitive endoderm, trophoblast and primitive ectoderm/neural ectoderm. The positions of the cells along these trajectories seem to reflect the developmental potency of cells and can be used as a scale for the potential of cells. Indeed, we show that embryonic germ cells and induced pluripotent cells are mapped near the origin of the trajectories, whereas mouse embryo fibroblast and fibroblast cell lines are mapped near the far end of the trajectories. We suggest that this method can be used as the non-operational semi-quantitative definition of cell differentiation status and developmental potency. Furthermore, the global expression profiles of cell lineages provide a framework for the future study of in vitro and in vivo cell differentiation. PMID:19112179

  8. Expression of early developmental markers predicts the efficiency of embryonic stem cell differentiation into midbrain dopaminergic neurons.


    Salti, Ahmad; Nat, Roxana; Neto, Sonya; Puschban, Zoe; Wenning, Gregor; Dechant, Georg


    Dopaminergic neurons derived from pluripotent stem cells are among the best investigated products of in vitro stem cell differentiation owing to their potential use for neurorestorative therapy of Parkinson's disease. However, the classical differentiation protocols for both mouse and human pluripotent stem cells generate a limited percentage of dopaminergic neurons and yield a considerable cellular heterogeneity comprising numerous scarcely characterized cell populations. To improve pluripotent stem cell differentiation protocols for midbrain dopaminergic neurons, we established extensive and strictly quantitative gene expression profiles, including markers for pluripotent cells, neural progenitors, non-neural cells, pan-neuronal and glial cells, neurotransmitter phenotypes, midbrain and nonmidbrain populations, floor plate and basal plate populations, as well as for Hedgehog, Fgf, and Wnt signaling pathways. The profiles were applied to discrete stages of in vitro differentiation of mouse embryonic stem cells toward the dopaminergic lineage and after transplantation into the striatum of 6-hydroxy-dopamine-lesioned rats. The comparison of gene expression in vitro with stages in the developing ventral midbrain between embryonic day 11.5 and 13.5 ex vivo revealed dynamic changes in the expression of transcription factors and signaling molecules. Based on these profiles, we propose quantitative gene expression milestones that predict the efficiency of dopaminergic differentiation achieved at the end point of the protocol, already at earlier stages of differentiation.

  9. Dynamic changes in the expression of apoptosis-related genes in differentiating gonocytes and in seminomas.


    Manku, Gurpreet; Culty, Martine


    Apoptosis is an integral part of the spermatogenic process, necessary to maintain a proper ratio of Sertoli to germ cell numbers and provide an adequate microenvironment to germ cells. Apoptosis may also represent a protective mechanism mediating the elimination of abnormal germ cells. Extensive apoptosis occurs between the first and second postnatal weeks, at the point when gonocytes, precursors of spermatogonial stem cells, should have migrated toward the basement membrane of the tubules and differentiated into spermatogonia. The mechanisms regulating this process are not well-understood. Gonocytes undergo phases of proliferation, migration, and differentiation which occur in a timely and closely regulated manner. Gonocytes failing to migrate and differentiate properly undergo apoptosis. Inadequate gonocyte differentiation has been suggested to lead to testicular germ cell tumor (TGCT) formation. Here, we examined the expression levels of apoptosis-related genes during gonocyte differentiation by quantitative real-time polymerase chain reaction, identifying 48 pro- and anti-apoptotic genes increased by at least two-fold in rat gonocytes induced to differentiate by retinoic acid, when compared to untreated gonocytes. Further analysis of the most highly expressed genes identified the pro-apoptotic genes Gadd45a and Cycs as upregulated in differentiating gonocytes and in spermatogonia compared with gonocytes. These genes were also significantly downregulated in seminomas, the most common type of TGCT, compared with normal human testicular tissues. These results indicate that apoptosis-related genes are actively regulated during gonocyte differentiation. Moreover, the down-regulation of pro-apoptotic genes in seminomas suggests that they could represent new therapeutic targets in the treatment of TGCTs.

  10. ATF3 represses PPARγ expression and inhibits adipocyte differentiation

    SciTech Connect

    Jang, Min-Kyung; Jung, Myeong Ho


    Highlights: • ATF3 decrease the expression of PPARγ and its target gene in 3T3-L1 adipocytes. • ATF3 represses the promoter activity of PPARγ2 gene. • ATF/CRE (−1537/−1530) is critical for ATF3-mediated downregulation of PPARγ. • ATF3 binds to the promoter region containing the ATF/CRE. • ER stress inhibits adipocyte differentiation through downregulation of PPARγ by ATF3. - Abstract: Activating transcription factor 3 (ATF3) is a stress-adaptive transcription factor that mediates cellular stress response signaling. We previously reported that ATF3 represses CCAAT/enhancer binding protein α (C/EBPα) expression and inhibits 3T3-L1 adipocyte differentiation. In this study, we explored potential role of ATF3 in negatively regulating peroxisome proliferator activated receptor-γ (PPARγ). ATF3 decreased the expression of PPARγ and its target gene in 3T3-L1 adipocytes. ATF3 also repressed the activity of −2.6 Kb promoter of mouse PPARγ2. Overexpression of PPARγ significantly prevented the ATF3-mediated inhibition of 3T3-L1 differentiation. Transfection studies with 5′ deleted-reporters showed that ATF3 repressed the activity of −2037 bp promoter, whereas it did not affect the activity of −1458 bp promoter, suggesting that ATF3 responsive element is located between the −2037 and −1458. An electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that ATF3 binds to ATF/CRE site (5′-TGACGTTT-3′) between −1537 and −1530. Mutation of the ATF/CRE site abrogated ATF3-mediated transrepression of the PPARγ2 promoter. Treatment with thapsigargin, endoplasmic reticulum (ER) stress inducer, increased ATF3 expression, whereas it decreased PPARγ expression. ATF3 knockdown significantly blocked the thapsigargin-mediated downregulation of PPARγ expression. Furthermore, overexpression of PPARγ prevented inhibition of 3T3-L1 differentiation by thapsigargin. Collectively, these results suggest that ATF3-mediated

  11. Flow Cytometry and Transplantation-Based Quantitative Assays for Satellite Cell Self-Renewal and Differentiation.


    Arpke, Robert W; Kyba, Michael


    In response to muscle damage, satellite cells proliferate and undertake both differentiation and self-renewal, generating new functional muscle tissue and repopulating this new muscle with stem cells for future injury responses. For many questions relating to the physiological regulation of satellite cells, quantitative readouts of self-renewal and differentiation can be very useful. There is a particular need for a quantitative assay for satellite cell self-renewal that does not rely solely upon sectioning, staining and counting cells in sections. In this chapter, we provide detailed methods for quantifying the self-renewal and differentiation potential of a given population of satellite cells using an assay involving transplantation into injured, regenerating muscle together with specific markers for donor cell identity and state of differentiation. In particular, using the Pax7-ZsGreen transgene as a marker of satellite cell state, self-renewal can be quantified by FACS on transplanted muscle to actually count the total number of resident satellite cells at time points following transplantation.

  12. A predictive approach to identify genes differentially expressed

    NASA Astrophysics Data System (ADS)

    Saraiva, Erlandson F.; Louzada, Francisco; Milan, Luís A.; Meira, Silvana; Cobre, Juliana


    The main objective of gene expression data analysis is to identify genes that present significant changes in expression levels between a treatment and a control biological condition. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating credibility intervals from predictive densities which are constructed using sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained indicate that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a publicly available data set on Escherichia coli bacteria.

  13. Strontium promotes cementoblasts differentiation through inhibiting sclerostin expression in vitro.


    Bao, Xingfu; Liu, Xianjun; Zhang, Yi; Cui, Yue; Yao, Jindan; Hu, Min


    Cementogenesis, performed by cementoblasts, is important for the repair of root resorption caused by orthodontic treatment. Based on recent studies, strontium has been applied for osteoporosis treatment due to its positive effect on osteoblasts. Although promising, the effect of strontium on cementoblasts is still unclear. So the aim of this research was to clarify and investigate the effect of strontium on cementogenesis via employing cementoblasts as model. A series of experiments including MTT, alkaline phosphatase activity, gene analysis, alizarin red staining, and western blot were carried out to evaluate the proliferation and differentiation of cementoblasts. In addition, expression of sclerostin was checked to analyze the possible mechanism. Our results show that strontium inhibits the proliferation of cementoblasts with a dose dependent manner; however, it can promote the differentiation of cementoblasts via downregulating sclerostin expression. Taking together, strontium may facilitate cementogenesis and benefit the treatment of root resorption at a low dose.

  14. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.


    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  15. Differential expression of oxygen-regulated genes in bovine blastocysts.


    Harvey, A J; Navarrete Santos, A; Kirstein, M; Kind, K L; Fischer, B; Thompson, J G


    Low oxygen conditions (2%) during post-compaction culture of bovine blastocysts improve embryo quality, which is associated with a small yet significant increase in the expression of glucose transporter 1 (GLUT-1), suggesting a role of oxygen in embryo development mediated through oxygen-sensitive gene expression. However, bovine embryos to at least the blastocyst stage lack a key regulator of oxygen-sensitive gene expression, hypoxia-inducible factor 1alpha (HIF1alpha). A second, less well-characterized protein (HIF2alpha) is, however, detectable from the 8-cell stage of development. Here we use differential display to determine additional gene targets in bovine embryos in response to low oxygen conditions. While development to the blastocyst stage was unaffected by the oxygen concentration used during post-compaction culture, differential display identified oxygen-regulation of myotrophin and anaphase promoting complex 1 expression, with significantly lower levels observed following culture under 20% oxygen than 2% oxygen. These results further support the hypothesis that the level of gene expression of specific transcripts by bovine embryos alters in response to changes in the oxygen environment post-compaction. Specifically, we have identified two oxygen-sensitive genes that are potentially regulated by HIF2 in the bovine blastocyst.

  16. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua

    PubMed Central

    Nakamura, Aline Minali; Chahad-Ehlers, Samira; Lima, André Luís A.; Taniguti, Cristiane Hayumi; Sobrinho Jr., Iderval; Torres, Felipe Rafael; de Brito, Reinaldo Alves


    The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. Therefore, the study of chemosensory proteins involved with a range of responses to the chemical environment will help not only on the understanding of the species biology but may also help the development of environmentally friendly pest control strategies. Here we analyzed the expression patterns of three OBP genes, Obp19d_2, Obp56a and Obp99c, across different phases of A. obliqua development by qPCR. In order to do so, we tested eight and identified three reference genes for data normalization, rpl17, rpl18 and ef1a, which displayed stability for the conditions here tested. All OBPs showed differential expression on adults and some differential expression among adult stages. Obp99c had an almost exclusive expression in males and Obp56a showed high expression in virgin females. Thereby, our results provide relevant data not only for other gene expression studies in this species, as well as for the search of candidate genes that may help in the development of new pest control strategies. PMID:26818909

  17. Bcl-2-related protein family gene expression during oligodendroglial differentiation.


    Itoh, Takayuki; Itoh, Aki; Pleasure, David


    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  18. Differential expression of CART in ewes with differing ovulation rates.


    Juengel, Jennifer L; French, Michelle C; Quirke, Laurel D; Kauff, Alexia; Smith, George W; Johnstone, Peter D


    We hypothesised that cocaine- and amphetamine-regulated transcript (CARTPT) would be differentially expressed in ewes with differing ovulation rates. Expression of mRNA for CARTPT, as well as LHCGR, FSHR, CYP19A1 and CYP17A1 was determined in antral follicles ≥1 mm in diameter collected during the follicular phase in ewes heterozygous for the Booroola and Inverdale genes (I+B+; average ovulation rate 4) and ++ contemporaries (++; average ovulation rate 1.8). In ++ ewes (n = 6), CARTPT was expressed in small follicles (1 to <3 mm diameter), where 18.8 ± 2.5% follicles expressed CARTPT CART peptide was also detected in follicular fluid of some follicles of ++ ewes. In I+B+ ewes, 5/6 ewes did not have any follicles that expressed CARTPT, and no CART peptide was detected in any follicle examined. Expression pattern of CYP19A1 differed between I+B+ and ++ ewes with an increased percentage of small and medium follicles (3 to <4.5 mm diameter) but decreased percentage of large follicles (≥4.5 mm diameter) expressing CYP19A1 in the I+B+ ewes. Many of the large follicles from the I+B+ ewes appeared non-functional and expression of LHCGR, FSHR, CYP17A1 and CYP19A1 was less than that observed in ++ ewes. Expression of FSHR and CYP17A1 was not different between groups in small and medium follicles, but LHCGR expression was approximately double in I+B+ ewes compared to that in ++ ewes. Thus, ewes with high ovulation rates had a distinct pattern of expression of CARTPT mRNA and protein compared to ewes with normal ovulation rates, providing evidence for CART being important in the regulation of ovulation rate.

  19. Comparative proteomic analysis of differentially expressed proteins between peripheral sensory and motor nerves.


    He, Qianru; Man, Lili; Ji, Yuhua; Zhang, Shuqiang; Jiang, Maorong; Ding, Fei; Gu, Xiaosong


    Peripheral sensory and motor nerves have different functions and different approaches to regeneration, especially their distinct ability to accurately reinervate terminal nerve pathways. To understand the molecular aspects underlying these differences, the proteomics technique by coupling isobaric tags for relative and absolute quantitation (iTRAQ) with online two-dimensional liquid chromatography tandem mass spectrometry (2D LC-MS/MS) was used to investigate the protein profile of sensory and motor nerve samples from rats. A total of 1472 proteins were identified in either sensory or motor nerve. Of them, 100 proteins showed differential expressions between both nerves, and some of them were validated by quantitative real time RT-PCR, Western blot analysis, and immunohistochemistry. In the light of functional categorization, the differentially expressed proteins in sensory and motor nerves, belonging to a broad range of classes, were related to a diverse array of biological functions, which included cell adhesion, cytoskeleton, neuronal plasticity, neurotrophic activity, calcium-binding, signal transduction, transport, enzyme catalysis, lipid metabolism, DNA-binding, synaptosome function, actin-binding, ATP-binding, extracellular matrix, and commitment to other lineages. The relatively higher expressed proteins in either sensory or motor nerve were tentatively discussed in combination with their specific molecular characteristics. It is anticipated that the database generated in this study will provide a solid foundation for further comprehensive investigation of functional differences between sensory and motor nerves, including the specificity of their regeneration.

  20. Amyloid precursor protein expression and processing are differentially regulated during cortical neuron differentiation

    PubMed Central

    Bergström, Petra; Agholme, Lotta; Nazir, Faisal Hayat; Satir, Tugce Munise; Toombs, Jamie; Wellington, Henrietta; Strandberg, Joakim; Bontell, Thomas Olsson; Kvartsberg, Hlin; Holmström, Maria; Boreström, Cecilia; Simonsson, Stina; Kunath, Tilo; Lindahl, Anders; Blennow, Kaj; Hanse, Eric; Portelius, Erik; Wray, Selina; Zetterberg, Henrik


    Amyloid precursor protein (APP) and its cleavage product amyloid β (Aβ) have been thoroughly studied in Alzheimer’s disease. However, APP also appears to be important for neuronal development. Differentiation of induced pluripotent stem cells (iPSCs) towards cortical neurons enables in vitro mechanistic studies on human neuronal development. Here, we investigated expression and proteolytic processing of APP during differentiation of human iPSCs towards cortical neurons over a 100-day period. APP expression remained stable during neuronal differentiation, whereas APP processing changed. α-Cleaved soluble APP (sAPPα) was secreted early during differentiation, from neuronal progenitors, while β-cleaved soluble APP (sAPPβ) was first secreted after deep-layer neurons had formed. Short Aβ peptides, including Aβ1-15/16, peaked during the progenitor stage, while processing shifted towards longer peptides, such as Aβ1-40/42, when post-mitotic neurons appeared. This indicates that APP processing is regulated throughout differentiation of cortical neurons and that amyloidogenic APP processing, as reflected by Aβ1-40/42, is associated with mature neuronal phenotypes. PMID:27383650

  1. Amyloid precursor protein expression and processing are differentially regulated during cortical neuron differentiation.


    Bergström, Petra; Agholme, Lotta; Nazir, Faisal Hayat; Satir, Tugce Munise; Toombs, Jamie; Wellington, Henrietta; Strandberg, Joakim; Bontell, Thomas Olsson; Kvartsberg, Hlin; Holmström, Maria; Boreström, Cecilia; Simonsson, Stina; Kunath, Tilo; Lindahl, Anders; Blennow, Kaj; Hanse, Eric; Portelius, Erik; Wray, Selina; Zetterberg, Henrik


    Amyloid precursor protein (APP) and its cleavage product amyloid β (Aβ) have been thoroughly studied in Alzheimer's disease. However, APP also appears to be important for neuronal development. Differentiation of induced pluripotent stem cells (iPSCs) towards cortical neurons enables in vitro mechanistic studies on human neuronal development. Here, we investigated expression and proteolytic processing of APP during differentiation of human iPSCs towards cortical neurons over a 100-day period. APP expression remained stable during neuronal differentiation, whereas APP processing changed. α-Cleaved soluble APP (sAPPα) was secreted early during differentiation, from neuronal progenitors, while β-cleaved soluble APP (sAPPβ) was first secreted after deep-layer neurons had formed. Short Aβ peptides, including Aβ1-15/16, peaked during the progenitor stage, while processing shifted towards longer peptides, such as Aβ1-40/42, when post-mitotic neurons appeared. This indicates that APP processing is regulated throughout differentiation of cortical neurons and that amyloidogenic APP processing, as reflected by Aβ1-40/42, is associated with mature neuronal phenotypes.

  2. Differential expression of neuroleukin in osseous tissues and its involvement in mineralization during osteoblast differentiation

    NASA Technical Reports Server (NTRS)

    Zhi, J.; Sommerfeldt, D. W.; Rubin, C. T.; Hadjiargyrou, M.


    Osteoblast differentiation is a multistep process that involves critical spatial and temporal regulation of cellular processes marked by the presence of a large number of differentially expressed molecules. To identify key functional molecules, we used differential messenger RNA (mRNA) display and compared RNA populations isolated from the defined transition phases (proliferation, matrix formation, and mineralization) of the MC3T3-E1 osteoblast-like cell line. Using this approach, a complementary DNA (cDNA) fragment was isolated and identified as neuroleukin (NLK), a multifunctional cytokine also known as autocrine motility factor (AMF), phosphoglucose isomerase (PGI; phosphohexose isomerase [PHI]), and maturation factor (MF). Northern analysis showed NLK temporal expression during MC3T3-E1 cell differentiation with a 3.5-fold increase during matrix formation and mineralization. Immunocytochemical studies revealed the presence of NLK in MC3T3-E1 cells as well as in the surrounding matrix, consistent with a secreted molecule. In contrast, the NLK receptor protein was detected primarily on the cell membrane. In subsequent studies, a high level of NLK expression was identified in osteoblasts and superficial articular chondrocytes in bone of 1-, 4-, and 8-month-old normal mice, as well as in fibroblasts, proliferating chondrocytes, and osteoblasts within a fracture callus. However, NLK was not evident in hypertrophic chondrocytes or osteocytes. In addition, treatment of MC3T3 cells with 6-phosphogluconic acid (6PGA; a NLK inhibitor) resulted in diminishing alkaline phosphatase (ALP) activity and mineralization in MC3T3-E1 cells, especially during the matrix formation stage of differentiating cells. Taken together, these data show specific expression of NLK in discrete populations of bone and cartilage cells and suggest a possible role for this secreted protein in bone development and regeneration.

  3. Detection of differentially expressed genes in the early developmental stage of the mouse mandible.


    Yamaza, H; Matsuo, K; Kiyoshima, T; Shigemura, N; Kobayashi, I; Wada, H; Akamime, A; Sakai, H


    We previously examined the development of the mouse mandible, and demonstrated that odontogenesis occurs between embryonic day 10.5 (E10.5) and E12. Based on the histological findings, we performed cDNA subtraction between the E10.5 and E12 mandibles to detect any differentially expressed genes which might be involved in the initiation of odontogenesis. By sequencing, homology search and semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), we thus found Pgk-1, Ccte, Hsp86, Nucleolin, Hsc73, Frg1, N-ras, Set alpha and Hsj2 from the E10.5 mandible, and E25, ATPase6, Mum2, Thymosin beta4 and L21 from the E12 mandible to be differentially expressed genes. These genes are functionally related to protein transport, signal transduction, transcription, translation and molecular chaperon activity. In situ hybridization analyses of Set alpha and E25 showed that Set alpha was detected in the tooth germ at E12 and E14.5, thus indicating a close relationship of this gene to odontogenesis. Meanwhile, the in situ signal of E25 was found in the muscular layer of the tongue, thus suggesting E25 to be related to the differentiation of muscular tissue. In conclusion, we found 15 differentially expressed genes in the course of the early developmental stage of the mouse mandible using a combination of the cDNA subtraction and semi-quantitative RT-PCR methods, while in addition, two genes were demonstrated to be related to the initiation and the development of both tooth germ and the tongue according to the in situ hybridization technique.

  4. Differential effects of detergents on keratinocyte gene expression.


    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J


    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  5. Differential expression of antimicrobial peptides in margins of chronic wounds.


    Dressel, Stefanie; Harder, Jürgen; Cordes, Jesko; Wittersheim, Maike; Meyer-Hoffert, Ulf; Sunderkötter, Cord; Gläser, Regine


    Skin wounds usually heal without major infections, although the loss of the mechanical epithelial barrier exposes the tissue to various bacteria. One reason may be the expression of antimicrobial peptides (AMP) of which some [human beta-defensins (hBD) and LL-37] were recently shown to support additionally certain steps of wound healing. There are no studies which have compared expression patterns of different classes of AMP in chronic wounds. The aim of our study was therefore to analyse the expression profile of hBD-2, hBD-3, LL-37, psoriasin and RNase 7 by immunohistochemistry from defined wound margins of chronic venous ulcers. We detected a strong induction of psoriasin and hBD-2 in chronic wounds in comparison with healthy skin. Except for stratum corneum, no expression of RNase 7 and LL-37 was detected in the epidermis while expression of hBD-3 was heterogeneous. Bacterial swabs identified Staphylococcus aureus and additional bacterial populations, but no association between colonization and AMP expression was found. The differential expression of AMP is noteworthy considering the high bacterial load of chronic ulcers. Clinically, supplementation of AMP with the capability to enhance wound healing besides restricting bacterial overgrowth could present a physiological support for treatment of disturbed wound healing.

  6. Quantitative flow cytometric analysis of membrane antigen expression.


    D'hautcourt, Jean-Luc


    Immunological analysis for cell antigens has been performed by flow cytometry in a qualitative fashion for over thirty years. During that time it has become increasingly apparent that quantitative measurements such as number of antigens per cell provide unique and useful information. This unit on quantitative flow cytometry (QFCM) describes the most commonly used protocols, both direct and indirect, and the major methods of analysis for the number of antibody binding sites on a cell or particle. Practical applications include detection of antigen under- or overexpression in hematological malignancies, distinguishing between B cell lymphoproliferative disorders, and precise diagnosis of certain rare diseases.

  7. PATHOME: an algorithm for accurately detecting differentially expressed subpathways

    PubMed Central

    Nam, S; Chang, H R; Kim, K-T; Kook, M-C; Hong, D; Kwon, C H; Jung, H R; Park, H S; Powis, G; Liang, H; Park, T; Kim, Y H


    The translation of high-throughput gene expression data into biologically meaningful information remains a bottleneck. We developed a novel computational algorithm, PATHOME, for detecting differentially expressed biological pathways. This algorithm employs straightforward statistical tests to evaluate the significance of differential expression patterns along subpathways. Applying it to gene expression data sets of gastric cancer (GC), we compared its performance with those of other leading programs. Based on a literature-driven reference set, PATHOME showed greater consistency in identifying known cancer-related pathways. For the WNT pathway uniquely identified by PATHOME, we validated its involvement in gastric carcinogenesis through experimental perturbation of both cell lines and animal models. We identified HNF4α-WNT5A regulation in the cross-talk between the AMPK metabolic pathway and the WNT signaling pathway, and further identified WNT5A as a potential therapeutic target for GC. We have demonstrated PATHOME to be a powerful tool, with improved sensitivity for identifying disease-related dysregulated pathways. PMID:24681952

  8. Identifying the optimal gene and gene set in hepatocellular carcinoma based on differential expression and differential co-expression algorithm.


    Dong, Li-Yang; Zhou, Wei-Zhong; Ni, Jun-Wei; Xiang, Wei; Hu, Wen-Hao; Yu, Chang; Li, Hai-Yan


    The objective of this study was to identify the optimal gene and gene set for hepatocellular carcinoma (HCC) utilizing differential expression and differential co-expression (DEDC) algorithm. The DEDC algorithm consisted of four parts: calculating differential expression (DE) by absolute t-value in t-statistics; computing differential co-expression (DC) based on Z-test; determining optimal thresholds on the basis of Chi-squared (χ2) maximization and the corresponding gene was the optimal gene; and evaluating functional relevance of genes categorized into different partitions to determine the optimal gene set with highest mean minimum functional information (FI) gain (Δ*G). The optimal thresholds divided genes into four partitions, high DE and high DC (HDE-HDC), high DE and low DC (HDE-LDC), low DE and high DC (LDE‑HDC), and low DE and low DC (LDE-LDC). In addition, the optimal gene was validated by conducting reverse transcription-polymerase chain reaction (RT-PCR) assay. The optimal threshold for DC and DE were 1.032 and 1.911, respectively. Using the optimal gene, the genes were divided into four partitions including: HDE-HDC (2,053 genes), HED-LDC (2,822 genes), LDE-HDC (2,622 genes), and LDE-LDC (6,169 genes). The optimal gene was microtubule‑associated protein RP/EB family member 1 (MAPRE1), and RT-PCR assay validated the significant difference between the HCC and normal state. The optimal gene set was nucleoside metabolic process (GO\\GO:0009116) with Δ*G = 18.681 and 24 HDE-HDC partitions in total. In conclusion, we successfully investigated the optimal gene, MAPRE1, and gene set, nucleoside metabolic process, which may be potential biomarkers for targeted therapy and provide significant insight for revealing the pathological mechanism underlying HCC.

  9. Differential gene expression by Moniliophthora roreri while overcoming cacao tolerance in the field.


    Bailey, Bryan A; Melnick, Rachel L; Strem, Mary D; Crozier, Jayne; Shao, Jonathan; Sicher, Richard; Phillips-Mora, Wilberth; Ali, Shahin S; Zhang, Dapeng; Meinhardt, Lyndel


    Frosty pod rot (FPR) of Theobroma cacao (cacao) is caused by the hemibiotrophic fungus Moniliophthora roreri. Cacao clones tolerant to FPR are being planted throughout Central America. To determine whether M. roreri shows a differential molecular response during successful infections of tolerant clones, we collected field-infected pods at all stages of symptomatology for two highly susceptible clones (Pound-7 and CATIE-1000) and three tolerant clones (UF-273, CATIE-R7 and CATIE-R4). Metabolite analysis was carried out on clones Pound-7, CATIE-1000, CATIE-R7 and CATIE-R4. As FPR progressed, the concentrations of sugars in pods dropped, whereas the levels of trehalose and mannitol increased. Associations between symptoms and fungal loads and some organic and amino acid concentrations varied depending on the clone. RNA-Seq analysis identified 873 M. roreri genes that were differentially expressed between clones, with the primary difference being whether the clone was susceptible or tolerant. Genes encoding transcription factors, heat shock proteins, transporters, enzymes modifying membranes or cell walls and metabolic enzymes, such as malate synthase and alternative oxidase, were differentially expressed. The differential expression between clones of 43 M. roreri genes was validated by real-time quantitative reverse transcription polymerase chain reaction. The expression profiles of some genes were similar in susceptible and tolerant clones (other than CATIE-R4) and varied with the biotrophic/necrotropic shift. Moniliophthora roreri genes associated with stress metabolism and responses to heat shock and anoxia were induced early in tolerant clones, their expression profiles resembling that of the necrotrophic phase. Moniliophthora roreri stress response genes, induced during the infection of tolerant clones, may benefit the fungus in overcoming cacao defense mechanisms.

  10. Differential gene expression profiling of large and small retinal ganglion cells

    PubMed Central

    Ivanov, Dmitry; Dvoriantchikova, Galina; Barakat, David J.; Nathanson, Lubov; Shestopalov, Valery I.


    Different sub-populations of retinal ganglion cells (RGCs) vary in their sensitivity to pathological conditions such as retinal ischemia, diabetic retinopathy and glaucoma. Comparative transcriptomic analysis of such groups will likely reveal molecular determinants of differential sensitivity to stress. However, gene expression profiling of primary neuronal sub-populations represent a challenge due to the cellular heterogeneity of retinal tissue. In this manuscript, we report the use of a fluorescent neural tracer to specifically label and selectively isolate RGCs with different soma sizes by fluorescence-activated cell sorting (FACS) for the purpose of differential gene expression profiling. We identified 145 genes that were more active in the large RGCs and 312 genes in the small RGCs. Differential data were validated by quantitative RT-PCR, several corresponding proteins were confirmed by immunohistochemistry. Functional characterization revealed differential activity of genes implicated in synaptic transmission, neurotransmitter secretion, axon guidance, chemotaxis, ion transport and tolerance to stress. An in silico reconstruction of cellular networks suggested that differences in pathway activity between the two sub-populations of RGCs are controlled by networks interconnected by SP-1, Erk2(MAPK1), Egr1, Egr2 and, potentially, regulated via transcription factors C/EBPbeta, HSF1, STAT1- and c-Myc. The results show that FACS-aided purification of retrogradely labeled cells can be effectively utilized for transcriptional profiling of adult retinal neurons. PMID:18640154

  11. Differential expression of GATA-3 in urothelial carcinoma variants.


    Liang, Yu; Heitzman, Joseph; Kamat, Ashish M; Dinney, Colin P; Czerniak, Bogdan; Guo, Charles C


    GATA binding protein 3 (GATA-3) is a novel immunohistochemical marker for urothelial carcinoma (UC); however, few studies have investigated GATA-3's role as a marker for UC variants. We used immunohistochemistry to assess GATA-3 expression in different UC variants, including micropapillary (n = 46), sarcomatoid (n = 43), small cell carcinoma (n = 22), and plasmacytoid (n = 16) variants, and we also compared GATA-3 expression in conventional bladder UC (n = 103) to that in squamous cell carcinoma (n = 14). GATA-3 expression was present in 70% (72/103) of conventional bladder UCs and highly concordant between matched primary and metastatic UCs. The GATA-3 expression levels of the micropapillary variants (57%; 26/46) and plasmacytoid variants (44%; 7/16) were not significantly different from that of conventional UC. However, the GATA-3 expression levels of the sarcomatoid variants (16%; 7/43) and small cell carcinoma variants (5%; 1/22), which only weakly expressed the protein, were significantly lower than that of conventional UC (P < .001). Only 7% of squamous cell carcinomas (1/14) expressed GATA-3, and it was also significantly lower than that of conventional UC (P < .001). GATA-3 expression was not significantly associated with tumor stage or patients' clinical outcomes. In conclusion, GATA-3 expression differed among UC variants. GATA-3 is a useful marker for confirming the urothelial origin of micropapillary and plasmacytoid UC variants but not that of sarcomatoid or small cell carcinoma variants. GATA-3 can also be used in differentiating UC from squamous cell carcinoma.

  12. Expression of T cell antigen receptor during differentiation

    SciTech Connect

    Allison, J.P.; Lanier, L.L.; Guyden, J.; Richie, E.R.


    The authors have used flow cytometry with monoclonal antibodies, radioimmuneprecipitation with a rabbit antiserum to common epitopes of the TCR, and Northern and Southern blot analysis with cloned TCR genes to study antigen receptor (TCR) expression by normal murine and human thymocytes and by primary murine thymomas. L3T4-,Lyt2- murine thymomas corresponding to the earliest stage of thymic differentiation, were found to have rearranged TCR beta genes, and to express low levels of beta transcript, but lacked alpha gene transcript and failed to express TCR on the cell surface. L3T4+,Lyt2+ thymomas were variable, but the majority were found to contain significant levels of both alpha and beta transcripts and to express TCR at the cell surface. Similarly, alpha and beta transcripts and TCR protein were detected in sorted L3T4+,Lyt2+ murine thymocytes. Using three color fluorescence, the authors determined that app. 70% of human T4+T8+ thymocytes also expressed T3, a component of the TCR complex. These data indicate that in mouse and man expression of TCR occurs in the immature, or cortical, thymic population.

  13. Differentially expressed miRNAs in oxygen-induced retinopathy newborn mouse models

    PubMed Central

    Wang, Yunpeng; Wu, Suying; Yang, Yang; Peng, Fen; Li, Qintao; Tian, Peng; Xiang, Erying; Liang, Honglu; Wang, Beibei; Zhou, Xiaoyu; Huang, Hua; Zhou, Xiaoguang


    The present study aimed to identify microRNAs (miRNAs) involved in regulating retinal neovascularization and retinopathy of prematurity (ROP). A total of 80 healthy C57BL/6 neonatal mice were randomly divided into the oxygen-induced retinopathy (OIR) group (n=40), in which 7-day-old mice were maintained in 75% oxygen conditions for 5 days, or the control group (n=40). Following collection of retinal tissue, retinal angiography and hematoxylin and eosin (H&E) staining were performed. Total RNA was also extracted from retinal tissue, and miRNA microarrays and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) were performed to identify differentially expressed miRNAs in the two groups. Retinal angiography and H&E staining revealed damage to retinas in the OIR group. Compared with the control group, 67 miRNAs were differentially expressed in the OIR group, of which 34 were upregulated and 33 were downregulated. Of these differentially expressed miRNAs, 32 exhibited a fold change ≥2, of which 21 were upregulated and 11 were downregulated. The results of RT-qPCR for miR-130a-3p and miR-5107-5p were in accordance with those of the miRNA microarray. The newly identified miRNAs may be important in the development of ROP, and may provide a basis for future research into the mechanisms of ROP. PMID:27922698

  14. Beyond differential expression: the quest for causal mutations and effector molecules

    PubMed Central


    High throughput gene expression technologies are a popular choice for researchers seeking molecular or systems-level explanations of biological phenomena. Nevertheless, there has been a groundswell of opinion that these approaches have not lived up to the hype because the interpretation of the data has lagged behind its generation. In our view a major problem has been an over-reliance on isolated lists of differentially expressed (DE) genes which – by simply comparing genes to themselves – have the pitfall of taking molecular information out of context. Numerous scientists have emphasised the need for better context. This can be achieved through holistic measurements of differential connectivity in addition to, or in replacement, of DE. However, many scientists continue to use isolated lists of DE genes as the major source of input data for common readily available analytical tools. Focussing this opinion article on our own research in skeletal muscle, we outline our resolutions to these problems – particularly a universally powerful way of quantifying differential connectivity. With a well designed experiment, it is now possible to use gene expression to identify causal mutations and the other major effector molecules with whom they cooperate, irrespective of whether they themselves are DE. We explain why, for various reasons, no other currently available experimental techniques or quantitative analyses are capable of reaching these conclusions. PMID:22849396

  15. Neuronal expression of pathological tau accelerates oligodendrocyte progenitor cell differentiation

    PubMed Central

    Ossola, Bernardino; Zhao, Chao; Compston, Alastair; Pluchino, Stefano; Franklin, Robin J. M.


    Oligodendrocyte progenitor cell (OPC) differentiation is an important therapeutic target to promote remyelination in multiple sclerosis (MS). We previously reported hyperphosphorylated and aggregated microtubule‐associated protein tau in MS lesions, suggesting its involvement in axonal degeneration. However, the influence of pathological tau‐induced axonal damage on the potential for remyelination is unknown. Therefore, we investigated OPC differentiation in human P301S tau (P301S‐htau) transgenic mice, both in vitro and in vivo following focal demyelination. In 2‐month‐old P301S‐htau mice, which show hyperphosphorylated tau in neurons, we found atrophic axons in the spinal cord in the absence of prominent axonal degeneration. These signs of early axonal damage were associated with microgliosis and an upregulation of IL‐1β and TNFα. Following in vivo focal white matter demyelination we found that OPCs differentiated more efficiently in P301S‐htau mice than wild type (Wt) mice. We also found an increased level of myelin basic protein within the lesions, which however did not translate into increased remyelination due to higher susceptibility of P301S‐htau axons to demyelination‐induced degeneration compared to Wt axons. In vitro experiments confirmed higher differentiation capacity of OPCs from P301S‐htau mice compared with Wt mice‐derived OPCs. Because the OPCs from P301S‐htau mice do not ectopically express the transgene, and when isolated from newborn mice behave like Wt mice‐derived OPCs, we infer that their enhanced differentiation capacity must have been acquired through microenvironmental priming. Our data suggest the intriguing concept that damaged axons may signal to OPCs and promote their differentiation in the attempt at rescue by remyelination. GLIA 2016;64:457–471 PMID:26576485

  16. Differentiation of Glioblastoma from Brain Metastasis: Qualitative and Quantitative Analysis Using Arterial Spin Labeling MR Imaging

    PubMed Central

    Sunwoo, Leonard; You, Sung-Hye; Yoo, Roh-Eul; Kang, Koung Mi; Choi, Seung Hong; Kim, Ji-hoon; Sohn, Chul-Ho; Park, Sun-Won; Jung, Cheolkyu; Park, Chul-Kee


    Purpose To evaluate the diagnostic performance of cerebral blood flow (CBF) by using arterial spin labeling (ASL) perfusion magnetic resonance (MR) imaging to differentiate glioblastoma (GBM) from brain metastasis. Materials and Methods The institutional review board of our hospital approved this retrospective study. The study population consisted of 128 consecutive patients who underwent surgical resection and were diagnosed as either GBM (n = 89) or brain metastasis (n = 39). All participants underwent preoperative MR imaging including ASL. For qualitative analysis, the tumors were visually graded into five categories based on ASL-CBF maps by two blinded reviewers. For quantitative analysis, the reviewers drew regions of interest (ROIs) on ASL-CBF maps upon the most hyperperfused portion within the tumor and upon peritumoral T2 hyperintensity area. Signal intensities of intratumoral and peritumoral ROIs for each subject were normalized by dividing the values by those of contralateral normal gray matter (nCBFintratumoral and nCBFperitumoral, respectively). Visual grading scales and quantitative parameters between GBM and brain metastasis were compared. In addition, the area under the receiver-operating characteristic curve was used to evaluate the diagnostic performance of ASL-driven CBF to differentiate GBM from brain metastasis. Results For qualitative analysis, GBM group showed significantly higher grade compared to metastasis group (p = 0.001). For quantitative analysis, both nCBFintratumoral and nCBFperitumoral in GBM were significantly higher than those in metastasis (both p < 0.001). The areas under the curve were 0.677, 0.714, and 0.835 for visual grading, nCBFintratumoral, and nCBFperitumoral, respectively (all p < 0.001). Conclusion ASL perfusion MR imaging can aid in the differentiation of GBM from brain metastasis. PMID:27861605

  17. Genetic susceptibility variants for lung cancer: replication study and assessment as expression quantitative trait loci

    PubMed Central

    Pintarelli, Giulia; Cotroneo, Chiara Elisabetta; Noci, Sara; Dugo, Matteo; Galvan, Antonella; Delli Carpini, Simona; Citterio, Lorena; Manunta, Paolo; Incarbone, Matteo; Tosi, Davide; Santambrogio, Luigi; Dragani, Tommaso A.; Colombo, Francesca


    Many single nucleotide polymorphisms (SNPs) have been associated with lung cancer but lack confirmation and functional characterization. We retested the association of 56 candidate SNPs with lung adenocarcinoma risk and overall survival in a cohort of 823 Italian patients and 779 healthy controls, and assessed their function as expression quantitative trait loci (eQTLs). In the replication study, eight SNPs (rs401681, rs3019885, rs732765, rs2568494, rs16969968, rs6495309, rs11634351, and rs4105144) associated with lung adenocarcinoma risk and three (rs9557635, rs4105144, and rs735482) associated with survival. Five of these SNPs acted as cis-eQTLs, being associated with the transcription of IREB2 (rs2568494, rs16969968, rs11634351, rs6495309), PSMA4 (rs6495309) and ERCC1 (rs735482), out of 10,821 genes analyzed in lung. For these three genes, we obtained experimental evidence of differential allelic expression in lung tissue, pointing to the existence of in-cis genomic variants that regulate their transcription. These results suggest that these SNPs exert their effects on cancer risk/outcome through the modulation of mRNA levels of their target genes. PMID:28181565

  18. Direct quantitative differentiation between Prevotella intermedia and Prevotella nigrescens in clinical specimens.


    Gmür, Rudolf; Thurnheer, Thomas


    This paper describes a quantitative fluorescent in situ hybridization (FISH) assay for the differential identification of Prevotella intermedia and Prevotella nigrescens in clinical samples, and compares its performance with less discriminatory culture and quantitative immunofluorescence (IF) assays. Fluorescence-labelled oligonucleotide probes directed to specific 16S rRNA sequences of P. intermedia, P. nigrescens, Prevotella pallens and Prevotella denticola were hybridized under stringent conditions with cultured reference strains or plaque samples from deep periodontal pockets. Probe specificity was defined with strains from multiple oral Prevotella species. The lower detection level of the assays was approximately 3x10(3) target cells per ml of plaque-sample suspension. P. intermedia, P. nigrescens, P. pallens and P. denticola were detected in plaques with prevalences of 69, 67, 0 and 28%, respectively. On average, 3.9 x 10(6) P. intermedia, 3.1 x 10(6) P. nigrescens and 5.6 x 10(5) P. denticola cells were counted per positive sample. All three species were found almost exclusively in dense mixed aggregates. Quantitative FISH data agreed satisfactorily with corresponding IF data (r=0.711). Both FISH and IF enumerations of the sum of P. intermedia and P. nigrescens markedly exceeded the c.f.u. counts of black-pigmented colonies in Porphyromonas gingivalis-free cultured subgingival plaques. The results demonstrate the validity of this new assay. Unlike established IF, culture, PCR or checkerboard DNA hybridization assays, this FISH assay differentiates quantitatively between P. intermedia and P. nigrescens, provides visual accuracy control, and offers insights into the spatial distribution of the target cells within a clinical sample.

  19. Human adipose tissue-derived mesenchymal stem cells differentiate into insulin, somatostatin, and glucagon expressing cells

    SciTech Connect

    Timper, Katharina; Seboek, Dalma; Eberhardt, Michael; Linscheid, Philippe; Christ-Crain, Mirjam; Keller, Ulrich; Mueller, Beat; Zulewski, Henryk . E-mail:


    Mesenchymal stem cells (MSC) from mouse bone marrow were shown to adopt a pancreatic endocrine phenotype in vitro and to reverse diabetes in an animal model. MSC from human bone marrow and adipose tissue represent very similar cell populations with comparable phenotypes. Adipose tissue is abundant and easily accessible and could thus also harbor cells with the potential to differentiate in insulin producing cells. We isolated human adipose tissue-derived MSC from four healthy donors. During the proliferation period, the cells expressed the stem cell markers nestin, ABCG2, SCF, Thy-1 as well as the pancreatic endocrine transcription factor Isl-1. The cells were induced to differentiate into a pancreatic endocrine phenotype by defined culture conditions within 3 days. Using quantitative PCR a down-regulation of ABCG2 and up-regulation of pancreatic developmental transcription factors Isl-1, Ipf-1, and Ngn3 were observed together with induction of the islet hormones insulin, glucagon, and somatostatin.

  20. Identification of Differentially Expressed Genes Between Osteoblasts and Osteocytes

    PubMed Central

    Paic, Frane; Igwe, John C.; Ravi, Nori; Kronenberg, Mark S.; Franceschetti, Tiziana; Harrington, Patrick; Kuo, Lynn; Shin, Don-Guk; Rowe, David W.; Harris, Stephen E.; Kalajzic, Ivo


    Osteocytes represent the most abundant cellular component of mammalian bones with important functions in bone mass maintenance and remodeling. To elucidate the differential gene expression between osteoblasts and osteocytes we completed a comprehensive analysis of their gene profiles. Selective identification of these two mature populations was achieved by utilization of visual markers of bone lineage cells. We have utilized dual GFP reporter mice in which osteocytes are expressing GFP (topaz) directed by the DMP1 promoter, while osteoblasts are identified by expression of GFP (cyan) driven by 2.3kb of the Col1a1 promoter. Histological analysis of 7-day-old neonatal calvaria confirmed the expression pattern of DMP1GFP in osteocytes and Col2.3 in osteoblasts and osteocytes. To isolate distinct populations of cells we utilized fluorescent activated cell sorting (FACS). Cells suspensions were subjected to RNA extraction, in vitro transcription and labeling of cDNA and gene expression was analyzed using the Illumina WG-6v1 BeadChip. Following normalization of raw data from four biological replicates, 3444 genes were called present in all three sorted cell populations: GFP negative, Col2.3cyan+ (osteoblasts), and DMP1topaz+(preosteocytes and osteocytes). We present the genes that showed in excess of a 2-fold change for gene expression between DMP1topaz+ and Col2.3cyan+ cells. The selected genes were classified and grouped according to their associated gene ontology terms. Genes clustered to osteogenesis and skeletal development such as Bmp4, Bmp8a, Dmp1, Enpp1, Phex and Ank were highly expressed in DMP1topaz+cells. Most of the genes encoding extracellular matrix components and secreted proteins had lower expression in DMP1topaz+ cells, while most of the genes encoding plasma membrane proteins were increased. Interestingly a large number of genes associated with muscle development and function and with neuronal phenotype were increased in DMP1topaz+ cells, indicating

  1. Differential expression of putative drug resistance genes in Mycobacterium tuberculosis clinical isolates.


    González-Escalante, Laura; Peñuelas-Urquides, Katia; Said-Fernández, Salvador; Silva-Ramírez, Beatriz; Bermúdez de León, Mario


    Understanding drug resistance in Mycobacterium tuberculosis requires an integrated analysis of strain lineages, mutations and gene expression. Previously, we reported the differential expression of esxG, esxH, infA, groES, rpmI, rpsA and lipF genes in a sensitive M. tuberculosis strain and in a multidrug-resistant clinical isolate. Here, we have evaluated the expression of these genes in 24 clinical isolates that belong to different lineages and have different drug resistance profiles. In vitro, growth kinetics analysis showed no difference in the growth of the clinical isolates, and thus drug resistance occurred without a fitness cost. However, a quantitative reverse transcription PCR analysis of gene expression revealed high variability among the clinical isolates, including those with similar drug resistance profiles. Due to the complexity of gene regulation pathways and the wide diversity of M. tuberculosis lineages, the use of gene expression as a molecular signature for drug resistance is not straightforward. Therefore, we recommend that the expression of M. tuberculosis genes be performed individually, and baseline expression levels should be verified among several different clinical isolates, before any further applications of these findings.

  2. Differentially expressed regulatory genes in honey bee caste development

    NASA Astrophysics Data System (ADS)

    Hepperle, C.; Hartfelder, K.


    In the honey bee, an eminently fertile queen with up to 200 ovarioles per ovary monopolizes colony level reproduction. In contrast, worker bees have only few ovarioles and are essentially sterile. This phenotype divergence is a result of caste-specifically modulated juvenile hormone and ecdysteroid titers in larval development. In this study we employed a differential-display reverse transcription (DDRT)-PCR protocol to detect ecdysteroid-regulated gene expression during a critical phase of caste development. We identified a Ftz-F1 homolog and a Cut-like transcript. Ftz-F1 could be a putative element of the metamorphic ecdysone response cascade of bees, whereas Cut-like proteins are described as transcription factors involved in maintaining cellular differentiation states. The downregulation of both factors can be interpreted as steps in the metamorphic degradation of ovarioles in worker-bee ovaries.

  3. Stemness-Related Transcriptional Factors and Homing Gene Expression Profiles in Hepatic Differentiation and Cancer

    PubMed Central

    Toraih, Eman A; Fawzy, Manal S; El-Falouji, Abdullah I; Hamed, Elham O; Nemr, Nader A; Hussein, Mohammad H; Fadeal, Noha M Abd El


    Stem cell transcriptional signature activation is an essential event in the development of cancer. This study aimed to investigate the differential expression profiles of three pluripotency-associated genes, OCT4, NANOG and SOX2, G-protein-coupled chemokine receptor 4 (CXCR4) and the ligand CXCL2, and alpha-fetoprotein (AFP) in hepatogenic differentiated stem cells and in sera of hepatitis C virus (HCV) and HCV-induced hepatocellular carcinoma (HCC) patients. Mesenchymal stem cells derived from umbilical cord blood were differentiated using hepatogenic differentiation media. Serum specimens were collected from 96 patients (32 cirrhotic HCV, 32 early HCC and 32 late HCC) and 96 controls. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed for relative quantification of the six target genes using the Livak method. In silico network analysis was also executed to explore the pluripotency and tumorigenetic regulatory circuits in liver cancer. The expression levels of all genes declined gradually during the stages of stem cell differentiation. On univariate and multivariate analyses, NANOG, CXCR4 and AFP were significantly upregulated in late clinical stage HCC patients. In contrast, SOX2 and CXCL2 were markedly overexpressed in cirrhotic patients and could be used for clear demarcation between cirrhotic and HCC patients in our cases. In conclusion, our data highlight the potential role of the SOX2 stem cell marker and CXCL2 chemokine in liver cell degeneration and fibrogenesis in HCV-induced hepatic cirrhosis in our sample of the Egyptian population. In addition, the significant association of NANOG and CXCR4 high expression with late HCC could contribute to the acquisition of stem cell–like properties in hepatic cancer and dissemination in late stages, respectively. Taken together, our results could have potential application in HCC prognosis and treatment. PMID:27623812

  4. Quantitative metabolic imaging using endogenous fluorescence to detect stem cell differentiation

    NASA Astrophysics Data System (ADS)

    Quinn, Kyle P.; Sridharan, Gautham V.; Hayden, Rebecca S.; Kaplan, David L.; Lee, Kyongbum; Georgakoudi, Irene


    The non-invasive high-resolution spatial mapping of cell metabolism within tissues could provide substantial advancements in assessing the efficacy of stem cell therapy and understanding tissue development. Here, using two-photon excited fluorescence microscopy, we elucidate the relationships among endogenous cell fluorescence, cell redox state, and the differentiation of human mesenchymal stem cells into adipogenic and osteoblastic lineages. Using liquid chromatography/mass spectrometry and quantitative PCR, we evaluate the sensitivity of an optical redox ratio of FAD/(NADH + FAD) to metabolic changes associated with stem cell differentiation. Furthermore, we probe the underlying physiological mechanisms, which relate a decrease in the redox ratio to the onset of differentiation. Because traditional assessments of stem cells and engineered tissues are destructive, time consuming, and logistically intensive, the development and validation of a non-invasive, label-free approach to defining the spatiotemporal patterns of cell differentiation can offer a powerful tool for rapid, high-content characterization of cell and tissue cultures.

  5. cDNA-AFLP analysis reveals differential gene expression in response to salt stress in foxtail millet (Setaria italica L.).


    Jayaraman, Ananthi; Puranik, Swati; Rai, Neeraj Kumar; Vidapu, Sudhakar; Sahu, Pranav Pankaj; Lata, Charu; Prasad, Manoj


    Plant growth and productivity are affected by various abiotic stresses such as heat, drought, cold, salinity, etc. The mechanism of salt tolerance is one of the most important subjects in plant science as salt stress decreases worldwide agricultural production. In our present study we used cDNA-AFLP technique to compare gene expression profiles of a salt tolerant and a salt-sensitive cultivar of foxtail millet (Seteria italica) in response to salt stress to identify early responsive differentially expressed transcripts accumulated upon salt stress and validate the obtained result through quantitative real-time PCR (qRT-PCR). The expression profile was compared between a salt tolerant (Prasad) and susceptible variety (Lepakshi) of foxtail millet in both control condition (L0 and P0) and after 1 h (L1 and P1) of salt stress. We identified 90 transcript-derived fragments (TDFs) that are differentially expressed, out of which 86 TDFs were classified on the basis of their either complete presence or absence (qualitative variants) and 4 on differential expression pattern levels (quantitative variants) in the two varieties. Finally, we identified 27 non-redundant differentially expressed cDNAs that are unique to salt tolerant variety which represent different groups of genes involved in metabolism, cellular transport, cell signaling, transcriptional regulation, mRNA splicing, seed development and storage, etc. The expression patterns of seven out of nine such genes showed a significant increase of differential expression in tolerant variety after 1 h of salt stress in comparison to salt-sensitive variety as analyzed by qRT-PCR. The direct and indirect relationship of identified TDFs with salinity tolerance mechanism is discussed.

  6. Differential expression profiling of serum proteins and metabolites for biomarker discovery

    NASA Astrophysics Data System (ADS)

    Roy, Sushmita Mimi; Anderle, Markus; Lin, Hua; Becker, Christopher H.


    A liquid chromatography-mass spectrometry (LC-MS) proteomics and metabolomics platform is presented for quantitative differential expression analysis. Proteome profiles obtained from 1.5 [mu]L of human serum show ~5000 de-isotoped and quantifiable molecular ions. Approximately 1500 metabolites are observed from 100 [mu]L of serum. Quantification is based on reproducible sample preparation and linear signal intensity as a function of concentration. The platform is validated using human serum, but is generally applicable to all biological fluids and tissues. The median coefficient of variation (CV) for ~5000 proteomic and ~1500 metabolomic molecular ions is approximately 25%. For the case of C-reactive protein, results agree with quantification by immunoassay. The independent contributions of two sources of variance, namely sample preparation and LC-MS analysis, are respectively quantified as 20.4 and 15.1% for the proteome, and 19.5 and 13.5% for the metabolome, for median CV values. Furthermore, biological diversity for ~20 healthy individuals is estimated by measuring the variance of ~6500 proteomic and metabolomic molecular ions in sera for each sample; the median CV is 22.3% for the proteome and 16.7% for the metabolome. Finally, quantitative differential expression profiling is applied to a clinical study comparing healthy individuals and rheumatoid arthritis (RA) patients.

  7. Expression of Transthyretin during bovine myogenic satellite cell differentiation.


    Pokharel, Smritee; Kamli, Majid Rasool; Mir, Bilal Ahmad; Malik, Adeel; Lee, Eun Ju; Choi, Inho


    Adult myogenesis responsible for the maintenance and repair of muscle tissue is mainly under the control of myogenic regulatory factors (MRFs) and a few other genes. Transthyretin gene (TTR), codes for a carrier protein for thyroxin (T4) and retinol binding protein bound with retinol in blood plasma, plays a critical role during the early stages of myogenesis. Herein, we investigated the relationship of TTR with other muscle-specific genes and report their expression in muscle satellite cells (MSCs), and increased messenger RNA (mRNA) and protein expression of TTR during MSCs differentiation. Silencing of TTR resulted in decreased myotube formation and decreased expression of myosin light chain (MYL2), myosin heavy chain 3 (MYH3), matrix gla protein (MGP), and voltage-dependent L type calcium channel (Cav1.1) genes. Increased mRNA expression observed in TTR and other myogenic genes with the addition of T4 decreased significantly following TTR knockdown, indicating the critical role of TTR in T4 transportation. Similarly, decreased expression of MGP and Cav1.1 following TTR knockdown signifies the dual role of TTR in controlling muscle myogenesis via regulation of T4 and calcium channel. Our computational and experimental evidences indicate that TTR has a relationship with MRFs and may act on calcium channel and related genes.

  8. Differential expression of angiogenic factors in peripheral nerve sheath tumors.


    Wasa, Junji; Nishida, Yoshihiro; Suzuki, Yoshitaka; Tsukushi, Satoshi; Shido, Yoji; Hosono, Kozo; Shimoyama, Yoshie; Nakamura, Shigeo; Ishiguro, Naoki


    It is difficult to differentiate some malignant peripheral nerve sheath tumors (MPNST) from benign peripheral nerve sheath tumors (BPNST) histologically, and to predict the clinical outcome of patients with MPNST. In this study, the expression of VEGF and MVD were evaluated immunohistochemically in 22 cases of MPNST, 14 of neurofibroma and 19 of schwannoma and correlation of the staining grade of VEGF or MVD and the various clinical factors were analyzed, and statistically evaluated. Levels of VEGF mRNA expression were also determined with real-time RT-PCR. Statistically higher positive staining for VEGF was observed in MPNST compared to neurofibroma (P=0.004) and schwannoma (P<0.001). Even low grade MPNST showed higher VEGF positive staining than neurofibroma. Moreover, high VEGF expression statistically correlated with the poor prognosis of the patients with MPNST (P=0.015). Although MVD in MPNST was significantly higher than that in neurofibroma (P=0.038) and schwannoma (P<0.001), MVD could not predict the prognosis of the patients with MPNST. Although VEGF mRNA expression tended to be higher in MPNST compared to neurofibroma, the difference was not significant. Levels of VEGF protein expression serve as a novel diagnostic and prognostic tools for peripheral nerve sheath tumors.

  9. Quantitative single cell analysis of cell population dynamics during submandibular salivary gland development and differentiation

    PubMed Central

    Nelson, Deirdre A.; Manhardt, Charles; Kamath, Vidya; Sui, Yunxia; Santamaria-Pang, Alberto; Can, Ali; Bello, Musodiq; Corwin, Alex; Dinn, Sean R.; Lazare, Michael; Gervais, Elise M.; Sequeira, Sharon J.; Peters, Sarah B.; Ginty, Fiona; Gerdes, Michael J.; Larsen, Melinda


    Summary Epithelial organ morphogenesis involves reciprocal interactions between epithelial and mesenchymal cell types to balance progenitor cell retention and expansion with cell differentiation for evolution of tissue architecture. Underlying submandibular salivary gland branching morphogenesis is the regulated proliferation and differentiation of perhaps several progenitor cell populations, which have not been characterized throughout development, and yet are critical for understanding organ development, regeneration, and disease. Here we applied a serial multiplexed fluorescent immunohistochemistry technology to map the progressive refinement of the epithelial and mesenchymal cell populations throughout development from embryonic day 14 through postnatal day 20. Using computational single cell analysis methods, we simultaneously mapped the evolving temporal and spatial location of epithelial cells expressing subsets of differentiation and progenitor markers throughout salivary gland development. We mapped epithelial cell differentiation markers, including aquaporin 5, PSP, SABPA, and mucin 10 (acinar cells); cytokeratin 7 (ductal cells); and smooth muscle α-actin (myoepithelial cells) and epithelial progenitor cell markers, cytokeratin 5 and c-kit. We used pairwise correlation and visual mapping of the cells in multiplexed images to quantify the number of single- and double-positive cells expressing these differentiation and progenitor markers at each developmental stage. We identified smooth muscle α-actin as a putative early myoepithelial progenitor marker that is expressed in cytokeratin 5-negative cells. Additionally, our results reveal dynamic expansion and redistributions of c-kit- and K5-positive progenitor cell populations throughout development and in postnatal glands. The data suggest that there are temporally and spatially discreet progenitor populations that contribute to salivary gland development and homeostasis. PMID:23789091

  10. Differentially expressed genes and canonical pathway expression in human atherosclerotic plaques – Tampere Vascular Study

    PubMed Central

    Sulkava, Miska; Raitoharju, Emma; Levula, Mari; Seppälä, Ilkka; Lyytikäinen, Leo-Pekka; Mennander, Ari; Järvinen, Otso; Zeitlin, Rainer; Salenius, Juha-Pekka; Illig, Thomas; Klopp, Norman; Mononen, Nina; Laaksonen, Reijo; Kähönen, Mika; Oksala, Niku; Lehtimäki, Terho


    Cardiovascular diseases due to atherosclerosis are the leading cause of death globally. We aimed to investigate the potentially altered gene and pathway expression in advanced peripheral atherosclerotic plaques in comparison to healthy control arteries. Gene expression analysis was performed (Illumina HumanHT-12 version 3 Expression BeadChip) for 68 advanced atherosclerotic plaques (15 aortic, 29 carotid and 24 femoral plaques) and 28 controls (left internal thoracic artery (LITA)) from Tampere Vascular Study. Dysregulation of individual genes was compared to healthy controls and between plaques from different arterial beds and Ingenuity pathway analysis was conducted on genes with a fold change (FC) > ±1.5 and false discovery rate (FDR) < 0.05. 787 genes were significantly differentially expressed in atherosclerotic plaques. The most up-regulated genes were osteopontin and multiple MMPs, and the most down-regulated were cell death-inducing DFFA-like effector C and A (CIDEC, CIDEA) and apolipoprotein D (FC > 20). 156 pathways were differentially expressed in atherosclerotic plaques, mostly inflammation-related, especially related with leukocyte trafficking and signaling. In artery specific plaque analysis 50.4% of canonical pathways and 41.2% GO terms differentially expressed were in common for all three arterial beds. Our results confirm the inflammatory nature of advanced atherosclerosis and show novel pathway differences between different arterial beds. PMID:28128285

  11. Differential expression profiling of microRNAs and their potential involvement in esophageal squamous cell carcinoma.


    Zang, Wenqiao; Wang, Yuanyuan; Du, Yuwen; Xuan, Xiaoyan; Wang, Tao; Li, Min; Ma, Yunyun; Li, Ping; Chen, Xudong; Dong, Ziming; Zhao, Guoqiang


    MicroRNAs are small, noncoding RNAs approximately 18-24 nucleotides in length that negatively regulate gene expression at the posttranscriptional and/or translational level by binding to complimentary sequences in the 3'-untranslated regions of target mRNAs. Growing evidence has indicated the important roles for different miRNA species in the development of different cancers. Therefore, miRNAs have the potential to become new biological markers for esophageal squamous cell carcinoma (ESCC) and to be applied in the diagnosis, prognosis, and targeted treatment of ESCC. In this study, we performed a miRNA microarray to analyze the miRNA expression profile in ESCC compared to normal tissues. Then, we made a preliminary analysis of the biological function for the most differentially expressed miRNAs and their potentially target genes regulated. Some microarray results were validated by performing quantitative RT-PCR. The study provided evidence that linked the biological role of miRNAs to ESCC and showed that miRNAs could undertake a variety of mechanisms. Additionally, we also found that altered miR-429 and miR-451 expression levels were associated with the occurrence of lymph node metastases and the differentiation status and TNM stage in ESCC. The study of miRNAs may lead to finding novel methods to diagnose, treat, and prevent ESCC.

  12. Aberrant expression of posterior HOX genes in well differentiated histotypes of thyroid cancers.


    Cantile, Monica; Scognamiglio, Giosuè; La Sala, Lucia; La Mantia, Elvira; Scaramuzza, Veronica; Valentino, Elena; Tatangelo, Fabiana; Losito, Simona; Pezzullo, Luciano; Chiofalo, Maria Grazia; Fulciniti, Franco; Franco, Renato; Botti, Gerardo


    Molecular etiology of thyroid cancers has been widely studied, and several molecular alterations have been identified mainly associated with follicular and papillary histotypes. However, the molecular bases of the complex pathogenesis of thyroid carcinomas remain poorly understood. HOX genes regulate normal embryonic development, cell differentiation and other critical processes in eukaryotic cell life. Several studies have shown that HOX genes play a role in neoplastic transformation of several human tissues. In particular, the genes belonging to HOX paralogous group 13 seem to hold a relevant role in both tumor development and progression. We have identified a significant prognostic role of HOX D13 in pancreatic cancer and we have recently showed the strong and progressive over-expression of HOX C13 in melanoma metastases and deregulation of HOX B13 expression in bladder cancers. In this study we have investigated, by immunohistochemisty and quantitative Real Time PCR, the HOX paralogous group 13 genes/proteins expression in thyroid cancer evolution and progression, also evaluating its ability to discriminate between main histotypes. Our results showed an aberrant expression, both at gene and protein level, of all members belonging to paralogous group 13 (HOX A13, HOX B13, HOX C13 and HOX D13) in adenoma, papillary and follicular thyroid cancers samples. The data suggest a potential role of HOX paralogous group 13 genes in pathogenesis and differential diagnosis of thyroid cancers.

  13. Differential expression of intracellular and extracellular CB(2) cannabinoid receptor protein by human peripheral blood leukocytes.


    Castaneda, Julie T; Harui, Airi; Kiertscher, Sylvia M; Roth, Jeffrey D; Roth, Michael D


    mRNA encoding for the CB(2) cannabinoid receptor is expressed by many subsets of human peripheral blood leukocytes (PBL), but little is known about the resulting protein expression and function. Employing clones from the A549 and 293T cell lines that were constructed to express both full-length human CB(2) and GFP, we developed a flow cytometry assay for characterizing CB(2) protein expression. A monoclonal antibody directed against human CB(2) selectively stained the surface of transduced but not parental cell lines. When cells were fixed and permeabilized, imaging flow cytometry identified large stores of intracellular protein. Total cellular staining for CB(2) corresponded closely with the level of GFP expression. When exposed to Δ(9)-tetrahydrocannabinol, CB(2)-expressing cells internalized cell surface CB(2) receptors in a time- and dose-dependent manner. Applying these approaches to human PBL, CB(2) protein was identified on the surface of human B cells but not on T cells or monocytes. In contrast, when PBL were fixed and permeabilized, intracellular CB(2) expression was readily detected in all three subsets by both conventional and imaging flow cytometry. Similar to the protein expression pattern observed in fixed and permeabilized PBL, purified B cells, T cells, and monocytes expressed relatively equal levels of CB(2) mRNA by quantitative real-time RT-PCR. Our findings confirm that human PBL express CB(2) protein but that its distribution is predominantly intracellular with only B cells expressing CB(2) protein at the extracellular membrane. The differential role of intracellular and extracellular CB(2) receptors in mediating ligand signaling and immune function remains to be determined.

  14. An Efficient and Robust Statistical Modeling Approach to Discover Differentially Expressed Genes Using Genomic Expression Profiles

    PubMed Central

    Thomas, Jeffrey G.; Olson, James M.; Tapscott, Stephen J.; Zhao, Lue Ping


    We have developed a statistical regression modeling approach to discover genes that are differentially expressed between two predefined sample groups in DNA microarray experiments. Our model is based on well-defined assumptions, uses rigorous and well-characterized statistical measures, and accounts for the heterogeneity and genomic complexity of the data. In contrast to cluster analysis, which attempts to define groups of genes and/or samples that share common overall expression profiles, our modeling approach uses known sample group membership to focus on expression profiles of individual genes in a sensitive and robust manner. Further, this approach can be used to test statistical hypotheses about gene expression. To demonstrate this methodology, we compared the expression profiles of 11 acute myeloid leukemia (AML) and 27 acute lymphoblastic leukemia (ALL) samples from a previous study (Golub et al. 1999) and found 141 genes differentially expressed between AML and ALL with a 1% significance at the genomic level. Using this modeling approach to compare different sample groups within the AML samples, we identified a group of genes whose expression profiles correlated with that of thrombopoietin and found that genes whose expression associated with AML treatment outcome lie in recurrent chromosomal locations. Our results are compared with those obtained using t-tests or Wilcoxon rank sum statistics. PMID:11435405

  15. Genes involved in epithelial differentiation and development are differentially expressed in oral and genital lichen planus epithelium compared to normal epithelium.


    Danielsson, Karin; Coates, Philip J; Ebrahimi, Majid; Nylander, Elisabet; Wahlin, Ylva Britt; Nylander, Karin


    Lichen planus (LP) is a chronic mucocutaneous disease with unknown cause. Patients with LP often have both oral and genital lesions, but these conditions are often considered as separate diseases and treated accordingly. To find out which genes are differently expressed in mucosal LP compared to normal mucosa and establish whether oral and genital LP are in fact the same disease, whole genome expression analysis was performed on epithelium from 13 patients diagnosed with oral and/or genital LP and normal controls. For confirmation of keratin 4 and corneodesmosin expression, quantitative reverse-transcription PCR and immunohistochemistry were used. Many genes involved in epithelial development and differentiation are differently expressed in epithelium from LP compared to normal epithelium. Several of the differentially expressed genes are common for oral and genital LP and the same biological processes are altered which supports the fact that oral and genital LP are manifestations of the same disease. The change in gene expression indicates that differentiation is altered leading to changes in the epithelial barrier.

  16. Quantitative expression of candidate genes affecting eggshell color.


    Zheng, Chuanwei; Li, Zesheng; Yang, Ning; Ning, Zhonghua


    There are three pigments that affect the color of an eggshell: protoporphyrin, biliverdin and biliverdin-zinc chelate. Protoporphyrin is the main pigment in brown and light-brown eggshells, whereas very little protoporphyrin is found in white eggshells. Eggshell protoporphyrin is derived from the heme formation in birds. Coproporphyrinogen III oxidase (CPOX) and ferrochelatase (FECH) represent rate-limiting enzymes for the heme-biosynthetic pathway. Breast cancer resistance protein (BCRP), feline leukemia virus receptor (FLVCR), and heme-responsive gene-1 (HRG1) serve as primary transporters for both protoporphyrinogen and heme. Finally, four organic anion transporting polypeptide family members (including solute carrier organic anion transporter family, SLCO1C1, SLCO1A2, SLCO1B3 and LOC418189) may affect pigment transport within eggshells. Here we measured gene expression levels in key tissues of egg-producing hens. We analyzed three different types of hens that generated distinct eggshell colors: white, pink or brown. Our data revealed three ways in which eggshell color was genetically influenced. First, high-level expression of CPOX generated more protoporphyrinogen and a brown eggshell color. In contrast, high expression of FECH likely converted more protoporphyrinogen into heme, reduced protoporphyrinogen levels within the eggshell and generated a light color. Second, heme transporters also affected eggshell color. High-level expression of BCRP, HRG1 and FLVCR were associated with brown, white and generally lighter eggshell colors, respectively. Finally, protoporphyrin precipitation also affected eggshell color, as high expression of both SLCO1A2 and SLCO1C1 were associated with brown eggshell color. As such, we have identified seven genes in which expression levels in different tissues were associated with eggshell color.

  17. Utilization of digital differential display to identify differentially expressed genes related to rumen development.


    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun


    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both.

  18. Importance of renal depth correction for quantitation of differential renal function

    SciTech Connect

    Choi, H.; Kirchner, P.T.


    To assess the frequency and magnitude of errors caused by asymmetries in renal depth, when estimates of differential function are based only posterior projections (as in DTPA studies). The authors compared ratios of right-to-left (R/L) DMSA localization derived from posterior camera images with R/L ratios based on geometric mean of posterior and anterior counts of each kidney. The factor (X) required to convert the ratio of R/L posterior counts to the more accurate R/L geometric counts (Rp/Lp.X = Rg/Lg) was determined in 55 randomly selected patients referred for DMSA studies. Frequency distributions for X and l/X reveal that the use of posterior counts alone is likely to produce differential flow/function estimates with errors greater than 30% in 5% of patients, greater than 20% in 16 of patients. Lack of depth correction also widens the normal range derived from normal controls, thus reducing sensitivity and specificity of quantitative renal studies by two different mechanisms. The authors recommend routine application of depth correction by conjugate counting or ultrasound techniques for all quantitations of renal function.

  19. Learning regulatory programs that accurately predict differential expression with MEDUSA.


    Kundaje, Anshul; Lianoglou, Steve; Li, Xuejing; Quigley, David; Arias, Marta; Wiggins, Chris H; Zhang, Li; Leslie, Christina


    Inferring gene regulatory networks from high-throughput genomic data is one of the central problems in computational biology. In this paper, we describe a predictive modeling approach for studying regulatory networks, based on a machine learning algorithm called MEDUSA. MEDUSA integrates promoter sequence, mRNA expression, and transcription factor occupancy data to learn gene regulatory programs that predict the differential expression of target genes. Instead of using clustering or correlation of expression profiles to infer regulatory relationships, MEDUSA determines condition-specific regulators and discovers regulatory motifs that mediate the regulation of target genes. In this way, MEDUSA meaningfully models biological mechanisms of transcriptional regulation. MEDUSA solves the problem of predicting the differential (up/down) expression of target genes by using boosting, a technique from statistical learning, which helps to avoid overfitting as the algorithm searches through the high-dimensional space of potential regulators and sequence motifs. Experimental results demonstrate that MEDUSA achieves high prediction accuracy on held-out experiments (test data), that is, data not seen in training. We also present context-specific analysis of MEDUSA regulatory programs for DNA damage and hypoxia, demonstrating that MEDUSA identifies key regulators and motifs in these processes. A central challenge in the field is the difficulty of validating reverse-engineered networks in the absence of a gold standard. Our approach of learning regulatory programs provides at least a partial solution for the problem: MEDUSA's prediction accuracy on held-out data gives a concrete and statistically sound way to validate how well the algorithm performs. With MEDUSA, statistical validation becomes a prerequisite for hypothesis generation and network building rather than a secondary consideration.

  20. Differentiation of Spermatogonia Stem Cells into Functional Mature Neurons Characterized with Differential Gene Expression.


    Bojnordi, Maryam Nazm; Azizi, Hossein; Skutella, Thomas; Movahedin, Mansoureh; Pourabdolhossein, Fereshteh; Shojaei, Amir; Hamidabadi, Hatef Ghasemi


    Transplantation of embryonic stem cells (ESCs) is a promising therapeutic approach for the treatment of neurodegenerative diseases. However, ESCs are not usable clinically due to immunological and ethical limitations. The identification of an alternative safe cell source opens novel options via autologous transplantation in neuro-regeneration circumventing these problems. Here, we examined the neurogenic capacity of embryonic stem-like cells (ES-like cells) derived from the testis using neural growth factor inducers and utilized them to generate functional mature neurons. The neuronal differentiation of ES-like cells is induced in three stages. Stage 1 is related to embryoid body (EB) formation. To induce neuroprogenitor cells, EBs were cultured in the presence of retinoic acid, N2 supplement and fibroblast growth factor followed by culturing in a neurobasal medium containing B27, N2 supplements for additional 10 days, to allow the maturation and development of neuronal progenitor cells. The neurogenic differentiation was confirmed by immunostaining for markers of mature neurons. The differentiated neurons were positive for Tuj1 and Tau1. Real-time PCR dates indicated the expression of Nestin and Neuro D (neuroprogenitor markers) in induced cells at the second stage of the differentiation protocol. The differentiated mature neurons exhibited the specific neuron markers Map2 and β-tubulin. The functional maturity of neurons was confirmed by an electrophysiological analysis of passive and active neural membrane properties. These findings indicated a differentiation capacity of ES-like cells derived from the testis to functionally mature neurons, which proposes them as a novel cell source for neuroregenerative medicine.

  1. Transgenic Expression of Osteoactivin/gpnmb Enhances Bone Formation in Vivo and Osteoprogenitor Differentiation ex Vivo

    PubMed Central

    Frara, Nagat; Abdelmagid, Samir M.; Sondag, Gregory R.; Moussa, Fouad M.; Yingling, Vanessa R.; Owen, Thomas A.; Popoff, Steven N.; Barbe, Mary F.; Safadi, Fayez F.


    Initial identification of osteoactivin (OA)/glycoprotein non-melanoma clone B (gpnmb) was demonstrated in an osteopetrotic rat model, where OA expression was increased 3-fold in mutant bones, compared to normal. OA mRNA and protein expression increase during active bone regeneration post-fracture, and primary rat osteoblasts show increased OA expression during differentiation in vitro. To further examine OA/gpnmb as an osteoinductive agent, we characterized the skeletal phenotype of transgenic mouse overexpressing OA/gpnmb under the CMV-promoter (OA-Tg). Western blot analysis showed increased OA/gpnmb in OA-Tg osteoblasts, compared to wild-type (WT). In OA-Tg mouse femurs versus WT littermates, micro-CT analysis showed increased trabecular bone volume and thickness, and cortical bone thickness; histomorphometry showed increased osteoblast numbers, bone formation and mineral apposition rates in OA-Tg mice; and biomechanical testing showed higher peak moment and stiffness. Given that OA/gpnmb is also over-expressed in osteoclasts in OA-Tg mice, we evaluated bone resorption by ELISA and histomorphometry, and observed decreased serum CTX-1 and RANK-L, and decreased osteoclast numbers in OA-Tg, compared to WT mice, indicating decreased bone remodeling in OA-Tg mice. The proliferation rate of OA-Tg osteoblasts in vitro was higher, compared to WT, as was alkaline phosphatase staining and activity, the latter indicating enhanced differentiation of OA-Tg osteoprogenitors. Quantitative RT-PCR analysis showed increased TGF-β1 and TGF-β receptors I and II expression in OA-Tg osteoblasts, compared to WT. Together, these data suggest that OA overexpression has an osteoinductive effect on bone mass in vivo and stimulates osteoprogenitor differentiation ex vivo. PMID:25899717

  2. Identification of differentially expressed genes in Mongolian sheep ovaries by suppression subtractive hybridization.


    He, Xiaolong; Li, Bei; Wang, Feng; Tian, Chunying; Rong, Weiheng; Liu, Yongbin


    Fecundity is an important trait in sheep. Because it is directly related to production costs and efficiency, it has great economic impact in sheep husbandry. Because Mongolian sheep are a longstanding, indigenous breed, they are genetically related to most other breeds of sheep in China. The study of genes related to reproductive traits is essential to improving the fecundity of Mongolian sheep. In the present study, suppression subtractive hybridization (SSH) was performed using forward and reverse nested primers on cDNA libraries from ovarian tissue of single-bearing (S) and biparous (B) Mongolian sheep (MS). This yielded 768 clones. The length of the inserted fragments ranged from 150 to 1000 bp. From these, dot blot hybridization followed by sequencing and homology blast search in GenBank resolved 373 differentially expressed clones, representing 185 gene sequences (homology >85% and length >200 bp), 10 expressed sequence tags (ESTs; homology >95% and length >100 bp), and 4 unknown ESTs. The analysis of the differentially expressed gene functions allowed these genes to be categorized into seven groups: cell/body or immune defense, metabolism, transportation, nucleic acid modification, cell development, signal transduction, and cell structure. Four differentially expressed genes, a disintegrin and metalloproteinase with thrombospondin motifs 1 (ADAMTS1), inhibitor of DNA binding 3 (ID3), bone morphogenetic protein 6 (BMP6), and integrin beta 1 (ITGB1), were randomly selected and verified using relative quantitative real-time polymerase chain reaction (RQ-PCR). The expression of these genes in BMS ovaries was 30.06, 11.55, 0.82, and 1.12-fold that of SMS ovaries, respectively.

  3. Innate immune gene expression differentiates the early avian intestinal response between Salmonella and Campylobacter.


    Shaughnessy, Ronan G; Meade, Kieran G; Cahalane, Sarah; Allan, Brenda; Reiman, Carla; Callanan, John J; O'Farrelly, Cliona


    Salmonella enterica serovar Typhimurium and Campylobacter jejuni are major human pathogens, yet colonise chickens without causing pathology. The aim of this study was to compare intestinal innate immune responses to both bacterial species, in a 4-week-old broiler chicken model. Challenged and control birds were sacrificed and tissue samples taken for histopathology and RNA extraction. No significant clinical or pathological changes were observed in response to infection with either bacterial species. Expression of selected genes involved in pathogen detection and the innate immune response were profiled in caecal tissues by quantitative real-time PCR. TLR4 and TLR21 gene expression was transiently increased in response to both bacterial species (P<0.05). Significant increases in TLR5 and TLR15 gene expression were detected in response to S. Typhimurium but not to C. jejuni. Transient increases of proinflammatory cytokine (IL6 and IFNG) and chemokine (IL8 and K60) genes increased as early as 6h in response to S. Typhimurium. Minimal cytokine gene expression was detected in response to C. jejuni after 20h. IL8 gene expression however, was significantly increased by 24-fold (P<0.01). The differential expression profiles of innate immune genes in both infection models shed light on the tailored responses of the host immune system to specific microbes. It is further evidence that innate regulation of these responses is an important prerequisite to preventing development of disease.

  4. Differential expression of fertility genes boule and dazl in Chinese sturgeon (Acipenser sinensis), a basal fish.


    Ye, Huan; Li, Chuang-Ju; Yue, Hua-Mei; Yang, Xiao-Ge; Wei, Qi-Wei


    The gene family DAZ (deleted in Azoospermia), including boule, dazl and DAZ, performs highly conserved functions in germ cell development and fertility across animal phyla. Differential expression patterns have been demonstrated for the family members in invertebrates and vertebrates including fish. Here, we report the identification of boule and dazl and their expression at both RNA and protein levels in developing and mature gonads of Chinese sturgeon (Acipenser sinensis). Firstly, the isolation of the boule and dazl genes in Chinese sturgeon and the observation of the two genes in coelacanth suggest that dazl originated after the divergence of bony fish from cartilaginous fish but before the emergence of the Actinistia. Quantitative real-time PCR and western blot analyses reveal that boule and dazl RNA and proteins are restricted to the testis and ovary. In situ hybridization and fluorescent immunohistochemistry show that the bisexual mitotic and meiotic germ cell expression of dazl RNA and protein is conserved in vertebrates, while Chinese sturgeon boule RNA and protein exhibit mitotic and meiotic expression in the testis, and also likely display mitotic and meiotic expression in female. Moreover, we directly demonstrate for the first time that sturgeon Balbiani body/mitochondrial cloud disperses in the cytoplasm of early developing oocytes and co-localizes with Dazl to some extent. Finally, urbilaterian boule may also have an ancestral function in oogenesis. Taken together, these results provide useful information on the evolution of DAZ family genes, expression patterns and functions in animal reproduction.

  5. Transcription in space--environmental vs. genetic effects on differential immune gene expression.


    Lenz, Tobias L


    Understanding how organisms adapt to their local environment is one of the key goals in molecular ecology. Adaptation can be achieved through qualitative changes in the coding sequence and/or quantitative changes in gene expression, where the optimal dosage of a gene's product in a given environment is being selected for. Differences in gene expression among populations inhabiting distinct environments can be suggestive of locally adapted gene regulation and have thus been studied in different species (Whitehead & Crawford ; Hodgins-Davis & Townsend ). However, in contrast to a gene's coding sequence, its expression level at a given point in time may depend on various factors, including the current environment. Although critical for understanding the extent of local adaptation, it is usually difficult to disentangle the heritable differences in gene regulation from environmental effects. In this issue of Molecular Ecology, Stutz et al. () describe an experiment in which they reciprocally transplanted three-spined sticklebacks (Gasterosteus aculeatus) between independent pairs of small and large lakes. Their experimental design allows them to attribute differences in gene expression among sticklebacks either to lake of origin or destination lake. Interestingly, they find that translocated sticklebacks show a pattern of gene expression more similar to individuals from the destination lake than to individuals from the lake of origin, suggesting that expression of the targeted genes is more strongly regulated by environmental effects than by genetics. The environmental effect by itself is not entirely surprising; however, the relative extent of it is. Especially when put in the context of local adaptation and population differentiation, as done here, these findings cast a new light onto the heritability of differential gene expression and specifically its relative importance during population divergence and ultimately ecological speciation.

  6. Trace elements as quantitative probes of differentiation processes in planetary interiors

    SciTech Connect

    Drake, M.J.


    Abundances of trace elements in extrusive igneous rocks may be used as petrological and geochemical probes of the source regions of the rocks if differentiation processes, partition coefficients, phase equilibria, and initial concentrations in the source region are known. The characteristic trace element signature that each mineral in the source region imparts on the magma forms the conceptual basis for trace element modeling. The task of the trace element geochemist is to solve mathematically the inverse problem. Given trace element abundances in a magma, what is the ode of its source region. The most successful modeling has been performed for small planetary bodies which underwent relatively simple igneous differentiation events. An example is the eucrite parent body, a planet which produced basals at approx. =4.6 Gy. and has been quiescent ever since. This simple differentiation history permits the calculation of its bulk composition (a feldspathic peridotite) and has led to the tentative identification of asteroid 4 Westa as the eucrite parent body. The differentiation of iron meteorite groups in parent body cores is amenable to similar treatment. The 'anomalous' behavior of Cr, suggests that IIIA, B irons and main group pallasites equilibrated with troilite, spinel, ferromagnesian silicates, or some combination thereof. The moon has undergone more complex differentiation, and quantitative geochemical modeling is correspondingly more difficult. Nevertheless, modeling the two-stage evolution of mare basals raises the possibility that the primordial moon did not have chondritic relative abundances of such refractory elements as Ca, Al, U, and the rare-earth elements. The nonchondritic element ratios are characteristic of planetary, not nebular, fractionation processes and are consistent with the derivation of the moon from a precursor planet, possibly the earth.

  7. MicroRNA expression profiles differentiate chronic pain condition subtypes

    PubMed Central

    Ciszek, Brittney P.; Khan, Asma A.; Dang, Hong; Slade, Gary D.; Smith, Shad; Bair, Eric; Maixner, William; Zolnoun, Denniz; Nackley, Andrea G.


    Chronic pain is a significant healthcare problem, ineffectively treated due to its unclear etiology and heterogeneous clinical presentation. Emerging evidence demonstrates that microRNAs regulate the expression of pain-relevant genes, yet little is known about their role in chronic pain. Here, we evaluate the relationship between pain, psychological characteristics, plasma cytokines and whole blood microRNAs in 22 healthy controls (HC); 33 subjects with chronic pelvic pain (vestibulodynia: VBD); and 23 subjects with VBD and irritable bowel syndrome (VBD+IBS). VBD subjects were similar to HCs in self-reported pain, psychological profiles and remote bodily pain. VBD+IBS subjects reported decreased health and function; and an increase in headaches, somatization and remote bodily pain. Furthermore, VBD subjects exhibited a balance in pro- and anti-inflammatory cytokines, while VBD+IBS subjects failed to exhibit a compensatory increase in anti-inflammatory cytokines. VBD subjects differed from controls in expression of 10 microRNAs of predicted importance for pain and estrogen signaling. VBD+IBS subjects differed from controls in expression of 11 microRNAs of predicted importance for pain, cell physiology and insulin signaling. MicroRNA expression was correlated with pain-relevant phenotypes and cytokine levels. These results suggest microRNAs represent a valuable tool for differentiating VBD subtypes (localized pain with apparent peripheral neurosensory disruption versus widespread pain with a central sensory contribution) that may require different treatment approaches. PMID:26166255

  8. Differential gene expression in Symbiodinium microadriaticum clade B following stress.


    Karako-Lampert, S; Hershkovits, G; Stambler, N; Simon-Blecher, N; Achituv, Y; Dubinsky, Z; Katcoff, D J


    Coral bleaching is caused by the loss of symbiont zooxanthellae and/or decrease in their pigments. Since the algal symbionts provide the energy basis for corals and whole reefs, their loss or impairment of function leads to widespread mortality. This phenomenon has been documented numerous times in recent years, and has extensively damaged coral reefs all over the world. Temperature has been found to be the major cause of bleaching, and rising sea temperatures have increased the frequency of these catastrophic episodes. To characterize the response of zooxanthellae to temperature stress at the molecular level, we used the mRNA differential display technique to monitor changes in the abundance of specific mRNA species in the cell under different temperature conditions. Axenically grown zooxanthellae were exposed to a range of temperatures (21.7, 17, 26 degrees C) before extraction of their mRNA. Of numerous differentially expressed sequences, seven mRNA species were amplified by the polymerase chain reaction (PCR) and sequenced. One of those sequences was positively identified as encoding a multifunction cell surface aminopeptidase, dipeptidyl peptidase IV, which is active in cell matrix adhesion. Our work illustrates the power of the differential display technique as a useful tool to study the response of zooxanthellae to stressors.

  9. LSOSS: Detection of Cancer Outlier Differential Gene Expression.


    Wang, Yupeng; Rekaya, Romdhane


    Detection of differential gene expression using microarray technology has received considerable interest in cancer research studies. Recently, many researchers discovered that oncogenes may be activated in some but not all samples in a given disease group. The existing statistical tools for detecting differentially expressed genes in a subset of the disease group mainly include cancer outlier profile analysis (COPA), outlier sum (OS), outlier robust t-statistic (ORT) and maximum ordered subset t-statistics (MOST). In this study, another approach named Least Sum of Ordered Subset Square t-statistic (LSOSS) is proposed. The results of our simulation studies indicated that LSOSS often has more power than previous statistical methods. When applied to real human breast and prostate cancer data sets, LSOSS was competitive in terms of the biological relevance of top ranked genes. Furthermore, a modified hierarchical clustering method was developed to classify the heterogeneous gene activation patterns of human breast cancer samples based on the significant genes detected by LSOSS. Three classes of gene activation patterns, which correspond to estrogen receptor (ER)+, ER- and a mixture of ER+ and ER-, were detected and each class was assigned a different gene signature.

  10. Differential protein expression in Phalaenopsis under low temperature.


    Yuan, Xiu-Yun; Liang, Fang; Jiang, Su-Hua; Wan, Mo-Fei; Ma, Jie; Zhang, Xian-Yun; Cui, Bo


    A comparative proteomic analysis was carried out to explore the molecular mechanisms of responses to cold stress in Phalaenopsis after treated by low temperature (13/8 °C day/night) for 15 days. Differentially expressed proteins were examined using two-dimensional electrophoresis (2-DE) and matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF-TOF/MS). Among 85 differentially expressed proteins, 73 distinct proteins were identified. Comparative analysis revealed that the identified proteins mainly participate in photosynthesis, protein synthesis, folding and degradation, respiration, defense response, amino acid metabolism, energy pathway, cytoskeleton, transcription regulation, signal transduction, and seed storage protein, while the functional classification of the remaining four proteins was not determined. These data suggested that the proteins might work cooperatively to establish a new homeostasis under cold stress; 37 % of the identified cold-responsive proteins were associated with various aspects of chloroplast physiology, and 56 % of them were predicted to be located in the chloroplasts, implying that the cold stress tolerance of Phalaenopsis was achieved, at least partly, by regulation of chloroplast function. Moreover, the protein destination control, which was mediated by chaperones and proteases, plays an important role in tolerance to cold stress.

  11. Detection and differentiation of human parvovirus variants by commercial quantitative real-time PCR tests.


    Hokynar, Kati; Norja, Päivi; Laitinen, Harri; Palomäki, Pekka; Garbarg-Chenon, Antoine; Ranki, Annamari; Hedman, Klaus; Söderlund-Venermo, Maria


    Parvovirus B19 causes a variety of diseases in humans, with outcomes ranging from asymptomatic to severe, such as chronic anemia in immunocompromised patients or fetal hydrops and death after maternal infection during pregnancy. The virus may be transmitted via plasma-derived products. According to the results of solvent-detergent safety studies, an upper limit of B19 DNA in plasma pools was recently defined. To restrict the input of B19 virus into production pools, a quantitative nucleic acid test is a prerequisite. We examined the suitability of the two commercial quantitative B19 PCR tests, LightCycler-Parvovirus B19 quantification kit (Roche Diagnostics) and RealArt Parvo B19 LC PCR (Artus) for detection, quantification, and differentiation of the three known B19 genotypes, including the newly described erythrovirus variants (genotypes 2 and 3). The former kit was highly sensitive for genotype 1 but was not suitable for detection of genotype 2 or one of two genotype 3 strains. The latter kit detected and differentiated all three genotypes, albeit with lower sensitivity for one of the genotype-3 strains. We furthermore assessed the prevalence of the three B19 virus genotypes in blood donors, by screening pooled plasma samples derived from 140,160 Finnish blood-donor units. None of the pools contained detectable levels of B19 virus genotypes 2 or 3. The origin, mode of transmission, and clinical significance of these genotypes are unknown and deserve further study. The RealArt Parvo B19 LC PCR is suitable for detection, quantification, and differentiation of all three B19 virus genotypes in molecular and clinical research.

  12. Adipogenic differentiation state-specific gene expression as related to bovine carcass adiposity.


    Pickworth, C L; Loerch, S C; Velleman, S G; Pate, J L; Poole, D H; Fluharty, F L


    Genetic regulation of the site of fat deposition is not well defined. The objective of this study was to investigate adipogenic differentiation state-specific gene expression in feedlot cattle (>75% Angus; <25% Simmental parentage) of varying adipose accretion patterns. Four groups of 4 steers were selected via ultrasound for the following adipose tissue characteristics: low subcutaneous-low intramuscular (LSQ-LIM), low subcutaneous-high intramuscular (LSQ-HIM), high subcutaneous-low intramuscular (HSQ-LIM), and high subcutaneous-high intramuscular (HSQ-HIM). Adipose tissue from the subcutaneous (SQ) and intramuscular (IM) depots was collected at slaughter. The relative expression of adipogenic genes was evaluated using quantitative PCR. Data were analyzed using the mixed model of SAS, and gene expression data were analyzed using covariate analysis with ribosomal protein L19 as the covariate. No interactions (P > 0.10) were observed between IM and SQ adipose tissue depots for any of the variables measured. Therefore, only the main effects of high and low accretion within a depot and the effects of depot are reported. Steers with LIM had smaller mean diameter IM adipocytes (P < 0.001) than HIM steers. Steers with HSQ had larger mean diameter SQ adipocytes (P < 0.001) than LSQ. However, there were no differences (P > 0.10) in any of the genes measured due to high or low adipose accretion. Preadipogenic delta-like kinase1 mRNA was greater in the IM than the SQ adipose tissue; conversely, differentiating and adipogenic genes, lipoprotein lipase, PPARγ, fatty acid synthetase, and fatty acid binding protein 4 were greater (P < 0.001) in the SQ than the IM depot. Intramuscular adipocytes were smaller than SQ adipocytes and had greater expression of the preadipogenic gene, indicating that more hyperplasia was occurring. Meanwhile, SQ adipose tissue contained much larger (P < 0.001) adipocytes that had a greater expression (P < 0.001) of differentiating and adipogenic

  13. [Expression pattern of myeloid differentiation-related transcription factor mRNA in differentiation of NB4 and HL-60 cells induced by all-trans retinoic acid].


    Wu, Yong; Li, Xian-Fang; Yang, Jing-Hui; Liao, Xiao-Ying; Huang, Hui-Fang; Chen, Yuan-Zhong


    Hematopoiesis is coordinated by a complex regulatory network of transcription factors that involves proliferation, differentiation and maturation of a very small population of pluripotent hematopoietic stem cells with self-renewing and differentiating into various specialized and distinct blood cell types. Malfunction of transcription factors may lead to diseases such as acute myeloid leukemia (AML). The purpose of this study was to investigate the expression pattern of transcription factor mRNA in acute myeloid leukemia (AML) cells during in vitro differentiation. The 2 human leukemic cell lines HL-60 and NB4 had been used as model cell lines. Differentiation of HL-60 and NB4 cells was induced by all-trans retinoic acid (ATRA) for 4 days. Morphological changes were observed by May-Grunwald Giemsa stainings, the CD11b expression level was detected by flow cytometry. Transcription factor mRNA profiles (PU.1, C/EBPα, ε, γ, GATA-1, GATA-2) were determined by real time RT-PCR during in vitro HL-60 and NB4 differentiation; The expression level of transcription factor mRNA was relatively quantitatively analyzed by using 2(-ΔΔCT) and compared with control group. The results showed that the expression levels of PU.1 and C/EBP ε mRNA in NB4 differentiation group were 5.75 and 6.16, respectively, which were significantly higher than those in untreated group; while the expression level of C/EBPα, γ, GATA-1, GATA-2 mRNA in NB4 differentiation group were 62%, 31%, 63% and 8.7% respectively, which were significantly lower than those in untreated group; In HL-60 differentiation group, the expression levels of PU.1, C/EBPα, ε were 1.97, 1.95 and 2.35 respectively, which were significantly higher than those in untreated group; while the expression levels of C/EBPγ, GATA-1, GATA-2 in HL-60 differentiation group were 20%, 21% and 18% respectively, which were significantly lower than those in untreated group. It is concluded that dysregulation of transcription factors is a

  14. Differential expression of GAP-43 and neurofilament during peripheral nerve regeneration through bio-artificial conduits.


    Carriel, Víctor; Garzón, Ingrid; Campos, Antonio; Cornelissen, Maria; Alaminos, Miguel


    Nerve conduits are promising alternatives for repairing nerve gaps; they provide a close microenvironment that supports nerve regeneration. In this sense, histological analysis of axonal growth is a determinant to achieve successful nerve regeneration. To evaluate this process, the most-used immunohistochemical markers are neurofilament (NF), β-III tubulin and, infrequently, GAP-43. However, GAP-43 expression in long-term nerve regeneration models is still poorly understood. In this study we analysed GAP-43 expression and its correlation with NF and S-100, using three tissue-engineering approaches with different regeneration profiles. A 10 mm gap was created in the sciatic nerve of 12 rats and repaired using collagen conduits or collagen conduits filled with fibrin-agarose hydrogels or with hydrogels containing autologous adipose-derived mesenchymal stem cells (ADMSCs). After 12 weeks the conduits were harvested for histological analysis. Our results confirm the long-term expression of GAP-43 in all groups. The expression of GAP-43 and NF was significantly higher in the group with ADMSCs. Interestingly, GAP-43 was observed in immature, newly formed axons and NF in thicker and mature axons. These proteins were not co-expressed, demonstrating their differential expression in newly formed nerve fascicles. Our descriptive and quantitative histological analysis of GAP-43 and NFL allowed us to determine, with high accuracy, the heterogenic population of axons at different stages of maturation in three tissue-engineering approaches. Finally, to perform a complete assessment of axonal regeneration, the quantitative immunohistochemical evaluation of both GAP-43 and NF could be a useful quality control in tissue engineering. Copyright © 2014 John Wiley & Sons, Ltd.

  15. Differential expression and subcellular distribution of dystrophin Dp71 isoforms during differentiation process.


    Marquez, F G; Cisneros, B; Garcia, F; Ceja, V; Velázquez, F; Depardón, F; Cervantes, L; Rendón, A; Mornet, D; Rosas-vargas, H; Mustre, M; Montañez, C


    Dp71 is the major product of the Duchenne muscular dystrophy gene in the brain. In order to study the function of Dp71 in the nervous system we examined the expression of Dp71 isoforms in PC12 rat pheochromocytoma cell line, a well-established system to study neuronal differentiation. We show by reverse transcriptase-polymerase chain reaction and Western blot assays that PC12 cells express two Dp71 isoforms. One isoform lacks exon 71 and the other isoform lacks exons 71 and 78 (Dp71d and Dp71f isoforms respectively). Nerve growth factor-induced neuronal differentiation of PC12 cells results in differential regulation of the expression and subcellular localization of Dp71 isoforms: a) the amount of Dp71f protein increases nine-fold in total extracts while Dp71d increases up to seven-fold in nuclear extracts; b) Dp71f relocates from the cytoplasm to neuritic processes, being prominent at varicosities and the growth cone; c) Dp71d relocates almost entirely to the nucleus and is detected to a lower extent in the cytoplasm and neuritic processes. Dp71f co-localizes with beta-dystroglycan and synaptophysin while Dp71d co-localizes with beta-dystroglycan in the nucleus. Dp71d accumulates at cell-cell contacts where Dp71f is absent. These results suggest that Dp71d and Dp71f associate with different subcellular complexes and therefore may have distinct functions in PC12 cells.

  16. Oligonucleotide microarray identifies genes differentially expressed during tumorigenesis of DMBA-induced pancreatic cancer in rats.


    Guo, Jun-Chao; Li, Jian; Yang, Ying-Chi; Zhou, Li; Zhang, Tai-Ping; Zhao, Yu-Pei


    The extremely dismal prognosis of pancreatic cancer (PC) is attributed, at least in part, to lack of early diagnosis. Therefore, identifying differentially expressed genes in multiple steps of tumorigenesis of PC is of great interest. In the present study, a 7,12-dimethylbenzanthraene (DMBA)-induced PC model was established in male Sprague-Dawley rats. The gene expression profile was screened using an oligonucleotide microarray, followed by real-time quantitative polymerase chain reaction (qRT-PCR) and immunohistochemical staining validation. A total of 661 differentially expressed genes were identified in stages of pancreatic carcinogenesis. According to GO classification, these genes were involved in multiple molecular pathways. Using two-way hierarchical clustering analysis, normal pancreas, acute and chronic pancreatitis, PanIN, early and advanced pancreatic cancer were completely discriminated. Furthermore, 11 upregulated and 142 downregulated genes (probes) were found by Mann-Kendall trend Monotone test, indicating homologous genes of rat and human. The qRT-PCR and immunohistochemistry analysis of CXCR7 and UBe2c, two of the identified genes, confirmed the microarray results. In human PC cell lines, knockdown of CXCR7 resulted in decreased migration and invasion. Collectively, our data identified several promising markers and therapeutic targets of PC based on a comprehensive screening and systemic validation.

  17. Identification of differentially expressed genes in parasitic phase Miamiensis avidus (Ciliophora: Scuticociliatia) using suppression subtractive hybridization.


    Lee, Eun Hye; Kim, Ki Hong


    Miamiensis avidus, a causative agent of scuticociliatosis in cultured marine fish, can live not only in seawater as a free-living organism but also in fish as a parasite. In this study, a cDNA library of representative mRNAs more specific to parasitic phase M. avidus was generated using suppression subtractive hybridization (SSH), and 520 clones selected from the SSH library were single-run sequenced. The differential gene expression patterns were confirmed by semi-quantitative reverse-transcription PCR. Of the 510 SSH clones, 21 clones of 6 putative genes did not match sequences in the public database. The expectation values (E-values) of 117 clones encoding 9 putative genes were greater than 1 x 10(-5). The other 372 clones that met the criterion of E value <1 x 10-5 were matched to 26 known sequences in the database. Genes associated with signal transduction, cell proliferation, membrane transportation, protein translocation, and transcription regulation were preferentially expressed in parasitic phase M. avidus. The differential gene expression may be needed for the ciliates to survive in the host fish, and the corresponding proteins might be used as antigen candidates for development of scuticociliatosis vaccines.

  18. Differential gene expression in patients with subsyndromal symptomatic depression and major depressive disorder

    PubMed Central

    Li, Zezhi; Wang, Qingzhong; Wang, Xuemei; Yuan, Chengmei; Wang, Zuowei; Hong, Wu; Lu, Weihong; Cao, Lan; Chen, Jun; Wang, Yong; Yu, Shunying; Zhou, Yimin; Yi, Zhenghui; Fang, Yiru


    Background Subsyndromal symptomatic depression (SSD) is a subtype of subthreshold depressive and can lead to significant psychosocial functional impairment. Although the pathogenesis of major depressive disorder (MDD) and SSD still remains poorly understood, a set of studies have found that many same genetic factors play important roles in the etiology of these two disorders. Nowadays, the differential gene expression between MDD and SSD is still unknown. In our previous study, we compared the expression profile and made the classification with the leukocytes by using whole-genome cRNA microarrays among drug-free first-episode subjects with SSD, MDD and matched healthy controls (8 subjects in each group), and finally determined 48 gene expression signatures. Based on these findings, we further clarify whether these genes mRNA was different expressed in peripheral blood in patients with SSD, MDD and healthy controls (60 subjects respectively) Method With the help of the quantitative real-time reverse transcription-polymerase chain reaction (RT-qPCR), we gained gene relative expression levels among the three groups. Results We found that there are three of the forty eight co-regulated genes had differential expression in peripheral blood among the three groups, which are CD84, STRN, CTNS gene (F = 3.528, p = 0.034; F = 3.382, p = 0.039; F = 3.801, p = 0.026, respectively) while there were no significant differences for other genes. Conclusion CD84, STRN, CTNS gene may have significant value for performing diagnostic functions and classifying SSD, MDD and healthy controls. PMID:28333931

  19. Phylogenetic ANOVA: The Expression Variance and Evolution Model for Quantitative Trait Evolution.


    Rohlfs, Rori V; Nielsen, Rasmus


    A number of methods have been developed for modeling the evolution of a quantitative trait on a phylogeny. These methods have received renewed interest in the context of genome-wide studies of gene expression, in which the expression levels of many genes can be modeled as quantitative traits. We here develop a new method for joint analyses of quantitative traits within- and between species, the Expression Variance and Evolution (EVE) model. The model parameterizes the ratio of population to evolutionary expression variance, facilitating a wide variety of analyses, including a test for lineage-specific shifts in expression level, and a phylogenetic ANOVA that can detect genes with increased or decreased ratios of expression divergence to diversity, analogous to the famous Hudson Kreitman Aguadé (HKA) test used to detect selection at the DNA level. We use simulations to explore the properties of these tests under a variety of circumstances and show that the phylogenetic ANOVA is more accurate than the standard ANOVA (no accounting for phylogeny) sometimes used in transcriptomics. We then apply the EVE model to a mammalian phylogeny of 15 species typed for expression levels in liver tissue. We identify genes with high expression divergence between species as candidates for expression level adaptation, and genes with high expression diversity within species as candidates for expression level conservation and/or plasticity. Using the test for lineage-specific expression shifts, we identify several candidate genes for expression level adaptation on the catarrhine and human lineages, including genes putatively related to dietary changes in humans. We compare these results to those reported previously using a model which ignores expression variance within species, uncovering important differences in performance. We demonstrate the necessity for a phylogenetic model in comparative expression studies and show the utility of the EVE model to detect expression divergence

  20. Differential expression of ribosome-inactivating protein genes during somatic embryogenesis in spinach (Spinacia oleracea).


    Kawade, Kensuke; Ishizaki, Takuma; Masuda, Kiyoshi


    Root segments from spinach (Spinacia oleracea L. cv. Jiromaru) seedlings form embryogenic callus (EC) that responded to exogenous GA(3) by accumulating a 31-kDa glycoprotein [BP31 or S. oleracea ribosome-inactivating protein (EC (SoRIP1)] in association with the expression of embryogenic potential. Microsequencing of this protein revealed significant similarity with type 1 RIPs. We identified cDNAs for SoRIP1 and S. oleracea RIP2 (SoRIP2), a novel RIP having a consensus shiga/ricin toxic domain and performed a comparative analysis of the expression of SoRIPs during somatic embryogenesis. Western blotting and quantitative polymerase chain reaction analyses revealed that the expression of SoRIP1 in calli increased remarkably in association with the acquisition of embryogenic potential, although the expression in somatic embryos decreased moderately with their development. However, the expression of SoRIP2 in calli remained low and constant but increased markedly with the development of somatic embryos. Treatment of callus with GA(3) and/or ABA for 24 h, or with ABA for a longer period, failed to stimulate the expression of either gene. Immunohistochemistry showed that SoRIP1 preferentially accumulated in the proembryos and peripheral meristem of somatic embryos early in development. Appreciable expression of SoRIP2 was not detected in the callus, but intense expression was found in the epidermis of somatic embryos. These results suggest that the expression of spinach RIP genes is differentially regulated in a development-dependent fashion during somatic embryogenesis in spinach.

  1. Information theory, gene expression, and combinatorial regulation: a quantitative analysis.


    Jost, Jürgen; Scherrer, Klaus


    According to a functional definition of the term "gene", a protein-coding gene corresponds to a polypeptide and, hence, a coding sequence. It is therefore as such not yet present at the DNA level, but assembled from possibly heterogeneous pieces in the course of RNA processing. Assembly and regulation of genes require, thus, information about when and in which quantity specific polypeptides are to be produced. To assess this, we draw upon precise biochemical data. On the basis of our conceptual framework, we also develop formal models for the coordinated expression of specific sets of genes through the interaction of transcripts and mRNAs and with proteins via a precise putative regulatory code. Thus, the nucleotides in transcripts and mRNA are not only arranged into amino acid-coding triplets, but at the same time may participate in regulatory oligomotifs that provide binding sites for specific proteins. We can then quantify and compare product and regulatory information involved in gene expression and regulation.

  2. Quantification of differentially expressed genes in Daphnia magna exposed to rubber wastewater.


    Jo, Hun-Je; Jung, Jinho


    In this study, differentially expressed genes (DEGs) were investigated in Daphnia magna exposed to rubber wastewater using an annealing control primer (ACP)-based polymerase chain reaction (PCR) and real-time PCR. Among three identified DEGs, two genes (DEG1 and DEG2) were up-regulated, and DEG1 expression was well-correlated to a logarithm of rubber wastewater concentration (r2=0.971, p<0.0001). In addition, DEG1 expression in D. magna exposed to rubber wastewater was strongly correlated with that of D. magna exposed to Zn (r2=0.9513, p<0.05), suggesting that the induction of DEG1 was caused by Zn, which is the dominant toxicant in rubber wastewater. In addition, DEG1 expression was more sensitive to toxicants than immobility, which is the conventional endpoint in toxicity tests using D. magna. The lowest observed effect concentrations (LOEC) determined using immobility tests were 2.5% for rubber wastewater and 1.6mgl(-1) for Zn. In contrast, a significant increase in DEG1 expression was observed at exposure concentrations of as low as 0.6% rubber wastewater and 0.2mgl(-1) Zn. These results indicate that DEG1 is a sensitive and quantitative biomarker of water and wastewater containing Zn.

  3. Differential Gene Expression in Foxtail Millet during Incompatible Interaction with Uromyces setariae-italicae

    PubMed Central

    Dong, Li; Bai, Hui; Quan, Jian Zhang; Liu, Lei; Dong, Zhi-Ping


    Foxtail millet (Setaria italica) is an important food and fodder grain crop that is grown for human consumption. Production of this species is affected by several plant diseases, such as rust. The cultivar Shilixiang has been identified as resistant to the foxtail millet rust pathogen, Uromyces setariae-italicae. In order to identify signaling pathways and genes related to the plant’s defense mechanisms against rust, the Shilixiang cultivar was used to construct a digital gene expression (DGE) library during the interaction of foxtail millet with U. setariae-italicae. In this study, we determined the most abundant differentially expressed signaling pathways of up-regulated genes in foxtail millet and identified significantly up-regulated genes. Finally, quantitative real-time polymerase chain reaction (qRT-PCR) analysis was used to analyze the expression of nine selected genes, and the patterns observed agreed well with DGE analysis. Expression levels of the genes were also compared between a resistant cultivar Shilixiang and a susceptible cultivar Yugu-1, and the result indicated that expression level of Shilixiang is higher than that of Yugu-1. This study reveals the relatively comprehensive mechanisms of rust-responsive transcription in foxtail millet. PMID:25885767

  4. Differential pattern of integrin receptor expression in differentiated and anaplastic thyroid cancer cell lines.


    Hoffmann, S; Maschuw, K; Hassan, I; Reckzeh, B; Wunderlich, A; Lingelbach, S; Zielke, A


    Adhesion of tumor cells to the extracellular matrix (ECM) is a crucial step for the development of metastatic disease and is mediated by specific integrin receptor molecules (IRM). The pattern of metastatic spread differs substantially among the various histotypes of thyroid cancer (TC). However, IRM have only occasionally been characterized in TC until now. IRM expression was investigated in 10 differentiated (FTC133, 236, 238, HTC, HTC TSHr, XTC, PTC4.0/4.2, TPC1, Kat5) and two anaplastic TC cell lines (ATC, C643, Hth74), primary cultures of normal thyroid tissue (Thy1,3), and thyroid cancer specimens (TCS). Expression of 16 IRM (beta1-4, beta7, alpha1-6, alphaV, alphaIIb, alphaL, alphaM, alphaX) and of four IRM heterodimers (alpha2beta1, alpha5beta1, alphaVbeta3, alphaVbeta5), was analyzed by fluorescent-activated cell sorter (FACS) and immunohistochemical staining. Thyroid tumor cell adhesion to ECM proteins and their IRM expression in response to thyrotropin (TSH) was assessed. Follicular TC cell lines presented high levels of integrins alpha2, alpha3, alpha5, beta1, beta3 and low levels of alpha1, whereas papillary lines expressed a heterogenous pattern of IRM, dominated by alpha5 and beta1. ATC mainly displayed integrins alpha2, alpha3, alpha5, alpha6, beta1 and low levels of alpha1, alpha4 and alphaV. Integrin heterodimers correlated with monomer expression. Evaluation of TCS largely confirmed these results with few exceptions, namely alpha4, alpha6, and beta3. The ability of TC cell lines to adhere to purified ECM proteins correlated with IRM expression. TSH induced TC cell adhesion in a dose-dependent fashion, despite an unchanged array of IRM expression or level of a particular IRM. Thyroid carcinoma cell lines of different histogenetic background display profoundly different patterns of IRM expression that appear to correlate with tumor aggressiveness. In vitro adhesion to ECM proteins and IRM expression concur. Finally, TSH-stimulated adhesion of

  5. Differential expression of endocannabinoid system-related genes in the dorsal hippocampus following expression and reinstatement of morphine conditioned place preference in mice.


    Li, Wei; Zhang, Cong-Li; Qiu, Zheng-Guo


    The endocannabinoid signaling plays a critical role in mediating rewarding effects to morphine. The relative stability for the expression and reinstatement of morphine conditioned place preference (CPP) suggests the involvement of differential neuroadaptations in learned associations between environmental cues and morphine. Changes in gene expression in hippocampus through the endogenous cannabinoid system (eCB) may accompany and mediate the development of such neuroadaptations to repeated morphine stimulation. To test this possibility, we systematically compared the expression of eCB-related genes in the dorsal hippocampus following the expression, extinction, and reinstatement of morphine CPP using quantitative RT-PCR analyses. We found that expression of morphine CPP was associated with significant increases in mRNA expression for the primary clearance routes for anandamide (AEA) and 2-AG (fatty acid amide hydrolase [FAAH] and monoacylglycerol lipase [MAGL], respectively), but with reductions in cannabinoid 1 receptors (CB1R) and CB2R in dorsal hippocampus following the expression of CPP. However, our results indicated that decreased in MAGL and increased CB1R mRNA levels were accompanied with morphine CPP reinstatement. No significant changes in mRNA expression for enzymes involved in AEA and 2-AG biosynthesis (N-acylphosphatidylethanolamine phospholipase D [NAPEPLD] and diacylglycerol lipase-α/β [DAGLα/β], respectively) were found in all conditions. These results suggest that differential regulation of the synthesis and/or degradation of the eCB system contribute to the expression and reinstatement of morphine CPP.

  6. Quantitative Changes in Gimap3 and Gimap5 Expression Modify Mitochondrial DNA Segregation in Mice

    PubMed Central

    Jokinen, Riikka; Lahtinen, Taina; Marttinen, Paula; Myöhänen, Maarit; Ruotsalainen, Pilvi; Yeung, Nicolas; Shvetsova, Antonina; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Öhman, Tiina; Nyman, Tuula A.; Weiler, Hartmut; Battersby, Brendan J.


    Mammalian mitochondrial DNA (mtDNA) is a high-copy maternally inherited genome essential for aerobic energy metabolism. Mutations in mtDNA can lead to heteroplasmy, the co-occurence of two different mtDNA variants in the same cell, which can segregate in a tissue-specific manner affecting the onset and severity of mitochondrial dysfunction. To investigate mechanisms regulating mtDNA segregation we use a heteroplasmic mouse model with two polymorphic neutral mtDNA haplotypes (NZB and BALB) that displays tissue-specific and age-dependent selection for mtDNA haplotypes. In the hematopoietic compartment there is selection for the BALB mtDNA haplotype, a phenotype that can be modified by allelic variants of Gimap3. Gimap3 is a tail-anchored member of the GTPase of the immunity-associated protein (Gimap) family of protein scaffolds important for leukocyte development and survival. Here we show how the expression of two murine Gimap3 alleles from Mus musculus domesticus and M. m. castaneus differentially affect mtDNA segregation. The castaneus allele has incorporated a uORF (upstream open reading frame) in-frame with the Gimap3 mRNA that impairs translation and imparts a negative effect on the steady-state protein abundance. We found that quantitative changes in the expression of Gimap3 and the paralogue Gimap5, which encodes a lysosomal protein, affect mtDNA segregation in the mouse hematopoietic tissues. We also show that Gimap3 localizes to the endoplasmic reticulum and not mitochondria as previously reported. Collectively these data show that the abundance of protein scaffolds on the endoplasmic reticulum and lysosomes are important to the segregation of the mitochondrial genome in the mouse hematopoietic compartment. PMID:25808953

  7. Screening and identification of differentially expressed genes in goose hepatocytes exposed to free fatty acid.


    Pan, Zhixiong; Wang, Jiwen; Kang, Bo; Lu, Lizhi; Han, Chunchun; Tang, Hui; Li, Liang; Xu, Feng; Zhou, Zehui; Lv, Jia


    The overaccumulation of triglycerides in hepatocytes induces hepatic steatosis; however, little is known about the mechanism of goose hepatic steatosis. The aim of this study was to define an experimental model of hepatocellular steatosis with TG overaccumulation and minimal cytotoxicity, using a mixture of various proportions of oleate and palmitate free fatty acids (FFAs) to induce fat-overloading, then using suppressive subtractive hybridization and a quantitative PCR approach to identify genes with higher or lower expression levels after the treatment of cells with FFA mixtures. Overall, 502 differentially expressed clones, representing 21 novel genes and 87 known genes, were detected by SSH. Based on functional clustering, up- and down-regulated genes were mostly related to carbohydrate and lipid metabolism, enzyme activity and signal transduction. The expression of 20 selected clones involved with carbohydrate and lipid metabolism pathways was further studied by quantitative PCR. The data indicated that six clones similar to the genes ChREBP, FoxO1, apoB, IHPK2, KIF1B, and FSP27, which participate in de novo synthesis of fatty acid and secretion of very low density lipoproteins, had significantly lower expression levels in the hepatocytes treated with FFA mixtures. Meanwhile, 13 clones similar to the genes DGAT-1, ACSL1, DHRS7, PPARα, L-FABP, DGAT-2, PCK, ACSL3, CPT-1, A-FABP, PPARβ, MAT, and ALDOB had significantly higher expression levels in the hepatocytes treated with FFA mixtures. These results suggest that several metabolic pathways are altered in goose hepatocytes, which may be useful for further research into the molecular mechanism of goose hepatic steatosis.

  8. Molecular identification and expression of the Foxl2 gene during gonadal sex differentiation in northern snakehead Channa argus.


    Wang, Dan-Dan; Zhang, Gui-Rong; Wei, Kai-Jian; Ji, Wei; Gardner, Jonathan P A; Yang, Rui-Bin; Chen, Kun-Ci


    Channa argus is one of the most commercially important fish species in China. Studies show that males of C. argus grow faster than females at the same age. In order to explore the sex differentiation mechanism of C. argus, we isolated the full length of the sex-related gene Foxl2 cDNA and analysed its expression patterns during gonadal sex differentiation. Alignment of known Foxl2 amino acid sequences from vertebrates confirmed the conservation of the Foxl2 open reading frame, especially the forkhead domain and C-terminal region. Quantitative RT-PCR revealed that Foxl2 is predominantly expressed in brain, pituitary, gill and ovary, with its highest level in ovary but low levels in testis and other tissues, reflecting a potential role for Foxl2 in the brain-pituitary-gonad axis in C. argus. Our ontogenetic stage data showed that C. argus Foxl2 expression was significantly upregulated from 1 to 11 days posthatching (dph) and that the initiation of expression preceded the first anatomical ovarian differentiation (27 dph), suggesting that Foxl2 might play a potential role in early gonadal sex differentiation in C. argus. In addition, the Foxl2 protein was primarily located in granulosa cells surrounding the oocytes of mature C. argus, implying that Foxl2 may have a basic function in granulosa cell differentiation and the maintenance of oocytes.

  9. Differential and quantitative molecular analysis of ischemia complexity reduction by isotopic labeling of proteins using a neural embryonic stem cell model.


    Schrattenholz, A; Wozny, W; Klemm, M; Schroer, K; Stegmann, W; Cahill, M A


    The analysis of rapid changes of protein expression in living systems in response to insults requires rigorous methods of complexity reduction. To control dynamic pattern of hundreds or even thousands of protein isoforms, we applied a novel method of differential molecular analysis to a cellular model which is suited to study ischemia. Neural derivatives of murine embryonic stem cells were exposed to chemical ischemia. The model was used to obtain starting material for a quantitative differential proteomics analysis. Fractionation of phosphoproteins from these samples and subsequent identification by mass spectrometry of differential proteins provide proof of principle of how novel molecular analytical tools provide new insight into the network of neuroprotective molecular events during specific situations of neuronal stress and related pharmaceutical intervention. Our results indicate a particular role of an isoform of the acidic calcium-independent phospholipase A2 in this type of insult.

  10. Hyperspectral and differential CARS microscopy for quantitative chemical imaging in human adipocytes.


    Di Napoli, Claudia; Pope, Iestyn; Masia, Francesco; Watson, Peter; Langbein, Wolfgang; Borri, Paola


    In this work, we demonstrate the applicability of coherent anti-Stokes Raman scattering (CARS) micro-spectroscopy for quantitative chemical imaging of saturated and unsaturated lipids in human stem-cell derived adipocytes. We compare dual-frequency/differential CARS (D-CARS), which enables rapid imaging and simple data analysis, with broadband hyperspectral CARS microscopy analyzed using an unsupervised phase-retrieval and factorization method recently developed by us for quantitative chemical image analysis. Measurements were taken in the vibrational fingerprint region (1200-2000/cm) and in the CH stretch region (2600-3300/cm) using a home-built CARS set-up which enables hyperspectral imaging with 10/cm resolution via spectral focussing from a single broadband 5 fs Ti:Sa laser source. Through a ratiometric analysis, both D-CARS and phase-retrieved hyperspectral CARS determine the concentration of unsaturated lipids with comparable accuracy in the fingerprint region, while in the CH stretch region D-CARS provides only a qualitative contrast owing to its non-linear behavior. When analyzing hyperspectral CARS images using the blind factorization into susceptibilities and concentrations of chemical components recently demonstrated by us, we are able to determine vol:vol concentrations of different lipid components and spatially resolve inhomogeneities in lipid composition with superior accuracy compared to state-of-the art ratiometric methods.

  11. Differential proteomic and tissue expression analyses identify valuable diagnostic biomarkers of hepatocellular differentiation and hepatoid adenocarcinomas.


    Reis, Henning; Padden, Juliet; Ahrens, Maike; Pütter, Carolin; Bertram, Stefanie; Pott, Leona L; Reis, Anna-Carinna; Weber, Frank; Juntermanns, Benjamin; Hoffmann, Andreas-C; Eisenacher, Martin; Schlaak, Joörg F; Canbay, Ali; Meyer, Helmut E; Sitek, Barbara; Baba, Hideo A


    The exact discrimination of lesions with true hepatocellular differentiation from secondary tumours and neoplasms with hepatocellular histomorphology like hepatoid adenocarcinomas (HAC) is crucial. Therefore, we aimed to identify ancillary protein biomarkers by using complementary proteomic techniques (2D-DIGE, label-free MS). The identified candidates were immunohistochemically validated in 14 paired samples of hepatocellular carcinoma (HCC) and non-tumourous liver tissue (NT). The candidates and HepPar1/Arginase1 were afterwards tested for consistency in a large cohort of hepatocellular lesions and NT (n = 290), non-hepatocellular malignancies (n = 383) and HAC (n = 13). Eight non-redundant, differentially expressed proteins were suitable for further immunohistochemical validation and four (ABAT, BHMT, FABP1, HAOX1) for further evaluation. Sensitivity and specificity rates for HCC/HAC were as follows: HepPar1 80.2%, 94.3% / 80.2%, 46.2%; Arginase1 82%, 99.4% / 82%, 69.2%; BHMT 61.4%, 93.8% / 61.4%, 100%; ABAT 84.4%, 33.7% / 84.4%, 30.8%; FABP1 87.2%, 95% / 87.2%, 69.2%; HAOX1 95.5%, 36.3% / 95.5%, 46.2%. The best 2×/3× biomarker panels for the diagnosis of HCC consisted of Arginase1/HAOX1 and BHMT/Arginase1/HAOX1 and for HAC consisted of Arginase1/FABP1 and BHMT/Arginase1/FABP1. In summary, we successfully identified, validated and benchmarked protein biomarker candidates of hepatocellular differentiation. BHMT in particular exhibited superior diagnostic characteristics in hepatocellular lesions and specifically in HAC. BHMT is therefore a promising (panel based) biomarker candidate in the differential diagnostic process of lesions with hepatocellular aspect.

  12. Quantitative assessment of gene expression network module-validation methods.


    Li, Bing; Zhang, Yingying; Yu, Yanan; Wang, Pengqian; Wang, Yongcheng; Wang, Zhong; Wang, Yongyan


    Validation of pluripotent modules in diverse networks holds enormous potential for systems biology and network pharmacology. An arising challenge is how to assess the accuracy of discovering all potential modules from multi-omic networks and validating their architectural characteristics based on innovative computational methods beyond function enrichment and biological validation. To display the framework progress in this domain, we systematically divided the existing Computational Validation Approaches based on Modular Architecture (CVAMA) into topology-based approaches (TBA) and statistics-based approaches (SBA). We compared the available module validation methods based on 11 gene expression datasets, and partially consistent results in the form of homogeneous models were obtained with each individual approach, whereas discrepant contradictory results were found between TBA and SBA. The TBA of the Zsummary value had a higher Validation Success Ratio (VSR) (51%) and a higher Fluctuation Ratio (FR) (80.92%), whereas the SBA of the approximately unbiased (AU) p-value had a lower VSR (12.3%) and a lower FR (45.84%). The Gray area simulated study revealed a consistent result for these two models and indicated a lower Variation Ratio (VR) (8.10%) of TBA at 6 simulated levels. Despite facing many novel challenges and evidence limitations, CVAMA may offer novel insights into modular networks.

  13. Successful pod infections by Moniliophthora roreri result in differential Theobroma cacao gene expression depending on the clone's level of tolerance.


    Ali, Shahin S; Melnick, Rachel L; Crozier, Jayne; Phillips-Mora, Wilberth; Strem, Mary D; Shao, Jonathan; Zhang, Dapeng; Sicher, Richard; Meinhardt, Lyndel; Bailey, Bryan A


    An understanding of the tolerance mechanisms of Theobroma cacao used against Moniliophthora roreri, the causal agent of frosty pod rot, is important for the generation of stable disease-tolerant clones. A comparative view was obtained of transcript populations of infected pods from two susceptible and two tolerant clones using RNA sequence (RNA-Seq) analysis. A total of 3009 transcripts showed differential expression among clones. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis of differentially expressed genes indicated shifts in 152 different metabolic pathways between the tolerant and susceptible clones. Real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) analyses of 36 genes verified the differential expression. Regression analysis validated a uniform progression in gene expression in association with infection levels and fungal loads in the susceptible clones. Expression patterns observed in the susceptible clones diverged in tolerant clones, with many genes showing higher expression at a low level of infection and fungal load. Principal coordinate analyses of real-time qRT-PCR data separated the gene expression patterns between susceptible and tolerant clones for pods showing malformation. Although some genes were constitutively differentially expressed between clones, most results suggested that defence responses were induced at low fungal load in the tolerant clones. Several elicitor-responsive genes were highly expressed in tolerant clones, suggesting rapid recognition of the pathogen and induction of defence genes. Expression patterns suggested that the jasmonic acid-ethylene- and/or salicylic acid-mediated defence pathways were activated in the tolerant clones, being enhanced by reduced brassinosteroid (BR) biosynthesis and catabolic inactivation of both BR and abscisic acids. Finally, several genes associated with hypersensitive response-like cell death were also induced in tolerant clones.

  14. Density based pruning for identification of differentially expressed genes from microarray data

    PubMed Central


    Motivation Identification of differentially expressed genes from microarray datasets is one of the most important analyses for microarray data mining. Popular algorithms such as statistical t-test rank genes based on a single statistics. The false positive rate of these methods can be improved by considering other features of differentially expressed genes. Results We proposed a pattern recognition strategy for identifying differentially expressed genes. Genes are mapped to a two dimension feature space composed of average difference of gene expression and average expression levels. A density based pruning algorithm (DB Pruning) is developed to screen out potential differentially expressed genes usually located in the sparse boundary region. Biases of popular algorithms for identifying differentially expressed genes are visually characterized. Experiments on 17 datasets from Gene Omnibus Database (GEO) with experimentally verified differentially expressed genes showed that DB pruning can significantly improve the prediction accuracy of popular identification algorithms such as t-test, rank product, and fold change. Conclusions Density based pruning of non-differentially expressed genes is an effective method for enhancing statistical testing based algorithms for identifying differentially expressed genes. It improves t-test, rank product, and fold change by 11% to 50% in the numbers of identified true differentially expressed genes. The source code of DB pruning is freely available on our website PMID:21047384

  15. Analysis of differentially expressed genes in placental tissues of preeclampsia patients using microarray combined with the Connectivity Map database.


    Song, Y; Liu, J; Huang, S; Zhang, L


    Preeclampsia (PE), which affects 2-7% of human pregnancies, causes significant maternal and neonatal morbidity and mortality. To better understand the pathophysiology of PE, the gene expression profiles of placental tissue from 5 controls and 5 PE patients were assessed using microarray. A total of 224 transcripts were significantly differentially expressed (>2-fold change and q value <0.05, SAM software). Gene Ontology (GO) enrichment analysis indicated that genes involved in hypoxia and oxidative and reductive processes were significantly changed. Three differentially expressed genes (DEGs) involved in these biological processes were further verified by quantitative real-time PCR. Finally, the potential therapeutic agents for PE were explored via the Connectivity Map database. In conclusion, the data obtained in this study might provide clues to better understand the pathophysiology of PE and to identify potential therapeutic agents for PE patients.

  16. Identification of differentially expressed genes involved in transient regeneration of the neonatal C57BL/6J mouse heart by digital gene expression profiling.


    Liu, Ming; Zhu, Jin-Gai; Yu, Zhang-Bin; Song, Gui-Xian; Shen, Ya-Hui; Liu, Yao-Qiu; Zhu, Chun; Qian, Ling-Mei


    Accumulating evidence has revealed that the mammalian heart possesses a measurable capacity for renewal. Neonatal mice retain a regenerative capacity over a short time-frame (≤6 days), but this capacity is lost by 7 days of age. In the present study, differential gene expression profiling of mouse cardiac tissue was performed to further elucidate the mechanisms underlying this process. The global gene expression patterns of the neonatal C57BL/6J mouse heart were examined at three key time-points (1, 6 and 7 days old) using digital gene expression analysis. In the distribution of total clean tags, high-expression tags (>100 copies) were found to be predominant, whereas low expression tags (<5 copies) occupied the majority of distinct tag distributions. In total, 306 differentially expressed genes (DEGs) were detected in cardiac tissue, with the expression levels of 115 genes upregulated and those of 191 genes downregulated in 7-day-old mice compared with expression levels in 1- and 6-day-old mice, respectively. The expression levels of five DEGs were confirmed using quantitative polymerase chain reaction. Gene ontology analysis revealed a large proportion of DEGs distributed throughout the cell, and these DEGs were associated with binding as well as catalytic, hydrolase, transferase and molecular transducer activities. Furthermore, these genes were involved in cellular, metabolic and developmental processes, as well as biological regulation and signaling pathways. Pathway analysis identified the oxidative phosphorylation pathway to be the process most significantly putatively affected by the differential expression of these genes. These data provide the basis for future analysis of the gene expression patterns that regulate the molecular mechanism of cardiac regeneration.

  17. Widespread DNA hypomethylation and differential gene expression in Turner syndrome

    PubMed Central

    Trolle, Christian; Nielsen, Morten Muhlig; Skakkebæk, Anne; Lamy, Philippe; Vang, Søren; Hedegaard, Jakob; Nordentoft, Iver; Ørntoft, Torben Falck; Pedersen, Jakob Skou; Gravholt, Claus Højbjerg


    Adults with 45,X monosomy (Turner syndrome) reflect a surviving minority since more than 99% of fetuses with 45,X monosomy die in utero. In adulthood 45,X monosomy is associated with increased morbidity and mortality, although strikingly heterogeneous with some individuals left untouched while others suffer from cardiovascular disease, autoimmune disease and infertility. The present study investigates the leukocyte DNAmethylation profile by using the 450K-Illumina Infinium assay and the leukocyte RNA-expression profile in 45,X monosomy compared with karyotypically normal female and male controls. We present results illustrating that genome wide X-chromosome RNA-expression profile, autosomal DNA-methylation profile, and the X-chromosome methylation profile clearly distinguish Turner syndrome from controls. Our results reveal genome wide hypomethylation with most differentially methylated positions showing a medium level of methylation. Contrary to previous studies, applying a single loci specific analysis at well-defined DNA loci, our results indicate that the hypomethylation extend to repetitive elements. We describe novel candidate genes that could be involved in comorbidity in TS and explain congenital urinary malformations (PRKX), premature ovarian failure (KDM6A), and aortic aneurysm formation (ZFYVE9 and TIMP1). PMID:27687697

  18. Twist1 correlates with poor differentiation and progression in gastric adenocarcinoma via elevation of FGFR2 expression

    PubMed Central

    Zhu, Dong-Yuan; Guo, Qi-Sen; Li, Yan-Liang; Cui, Bin; Guo, Jun; Liu, Ji-Xiao; Li, Peng


    AIM: To explore the correlation between Twist-related protein (Twist)1, fibroblast growth factor receptor (FGFR)2 and gastric adenocarcinoma differentiation and progression. METHODS: We evaluated Twist1 and FGFR2 in 52 gastric adenocarcinoma samples by immunohistochemistry and quantitative real time polymerase chain reaction, and analyzed the correlation between Twist1, FGFR2 and cancer differentiation. We also detected Twist1 and FGFR2 expression in gastric adenocarcinoma cell lines, and evaluated Twist1 influence on FGFR2 expression. In addition, we studied the role of FGFR2 in Twist1-promoted cancer progression, including proliferation, invasion and epithelial-mesenchymal transition (EMT). RESULTS: Twist1 and FGFR2 were detected in almost all the gastric adenocarcinoma samples. Twist1 (P = 0.0213) and FGFR2 (P = 0.0310) mRNA levels had a significant association with gastric adenocarcinoma differentiation. Moreover, Twist1 and FGFR2 expression in poorly differentiated cells (SNU-1 and SNU-16) was notably higher than in well-differentiated cells (MKN-7 and MKN-28). In poorly differentiated gastric adenocarcinomas, FGFR2 mRNA level was significantly positively correlated with Twist1 mRNA level (P = 0.004). Twist1 was proved to promote FGFR2 by regulating Twist1 expression by knockdown and overexpression. Additionally, Twist1 could induce proliferation, invasion and EMT in gastric cancer; of these, FGFR2 was required for invasion and EMT, rather than proliferation. CONCLUSION: Twist1 and FGFR2 are highly associated with differentiation of gastric adenocarcinoma; Twist1 can facilitate invasion and EMT in gastric adenocarcinoma via promotion of FGFR2 expression. PMID:25561797

  19. Analysis of differential protein expression in normal and neoplastic human breast epithelial cell lines

    SciTech Connect

    Williams, K.; Chubb, C.; Huberman, E.; Giometti, C.S.


    High resolution two dimensional get electrophoresis (2DE) and database analysis was used to establish protein expression patterns for cultured normal human mammary epithelial cells and thirteen breast cancer cell lines. The Human Breast Epithelial Cell database contains the 2DE protein patterns, including relative protein abundances, for each cell line, plus a composite pattern that contains all the common and specifically expressed proteins from all the cell lines. Significant differences in protein expression, both qualitative and quantitative, were observed not only between normal cells and tumor cells, but also among the tumor cell lines. Eight percent of the consistently detected proteins were found in significantly (P < 0.001) variable levels among the cell lines. Using a combination of immunostaining, comigration with purified protein, subcellular fractionation, and amino-terminal protein sequencing, we identified a subset of the differentially expressed proteins. These identified proteins include the cytoskeletal proteins actin, tubulin, vimentin, and cytokeratins. The cell lines can be classified into four distinct groups based on their intermediate filament protein profile. We also identified heat shock proteins; hsp27, hsp60, and hsp70 varied in abundance and in some cases in the relative phosphorylation levels among the cell lines. Finally, we identified IMP dehydrogenase in each of the cell lines, and found the levels of this enzyme in the tumor cell lines elevated 2- to 20-fold relative to the levels in normal cells.

  20. Differential gene expression and bioinformatics analysis of copper resistance gene afe_1073 in Acidithiobacillus ferrooxidans.


    Hu, Qi; Wu, Xueling; Jiang, Ying; Liu, Yuandong; Liang, Yili; Liu, Xueduan; Yin, Huaqun; Baba, Ngom


    Copper resistance of acidophilic bacteria is very significant in bioleaching of copper ore since high concentration of copper are harmful to the growth of organisms. Copper resistance gene afe_1073 was putatively considered to be involved in copper homeostasis in Acidithiobacillus ferrooxidans ATCC23270. In the present study, differential expression of afe_1073 in A. ferrooxidans strain DY26 and DC was assessed with quantitative reverse transcription polymerase chain reaction. The results showed the expression of afe_1073 in two strains increased with the increment of copper concentrations. The expression of DY26 was lower than that of DC at the same copper concentration although A. ferrooxidans strain DY26 possessed higher copper resistance than strain DC. In addition, bioinformatics analysis showed AFE_1073 was a typical transmembrane protein P1b1-ATPase, which could reduce the harm of Cu(+) by pumping it out from the cell. There were two mutation sites in AFE_1073 between DY26 and DC and one may change the hydrophobicity of AFE_1073, which could enhance the ability of DY26 to pump out Cu(+). Therefore, DY26 needed less gene expression of afe_1073 for resisting copper toxicity than that of DC at the same copper stress. Our study will be beneficial to understanding the copper resistance mechanism of A. ferrooxidans.

  1. Cassava (Manihot esculenta Krantz) genome harbors KNOX genes differentially expressed during storage root development.


    Guo, D; Li, H L; Tang, X; Peng, S Q


    In plants, homeodomain proteins play a critical role in regulating various aspects of plant growth and development. KNOX proteins are members of the homeodomain protein family. The KNOX transcription factors have been reported from Arabidopsis, rice, and other higher plants. The recent publication of the draft genome sequence of cassava (Manihot esculenta Krantz) has allowed a genome-wide search for M. esculenta KNOX (MeKNOX) transcription factors and the comparison of these positively identified proteins with their homologs in model plants. In the present study, we identified 12 MeKNOX genes in the cassava genome and grouped them into two distinct subfamilies based on their domain composition and phylogenetic analysis. Furthermore, semi-quantitative reverse transcription polymerase chain reaction analysis was performed to elucidate the expression profiles of these genes in different tissues and during various stages of root development. The analysis of MeKNOX expression profiles of indicated that 12 MeKNOX genes display differential expressions either in their transcript abundance or expression patterns.

  2. Identification of differentially expressed genes in the development of osteosarcoma using RNA-seq

    PubMed Central

    Yang, Yihao; Zhang, Ya; Qu, Xin; Xia, Junfeng; Li, Dongqi; Li, Xiaojuan; Wang, Yu; He, Zewei; Li, Su; Zhou, Yonghong; Xie, Lin; Yang, Zuozhang


    Objective Osteosarcoma (OS) is a malignant bone tumor with high morbidity in young adults and adolescents. This study aimed to discover potential early diagnosis biomarkers in OS. Results In total, 111 differentially expressed genes (DEGs) were identified in primary OS compared with normal controls and 235 DEGs were identified in metastatic OS compared with primary OS. AURKB and PPP2R2B were the significantly up-regulated and down-regulated hub proteins, respectively, in the PPI protein-protein network (PPI) network of primary OS. ISG15 and BTRC were the significantly up-regulated and down-regulated hub proteins, respectively, in the network of metastatic OS. The DEGs in metastatic OS compared with primary OS were significantly enriched in the arachidonic acid metabolism, malaria, and chemokine signaling pathways. Finally, we employed quantitative real-time polymerase chain reaction (qRT-PCR) to validate the expression levels of candidate DEGs and the results indicated that our bioinformatics approach was acceptable. Materials and Methods The mRNA expression profiling of 20 subjects was obtained through high-throughput RNA-sequencing. DEGs were identified between primary OS and normal Control, and between primary OS and metastatic OS, respectively. Functional annotation and PPI networks were used to obtain insights into the functions of DEGs. qRT-PCR was performed to detect the expression levels of dysregulated genes in OS. Conclusions Our work might provide groundwork for the further exploration of tumorigenesis and metastasis mechanisms of OS. PMID:27888627

  3. Differential response to bacteria, and TOLLIP expression, in the human respiratory tract

    PubMed Central

    Moncayo-Nieto, Olga Lucia; Wilkinson, Thomas S; Brittan, Mairi; McHugh, Brian J; Jones, Richard O; Conway Morris, Andrew; Walker, William S; Davidson, Donald J; Simpson, A John


    Objectives The observation that pathogenic bacteria are commonly tolerated in the human nose, yet drive florid inflammation in the lung, is poorly understood, partly due to limited availability of primary human cells from each location. We compared responses to bacterial virulence factors in primary human nasal and alveolar cells, and characterised the distribution of Toll-interacting protein (TOLLIP; an inhibitor of Toll-like receptor (TLR) signalling) in the human respiratory tract. Methods Primary cells were isolated from nasal brushings and lung tissue taken from patients undergoing pulmonary resection. Cells were exposed to lipopolysaccharide, lipoteichoic acid, peptidoglycan, CpG-C DNA or tumour necrosis factor (TNF). Cytokines were measured in cell supernatants. TOLLIP was characterised using quantitative real-time PCR and immunofluorescence. Results In primary alveolar, but not primary nasal, cells peptidoglycan significantly increased secretion of interleukin (IL)-1β, IL-6, IL-8, IL-10 and TNF. TLR2 expression was significantly higher in alveolar cells and correlated with IL-8 production. TOLLIP expression was significantly greater in nasal cells. Conclusion In conclusion, primary human alveolar epithelial cells are significantly more responsive to peptidoglycan than primary nasal epithelial cells. This may partly be explained by differential TLR2 expression. TOLLIP is expressed widely in the human respiratory tract, and may contribute to the regulation of inflammatory responses. PMID:25478190

  4. Differential expression of laminin receptors in human hepatocellular carcinoma

    PubMed Central

    Ozaki, I; Yamamoto, K; Mizuta, T; Kajihara, S; Fukushima, N; Setoguchi, Y; Morito, F; Sakai, T


    Background—Laminin receptors are involved in cell-extracellular matrix interactions in malignant cells that show invasion and metastasis. Hepatocellular carcinoma frequently shows early invasion into blood vessels, and intrahepatic and extrahepatic metastases. However, the role of laminin receptors in hepatocellular carcinoma is unknown. 
Aims—To examine the expression of mRNA for laminin receptors and their isoforms in hepatocellular carcinoma. 
Methods—The expression of several laminin receptors, including α1 integrin, α6 integrin and its isoforms α6A and α6B, β1 integrin and its isoforms β1A and β1B, and 32kD/67kDa laminin binding protein was examined in human hepatocellular carcinomas and non-cancerous liver tissues using the reverse transcription polymerase chain reaction. 
Results—α6 Integrin, β1 integrin, and laminin binding protein showed notably increased expression in hepatocellular carcinoma, compared with non-cancerous liver tissue, although the α1 integrin did not show a significant change. Furthermore, β1B integrin, a splicing variant of β1 integrin, was overexpressed in hepatocellular carcinoma while the β1A integrin isoform did not show significant changes between hepatocellular carcinoma and surrounding non-cancerous liver tissue. 
Conclusions—The differential upregulation of laminin receptors and their splicing isoforms was shown in hepatocellular carcinoma, suggesting that certain laminin receptors and their isoforms may be involved in the development and progression of hepatocellular carcinoma. 

 Keywords: laminin receptor; integrin α6β1; hepatocellular carcinoma PMID:9824613

  5. Integrated analysis of differentially expressed genes in breast cancer pathogenesis

    PubMed Central



    The present study aimed to detect the differences between breast cancer cells and normal breast cells, and investigate the potential pathogenetic mechanisms of breast cancer. The sample GSE9574 series was downloaded, and the microarray data was analyzed to identify differentially expressed genes (DEGs). Gene Ontology (GO) cluster analysis using the GO Enrichment Analysis Software Toolkit platform and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis for DEGs was conducted using the Gene Set Analysis Toolkit V2. In addition, a protein-protein interaction (PPI) network was constructed, and target sites of potential transcription factors and potential microRNA (miRNA) molecules were screened. A total of 106 DEGs were identified in the current study. Based on these DEGs, a number of bio-pathways appear to be altered in breast cancer, including a number of signaling pathways and other disease-associated pathways, as indicated by KEGG pathway clustering analysis. ATF3, JUND, FOSB and JUNB were detected in the PPI network. Finally, the most significant potential target sites of transcription factors and miRNAs in breast cancer, which are important in the regulation of gene expression, were identified. The results indicated that miR-93, miR-302A, miR-302B, miR-302C, miR-302D, miR-372, miR-373, miR-520E and miR-520A were closely associated with the occurrence and development of breast cancer. Therefore, changes in the expression of these miRNAs may alter cell metabolism and trigger the development of breast cancer and its complications. PMID:26137106

  6. Differential expression of a retrotransposable element, Rex6, in Colossoma macropomum fish from different Amazonian environments

    PubMed Central

    Barbosa, Cassiane Martins; Mareco, Edson Assunção; Silva, Maeli Dal Pai; Martins, Cesar; Alves-Costa, Fernanda Antunes


    Transposable elements (TEs) are DNA sequences that have the ability to move and replicate within the genomes. TEs can be classified according to their intermediates of transposition, RNA (retrotransposons) or DNA. In some aquatic organisms, it has been observed that environmental factors such as pH, temperature and pollution may stimulate differential transcription and mobilization of retrotransposons. In light of this information, the present study sought to evaluate the expression of Rex6 TE transcripts in Colossoma macropomum, which is a very commercially exploited fish in Brazil. In order to establish a comparative analysis using real-time PCR, the samples were collected from Amazonian rivers with different physical and chemical characteristics (distinguished by clear water and black water). Quantitative RT-PCR analyses revealed a differential pattern of expression between tissues collected from different types of water (clear and black waters). When it came to the hepatic and muscle tissues sampled, the levels of Rex6 transcripts were significantly different between the two Amazonian water types. These results suggest that environmental conditions operate differently in the regulation of Rex6 transcription in C. macropomum, results which have implications in the reshaping of the genome against environmental variations. PMID:25089227

  7. Localization and differential regulation of angiotensinogen mRNA expression in the vessel wall.

    PubMed Central

    Naftilan, A J; Zuo, W M; Inglefinger, J; Ryan, T J; Pratt, R E; Dzau, V J


    Recent data demonstrate the existence of a vascular renin angiotensin system. In this study we examine the localization of angiotensinogen mRNA in the blood vessel wall of two rat strains, the Wistar and Wistar Kyoto (WKY), as well as the regulation of vascular angiotensinogen mRNA expression by dietary sodium. Northern blot analysis and in situ hybridization histochemistry demonstrate that in both strains angiotensinogen mRNA is detected in the aortic medial smooth muscle layer as well as the periaortic fat. In WKY rats fed a 1.6% sodium diet, angiotensinogen mRNA concentration is 2.6-fold higher in the periaortic fat than in the smooth muscle, as analyzed by quantitative slot blot hybridization. Angiotensinogen mRNA expression in the medial smooth muscle layer is sodium regulated. After 5 d of a low (0.02%) sodium diet, smooth muscle angiotensinogen mRNA levels increase 3.2-fold (P less than 0.005) as compared with the 1.6% sodium diet. In contrast, angiotensinogen mRNA level in the periaortic fat is not influenced by sodium diet. In summary, our data demonstrate regional (smooth muscle vs. periaortic fat) differential regulation of angiotensinogen mRNA levels in the blood vessel wall by sodium. This regional differential regulation by sodium may have important physiological implications. Images PMID:2010543

  8. Differential gene expression in Streptococcus pneumoniae in response to various iron sources.


    Gupta, R; Shah, P; Swiatlo, E


    Iron is a critical co-factor for several enzymes and is known to regulate gene expression in many pathogens. Streptococcus pneumoniae (pneumococcus) normally colonizes the upper respiratory mucosa, which is an iron-restricted environment. In contrast, during bacteremia available iron from heme and non-heme proteins potentially increases. In iron-depleted medium pneumococcal strain TIGR4 showed reduced growth, however, addition of several physiological iron sources restored growth. Gene expression of selected known and putative pneumococcal virulence factors was analyzed by quantitative RT-PCR in response to iron sources in vitro and during colonization, pneumonia, and bacteremia in a mouse model. Change in mRNA levels relative to transcription in iron-depleted medium was reported. In presence of iron sources, transcription of cps4A, zmpA, pavA, hemolysin and a putative exfoliative toxin was significantly increased, but nanB was suppressed. Hemoglobin at physiological concentration repressed ply and pspA expression. Ferritin, an acute phase protein, increased expression of an iron ABC transporter and repressed expression of a bacterial non-heme iron-containing ferritin. Transcription of cps4A, nanB, hemolysin, and a putative exfoliative toxin were significantly up-regulated during pneumonia and bacteremia, while mRNA of pavA and non-heme ferritin were expressed at higher levels during pneumonia and carriage. An iron ABC transporter was most up-regulated during bacteremia, while pspA and ply were expressed only in pneumonia. Transcription of zmpA was elevated during both pneumonia and bacteremia. These findings suggest that a subset of virulence genes in pneumococci is differentially regulated in response to the quantity and form of iron sources available in a host.

  9. Genetic diversity analysis of buffalo fatty acid synthase (FASN) gene and its differential expression among bovines.


    Niranjan, S K; Goyal, S; Dubey, P K; Kumari, N; Mishra, S K; Mukesh, M; Kataria, R S


    Fatty Acid Synthase (FASN) gene seems to be structurally and functionally different in bovines in view of their distinctive fatty acid synthesis process. Structural variation and differential expression of FASN gene is reported in buffalo (Bubalus bubalis), a bovine species close to cattle, in this study. Amino acid sequence and phylogenetic analysis of functionally important thioesterase (TE) domain of FASN revealed its conserved nature across mammals. Amino acid residues at TE domain, responsible for substrate binding and processing, were found to be invariant in all the mammalian species. A total of seven polymorphic nucleotide sites, including two in coding region of TE domain were identified across the 10 buffalo populations of riverine and swamp types. G and C alleles were found almost fixed at g18996 and g19056 loci, respectively in riverine buffaloes. Principal component analysis of three SNPs (g18433, g18996 and g19056) revealed distinct classification of riverine and swamp buffalo populations. Reverse Transcription-PCR amplification of mRNA corresponding to exon 8-10 region of buffalo FASN helped in identification of two transcript variants; one transcript of 565 nucleotides and another alternate transcript of 207 nucleotides, seems to have arisen through alternative splicing. Both the transcripts were found to be expressed in most of the vital tissues of buffalo with the highest expression in mammary gland. Semi-quantitative and real-time expression analysis across 13 different buffalo tissues revealed its highest expression in lactating mammary gland. When compared, expression of FASN was also found to be higher in liver, adipose and skeletal muscle of buffalo tissues, than cattle. However, the FASN expression was highest in adipose among the three tissues in both the species. Results indicate structural and functional distinctiveness of bovine FASN. Presence of alternate splicing in buffalo FASN also seems to be a unique phenomenon to the bovines

  10. Sexual dimorphic expression of genes in gonads during early differentiation of a teleost fish, the Nile tilapia Oreochromis niloticus.


    Ijiri, Shigeho; Kaneko, Hiroyo; Kobayashi, Tohru; Wang, De-Shou; Sakai, Fumie; Paul-Prasanth, Bindhu; Nakamura, Masaru; Nagahama, Yoshitaka


    The Nile tilapia, a gonochoristic teleost fish with an XX/XY sex-determining system, provides an excellent model for studying gonadal sex differentiation because genetic all-females and all-males are available. In this study, we used quantitative real-time RT-PCR to determine the precise timing of the gonadal expression of 17 genes thought to be associated with gonadal sex differentiation in vertebrates. Gonads were isolated from all-female and all-male tilapia before (5-15 days after hatching [dah]) and after (25-70 dah) morphological sex differentiation. The transcript of aromatase (cyp19a1a), an enzyme responsible for producing estradiol-17beta, was expressed only in XX gonads at 5 dah, with a marked elevation in expression thereafter. In contrast, mRNA expression of steroid 11beta-hydroxylase (cyp11b2), an enzyme responsible for the synthesis of 11-ketotestosterone (11-KT, a potent androgen in fish), was found in XY gonads from 35 dah only. These results, combined with the presence of transcripts for other steroidogenic enzymes and estrogen receptors in XX gonads at 5-7 dah, are consistent with our earlier suggestion that estradiol-17beta plays a critical role in ovarian differentiation in tilapia, whereas a role for 11-KT in testicular differentiation is questionable. A close relationship between the expression of foxl2, but not nr5a1 (Ad4BP/SF-1), and that of cyp19a1a in XX gonads suggests an important role for Foxl2 in the transcriptional regulation of cyp19a1a. Dmrt1 exhibited a male-specific expression in XY gonads from 6 dah onward, suggesting an important role for Dmrt1 in testicular differentiation. Sox9 and amh (anti-Mullerian hormone) showed a testis-specific expression, being evident only in the later stages of testicular differentiation. It is concluded that the sex-specific expression of foxl2 and cyp19a1a in XX gonads and dmrt1 in XY gonads during early gonadal differentiation (5-6 dah) is critical for undifferentiated gonads to differentiate into

  11. Screening and identification of distant metastasis-related differentially expressed genes in human squamous cell lung carcinoma.


    Wang, Na; Zhou, Fachen; Xiong, Hai; Du, Sha; Ma, Jianwei; Okai, Issac; Wang, Jian; Suo, Jing; Hao, Lihong; Song, Yang; Hu, Jun; Shao, Shujuan


    Distant metastasis is one of the leading causes of lung cancer death. Detecting the early-stage molecular alternations in primary tumors, such as gene expression differences, provides a "prognostic" value to the precaution of tumor metastasis. The aim of this article is to screen and identify the metastasis-related genes in human squamous cell lung carcinoma. Primary tumor tissues of nine patients with subsequent metastasis and eight patients without metastasis were selected to perform the gene microarray experiment. GO and pathway analyses were used to determine the differentially expressed genes. Two identified genes were further validated by real-time quantitative reverse transcription polymerase chain reaction (PCR) (real-time qRT-PCR). Two hundred and thirty-eight differentially expressed genes were detected in gene chip experiment, including 51 up-regulated genes and 187 down-regulated genes. These genes were involved in several cellular processes, including cell adhesion, cell cycle regulation, and apoptosis. GO analysis showed that the differentially expressed genes participated in a wide ranging of metastasis-related processes, including extracellular region and regulation of liquid surface tension. In addition, pathway analysis demonstrated that the differentially expressed genes were enriched in pathways related to cell cycle and Wnt signaling. Real-time qRT-PCR validation experiment of LCN2 and PDZK1IP1 showed a consistent up-regulation in the metastasis group. The metastasis of human squamous cell lung carcinoma is a complex process that is regulated by multiple gene alternations on the expression levels. The 238 differentially expressed genes identified in this study presumably contain a core set of genes involved in tumor metastasis. The real-time qRT-PCR results of PDZK1IP1 and LCN2 validated the reliability of this gene microarray experiment.

  12. Differentially expressed genes and proteins upon drought acclimation in tolerant and sensitive genotypes of Coffea canephora

    PubMed Central

    Marraccini, Pierre; Vinecky, Felipe; Alves, Gabriel S.C.; Ramos, Humberto J.O.; Elbelt, Sonia; Vieira, Natalia G.; Carneiro, Fernanda A.; Sujii, Patricia S.; Alekcevetch, Jean C.; Silva, Vânia A.; DaMatta, Fábio M.; Ferrão, Maria A.G.; Leroy, Thierry; Pot, David; Vieira, Luiz G.E.; da Silva, Felipe R.; Andrade, Alan C.


    The aim of this study was to investigate the molecular mechanisms underlying drought acclimation in coffee plants by the identification of candidate genes (CGs) using different approaches. The first approach used the data generated during the Brazilian Coffee expressed sequence tag (EST) project to select 13 CGs by an in silico analysis (electronic northern). The second approach was based on screening macroarrays spotted with plasmid DNA (coffee ESTs) with separate hybridizations using leaf cDNA probes from drought-tolerant and susceptible clones of Coffea canephora var. Conilon, grown under different water regimes. This allowed the isolation of seven additional CGs. The third approach used two-dimensional gel electrophoresis to identify proteins displaying differential accumulation in leaves of drought-tolerant and susceptible clones of C. canephora. Six of them were characterized by MALDI-TOF-MS/MS (matrix-assisted laser desorption-time of flight-tandem mass spectrometry) and the corresponding proteins were identified. Finally, additional CGs were selected from the literature, and quantitative real-time polymerase chain reaction (qPCR) was performed to analyse the expression of all identified CGs. Altogether, >40 genes presenting differential gene expression during drought acclimation were identified, some of them showing different expression profiles between drought-tolerant and susceptible clones. Based on the obtained results, it can be concluded that factors involved a complex network of responses probably involving the abscisic signalling pathway and nitric oxide are major molecular determinants that might explain the better efficiency in controlling stomata closure and transpiration displayed by drought-tolerant clones of C. canephora. PMID:22511801

  13. Differentially Expressed Genes during Contrasting Growth Stages of Artemisia annua for Artemisinin Content

    PubMed Central

    Nair, Priya; Misra, Amita; Singh, Alka; Shukla, Ashutosh K.; Gupta, Madan M.; Gupta, Anil K.; Gupta, Vikrant; Khanuja, Suman P. S.; Shasany, Ajit K.


    Artemisia annua is the source of antimalarial phytomolecule, artemisinin. It is mainly produced and stored in the glandular secretory trichomes present in the leaves of the plant. Since, the artemisinin biosynthesis steps are yet to be worked out, in this investigation a microarray chip was strategized for the first time to shortlist the differentially expressing genes at a stage of plant producing highest artemisinin compared to the stage with no artemisinin. As the target of this study was to analyze differential gene expression associated with contrasting artemisinin content in planta and a genotype having zero/negligible artemisinin content was unavailable, it was decided to compare different stages of the same genotype with contrasting artemisinin content (seedling - negligible artemisinin, mature leaf - high artemisinin). The SCAR-marked artemisinin-rich (∼1.2%) Indian variety ‘CIM-Arogya’ was used in the present study to determine optimal plant stage and leaf ontogenic level for artemisinin content. A representative EST dataset from leaf trichome at the stage of maximal artemisinin biosynthesis was established. The high utility small scale custom microarray chip of A. annua containing all the significant artemisinin biosynthesis-related genes, the established EST dataset, gene sequences isolated in-house and strategically selected candidates from the A. annua Unigene database (NCBI) was employed to compare the gene expression profiles of two stages. The expression data was validated through semiquantitative and quantitative RT-PCR followed by putative annotations through bioinformatics-based approaches. Many candidates having probable role in artemisinin metabolism were identified and described with scope for further functional characterization. PMID:23573249

  14. Gene expression analysis of terminal differentiation of human melanoma cells highlights global reductions in cell cycle-associated genes.


    Huynh, Kim Mai; Kim, Gyoungmi; Kim, Dong-Joon; Yang, Suk-Jin; Park, Seong-min; Yeom, Young-Il; Fisher, Paul B; Kang, Dongchul


    Defects in differentiation are frequently observed in cancer cells. By appropriate treatment specific tumor cell types can be induced to terminally differentiate. Metastatic HO-1 human melanoma cells treated with IFN-beta plus mezerein (MEZ) undergo irreversible growth arrest and terminal differentiation followed by apoptosis. In order to define the molecular changes associated with this process, changes in gene expression were analyzed by cDNA microarray hybridization and by semi-quantitative and quantitative RT-PCRs of representative 44 genes. The expression of 210 genes was changed more than two-fold at either 8 or 24 h post-treatment (166 up and 44 down). Major biological processes associated with the up-regulated genes were response to endogenous/exogenous stimuli (38%), cell proliferation (13%), cell death (16%) and development (30%). Approximately 34% of the down-regulated genes were associated with cell cycle, 9% in DNA replication and 11% in chromosome organization, respectively. Suppression of cell cycle associated genes appeared to directly correlate with growth arrest observed in the terminal differentiation process. Expression of Calpain 3 (CAPN3) variant 6 was suppressed by the combined treatment and maintained high in various melanoma cell lines. However, over-expression of the CAPN3 did not significantly affect growth kinetics and cell viability, suggesting that up-regulation of CAPN3 alone may not be a causative, but an associated change with melanoma development. This analysis provides further insights into the spectrum of up-regulated and the first detailed investigation of down-regulated gene changes associated with and potentially causative of induction of loss of proliferative capacity and terminal differentiation in human melanoma cells.

  15. Differential expression analysis of miRNA in peripheral blood mononuclear cells of patients with non-segmental vitiligo.


    Wang, Yi; Wang, Keyu; Liang, Jianhua; Yang, Hong; Dang, Ningning; Yang, Xi; Kong, Yi


    Vitiligo is a common depigmentary skin disease that may follow a pattern of multifactorial inheritance. The essential factors of its immunopathogenesis is thought to be the selective destruction of melanocytes. As a new class of microregulators of gene expression, miRNA have been reported to play vital roles in autoimmune diseases, metabolic diseases and cancer. This study sought to characterize the different miRNA expression pattern in the peripheral blood mononuclear cells (PBMC) of patients with non-segmental vitiligo (NSV) and healthy individuals and to examine their direct responses to thymosin α1 (Tα1) treatment. The miRNA expression profile in the PBMC of patients with NSV was analyzed using Exiqon's miRCURY LNA microRNA Array. The differentially expressed miRNA were validated by real-time quantitative polymerase chain reaction. We found that the expression levels of miR-224-3p and miR-4712-3p were upregulated, and miR-3940-5p was downregulated in the PBMC. The common clinical immune modulator Tα1 changed the miRNA expression profile. Our analysis showed that differentially expressed miRNA were associated with the mechanism of immune imbalance of vitiligo and that Tα1 could play an important role in changing the expression of these miRNA in the PBMC of patients with NSV. This study provided further evidence that miRNA may serve as novel drug targets for vitiligo therapeutic evaluation.

  16. Utility of Quantitative Flow Cytometry Immunophenotypic Analysis of CD5 Expression in Small B-cell Neoplasms

    PubMed Central

    Challagundla, Pramoda; Jorgensen, Jeffrey L.; Kanagal-Shamanna, Rashmi; Gurevich, Inga; Pierson, Diane M.; Ferrajoli, Alessandra; Reyes, Steven R.; Medeiros, L. Jeffrey; Miranda, Roberto N.


    Background The value of assessing CD5 expression in the differential diagnosis of small B-cell neoplasms is well established. Usually CD5 is assessed qualitatively. Materials and Methods We assessed CD5 expression levels by quantitative flow cytometry immunophenotyping to determine possible differences among various small B-cell neoplasms. We performed 4-color flow cytometry analysis on peripheral blood (PB) and bone marrow (BM) aspirate specimens and quantified CD5 expression in various mature small B-cell lymphomas and leukemias. We also assessed CD5 levels in PB samples of normal donors (controls). Results Cases of chronic lymphocytic leukemia (CLL) and mantle cell lymphoma had higher levels of CD5 compared with control (benign) B-cells (p < 0.001). Cases of marginal zone lymphoma (MZL) and hairy cell leukemia (HCL) had CD5 levels similar to control B-cells (p > 0.05), while cases of follicular lymphoma (FL) and lymphoplasmacytic lymphoma (LPL) had significantly lower CD5 levels than control B-cells (p <0.05). In B-cell neoplasms, a high level of CD5 expression correlated with a homogeneous pattern of positive events whereas lower CD5 levels correlated with a heterogeneous pattern of positive events. Conclusions Using flow cytometric immunophenotypic analysis to quantify CD5 levels can aid in diagnosis. CD5 expression levels are substantially higher in CLL and mantle cell lymphoma and expression is observed in a homogeneous pattern as compared with other B-cell neoplasms that are either negative for CD5 or express this antigen at lower levels with a heterogeneous pattern of expression. However, there is some overlap in CD5 expression levels between a subset of atypical CLL and MZL cases. PMID:24978916

  17. Quantitative differentiation of normal and scarred tissues using second-harmonic generation microscopy.


    Yildirim, Murat; Quinn, Kyle P; Kobler, James B; Zeitels, Steven M; Georgakoudi, Irene; Ben-Yakar, Adela


    The aim of this study was to differentiate normal and scarred hamster cheek pouch samples by applying a quantitative image analysis technique for determining collagen fiber direction and density in second-harmonic generation microscopy images. This paper presents a collagen tissue analysis of scarred cheek pouches of four adult male Golden Syrian hamsters as an animal model for vocal fold scarring. One cheek pouch was scarred using an electrocautery unit and the other cheek was used as a control for each hamster. A home-built upright microscope and a compact ultrafast fiber laser were used to acquire depth resolved epi-collected second-harmonic generation images of collagen fibers. To quantify the average fiber direction and fiber density in each image, we applied two-dimensional Fourier analysis and intensity thresholding at five different locations for each control and scarred tissue sample, respectively. The resultant depth-resolved average fiber direction variance for scarred hamster cheek pouches (0.61 ± 0.03) was significantly lower (p < 0.05) than control tissue (0.73 ± 0.04), indicating increased fiber alignment within the scar. Depth-resolved average voxel density measurements indicated scarred tissues contained greater (p < 0.005) fiber density (0.72 ± 0.09) compared to controls (0.18 ± 0.03). In the present study, image analysis of both fiber alignment and density from depth-resolved second-harmonic generation images in epi-detection mode enabled the quantification of the increased collagen fiber deposition and alignment typically observed in fibrosis. The epi-detection geometry is the only viable method for in vivo imaging as well as imaging thick turbid tissues. These quantitative endpoints, clearly differentiating between control and scarred hamster cheek pouches, provide an objective means to characterize the extent of vocal fold scarring in vivo in preclinical and clinical research. In particular, this non-invasive method

  18. Differential expression patterns of non-symbiotic hemoglobins in sugar beet (Beta vulgaris ssp. vulgaris).


    Leiva-Eriksson, Nélida; Pin, Pierre A; Kraft, Thomas; Dohm, Juliane C; Minoche, André E; Himmelbauer, Heinz; Bülow, Leif


    Biennial sugar beet (Beta vulgaris spp. vulgaris) is a Caryophyllidae that has adapted its growth cycle to the seasonal temperature and daylength variation of temperate regions. This is the first time a holistic study of the expression pattern of non-symbiotic hemoglobins (nsHbs) is being carried out in a member of this group and under two essential environmental conditions for flowering, namely vernalization and length of photoperiod. BvHb genes were identified by sequence homology searches against the latest draft of the sugar beet genome. Three nsHb genes (BvHb1.1, BvHb1.2 and BvHb2) and one truncated Hb gene (BvHb3) were found in the genome of sugar beet. Gene expression profiling of the nsHb genes was carried out by quantitative PCR in different organs and developmental stages, as well as during vernalization and under different photoperiods. BvHb1.1 and BvHb2 showed differential expression during vernalization as well as during long and short days. The high expression of BvHb2 indicates that it has an active role in the cell, maybe even taking over some BvHb1.2 functions, except during germination where BvHb1.2 together with BvHb1.1-both Class 1 nsHbs-are highly expressed. The unprecedented finding of a leader peptide at the N-terminus of BvHb1.1, for the first time in an nsHb from higher plants, together with its observed expression indicate that it may have a very specific role due to its suggested location in chloroplasts. Our findings open up new possibilities for research, breeding and engineering since Hbs could be more involved in plant development than previously was anticipated.

  19. Correlation of Versican Expression, Accumulation, and Degradation during Embryonic Development by Quantitative Immunohistochemistry

    PubMed Central

    Snyder, Jessica M.; Washington, Ida M.; Birkland, Timothy; Chang, Mary Y.; Frevert, Charles W.


    Versican, a chondroitin sulfate proteoglycan, is important in embryonic development, and disruption of the versican gene is embryonically lethal in the mouse. Although several studies show that versican is increased in various organs during development, a focused quantitative study on versican expression and distribution during lung and central nervous system development in the mouse has not previously been performed. We tracked changes in versican (Vcan) gene expression and in the accumulation and degradation of versican. Vcan expression and quantitative immunohistochemistry performed from embryonic day (E) 11.5 to E15.5 showed peak Vcan expression at E13.5 in the lungs and brain. Quantitative mRNA analysis and versican immunohistochemistry showed differences in the expression of the versican isoforms in the embryonic lung and head. The expression of Vcan mRNA and accumulation of versican in tissues was complementary. Immunohistochemistry demonstrated co-localization of versican accumulation and degradation, suggesting distinct roles of versican deposition and degradation in embryogenesis. Very little versican mRNA or protein was found in the lungs of 12- to 16-week-old mice but versican accumulation was significantly increased in mice with Pseudomonas aeruginosa lung infection. These data suggest that versican plays an important role in fundamental, overlapping cellular processes in lung development and infection. PMID:26385570

  20. Correlation of Versican Expression, Accumulation, and Degradation during Embryonic Development by Quantitative Immunohistochemistry.


    Snyder, Jessica M; Washington, Ida M; Birkland, Timothy; Chang, Mary Y; Frevert, Charles W


    Versican, a chondroitin sulfate proteoglycan, is important in embryonic development, and disruption of the versican gene is embryonically lethal in the mouse. Although several studies show that versican is increased in various organs during development, a focused quantitative study on versican expression and distribution during lung and central nervous system development in the mouse has not previously been performed. We tracked changes in versican (Vcan) gene expression and in the accumulation and degradation of versican. Vcan expression and quantitative immunohistochemistry performed from embryonic day (E) 11.5 to E15.5 showed peak Vcan expression at E13.5 in the lungs and brain. Quantitative mRNA analysis and versican immunohistochemistry showed differences in the expression of the versican isoforms in the embryonic lung and head. The expression of Vcan mRNA and accumulation of versican in tissues was complementary. Immunohistochemistry demonstrated co-localization of versican accumulation and degradation, suggesting distinct roles of versican deposition and degradation in embryogenesis. Very little versican mRNA or protein was found in the lungs of 12- to 16-week-old mice but versican accumulation was significantly increased in mice with Pseudomonas aeruginosa lung infection. These data suggest that versican plays an important role in fundamental, overlapping cellular processes in lung development and infection.

  1. Expression quantitative trait loci for PAX8 contributes to the prognosis of hepatocellular carcinoma

    PubMed Central

    Ge, Zijun; Zhou, Jing; Zhang, Guoxin; Hu, Zhibin


    Paired-box family member PAX8 encodes a transcription factor that has a role in cell differentiation and cell growth and may participate in the prognosis of hepatocellular carcinoma (HCC). By bioinformatics analysis, we identified several single nucleotide polymorphisms (SNPs) within a newly identified long non-coding RNA (lncRNA) AC016683.6 as expression quantitative trait loci (eQTLs) for PAX8. Hence, we hypothesized that PAX8eQTLs in lncRNA AC016683.6 may influence the HCC prognosis. We then performed a case-only study to assess the association between the two SNPs as well as the prognosis of HCC in 331 HBV-positive HCC patients without surgical treatment. Cox proportional hazard models were used for survival analysis with adjustments for the age, gender, smoking status, drinking status, Barcelona-Clinic Liver Cancer (BCLC) stage, and chemotherapy or TACE (transcatheter hepatic arterial chemoembolization) status. We found that the G allele of rs1110839 and the T allele of rs4848320 in PAX8was significantly associated with a better prognosis compared with the T allele of rs1110839 and the C allele of rs4848320 (adjusted HR = 0.74, 95% CI = 0.61–0.91, P = 0.004 for rs1110839 and adjusted HR = 0.71, 95% CI = 0.54–0.94, P = 0.015 for rs4848320 in the additive model). Furthermore, the combined effect of the variant genotypes for these two SNPs was more prominent in patients with the BCLC-C stage orpatients with chemotherapy or TACE. Although the exact biological function remains to be explored, our findings suggest a possible association of PAX8eQTLs in lncRNA AC016683.6 with the HCC prognosis inthe Chinese population. Further large and functional studies are needed to confirm our findings. PMID:28339471

  2. Differential microRNA expression is associated with androgen receptor expression in breast cancer.


    Shi, Yaqin; Yang, Fang; Sun, Zijia; Zhang, Wenwen; Gu, Jun; Guan, Xiaoxiang


    The androgen receptor (AR) is frequently expressed in breast cancer; however, its prognostic value remains unclear. AR expression in breast cancer has been associated with improved outcomes in estrogen receptor (ER)‑positive breast cancer compared with ER‑negative disease. Eliminating AR function in breast cancer is critically important for breast cancer progression. However, the mechanism underlying AR regulation remains poorly understood. The study of microRNAs (miRNAs) has provided important insights into the pathogenesis of hormone‑dependent cancer. To determine whether miRNAs function in the AR regulation of breast cancer, the present study performed miRNA expression profiling in AR‑positive and ‑negative breast cancer cell lines. A total of 153 miRNAs were differentially expressed in AR‑positive compared with AR‑negative breast cancer cells; 52 were upregulated and 101 were downregulated. A number of these have been extensively associated with breast cancer cell functions, including proliferation, invasion and drug‑resistance. Furthermore, through pathway enrichment analysis, signaling pathways associated with the prediction targets of the miRNAs were characterized, including the vascular endothelial growth factor and mammalian target of rapamycin signaling pathways. In conclusion, the results of the present study indicated that the expression of miRNAs may be involved in the mechanism underlying AR regulation of breast cancer, and may improve understanding of the role of AR in breast cancer.

  3. Personalized Identification of Differentially Expressed Modules in Osteosarcoma

    PubMed Central

    Liu, Xiaozhou; Li, Chengjun; Zhang, Lei; Shi, Xin; Wu, Sujia


    Background Osteosarcoma (OS), an aggressive malignant neoplasm, is the most common primary bone cancer mainly in adolescents and young adults. Differentially expressed modules tend to distinguish differences integrally. Identifying modules individually has been crucial for understanding OS mechanisms and applications of custom therapeutic decisions in the future. Material/Methods Samples came from individuals were used from control group (n=15) and OS group (n=84). Based on clique-merging, module-identification algorithm was used to identify modules from OS PPI networks. A novel approach – the individualized module aberrance score (iMAS) was performed to distinguish differences, making special use of accumulated normal samples (ANS). We performed biological process ontology to classify functionally modules. Then Support Vector Machine (SVM) was used to test distribution results of normal and OS group with screened modules. Results We identified 83 modules containing 2084 genes from PPI network in which 61 modules were significantly different. Cluster analysis of OS using the iMAS method identified 5 modules clusters. Specificity=1.00 and Sensitivity=1.00 proved the distribution outcomes of screened modules were mainly consistent with that of total data, which suggested the efficiency of 61 modules. Conclusions We conclude that a novel pipeline that identified the dysregulated modules in individuals of OS. The constructed process is expected to aid in personalized health care, which may present fruitful strategies for medical therapy. PMID:28190021

  4. Differential Expression of the Three Multicopper Oxidases from Myxococcus xanthus▿

    PubMed Central

    Sánchez-Sutil, María Celestina; Gómez-Santos, Nuria; Moraleda-Muñoz, Aurelio; Martins, Lígia O.; Pérez, Juana; Muñoz-Dorado, José


    Myxococcus xanthus is a soil bacterium that undergoes a unique life cycle among the prokaryotes upon starvation, which includes the formation of macroscopic structures, the fruiting bodies, and the differentiation of vegetative rods into coccoid myxospores. This peculiarity offers the opportunity to study the copper response in this bacterium in two different stages. In fact, M. xanthus vegetative rods exhibit 15-fold-greater resistance against copper than developing cells. However, cells preadapted to this metal reach the same levels of resistance during both stages. Analysis of the M. xanthus genome reveals that many of the genes involved in copper resistance are redundant, three of which encode proteins of the multicopper oxidase family (MCO). Each MCO gene exhibits a different expression profile in response to external copper addition. Promoters of cuoA and cuoB respond to Cu(II) ions during growth and development; however, they show a 10-fold-increased copper sensitivity during development. The promoter of cuoC shows copper-independent induction upon starvation, but it is copper up-regulated during growth. Phenotypic analyses of deletion mutants reveal that CuoB is involved in the primary copper-adaptive response; CuoA and CuoC are necessary for the maintenance of copper tolerance; and CuoC is required for normal development. These roles seem to be carried out through cuprous oxidase activity. PMID:17483223

  5. Expressing Certainty in Discussion Sections of Qualitative and Quantitative Research Articles

    ERIC Educational Resources Information Center

    Dobakhti, Leila


    This paper investigates how boosters are used by qualitative and quantitative research article writers to express certainty. Boosters are words such as "definitely," "sure," "demonstrate" which signal writers' assurance in what they say. Drawing on a corpus of 200 research articles in Applied Linguistics, this…

  6. Evaluation of reference genes in Vibrio parahaemolyticus for gene expression analysis using quantitative RT-PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Vibrio parahaemolyticus is a significant human pathogen capable of causing foodborne gastroenteritis associated with the consumption of contaminated raw or undercooked seafood. Quantitative RT-PCR (qRT-PCR) is a useful tool for studying gene expression in V. parahaemolyticus to characterize the viru...

  7. Quantitative assessment of p-glycoprotein expression and function using confocal image analysis.


    Hamrang, Zahra; Arthanari, Yamini; Clarke, David; Pluen, Alain


    P-glycoprotein is implicated in clinical drug resistance; thus, rapid quantitative analysis of its expression and activity is of paramout importance to the design and success of novel therapeutics. The scope for the application of quantitative imaging and image analysis tools in this field is reported here at "proof of concept" level. P-glycoprotein expression was utilized as a model for quantitative immunofluorescence and subsequent spatial intensity distribution analysis (SpIDA). Following expression studies, p-glycoprotein inhibition as a function of verapamil concentration was assessed in two cell lines using live cell imaging of intracellular Calcein retention and a routine monolayer fluorescence assay. Intercellular and sub-cellular distributions in the expression of the p-glycoprotein transporter between parent and MDR1-transfected Madin-Derby Canine Kidney cell lines were examined. We have demonstrated that quantitative imaging can provide dose-response parameters while permitting direct microscopic analysis of intracellular fluorophore distributions in live and fixed samples. Analysis with SpIDA offers the ability to detect heterogeniety in the distribution of labeled species, and in conjunction with live cell imaging and immunofluorescence staining may be applied to the determination of pharmacological parameters or analysis of biopsies providing a rapid prognostic tool.

  8. Quantitative PCR for glucose transporter and tristetraprolin family gene expression in cultured mouse adipocytes and macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Quantitative real-time PCR (qPCR) such as TaqMan and SYBR Green qPCR are widely used for gene expression analysis. The drawbacks of SYBR Green assay are that the dye binds to any double-stranded DNA which can generate falsepositive signals and that the length of the amplicon affects the intensity of...

  9. Plum pox virus induces differential gene expression in the partially resistant stone fruit tree Prunus armeniaca cv. Goldrich.


    Schurdi-Levraud Escalettes, Valérie; Hullot, Clémence; Wawrzy'nczak, Danuta; Mathieu, Elodie; Eyquard, Jean-Philippe; Le Gall, Olivier; Decroocq, Véronique


    We investigated the changes in the expression profiles of the partially resistant apricot (Prunus armeniaca L.) cultivar Goldrich following inoculation with Plum pox virus (PPV) using cDNA-amplification fragment length polymorphism (AFLP). Altered expression patterns were detected and twenty-one differentially expressed cDNA had homologies with genes in databases coding for proteins involved in metabolism, signal transduction, defense, stress and intra/intercellular connections. Seven of the modified expressed patterns were further investigated by semi-quantitative RT-PCR or Northern blotting. The expression patterns of five of these genes were confirmed in the partially resistant P. armeniaca cv. 'Goldrich' and assessed in a susceptible genotype. One of these cDNAs, coding for a putative class III chitinase, appeared to be repressed in infected plants of the partially resistant genotype and expressed in the susceptible one which could be related to the partially resistant phenotype. On the contrary, the expression patterns of the genes coding for a transketolase, a kinesin-like and an ankyrin-like protein, were clearly linked to the susceptible interaction. These candidate genes could play a role either in the compatible interaction leading to virus invasion or to the quantitative resistance of apricot to PPV.

  10. DCGL v2.0: An R Package for Unveiling Differential Regulation from Differential Co-expression

    PubMed Central

    Liu, Bao-Hong; Zhao, Zhongming; Liu, Lei; Ma, Liang-Xiao; Li, Yi-Xue; Li, Yuan-Yuan


    Motivation Differential co-expression analysis (DCEA) has emerged in recent years as a novel, systematic investigation into gene expression data. While most DCEA studies or tools focus on the co-expression relationships among genes, some are developing a potentially more promising research domain, differential regulation analysis (DRA). In our previously proposed R package DCGL v1.0, we provided functions to facilitate basic differential co-expression analyses; however, the output from DCGL v1.0 could not be translated into differential regulation mechanisms in a straightforward manner. Results To advance from DCEA to DRA, we upgraded the DCGL package from v1.0 to v2.0. A new module named “Differential Regulation Analysis” (DRA) was designed, which consists of three major functions: DRsort, DRplot, and DRrank. DRsort selects differentially regulated genes (DRGs) and differentially regulated links (DRLs) according to the transcription factor (TF)-to-target information. DRrank prioritizes the TFs in terms of their potential relevance to the phenotype of interest. DRplot graphically visualizes differentially co-expressed links (DCLs) and/or TF-to-target links in a network context. In addition to these new modules, we streamlined the codes from v1.0. The evaluation results proved that our differential regulation analysis is able to capture the regulators relevant to the biological subject. Conclusions With ample functions to facilitate differential regulation analysis, DCGL v2.0 was upgraded from a DCEA tool to a DRA tool, which may unveil the underlying differential regulation from the observed differential co-expression. DCGL v2.0 can be applied to a wide range of gene expression data in order to systematically identify novel regulators that have not yet been documented as critical. Availability DCGL v2.0 package is available at or at our project home page PMID

  11. Identification and expression profiling analysis of goose melanoma differentiation associated gene 5 (MDA5) gene.


    Wei, L M; Jiao, P R; Song, Y F; Han, F; Cao, L; Yang, F; Ren, T; Liao, M


    Melanoma differentiation associated gene 5 (MDA5) is an important cytoplasmic receptor that recognizes long molecules of viral double-stranded RNA and single-stranded RNA with 5' triphosphate and mediates type I interferon secretion. In this study, the full-length MDA5 gene in the goose was identified and characterized. The cDNA of goose MDA5 was 3,306 bp in length with an open reading frame of 3,018 bp, which encoded a polypeptide of 1,005 amino acids. The deduced amino acid sequence contained 6 main structure domains including 2 caspase activation and recruitment domains, one DExD/H-box helicase domain, one type III restriction enzyme domain, one helicase conserved C-terminal domain, and one RIG-I C-terminal domain. Quantitative real-time PCR analysis indicated that goose MDA5 mRNA was constitutively expressed in all sampled tissues. It was highly expressed in the jejunum, trachea, ileum, colon, and kidney, and lowly expressed in the muscular stomach, glandular stomach, and muscle. A significant increase in the transcription of MDA5 was detected in the brain, spleen, and lungs of geese after infection with H5N1 highly pathogenic avian influenza virus compared with uninfected tissues. These findings indicated that goose MDA5 was an important receptor, involved in the antiviral innate immune defense to H5N1 highly pathogenic avian influenza virus in geese.

  12. Differential expression of the lethal gene Luteus-Pa in cacao of the Parinari series.


    Rehem, B C; Almeida, A-A F; Figueiredo, G S F; Gesteira, A S; Santos, S C; Corrêa, R X; Yamada, M M; Valle, R R


    The recessive lethal character Luteus-Pa is found in cacao (Theobroma cacao) genotypes of the Parinari series (Pa) and is characterized by expression of leaf chlorosis and seedling death. Several genotypes of the Pa series are bearers of the gene responsible for the expression of the Luteus-Pa character, which can be used as a tool for determining relationships between genotypes of this group. To evaluate this phenomenon, we analyzed the differential expression of genes between mutant seedlings and wild-type hybrid Pa 30 x 169 seedlings, with the aim of elucidating the possible lethal mechanisms of the homozygous recessive character Luteus-Pa. Plant material was harvested from leaves of wild and mutant seedlings at different periods to construct a subtractive library and perform quantitative analysis using real-time PCR. The 649 sequences obtained from the subtractive library had an average length of 500 bp, forming 409 contigs. The probable proteins encoded were grouped into 10 functional categories. Data from ESTs identified genes associated with Rubisco, peroxidases, and other proteins and enzymes related to carbon assimilation, respiration, and photosystem 2. Mutant seedlings were characterized by synthesizing defective PsbO and PsbA proteins, which were overexpressed from 15 to 20 days after seedling emergence.

  13. Identification of Differentially Expressed Genes Associated with Apple Fruit Ripening and Softening by Suppression Subtractive Hybridization.


    Zhang, Zongying; Jiang, Shenghui; Wang, Nan; Li, Min; Ji, Xiaohao; Sun, Shasha; Liu, Jingxuan; Wang, Deyun; Xu, Haifeng; Qi, Sumin; Wu, Shujing; Fei, Zhangjun; Feng, Shouqian; Chen, Xuesen


    Apple is one of the most economically important horticultural fruit crops worldwide. It is critical to gain insights into fruit ripening and softening to improve apple fruit quality and extend shelf life. In this study, forward and reverse suppression subtractive hybridization libraries were generated from 'Taishanzaoxia' apple fruits sampled around the ethylene climacteric to isolate ripening- and softening-related genes. A set of 648 unigenes were derived from sequence alignment and cluster assembly of 918 expressed sequence tags. According to gene ontology functional classification, 390 out of 443 unigenes (88%) were assigned to the biological process category, 356 unigenes (80%) were classified in the molecular function category, and 381 unigenes (86%) were allocated to the cellular component category. A total of 26 unigenes differentially expressed during fruit development period were analyzed by quantitative RT-PCR. These genes were involved in cell wall modification, anthocyanin biosynthesis, aroma production, stress response, metabolism, transcription, or were non-annotated. Some genes associated with cell wall modification, anthocyanin biosynthesis and aroma production were up-regulated and significantly correlated with ethylene production, suggesting that fruit texture, coloration and aroma may be regulated by ethylene in 'Taishanzaoxia'. Some of the identified unigenes associated with fruit ripening and softening have not been characterized in public databases. The results contribute to an improved characterization of changes in gene expression during apple fruit ripening and softening.

  14. Identification of Differentially Expressed Genes Associated with Apple Fruit Ripening and Softening by Suppression Subtractive Hybridization

    PubMed Central

    Zhang, Zongying; Jiang, Shenghui; Wang, Nan; Li, Min; Ji, Xiaohao; Sun, Shasha; Liu, Jingxuan; Wang, Deyun; Xu, Haifeng; Qi, Sumin; Wu, Shujing; Fei, Zhangjun; Feng, Shouqian; Chen, Xuesen


    Apple is one of the most economically important horticultural fruit crops worldwide. It is critical to gain insights into fruit ripening and softening to improve apple fruit quality and extend shelf life. In this study, forward and reverse suppression subtractive hybridization libraries were generated from ‘Taishanzaoxia’ apple fruits sampled around the ethylene climacteric to isolate ripening- and softening-related genes. A set of 648 unigenes were derived from sequence alignment and cluster assembly of 918 expressed sequence tags. According to gene ontology functional classification, 390 out of 443 unigenes (88%) were assigned to the biological process category, 356 unigenes (80%) were classified in the molecular function category, and 381 unigenes (86%) were allocated to the cellular component category. A total of 26 unigenes differentially expressed during fruit development period were analyzed by quantitative RT-PCR. These genes were involved in cell wall modification, anthocyanin biosynthesis, aroma production, stress response, metabolism, transcription, or were non-annotated. Some genes associated with cell wall modification, anthocyanin biosynthesis and aroma production were up-regulated and significantly correlated with ethylene production, suggesting that fruit texture, coloration and aroma may be regulated by ethylene in ‘Taishanzaoxia’. Some of the identified unigenes associated with fruit ripening and softening have not been characterized in public databases. The results contribute to an improved characterization of changes in gene expression during apple fruit ripening and softening. PMID:26719904

  15. Detection of Structural and Metabolic Changes in Traumatically Injured Hippocampus by Quantitative Differential Proteomics

    PubMed Central

    Wu, Ping; Zhao, Yingxin; Haidacher, Sigmund J.; Wang, Enyin; Parsley, Margaret O.; Gao, Junling; Sadygov, Rovshan G.; Starkey, Jonathan M.; Luxon, Bruce A.; Spratt, Heidi; DeWitt, Douglas S.; Prough, Donald S.


    Abstract Traumatic brain injury (TBI) is a complex and common problem resulting in the loss of cognitive function. In order to build a comprehensive knowledge base of the proteins that underlie these cognitive deficits, we employed unbiased quantitative mass spectrometry, proteomics, and bioinformatics to identify and quantify dysregulated proteins in the CA3 subregion of the hippocampus in the fluid percussion model of TBI in rats. Using stable isotope 18O-water differential labeling and multidimensional tandem liquid chromatography (LC)-MS/MS with high stringency statistical analyses and filtering, we identified and quantified 1002 common proteins, with 124 increased and 76 decreased. The Ingenuity Pathway Analysis (IPA) bioinformatics tool identified that TBI had profound effects on downregulating global energy metabolism, including glycolysis, the Krebs cycle, and oxidative phosphorylation, as well as cellular structure and function. Widespread upregulation of actin-related cytoskeletal dynamics was also found. IPA indicated a common integrative signaling node, calcineurin B1 (CANB1, CaNBα, or PPP3R1), which was downregulated by TBI. Western blotting confirmed that the calcineurin regulatory subunit, CANB1, and its catalytic binding partner PP2BA, were decreased without changes in other calcineurin subunits. CANB1 plays a critical role in downregulated networks of calcium signaling and homeostasis through calmodulin and calmodulin-dependent kinase II to highly interconnected structural networks dominated by tubulins. This large-scale knowledge base lays the foundation for the identification of novel therapeutic targets for cognitive rescue in TBI. PMID:22757692

  16. Polymorphism in nimodipine raw materials: development and validation of a quantitative method through differential scanning calorimetry.


    Riekes, Manoela Klüppel; Pereira, Rafael Nicolay; Rauber, Gabriela Schneider; Cuffini, Silvia Lucia; de Campos, Carlos Eduardo Maduro; Silva, Marcos Antonio Segatto; Stulzer, Hellen Karine


    Due to the physical-chemical and therapeutic impacts of polymorphism, its monitoring in raw materials is necessary. The purpose of this study was to develop and validate a quantitative method to determine the polymorphic content of nimodipine (NMP) raw materials based on differential scanning calorimetry (DSC). The polymorphs required for the development of the method were characterized through DSC, X-ray powder diffraction (XRPD) and Raman spectroscopy and their polymorphic identity was confirmed. The developed method was found to be linear, robust, precise, accurate and specific. Three different samples obtained from distinct suppliers (NMP 1, NMP 2 and NMP 3) were firstly characterized through XRPD and DSC as polymorphic mixtures. The determination of their polymorphic identity revealed that all samples presented the Modification I (Mod I) or metastable form in greatest proportion. Since the commercial polymorph is Mod I, the polymorphic characteristic of the samples analyzed needs to be investigated. Thus, the proposed method provides a useful tool for the monitoring of the polymorphic content of NMP raw materials.

  17. Sequencing and bioinformatics analysis of the differentially expressed genes in herniated discs with or without calcification

    PubMed Central

    Shao, Jia; Yu, Miao; Jiang, Liang; Wu, Fengliang; Liu, Xiaoguang


    The purpose of this study was to detect the differentially expressed genes between ossified herniated discs and herniated discs without ossification. In addition, we sought to identify a few candidate genes and pathways by using bioinformatics analysis. We analyzed 6 samples each of ossified herniated discs (experimental group) and herniated discs without ossification (control group). Purified mRNA and cDNA extracted from the samples were subjected to sequencing. The NOISeq method was used to statistically identify the differentially expressed genes (DEGs) between the 2 groups. An in-depth analysis using bioinformatics tools based on the DEGs was performed using Gene Ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment, and protein-protein interaction network analysis. The top 6 DEGs were verified using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). A total of 132 DEGs was detected. A total of 129 genes in the ossified group were upregulated and 3 genes were found to be downregulated as compared to the control group. The top 3 cellular components in GO ontologies analysis were extracellular matrix components. GO functions were mainly related to the glycoprotein in the cell membrane and extracellular matrix. The GO process was related to completing response to stimulus, immune reflex and defense. The top 5 KEGG enrichment pathways were associated with infection and inflammation. Three of the top 20 DEGs [sclerostin (SOST), WNT inhibitory factor 1 (WIF1) and secreted frizzled related protein 4 (SFRP4)] were related to the inhibition of the Wnt pathway. The ossified discs exhibited a higher expression of the top 6 DEGs [SOST, joining chain of multimeric IgA and IgM (IGJ; also known as JCHAIN), defensin alpha 4 (DEFA4), SFRP4, proteinase 3 (PRTN3) and cathepsin G (CTSG)], with the associated P-values of 0.045, 0.000, 0.008, 0.010, 0.015 and 0.002, respectively, as calculated by the independent sample t

  18. Hypoxia-Inducible Factor 1 Is an Inductor of Transcription Factor Activating Protein 2 Epsilon Expression during Chondrogenic Differentiation.


    Niebler, Stephan; Angele, Peter; Kujat, Richard; Bosserhoff, Anja K


    The transcription factor AP-2ε (activating enhancer-binding protein epsilon) is expressed in cartilage of humans and mice. However, knowledge about regulatory mechanisms influencing AP-2ε expression is limited. Using quantitative real time PCR, we detected a significant increase in AP-2ε mRNA expression comparing initial and late stages of chondrogenic differentiation processes in vitro and in vivo. Interestingly, in these samples the expression pattern of the prominent hypoxia marker gene angiopoietin-like 4 (Angptl4) strongly correlated with that of AP-2ε suggesting that hypoxia might represent an external regulator of AP-2ε expression in mammals. In order to show this, experiments directly targeting the activity of hypoxia-inducible factor-1 (HIF1), the complex mediating responses to oxygen deprivation, were performed. While the HIF1-activating compounds 2,2'-dipyridyl and desferrioxamine resulted in significantly enhanced mRNA concentration of AP-2ε, siRNA against HIF1α led to a significantly reduced expression rate of AP-2ε. Additionally, we detected a significant upregulation of the AP-2ε mRNA level after oxygen deprivation. In sum, these different experimental approaches revealed a novel role for the HIF1 complex in the regulation of the AP-2ε gene in cartilaginous cells and underlined the important role of hypoxia as an important external regulatory stimulus during chondrogenic differentiation modulating the expression of downstream transcription factors.

  19. Verification of suitable and reliable reference genes for quantitative real-time PCR during adipogenic differentiation in porcine intramuscular stromal-vascular cells.


    Li, X; Huang, K; Chen, F; Li, W; Sun, S; Shi, X-E; Yang, G


    Intramuscular fat (IMF) is an important trait influencing meat quality, and intramuscular stromal-vascular cell (MSVC) differentiation is a key factor affecting IMF deposition. Quantitative real-time PCR (qPCR) is often used to screen the differentially expressed genes during differentiation of MSVCs, where proper reference genes are essential. In this study, we assessed 31 of previously reported reference genes for their expression suitability in porcine MSVCs derived form longissimus dorsi with qPCR. The expression stability of these genes was evaluated using NormFinder, geNorm and BestKeeper algorithms. NormFinder and geNorm uncovered ACTB, ALDOA and RPS18 as the most three stable genes. BestKeeper identified RPL13A, SSU72 and DAK as the most three stable genes. GAPDH was found to be the least stable gene by all of the three software packages, indicating it is not an appropriate reference gene in qPCR assay. These results might be helpful for further studies in pigs that explore the molecular mechanism underlying IMF deposition.

  20. Differentiating malignant from benign gastric mucosal lesions with quantitative analysis in dual energy spectral computed tomography

    PubMed Central

    Meng, Xiaoyan; Ni, Cheng; Shen, Yaqi; Hu, Xuemei; Chen, Xiao; Li, Zhen; Hu, Daoyu


    Abstract To investigate the value of quantitative analysis in dual energy spectral computed tomography (DESCT) for differentiating malignant gastric mucosal lesions from benign gastric mucosal lesions (including gastric inflammation [GI] and normal gastric mucosa [NGM]). This study was approved by the ethics committee, and all patients provided written informed consent. A total of 161 consecutive patients (63 with gastric cancer [GC], 48 with GI, and 50 with NGM) who underwent dual-phase contrast enhanced DESCT scans in the arterial phase (AP) and portal venous phase (PVP) were included in this study. Iodine concentration (IC) in lesions was derived from the iodine-based material-decomposition images and normalized to that in the aorta to obtain normalized IC (nIC). The ratios of IC and nIC between the AP and PVP were calculated. Diagnostic confidence for GC and GI was evaluated with reviewing the features including gastric wall thickness, focal, and eccentric on the conventional polychromatic images. All statistical analyses were performed by using statistical software SPSS 17.0 (SPSS, Chicago, IL). IC and nIC in GC differed significantly from those in GI and NGM, except for nICAP in comparing GC with GI. Mean nIC values of GC (0.18 ± 0.06 in AP and 0.62 ± 0.16 in PVP) were significantly higher than that of NGM (0.12 ± 0.03 in AP and 0.37 ± 0.08 in PVP) (all P < 0.05). There was also significant difference for IC values in GC, GI, and NGM (24.19 ± 8.27, 19.07 ± 5.82, and 13.61 ± 2.52 mg/mL, respectively, in AP and 28.00 ± 7.01, 24.66 ± 6.55, and 16.94 ± 3.06 mg/mL, respectively, in PVP). Based on Receiver Operating Characteristic Curve analysis, nIC and IC in PVP had high sensitivities of 88.89% and 90.48%, respectively, in differentiating GC from NGM, while the sensitivities were 71.43% and 88.89% during AP. Ratios IC and nIC ratios did not provide adequate diagnostic accuracy with their area under curves

  1. Validation of internal reference genes for relative quantitation studies of gene expression in human laryngeal cancer

    PubMed Central

    Wang, Xiaofeng; He, Jinting; Wang, Wei; Ren, Ming; Gao, Sujie; Zhao, Guanjie


    Background The aim of this study was to determine the expression stabilities of 12 common internal reference genes for the relative quantitation analysis of target gene expression performed by reverse transcription real-time quantitative polymerase chain reaction (RT-qPCR) in human laryngeal cancer. Methods Hep-2 cells and 14 laryngeal cancer tissue samples were investigated. The expression characteristics of 12 internal reference gene candidates (18S rRNA, GAPDH, ACTB, HPRT1, RPL29, HMBS, PPIA, ALAS1, TBP, PUM1, GUSB, and B2M) were assessed by RT-qPCR. The data were analyzed by three commonly used software programs: geNorm, NormFinder, and BestKeeper. Results The use of the combination of four internal reference genes was more appropriate than the use of a single internal reference gene. The optimal combination was PPIA + GUSB + RPL29 + HPRT1 for both the cell line and tissues; while the most appropriate combination was GUSB + RPL29 + HPRT1 + HMBS for the tissues. Conclusions Our recommended internal reference genes may improve the accuracy of relative quantitation analysis of target gene expression performed by the RT-qPCR method in further gene expression research on laryngeal tumors. PMID:27957397

  2. Functional interactors of three genome-wide association study genes are differentially expressed in severe chronic obstructive pulmonary disease lung tissue

    PubMed Central

    Morrow, Jarrett D.; Zhou, Xiaobo; Lao, Taotao; Jiang, Zhiqiang; DeMeo, Dawn L.; Cho, Michael H.; Qiu, Weiliang; Cloonan, Suzanne; Pinto-Plata, Victor; Celli, Bartholome; Marchetti, Nathaniel; Criner, Gerard J.; Bueno, Raphael; Washko, George R.; Glass, Kimberly; Quackenbush, John; Choi, Augustine M. K.; Silverman, Edwin K.; Hersh, Craig P.


    In comparison to genome-wide association studies (GWAS), there has been poor replication of gene expression studies in chronic obstructive pulmonary disease (COPD). We performed microarray gene expression profiling on a large sample of resected lung tissues from subjects with severe COPD. Comparing 111 COPD cases and 40 control smokers, 204 genes were differentially expressed; none were at significant GWAS loci. The top differentially expressed gene was HMGB1, which interacts with AGER, a known COPD GWAS gene. Differentially expressed genes showed enrichment for putative interactors of the first three identified COPD GWAS genes IREB2, HHIP, and FAM13A, based on gene sets derived from protein and RNA binding studies, RNA-interference, a murine smoking model, and expression quantitative trait locus analyses. The gene module most highly associated for COPD in Weighted Gene Co-Expression Network Analysis (WGCNA) was enriched for B cell pathways, and shared seventeen genes with a mouse smoking model and twenty genes with previous emphysema studies. As in other common diseases, genes at COPD GWAS loci were not differentially expressed; however, using a combination of network methods, experimental studies and careful phenotype definition, we found differential expression of putative interactors of these genes, and we replicated previous human and mouse microarray results. PMID:28287180

  3. Differential gene expression and lipid metabolism in fatty liver induced by acute ethanol treatment in mice

    SciTech Connect

    Yin Huquan; Kim, Mingoo; Kim, Ju-Han; Kong, Gu; Kang, Kyung-Sun; Kim, Hyung-Lae; Yoon, Byung-IL; Lee, Mi-Ock; Lee, Byung-Hoon


    Ethanol induces cumulative liver damage including steatosis, steatohepatitis and cirrhosis. The aim of this study is to investigate the global intrahepatic gene expression profile in the mouse liver treated with ethanol. A single oral dose of 0.5 or 5 g/kg ethanol was administered to male ICR mice, and liver samples were obtained after 6, 24 and 72 h. Histopathological evaluation showed typical fatty livers in the high-dose group at 24 h. Microarray analysis identified 28 genes as being ethanol responsive (two-way ANOVA; p < 0.05), after adjustment by the Benjamini-Hochberg multiple testing correction; these genes displayed {>=} 2-fold induction or repression. The expression of genes that are known to be involved in fatty acid synthesis was examined. The transcript for lipogenic transcription factor, sterol regulatory element (SRE)-binding factor 1 (Srebf1), was upregulated by acute ethanol exposure. Of the genes known to contain SRE or SRE-like sequences and to be regulated by SRE-binding protein 1 (SREBP1), those encoding malic enzyme (Mod1), ATP-citrate lyase (Acly), fatty acid synthase (Fasn) and stearyl-CoA desaturase (Scd1) were induced by ethanol. Quantitative real-time PCR confirmed the changes in the expression levels of the selected genes. The change in the Srebf1 mRNA level correlates well with that of the SREBP1 protein expression as well as its binding to the promoters of the target genes. The present study identifies differentially expressed genes that can be applied to the biomarkers for alcohol-binge-induced fatty liver. These results support the hypothesis by which ethanol-induced steatosis in mice is mediated by the fatty acid synthetic pathway regulated by SREBP1.

  4. Differential expression of imprinted genes in normal and IUGR human placentas.


    Diplas, Andreas I; Lambertini, Luca; Lee, Men-Jean; Sperling, Rhoda; Lee, Yin Leng; Wetmur, James; Chen, Jia


    Genomic imprinting refers to silencing of one parental allele in the zygotes of gametes depending upon the parent of origin. Loss of imprinting (LOI) is the gain of function from the silent allele that can have a maximum effect of doubling the gene dosage. LOI may play a significant role in the etiology of intrauterine growth restriction (IUGR). Using placental tissue from ten normal and seven IUGR pregnancies, we conducted a systematic survey of the expression of a panel of 74 "putatively" imprinted genes using quantitative RT-PCR. We found that 52/74 ( approximately 70%) of the genes were expressed in human placentas. Nine of the 52 (17%) expressed genes were significantly differentially expressed between normal and IUGR placentas; five were upregulated (PHLDA2, ILK2, NNAT, CCDC86, PEG10) and four downregulated (PLAGL1, DHCR24, ZNF331, CDKAL1). We also assessed LOI profile of 14 imprinted genes in 14 normal and 24 IUGR placentas using a functional and sensitive assay developed in our laboratory. Little LOI was observed in any placentas for five of the genes (PEG10, PHLDA2, MEG3, EPS15, CD44). With the 149 heterozygosities examined, 40 (26.8%) exhibited LOI >3%. Some genes exhibited frequent LOI in placentas regardless of the disease status (IGF2, TP73, MEST, SLC22A18, PEG3), while others exhibited LOI only in IUGR placentas (PLAGL1, DLK1, H19, SNRPN). Importantly, there was no correlation between gene expression and LOI profile. Our study suggests that genomic imprinting may play a role in IUGR pathogenesis, but mechanisms other than LOI may contribute to dysregulation of imprinted genes.

  5. Differential expression and regional distribution of aquaporins in amnion of normal and gestational diabetic pregnancies.


    Bednar, Amy D; Beardall, Michael K; Brace, Robert A; Cheung, Cecilia Y


    The region of the amnion overlying the placenta plays an active role in fluid exchange between amniotic fluid and fetal blood perfusing the surface of the placenta, whereas little transfer occurs across the reflected amnion that contacts the membranous chorion. Because aquaporins (AQPs) facilitate rapid movement of water across cells, we hypothesized that AQP gene expression in placental amnion is higher than in reflected amnion. Furthermore, because gestational diabetes mellitus (GDM) is often associated with polyhydramnios, we hypothesized that amnion AQP gene expression is reduced when amniotic fluid volume is elevated. Human placental and reflected amnion were obtained at cesarean delivery and subjected to relative quantitation of AQP mRNA by real-time RT-qPCR and proteins by western immunoblot. Amnion mRNA levels of five AQPs differed by up to 400-fold (P < 0.001), with AQP1 and AQP3 most abundant, AQP8 least and AQP9 and AQP11 intermediately expressed. Aquaporin proteins showed a similar profile. Aquaporin mRNA abundance was higher (P < 0.001) in placental than reflected amnion, whereas protein levels were lower (P < 0.01). In GDM pregnancies, neither AQP mRNA nor protein levels were different from normal. There was no correlation between AQP mRNA or protein levels with the amniotic fluid index in normal or GDM subjects. We conclude that there is a strong differential expression profile among individual AQPs and between regions of the amnion. These findings suggest differences in contribution of individual AQPs to water transport in the two regions of the amnion. Furthermore, AQP expression in the amnion is not altered in patients with GDM.

  6. Differential expression of bitter taste receptors in non-cancerous breast epithelial and breast cancer cells.


    Singh, Nisha; Chakraborty, Raja; Bhullar, Rajinder Pal; Chelikani, Prashen


    The human bitter taste receptors (T2Rs) are chemosensory receptors that belong to the G protein-coupled receptor superfamily. T2Rs are present on the surface of oral and many extra-oral cells. In humans 25 T2Rs are present, and these are activated by hundreds of chemical molecules of diverse structure. Previous studies have shown that many bitter compounds including chloroquine, quinidine, bitter melon extract and cucurbitacins B and E inhibit tumor growth and induce apoptosis in cancer cells. However, the existence of T2Rs in cancer cell is not yet elucidated. In this report using quantitative (q)-PCR and flow cytometry, we characterized the expression of T2R1, T2R4, T2R10, T2R38 and T2R49 in the highly metastatic breast cancer cell line MDA-MB-231, poorly metastatic cell line MCF-7, and non-cancerous mammary epithelial cell line MCF-10A. Among the 5 T2Rs analyzed by qPCR and flow cytometry, T2R4 is expressed at 40-70% in mammary epithelial cells in comparison to commonly used breast cancer marker proteins, estrogen receptor and E-cadherin. Interestingly, the expression of T2R4 was downregulated in breast cancer cells. An increase in intracellular calcium mobilization was observed after the application of bitter agonists, quinine, dextromethorphan, and phenylthiocarbamide that are specific for some of the 5 T2Rs. This suggests that the endogenous T2Rs expressed in these cells are functional. Taken together, our novel findings suggest that T2Rs are differentially expressed in mammary epithelial cells, with some T2Rs downregulated in breast cancer cells.

  7. Protein palmitoylation regulates osteoblast differentiation through BMP-induced osterix expression.


    Leong, Wai Fook; Zhou, Tielin; Lim, Gek Liang; Li, Baojie


    Osteoporosis is one of the most common diseases and can be treated by either anti-resorption drugs, anabolic drugs, or both. To search for anabolic drug targets for osteoporosis therapy, it is crucial to understand the biology of bone forming cells, osteoblasts, in terms of their proliferation, differentiation, and function. Here we found that protein palmitoylation participates in signaling pathways that control osterix expression and osteoblast differentiation. Mouse calvarial osteoblasts express most of the 24 palmitoyl transferases, with some being up-regulated during differentiation. Inhibition of protein palmitoylation, with a substrate-analog inhibitor, diminished osteoblast differentiation and mineralization, but not proliferation or survival. The decrease in differentiation capacity is associated with a reduction in osterix, but not Runx2 or Atf4. Inhibition of palmitoyl transferases had little effect in p53(-/-) osteoblasts that show accelerated differentiation due to overexpression of osterix, suggesting that osterix, at least partially, mediated the effect of inhibition of palmitoyl transferases on osteoblast differentiation. BMPs are the major driving force of osteoblast differentiation in the differentiation assays. We found that inhibition of palmitoyl transferases also compromised BMP2-induced osteoblast differentiation through down-regulating osterix induction. However, palmitoyl transferases inhibitor did not inhibit Smad1/5/8 activation. Instead, it compromised the activation of p38 MAPK, which are known positive regulators of osterix expression and differentiation. These results indicate that protein palmitoylation plays an important role in BMP-induced MAPK activation, osterix expression, and osteoblast differentiation.

  8. Quantitative PCR for glucose transporter and tristetraprolin family gene expression in cultured mouse adipocytes and macrophages.


    Cao, Heping; Cao, Fangping; Roussel, Anne-Marie; Anderson, Richard A


    Quantitative real-time PCR (qPCR) such as TaqMan and SYBR Green qPCR are widely used for gene expression analysis. The drawbacks of SYBR Green assay are that the dye binds to any double-stranded DNA which can generate false-positive signals and that the length of the amplicon affects the intensity of the amplification. Previous results demonstrate that TaqMan assay is more sensitive but generates lower calculated expression levels than SYBR Green assay in quantifying seven mRNAs in tung tree tissues. The objective of this study is to expand the analysis using animal cells. We compared both qPCR assays for quantifying 24 mRNAs including those coding for glucose transporter (Glut) and mRNA-binding protein tristetraprolin (TTP) in mouse 3T3-L1 adipocytes and RAW264.7 macrophages. The results showed that SYBR Green and TaqMan qPCR were reliable for quantitative gene expression in animal cells. This result was supported by validation analysis of Glut and TTP family gene expression. However, SYBR Green qPCR overestimated the expression levels in most of the genes tested. Finally, both qPCR instruments (Bio-Rad's CFX96 real-time system and Applied Biosystems' Prism 7700 real-time PCR instrument) generated similar gene expression profiles in the mouse cells. These results support the conclusion that both qPCR assays (TaqMan and SYBR Green qPCR) and both qPCR instruments (Bio-Rad's CFX96 real-time system and Applied Biosystems' Prism 7700 real-time PCR instrument) are reliable for quantitative gene expression analyses in animal cells but SYBR Green qPCR generally overestimates gene expression levels than TaqMan qPCR.

  9. Expression and subcellular localization of myogenic regulatory factors during the differentiation of skeletal muscle C2C12 myoblasts.


    Ferri, Paola; Barbieri, Elena; Burattini, Sabrina; Guescini, Michele; D'Emilio, Alessandra; Biagiotti, Laura; Del Grande, Paolo; De Luca, Antonio; Stocchi, Vilberto; Falcieri, Elisabetta


    It is known that the MyoD family members (MyoD, Myf5, myogenin, and MRF4) play a pivotal role in the complex mechanism of skeletal muscle cell differentiation. However, fragmentary information on transcription factor-specific regulation is available and data on their post-transcriptional and post-translational behavior are still missing. In this work, we combined mRNA and protein expression analysis with their subcellular localization. Each myogenic regulator factor (MRF) revealed a specific mRNA trend and a protein quantitative analysis not overlapping, suggesting the presence of post-transcriptional mechanisms. In addition, each MRF showed a specific behavior in situ, characterized by a differentiation stage-dependent localization suggestive of a post-translational regulation also. Consistently with their transcriptional activity, immunogold electron microscopy data revealed MRFs distribution in interchromatin domains. Our results showed a MyoD and Myf5 contrasting expression profile in proliferating myoblasts, as well as myogenin and MRF4 opposite distribution in the terminally differentiated myotubes. Interestingly, MRFs expression and subcellular localization analysis during C2C12 cell differentiation stages showed two main MRFs regulation mechanisms: (i) the protein half-life regulation to modulate the differentiation stage-dependent transcriptional activity and (ii) the cytoplasmic retention, as a translocation process, to inhibit the transcriptional activity. Therefore, our results exhibit that MRFs nucleo-cytoplasmic trafficking is involved in muscle differentiation and suggest that, besides the MRFs expression level, also MRFs subcellular localization, related to their functional activity, plays a key role as a regulatory step in transcriptional control mechanisms.

  10. Validation and Interrogation of Differentially Expressed and Alternatively Spliced Genes in African-American Prostate Cancer

    DTIC Science & Technology


    RNA and annotated. In addition, we have developed SSOs to manipulate PIK3CD alternative splicing, to correct aberrant splicing leading to production...molecular mechanisms, differential gene expression, alternative RNA splicing, epigenetic alterations, clinical tumor aggressiveness 16. SECURITY...words): Prostate cancer, health disparities among racial groups, molecular mechanisms, differential gene expression, alternative RNA splicing

  11. Co-culture with periodontal ligament stem cells enhances osteogenic gene expression in de-differentiated fat cells.


    Tansriratanawong, Kallapat; Tamaki, Yuichi; Ishikawa, Hiroshi; Sato, Soh


    In recent decades, de-differentiated fat cells (DFAT cells) have emerged in regenerative medicine because of their trans-differentiation capability and the fact that their characteristics are similar to bone marrow mesenchymal stem cells. Even so, there is no evidence to support the osteogenic induction using DFAT cells in periodontal regeneration and also the co-culture system. Consequently, this study sought to evaluate the DFAT cells co-culture with periodontal ligament stem cells (PDLSCs) in vitro in terms of gene expression by comparing runt-related transcription factor 2 (RUNX2) and Peroxisome proliferator-activated receptor gamma 2 (PPARγ2) genes. We isolated DFAT cells from mature adipocytes and compared proliferation with PDLSCs. After co-culture with PDLSCs, we analyzed transcriptional activity implying by DNA methylation in all adipogenic gene promoters using combined bisulfite restriction analysis. We compared gene expression in RUNX2 gene with the PPARγ2 gene using quantitative RT-PCR. After being sub-cultured, DFAT cells demonstrated morphology similar to fibroblast-like cells. At the same time, PDLSCs established all stem cell characteristics. Interestingly, the co-culture system attenuated proliferation while enhancing osteogenic gene expression in RUNX2 gene. Using the co-culture system, DFAT cells could trans-differentiate into osteogenic lineage enhancing, but conversely, their adipogenic characteristic diminished. Therefore, DFAT cells and the co-culture system might be a novel cell-based therapy for promoting osteogenic differentiation in periodontal regeneration.

  12. Identification of differentially expressed peptides in high-throughput proteomics data.


    van Ooijen, Michiel P; Jong, Victor L; Eijkemans, Marinus J C; Heck, Albert J R; Andeweg, Arno C; Binai, Nadine A; van den Ham, Henk-Jan


    With the advent of high-throughput proteomics, the type and amount of data pose a significant challenge to statistical approaches used to validate current quantitative analysis. Whereas many studies focus on the analysis at the protein level, the analysis of peptide-level data provides insight into changes at the sub-protein level, including splice variants, isoforms and a range of post-translational modifications. Statistical evaluation of liquid chromatography-mass spectrometry/mass spectrometry peptide-based label-free differential data is most commonly performed using a t-test or analysis of variance, often after the application of data imputation to reduce the number of missing values. In high-throughput proteomics, statistical analysis methods and imputation techniques are difficult to evaluate, given the lack of gold standard data sets. Here, we use experimental and resampled data to evaluate the performance of four statistical analysis methods and the added value of imputation, for different numbers of biological replicates. We find that three or four replicates are the minimum requirement for high-throughput data analysis and confident assignment of significant changes. Data imputation does increase sensitivity in some cases, but leads to a much higher actual false discovery rate. Additionally, we find that empirical Bayes method (limma) achieves the highest sensitivity, and we thus recommend its use for performing differential expression analysis at the peptide level.

  13. Differential expression of Yes-associated protein and phosphorylated Yes-associated protein is correlated with expression of Ki-67 and phospho-ERK in colorectal adenocarcinoma.


    Kim, Dong-Hoon; Kim, Seok-Hyung; Lee, Ok-Jun; Huang, Song-Mei; Kwon, Ju-Lee; Kim, Jin Man; Kim, Ji-Yeon; Seong, In Ock; Song, Kyu Sang; Kim, Kyung-Hee


    Yes-associated protein (YAP) is a transcriptional co-activator and functions as a nuclear downstream effector of the Hippo pathway. Differential expression of YAP and phosphorylated Yes-associated protein (pYAP), which are involved in the expression of Ki-67 and phosphorylated extracellular signal-regulated kinase (pERK) in colorectal adenocarcinoma (CRAC), is not clear. Herein, we hypothesized that nuclear expression of YAP could predict cell proliferation and poor prognosis, while cytoplasmic expression of pYAP would show a reverse correlation with cell proliferation. Paraffin-embedded samples from 144 CRAC patients were studied using immunohistochemistry for YAP, pYAP, Ki-67 and pERK. Frozen samples from 20 CRAC patients were examined for YAP mRNA in tumor and non-tumor tissues, using quantitative real-time PCR. High nuclear YAP expression coincided with high Ki-67 expression (P=0.002). The high nuclear YAP expression group tended to display a poor overall and disease-free survival (P=0.089 and P=0.089, respectively), but YAP mRNA levels in the 20 CRAC tissues were not significantly different in comparison with the 20 non-tumor tissues (P=0.929). We observed an inverse correlation between high cytoplasmic pYAP expression and high Ki-67 expression (P=0.001). Nuclear pERK expression was positively correlated with nuclear YAP expression, but negatively correlated with cytoplasmic pYAP expression (P=0.017 and P=0.020, respectively). Activated nuclear YAP and inactivated cytoplasmic pYAP in CRAC showed a positive correlation with Ki-67 and nuclear pERK expression, suggesting that the expression of YAP and pYAP is a possible predictor of tumor cell proliferation and prognosis in CRAC.

  14. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction

    PubMed Central

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu


    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  15. Differential expression of microRNA (miRNA) in chordoma reveals a role for miRNA-1 in Met expression.


    Duan, Zhenfeng; Choy, Edwin; Nielsen, G Petur; Rosenberg, Andrew; Iafrate, John; Yang, Cao; Schwab, Joe; Mankin, Henry; Xavier, Ramnik; Hornicek, Francis J


    Emerging evidence suggests that microRNA (miRNA) expression signatures in cancer may have important diagnostic, prognostic, and therapeutic value, but there is no data on miRNA expression in chordoma. The purpose of this study was to identify the role of miRNAs in human chordoma. We analyzed miRNA expression in chordoma-derived cell lines and chordoma tissue by using miRNA microarray technology with unsupervised hierarchical clustering analysis. The relative expression levels of these miRNAs were confirmed by real-time quantitative RT-PCR and Northern blot analysis. To characterize the potential role of miRNA-1, miRNA-1 was stably transfected into a chordoma cell line, UCH1. The expression of miRNA-1 targeted gene Met in chordoma tissues was also studied. We observe that human chordoma tissues and cell lines can be distinguished from normal muscle tissue by comparing miRNA expression profiles. Several miRNAs were differentially expressed in chordoma cell lines compared to controls, and similar expression patterns were found in primary chordoma tissues. Importantly, we were able to show for the first time, to our knowledge, that expression of miRNA-1 and miRNA-206, two miRNAs implicated in a number of other cancer types, were markedly decreased in both chordoma tissues and cell lines. When chordoma cell lines were transfected with miRNA-1, downregulation of known miRNA-1 targets was observed. These targets included Met and HDAC4-two genes that were observed to be overexpressed in chordoma. Our results demonstrate that some miRNAs are differentially expressed in chordoma and, in particular, miRNA-1 may have a functional effect on chordoma tumor pathogenesis.

  16. Conditional estimation of local pooled dispersion parameter in small-sample RNA-Seq data improves differential expression test.


    Gim, Jungsoo; Won, Sungho; Park, Taesung


    High throughput sequencing technology in transcriptomics studies contribute to the understanding of gene regulation mechanism and its cellular function, but also increases a need for accurate statistical methods to assess quantitative differences between experiments. Many methods have been developed to account for the specifics of count data: non-normality, a dependence of the variance on the mean, and small sample size. Among them, the small number of samples in typical experiments is still a challenge. Here we present a method for differential analysis of count data, using conditional estimation of local pooled dispersion parameters. A comprehensive evaluation of our proposed method in the aspect of differential gene expression analysis using both simulated and real data sets shows that the proposed method is more powerful than other existing methods while controlling the false discovery rates. By introducing conditional estimation of local pooled dispersion parameters, we successfully overcome the limitation of small power and enable a powerful quantitative analysis focused on differential expression test with the small number of samples.

  17. Analysis of differentially expressed lncRNAs in differentiation of bone marrow stem cells into neural cells.


    Wu, Ai-Min; Ni, Wen-Fei; Huang, Zhe-Yu; Li, Qing-Long; Wu, Jian-Bo; Xu, Hua-Zi; Yin, Li-Hui


    Many studies have reported micro RNAs involved in the differentiation of bone marrow mesenchymal stem cells (BMSCs) into neural cells; however, the roles of long non-coding RNAs (lncRNAs) in the differentiation of BMSCs into neural cells remain poorly understood. We used microarray assays to compare the lncRNA and messenger RNA (mRNA) expression profiles in BMSCs and neural-induced BMSCs. We found a total of 24 lncRNAs and 738 mRNAs that were upregulated and 32 lncRNAs and 682 mRNAs that were downregulated in samples induced for 3h; 27 lncRNAs and 864 mRNAs that were upregulated and 37 lncRNAs and 968 mRNAs that were downregulated in 6h samples; and 23 lncRNAs and 1159 mRNAs that were upregulated or downregulated in both the 3h and 6h samples. For 23 differentially lncRNAs and 83 differentially mRNAs, 256 matched lncRNA-mRNA pairs were found. GO (Gene ontology) analysis showed that these lncRNAs were associated with biological processes, cellular components, and molecular functions. Twenty-five pathways were identified by pathway analysis. Then, RT-qPCR validation of the differentially expressed H19, Esco2, Pcdhb18, and RGD1560277 genes confirmed the microarray data. Our study revealed the expression patterns of lncRNAs in the differentiation of BMSCs into neural cells, and many lncRNAs were differentially expressed in induced BMSCs, suggesting that they may play key roles in processes of differentiation. Our findings may promote the use of BMSCs to treat neurodegenerative diseases and trauma.

  18. Quantitative analysis of Euclidean distance to complement qualitative analysis of facial expression during deception

    PubMed Central

    Mondal, Ananya; Mukhopadhyay, Pritha; Basu, Nabanita; Bandyopadhyay, Samir Kumar; Chatterjee, Tanima


    Background: Accurate evaluation of an individuals' veracity is a fundamental aspect of social functioning that allows individuals to act in adaptive ways. The domain of deception detection ability is still young, and many components in this field are yet to be touched which demands more research in this field. Aims: The present study aims at deciphering the structural composition of face during felt, posed, and deceived emotions in facial expression unique to Indian culture, using Facial Action Coding System (FACS). Quantitative analysis of Euclidean distance has been done to complement qualitative FACS analysis. Methods: In this study, thirty female, young adults with age range of 23–27 years were chosen randomly for portraying their (felt, posed, and deceived) facial expression. All facial expressions were captured through instruction, and videos were converted into static images. The static images were coded on the basis of FACS to decipher the felt, posed, and deceived expressions. Quantitative analysis of the data has been done using MATLAB to meet the objectives of the study and to complement the qualitative analysis. Results: Felt and posed emotions differ in terms of intensity of the expression and subjective experience. Posed emotional and deceived expressions differ in intent. Facial asymmetry is an important indicator for detecting deception. PMID:28163412

  19. Quantitative EEG (QEEG) Measures Differentiate Parkinson's Disease (PD) Patients from Healthy Controls (HC)

    PubMed Central

    Chaturvedi, Menorca; Hatz, Florian; Gschwandtner, Ute; Bogaarts, Jan G.; Meyer, Antonia; Fuhr, Peter; Roth, Volker


    Objectives: To find out which Quantitative EEG (QEEG) parameters could best distinguish patients with Parkinson's disease (PD) with and without Mild Cognitive Impairment from healthy individuals and to find an optimal method for feature selection. Background: Certain QEEG parameters have been seen to be associated with dementia in Parkinson's and Alzheimer's disease. Studies have also shown some parameters to be dependent on the stage of the disease. We wanted to investigate the differences in high-resolution QEEG measures between groups of PD patients and healthy individuals, and come up with a small subset of features that could accurately distinguish between the two groups. Methods: High-resolution 256-channel EEG were recorded in 50 PD patients (age 68.8 ± 7.0 year; female/male 17/33) and 41 healthy controls (age 71.1 ± 7.7 year; female/male 20/22). Data was processed to calculate the relative power in alpha, theta, delta, beta frequency bands across the different regions of the brain. Median, peak frequencies were also obtained and alpha1/theta ratios were calculated. Machine learning methods were applied to the data and compared. Additionally, penalized Logistic regression using LASSO was applied to the data in R and a subset of best-performing features was obtained. Results: Random Forest and LASSO were found to be optimal methods for feature selection. A group of six measures selected by LASSO was seen to have the most effect in differentiating healthy individuals from PD patients. The most important variables were the theta power in temporal left region and the alpha1/theta ratio in the central left region. Conclusion: The penalized regression method applied was helpful in selecting a small group of features from a dataset that had high multicollinearity. PMID:28167911

  20. Differentially expressed transcripts in shell glands from low and high egg production strains of chickens using cDNA microarrays.


    Yang, Kuo-Tai; Lin, Chia-Yu; Liou, Jong-Shian; Fan, Yi-Hsing; Chiou, Shiow-Her; Huang, Chang-Wen; Wu, Chean-Ping; Lin, En-Chung; Chen, Chih-Feng; Lee, Yen-Pai; Lee, Wen-Chuan; Ding, Shih-Torng; Cheng, Winston Teng-Kuei; Huang, Mu-Chiou


    We have constructed a tissue-specific in-house cDNA microarray to identify differentially expressed transcripts in shell glands from low (B) and high (L2) egg production strains of Taiwanese country chickens during their egg-laying period. The shell gland cDNA library was constructed from the high egg production strain. cDNA clones (7680) were randomly selected and their 5'-end sequences characterized. After excluding overlapping sequences, an in-house cDNA microarray, representing 2743 non-redundant transcripts, was generated for functional genomic studies. Using our microarray, we have successfully identified 85 differentially expressed transcripts from the two different strains of chicken shell glands. In this study, 34 of these transcripts were associated with signal transduction, protein biosynthesis, cell adhesion, cellular metabolism, skeletal development, cell organization and biogenesis. We selected a number of the differentially expressed transcripts for further validation using semi-quantitative RT-PCR. These included elongation factor 2 (EEF2), ovocalyxin-32 (OCX-32) and annexin A2 (ANXA2) which were expressed at high levels in the chicken shell glands of the B strain and, in contrast, the coactosin-like protein (COTL1), transcription factor SOX18 and MX protein were more highly expressed in the L2 strain. Our results suggest that these differentially expressed transcripts may be suitable to use as molecular markers for high rates of egg production, and now need to be investigated further to assess whether they can be applied for use in breeding selection programs in Taiwanese country chickens.

  1. Posttranscriptional deregulation of signaling pathways in meningioma subtypes by differential expression of miRNAs

    PubMed Central

    Ludwig, Nicole; Kim, Yoo-Jin; Mueller, Sabine C.; Backes, Christina; Werner, Tamara V.; Galata, Valentina; Sartorius, Elke; Bohle, Rainer M.; Keller, Andreas; Meese, Eckart


    Background Micro (mi)RNAs are key regulators of gene expression and offer themselves as biomarkers for cancer development and progression. Meningioma is one of the most frequent primary intracranial tumors. As of yet, there are limited data on the role of miRNAs in meningioma of different histological subtypes and the affected signaling pathways. Methods In this study, we compared expression of 1205 miRNAs in different meningioma grades and histological subtypes using microarrays and independently validated deregulation of selected miRNAs with quantitative real-time PCR. Clinical utility of a subset of miRNAs as biomarkers for World Health Organization (WHO) grade II meningioma based on quantitative real-time data was tested. Potential targets of deregulated miRNAs were discovered with an in silico analysis. Results We identified 13 miRNAs deregulated between different subtypes of benign meningiomas, and 52 miRNAs deregulated in anaplastic meningioma compared with benign meningiomas. Known and putative target genes of deregulated miRNAs include genes involved in epithelial-to-mesenchymal transition for benign meningiomas, and Wnt, transforming growth factor–β, and vascular endothelial growth factor signaling for higher-grade meningiomas. Furthermore, a 4-miRNA signature (miR-222, -34a*, -136, and -497) shows promise as a biomarker differentiating WHO grade II from grade I meningiomas with an area under the curve of 0.75. Conclusions Our data provide novel insights into the contribution of miRNAs to the phenotypic spectrum in benign meningiomas. By deregulating translation of genes belonging to signaling pathways known to be important for meningioma genesis and progression, miRNAs provide a second in line amplification of growth promoting cellular signals. MiRNAs as biomarkers for diagnosis of aggressive meningiomas might prove useful and should be explored further in a prospective manner. PMID:25681310

  2. Endogenous oncornaviral gene expression in adult and fetal mice: quantitative, histologic, and physiologic studies of the major viral glycorprotein, gp70

    PubMed Central


    Endogenous expression of the murine leukemia virus (MuLV) genome has been studied in a number of strains of mice. Expression of the major envelope glycoprotein, gp70, is restricted to certain anatomical sites and cell types, prominent among which are lymphoid and epithelial cells. On a quantitative basis, the major site of gp70 expression is the male genital tract. During development, gp70 first appears in the hematopoietic liver of 14-day-old embryos and by day 18, it is already expressed at anatomical sites similar to those of the adult. In toto, these results show that control of expression of the MuLV genome in adult and developing mice is linked to differentiation. PMID:172586

  3. Differentially expressed genes implicated in embryo abortion of mango identified by suppression subtractive hybridization.


    He, J H; Ma, F W; Chen, Y Y; Shu, H R


    Embryo abortion in mango severely damages mango production worldwide. The mechanisms by which the mango embryos abort have long been an intriguing question. We used subtractive suppression hybridization to investigate the differentially expressed genes involved in this process. We generated 2 cDNA libraries from normal seed and aborted seed embryos of mango cultivar 'Jinhuang'. One thousand five hundred and seventy-two high-quality expressed sequence tags (ESTs) were obtained, with 1092 from the normal seed tester library and 480 from the aborted seed tester library. These ESTs were assembled into 783 unigenes, including 147 contigs and 636 singletons in contigs; 297 singletons in gene ontology (GO) indicated coverage of a broad range of GO categories. Seven candidate genes from different categories were selected for semi-quantitative PCR analysis, and their possible functions in embryo abortion are discussed. These data provide new insight into the genetic regulation of embryo abortion in mango and may aid in further identification of novel genes and their functions.

  4. Novel conserved segments are associated with differential expression patterns for Pinaceae dehydrins.


    Perdiguero, Pedro; Barbero, M Carmen; Cervera, M Teresa; Soto, Alvaro; Collada, Carmen


    Dehydrins are thought to play an essential role in the response, acclimation and tolerance to different abiotic stresses, such as cold and drought. These proteins have been classified into five groups according to the presence of conserved and repeated motifs in their amino acid sequence. Due to their putative functions in the response to stress, dehydrins have been often used as candidate genes in studies on population variability and local adaptation to environmental conditions. However, little is still known regarding the differential role played by such groups or the mechanism underlying their function. Based on the sequences corresponding to dehydrins available in public databases we have isolated eight different dehydrins from cDNA of Pinus pinaster. We have obtained also their genomic sequences and identified their intron/exon structure. Quantitative RT-PCR analysis of their expression pattern in needles, stems and roots during a severe and prolonged drought stress, similar to the ones trees must face in nature, is also reported. Additionally, we have identified two amino acid motifs highly conserved and repeated in Pinaceae dehydrins and absent in angiosperms, presumably related to the divergent expression profiles observed.

  5. Analysis of genes that are differentially expressed during the Sclerotinia sclerotiorum–Phaseolus vulgaris interaction

    PubMed Central

    Oliveira, Marília B.; de Andrade, Rosângela V.; Grossi-de-Sá, Maria F.; Petrofeza, Silvana


    The fungus Sclerotinia sclerotiorum (Lib.) de Bary, one of the most important plant pathogens, causes white mold on a wide range of crops. Crop yield can be dramatically decreased due to this disease, depending on the plant cultivar and environmental conditions. In this study, a suppression subtractive hybridization cDNA library approach was used for the identification of pathogen and plant genes that were differentially expressed during infection of the susceptible cultivar BRS Pérola of Phaseolus vulgaris L. A total of 979 unigenes (430 contigs and 549 singletons) were obtained and classified according to their functional categories. The transcriptional profile of 11 fungal genes related to pathogenicity and virulence were evaluated by reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR). Additionally, the temporal expression profile obtained by RT-qPCR was evaluated for the following categories of plant defense-related genes: pathogenesis-related genes (PvPR1, PvPR2, and PvPR3), phenylpropanoid pathway genes (PvIsof, PvFPS1, and 4CL), and genes involved in defense and stress-related categories (PvLox, PvHiprp, PvGST, PvPod, and PvDox). Data obtained in this study provide a starting point for achieving a better understanding of the pathosystem S. sclerotiorum–P. vulgaris. PMID:26579080

  6. Transcriptome Analysis of Differentially Expressed Genes Provides Insight into Stolon Formation in Tulipa edulis

    PubMed Central

    Miao, Yuanyuan; Zhu, Zaibiao; Guo, Qiaosheng; Zhu, Yunhao; Yang, Xiaohua; Sun, Yuan


    Tulipa edulis (Miq.) Baker is an important medicinal plant with a variety of anti-cancer properties. The stolon is one of the main asexual reproductive organs of T. edulis and possesses a unique morphology. To explore the molecular mechanism of stolon formation, we performed an RNA-seq analysis of the transcriptomes of stolons at three developmental stages. In the present study, 15.49 Gb of raw data were generated and assembled into 74,006 unigenes, and a total of 2,811 simple sequence repeats were detected in T. edulis. Among the three libraries of stolons at different developmental stages, there were 5,119 differentially expressed genes (DEGs). A functional annotation analysis based on sequence similarity queries of the GO, COG, KEGG databases showed that these DEGs were mainly involved in many physiological and biochemical processes, such as material and energy metabolism, hormone signaling, cell growth, and transcription regulation. In addition, quantitative real-time PCR analysis revealed that the expression patterns of the DEGs were consistent with the transcriptome data, which further supported a role for the DEGs in stolon formation. This study provides novel resources for future genetic and molecular studies in T. edulis. PMID:27064558

  7. Transcriptome Analysis of Differentially Expressed Genes Provides Insight into Stolon Formation in Tulipa edulis.


    Miao, Yuanyuan; Zhu, Zaibiao; Guo, Qiaosheng; Zhu, Yunhao; Yang, Xiaohua; Sun, Yuan


    Tulipa edulis (Miq.) Baker is an important medicinal plant with a variety of anti-cancer properties. The stolon is one of the main asexual reproductive organs of T. edulis and possesses a unique morphology. To explore the molecular mechanism of stolon formation, we performed an RNA-seq analysis of the transcriptomes of stolons at three developmental stages. In the present study, 15.49 Gb of raw data were generated and assembled into 74,006 unigenes, and a total of 2,811 simple sequence repeats were detected in T. edulis. Among the three libraries of stolons at different developmental stages, there were 5,119 differentially expressed genes (DEGs). A functional annotation analysis based on sequence similarity queries of the GO, COG, KEGG databases showed that these DEGs were mainly involved in many physiological and biochemical processes, such as material and energy metabolism, hormone signaling, cell growth, and transcription regulation. In addition, quantitative real-time PCR analysis revealed that the expression patterns of the DEGs were consistent with the transcriptome data, which further supported a role for the DEGs in stolon formation. This study provides novel resources for future genetic and molecular studies in T. edulis.

  8. Differential expression of human placental neurotrophic factors in preterm and term deliveries.


    Dhobale, Madhavi V; Pisal, Hemlata R; Mehendale, Savita S; Joshi, Sadhana R


    Neurotrophic factors such as brain derived neurotrophic factor (BDNF) and nerve growth factor (NGF) are involved in development of the placenta and fetal brain. A series of human and animal studies in our department have shown that micronutrients (folic acid, vitamin B12) and omega 3 fatty acids like DHA are all interlinked in the one carbon cycle. Any alterations in one carbon components will lead to changes in methylation patterns that further affect the gene expression at critical periods of development resulting in complications during pregnancy. This may further contribute to risk for neurodevelopmental disorders in children born preterm. Therefore this study for the first time examines the mRNA levels from preterm and term placentae. A total number of 38 women delivering preterm (<37 weeks gestation) and 37 women delivering at term (=>37 weeks gestation) were recruited. The mRNA levels of BDNF and NGF were analyzed by real time quantitative polymerase chain reaction. Our results indicate that BDNF and NGF mRNA levels were lower in preterm group as compared to term group. There was a positive association of placental BDNF and NGF mRNA levels with cord plasma BDNF and NGF levels. The differential expression of BDNF and NGF gene in preterm placentae may also alter the vascular development in preterm deliveries. Our data suggests that the reduced mRNA levels of BDNF and NGF may possibly be a result of altered epigenetic mechanisms and may have an implication for altered fetal programming in children born preterm.

  9. [Expression change of IL-3 receptor system in all-trans retinoic acid induced differentiation of NB4 cells].


    Wu, Yong; Yang, Jing-Hui; Li, Xian-Fang; Liao, Xiao-Ying; Huang, Hui-Fang; Chen, Yuan-Zhong


    Interleukin-3 receptor (IL-3R) is a heterodimeric membrane receptor. The α subunit is essential for ligand binding and confers ligand specificity to the receptor. The common beta chain (βc) subunit, which is shared by the granulocyte macrophage-colony stimulating factor (GM-CSF), IL-3 and IL-5 receptors, is required for high-affinity ligand binding and signal transduction, mediating growth and survival of hematopoietic progenitor cells and the production and activation of mature hematopoietic cells. In order to investigate the role of IL-3 receptor system (IL-3Rα, GM-CSFRα and hβc) in myeloid differentiation, the expression level of IL-3 receptor system gene in all-trans retinoic acid (ATRA)-induced NB4 cell differentiation was detected by quantitative real time RT-PCR. At the same time, DNA sequence change was analyzed by cDNA sequencing. The results showed that the expression level of IL-3Rα mRNA was obviously down-regulated in NB4 cells treated with ATRA for 24 hours, but during differentiation of ATRA induced NB4 cells, the expression level of IL-3Rα mRNA was gradually restored, while the expression levels of GM-CSFRα mRNA and hβc mRNA were gradually up-regulated. The sequence of IL-3Rα and GM-CSFRα gene did not change before and after NB4 cells differentiation, but the sequence of hβc gene changed when NB4 cells were treated with ATRA, the expression of hβc mRNA sequence before NB4 cell differentiation taken truncated mutation as dominant, as regards expression of hβc mRNA sequence after NB4 cell differentiation, the truncated mutation of hβc mRNA had restored to wild type. It is concluded that the IL-3 receptor abnormality exists in NB4 cells, over expression of IL-3Rα and truncated mutation of hβc may be involved in proliferation and differentiation block in NB4 cells.

  10. Analysis of Differentially Expressed Genes Associated with Coronatine-Induced Laticifer Differentiation in the Rubber Tree by Subtractive Hybridization Suppression.


    Zhang, Shi-Xin; Wu, Shao-Hua; Chen, Yue-Yi; Tian, Wei-Min


    The secondary laticifer in the secondary phloem is differentiated from the vascular cambia of the rubber tree (Hevea brasiliensis Muell. Arg.). The number of secondary laticifers is closely related to the rubber yield potential of Hevea. Pharmacological data show that jasmonic acid and its precursor linolenic acid are effective in inducing secondary laticifer differentiation in epicormic shoots of the rubber tree. In the present study, an experimental system of coronatine-induced laticifer differentiation was developed to perform SSH identification of genes with differential expression. A total of 528 positive clones were obtained by blue-white screening, of which 248 clones came from the forward SSH library while 280 clones came from the reverse SSH library. Approximately 215 of the 248 clones and 171 of the 280 clones contained cDNA inserts by colony PCR screening. A total of 286 of the 386 ESTs were detected to be differentially expressed by reverse northern blot and sequenced. Approximately 147 unigenes with an average length of 497 bp from the forward and 109 unigenes with an average length of 514 bp from the reverse SSH libraries were assembled and annotated. The unigenes were associated with the stress/defense response, plant hormone signal transduction and structure development. It is suggested that Ca2+ signal transduction and redox seem to be involved in differentiation, while PGA and EIF are associated with the division of cambium initials for COR-induced secondary laticifer differentiation in the rubber tree.

  11. Differential expression of two distinct functional isoforms of melanopsin (Opn4) in the mammalian retina.


    Pires, Susana S; Hughes, Steven; Turton, Michael; Melyan, Zare; Peirson, Stuart N; Zheng, Lei; Kosmaoglou, Maria; Bellingham, James; Cheetham, Michael E; Lucas, Robert J; Foster, Russell G; Hankins, Mark W; Halford, Stephanie


    Melanopsin is the photopigment that confers photosensitivity to a subset of retinal ganglion cells (pRGCs) that regulate many non-image-forming tasks such as the detection of light for circadian entrainment. Recent studies have begun to subdivide the pRGCs on the basis of morphology and function, but the origin of these differences is not yet fully understood. Here we report the identification of two isoforms of melanopsin from the mouse Opn4 locus, a previously described long isoform (Opn4L) and a novel short isoform (Opn4S) that more closely resembles the sequence and structure of rat and human melanopsins. Both isoforms, Opn4L and Opn4S, are expressed in the ganglion cell layer of the retina, traffic to the plasma membrane and form a functional photopigment in vitro. Quantitative PCR revealed that Opn4S is 40 times more abundant than Opn4L. The two variants encode predicted proteins of 521 and 466 aa and only differ in the length of their C-terminal tails. Antibodies raised to isoform-specific epitopes identified two discrete populations of melanopsin-expressing RGCs, those that coexpress Opn4L and Opn4S and those that express Opn4L only. Recent evidence suggests that pRGCs show a range of anatomical subtypes, which may reflect the functional diversity reported for mouse Opn4-mediated light responses. The distinct isoforms of Opn4 described in this study provide a potential molecular basis for generating this diversity, and it seems likely that their differential expression plays a role in generating the variety of pRGC light responses found in the mammalian retina.

  12. Differential gene expression in response to copper in Acidithiobacillus ferrooxidans strains possessing dissimilar copper resistance.


    Wu, Xueling; Hu, Qi; Hou, Dongmei; Miao, Bo; Liu, Xueduan


    Locus afe_0454 from Acidithiobacillus ferrooxidans (At.ferrooxidans) is annotated as related to copper resistance in The Institute for Genomic Research database. In our study, two At.ferrooxidans strains, 26(#) and DC, with different levels of copper ion resistance were isolated from acid mine drainages at two major copper mines in China, and their copper-resistance capacity was determined. The 26(#) strain had a copper-tolerance level of 0.22 mol/L, whereas the DC strain had a lower copper-tolerance level of 0.04 mol/L. The mutant 26(#) was generated from strain 26(#), and its copper-tolerance level was 0.25 mol/L. Using real-time quantitative reverse transcription polymerase chain reaction, differential expression of the afe_0454 gene during copper ion stress of these three strains was investigated. The results showed that the expression of afe_0454 was increased under copper ion stress, indicating that the afe_0454 gene is sensitive to copper levels. Furthermore, the afe_0454 gene expression ratio varied in the different copper-resistant strains. Gene expression was highest in the highest copper-resistant strain. The deduced amino acid sequence of the afe_0454 gene was 56.87% non-polar, indicating the AFE_0454 protein was hydrophobic. Searching with the AFE_0454 protein in The Institute for Genomic Research database showed that the structure of the copper resistance protein D (CopD), which transports copper ions outside of the cell, had the highest sequence identity (46%). Bioinformatics analysis showed that the AFE_0454 protein has eight transmembrane helixes and was predicted to be localized to the plasma membrane. These results strongly suggested that the AFE_0454 protein is likely a transmembrane protein and might be directly involved in copper ion resistance.

  13. Differentially profiling the low-expression transcriptomes of human hepatoma using a novel SSH/microarray approach

    PubMed Central

    Pan, Yi-Shin; Lee, Yun-Shien; Lee, Yung-Lin; Lee, Wei-Chen; Hsieh, Sen-Yung


    /non-hepatoma liver tissues using quantitative RT-PCR. The SSH/microarray approaches resulted in identifying many differentially expressed genes implicated in the regulation of cell cycle, cell death, signal transduction and cell morphogenesis, suggesting the involvement of multi-biological processes in hepato-carcinogenesis. Conclusion The modified SSH/microarray approach is a simple but high-sensitive and high-efficient tool for differentially profiling the low-expression transcriptomes. It is most adequate for applying to functional genomic studies. PMID:16737534

  14. Genetic differentiation of neutral markers and quantitative traits in predominantly selfing metapopulations: confronting theory and experiments with Arabidopsis thaliana.


    Porcher, Emmanuelle; Giraud, Tatiana; Lavigne, Claire


    The comparison of the genetic differentiation of quantitative traits (QST) and molecular markers (FST) can inform on the strength and spatial heterogeneity of selection in natural populations, provided that markers behave neutrally. However, selection may influence the behaviour of markers in selfing species with strong linkage disequilibria among loci, therefore invalidating this test of detection of selection. We address this issue by monitoring the genetic differentiation of five microsatellite loci (FST) and nine quantitative traits (QST) in experimental metapopulations of the predominantly selfing species Arabidopsis thaliana, that evolved during eight generations. Metapopulations differed with respect to population size and selection heterogeneity. In large populations, the genetic differentiation of neutral microsatellites was much larger under heterogeneous selection than under uniform selection. Using simulations, we show that this influence of selection heterogeneity on FST can be attributable to initial linkage disequilibria among loci, creating stronger genetic differentiation of QTL than expected under a simple additive model with no initial linkage. We found no significant differences between FST and QST regardless of selection heterogeneity, despite a demonstrated effect of selection on QST values. Additional data are required to validate the role of mating system and linkage disequilibria in the joint evolution of neutral and selected genetic differentiation, but our results suggest that FST/QST comparisons can be conservative tests to detect selection in selfing species.

  15. [Differential diagnosis betwen Gougerot-Sjögren syndrome and sialadenosis using quantitative scintigraphy of the salivary glands].


    Hermans, P; Hausler, R; Vischer, T L


    The symptoms of both Gougerot-Sjögren's syndrome and sialadenosis consist in a reduction of salive and tear production. Sialadenosis is either essential or secondary to the intake of certain drugs. As it is sometimes difficult to differentiate between the two diseases a new quantitative scintigraphic method is proposed, where the activity over the salivary glands is compared with a neutral zone. This method has been validated with control sialography and parotid biopsies and permits an easy differentiation between the two conditions.

  16. A study on differentially expressed gene screening of Chrysanthemum plants under sound stress.


    Hongbo, Shao; Biao, Li; Bochu, Wang; Kun, Tang; Yilong, Liang


    Environmental stress can induce differential expression of genes of flower plants. It had been found that sound stimulation had an obvious effect on the growth and development of flower plants, but it is not reported on the differentially expressed genes and their expressing characteristics under sound stimulation. This is one of the few reports in terms of using the DDRT-PCR technique for screening the differentially expressed cDNA fragments responding to sound-wave stress on Chrysanthemum. Six differentially expressed cDNA fragments were obtained. Molecular weight of fragments was from 200 to 600 bp, respectively. Among differential fragments acquired, three of them (SA3, SG7-1, and CA2) were found to be positive fragments by northern dot hybridization, whose molecular weight are 270, 580 and 370 bp, respectively. SA3 was differentially expressed and SG7-1 was preferably expressed, while CA2 was restrained by the sound wave. These results indicated that expression of some genes was turned on, meanwhile the stress restrained some genes from expression under the mode of sound-stress stimulation.

  17. HNF4α Regulates Claudin-7 Protein Expression during Intestinal Epithelial Differentiation

    PubMed Central

    Farkas, Attila E.; Hilgarth, Roland S.; Capaldo, Christopher T.; Gerner-Smidt, Christian; Powell, Doris R.; Vertino, Paula M.; Koval, Michael; Parkos, Charles A.; Nusrat, Asma


    The intestinal epithelium is a dynamic barrier that maintains the distinct environments of intestinal tissue and lumen. Epithelial barrier function is defined principally by tight junctions, which, in turn, depend on the regulated expression of claudin family proteins. Claudins are expressed differentially during intestinal epithelial cell (IEC) differentiation. However, regulatory mechanisms governing claudin expression during epithelial differentiation are incompletely understood. We investigated the molecular mechanisms regulating claudin-7 during IEC differentiation. Claudin-7 expression is increased as epithelial cells differentiate along the intestinal crypt–luminal axis. By using model IECs we observed increased claudin-7 mRNA and nascent heteronuclear RNA levels during differentiation. A screen for potential regulators of the CLDN7 gene during IEC differentiation was performed using a transcription factor/DNA binding array, CLDN7 luciferase reporters, and in silico promoter analysis. We identified hepatocyte nuclear factor 4α as a regulatory factor that bound endogenous CLDN7 promoter in differentiating IECs and stimulated CLDN7 promoter activity. These findings support a role of hepatocyte nuclear factor 4α in controlling claudin-7 expression during IEC differentiation. PMID:26216285

  18. Analysis of disease-associated protein expression using quantitative proteomics—fibulin-5 is expressed in association with hepatic fibrosis.


    Bracht, Thilo; Schweinsberg, Vincent; Trippler, Martin; Kohl, Michael; Ahrens, Maike; Padden, Juliet; Naboulsi, Wael; Barkovits, Katalin; Megger, Dominik A; Eisenacher, Martin; Borchers, Christoph H; Schlaak, Jörg F; Hoffmann, Andreas-Claudius; Weber, Frank; Baba, Hideo A; Meyer, Helmut E; Sitek, Barbara


    Hepatic fibrosis and cirrhosis are major health problems worldwide. Until now, highly invasive biopsy remains the diagnostic gold standard despite many disadvantages. To develop noninvasive diagnostic assays for the assessment of liver fibrosis, it is urgently necessary to identify molecules that are robustly expressed in association with the disease. We analyzed biopsied tissue samples from 95 patients with HBV/HCV-associated hepatic fibrosis using three different quantification methods. We performed a label-free proteomics discovery study to identify novel disease-associated proteins using a subset of the cohort (n = 27). Subsequently, gene expression data from all available clinical samples were analyzed (n = 77). Finally, we performed a targeted proteomics approach, multiple reaction monitoring (MRM), to verify the disease-associated expression in samples independent from the discovery approach (n = 68). We identified fibulin-5 (FBLN5) as a novel protein expressed in relation to hepatic fibrosis. Furthermore, we confirmed the altered expression of microfibril-associated glycoprotein 4 (MFAP4), lumican (LUM), and collagen alpha-1(XIV) chain (COL14A1) in association to hepatic fibrosis. To our knowledge, no tissue-based quantitative proteomics study for hepatic fibrosis has been performed using a cohort of comparable size. By this means, we add substantial evidence for the disease-related expression of the proteins examined in this study.

  19. Promoting effect of triterpenoid compound from Agrimonia pilosa Ledeb on preadipocytes differentiation via up-regulation of PPARγ expression

    PubMed Central

    Guo, Tingwang; Zhu, Liancai; Tan, Jun; Zhou, Xuemei; Xiao, Ling; Liu, Xi; Wang, Bochu


    Background: Agrimonia Pilosa Ledeb (APL), a traditional Chinese medicine, has been reported a variety of biological activities, including treating T2DM. Objective: Triterpenoid compound (TC) was collected from APL. The aim of this study was to investigate the effects of TC on 3T3-L1 preadipocytes differentiation and genes related to differentiation and IR. Materials and Methods: Column chromatography was used to collect TC from ALP. 3T3-L1 cell differentiation was induced typically in the presence of various concentrations of TC or pioglitazone. Oil red O staining and measurement of intracellular TG content were performed on the seventh day of differentiation. Then quantitative polymerase chain reaction (Q-PCR) was used to test the expressions of three transcription factors (PPARγ, CCAAT enhancer binding protein-α (C/EBP-α), and sterol regulatory element-binding protein 1 (SREBP-1)) and the target genes of PPARγ including glucose transporter (GLUT4), lipoprotein lipase (LPL), fat acid binding protein (AP2), and adiponectin in 3T3-L1 cells. Results: At the concentration of 5, 25 and 125 μg/mL, TC significantly promoted triglyceride accumulation. Further study showed that TC could promote the expression of PPARγ, C/EBPα and ADD1/SREBP1 significantly at 125 μg/mL. As for downstream genes controlled by PPARγ, TC at 25 and 125 μg/mL could significantly promote the expression of GLUT4 and adiponectin. However, the expression of aP2 related to lipid metabolism and adiposity in the TC group was significantly lower than that in the pioglitazone group. Conclusion: TC could promote preadipocytes differentiation through activating PPARγ and downstream controlled genes. TC has the ideal insulin sensitization with lower adipogenic action than classical TZDs in vitro. So TC from Agrimonia Pilosa Ledeb has a good prospect as a natural drug for IR and T2DM. PMID:25709235

  20. Processing of gene expression data generated by quantitative real-time RT-PCR.


    Muller, Patrick Y; Janovjak, Harald; Miserez, André R; Dobbie, Zuzana


    Quantitative real-time PCR represents a highly sensitive and powerful technique for the quantitation of nucleic acids. It has a tremendous potential for the high-throughput analysis of gene expression in research and routine diagnostics. However, the major hurdle is not the practical performance of the experiments themselves but rather the efficient evaluation and the mathematical and statistical analysis of the enormous amount of data gained by this technology, as these functions are not included in the software provided by the manufacturers of the detection systems. In this work, we focus on the mathematical evaluation and analysis of the data generated by quantitative real-time PCR, the calculation of the final results, the propagation of experimental variation of the measured values to the final results, and the statistical analysis. We developed a Microsoft Excel-based software application coded in Visual Basic for Applications, called Q-Gene, which addresses these points. Q-Gene manages and expedites the planning, performance, and evaluation of quantitative real-time PCR experiments, as well as the mathematical and statistical analysis, storage, and graphical presentation of the data. The Q-Gene software application is a tool to cope with complex quantitative real-time PCR experiments at a high-throughput scale and considerably expedites and rationalizes the experimental setup, data analysis, and data management while ensuring highest reproducibility.

  1. Prediction of Differentiation Tendency Toward Hepatocytes from Gene Expression in Undifferentiated Human Pluripotent Stem Cells

    PubMed Central

    Yanagihara, Kana; Liu, Yujung; Kanie, Kei; Takayama, Kazuo; Kokunugi, Minako; Hirata, Mitsuhi; Fukuda, Takayuki; Suga, Mika; Nikawa, Hiroki; Mizuguchi, Hiroyuki; Kato, Ryuji


    Abstract Functional hepatocytes derived from human pluripotent stem cells (hPSCs) have potential as tools for predicting drug-induced hepatotoxicity in the early phases of drug development. However, the propensity of hPSC lines to differentiate into specific lineages is reported to differ. The ability to predict low propensity of hPSCs to differentiate into hepatocytes would facilitate the selection of useful hPSC clones and substantially accelerate development of hPSC-derived hepatocytes for pharmaceutical research. In this study, we compared the expression of genes associated with hepatic differentiation in five hPSC lines including human ES cell line, H9, which is known to differentiate into hepatocytes, and an hPSC line reported with a poor propensity for hepatic differentiation. Genes distinguishing between undifferentiated hPSCs, hPSC-derived hepatoblast-like differentiated cells, and primary human hepatocytes were drawn by two-way cluster analysis. The order of expression levels of genes in undifferentiated hPSCs was compared with that in hPSC-derived hepatoblast-like cells. Three genes were selected as predictors of low propensity for hepatic differentiation. Expression of these genes was investigated in 23 hPSC clones. Review of representative cells by induction of hepatic differentiation suggested that low prediction scores were linked with low hepatic differentiation. Thus, our model using gene expression ranking and bioinformatic analysis could reasonably predict poor differentiation propensity of hPSC lines. PMID:27733097

  2. Down-regulating the expression of IL-3Rβ interfered with the proliferation, not differentiation in NB4 cells.


    Li, Xin; Wu, Yong; Chen, Yuanzhong


    The human IL-3 receptor is composed of both α and β subunits. In early studies, we showed that the level of IL-3Rβ expression was lower in patients with acute promyelocytic leukemia (APL) than healthy donors and patients in complete remission by real-time quantitative polymerase chain reaction (RT-qPCR). With the differentiation of cells, enhanced expression of IL-3Rβ was also observed in all-trans-retinoic acid (ATRA)-induced NB4 cells. To unravel the role of IL-3Rβ upregulation in NB4 cells induced with ATRA, we knocked down IL-3Rβ expression by RNA interference (RNAi). Knockdown of IL-3Rβ resulted in decreased proliferation in NB4 cells induced with or without ATRA, observed by cell growth curves, colony formation assays and cell cycle analysis. Surface expression of CD11b antigen and nitroblue tetrazolium (NBT) reduction assays were also carried out at different time points. However, no significant difference was observed between the experimental and control groups treated with ATRA. Other findings suggested that IL-3Rα was decreased in NB4-IL-3Rβ shRNA cells by western blot. Down-regulation of IL-3Rβ also caused a decrease in PML/RARα expression detected with RT-qPCR. Together, these results suggest that abnormalities of IL-3Rβ expression were observed in APL; knockdown of IL-3Rβ inhibited the proliferation of NB4 cells with or without ATRA, but no effect was detected in the cellular differentiation. When NB4 cells exposed to ATAR, the up-regulation of IL-3Rβ expression may contribute to the maintenance of proliferation rather than cell differentiation.

  3. Heterogeneous lineage marker expression in naive embryonic stem cells is mostly due to spontaneous differentiation

    PubMed Central

    Nair, Gautham; Abranches, Elsa; Guedes, Ana M. V.; Henrique, Domingos; Raj, Arjun


    Populations of cultured mouse embryonic stem cells (ESCs) exhibit a subfraction of cells expressing uncharacteristically low levels of pluripotency markers such as Nanog. Yet, the extent to which individual Nanog-negative cells are differentiated, both from ESCs and from each other, remains unclear. Here, we show the transcriptome of Nanog-negative cells exhibits expression of classes of genes associated with differentiation that are not yet active in cells exposed to differentiation conditions for one day. Long non-coding RNAs, however, exhibit more changes in expression in the one-day-differentiated cells than in Nanog-negative cells. These results are consistent with the concept that Nanog-negative cells may contain subpopulations of both lineage-primed and differentiated cells. Single cell analysis showed that Nanog-negative cells display substantial and coherent heterogeneity in lineage marker expression in progressively nested subsets of cells exhibiting low levels of Nanog, then low levels of Oct4, and then a set of lineage markers, which express intensely in a small subset of these more differentiated cells. Our results suggest that the observed enrichment of lineage-specific marker gene expression in Nanog-negative cells is associated with spontaneous differentiation of a subset of these cells rather than the more random expression that may be associated with reversible lineage priming. PMID:26292941

  4. Differentially expressed cytosolic proteins in human leukemia and lymphoma cell lines correlate with lineages and functions.


    Gez, Swetlana; Crossett, Ben; Christopherson, Richard I


    Identification of cytosolic proteins differentially expressed between types of leukemia and lymphoma may provide a molecular basis for classification and understanding their cellular properties. Two-dimensional fluorescence difference gel electrophoresis (DIGE) and mass spectrometry have been used to identify proteins that are differentially expressed in cytosolic extracts from four human leukemia and lymphoma cell lines: HL-60 (acute promyelocytic leukemia), MEC1 (B-cell chronic lymphocytic leukemia), CCRF-CEM (T-cell acute lymphoblastic leukemia) and Raji (B-cell Burkitt's lymphoma). A total of 247 differentially expressed proteins were identified between the four cell lines. Analysis of the data by principal component analysis identified 22 protein spots (17 different protein species) differentially expressed at more than a 95% variance level between these cell lines. Several of these proteins were differentially expressed in only one cell line: HL-60 (myeloperoxidase, phosphoprotein 32 family member A, ras related protein Rab-11B, protein disulfide-isomerase, ran-specific GTPase-activating protein, nucleophosmin and S-100 calcium binding protein A4), and Raji (ezrin). Several of these proteins were differentially expressed in two cell lines: Raji and MEC1 (C-1-tetrahydrofolate synthase, elongation factor 2, alpha- and beta-tubulin, transgelin-2 and stathmin). MEC1 and CCRF-CEM (gamma-enolase), HL-60 and CCRF-CEM (ubiquitin-conjugating enzyme E2 N). The differentially expressed proteins identified in these four cell lines correlate with cellular properties and provide insights into the molecular basis of these malignancies.

  5. Differential expression and localization of CFTR and ENaC in mouse endometrium during pre-implantation.


    Yang, Jian Zhi; Ajonuma, Louis Chukwuemeka; Tsang, Lai Ling; Lam, Sun Yee; Rowlands, Dewi Kenneth; Ho, Lok Sze; Zhou, Chen Xi; Chung, Yiu Wa; Chan, Hsiao Chang


    Interaction between the cystic fibrosis transmembrane conductance regulator (CFTR), a CAMP-activated Cl- channel, and epithelial Na+ channel (ENaC) has been proposed as the major mechanism regulating uterine fluid absorption and secretion. Differential expression of these ion channels may give rise to dynamic changes in the fluid environment affecting various reproductive events in the female reproductive tract. This study investigated the expression and localization of CFTR and ENaC during the pre-implantation period. Semi-quantitative reverse transcriptase polymerase chain reaction and immunohistochemistry were used to study the expression and localization of CFTR and ENaC in uteri collected from mature superovulated female mice. RT-PCR showed maximal ENaC and CFTR expression on day 3 after mating. Maximal immunoreactivity was also observed for both ENaC and CFTR on day 3 after mating. However, ENaC was immunolocalized to the apical membrane of both luminal and glandular epithelia, while CFTR was predominantly found in the stromal cells rather than the epithelial cells. Differential expression and localization of CFTR and ENaC provide a molecular mechanism by which maximal fluid absorption can be achieved immediately prior to implantation, to ensure the immobilization of the blastocyst necessary for implantation.

  6. Knockdown of the differentially expressed gene TNFRSF12A inhibits hepatocellular carcinoma cell proliferation and migration in vitro

    PubMed Central

    Wang, Tao; Ma, Sicong; Qi, Xingxing; Tang, Xiaoyin; Cui, Dan; Wang, Zhi; Chi, Jiachang; Li, Ping; Zhai, Bo


    Human hepatocellular carcinoma (HCC) has been reported to be highly insensitive to conventional chemotherapy. In the current study, the Agilent Whole Human Genome Oligo Microarray (4×44 K) was used in order to identify the differentially expressed genes between HCC and adjacent tissues, and the top 22 differentially expressed genes were confirmed through reverse transcription-quantitative polymerase chain reaction. Among the identified differences in gene expression, expression of tumor necrosis factor receptor superfamily member 12A (TNFRSF12A) was markedly higher in HCC tissue than in adjacent tissue. Previous studies have suggested that TNFRSF12A may serve a role in tumor growth and metastasis, thus in the current study, TNFRSF12A was knocked down in the SMMC7721 cell line through siRNA. This demonstrated that cells exhibited reduced reproductive and metastatic capacity ex vivo. Thus, the results of the current study suggest that TNFRSF12A may be a candidate therapeutic target for cancer including HCC, and additional genes that exhibited significantly different expression from normal adjacent tissues require further study. PMID:28138696

  7. Identification and characterization of genes differentially expressed in X and Y sperm using suppression subtractive hybridization and cDNA microarray.


    Chen, Xiaoli; Yue, Yang; He, Yanan; Zhu, Huabin; Hao, Haisheng; Zhao, Xueming; Qin, Tong; Wang, Dong


    Differential expression of genes leads to variations in the phenotypes of X and Y sperm, although some differentially expressed gene products are shared through intercellular bridges. Genes differentially expressed in bovine X and Y sperm were identified by a combination of suppression subtractive hybridization (SSH), cDNA microarray, and sequence-homology analysis. Microarray data and Significance Analysis of Microarrays software were used to identify 31 differentially expressed genes, only four of which were previously identified. These genes are involved in fundamental life processes of mature sperm, and may be associated with the differences between X and Y sperm since 27 versus 4 were upregulated in X versus Y sperm, respectively. The levels of expression of seven genes-including the known genes UTY, DPH3, CYTB, and ISCU, and the unknown genes X + Y contig 41, X + Y contig 18, and Y + X contig 16-were validated by quantitative real-time PCR, and some genes were clearly differentially expressed by X and Y sperm, despite the presence of intercellular bridges among spermatids. These results provide a theoretical basis for research on gene expression during sperm development, as well as on sex control at the level of sperm.

  8. Analyses of differentially expressed genes after exposure to acute stress, acute ethanol, or a combination of both in mice.


    Baker, Jessica A; Li, Jingxin; Zhou, Diana; Yang, Ming; Cook, Melloni N; Jones, Byron C; Mulligan, Megan K; Hamre, Kristin M; Lu, Lu


    a1, a candidate gene underlying the quantitative trait locus for several of these phenotypes, and network analyses, we show that a large group of differentially expressed genes in the NOE group are highly interrelated, some of which have previously been linked to alcohol addiction or alcohol-related phenotypes.

  9. Differential Expression of Neuronal Genes in Müller Glia in Two- and Three-Dimensional Cultures

    PubMed Central

    Phillips, M. Joseph


    Purpose. Müller glia in the mammalian retina have some stem cell-like characteristics, although their capacity for neurogenesis remains limited both in vivo and in vitro. In vitro studies to date have used traditional two-dimensional (2D) cell culture to assess neuronal differentiation of Müller glia. The purpose of this study was to compare the effects of 2D and three-dimensional (3D) environments on Müller glial gene expression after growth factor stimulation. Methods. Conditionally immortalized mouse Müller glia cells (ImM10) were cultured under nonimmortalizing conditions with EGF/FGF2 to generate spheres that were differentiated in vitro on uncoated culture dishes (2D) or encapsulated in self-assembling, RADA-16 peptide hydrogels (3D) under identical media and growth factor supplementation conditions. Gene expression was analyzed using quantitative RT-PCR and immunocytochemistry. Cellular morphology was analyzed with light and confocal microscopy; sphere ultrastructure was analyzed with transmission electron microscopy. Results. ImM10 Müller cells express numerous genes associated with neural stem cells and retinal progenitors in both normal growth conditions and sphere-forming conditions. When encapsulated in the 3D hydrogel, cells can migrate and send processes into the hydrogel. Many genes associated with neurogenesis, as well as retinal neuron–specific genes, are differentially expressed in 2D and 3D differentiation conditions. Conclusions. ImM10 Müller glia upregulate genes characteristic of retinal neurons after growth factor stimulation in vitro, and gene expression patterns are altered in 3D hydrogel cultures. PMID:21051699

  10. Cloning, identification, and expression analysis at the stage of gonadal sex differentiation of chicken miR-363 and 363*.


    Huang, Pan; Gong, Yanzhang; Peng, Xiuli; Li, Shijun; Yang, Yu; Feng, Yanping


    miRNAs (microRNAs) are small, functional, non-coding RNAs and have been proved to implicate in regulation of diverse biological processes ranging from cell differentiation to organism development. With the purpose of exploring the roles of miRNAs on chicken embryo sexual determination and gonadal differentiation, we cloned and identified the stem-loop precursor structure (GenBank accession no. GU597370) of chicken miR-363 and 363* followed by studying their temporal and spatial expression patterns in chicken embryo at the stage of E3.5-6.5 d (embryonic days 3.5-6.5) by semi-quantitative RT-PCR and WISH (whole-mount in situ hybridization) in this study. The results showed that miR-363* located in cloned sequence of unknown segment in chicken genome, and flanking sequence of miR-363 and 363* according to the structural features of miRNAs precursor. Significantly differential expression (P < 0.05) of gga-miR-363 between female and male chicken embryonic gonads was found at E4.5 and 6.5 d, but the differential expression of gga-miR-363* from E3.5 to 6.5 d between both sexes fell short of significant level. The results of WISH indicated that expression signals of gga-miR-363 mainly appeared at limb bud, notochord, ectoderm, brain in E4.5 d chicken embryo, and urogenital systems (UGSs) at E6.5 d, and the expression level of E6.5 d was higher in the female than that in the male. It can be speculated that gga-miR-363 would involve in the gonadal development and gga-miR-363* might have transient regulatory functions during the early stages of chicken embryo development.

  11. Transcriptome analysis of differentially expressed genes during embryo sac development in apomeiotic non-parthenogenetic interspecific hybrid of Pennisetum glaucum.


    Sahu, Pranav Pankaj; Gupta, Sarika; Malaviya, D R; Roy, Ajoy Kumar; Kaushal, Pankaj; Prasad, Manoj


    Apomixis results in the production of genetically uniform progeny, derived from the fertilization independent development (parthenogenesis) of an unreduced egg cell (apomeiosis). To identify genes involved in the apomeiosis, a comparative transcriptome analysis of differentially expressed genes during embryo sac (ES) development in a sexual Pennisetum glaucum (genotype 81A1) and its apomeiotic (aposporic) non-parthenogenetic interspecific hybrid (BC1GO) was investigated. BC1GO exhibited the partitioned apomeiosis component, whereby the second apomixis component viz., parthenogenesis was completely lacking. A total of 96 non-redundant transcripts were recovered using suppression subtractive hybridization and classified into 11 different categories according to their putative functions. Amongst the identified transcripts, many of them belonged to unknown function (40%) followed by those involved in protein metabolism, stress response, pollen/ovule/embryo development, and translation/protein modification process. A data search of transcriptional profiling in other apomictic species revealed that 75% of the differentially expressed transcripts have not been reported in previous studies. By macroarray analysis, we identified differential expression pattern of 96 transcripts, 45 (47%) of which showed ≥2-fold induction in apomeiotic BC1GO. Further, the obtained results were validated by quantitative real-time polymerase chain reaction to have a comparative expression profiling of eight selected up-regulated transcripts (≥2.5-fold) between BC1GO and 81A1 at different phases of ovule development. In silico mapping demonstrated that 13 transcripts were located onto rice chromosome 2, region syntenic with the apospory locus as reported in Brachiaria brizantha and Paspalum notatum. The expression patterns of these transcripts showed a significant difference at differentiating megaspore mother cell and gametogenesis stages thereby suggesting their involvement in floral

  12. Differential expression profile of membrane proteins in Aplysia pleural–pedal ganglia under the stress of methyl parathion.


    Chen, Ying-Ying; Huang, Lin; Zhang, Yong; Ke, Cai-Huan; Huang, He-Qing


    This study was aimed to analyze the alteration of membrane protein profiles in Aplysia juliana Quoy & Gaimard (A. juliana) pleural–pedal ganglia under MP exposure. Both the results of GC–MS analysis and the activity assay of acetylcholinesterase (AChE), superoxide dismutase (SOD), catalase (CAT) reveal that MP toxicological effects on Aplysia left and right pleural–pedal ganglia are different under 7 and 14 days of exposure. Therefore, Aplysia were subjected for exposure at two concentrations (1 and 2 mg/l) of MP for 7 and 14 days for membrane proteomic study. As a result, 19 and 14 protein spots were differentially expressed in A. juliana left pleural–pedal ganglia under 7 and 14 days treatment, and 20 and 14 protein spots found with differential expressions in their right ganglia under the same treatment, respectively. Several proteins with expression variations were detected from both the left and right pleural–pedal ganglia; however, most proteins have distinctive expressions, indicating different mechanisms might be involved in initiating MP toxicology in left and right ganglia. Among the total differential protein spots obtained, 29 proteins were classed as membrane proteins. These proteins are mainly involved in the metabolism process, cell redox homeostasis, signal transduction, immunology, intracellular transport and catalysis, indicating MP toxicity in mollusks seems to be complex and diverse. Some differentially expressed proteins were further confirmed by Western blotting and quantitative real-time PCR. These results might provide renovated insights to reveal the mechanism of MP-induced neurotoxicity, and the novel candidate biomarkers might have potential application for environmental evaluation of MP pollution level.

  13. Identification of differentially expressed genes in HPV-positive and HPV-negative oropharyngeal squamous cell carcinomas

    PubMed Central

    Martinez, Ivan; Wang, Jun; Hobson, Kenosha F.; Ferris, Robert L.; Khan, Saleem A.


    Human papillomaviruses (HPVs) have been implicated in the pathogenesis of a subset of squamous cell carcinoma of the head and neck (SCCHN). The goal of this study was to compare the cellular gene expression profiles of HPV-positive and HPV-negative oropharyngeal carcinomas with those of the normal oral epithelium. Using Affymetrix Human U133A GeneChip, our results showed that 397 genes were differentially expressed in HPV-positive SCCHN compared to the normal oral epithelium. The up-regulated genes included those involved in cell cycle regulation (CDKN2A), cell differentiation (SFRP4) and DNA repair (RAD51AP1), while the down-regulated genes included those involved in proteolysis (PRSS3). We also found 162 differentially expressed genes in HPV-negative SCCHN compared to the normal oral mucosa. The up-regulated genes included those involved in cell proliferation (AKR1C3) and transcription regulation (SNAPC1), while down-regulated genes included those involved in apoptosis (CLU) and RNA processing (RBM3). Our studies also identified a subgroup of 59 differentially expressed genes in HPV-positive SCCHN as compared to both HPV-negative SCCHN and normal oral tissues. Such up-regulated genes included those involved in nuclear structure and meiosis (SYCP2), DNA repair (RFC5), and transcription regulation (ZNF238). Genes involved in proteolysis (KLK8) and signal transduction (CRABP2) were found to be down-regulated in HPV-positive SCCHN. The results of GeneChip experiments were validated by quantitative real-time RT-PCR analysis of a few representative genes. Our results reveal specific gene expression patterns in HPV-positive and HPV-negative oropharyngeal squamous carcinomas that may serve as potential biomarkers for the development of SCCHN. PMID:17079134

  14. Differential gene expression in anatomical compartments of the human eye

    PubMed Central

    Diehn, Jennifer J; Diehn, Maximilian; Marmor, Michael F; Brown, Patrick O


    Background The human eye is composed of multiple compartments, diverse in form, function, and embryologic origin, that work in concert to provide us with our sense of sight. We set out to systematically characterize the global gene expression patterns that specify the distinctive characteristics of the various eye compartments. Results We used DNA microarrays representing approximately 30,000 human genes to analyze gene expression in the cornea, lens, iris, ciliary body, retina, and optic nerve. The distinctive patterns of expression in each compartment could be interpreted in relation to the physiology and cellular composition of each tissue. Notably, the sets of genes selectively expressed in the retina and in the lens were particularly large and diverse. Genes with roles in immune defense, particularly complement components, were expressed at especially high levels in the anterior segment tissues. We also found consistent differences between the gene expression patterns of the macula and peripheral retina, paralleling the differences in cell layer densities between these regions. Based on the hypothesis that genes responsible for diseases that affect a particular eye compartment are likely to be selectively expressed in that compartment, we compared our gene expression signatures with genetic mapping studies to identify candidate genes for diseases affecting the cornea, lens, and retina. Conclusion Through genome-scale gene expression profiling, we were able to discover distinct gene expression 'signatures' for each eye compartment and identified candidate disease genes that can serve as a reference database for investigating the physiology and pathophysiology of the eye. PMID:16168081

  15. Differential expression of L- and S-MAG upon cAMP stimulated differentiation in oligodendroglial cells.


    Erb, M; Steck, A J; Nave, K A; Schaeren-Wiemers, N


    Myelin-associated glycoprotein (MAG), an immunoglobulin-like cell signaling protein involved in axon-glial interactions, displays two intracellular C-termini as a result of alternative mRNA splicing. During brain development, the two MAG mRNAs that encode L-MAG and S-MAG differ in their relative abundance. We have investigated the differential expression of L- and S-MAG upon cAMP treatment in the oligodendroglial cell line Oli-neu, a cell line able to differentiate in vitro. We have engineered GFP and VSVG fusions by small insertions into the alternatively spliced exons of the cloned MAG gene and reintroduced them into Oli-neu cells. The individually tagged MAG isoforms were expressed under the control of the MAG promoter and regulatory region. In this system, L-MAG was the predominant isoform before the stimulation of cells with cAMP, whereas upon cAMP treatment the S-MAG isoform was predominantly expressed in cells with a high degree of morphological differentiation. We suggest that the regulation of the MAG alternative splicing and the morphological differentiation in oligodendrocytes are controlled both by the same cAMP-responsive differentiation step.

  16. Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF-{alpha}

    SciTech Connect

    Tsukasaki, Masayuki; Yamada, Atsushi; Suzuki, Dai; Aizawa, Ryo; Miyazono, Agasa; Miyamoto, Yoichi; Suzawa, Tetsuo; Takami, Masamichi; Yoshimura, Kentaro; Morimura, Naoko; Yamamoto, Matsuo; Kamijo, Ryutaro


    Highlights: {yields} TNF-{alpha} inhibits POEM gene expression. {yields} Inhibition of POEM gene expression is caused by NF-{kappa}B activation by TNF-{alpha}. {yields} Over-expression of POEM recovers inhibition of osteoblast differentiation by TNF-{alpha}. -- Abstract: POEM, also known as nephronectin, is an extracellular matrix protein considered to be a positive regulator of osteoblast differentiation. In the present study, we found that tumor necrosis factor-{alpha} (TNF-{alpha}), a key regulator of bone matrix properties and composition that also inhibits terminal osteoblast differentiation, strongly inhibited POEM expression in the mouse osteoblastic cell line MC3T3-E1. TNF-{alpha}-induced down-regulation of POEM gene expression occurred in both time- and dose-dependent manners through the nuclear factor kappa B (NF-{kappa}B) pathway. In addition, expressions of marker genes in differentiated osteoblasts were down-regulated by TNF-{alpha} in a manner consistent with our findings for POEM, while over-expression of POEM recovered TNF-{alpha}-induced inhibition of osteoblast differentiation. These results suggest that TNF-{alpha} inhibits POEM expression through the NF-{kappa}B signaling pathway and down-regulation of POEM influences the inhibition of osteoblast differentiation by TNF-{alpha}.

  17. Differential expression of the ras gene family in mice.

    PubMed Central

    Leon, J; Guerrero, I; Pellicer, A


    We compared the expression of the ras gene family (H-ras, K-ras, and N-ras) in adult mouse tissues and during development. We found substantial variations in expression among different organs and in the amounts of the different transcripts originating from each gene, especially for the N-ras gene. The expression patterns were consistent with the reported preferential tissue activation of ras genes and suggested different cellular functions for each of the ras genes. Images PMID:3600635

  18. MYCN gene expression is required for the onset of the differentiation programme in neuroblastoma cells

    PubMed Central

    Guglielmi, L; Cinnella, C; Nardella, M; Maresca, G; Valentini, A; Mercanti, D; Felsani, A; D'Agnano, I


    Neuroblastoma is an embryonic tumour of the sympathetic nervous system and is one of the most common cancers in childhood. A high differentiation stage has been associated with a favourable outcome; however, the mechanisms governing neuroblastoma cell differentiation are not completely understood. The MYCN gene is considered the hallmark of neuroblastoma. Even though it has been reported that MYCN has a role during embryonic development, it is needed its decrease so that differentiation can be completed. We aimed to better define the role of MYCN in the differentiation processes, particularly during the early stages. Considering the ability of MYCN to regulate non-coding RNAs, our hypothesis was that N-Myc protein might be necessary to activate differentiation (mimicking embryonic development events) by regulating miRNAs critical for this process. We show that MYCN expression increased in embryonic cortical neural precursor cells at an early stage after differentiation induction. To investigate our hypothesis, we used human neuroblastoma cell lines. In LAN-5 neuroblastoma cells, MYCN was upregulated after 2 days of differentiation induction before its expected downregulation. Positive modulation of various differentiation markers was associated with the increased MYCN expression. Similarly, MYCN silencing inhibited such differentiation, leading to negative modulation of various differentiation markers. Furthermore, MYCN gene overexpression in the poorly differentiating neuroblastoma cell line SK-N-AS restored the ability of such cells to differentiate. We identified three key miRNAs, which could regulate the onset of differentiation programme in the neuroblastoma cells in which we modulated MYCN. Interestingly, these effects were accompanied by changes in the apoptotic compartment evaluated both as expression of apoptosis-related genes and as fraction of apoptotic cells. Therefore, our idea is that MYCN is necessary during the activation of neuroblastoma

  19. Differential expression of sirtuins in the aging rat brain

    PubMed Central

    Braidy, Nady; Poljak, Anne; Grant, Ross; Jayasena, Tharusha; Mansour, Hussein; Chan-Ling, Tailoi; Smythe, George; Sachdev, Perminder; Guillemin, Gilles J.


    Although there are seven mammalian sirtuins (SIRT1-7), little is known about their expression in the aging brain. To characterize the change(s) in mRNA and protein expression of SIRT1-7 and their associated proteins in the brain of “physiologically” aged Wistar rats. We tested mRNA and protein expression levels of rat SIRT1-7, and the levels of associated proteins in the brain using RT-PCR and western blotting. Our data shows that SIRT1 expression increases with age, concurrently with increased acetylated p53 levels in all brain regions investigated. SIRT2 and FOXO3a protein levels increased only in the occipital lobe. SIRT3-5 expression declined significantly in the hippocampus and frontal lobe, associated with increases in superoxide and fatty acid oxidation levels, and acetylated CPS-1 protein expression, and a reduction in MnSOD level. While SIRT6 expression declines significantly with age acetylated H3K9 protein expression is increased throughout the brain. SIRT7 and Pol I protein expression increased in the frontal lobe. This study identifies previously unknown roles for sirtuins in regulating cellular homeostasis and healthy aging. PMID:26005404

  20. Quantitative analysis of cell-type specific gene expression in the green alga Volvox carteri

    PubMed Central

    Nematollahi, Ghazaleh; Kianianmomeni, Arash; Hallmann, Armin


    Background The multicellular alga Volvox carteri possesses only two cell types: mortal, motile somatic cells and potentially immortal, immotile reproductive cells. It is therefore an attractive model system for studying how cell-autonomous cytodifferentiation is programmed within a genome. Moreover, there are ongoing genome projects both in Volvox carteri and in the closely related unicellular alga Chlamydomonas reinhardtii. However, gene sequencing is only the beginning. To identify cell-type specific expression and to determine relative expression rates, we evaluate the potential of real-time RT-PCR for quantifying gene transcript levels. Results Here we analyze a diversified pool of 39 target genes by real-time RT-PCR for each cell type. This gene pool contains previously known genes with unknown localization of cellular expression, 28 novel genes which are described in this study for the first time, and a few known, cell-type specific genes as a control. The respective gene products are, for instance, part of photosynthesis, cellular regulation, stress response, or transport processes. We provide expression data for all these genes. Conclusion The results show that quantitative real-time RT-PCR is a favorable approach to analyze cell-type specific gene expression in Volvox, which can be extended to a much larger number of genes or to developmental or metabolic mutants. Our expression data also provide a basis for a detailed analysis of individual, previously unknown, cell-type specifically expressed genes. PMID:17184518

  1. Quantitative Expression Analysis in Brassica napus by Northern Blot Analysis and Reverse Transcription-Quantitative PCR in a Complex Experimental Setting.


    Rumlow, Annekathrin; Keunen, Els; Klein, Jan; Pallmann, Philip; Riemenschneider, Anja; Cuypers, Ann; Papenbrock, Jutta

    Analysis of gene expression is one of the major ways to better understand plant reactions to changes in environmental conditions. The comparison of many different factors influencing plant growth challenges the gene expression analysis for specific gene-targeted experiments, especially with regard to the choice of suitable reference genes. The aim of this study is to compare expression results obtained by Northern blot, semi-quantitative PCR and RT-qPCR, and to identify a reliable set of reference genes for oilseed rape (Brassica napus L.) suitable for comparing gene expression under complex experimental conditions. We investigated the influence of several factors such as sulfur deficiency, different time points during the day, varying light conditions, and their interaction on gene expression in oilseed rape plants. The expression of selected reference genes was indeed influenced under these conditions in different ways. Therefore, a recently developed algorithm, called GrayNorm, was applied to validate a set of reference genes for normalizing results obtained by Northern blot analysis. After careful comparison of the three methods mentioned above, Northern blot analysis seems to be a reliable and cost-effective alternative for gene expression analysis under a complex growth regime. For using this method in a quantitative way a number of references was validated revealing that for our experiment a set of three references provides an appropriate normalization. Semi-quantitative PCR was prone to many handling errors and difficult to control while RT-qPCR was very sensitive to expression fluctuations of the reference genes.

  2. Expression of IL-4/IL-13 receptors in differentiating human airway epithelial cells

    PubMed Central

    Martin, Linda D.; Stern, Randi; Laxman, Bharathi; Marroquin, Bertha A.


    IL-4 and IL-13 elicit several important responses in airway epithelium including chemokine secretion and mucous secretion that may contribute to airway inflammation, cell migration, and differentiation. These cytokines have overlapping but not identical effector profiles likely due to shared subunits in their receptor complexes. These receptors are variably described in epithelial cells, and the relative expression, localization, and function of these receptors in differentiated and repairing epithelial cells are not clear. We examined IL-4/IL-13 receptor expression and localization in primary airway epithelial cells collected from normal human lungs and grown under conditions yielding both undifferentiated and differentiated cells inclusive of basal, goblet, and ciliated cell phenotypes. Gene expression of the IL-4Rα, IL-2Rγc, IL-13Rα1, and IL-13Rα2 receptor subunits increased with differentiation, but different patterns of localization and protein abundance were seen for each subunit based on both differentiation and the cell subtypes present. Increased expression of receptor subunits observed in more differentiated cells was associated with more substantial functional responses to IL-4 stimulation including increased eotaxin-3 expression and accelerated migration after injury. We demonstrate substantial differences in IL-4/IL-13 receptor subunit expression and responsiveness to IL-4 based on the extent of airway epithelial cell differentiation and suggest that these differences may have functional consequences in airway inflammation. PMID:20729386

  3. Differential Gene Expression Analysis in Polygonum minus Leaf upon 24 h of Methyl Jasmonate Elicitation

    PubMed Central

    Rahnamaie-Tajadod, Reyhaneh; Loke, Kok-Keong; Goh, Hoe-Han; Noor, Normah M.


    Polygonum minus is an herbal plant that grows in Southeast Asian countries and traditionally used as medicine. This plant produces diverse secondary metabolites such as phenolic compounds and their derivatives, which are known to have roles in plant abiotic and biotic stress responses. Methyl jasmonate (MeJA) is a plant signaling molecule that triggers transcriptional reprogramming in secondary metabolism and activation of defense responses against many biotic and abiotic stresses. However, the effect of MeJA elicitation on the genome-wide expression profile in the leaf tissue of P. minus has not been well-studied due to the limited genetic information. Hence, we performed Illumina paired-end RNA-seq for de novo reconstruction of P. minus leaf transcriptome to identify differentially expressed genes (DEGs) in response to MeJA elicitation. A total of 182,111 unique transcripts (UTs) were obtained by de novo assembly of 191.57 million paired-end clean reads using Trinity analysis pipeline. A total of 2374 UTs were identified to be significantly up-/down-regulated 24 h after MeJA treatment. These UTs comprising many genes related to plant secondary metabolite biosynthesis, defense and stress responses. To validate our sequencing results, we analyzed the expression of 21 selected DEGs by quantitative real-time PCR and found a good correlation between the two analyses. The single time-point analysis in this work not only provides a useful genomic resource for P. minus but also gives insights on molecular mechanisms of stress responses in P. minus. PMID:28220135

  4. Suppression subtractive hybridization reveals differentially expressed genes in supraspinous ligaments of patients with ankylosing spondylitis.


    Zhang, Ying; Hu, Xu; Zhang, Chao; Zhou, Yue; Chu, Tong-Wei


    Ankylosing spondylitis (AS) is a severe chronic inflammatory disease that may ultimately result in the development of a 'bamboo‑like' spine. Although the pathological changes that occur in AS have been extensively investigated, the mechanism underlying spinal fusion during AS remains elusive. Differentially expressed genes (DEGs) in paraspinal tissues from patients with AS compared with those from healthy controls were therefore investigated. Polymerase chain reaction (PCR)‑based suppression subtractive hybridization was performed using total mRNA from the supraspinal ligaments of three patients with AS and three patients with spinal fractures as controls. From this, 27 genes were identified in all of the three independent forward libraries, which were defined as DEGs associated with AS. Reverse transcription‑quantitative PCR demonstrated that six DEGs were overexpressed in the tissues from patients with AS compared with those from individuals in the control group, including those encoding transforming growth factor β types I and III receptor, vascular endothelial growth factor, matrix metalloproteinase‑3, core‑binding factor α1 and bone morphogenetic protein 2. Western blot analysis showed increased expression in all six of these proteins in the samples from patients with AS compared with those in the control groups. These findings suggested that changes in the expression of these genes and proteins are associated with the development of spinal fusion during the pathogenesis of AS. Furthermore, these genes may be novel markers of the risk of developing AS, in addition to being targets for the treatment of this disease.

  5. An Exercise to Estimate Differential Gene Expression in Human Cells

    ERIC Educational Resources Information Center

    Chaudhry, M. Ahmad


    The expression of genes in cells of various tissue types varies considerably and is correlated with the function of a particular organ. The pattern of gene expression changes in diseased tissues, in response to therapy or infection and exposure to environmental mutagens, chemicals, ultraviolet light, and ionizing radiation. To better understand…

  6. Differential expression and regulation of Tdo2 during mouse decidualization.


    Li, Dang-Dang; Gao, Ying-Jie; Tian, Xue-Chao; Yang, Zhan-Qing; Cao, Hang; Zhang, Qiao-Ling; Guo, Bin; Yue, Zhan-Peng


    Tryptophan 2,3-dioxygenase (Tdo2) is a rate-limiting enzyme which directs the conversion of tryptophan to kynurenine. The aim of this study was to examine the expression and regulation of Tdo2 in mouse uterus during decidualization. Tdo2 mRNA was mainly expressed in the decidua on days 6-8 of pregnancy. By real-time PCR, a high level of Tdo2 expression was observed in the uteri from days 6 to 8 of pregnancy, although Tdo2 expression was observed on days 1-8. Simultaneously, Tdo2 mRNA was also detected under in vivo and in vitro artificial decidualization. Estrogen, progesterone, and 8-bromoadenosine-cAMP could induce the expression of Tdo2 in the ovariectomized mouse uterus and uterine stromal cells. Tdo2 could regulate cell proliferation and stimulate the expression of decidual marker Dtprp in the uterine stromal cells and decidual cells. Overexpression of Tdo2 could upregulate the expression of Ahr, Cox2, and Vegf genes in uterine stromal cells, while Tdo2 inhibitor 680C91 could downregulate the expression of Cox2 and Vegf genes in uterine decidual cells. These data indicate that Tdo2 may play an important role during mouse decidualization and be regulated by estrogen, progesterone, and cAMP.

  7. Differential gene expression from microarray analysis distinguishes woven and lamellar bone formation in the rat ulna following mechanical loading.


    McKenzie, Jennifer A; Bixby, Elise C; Silva, Matthew J


    Formation of woven and lamellar bone in the adult skeleton can be induced through mechanical loading. Although much is known about the morphological appearance and structural properties of the newly formed bone, the molecular responses to loading are still not well understood. The objective of our study was to use a microarray to distinguish the molecular responses between woven and lamellar bone formation induced through mechanical loading. Rat forelimb loading was completed in a single bout to induce the formation of woven bone (WBF loading) or lamellar bone (LBF loading). A set of normal (non-loaded) rats were used as controls. Microarrays were performed at three timepoints after loading: 1 hr, 1 day and 3 days. Confirmation of microarray results was done for a select group of genes using quantitative real-time PCR (qRT-PCR). The micorarray identified numerous genes and pathways that were differentially regulated for woven, but not lamellar bone formation. Few changes in gene expression were evident comparing lamellar bone formation to normal controls. A total of 395 genes were differentially expressed between formation of woven and lamellar bone 1 hr after loading, while 5883 and 5974 genes were differentially expressed on days 1 and 3, respectively. Results suggest that not only are the levels of expression different for each type of bone formation, but that distinct pathways are activated only for woven bone formation. A strong early inflammatory response preceded an increase in angiogenic and osteogenic gene expression for woven bone formation. Furthermore, at later timepoints there was evidence of bone resorption after WBF loading. In summary, the vast coverage of the microarray offers a comprehensive characterization of the early differences in expression between woven and lamellar bone formation.

  8. Differential expression of two scribble isoforms during Drosophila embryogenesis.


    Li, M; Marhold, J; Gatos, A; Török, I; Mechler, B M


    The tumour suppressor gene scribble (scrib) is required for epithelial polarity and growth control in Drosophila. Here, we report the identification and embryonic expression pattern of two Scrib protein isoforms resulting from alternative splicing during scrib transcription. Both proteins are first ubiquitously expressed during early embryogenesis. Then, during morphogenesis each Scrib protein displays a specific pattern of expression in the central and peripheral nervous systems, CNS and PNS, respectively. During germ band extension, the expression of the longer form Scrib1 occurs predominantly in the neuroblasts derived from the neuro-ectoderm and becomes later restricted to CNS neurones as well as to the pole cells in the gonads. By contrast, the shorter form Scrib2 is strongly expressed in the PNS and a subset of CNS neurones.

  9. Differential Gene Expression in the Meristem and during Early Fruit Growth of Pisum sativum L. Identifies Potential Targets for Breeding

    PubMed Central

    Smitha Ninan, Annu; Shah, Anish; Song, Jiancheng; Jameson, Paula E.


    For successful molecular breeding it is important to identify targets to the gene family level, and in the specific species of interest, in this case Pisum sativum L. The cytokinins have been identified as a key breeding target due to their influence on plant architecture, and on seed size and sink activity. We focused on the cytokinin biosynthetic gene family (the IPTs) and the gene family key to the destruction of cytokinins (the CKXs), as well as other gene families potentially affected by changing cytokinin levels. These included key meristem genes (WUS and BAM1) and the transporter gene families, sucrose transporters (SUTs) and amino acid permeases (AAPs). We used reverse transcription quantitative PCR (RT-qPCR) to monitor gene expression in the vegetative meristem and in pre- and post-fertilisation young pea fruits. PsWUS expression was specific to the shoot apical meristem while PsBAM1 was highly expressed in the shoot apical meristem (SAM) but was also expressed at a low level in the young fruit. Differential expression was shown between genes and within gene families for IPT, CKX, SUT, and AAP. PsCKX7 showed strong gene family member-specific expression in the SAM, and was also expressed in young pea fruits. We suggest that PsCKX7 is a potential target for downregulation via molecular breeding or gene editing. PMID:28212324

  10. Differential Expression of Toll-Like Receptors 2 and 4 in Tissues of the Human Female Reproductive Tract

    PubMed Central

    Pioli, Patricia A.; Amiel, Eyal; Schaefer, Todd M.; Connolly, John E.; Wira, Charles R.; Guyre, Paul M.


    Toll-like receptor (TLR) signal transduction is a central component of the innate immune response to pathogenic challenge. Although recent studies have begun to elucidate differences in acquired immunity in tissues of the human female reproductive tract, there is a relative paucity of work regarding innate defense mechanisms. We investigated TLR mRNA and protein expression in tissues of the human female reproductive tract. Constitutive mRNA expression of TLRs 1 to 6 was observed in fallopian tubes, uterine endometrium, cervix, and ectocervix. Furthermore, transcripts of the signaling adapter MyD88 and the accessory molecule CD14 were also detected in all tissues assayed. Quantitative analysis of TLR2 mRNA levels revealed highest expression of this molecule in fallopian tube and cervical tissues, followed by endometrium and ectocervix. In contrast to TLR2, TLR4 expression declined progressively along the tract, with highest expression in the upper tissues (fallopian tubes and endometrium), followed by cervix and ectocervix. In addition to mRNA, protein expression of TLR2 and TLR4 was also documented in these tissues. These data suggest that TLRs are differentially expressed in distinct compartments of the female reproductive tract and may provide insight regarding the regulation of inflammation and immunity within the tract. PMID:15385480

  11. The workflow of single-cell expression profiling using quantitative real-time PCR

    PubMed Central

    Ståhlberg, Anders; Kubista, Mikael


    Biological material is heterogeneous and when exposed to stimuli the various cells present respond differently. Much of the complexity can be eliminated by disintegrating the sample, studying the cells one by one. Single-cell profiling reveals responses that go unnoticed when classical samples are studied. New cell types and cell subtypes may be found and relevant pathways and expression networks can be identified. The most powerful technique for single-cell expression profiling is currently quantitative reverse transcription real-time PCR (RT-qPCR). A robust RT-qPCR workflow for highly sensitive and specific measurements in high-throughput and a reasonable degree of multiplexing has been developed for targeting mRNAs, but also microRNAs, non-coding RNAs and most recently also proteins. We review the current state of the art of single-cell expression profiling and present also the improvements and developments expected in the next 5 years. PMID:24649819

  12. The quantitative real-time polymerase chain reaction for the analysis of plant gene expression.


    Fitzgerald, Timothy L; McQualter, Richard B


    The quantitative real-time polymerase chain reaction is used to simultaneously amplify and quantify a targeted DNA molecule. It can be used to determine exact copy number of a molecule within a sample and/or to compare the quantity of a molecule between samples. When combined with reverse transcription, it is a powerful tool for the analysis of gene expression, and it is widely used for this purpose in plant species. Here we provide an introduction to fundamental concepts relevant for the analysis of gene expression in plants using this technique and a protocol for quantification of the relative expression of a sucrose phosphate synthase gene along the maturation gradient of a sugarcane leaf.

  13. Fat accumulation in differentiated brown adipocytes is linked with expression of Hox genes.


    Singh, Smita; Rajput, Yudhishthir S; Barui, Amit K; Sharma, Rajan; Datta, Tirtha K


    Homeobox (Hox) genes are involved in body plan of embryo along the anterior-posterior axis. Presence of several Hox genes in white adipose tissue (WAT) and brown adipose tissue (BAT) is indicative of involvement of Hox genes in adipogenesis. We propose that differentiation inducing agents viz. isobutyl-methyl-xanthine (IBMX), indomethacin, dexamethasone (DEX), triiodothyronine (T3) and insulin may regulate differentiation in brown adipose tissue through Hox genes. In vitro culture of brown fat stromalvascular fraction (SVF) in presence or absence of differentiation inducing agents was used for establishing relationship between fat accumulation in differentiated adipocytes and expression of Hox genes. Relative expression of Pref1, UCP1 and Hox genes was determined in different stages of adipogenesis. Presence or absence of IBMX, indomethacin and DEX during differentiation of proliferated pre-adipocytes resulted in marked differences in expression of Hox genes and lipid accumulation. In presence of these inducing agents, lipid accumulation as well as expression of HoxA1, HoxA5, HoxC4 &HoxC8 markedly enhanced. Irrespective of presence or absence of T3, insulin down regulates HoxA10. T3 results in over expression of HoxA5, HoxC4 and HoxC8 genes, whereas insulin up regulates expression of only HoxC8. Findings suggest that accumulation of fat in differentiated adipocytes is linked with expression of Hox genes.

  14. Gene expression in breast muscle associated with feed efficiency in a single male broiler line using a chicken 44K oligo microarray. I. Top differentially expressed genes.


    Kong, B-W; Song, J J; Lee, J Y; Hargis, B M; Wing, T; Lassiter, K; Bottje, W


    Global RNA expression in breast muscle obtained from a male broiler line phenotyped for high or low feed efficiency (FE) was investigated. Pooled RNA samples (n = 6/phenotype) labeled with cyanine 3 or cyanine 5 fluorescent dyes to generate cRNA probes were hybridized on a 4 × 44K chicken oligo microarray. Local polynomial regression normalization was applied to background-corrected red and green intensities with a moderated t-statistic. Corresponding P-values were computed and adjusted for multiple testing by false discovery rate to identify differentially expressed genes. Microarray validation was carried out by comparing findings with quantitative reverse-transcription PCR. A 1.3-fold difference in gene expression was set as a cutoff value, which encompassed 20% (782 of 4,011) of the total number of genes that were differentially expressed between FE phenotypes. Using an online software program (Ingenuity Pathway Analysis), the top 10 upregulated genes identified by Ingenuity Pathway Analysis in the high-FE group were generally associated with anabolic processes. In contrast, 7 of the top 10 downregulated genes in the high-FE phenotype (upregulated in the low-FE phenotype) were associated with muscle fiber development, muscle function, and cytoskeletal organization, with the remaining 3 genes associated with self-recognition or stress-responding genes. The results from this study focusing on only the top differentially expressed genes suggest that the high-FE broiler phenotype is derived from the upregulation of genes associated with anabolic processes as well as a downregulation of genes associated with muscle fiber development, muscle function, cytoskeletal organization, and stress response.

  15. Visualization and Differential Analysis of Protein Expression Data Using R.


    Silva, Tomé S; Richard, Nadège


    Data analysis is essential to derive meaningful conclusions from proteomic data. This chapter describes ways of performing common data visualization and differential analysis tasks on gel-based proteomic datasets using a freely available statistical software package (R). A workflow followed is illustrated using a synthetic dataset as example.

  16. Differentially correlated genes in co-expression networks control phenotype transitions

    PubMed Central

    Thomas, Lina D.; Vyshenska, Dariia; Shulzhenko, Natalia; Yambartsev, Anatoly; Morgun, Andrey


    Background: Co-expression networks are a tool widely used for analysis of “Big Data” in biology that can range from transcriptomes to proteomes, metabolomes and more recently even microbiomes. Several methods were proposed to answer biological questions interrogating these networks. Differential co-expression analysis is a recent approach that measures how gene interactions change when a biological system transitions from one state to another. Although the importance of differentially co-expressed genes to identify dysregulated pathways has been noted, their role in gene regulation is not well studied. Herein we investigated differentially co-expressed genes in a relatively simple mono-causal process (B lymphocyte deficiency) and in a complex multi-causal system (cervical cancer). Methods: Co-expression networks of B cell deficiency (Control and BcKO) were reconstructed using Pearson correlation coefficient for two mus musculus datasets: B10.A strain (12 normal, 12 BcKO) and BALB/c strain (10 normal, 10 BcKO). Co-expression networks of cervical cancer (normal and cancer) were reconstructed using local partial correlation method for five datasets (total of 64 normal, 148 cancer). Differentially correlated pairs were identified along with the location of their genes in BcKO and in cancer networks. Minimum Shortest Path and Bi-partite Betweenness Centrality where statistically evaluated for differentially co-expressed genes in corresponding networks.    Results: We show that in B cell deficiency the differentially co-expressed genes are highly enriched with immunoglobulin genes (causal genes). In cancer we found that differentially co-expressed genes act as “bottlenecks” rather than causal drivers with most flows that come from the key driver genes to the peripheral genes passing through differentially co-expressed genes. Using in vitro knockdown experiments for two out of 14 differentially co-expressed genes found in cervical cancer (FGFR2 and CACYBP), we

  17. Differentially-expressed glycoproteins in Locusta migratoria hemolymph infected with Metarhizium anisopliae.


    Wang, Chutao; Cao, Yueqing; Wang, Zhongkang; Yin, Youping; Peng, Guoxiong; Li, Zhenlun; Zhao, Hua; Xia, Yuxian


    Glycoproteins play important roles in insect physiology. Infection with pathogen always results in the differential expression of some glycoproteins, which may be involved in host-pathogen interactions. In this report, differentially-expressed glycoproteins from the hemolymph of locusts infected with Metarhizium anisopliae were analyzed by two-dimensional electrophoresis (2-DE) and PDQuest software. The results showed that 13 spots were differentially expressed, of which nine spots were upregulated and four were downregulated. Using MS/MS with de novo sequencing and NCBI database searches, three upregulated proteins were identified as locust transferrin, apolipoprotein precursor, and hexameric storage protein 3. These proteins have been reported to be involved in the insect innate immune response to microbial challenge. Due to the limited available genome information and protein sequences of locusts, the possible functions of the other 10 differentially-expressed spots remain unknown.

  18. Characterizing differential gene expression in polyploid grasses lacking a reference transcriptome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Basal transcriptome characterization and differential gene expression in response to varying conditions are often addressed through next generation sequencing (NGS) and data analysis techniques. While these strategies are commonly used, there are countless tools, pipelines, data analysis methods an...

  19. Quantitative and correlation analysis of the DNA methylation and expression of DAPK in breast cancer

    PubMed Central

    Zhu, Youzhi; Li, Shuiqin; Wang, Qingshui; Chen, Ling; Wu, Kunlin; Huang, Yide


    Background Death-associated protein kinase 1 (DAPK) is an important tumor suppressor kinase involved in the regulation of multiple cellular activities such as apoptosis and autophagy. DNA methylation of DAPK gene was found in various types of cancers and often correlated with the clinicopathological characteristics. However, the mRNA and protein expression of DAPK in the same sample was rarely measured. Thus, it was unclear if the correlation between DAPK gene methylation and clinicopathological parameters was due to the loss of DAPK expression. Methods In this study, the DNA methylation rate, mRNA and protein expression of DAPK was quantitatively detected in 15 pairs of breast cancer patient samples including tumor (T) and adjacent non-tumor (N) tissues. Results The correlation between DNA methylation rate and mRNA expression, together with the correlation between mRNA and protein expression, was calculated. No correlation was observed between any levels using either the measurement value of each sample or the T/N ratio of each pair. Discussion These data suggested that the DNA methylation status of DAPK did not correlate well with its mRNA or protein expression. Extra caution is needed when interpreting the DNA methylation data of DAPK gene in clinical studies. PMID:28316888

  20. Hepatic transcriptome analysis and identification of differentially expressed genes response to dietary oxidized fish oil in loach Misgurnus anguillicaudatus

    PubMed Central

    Zhang, Yin; Li, Yang; Liang, Xiao; Cao, Xiaojuan; Huang, Longfei; Yan, Jie; Wei, Yanxing; Gao, Jian


    RNA sequencing and short-read assembly were utilized to produce a transcriptome of livers from loaches (Misgurnus anguillicaudatus) fed with three different diets respectively containing fresh fish oil (FO group), medium oxidized fish oil (MO group) and high oxidized fish oil (HO group). A total of 60,663 unigenes were obtained in this study, with mean length 848.74 bp. 50,814, 49,584 and 49,814 unigenes were respectively obtained from FO, MO and HO groups. There were 2,343 differentially expressed genes between FO and MO, with 855 down- and 1,488 up-regulated genes in the MO group. 2,813 genes were differentially expressed between FO and HO, including 1,256 down- and 1,552 up-regulated genes in the HO group. 2,075 differentially expressed genes were found in the comparison of MO and HO, including 1,074 up- and 1,001 down-regulated genes in the MO group. Some differentially expressed genes, such as fatty acid transport protein (fatp), fatty acid binding protein (fabp), apolipoprotein (apo), peroxisome proliferator activated receptor-gamma (ppar-γ), acetyl-CoA synthetase (acs) and arachidonate 5-lipoxygenase (alox5), were involved in lipid metabolism, suggesting these genes in the loach were responsive to dietary oxidized fish oil. Results of transcriptome profilings here were validated using quantitative real time PCR in fourteen randomly selected unigenes. The present study provides insights into hepatic transcriptome profile of the loach, which is a valuable resource for studies of loach genomics. More importantly, this study identifies some important genes responsible for dietary oxidized fish oil, which will benefit researches of lipid metabolism in fish. PMID:28212448

  1. Hepatic transcriptome analysis and identification of differentially expressed genes response to dietary oxidized fish oil in loach Misgurnus anguillicaudatus.


    Zhang, Yin; Li, Yang; Liang, Xiao; Cao, Xiaojuan; Huang, Longfei; Yan, Jie; Wei, Yanxing; Gao, Jian


    RNA sequencing and short-read assembly were utilized to produce a transcriptome of livers from loaches (Misgurnus anguillicaudatus) fed with three different diets respectively containing fresh fish oil (FO group), medium oxidized fish oil (MO group) and high oxidized fish oil (HO group). A total of 60,663 unigenes were obtained in this study, with mean length 848.74 bp. 50,814, 49,584 and 49,814 unigenes were respectively obtained from FO, MO and HO groups. There were 2,343 differentially expressed genes between FO and MO, with 855 down- and 1,488 up-regulated genes in the MO group. 2,813 genes were differentially expressed between FO and HO, including 1,256 down- and 1,552 up-regulated genes in the HO group. 2,075 differentially expressed genes were found in the comparison of MO and HO, including 1,074 up- and 1,001 down-regulated genes in the MO group. Some differentially expressed genes, such as fatty acid transport protein (fatp), fatty acid binding protein (fabp), apolipoprotein (apo), peroxisome proliferator activated receptor-gamma (ppar-γ), acetyl-CoA synthetase (acs) and arachidonate 5-lipoxygenase (alox5), were involved in lipid metabolism, suggesting these genes in the loach were responsive to dietary oxidized fish oil. Results of transcriptome profilings here were validated using quantitative real time PCR in fourteen randomly selected unigenes. The present study provides insights into hepatic transcriptome profile of the loach, which is a valuable resource for studies of loach genomics. More importantly, this study identifies some important genes responsible for dietary oxidized fish oil, which will benefit researches of lipid metabolism in fish.

  2. Demonstration of differential quantitative requirements for NSF among multiple vesicle fusion pathways of GLUT4 using a dominant-negative ATPase-deficient NSF

    SciTech Connect

    Chen Xiaoli; Matsumoto, Hideko; Hinck, Cynthia S.; Al-Hasani, Hadi; St-Denis, Jean-Francois; Whiteheart, Sidney W.; Cushman, Samuel W. . E-mail:


    In this study, we investigated the relative participation of N-ethylmaleimide-sensitive factor (NSF) in vivo in a complex multistep vesicle trafficking system, the translocation response of GLUT4 to insulin in rat adipose cells. Transfections of rat adipose cells demonstrate that over-expression of wild-type NSF has no effect on total, or basal and insulin-stimulated cell-surface expression of HA-tagged GLUT4. In contrast, a dominant-negative NSF (NSF-D1EQ) can be expressed at a low enough level that it has little effect on total HA-GLUT4, but does reduce both basal and insulin-stimulated cell-surface HA-GLUT4 by {approx}50% without affecting the GLUT4 fold-translocation response to insulin. However, high expression levels of NSF-D1EQ decrease total HA-GLUT4. The inhibitory effect of NSF-D1EQ on cell-surface HA-GLUT4 is reversed when endocytosis is inhibited by co-expression of a dominant-negative dynamin (dynamin-K44A). Moreover, NSF-D1EQ does not affect cell-surface levels of constitutively recycling GLUT1 and TfR, suggesting a predominant effect of low-level NSF-D1EQ on the trafficking of GLUT4 from the endocytic recycling compared to the intracellular GLUT4-specific compartment. Thus, our data demonstrate that the multiple fusion steps in GLUT4 trafficking have differential quantitative requirements for NSF activity. This indicates that the rates of plasma and intracellular membrane fusion reactions vary, leading to differential needs for the turnover of the SNARE proteins.

  3. Comprehensive transcriptome-based characterization of differentially expressed genes involved in microsporogenesis of radish CMS line and its maintainer.


    Xie, Yang; Zhang, Wei; Wang, Yan; Xu, Liang; Zhu, Xianwen; Muleke, Everlyne M; Liu, Liwang


    Microsporogenesis is an indispensable period for investigating microspore development and cytoplasmic male sterility (CMS) occurrence. Radish CMS line plays a critical role in elite F1 hybrid seed production and heterosis utilization. However, the molecular mechanisms of microspore development and CMS occurrence have not been thoroughly uncovered in radish. In this study, a comparative analysis of radish floral buds from a CMS line (NAU-WA) and its maintainer (NAU-WB) was conducted using next generation sequencing (NGS) technology. Digital gene expression (DGE) profiling revealed that 3504 genes were significantly differentially expressed between NAU-WA and NAU-WB library, among which 1910 were upregulated and 1594 were downregulated. Gene ontology (GO) analysis showed that these differentially expressed genes (DEGs) were mainly enriched in extracellular region, catalytic activity, and response to stimulus. KEGG enrichment analysis revealed that the DEGs were predominantly associated with flavonoid biosynthesis, glycolysis, and biosynthesis of secondary metabolites. Real-time quantitative PCR analysis showed that the expression profiles of 13 randomly selected DEGs were in high agreement with results from Illumina sequencing. Several candidate genes encoding ATP synthase, auxin response factor (ARF), transcription factors (TFs), chalcone synthase (CHS), and male sterility (MS) were responsible for microsporogenesis. Furthermore, a schematic diagram for functional interaction of DEGs from NAU-WA vs. NAU-WB library in radish plants was proposed. These results could provide new information on the dissection of the molecular mechanisms underlying microspore development and CMS occurrence in radish.

  4. Differential expression of endoglin in human melanoma cells expressing the V3 isoform of versican by microarray analysis.


    Miquel-Serra, Laia; Hernandez, Daniel; Docampo, María Jose; Bassols, Anna


    Versican is a large chondroitin sulfate proteoglycan produced by several tumor types, including malignant melanoma, which exists as four different splice variants. The large isoforms V0 and V1 promote melanoma cell proliferation. We previously described that overexpression of the short V3 isoform in MeWo human melanoma cells markedly reduced tumor cell growth in vitro and in vivo, but favored the appearance of secondary tumors. This study aimed to elucidate the mechanisms of V3 by identifying differentially expressed genes between parental and V3-expressing MeWo melanoma cells using microarray analysis. V3 expression significantly reduced the expression of endoglin, a transforming growth factor-β superfamily co-receptor. Other differentially expressed genes were VEGF and PPP1R14B. Changes in endoglin levels were validated by qRT-PCR and Western blotting.

  5. [Alteration of isozyme gene expression during cell differentiation and oncogenesis].


    Yamada, K; Noguchi, T


    Rat pyruvate kinase (PK) has four isozymes, called the M1-, M2-, L-, and R-types. The M1- and M2-type isozymes of PK are produced from the PKM gene by alternative splicing, whereas the L- and R-type isozymes of PK are produced from the PKL gene by use of different tissue-specific promoters. In early development, only M2-type PK expresses in all tissues. After late morphogenesis, M1-, L-, and R-type PK express tissue-specifically. In contrast, cell proliferation such as regenerating liver and oncogenesis lead to decrease or cessation of the expression of tissue-specific PK isozymes and to stimulation of the expression of M2-type PK. These phenomena from the point of view transcriptional regulatory apparatus of the PKM and PKL gene are discussed.

  6. Integrin expression in stem cells from bone marrow and adipose tissue during chondrogenic differentiation.


    Goessler, Ulrich Reinhart; Bugert, Peter; Bieback, Karen; Stern-Straeter, Jens; Bran, Gregor; Hörmann, Karl; Riedel, Frank


    The use of adult mesenchymal stem cells (MSC) in cartilage tissue engineering offers new perspectives in the generation of transplants for reconstructive surgery. The extracelular matrix (ECM) plays a key role in modulating the function and phenotype of the embedded cells and contains the integrins as adhesion receptors mediating cell-cell and cell-matrix interactions. In our study, characteristic changes in integrin expression during the course of chondrogenic differentiation of MSC from bone marrow and adipose tissue were compared. MSC were isolated from bone marrow biopsies and adipose tissue. During cell culture, chondrogenic differentiation was performed. The expression of integrins and their signaling components were analysed with microarray and immunohistochemistry in freshly isolated MSC and after chondrogenic differentiation. The fibronectin receptor (integrin alpha5beta1) was expressed by undifferentiated MSC, and expression rose during chondrogenic differentiation in both types of MSC. The components of the vitronectin/osteopontin receptors (alphavbeta5) were not expressed by freshly isolated MSC, and expression rose with ongoing differentiation. Receptors for the collagens (alpha1beta1, alpha2beta1, alpha3beta1) were weakly expressed by undifferentiated MSC and were activated during differentiation. Intracellular signaling components integrin-linked kinase (ILK) and CD47 showed increased expression with ongoing differentiation. For all integrins, no significant differences were be found in the 2 types of MSC. Integrin-mediated signaling appeared to play an important role in the generation and maintenance of the chondrocytic phenotype during chondrogenic differentiation. Particularly, the receptors for fibronectin, vitronectin, osteopontin and the collagens may be involved in the generation of the ECM. Intracellularly, their signals might be transduced by ILK and CD47. To fully harness the potential of these cells, future studies should be directed to

  7. Comprehensive Gene Expression Analysis of Human Embryonic Stem Cells during Differentiation into Neural Cells

    PubMed Central

    Fathi, Ali; Hatami, Maryam; Hajihosseini, Vahid; Fattahi, Faranak; Kiani, Sahar; Baharvand, Hossein; Salekdeh, Ghasem Hosseini


    Global gene expression analysis of human embryonic stem cells (hESCs) that differentiate into neural cells would help to further define the molecular mechanisms involved in neurogenesis in humans. We performed a comprehensive transcripteome analysis of hESC differentiation at three different stages: early neural differentiation, neural ectoderm, and differentiated neurons. We identified and validated time-dependent gene expression patterns and showed that the gene expression patterns reflect early ESC differentiation. Sets of genes are induced in primary ectodermal lineages and then in differentiated neurons, constituting consecutive waves of known and novel genes. Pathway analysis revealed dynamic expression patterns of members of several signaling pathways, including NOTCH, mTOR and Toll like receptors (TLR), during neural differentiation. An interaction network analysis revealed that the TGFβ family of genes, including LEFTY1, ID1 and ID2, are possible key players in the proliferation and maintenance of neural ectoderm. Collectively, these results enhance our understanding of the molecular dynamics underlying neural commitment and differentiation. PMID:21829537

  8. Quantitative Reverse Transcription-qPCR-Based Gene Expression Analysis in Plants.


    Abdallah, Heithem Ben; Bauer, Petra


    The investigation of gene expression is an initial and essential step to understand the function of a gene in a physiological context. Reverse transcription-quantitative real-time PCR (RT-qPCR) assays are reproducible, quantitative, and fast. They can be adapted to study model and non-model plant species without the need to have whole genome or transcriptome sequence data available. Here, we provide a protocol for a reliable RT-qPCR assay, which can be easily adapted to any plant species of interest. We describe the design of the qPCR strategy and primer design, considerations for plant material generation, RNA preparation and cDNA synthesis, qPCR setup and run, and qPCR data analysis, interpretation, and final presentation.

  9. MicroRNA gene expression during retinoic acid-induced differentiation of human acute promyelocytic leukemia.


    Garzon, R; Pichiorri, F; Palumbo, T; Visentini, M; Aqeilan, R; Cimmino, A; Wang, H; Sun, H; Volinia, S; Alder, H; Calin, G A; Liu, C-G; Andreeff, M; Croce, C M


    MicroRNAs (miRNAs) are small non-coding RNAs of 19-25 nucleotides that are involved in the regulation of critical cell processes such as apoptosis, cell proliferation and differentiation. However, little is known about the role of miRNAs in granulopoiesis. Here, we report the expression of miRNAs in acute promyelocytic leukemia patients and cell lines during all-trans-retinoic acid (ATRA) treatment by using a miRNA microarrays platform and quantitative real time-polymerase chain reaction (qRT-PCR). We found upregulation of miR-15a, miR-15b, miR-16-1, let-7a-3, let-7c, let-7d, miR-223, miR-342 and miR-107, whereas miR-181b was downregulated. Among the upregulated miRNAs, miR-107 is predicted to target NFI-A, a gene that has been involved in a regulatory loop involving miR-223 and C/EBPa during granulocytic differentiation. Indeed, we have confirmed that miR-107 targets NF1-A. To get insights about ATRA regulation of miRNAs, we searched for ATRA-modulated transcription factors binding sites in the upstream genomic region of the let-7a-3/let-7b cluster and identified several putative nuclear factor-kappa B (NF-kappaB) consensus elements. The use of reporter gene assays, chromatin immunoprecipitation and site-directed mutagenesis revealed that one proximal NF-kappaB binding site is essential for the transactivation of the let-7a-3/let-7b cluster. Finally, we show that ATRA downregulation of RAS and Bcl2 correlate with the activation of known miRNA regulators of those proteins, let-7a and miR-15a/miR-16-1, respectively.

  10. Differential gene expressions in arbuscular mycorrhizal-colonized tomato grown under heavy metal stress.


    Ouziad, Fouad; Hildebrandt, Ulrich; Schmelzer, Elmon; Bothe, Hermann


    When tomato was grown in either "Breinigerberg" soil, which has a high content of Zn and of other heavy metals or in non-polluted soil enriched with up to 1 mM CdCl2, plants colonized with the arbuscular mycorrhizal fungus (AMF) Glomus intraradices grew distinctly better than non-mycorrhizal controls. An analysis of differential mRNA transcript formations was performed on several plant genes coding for products potentially involved in heavy metal tolerance. Northern blot analyses indicated that the mRNA from either roots or leaves was not differentially expressed in the case of LePCS1 (coding for phytochelatin synthase), Lemt1, Lemt3 and Lemt4 (for metallothioneins) or LeNramp2 (for a broad range heavy metal transporter) in both mycorrhizal and non-mycorrhizal plants, grown either with or without heavy metals. In contrast, Lemt2 was strongly expressed only in non-AMF-colonized roots, and only after growth in the Breinigerberg soil or in the presence of high CdCl2-concentrations. AMF colonization distinctly reduced the level of Lemt2 transcripts. This was also the case for the root specific LeNramp1 transporter, however, only after growth in the Breinigerberg soil, but not under Cd-stress. Likewise, the levels of LeNramp3 transcripts were reduced by the AMF colonization in roots, but not in leaves. Quantitative Real-Time RT-PCR-experiments performed with Lemt2, LeNramp1 and LeNramp3 largely corroborated the Northern analysis data. In situ hybridization experiments with Lemt2 and LeNramp1 showed that both genes were strongly expressed throughout the plant cells in non-colonized roots, whereas colonized roots revealed only few signals restricted to some parenchyma cells. All the data suggest that the transcript levels of some, but not all genes of the Nramp or mt family are elevated under heavy metal stress. AMF colonization results in a down-regulation of these genes, presumably due to the fact that the content of heavy metals is lower in mycorrhizal than in non

  11. Glucocorticoids promote development of the osteoblast phenotype by selectively modulating expression of cell growth and differentiation associated genes

    NASA Technical Reports Server (NTRS)

    Shalhoub, V.; Conlon, D.; Tassinari, M.; Quinn, C.; Partridge, N.; Stein, G. S.; Lian, J. B.


    To understand the mechanisms by which glucocorticoids promote differentiation of fetal rat calvaria derived osteoblasts to produce bone-like mineralized nodules in vitro, a panel of osteoblast growth and differentiation related genes that characterize development of the osteoblast phenotype has been quantitated in glucocorticoid-treated cultures. We compared the mRNA levels of osteoblast expressed genes in control cultures of subcultivated cells where nodule formation is diminished, to cells continuously (35 days) exposed to 10(-7) M dexamethasone, a synthetic glucocorticoid, which promotes nodule formation to levels usually the extent observed in primary cultures. Tritiated thymidine labelling revealed a selective inhibition of internodule cell proliferation and promotion of proliferation and differentiation of cells forming bone nodules. Fibronectin, osteopontin, and c-fos expression were increased in the nodule forming period. Alkaline phosphatase and type I collagen expression were initially inhibited in proliferating cells, then increased after nodule formation to support further growth and mineralization of the nodule. Expression of osteocalcin was 1,000-fold elevated in glucocorticoid-differentiated cultures in relation to nodule formation. Collagenase gene expression was also greater than controls (fivefold) with the highest levels observed in mature cultures (day 35). At this time, a rise in collagen and TGF beta was also observed suggesting turnover of the matrix. Short term (48 h) effects of glucocorticoid on histone H4 (reflecting cell proliferation), alkaline phosphatase, osteopontin, and osteocalcin mRNA levels reveal both up or down regulation as a function of the developmental stage of the osteoblast phenotype. A comparison of transcriptional levels of these genes by nuclear run-on assays to mRNA levels indicates that glucocorticoids exert both transcriptional and post-transcriptional effects. Further, the presence of glucocorticoids enhances the

  12. Identification of differentially expressed proteins in the cervical mucosa of HIV-1-resistant sex workers.


    Burgener, Adam; Boutilier, Julie; Wachihi, Charles; Kimani, Joshua; Carpenter, Michael; Westmacott, Garrett; Cheng, Keding; Ball, Terry B; Plummer, Francis


    Novel tools are necessary to understand mechanisms of altered susceptibility to HIV-1 infection in women of the Pumwani Sex Worker cohort, Kenya. In this cohort, more than 140 of the 2000 participants have been characterized to be relatively resistant to HIV-1 infection. Given that sexual transmission of HIV-1 occurs through mucosal surfaces such as that in the cervicovaginal environment, our hypothesis is that innate immune factors in the genital tract may play a role in HIV-1 infection resistance. Understanding this mechanism may help develop microbicides and/or vaccines against HIV-1. A quantitative proteomics technique (2D-DIGE: two-dimensional difference in-gel electrophoresis) was used to examine cervical mucosa of HIV-1 resistant women ( n = 10) for biomarkers of HIV-1 resistance. Over 15 proteins were found to be differentially expressed between HIV-1-resistant women and control groups ( n = 29), some which show a greater than 8-fold change. HIV-1-resistant women overexpressed several antiproteases, including those from the serpin B family, and also cystatin A, a known anti-HIV-1 factor. Immunoblotting for a selection of the identified proteins confirmed the DIGE volume differences. Validation of these results on a larger sample of individuals will provide further evidence these biomarkers are associated with HIV-1 resistance and could help aid in the development of effective microbicides against HIV-1.

  13. Human mesenchymal stem cells express neuronal markers after osteogenic and adipogenic differentiation.


    Foudah, Dana; Redondo, Juliana; Caldara, Cristina; Carini, Fabrizio; Tredici, Giovanni; Miloso, Mariarosaria


    Mesenchymal stem cells (MSCs) are multipotent cells that are able to differentiate into mesodermal lineages (osteogenic, adipogenic, chondrogenic), but also towards non-mesodermal derivatives (e.g. neural cells). Recent in vitro studies revealed that, in the absence of any kind of differentiation stimuli, undifferentiated MSCs express neural differentiation markers, but the literature data do not all concur. Considering their promising therapeutic potential for neurodegenerative diseases, it is very important to expand our knowledge about this particular biological property of MSCs. In this study, we confirmed the spontaneous expression of neural markers (neuronal, glial and progenitor markers) by undifferentiated human MSCs (hMSCs) and in particular, we demonstrated that the neuronal markers βIII-tubulin and NeuN are expressed by a very high percentage of hMSCs, regardless of the number of culture passages and the culture conditions. Moreover, the neuronal markers βIII-tubulin and NeuN are still expressed by hMSCs after in vitro osteogenic and adipogenic differentiation. On the other hand, chondrogenically differentiated hMSCs are negative for these markers. Our findings suggest that the expression of neuronal markers could be common to a wide range of cellular types and not exclusive for neuronal lineages. Therefore, the expression of neuronal markers alone is not sufficient to demonstrate the differentiation of MSCs towards the neuronal phenotype. Functional properties analysis is also required.

  14. CG Methylation Covaries with Differential Gene Expression between Leaf and Floral Bud Tissues of Brachypodium distachyon.


    Roessler, Kyria; Takuno, Shohei; Gaut, Brandon S


    DNA methylation has the potential to influence plant growth and development through its influence on gene expression. To date, however, the evidence from plant systems is mixed as to whether patterns of DNA methylation vary significantly among tissues and, if so, whether these differences affect tissue-specific gene expression. To address these questions, we analyzed both bisulfite sequence (BSseq) and transcriptomic sequence data from three biological replicates of two tissues (leaf and floral bud) from the model grass species Brachypodium distachyon. Our first goal was to determine whether tissues were more differentiated in DNA methylation than explained by variation among biological replicates. Tissues were more differentiated than biological replicates, but the analysis of replicated data revealed high (>50%) false positive rates for the inference of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). Comparing methylation to gene expression, we found that differential CG methylation consistently covaried negatively with gene expression, regardless as to whether methylation was within genes, within their promoters or even within their closest transposable element. The relationship between gene expression and either CHG or CHH methylation was less consistent. In total, CG methylation in promoters explained 9% of the variation in tissue-specific expression across genes, suggesting that CG methylation is a minor but appreciable factor in tissue differentiation.

  15. CG Methylation Covaries with Differential Gene Expression between Leaf and Floral Bud Tissues of Brachypodium distachyon

    PubMed Central

    Roessler, Kyria; Takuno, Shohei; Gaut, Brandon S.


    DNA methylation has the potential to influence plant growth and development through its influence on gene expression. To date, however, the evidence from plant systems is mixed as to whether patterns of DNA methylation vary significantly among tissues and, if so, whether these differences affect tissue-specific gene expression. To address these questions, we analyzed both bisulfite sequence (BSseq) and transcriptomic sequence data from three biological replicates of two tissues (leaf and floral bud) from the model grass species Brachypodium distachyon. Our first goal was to determine whether tissues were more differentiated in DNA methylation than explained by variation among biological replicates. Tissues were more differentiated than biological replicates, but the analysis of replicated data revealed high (>50%) false positive rates for the inference of differentially methylated sites (DMSs) and differentially methylated regions (DMRs). Comparing methylation to gene expression, we found that differential CG methylation consistently covaried negatively with gene expression, regardless as to whether methylation was within genes, within their promoters or even within their closest transposable element. The relationship between gene expression and either CHG or CHH methylation was less consistent. In total, CG methylation in promoters explained 9% of the variation in tissue-specific expression across genes, suggesting that CG methylation is a minor but appreciable factor in tissue differentiation. PMID:26950546

  16. Cellular differentiation and I-FABP protein expression modulate fatty acid uptake and diffusion.


    Atshaves, B P; Foxworth, W B; Frolov, A; Roths, J B; Kier, A B; Oetama, B K; Piedrahita, J A; Schroeder, F


    The effect of cellular differentiation on fatty acid uptake and intracellular diffusion was examined in transfected pluripotent mouse embryonic stem (ES) cells stably expressing intestinal fatty acid binding protein (I-FABP). Control ES cells, whether differentiated or undifferentiated, did not express I-FABP. The initial rate and maximal uptake of the fluorescent fatty acid, 12-(N-methyl)-N-[(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-octadec anoic acid (NBD-stearic acid), was measured in single cells by kinetic digital fluorescence imaging. I-FABP expression in undifferentiated ES cells increased the initial rate and maximal uptake of NBD-stearic acid 1.7- and 1.6-fold, respectively, as well as increased its effective intracellular diffusion constant (Deff) 1.8-fold as measured by the fluorescence recovery after photobleaching technique. In contrast, ES cell differentiation decreased I-FABP expression up to 3-fold and decreased the NBD-stearic acid initial rate of uptake, maximal uptake, and Deff by 10-, 4.7-, and 2-fold, respectively. There were no significant differences in these parameters between the differentiated control and differentiated I-FABP-expressing ES cell lines. In summary, differentiation and expression of I-FABP oppositely modulated NBD-stearic acid uptake parameters and intracellular diffusion in ES cells.

  17. Quantitative phase-filtered wavelength-modulated differential photoacoustic radar tumor hypoxia imaging toward early cancer detection.


    Dovlo, Edem; Lashkari, Bahman; Soo Sean Choi, Sung; Mandelis, Andreas; Shi, Wei; Liu, Fei-Fei


    Overcoming the limitations of conventional linear spectroscopy used in multispectral photoacoustic imaging, wherein a linear relationship is assumed between the absorbed optical energy and the absorption spectra of the chromophore at a specific location, is crucial for obtaining accurate spatially-resolved quantitative functional information by exploiting known chromophore-specific spectral characteristics. This study introduces a non-invasive phase-filtered differential photoacoustic technique, wavelength-modulated differential photoacoustic radar (WM-DPAR) imaging that addresses this issue by eliminating the effect of the unknown wavelength-dependent fluence. It employs two laser wavelengths modulated out-of-phase to significantly suppress background absorption while amplifying the difference between the two photoacoustic signals. This facilitates pre-malignant tumor identification and hypoxia monitoring, as minute changes in total hemoglobin concentration and hemoglobin oxygenation are detectable. The system can be tuned for specific applications such as cancer screening and SO2 quantification by regulating the amplitude ratio and phase shift of the signal. The WM-DPAR imaging of a head and neck carcinoma tumor grown in the thigh of a nude rat demonstrates the functional PA imaging of small animals in vivo. The PA appearance of the tumor in relation to tumor vascularity is investigated by immunohistochemistry. Phase-filtered WM-DPAR imaging is also illustrated, maximizing quantitative SO2 imaging fidelity of tissues. Oxygenation levels within a tumor grown in the thigh of a nude rat using the two-wavelength phase-filtered differential PAR method.

  18. Robust stratification of breast cancer subtypes using differential patterns of transcript isoform expression.


    Stricker, Thomas P; Brown, Christopher D; Bandlamudi, Chaitanya; McNerney, Megan; Kittler, Ralf; Montoya, Vanessa; Peterson, April; Grossman, Robert; White, Kevin P


    Breast cancer, the second leading cause of cancer death of women worldwide, is a heterogenous disease with multiple different subtypes. These subtypes carry important implications for prognosis and therapy. Interestingly, it is known that these different subtypes not only have different biological behaviors, but also have distinct gene expression profiles. However, it has not been rigorously explored whether particular transcriptional isoforms are also differentially expressed among breast cancer subtypes, or whether transcript isoforms from the same sets of genes can be used to differentiate subtypes. To address these questions, we analyzed the patterns of transcript isoform expression using a small set of RNA-sequencing data for eleven Estrogen Receptor positive (ER+) subtype and fourteen triple negative (TN) subtype tumors. We identified specific sets of isoforms that distinguish these tumor subtypes with higher fidelity than standard mRNA expression profiles. We found that alternate promoter usage, alternative splicing, and alternate 3'UTR usage are differentially regulated in breast cancer subtypes. Profiling of isoform expression in a second, independent cohort of 68 tumors confirmed that expression of splice isoforms differentiates breast cancer subtypes. Furthermore, analysis of RNAseq data from 594 cases from the TCGA cohort confirmed the ability of isoform usage to distinguish breast cancer subtypes. Also using our expression data, we identified several RNA processing factors that were differentially expressed between tumor subtypes and/or regulated by estrogen receptor, including YBX1, YBX2, MAGOH, MAGOHB, and PCBP2. RNAi knock-down of these RNA processing factors in MCF7 cells altered isoform expression. These results indicate that global dysregulation of splicing in breast cancer occurs in a subtype-specific and reproducible manner and is driven by specific differentially expressed RNA processing factors.

  19. Robust stratification of breast cancer subtypes using differential patterns of transcript isoform expression

    PubMed Central

    Stricker, Thomas P.; Bandlamudi, Chaitanya; Kittler, Ralf; Montoya, Vanessa; Peterson, April; Grossman, Robert


    Breast cancer, the second leading cause of cancer death of women worldwide, is a heterogenous disease with multiple different subtypes. These subtypes carry important implications for prognosis and therapy. Interestingly, it is known that these different subtypes not only have different biological behaviors, but also have distinct gene expression profiles. However, it has not been rigorously explored whether particular transcriptional isoforms are also differentially expressed among breast cancer subtypes, or whether transcript isoforms from the same sets of genes can be used to differentiate subtypes. To address these questions, we analyzed the patterns of transcript isoform expression using a small set of RNA-sequencing data for eleven Estrogen Receptor positive (ER+) subtype and fourteen triple negative (TN) subtype tumors. We identified specific sets of isoforms that distinguish these tumor subtypes with higher fidelity than standard mRNA expression profiles. We found that alternate promoter usage, alternative splicing, and alternate 3’UTR usage are differentially regulated in breast cancer subtypes. Profiling of isoform expression in a second, independent cohort of 68 tumors confirmed that expression of splice isoforms differentiates breast cancer subtypes. Furthermore, analysis of RNAseq data from 594 cases from the TCGA cohort confirmed the ability of isoform usage to distinguish breast cancer subtypes. Also using our expression data, we identified several RNA processing factors that were differentially expressed between tumor subtypes and/or regulated by estrogen receptor, including YBX1, YBX2, MAGOH, MAGOHB, and PCBP2. RNAi knock-down of these RNA processing factors in MCF7 cells altered isoform expression. These results indicate that global dysregulation of splicing in breast cancer occurs in a subtype-specific and reproducible manner and is driven by specific differentially expressed RNA processing factors. PMID:28263985

  20. Neural stem cell sex dimorphism in aromatase (CYP19) expression: a basis for differential neural fate

    PubMed Central

    Waldron, Jay; McCourty, Althea; Lecanu, Laurent


    Purpose Neural stem cell (NSC) transplantation and pharmacologic activation of endogenous neurogenesis are two approaches that trigger a great deal of interest as brain repair strategies. However, the success rate of clinical attempts using stem cells to restore neurologic functions altered either after traumatic brain injury or as a consequence of neurodegenerative disease remains rather disappointing. This suggests that factors affecting the fate of grafted NSCs are largely understudied and remain to be characterized. We recently reported that aging differentially affects the neurogenic properties of male and female NSCs. Although the sex steroids androgens and estrogens participate in the regulation of neurogenesis, to our knowledge, research on how gender-based differences affect the capacity of NSCs to differentiate and condition their neural fate is lacking. In the present study, we explored further the role of cell sex as a determining factor of the neural fate followed by differentiating NSCs and its relationship with a potential differential expression of aromatase (CYP19), the testosterone-metabolizing enzyme. Results Using NSCs isolated from the subventricular zone of three-month-old male and female Long-Evans rats and maintained as neurospheres, we showed that differentiation triggered by retinoic acid resulted in a neural phenotype that depends on cell sex. Differentiated male NSCs mainly expressed markers of neuronal fate, including βIII-tubulin, microtubule associated protein 2, growth-associated protein 43, and doublecortin. In contrast, female NSCs essentially expressed the astrocyte marker glial fibrillary acidic protein. Quantification of the expression of aromatase showed a very low level of expression in undifferentiated female NSCs, whereas aromatase expression in male NSCs was 14-fold greater than the female level. Conclusion Our results confirm our previous data that the neural phenotype acquired by differentiating NSCs largely depends on

  1. 1,25-Dihydroxyvitamin D3 Does Not Affect MicroRNA Expression When Suppressing Human Th17 Differentiation

    PubMed Central

    Huang, Jian; Liang, Zibin; Kuang, Ying; Jia, Fujie; Yang, Yaqi; Kang, Miaomiao; Xie, Muke; Li, Feng


    Background Vitamin D is an import regulator of T helper 17 (Th17) differentiation, but our understanding of the underlying mechanisms remains limited. In the present study, we aimed to detect the expression levels of microRNAs (miRNAs) during human Th17 differentiation and evaluate the effects of 1,25-dihydroxyvitamin D3 (1,25(OH)2D3), the bioactive form of vitamin D, on Th17 differentiation and miRNA expression. Material/Methods We cultured human peripheral blood mononuclear cells (PBMC) in vitro and activated them with anti-CD3 and anti-CD28 antibodies in the presence of Th17-promoting cytokines interleukin (IL)-23, IL-1β, TGF-β1, and IL-6 for 72 hours. 1,25(OH)2D3 was added to the medium at a final concentration of 100 nM on day 0. The production of IL-17A in culture medium was detected by enzyme-linked immunosorbent assay (ELISA). The expression levels of miRNAs during Th17 differentiation were determined by quantitative polymerase chain reaction (qPCR). Results Six miRNAs were found to be dysregulated during human Th17 differentiation. Of these miRNAs, hsa-miR-155 was significantly up-regulated (median fold change: 3.61, P<0.05), whereas hsa-miR-20b, hsa-miR-21, hsa-miR-181a, hsa-miR-210, and hsa-miR-301a were significantly down-regulated (median fold change: 0.44, 0.37, 0.18, 0.15, and 0.26, respectively, P<0.05). 1,25(OH)2D3 treatment significantly decreased IL-17A production (median [interquartile range], 745.7 [473.5] pg/mL vs. 2535.4 [2153.3] pg/mL, P<0.05). However, expression of these miRNAs was not changed after 1,25(OH)2D3 treatment. Conclusions 1,25(OH)2D3 suppressed human Th17 differentiation without affecting miRNA expression. PMID:28133358

  2. Distributional fold change test – a statistical approach for detecting differential expression in microarray experiments

    PubMed Central


    Background Because of the large volume of data and the intrinsic variation of data intensity observed in microarray experiments, different statistical methods have been used to systematically extract biological information and to quantify the associated uncertainty. The simplest method to identify differentially expressed genes is to evaluate the ratio of average intensities in two different conditions and consider all genes that differ by more than an arbitrary cut-off value to be differentially expressed. This filtering approach is not a statistical test and there is no associated value that can indicate the level of confidence in the designation of genes as differentially expressed or not differentially expressed. At the same time the fold change by itself provide valuable information and it is important to find unambiguous ways of using this information in expression data treatment. Results A new method of finding differentially expressed genes, called distributional fold change (DFC) test is introduced. The method is based on an analysis of the intensity distribution of all microarray probe sets mapped to a three dimensional feature space composed of average expression level, average difference of gene expression and total variance. The proposed method allows one to rank each feature based on the signal-to-noise ratio and to ascertain for each feature the confidence level and power for being differentially expressed. The performance of the new method was evaluated using the total and partial area under receiver operating curves and tested on 11 data sets from Gene Omnibus Database with independently verified differentially expressed genes and compared with the t-test and shrinkage t-test. Overall the DFC test performed the best – on average it had higher sensitivity and partial AUC and its elevation was most prominent in the low range of differentially expressed features, typical for formalin-fixed paraffin-embedded sample sets. Conclusions The

  3. A high-throughput data mining of single nucleotide polymorphisms in Coffea species expressed sequence tags suggests differential homeologous gene expression in the allotetraploid Coffea arabica.


    Vidal, Ramon Oliveira; Mondego, Jorge Maurício Costa; Pot, David; Ambrósio, Alinne Batista; Andrade, Alan Carvalho; Pereira, Luiz Filipe Protasio; Colombo, Carlos Augusto; Vieira, Luiz Gonzaga Esteves; Carazzolle, Marcelo Falsarella; Pereira, Gonçalo Amarante Guimarães


    Polyploidization constitutes a common mode of evolution in flowering plants. This event provides the raw material for the divergence of function in homeologous genes, leading to phenotypic novelty that can contribute to the success of polyploids in nature or their selection for use in agriculture. Mounting evidence underlined the existence of homeologous expression biases in polyploid genomes; however, strategies to analyze such transcriptome regulation remained scarce. Important factors regarding homeologous expression biases remain to be explored, such as whether this phenomenon influences specific genes, how paralogs are affected by genome doubling, and what is the importance of the variability of homeologous expression bias to genotype differences. This study reports the expressed sequence tag assembly of the allopolyploid Coffea arabica and one of its direct ancestors, Coffea canephora. The assembly was used for the discovery of single nucleotide polymorphisms through the identification of high-quality discrepancies in overlapped expressed sequence tags and for gene expression information indirectly estimated by the transcript redundancy. Sequence diversity profiles were evaluated within C. arabica (Ca) and C. canephora (Cc) and used to deduce the transcript contribution of the Coffea eugenioides (Ce) ancestor. The assignment of the C. arabica haplotypes to the C. canephora (CaCc) or C. eugenioides (CaCe) ancestral genomes allowed us to analyze gene expression contributions of each subgenome in C. arabica. In silico data were validated by the quantitative polymerase chain reaction and allele-specific combination TaqMAMA-based method. The presence of differential expression of C. arabica homeologous genes and its implications in coffee gene expression, ontology, and physiology are discussed.

  4. Statistical Power of Expression Quantitative Trait Loci for Mapping of Complex Trait Loci in Natural Populations

    PubMed Central

    Schliekelman, Paul


    A number of recent genomewide surveys have found numerous QTL for gene expression, often with intermediate to high heritability values. As a result, there is currently a great deal of interest in genetical genomics—that is, the combination of genomewide expression data and molecular marker data to elucidate the genetics of complex traits. To date, most genetical genomics studies have focused on generating candidate genes for previously known trait loci or have otherwise leveraged existing knowledge about trait-related genes. The purpose of this study is to explore the potential for genetical genomics approaches in the context of genomewide scans for complex trait loci. I explore the expected strength of association between expression-level traits and a clinical trait, as a function of the underlying genetic model in natural populations. I give calculations of statistical power for detecting differential expression between affected and unaffected individuals. I model both reactive and causative expression-level traits with both additive and multiplicative multilocus models for the relationship between phenotype and genotype and explore a variety of assumptions about dominance, number of segregating loci, and other parameters. There are two key results. If a transcript is causative for the disease (in the sense that disease risk depends directly on transcript level), then the power to detect association between transcript and disease is quite good. Sample sizes on the order of 100 are sufficient for 80% power. On the other hand, if the transcript is reactive to a disease locus, then the correlation between expression-level traits and disease is low unless the expression-level trait shares several causative loci with the disease—that is, the expression-level trait itself is a complex trait. Thus, there is a trade-off between the power to show association between a reactive expression-level trait and the clinical trait of interest and the power to map expression

  5. Association of tissue lineage and gene expression: conservatively and differentially expressed genes define common and special functions of tissues

    PubMed Central


    Background Embryogenesis is the process by which the embryo is formed, develops, and establishes developmental hierarchies of tissues. The recent advance in microarray technology made it possible to investigate the tissue specific patterns of gene expression and their relationship with tissue lineages. This study is focused on how tissue specific functions, tissue lineage, and cell differentiation are correlated, which is essential to understand embryonic development and organism complexity. Results We performed individual gene and gene set based analysis on multiple tissue expression data, in association with the classic topology of mammalian fate maps of embryogenesis. For each sub-group of tissues on the fate map, conservatively, differentially and correlatively expressed genes or gene sets were identified. Tissue distance was found to correlate with gene expression divergence. Tissues of the ectoderm or mesoderm origins from the same segments on the fate map shared more similar expression pattern than those from different origins. Conservatively expressed genes or gene sets define common functions in a tissue group and are related to tissue specific diseases, which is supported by results from Gene Ontology and KEGG pathway analysis. Gene expression divergence is larger in certain human tissues than in the mouse homologous tissues. Conclusion The results from tissue lineage and gene expression analysis indicate that common function features of neighbor tissue groups were defined by the conservatively expressed genes and were related to tissue specific diseases, and differentially expressed genes contribute to the functional divergence of tissues. The difference of gene expression divergence in human and mouse homologous tissues reflected the organism complexity, i.e. distinct neural development levels and different body sizes. PMID:21172044

  6. Molecular characterization and differential expression of multiple goose dopamine D2 receptors.


    Wang, Cui; Liu, Yi; Wang, Huiying; Wu, Huali; Gong, Shaoming; Chen, Weihu; He, Daqian


    Dopamine D2 receptor (DRD2) gene, a member of the dopamine receptors gene family, has been studied as a candidate gene for broodiness due to its special effects on avian prolactin secretion. Here, the genomic DNA and cDNA sequences of goose (Anser cygnoides) DRD2 gene were cloned and characterized for the first time. The goose DRD2 cDNA is 1353bp in length and encodes a protein of 450 amino acids. The length of goose DRD2 genomic DNA is 8350bp, including seven exons and six introns. We identified four goose DRD2 variants, which were generated due to alternative splicing. Bioinformatics analysis indicates that all the deduced DRD2 amino acid sequences contain seven putative transmembrane domains and four potential N-glycosylation sites. A phylogenetic tree based on amino acid sequences displays that the goose DRD2 protein is closely related to those of avian species. Semi-quantitative RT-PCR analysis demonstrates that the DRD2-1, DRD2-2 and DRD2-4 transcripts are differentially expressed in the pituitary, ovary, hypothalamus, as well as in the kidney, whereas the DRD2-3 transcript is widely expressed in all the examined tissues at different levels. Meanwhile, 54 single nucleotide polymorphisms (SNPs) and 4 insert-deletion (indel) variations were identified in the coding region and partial intron region of the goose DRD2 gene. Those findings will help us gain insight into the functions of the DRD2 gene in geese.

  7. Expression Profiles of the Nuclear Receptors and Their Transcriptional Coregulators During Differentiation of Neural Stem Cells

    PubMed Central

    Androutsellis-Theotokis, A.; Chrousos, G. P.; McKay, R. D.; DeCherney, A. H.; Kino, T.


    Neural stem cells (NSCs) are pluripotent precursors with the ability to proliferate and differentiate into 3 neural cell lineages, neurons, astrocytes and oligodendrocytes. Elucidation of the mechanisms underlying these biologic processes is essential for understanding both physiologic and pathologic neural development and regeneration after injury. Nuclear hormone receptors (NRs) and their transcriptional coregulators also play crucial roles in neural development, functions and fate. To identify key NRs and their transcriptional regulators in NSC differentiation, we examined mRNA expression of 49 NRs and many of their coregulators during differentiation (0–5 days) of mouse embryonic NSCs induced by withdrawal of fibroblast growth factor-2 (FGF2). 37 out of 49 NRs were expressed in NSCs before induction of differentiation, while receptors known to play major roles in neural development, such as THRα, RXRs, RORs, TRs, and COUPTFs, were highly expressed. CAR, which plays important roles in xenobiotic metabolism, was also highly expressed. FGF2 withdrawal induced mRNA expression of RORγ, RXRγ, and MR by over 20-fold. Most of the transcriptional coregulators examined were expressed basally and throughout differentiation without major changes, while FGF2 withdrawal strongly induced mRNA expression of several histone deacetylases (HDACs), including HDAC11. Dexamethasone and aldosterone, respectively a synthetic glucocorticoid and natural mineralocorticoid, increased NSC numbers and induced differentiation into neurons and astrocytes. These results indicate that the NRs and their coregulators are present and/or change their expression during NSC differentiation, suggesting that they may influence development of the central nervous system in the absence or presence of their ligands. PMID:22990992

  8. Enhanced expression of hydroxylated ceramide in well-differentiated endometrial adenocarcinoma

    PubMed Central

    Tajima, Toshiki; Miyazawa, Masaki; Hayashi, Masaru; Asai, Satoshi; Ikeda, Masae; Shida, Masako; Hirasawa, Takeshi; Iwamori, Masao; Mikami, Mikio


    Based on our previous analysis of neutral glycolipids in the human endometrium, the present authors already reported that the concentrations of glucosylceramide, lactosylceramide and globotriaosylceramide (Gb3Cer), in which both fatty acids and sphingosines in the ceramides are hydroxylated, exhibit a marked increase during the luteal phase of the menstrual cycle. It is also well known that poorly differentiated endometrial adenocarcinoma exhibits a more rapid progression and a worse response to therapy than well-differentiated endometrial adenocarcinoma. To examine the molecular background of well-differentiated and poorly differentiated cancers, the levels of neutral glycolipids in tumor tissues from endometrial carcinoma displaying different degrees of differentiation were measured. The composition of neutral glycolipids in tumor tissues was determined, and ceramide structures that were specifically expressed in well-differentiated endometrial carcinomas were investigated using biochemical analytical methods, including lipid extraction, enzyme digestion, thin-layer chromatography (TLC), gas-liquid chromatography and mass spectrometry. Well-differentiated adenocarcinoma contained numerous structurally unknown glycolipids that exhibited slower migration than globotetraosylceramide (Gb4Cer). In the case of Gb3Cer, three bands appeared on TLC in well-differentiated cancer, but only two bands appeared in the poorly-differentiated cancer. This difference was associated with the fatty acid composition of ceramide, since non-hydroxy fatty acids with ≥20 carbon atoms were increased in well-differentiated cancer, while α-hydroxy fatty acids were increased in poorly differentiated cancer. Similarly, there were two bands on TLC of Gb4Cer from well-differentiated cancer, but only one band in poorly differentiated cancer, and the long-chain base of ceramide was observed to contain phytosphingosine in well-differentiated cancer. It was demonstrated in endometrial cancer

  9. Myostatin inhibits myoblast differentiation by down-regulating MyoD expression.


    Langley, Brett; Thomas, Mark; Bishop, Amy; Sharma, Mridula; Gilmour, Stewart; Kambadur, Ravi


    Myostatin, a negative regulator of myogenesis, is shown to function by controlling the proliferation of myoblasts. In this study we show that myostatin is an inhibitor of myoblast differentiation and that this inhibition is mediated through Smad 3. In vitro, increasing concentrations of recombinant mature myostatin reversibly blocked the myogenic differentiation of myoblasts, cultured in low serum media. Western and Northern blot analysis indicated that addition of myostatin to the low serum culture media repressed the levels of MyoD, Myf5, myogenin, and p21 leading to the inhibition of myogenic differentiation. The transient transfection of C(2)C(12) myoblasts with MyoD expressing constructs did not rescue myostatin-inhibited myogenic differentiation. Myostatin signaling specifically induced Smad 3 phosphorylation and increased Smad 3.MyoD association, suggesting that Smad 3 may mediate the myostatin signal by interfering with MyoD activity and expression. Consistent with this, the expression of dominant-negative Smad3 rescued the activity of a MyoD promoter-reporter in C(2)C(12) myoblasts treated with myostatin. Taken together, these results suggest that myostatin inhibits MyoD activity and expression via Smad 3 resulting in the failure of the myoblasts to differentiate into myotubes. Thus we propose that myostatin plays a critical role in myogenic differentiation and that the muscular hyperplasia and hypertrophy seen in animals that lack functional myostatin is because of deregulated proliferation and differentiation of myoblasts.

  10. Differential expression of murine adult hemoglobins in early ontogeny

    SciTech Connect

    Wawrzyniak, C.J.; Lewis, S.E.; Popp, R.A.


    A hemoglobin mutation is described that permits study of the expression of the two adult ..beta..-globin genes throughout fetal and postnatal development. Mice with a mutation at the Hbb/sup s/, ..beta..-globin locus, were used to study the relative levels of ..beta..-s2major and ..beta..-sminor globins specified by the mutant Hbb/sup s2/ haplotype during development. At 11.5 days of gestation ..beta..-sminor comprised over 80% and ..beta..-s2major under 20% of the adult beta-globin. The relative level of ..beta..-sminor decreased through fetal development; at birth ..beta..-sminor represented 33.7% of the ..beta..-globin. The adult values of 71.0% ..beta..-s2major and 29.0% ..beta..-sminor globin are expressed in mice six days after birth. Because the two ..beta..-globin genes are expressed in mice of the Hbb/sup 2s/ haplotype, both the ..beta..-smajor and ..beta..-sminor genes must be expressed in mice of the Hbb/sup s/ haplotype. Expression of the ..beta..-sminor gene is elevated to 35.6% in Hbb/sup s2/ mice that have been bled repeatedly. Thus, the 5' ..beta..-s2major and 3' ..beta..-sminor genes of the Hbb/sup s2/ haplotype and, presumably the 5' ..beta..-smajor and 3' ..beta..-sminor genes of the Hbb/sup s/ haplotype, are regulated independently and are homologous to the 5' ..beta..-dmajor and 3' ..beta..-dminor genes of the Hbb/sup d/ haplotype. Mice of the Hbb/sup s2/ haplotype are better than mice of the Hbb/sup d/ haplotytpe for studying the mechanisms of hemoglobin switching because the Hbb/sup s2/ each of the three embryonic and two adult hemoglobins can be separated by electrophoresis. 17 refs., 3 figs.

  11. The workflow for quantitative proteome analysis of chloroplast development and differentiation, chloroplast mutants, and protein interactions by spectral counting.


    Friso, Giulia; Olinares, Paul Dominic B; van Wijk, Klaas J


    This chapter outlines a quantitative proteomics workflow using a label-free spectral counting technique. The workflow has been tested on different aspects of chloroplast biology in maize and Arabidopsis, including chloroplast mutant analysis, cell-type specific chloroplast differentiation, and the proplastid-to-chloroplast transition. The workflow involves one-dimensional SDS-PAGE of the proteomes of leaves or chloroplast subfractions, tryptic digestions, online LC-MS/MS using a mass spectrometer with high mass accuracy and duty cycle, followed by semiautomatic data processing. The bioinformatics analysis can effectively select best gene models and deals with quantification of closely related proteins; the workflow avoids overidentification of proteins and results in more accurate protein quantification. The final output includes pairwise comparative quantitative analysis, as well as hierarchical clustering for discovery of temporal and spatial patterns of protein accumulation. A brief discussion about potential pitfalls, as well as the advantages and disadvantages of spectral counting, is provided.

  12. A Genome-Wide Screen Indicates Correlation between Differentiation and Expression of Metabolism Related Genes

    PubMed Central

    Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha


    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation. PMID:23717462

  13. A genome-wide screen indicates correlation between differentiation and expression of metabolism related genes.


    Roy, Priti; Kumar, Brijesh; Shende, Akhilesh; Singh, Anupama; Meena, Anil; Ghosal, Ritika; Ranganathan, Madhav; Bandyopadhyay, Amitabha


    Differentiated tissues may be considered as materials with distinct properties. The differentiation program of a given tissue ensures that it acquires material properties commensurate with its function. It may be hypothesized that some of these properties are acquired through production of tissue-specific metabolites synthesized by metabolic enzymes. To establish correlation between metabolism and organogenesis we have carried out a genome-wide expression study of metabolism related genes by RNA in-situ hybridization. 23% of the metabolism related genes studied are expressed in a tissue-restricted but not tissue-exclusive manner. We have conducted the screen on whole mount chicken (Gallus gallus) embryos from four distinct developmental stages to correlate dynamic changes in expression patterns of metabolic enzymes with spatio-temporally unique developmental events. Our data strongly suggests that unique combinations of metabolism related genes, and not specific metabolic pathways, are upregulated during differentiation. Further, expression of metabolism related genes in well established signaling centers that regulate different aspects of morphogenesis indicates developmental roles of some of the metabolism related genes. The database of tissue-restricted expression patterns of metabolism related genes, generated in this study, should serve as a resource for systematic identification of these genes with tissue-specific functions during development. Finally, comprehensive understanding of differentiation is not possible unless the downstream genes of a differentiation cascade are identified. We propose, metabolic enzymes constitute a significant portion of these downstream target genes. Thus our study should help elucidate different aspects of tissue differentiation.

  14. Identification of an IL-4-Inducible Gene Expressed in Differentiating Lymphocytes and Male Germ Cells

    PubMed Central

    Nabavi, Nasrin; Grusby, Michael J.; Finn, Patricia W.; Wolgemuth, Debra J.; Glimcher, Laurie H.


    Interleukin 4 (IL-4) is a cytokine that is involved in the differentiation of B and T lymphocytes. In this report, we describe the identification of a novel gene, N.52, which was cloned from the murine pre-B cell line R8205 grown in the presence of IL-4 for 48 hr. Although N.52 expression is detectable at low levels in unstimulated R8205 cells, the level of N.52 dramatically increases after only .4 hr exposure to IL-4 and remains at a high .level up to 48 hr. Although N.52 expression is low or absent in normal spleen B and T cells, its expression can be induced by the differentiation signals delivered by LPS in B cells and by Con A in T-cell hybrids. While N.52 mRNA is absent in all highly differentiated organs, it is detectable in stem cell harboring lymphoid tissues such as bone marrow, fetal liver, and thymus. Furthermore, N.52 mRNA is expressed at strikingly high levels in the testis, specifically in differentiating male germ cells. It is induced by differentiation signals triggered by the combination of cyclic AMP and retinoic acid in teratocarcinoma F9 cells. Taken together, these data suggest that N.52 is a developmentally regulated gene whose expression in cells of the immune and reproductive systems may be controlled by stimuli that induce differentiation. PMID:2136202

  15. Expression Quantitative Trait loci (QTL) in tumor adjacent normal breast tissue and breast tumor tissue.


    Quiroz-Zárate, Alejandro; Harshfield, Benjamin J; Hu, Rong; Knoblauch, Nick; Beck, Andrew H; Hankinson, Susan E; Carey, Vincent; Tamimi, Rulla M; Hunter, David J; Quackenbush, John; Hazra, Aditi


    We investigate 71 single nucleotide polymorphisms (SNPs) identified in meta-analytic studies of genome-wide association studies (GWAS) of breast cancer, the majority of which are located in intergenic or intronic regions. To explore regulatory impacts of these variants we conducted expression quantitative loci (eQTL) analyses on tissue samples from 376 invasive postmenopausal breast cancer cases in the Nurses' Health Study (NHS) diagnosed from 1990-2004. Expression analysis was conducted on all formalin-fixed paraffin-embedded (FFPE) tissue samples (and on 264 adjacent normal samples) using the Affymetrix Human Transcriptome Array. Significance and ranking of associations between tumor receptor status and expression variation was preserved between NHS FFPE and TCGA fresh-frozen sample sets (Spearman r = 0.85, p<10^-10 for 17 of the 21 Oncotype DX recurrence signature genes). At an FDR threshold of 10%, we identified 27 trans-eQTLs associated with expression variation in 217 distinct genes. SNP-gene associations can be explored using an open-source interactive browser distributed in a Bioconductor package. Using a new a procedure for testing hypotheses relating SNP content to expression patterns in gene sets, defined as molecular function pathways, we find that loci on 6q14 and 6q25 affect various gene sets and molecular pathways (FDR < 10%). Although the ultimate biological interpretation of the GWAS-identified variants remains to be uncovered, this study validates the utility of expression analysis of this FFPE expression set for more detailed integrative analyses.

  16. Relative neurotoxin gene expression in clostridium botulinum type B, determined using quantitative reverse transcription-PCR.


    Lövenklev, Maria; Holst, Elisabet; Borch, Elisabeth; Rådström, Peter


    A quantitative reverse transcription-PCR (qRT-PCR) method was developed to monitor the relative expression of the type B botulinum neurotoxin (BoNT/B) gene (cntB) in Clostridium botulinum. The levels of cntB mRNA in five type B strains were accurately monitored by using primers specific for cntB and for the reference gene encoding the 16S rRNA. The patterns and relative expression of cntB were different in the different strains. Except for one of the strains investigated, an increase in cntB expression was observed when the bacteria entered the early stationary growth phase. In the proteolytic strain C. botulinum ATCC 7949, the level of cntB mRNA was four- to fivefold higher than the corresponding levels in the other strains. This was confirmed when we quantified the production of extracellular BoNT/B by an enzyme-linked immunosorbent assay and measured the toxicity of BoNT/B by a mouse bioassay. When the effect of exposure to air on cntB expression was investigated, no decline in the relative expression was observed in spite of an 83% reduction in the viable count based on the initial cell number. Instead, the level of cntB mRNA remained the same. When there was an increase in the sodium nitrite concentration, the bacteria needed a longer adjustment time in the medium before exponential growth occurred. In addition, there was a reduction in the expression of cntB compared to the expression of the 16S rRNA gene at higher sodium nitrite concentrations. This was most obvious in the late exponential growth phase, but at the highest sodium nitrite concentration investigated, 45 ppm, a one- to threefold decline in the cntB mRNA level was observed in all growth phases.

  17. Housekeeping genes for quantitative expression studies in the three-spined stickleback Gasterosteus aculeatus

    PubMed Central

    Hibbeler, Sascha; Scharsack, Joern P; Becker, Sven


    Background During the last years the quantification of immune response under immunological challenges, e.g. parasitation, has been a major focus of research. In this context, the expression of immune response genes in teleost fish has been surveyed for scientific and commercial purposes. Despite the fact that it was shown in teleostei and other taxa that the gene for beta-actin is not the most stably expressed housekeeping gene (HKG), depending on the tissue and experimental treatment, the gene has been used as a reference gene in such studies. In the three-spined stickleback, Gasterosteus aculeatus, other HKG than the one for beta-actin have not been established so far. Results To establish a reliable method for the measurement of immune gene expression in Gasterosteus aculeatus, sequences from the now available genome database and an EST library of the same species were used to select oligonucleotide primers for HKG, in order to perform quantitative reverse-transcription (RT) PCR. The expression stability of ten candidate reference genes was evaluated in three different tissues, and in five parasite treatment groups, using the three algorithms BestKeeper, geNorm and NormFinder. Our results showed that in most of the tissues and treatments HKG that could not be used so far due to unknown sequences, proved to be more stably expressed than the one for beta-actin. Conclusion As they were the most stably expressed genes in all tissues examined, we suggest using the genes for the L13a ribosomal binding protein and ubiquitin as alternative or additional reference genes in expression analysis in Gasterosteus aculeatus. PMID:18230138

  18. Expression Quantitative Trait loci (QTL) in tumor adjacent normal breast tissue and breast tumor tissue

    PubMed Central

    Quiroz-Zárate, Alejandro; Harshfield, Benjamin J.; Hu, Rong; Knoblauch, Nick; Beck, Andrew H.; Hankinson, Susan E.; Carey, Vincent; Tamimi, Rulla M.; Hunter, David J.; Quackenbush, John; Hazra, Aditi


    We investigate 71 single nucleotide polymorphisms (SNPs) identified in meta-analytic studies of genome-wide association studies (GWAS) of breast cancer, the majority of which are located in intergenic or intronic regions. To explore regulatory impacts of these variants we conducted expression quantitative loci (eQTL) analyses on tissue samples from 376 invasive postmenopausal breast cancer cases in the Nurses’ Health Study (NHS) diagnosed from 1990–2004. Expression analysis was conducted on all formalin-fixed paraffin-embedded (FFPE) tissue samples (and on 264 adjacent normal samples) using the Affymetrix Human Transcriptome Array. Significance and ranking of associations between tumor receptor status and expression variation was preserved between NHS FFPE and TCGA fresh-frozen sample sets (Spearman r = 0.85, p<10^-10 for 17 of the 21 Oncotype DX recurrence signature genes). At an FDR threshold of 10%, we identified 27 trans-eQTLs associated with expression variation in 217 distinct genes. SNP-gene associations can be explored using an open-source interactive browser distributed in a Bioconductor package. Using a new a procedure for testing hypotheses relating SNP content to expression patterns in gene sets, defined as molecular function pathways, we find that loci on 6q14 and 6q25 affect various gene sets and molecular pathways (FDR < 10%). Although the ultimate biological interpretation of the GWAS-identified variants remains to be uncovered, this study validates the utility of expression analysis of this FFPE expression set for more detailed integrative analyses. PMID:28152060

  19. Neuropilin 1 expression correlates with differentiation status of epidermal cells and cutaneous squamous cell carcinomas.


    Shahrabi-Farahani, Shokoufeh; Wang, Lili; Zwaans, Bernadette M M; Santana, Jeans M; Shimizu, Akio; Takashima, Seiji; Kreuter, Michael; Coultas, Leigh; D'Amore, Patricia A; Arbeit, Jeffrey M; Akslen, Lars A; Bielenberg, Diane R


    Neuropilins (NRPs) are cell surface receptors for vascular endothelial growth factor (VEGF) and SEMA3 (class 3 semaphorin) family members. The role of NRPs in neurons and endothelial cells has been investigated, but the expression and role of NRPs in epithelial cells is much less clear. Herein, the expression and localization of NRP1 was investigated in human and mouse skin and squamous cell carcinomas (SCCs). Results indicated that NRP1 mRNA and protein was expressed in the suprabasal epithelial layers of the skin sections. NRP1 staining did not overlap with that of keratin 14 (K14) or proliferating cell nuclear antigen, but did co-localize with staining for keratin 1, indicating that differentiated keratinocytes express NRP1. Similar to the expression of NRP1, VEGF-A was expressed in suprabasal epithelial cells, whereas Nrp2 and VEGFR2 were not detectable in the epidermis. The expression of NRP1 correlated with a high degree of differentiation in human SCC specimens, human SCC xenografts, and mouse K14-HPV16 transgenic SCC. UVB irradiation of mouse skin induced Nrp1 upregulation. In vitro, Nrp1 was upregulated in primary keratinocytes in response to differentiating media or epidermal growth factor-family growth factors. In conclusion, the expression of NRP1 is regulated in the skin and is selectively produced in differentiated epithelial cells. NRP1 may function as a reservoir to sequester VEGF ligand within the epithelial compartment, thereby modulating its bioactivity.

  20. Neuropilin 1 expression correlates with differentiation status of epidermal cells and cutaneous squamous cell carcinomas

    PubMed Central

    Shahrabi-Farahani, Shokoufeh; Wang, Lili; Zwaans, Bernadette M. M.; Santana, Jeans M.; Shimizu, Akio; Takashima, Seiji; Kreuter, Michael; Coultas, Leigh; D'Amore, Patricia A.; Arbeit, Jeffrey M.; Akslen, Lars A.; Bielenberg, Diane R.


    Neuropilins (NRP) are cell surface receptors for VEGF and SEMA3 family members. The role of NRP in neurons and endothelial cells has been investigated, but the expression and role of NRP in epithelial cells is much less clear. Herein, the expression and localization of neuropilin 1 (NRP1) was investigated in human and mouse skin and squamous cell carcinomas (SCC). Results indicated that NRP1 mRNA and protein was expressed in the suprabasal epithelial layers of skin sections. NRP1 staining did not overlap with that of keratin 14 (K14) or proliferating cell nuclear antigen, but did colocalize with staining for keratin 1, indicating that differentiated keratinocytes express NRP1. Similar to the expression of NRP1, VEGF-A was expressed in suprabasal epithelial cells, whereas Nrp2 and VEGFR2 were not detectable in the epidermis. The expression of NRP1 correlated with a high degree of differentiation in human SCC specimens, human SCC xenografts, and mouse K14-HPV16 transgenic SCC. UVB irradiation of mouse skin induced Nrp1 upregulation. In vitro, Nrp1 was upregulated in primary keratinocytes in response to differentiating media or EGF-family growth factors. In conclusion, the expression of NRP1 is regulated in the skin and is selectively produced in differentiated epithelial cells. NRP1 may function as a reservoir to sequester VEGF ligand within the epithelial compartment, thereby modulating its bioactivity. PMID:24791743

  1. Differential Effects of Language Attrition in the Domains of Verb Placement and Object Expression

    ERIC Educational Resources Information Center

    Flores, Cristina


    This study investigates the differential effects of language attrition in two diverse linguistic domains: verb placement and object expression. Linguistic phenomena at the syntax--discourse interface, such as object expression, have been shown to be more vulnerable to attrition than narrow syntax properties, such as verb placement. This study aims…

  2. Differential Language Functioning of Monolinguals and Bilinguals on Positive-Negative Emotional Expression

    ERIC Educational Resources Information Center

    Kheirzadeh, Shiela; Hajiabed, Mohammadreza


    The present interdisciplinary research investigates the differential emotional expression between Persian monolinguals and Persian-English bilinguals. In other words, the article was an attempt to answer the questions whether bilinguals and monolinguals differ in the expression of positive and negative emotions elicited through sad and happy…

  3. Role Differentiation in Groups: The Relationship Between Instrumental and Expressive Leadership.

    ERIC Educational Resources Information Center

    Rees, C. Roger; Segal, Mady Wechsler


    Examined the degree of differentiation between instrumental and expressive leadership roles in two natural groups (N=101). Results showed a relatively high degree of leadership role integration with several members of each group fulfilling both instrumental and expressive leadership roles. (LLL)

  4. Expression quantitative trait loci: replication, tissue- and sex-specificity in mice.


    van Nas, Atila; Ingram-Drake, Leslie; Sinsheimer, Janet S; Wang, Susanna S; Schadt, Eric E; Drake, Thomas; Lusis, Aldons J


    By treating the transcript abundance as a quantitative trait, gene expression can be mapped to local or distant genomic regions relative to the gene encoding the transcript. Local expression quantitative trait loci (eQTL) generally act in cis (that is, control the expression of only the contiguous structural gene), whereas distal eQTL act in trans. Distal eQTL are more difficult to identify with certainty due to the fact that significant thresholds are very high since all regions of the genome must be tested, and confounding factors such as batch effects can produce false positives. Here, we compare findings from two large genetic crosses between mouse strains C3H/HeJ and C57BL/6J to evaluate the reliability of distal eQTL detection, including "hotspots" influencing the expression of multiple genes in trans. We found that >63% of local eQTL and >18% of distal eQTL were replicable at a threshold of LOD > 4.3 between crosses and 76% of local and >24% of distal eQTL at a threshold of LOD > 6. Additionally, at LOD > 4.3 four tissues studied (adipose, brain, liver, and muscle) exhibited >50% preservation of local eQTL and >17% preservation of distal eQTL. We observed replicated distal eQTL hotspots between the crosses on chromosomes 9 and 17. Finally, >69% of local eQTL and >10% of distal eQTL were preserved in most tissues between sexes. We conclude that most local eQTL are highly replicable between mouse crosses, tissues, and sex as compared to distal eQTL, which exhibited modest replicability.

  5. Pilot study on molecular quantitation and sequencing of endometrial cytokines gene expression and their effect on the outcome of in vitro fertilization (IVF) cycle.


    Sabry, D; Nouh, O; Marzouk, S; Hassouna, A


    Human trophoblast invasion and differentiation are essential for successful pregnancy outcome. The molecular mechanisms, however, are poorly understood. Interleukin (IL)-11, a cytokine, regulates endometrial epithelial cell adhesion. Leukemia inhibitory factor (LIF) is one of the key cytokines in the embryo implantation regulation. The present study aimed to assess the levels of LIF, IL-11, and IL-11 α receptor gene expression in the endometrium of women undergoing IVF and correlate their levels with the IVF pregnancy outcome. Also, the study aimed to detect any mutation in these three genes among IVF pregnant and non-pregnant women versus control menstrual blood of fertile women. Endometrial tissue biopsies were taken from 15 women undergoing IVF on the day of oocyte retrieval. The quantitative expression of IL-11, IL-11Rα, and LIF genes was assessed by real-time PCR and PCR products were sequenced. Menstrual blood from 10 fertile women was used as control to compare the DNA sequence versus DNA sequence of the studied genes in endometrial biopsies. LH, FSH, and E2 were assessed for enrolled patients by ELISA. Endometrial thickness was also assessed by pelvic ultrasonography. No significant difference was detected between quantitative expression of the three studied genes and pregnancy IVF outcome. Although DNA sequence changes were found in IL-11 and LIF genes of women with negative pregnancy IVF outcome compared to women with positive pregnancy IVF outcome, no DNA sequence changes were detected for IL-11Rα. Other studied parameters (e.g., age, LH, FSH, E2, and endometrial thickness) showed no significant differences or correlation of quantitative expression of the three studied involved genes. Data suggested that there were no significant differences between quantitative expression of IL-11, IL-11Rα, and LIF genes and the IVF pregnancy outcome. The present study may reveal that changes in IL-11 and LIF genes sequence may contribute in pregnancy IVF outcome.

  6. Differentiation between Glioblastoma Multiforme and Primary Cerebral Lymphoma: Additional Benefits of Quantitative Diffusion-Weighted MR Imaging

    PubMed Central

    Li, Chien Feng; Chen, Tai Yuan; Shu, Ginger; Kuo, Yu Ting; Lee, Yu Chang


    The differentiation between glioblastoma multiforme (GBM) and primary cerebral lymphoma (PCL) is important because the treatments are substantially different. The purpose of this article is to describe the MR imaging characteristics of GBM and PCL with emphasis on the quantitative ADC analysis in the tumor necrosis, the most strongly-enhanced tumor area, and the peritumoral edema. This retrospective cohort study collected 104 GBM (WHO grade IV) patients and 22 immune-competent PCL (diffuse large B cell lymphoma) patients. All these patients had pretreatment brain MR DWI and ADC imaging. Analysis of conventional MR imaging and quantitative ADC measurement including the tumor necrosis (ADCn), the most strongly-enhanced tumor area (ADCt), and the peritumoral edema (ADCe) were done. ROC analysis with optimal cut-off values and area-under-the ROC curve (AUC) was performed. For conventional MR imaging, there are statistical differences in tumor size, tumor location, tumor margin, and the presence of tumor necrosis between GBM and PCL. Quantitative ADC analysis shows that GBM tended to have significantly (P<0.05) higher ADC in the most strongly-enhanced area (ADCt) and lower ADC in the peritumoral edema (ADCe) as compared with PCL. Excellent AUC (0.94) with optimal sensitivity of 90% and specificity of 86% for differentiating between GBM and PCL was obtained by combination of ADC in the tumor necrosis (ADCn), the most strongly-enhanced tumor area (ADCt), and the peritumoral edema (ADCe). Besides, there are positive ADC gradients in the peritumoral edema in a subset of GBMs but not in the PCLs. Quantitative ADC analysis in these three areas can thus be implemented to improve diagnostic accuracy for these two brain tumor types. The histological correlation of the ADC difference deserves further investigation. PMID:27631626

  7. A distinct de novo expression of Nav1.5 sodium channels in human atrial fibroblasts differentiated into myofibroblasts.


    Chatelier, Aurélien; Mercier, Aurélie; Tremblier, Boris; Thériault, Olivier; Moubarak, Majed; Benamer, Najate; Corbi, Pierre; Bois, Patrick; Chahine, Mohamed; Faivre, Jean François


    Fibroblasts play a major role in heart physiology. They are at the origin of the extracellular matrix renewal and production of various paracrine and autocrine factors. In pathological conditions, fibroblasts proliferate, migrate and differentiate into myofibroblasts leading to cardiac fibrosis. This differentiated status is associated with changes in expression profile leading to neo-expression of proteins such as ionic channels. The present study investigates further electrophysiological changes associated with fibroblast differentiation focusing on the activity of voltage-gated sodium channels in human atrial fibroblasts and myofibroblasts. Using the patch clamp technique we show that human atrial myofibroblasts display a fast inward voltage gated sodium current with a density of 13.28 ± 2.88 pA pF(-1) whereas no current was detectable in non-differentiated fibroblasts. Quantitative RT-PCR reveals a large amount of transcripts encoding the Na(v)1.5 α-subunit with a fourfold increased expression level in myofibroblasts when compared to fibroblasts. Accordingly, half of the current was blocked by 1 μm of tetrodotoxin and immunocytochemistry experiments reveal the presence of Na(v)1.5 proteins. Overall, this current exhibits similar biophysical characteristics to sodium currents found in cardiac myocytes except for the window current that is enlarged for potentials between -100 and -20 mV. Since fibrosis is one of the fundamental mechanisms implicated in atrial fibrillation, it is of great interest to investigate how this current could influence myofibroblast properties. Moreover, since several Na(v)1.5 mutations are related to cardiac pathologies, this study offers a new avenue on the fibroblasts involvement of these mutations.

  8. Expression of osterix inhibits bone morphogenetic protein-induced chondrogenic differentiation of mesenchymal progenitor cells.


    Tominaga, Hiroyuki; Maeda, Shingo; Miyoshi, Hiroyuki; Miyazono, Kohei; Komiya, Setsuro; Imamura, Takeshi


    Osteoblasts and chondrocytes arise from common bipotential mesenchymal progenitor cells. Although the differentiation of these two cell lineages can be induced by treatment with bone morphogenetic proteins (BMPs), the responses of mesenchymal progenitors to BMP differ from cell line to cell line. Here we demonstrate that C3H/10T1/2 cells preferred chondrogenic differentiation, primary bone marrow stroma cells (MSCs) tended to convert to osteoblasts, and ST-2 cells differentiated into both the osteoblastic and chondrocytic lineages simultaneously, suggesting that a molecular switch functions to select cell fate. Osterix, the secondary master regulator of osteoblastogenesis, was induced by BMP at high and low levels in MSCs and ST-2 cells, respectively; in contrast, C3H/10T1/2 cells demonstrated only faint expression. As osterix has been suggested as a negative regulator of chondrogenesis, we hypothesized that the intense chondrocyte differentiation of C3H/10T1/2 cells may have resulted from an absence of osterix. We therefore restored osterix gene expression in C3H/10T1/2 cells using an adenovirus vector. Following BMP treatment, infection with an osterix-encoding virus dramatically inhibited the chondrocytic differentiation of C3H/10T1/2 cells, resulting instead in prominent osteoblast differentiation. These results indicate the chondrogenic potential of C3H/10T1/2 cells was abrogated by osterix expression. Chondrocyte differentiation of MSCs, however, was not enhanced by silencing the osterix gene using lentivirus-mediated shRNA, despite successful suppression of osteoblast differentiation. These results suggest that the low levels of osterix expression remaining after knockdown are sufficient to block chondrogenesis, whereas higher expression may be required to promote osteoblastic differentiation.

  9. Berberine increases expression of GATA-2 and GATA-3 during inhibition of adipocyte differentiation.


    Hu, Y; Davies, G E


    It is known that a number of transcription factors are key regulators in the complex process of adipocyte differentiation including peroxisome proliferator activated receptor gamma (PPARgamma) and the CCAAT enhancer binding protein alpha (C/EBPalpha). Studies have demonstrated that in pre-adipocyte 3T3-L1 cells constitutive expression of the DNA binding proteins GATA-2 and GATA-3 results in protein/protein interactions with C/EBPalpha resulting in down regulation of PPARgamma and subsequent suppressed adipocyte differentiation with cells trapped at the pre-adipocyte stage. Thus it appears that GATA-2 and GATA-3 are of critical importance in regulating adipocyte differentiation through molecular interactions with PPARgamma and C/EBPalpha. Recent reports suggest that berberine, an isoquinoline derivative alkaloid isolated from many medicinal herbs prevents differentiation of 3T3-L1 cells via a down regulation of PPARgamma and C/EBPalpha expression. The aim of this study was to determine the effect of berberine on GATA-2 and 3 gene and protein expression levels during differentiation of 3T3-L1 cells. MTT (Methylthiazolyldiphenyl-tetrazolium bromide) was used to detect the cytotoxic effects of berberine on the viability of 3T3-L1 cells during proliferation and differentiation. Differentiation of 3T3-L1 cells was monitored by Oil Red O staining and RT-PCR of PPARgamma and C/EBPalpha and the expression of GATA-2 and 3 was determined by RT-PCR and Western Blot. Results show that following treatment with 8microM berberine the mRNA and protein expression levels of GATA-2 and 3 were elevated and accompanied by inhibited adipocyte differentiation. These results may lead to the use of berberine to target the induction of specific genes such as GATA-2 and GATA-3 which affect adipocyte differentiation.

  10. Do Quantitative EEG Measures Differentiate Hyperactivity in Attention Deficit/Hyperactivity Disorder?

    ERIC Educational Resources Information Center

    Stewart, Garth A.; Steffler, Dorothy J.; Lemoine, Daniel E.; Leps, Jolene D.


    Used quantitative electroencephalogram analysis to examine difference in brain wave activity of attention deficit disorders (ADD) with and without hyperactivity while completing a computerized task measuring a variety of constructs associated with attention and impulsivity. Found that although behavioral ratings confirmed differential…

  11. Characterization and Improvement of RNA-Seq Precision in Quantitative Transcript Expression Profiling

    SciTech Connect

    Labaj, Pawel P.; Leparc, German G.; Linggi, Bryan E.; Markillie, Lye Meng; Wiley, H. S.; Kreil, David P.


    Measurement precision determines the power of any analysis to reliably identify significant signals, such as in screens for differential expression, independent of whether the experimental design incorporates replicates or not. With the compilation of large scale RNA-Seq data sets with technical replicate samples, however, we can now, for the first time, perform a systematic analysis of the precision of expression level estimates from massively parallel sequencing technology. This then allows considerations for its improvement by computational or experimental means. Results: We report on a comprehensive study of target coverage and measurement precision, including their dependence on transcript expression levels, read depth and other parameters. In particular, an impressive target coverage of 84% of the estimated true transcript population could be achieved with 331 million 50 bp reads, with diminishing returns from longer read lengths and even less gains from increased sequencing depths. Most of the measurement power (75%) is spent on only 7% of the known transcriptome, however, making less strongly expressed transcripts harder to measure. Consequently, less than 30% of all transcripts could be quantified reliably with a relative error < 20%. Based on established tools, we then introduce a new approach for mapping and analyzing sequencing reads that yields substantially improved performance in gene expression profiling, increasing the number of transcripts that can reliably be quantified to over 40%. Extrapolations to higher sequencing depths highlight the need for efficient complementary steps. In discussion we outline possible experimental and computational strategies for further improvements in quantification precision.

  12. Differential regulation of COL2A1 expression in developing and mature chondrocytes.


    Seghatoleslami, M R; Lichtler, A C; Upholt, W B; Kosher, R A; Clark, S H; Mack, K; Rowe, D W


    To investigate the regulation of type II collagen gene expression in cells undergoing chondrogenic differentiation, we have employed a 5-kbp genomic fragment of the human type II collagen gene which contains 1.8kbp of upstream sequences, the transcription start site, the first exon and 3 kbp of intronic sequences, fused to either lac Z or chloramphenicol acetyl transferase-reporter gene. Transient expression studies revealed a parallel increase in transgene activity and endogenous type II collagen mRNA levels during the onset of the cartilage differentiation of limb mesenchymal cells in high-density micromass cultures. At later periods in culture, however, the transgene activity declines, although steady-state levels of type II collagen mRNA are reported to continue to increase (Kosher et al.: J. Cell. Biol. 102: 1151-1156, 1986; Kravis and Upholt. Dev. Biol. 108: 164-172, 1985). In addition, the activity of the transgene is seven-fold higher at the onset of chondrogenic differentiation in micromass cultures that in well differentiated sternal chondrocytes, although similar levels of type II collagen transcripts are found in these cells. Furthermore, deletions of intronic segments resulted in greater drop in activity of the constructs in differentiating chondrocytes in micromass cultures than in mature sternal chondrocytes. The expression of the construct in transgenic mice is higher at the onset of chondrogenic differentiation and in newly differentiated chondrocytes than in more mature differentiated chondrocytes. Based on these observations, it appears that the mechanisms involved in the regulation of the type II collagen gene at the onset of chondrocyte differentiation are different from those resulting in the maintenance of its expression in fully differentiated chondrocytes.

  13. Differential expression of ETS family transcription factors in NCCIT human embryonic carcinoma cells upon retinoic acid-induced differentiation.


    Park, Sung-Won; Do, Hyun-Jin; Ha, Woo Tae; Han, Mi-Hee; Song, Hyuk; Uhm, Sang-Jun; Chung, Hak-Jae; Kim, Jae-Hwan


    E26 transformation-specific (ETS) transcription factors play important roles in normal and tumorigenic processes during development, differentiation, homeostasis, proliferation, and apoptosis. To identify critical ETS factor(s) in germ cell-derived cancer cells, we examined the expression patterns of the 27 ETS transcription factors in naive and differentiated NCCIT human embryonic carcinoma cells, which exhibit both pluripotent and tumorigenic characteristics. Overall, expression of ETS factors was relatively low in NCCIT cells. Among the 27 ETS factors, polyomavirus enhancer activator 3 (PEA3) and epithelium-specific ETS transcription factor-1 (ESE-1) exhibited the most significant changes in their expression levels. Western blot analysis confirmed these patterns, revealing reduced levels of PEA3 protein and elevated levels of ESE-1 protein in differentiated cells. PEA3 increased the proportion of cells in S-phase and promoted cell growth, whereas ESE-1 reduced proliferation potential. These data suggest that PEA3 and ESE-1 may play important roles in pluripotent and tumorigenic embryonic carcinoma cells. These findings contribute to our understanding of the functions of oncogenic ETS factors in germ cell-derived stem cells during processes related to tumorigenesis and pluripotency.

  14. Identification of embryonic precursor cells that differentiate into thymic epithelial cells expressing autoimmune regulator

    PubMed Central

    Takizawa, Nobukazu; Miyauchi, Maki; Yanai, Hiromi; Tateishi, Ryosuke; Shinzawa, Miho; Yoshinaga, Riko; Kurihara, Masaaki; Yasuda, Hisataka; Sakamoto, Reiko; Yoshida, Nobuaki


    Medullary thymic epithelial cells (mTECs) expressing autoimmune regulator (Aire) are critical for preventing the onset of autoimmunity. However, the differentiation program of Aire-expressing mTECs (Aire+ mTECs) is unclear. Here, we describe novel embryonic precursors of Aire+ mTECs. We found the candidate precursors of Aire+ mTECs (pMECs) by monitoring the expression of receptor activator of nuclear factor-κB (RANK), which is required for Aire+ mTEC differentiation. pMECs unexpectedly expressed cortical TEC molecules in addition to the mTEC markers UEA-1 ligand and RANK and differentiated into mTECs in reaggregation thymic organ culture. Introduction of pMECs in the embryonic thymus permitted long-term maintenance of Aire+ mTECs and efficiently suppressed the onset of autoimmunity induced by Aire+ mTEC deficiency. Mechanistically, pMECs differentiated into Aire+ mTECs by tumor necrosis factor receptor-associated factor 6-dependent RANK signaling. Moreover, nonclassical nuclear factor-κB activation triggered by RANK and lymphotoxin-β receptor signaling promoted pMEC induction from progenitors exhibiting lower RANK expression and higher CD24 expression. Thus, our findings identified two novel stages in the differentiation program of Aire+ mTECs. PMID:27401343

  15. Identification of embryonic precursor cells that differentiate into thymic epithelial cells expressing autoimmune regulator.


    Akiyama, Nobuko; Takizawa, Nobukazu; Miyauchi, Maki; Yanai, Hiromi; Tateishi, Ryosuke; Shinzawa, Miho; Yoshinaga, Riko; Kurihara, Masaaki; Demizu, Yosuke; Yasuda, Hisataka; Yagi, Shintaro; Wu, Guoying; Matsumoto, Mitsuru; Sakamoto, Reiko; Yoshida, Nobuaki; Penninger, Josef M; Kobayashi, Yasuhiro; Inoue, Jun-Ichiro; Akiyama, Taishin


    Medullary thymic epithelial cells (mTECs) expressing autoimmune regulator (Aire) are critical for preventing the onset of autoimmunity. However, the differentiation program of Aire-expressing mTECs (Aire(+) mTECs) is unclear. Here, we describe novel embryonic precursors of Aire(+) mTECs. We found the candidate precursors of Aire(+) mTECs (pMECs) by monitoring the expression of receptor activator of nuclear factor-κB (RANK), which is required for Aire(+) mTEC differentiation. pMECs unexpectedly expressed cortical TEC molecules in addition to the mTEC markers UEA-1 ligand and RANK and differentiated into mTECs in reaggregation thymic organ culture. Introduction of pMECs in the embryonic thymus permitted long-term maintenance of Aire(+) mTECs and efficiently suppressed the onset of autoimmunity induced by Aire(+) mTEC deficiency. Mechanistically, pMECs differentiated into Aire(+) mTECs by tumor necrosis factor receptor-associated factor 6-dependent RANK signaling. Moreover, nonclassical nuclear factor-κB activation triggered by RANK and lymphotoxin-β receptor signaling promoted pMEC induction from progenitors exhibiting lower RANK expression and higher CD24 expression. Thus, our findings identified two novel stages in the differentiation program of Aire(+) mTECs.

  16. Changes in Laminin Expression Pattern during Early Differentiation of Human Embryonic Stem Cells.


    Pook, Martin; Teino, Indrek; Kallas, Ade; Maimets, Toivo; Ingerpuu, Sulev; Jaks, Viljar


    Laminin isoforms laminin-511 and -521 are expressed by human embryonic stem cells (hESC) and can be used as a growth matrix to culture these cells under pluripotent conditions. However, the expression of these laminins during the induction of hESC differentiation has not been studied in detail. Furthermore, the data regarding the expression pattern of laminin chains in differentiating hESC is scarce. In the current study we aimed to fill this gap and investigated the potential changes in laminin expression during early hESC differentiation induced by retinoic acid (RA). We found that laminin-511 but not -521 accumulates in the committed cells during early steps of hESC differentiation. We also performed a comprehensive analysis of the laminin chain repertoire and found that pluripotent hESC express a more diverse range of laminin chains than shown previously. In particular, we provide the evidence that in addition to α1, α5, β1, β2 and γ1 chains, hESC express α2, α3, β3, γ2 and γ3 chain proteins and mRNA. Additionally, we found that a variant of laminin α3 chain-145 kDa-accumulated in RA-treated hESC showing that these cells produce prevalently specifically modified version of α3 chain in early phase of differentiation.

  17. Gene expression signatures defining fundamental biological processes in pluripotent, early, and late differentiated embryonic stem cells.


    Gaspar, John Antonydas; Doss, Michael Xavier; Winkler, Johannes; Wagh, Vilas; Hescheler, Jürgen; Kolde, Raivo; Vilo, Jaak; Schulz, Herbert; Sachinidis, Agapios


    Investigating the molecular mechanisms controlling the in vivo developmental program postembryogenesis is challenging and time consuming. However, the developmental program can be partly recapitulated in vitro by the use of cultured embryonic stem cells (ESCs). Similar to the totipotent cells of the inner cell mass, gene expression and morphological changes in cultured ESCs occur hierarchically during their differentiation, with epiblast cells developing first, followed by germ layers and finally somatic cells. Combination of high throughput -omics technologies with murine ESCs offers an alternative approach for studying developmental processes toward organ-specific cell phenotypes. We have made an attempt to understand differentiation networks controlling embryogenesis in vivo using a time kinetic, by identifying molecules defining fundamental biological processes in the pluripotent state as well as in early and the late differentiation stages of ESCs. Our microarray data of the differentiation of the ESCs clearly demonstrate that the most critical early differentiation processes occur at days 2 and 3 of differentiation. Besides monitoring well-annotated markers pertinent to both self-renewal and potency (capacity to differentiate to different cell lineage), we have identified candidate molecules for relevant signaling pathways. These molecules can be further investigated in gain and loss-of-function studies to elucidate their role for pluripotency and differentiation. As an example, siRNA knockdown of MageB16, a gene highly expressed in the pluripotent state, has proven its influence in inducing differentiation when its function is repressed.

  18. Achaete-Scute Homolog 1 Expression Controls Cellular Differentiation of Neuroblastoma

    PubMed Central

    Kasim, Mumtaz; Heß, Vicky; Scholz, Holger; Persson, Pontus B.; Fähling, Michael


    Neuroblastoma, the major cause of infant cancer deaths, results from fast proliferation of undifferentiated neuroblasts. Treatment of high-risk neuroblastoma includes differentiation with retinoic acid (RA); however, the resistance of many of these tumors to RA-induced differentiation poses a considerable challenge. Human achaete-scute homolog 1 (hASH1) is a proneural basic helix-loop-helix transcription factor essential for neurogenesis and is often upregulated in neuroblastoma. Here, we identified a novel function for hASH1 in regulating the differentiation phenotype of neuroblastoma cells. Global analysis of 986 human neuroblastoma datasets revealed a negative correlation between hASH1 and neuron differentiation that was independent of the N-myc (MYCN) oncogene. Using RA to induce neuron differentiation in two neuroblastoma cell lines displaying high and low levels of hASH1 expression, we confirmed the link between hASH1 expression and the differentiation defective phenotype, which was reversed by silencing hASH1 or by hypoxic preconditioning. We further show that hASH1 suppresses neuronal differentiation by inhibiting transcription at the RA receptor element. Collectively, our data indicate hASH1 to be key for understanding neuroblastoma resistance to differentiation therapy and pave the way for hASH1-targeted therapies for augmenting the response of neuroblastoma to differentiation therapy. PMID:28066180

  19. Application of SSH and quantitative real time PCR to construction of gene expression profiles from scallop Chlamys farreri in response to exposure to tetrabromobisphenol A.


    Gong, Xiaoli; Pan, Luqing; Miao, Jingjing; Liu, Na


    TBBPA-induced genes were identified using suppression subtractive hybridization (SSH) from Chlamys farreri. A total of 203 and 44 clones from SSH forward and reverse library were respectively obtained including cellular process, immune system process, response to stimulus, metabolic process and signaling etc. Differential gene expressions were compared between scallops from control and TBBPA treatment groups (400 μg/L, 15 days) using quantitative real time RT-PCR. For further research, eight significant genes expression from scallops exposed to TBBPA (0; 100; 200; 400 μg/L) sampling at 0, 1, 3, 6 and 15 days, were utilized for Q-RT-PCR. The results revealed that the expression level of most selected cDNAs was dominantly up-regulated or down-regulated in the TBBPA-induced scallops. These findings provide basic genomic information of the bivalve and the selected genes may be the potential molecular biomarkers for TBBPA pollution in aquatic environment.

  20. Differential regulation of alpha7 nicotinic receptor gene (CHRNA7) expression in schizophrenic smokers.


    Mexal, Sharon; Berger, Ralph; Logel, Judy; Ross, Randal G; Freedman, Robert; Leonard, Sherry


    The alpha7 neuronal nicotinic receptor gene (CHRNA7) has been implicated in the pathophysiology of schizophrenia by genetic and pharmacological studies. Expression of the alpha7* receptor, as measured by [(125)I]alpha-bungarotoxin autoradiography, is decreased in postmortem brain of schizophrenic subjects compared to non-mentally ill controls. Most schizophrenic patients are heavy smokers, with high levels of serum cotinine. Smoking changes the expression of multiple genes and differentially regulates gene expression in schizophrenic hippocampus. We examined the effects of smoking on CHRNA7 expression in the same tissue and find that smoking differentially regulates expression of both mRNA and protein for this gene. CHRNA7 mRNA and protein levels are significantly lower in schizophrenic nonsmokers compared to control nonsmokers and are brought to control levels in schizophrenic smokers. Sufficient protein but low surface expression of the alpha7* receptor, seen in the autoradiographic studies, suggests aberrant assembly or trafficking of the receptor.

  1. Differential expression of calreticulin in developmental stages of Taenia solium.


    Mendlovic, Fela; Carrillo-Farga, Joaquín; Torres, José; Laclette, Juan Pedro; Flisser, Ana


    Taenia solium, a cestode that causes neurocysticercosis and taeniasis in humans, has a complex life cycle. The adult tapeworm develops in the intestine of human beings and is also responsible for neurocysticercosis, which is caused by the metacestode or cysticercus that develops in the brain. Recently, we have cloned the coding region for T. solium calreticulin (TsCRT) as a functional Ca(2+)-binding protein. Calreticulin is a ubiquitous protein involved in cellular Ca2+ homeostasis and protein folding. These important functions affect several aspects of cell physiology. To explore the expression of TsCRT during the T. solium life cycle, we used a specific polyclonal antibody raised against recombinant TsCRT to localize this protein by immunolabeling techniques. In sections of cysticerci obtained from swine muscle, as well as of adult tapeworms obtained after infection of hamsters with cysticerci, TsCRT was preferentially localized in tegumentary and muscle cytons of the suckers and rostellum. In mature proglottids obtained from infected humans, positive staining was observed in spermatogonia, ovogonia, uterine epithelium, and cells of the vas deferens. In the gravid uterus, the morula and early stage embryos were highly positive to TsCRT. However, expression diminished as embryonic development progressed and was absent in fully developed oncospheres that were surrounded by an embryophore. A similar down regulation was observed during spermatogenesis. Although early spermatocytes showed a high expression of TsCRT, mature spermatozoa present in the vas deferens were completely negative. These data indicate that calreticulin expression is spatially and temporally regulated during development of T. solium, especially during germ cell development and embryogenesis. In addition, these original images illustrate, for the first time, these processes at a histological level.

  2. Identification of novel molecules and pathogenic pathways in primary biliary cirrhosis: cDNA array analysis of intrahepatic differential gene expression

    PubMed Central

    Shackel, N; McGuinness, P; Abbott, C; Gorrell, M; McCaughan, G


    BACKGROUND—Primary biliary cirrhosis (PBC) is an autoimmune disease in which the pathogenesis of progressive liver injury is poorly understood.
AIM—To provide novel insights into the pathogenesis of PBC related liver injury using cDNA array analysis, which simultaneously examines expression of many genes.
METHODS—Utilising cDNA arrays of 874 genes, PBC was compared with primary sclerosing cholangitis (PSC) associated cirrhosis and non-diseased liver. Differential expression of 10 genes was confirmed by real time quantitative reverse transcriptase-polymerase chain reaction (RT-PCR).
RESULTS—Array analysis identified many differentially expressed genes that are important in inflammation, fibrosis, proliferation, signalling, apoptosis, and oxidative stress. PBC was associated with increased expression of both Th1 and Th2 type molecules of the immune response. Fibrosis related gene expression featured upregulation of connective tissue growth factor and transforming growth factor beta3. Many more apoptosis associated molecules exhibited increased expression, consistent with apoptosis being a more active and regulated process, in PSC associated cirrhosis than in PBC. Increased expression of many genes of the Wnt and notch pathways implicated these highly conserved and linked pathways in PBC pathogenesis. The observed increases in expression of c-jun, c-myc, and c-fos related antigen 1 are consistent with increased Wnt pathway activity in PBC. Differential expression of four components of the Wnt pathway, Wnt-5a, Wnt-13, FRITZ, and beta-catenin, was confirmed by quantitative RT-PCR.
CONCLUSION—Many genes implicated in intrahepatic inflammation, fibrosis, and regeneration were upregulated in PBC cirrhosis. In particular, increased expression of a number of Drosophila homologues was seen in PBC.

Keywords: primary sclerosing cholangitis; apoptosis; fibrosis; connective tissue growth factor; Wnt; Th1/Th2; brain derived neurotrophic factor; notch

  3. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling.


    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu


    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori.

  4. Heterosis and differential gene expression in hybrids and parents in Bombyx mori by digital gene expression profiling

    PubMed Central

    Wang, Hua; Fang, Yan; Wang, Lipeng; Zhu, Wenjuan; Ji, Haipeng; Wang, Haiying; Xu, Shiqing; Sima, Yanghu


    Heterosis is a concern to all breeders, but the mechanism of heterosis remains unknown. In F1 organisms, genetic material is inherited from the two parents and theoretically, heterosis might be caused by differences in gene expression or modification. Differential gene expression was analyzed in hybrids and parents in Bombyx mori. The results showed that there were significant changes in gene expression in the fat body involving biological regulation, cellular and metabolic processes. Consistent trends in expression patterns covering different hybrid combinations were seen in 74 genes. Moreover, these differential gene expression patterns included overdominance, dominance, and additive effects. By correlating these patterns with economic traits, a potential relationship was found. Differential gene expression was seen in different cross combinations and in different sexes. In addition, a regulatory mechanism involving metabolism and ErbB signaling pathways was also found, suggesting that such a network might also be related to heterosis in Bombyx mori. Together, our data provide a comprehensive overview and useful resource for transcriptional analysis of heterosis of Bombyx mori. PMID:25736158

  5. Differential extra-renal expression of the mouse renin genes.

    PubMed Central

    Miller, C C; Carter, A T; Brooks, J I; Lovell-Badge, R H; Brammar, W J


    We have used RNase-protection analyses to study renin gene expression in one- and two-gene mouse strains. The RNase-protection assay is capable of discriminating between the transcripts from the different renin genes. In a two-gene strain containing Ren-1D and Ren-2, we demonstrate transcriptional activity from Ren-1D in kidney, submandibular gland (SMG), testes, liver, brain and heart. Ren-2 is clearly expressed in kidney, SMG and testes. Similar analyses of one gene strains (containing Ren-1C only) show expression in kidney, SMG, testes, brain and heart. We cannot detect renin mRNA in the liver of these mice. Ren-1C and Ren-1D thus display quite different tissue-specificities. In order to determine whether the different tissue-specificities of the highly homologous Ren-1C and Ren-1D genes are due to different trans-acting factors in the different mouse strains or to different cis-acting DNA elements inherent to the genes, we introduced a Ren-1D transgene (Ren-1*) into a background strain containing only the Ren-1C gene. The transgene exhibits the same tissue-specificity as the Ren-1D gene of two-gene strains suggesting the presence of different cis-acting DNA elements in Ren-1C and Ren-1D. Images PMID:2657654

  6. Stress response in tardigrades: differential gene expression of molecular chaperones.


    Reuner, Andy; Hengherr, Steffen; Mali, Brahim; Förster, Frank; Arndt, Detlev; Reinhardt, Richard; Dandekar, Thomas; Frohme, Marcus; Brümmer, Franz; Schill, Ralph O


    Semi-terrestrial tardigrades exhibit a remarkable tolerance to desiccation by entering a state called anhydrobiosis. In this state, they show a strong resistance against several kinds of physical extremes. Because of the probable importance of stress proteins during the phases of dehydration and rehydration, the relative abundance of transcripts coding for two alpha-crystallin heat-shock proteins (Mt-sHsp17.2 and Mt-sHsp19.5), as well for the heat-shock proteins Mt-sHsp10, Mt-Hsp60, Mt-Hsp70 and Mt-Hsp90, were analysed in active and anhydrobiotic tardigrades of the species Milnesium tardigradum. They were also analysed in the transitional stage (I) of dehydration, the transitional stage (II) of rehydration and in heat-shocked specimens. A variable pattern of expression was detected, with most candidates being downregulated. Gene transcripts of one Mt-hsp70 isoform in the transitional stage I and Mt-hsp90 in the anhydrobiotic stage were significantly upregulated. A high gene expression (778.6-fold) was found for the small alpha-crystallin heat-shock protein gene Mt-sHsp17.2 after heat shock. We discuss the limited role of the stress-gene expression in the transitional stages between the active and anhydrobiotic tardigrades and other mechanisms which allow tardigrades to survive desiccation.

  7. Quantitative proteomic analysis to decipher the differential apoptotic response of bortezomib-treated APL cells before and after retinoic acid differentiation reveals involvement of protein toxicity mechanisms.


    Uttenweiler-Joseph, Sandrine; Bouyssié, David; Calligaris, David; Lutz, Pierre G; Monsarrat, Bernard; Burlet-Schiltz, Odile


    The ubiquitin-proteasome system allows the targeted degradation of proteins and plays a critical role in the regulation of many cellular processes. Proteasome inhibition is a recent antitumor therapeutic strategy and bortezomib was the first proteasome inhibitor approved for clinical use. In this study, we used the NB4 cell line to investigate the effects of bortezomib toward acute promyelocytic leukemia cells before and after retinoic acid-induced differentiation. We showed that apoptosis level after bortezomib treatment is higher in NB4 cells than in differentiated NB4 cells. To compare early protein variations upon bortezomib treatment in both NB4 cell populations, we performed a quantitative proteomic analysis based on iTRAQ peptide labeling followed by data analysis with in-house developed scripts. This strategy revealed the regulation of 14 proteins principally involved in protein stress response and apoptosis in NB4 cells after proteasome inhibition. Altogether, our results suggest that the differential level of apoptosis induced by bortezomib treatment in both NB4 cell populations could result from distinct protein toxicity level.

  8. Ibandronate promotes osteogenic differentiation of periodontal ligament stem cells by regulating the expression of microRNAs

    SciTech Connect

    Zhou, Qiang; Zhao, Zhi-Ning; Cheng, Jing-Tao; Zhang, Bin; Xu, Jie; Huang, Fei; Zhao, Rui-Ni; Chen, Yong-Jin


    Research highlights: {yields} Ibandronate significantly promote the proliferation of PDLSC cells. {yields} Ibandronate enhanced the expression of ALP, COL-1, OPG, OCN, Runx2. {yields} The expression of a class of miRNAs, e.g., miR-18a, miR-133a, miR-141 and miR-19a, was significantly modified in PDLSC cells cultured with ibandronate. {yields} Ibandronate regulates the expression of diverse bone formation-related genes via miRNAs in PDLSCs. {yields} Ibandronate can suppress the activity of osteoclast while promoting the proliferation of osteoblast by regulating the expression of microRNAs. -- Abstract: Bisphosphonates (BPs) have a profound effect on bone resorption and are widely used to treat osteoclast-mediated bone diseases. They suppress bone resorption by inhibiting the activity of mature osteoclasts and/or the formation of new osteoclasts. Osteoblasts may be an alternative target for BPs. Periodontal ligament stem cells (PDLSCs) exhibit osteoblast-like features and are capable of differentiating into osteoblasts or cementoblasts. This study aimed to determine the effects of ibandronate, a nitrogen-containing BP, on the proliferation and the differentiation of PDLSCs and to identify the microRNAs (miRNAs) that mediate these effects. The PDLSCs were treated with ibandronate, and cell proliferation was measured using the MTT (3-dimethylthiazol-2,5-diphenyltetrazolium bromide) assay. The expression of genes and miRNAs involved in osteoblastic differentiation was assayed using quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR). Ibandronate promoted the proliferation of PDLSCs and enhanced the expression of alkaline phosphatase (ALP), type I collagen (COL-1), osteoprotegerin (OPG), osteocalcin (OCN), and Runx2. The expression of miRNAs, including miR-18a, miR-133a, miR-141 and miR-19a, was significantly altered in the PDLSCs cultured with ibandronate. In PDLSCs, ibandronate regulates the expression of diverse bone formation

  9. Quantitative assessment of Hox complex expression in the indirect development of the polychaete annelid Chaetopterus sp

    NASA Technical Reports Server (NTRS)

    Peterson, K. J.; Irvine, S. Q.; Cameron, R. A.; Davidson, E. H.


    A prediction from the set-aside theory of bilaterian origins is that pattern formation processes such as those controlled by the Hox cluster genes are required specifically for adult body plan formation. This prediction can be tested in animals that use maximal indirect development, in which the embryonic formation of the larva and the postembryonic formation of the adult body plan are temporally and spatially distinct. To this end, we quantitatively measured the amount of transcripts for five Hox genes in embryos of a lophotrochozoan, the polychaete annelid Chaetopterus sp. The polychaete Hox complex is shown not to be expressed during embryogenesis, but transcripts of all measured Hox complex genes are detected at significant levels during the initial stages of adult body plan formation. Temporal colinearity in the sequence of their activation is observed, so that activation follows the 3'-5' arrangement of the genes. Moreover, Hox gene expression is spatially localized to the region of teloblastic set-aside cells of the later-stage embryos. This study shows that an indirectly developing lophotrochozoan shares with an indirectly developing deuterostome, the sea urchin, a common mode of Hox complex utilization: construction of the larva, whether a trochophore or dipleurula, does not involve Hox cluster expression, but in both forms the complex is expressed in the set-aside cells from which the adult body plan derives.

  10. A new system for fast and quantitative analysis of heterologous gene expression in plants.


    Thévenin, J; Dubos, C; Xu, W; Le Gourrierec, J; Kelemen, Z; Charlot, F; Nogué, F; Lepiniec, L; Dubreucq, B


    • Large-scale analysis of transcription factor-cis-acting element interactions in plants, or the dissection of complex transcriptional regulatory mechanisms, requires rapid, robust and reliable systems for the quantification of gene expression. • Here, we describe a new system for transient expression analysis of transcription factors, which takes advantage of the fast and easy production and transfection of Physcomitrella patens protoplasts, coupled to flow cytometry quantification of a fluorescent protein (green fluorescent protein). Two small-sized and high-copy Gateway® vectors were specifically designed, although standard binary vectors can also be employed. • As a proof of concept, the regulation of BANYULS (BAN), a key structural gene involved in proanthocyanidin biosynthesis in Arabidopsis thaliana seeds, was used. In P. patens, BAN expression is activated by a complex composed of three proteins (TT2/AtMYB123, TT8/bHLH042 and TTG1), and is inhibited by MYBL2, a transcriptional repressor, as in Arabidopsis. Using this approach, two new regulatory sequences that are necessary and sufficient for specific BAN expression in proanthocyanidin-accumulating cells were identified. • This one hybrid-like plant system was successfully employed to quantitatively assess the transcriptional activity of four regulatory proteins, and to identify their target recognition sites on the BAN promoter.

  11. Functional properties and expression quantitative trait loci for phosphate transporter GmPT1 in soybean.


    Song, Haina; Yin, Zhitong; Chao, Maoni; Ning, Lihua; Zhang, Dan; Yu, Deyue


    Phosphate (Pi) remobilization within a plant is critical for plant survival under Pi-limiting conditions. In this paper, a soybean Pi transporter gene, GmPT1, was characterized. A marked induction of GmPT1 transcript was observed in young leaves, mature leaves and lateral roots during long-term Pi starvation. Transgenic tobacco plants containing the GmPT1 gene were obtained using an Agrobacterium-mediated transformation system. Compared with wild-type plants, transgenic plants showed significant increases in phosphorus-use efficiency (PUE), photosystem II (PSII) function, total dry weight and seed weight under Pi-deficient conditions. GmPT1 expression levels and PUE were determined in a soybean recombinant inbred line population during a pot experiment that was conducted to measure chlorophyll fluorescence parameters, photosynthetic rate (PN ) and seed yield. Correlation analysis revealed that GmPT1 expression levels had significantly positive correlations with seed yield, PUE, PN and the quantum yield of PSII primary photochemistry (ΦPSII ). Expression quantitative trait loci (eQTL) mapping for GmPT1 revealed two eQTLs, one of which coincided with both the physical location of GmPT1 and a QTL associated with seed yield. These results suggest that GmPT1 plays a role in Pi remobilization, and it may be possible to improve soybean seed yields under Pi-limiting conditions by modulating GmPT1 expression levels.

  12. Quantitative analysis of wine yeast gene expression profiles under winemaking conditions.


    Varela, Cristian; Cárdenas, Javier; Melo, Francisco; Agosin, Eduardo


    Wine fermentation is a dynamic and complex process in which the yeast cell is subjected to multiple stress conditions. A successful adaptation involves changes in gene expression profiles where a large number of genes are up- or downregulated. Functional genomic approaches are commonly used to obtain global gene expression profiles, thereby providing a comprehensive view of yeast physiology. We used SAGE to quantify gene expression profiles in an industrial strain of Saccharomyces cerevisiae under winemaking conditions. The transcriptome of wine yeast was analysed at three stages during the fermentation process, mid-exponential phase, and early- and late-stationary phases. Upon correlation with the yeast genome, we found three classes of transcripts: (a) sequences that corresponded to ORFs; (b) expressed sequences from intergenic regions; and (c) messengers that did not match the published reference yeast genome. In all fermentation phases studied, the most highly expressed genes related to energy production and stress response. For many pathways, including glycolysis, different transcript levels were observed during each phase. Different isoenzymes, including hexose transporters (HXT), were differentially induced, depending on the growth phase. About 10% of transcripts matched non-annotated ORF regions within the yeast genome and could correspond to small novel genes originally omitted in the first gene annotation effort. Up to 22% of transcripts, particularly at late-stationary phase, did not match any known location within the genome. As the available reference yeast genome was obtained from a laboratory strain, these expressed sequences could represent genes only expressed by an industrial yeast strain. Further studies are necessary to identify the role of these potential genes during wine fermentation.

  13. Brief Communication: Quantitative- and molecular-genetic differentiation in humans and chimpanzees: implications for the evolutionary processes underlying cranial diversification.


    Weaver, Timothy D


    Estimates of the amount of genetic differentiation in humans among major geographic regions (e.g., Eastern Asia vs. Europe) from quantitative-genetic analyses of cranial measurements closely match those from classical- and molecular-genetic markers. Typically, among-region differences account for ∼10% of the total variation. This correspondence is generally interpreted as evidence for the importance of neutral evolutionary processes (e.g., genetic drift) in generating among-region differences in human cranial form, but it was initially surprising because human cranial diversity was frequently assumed to show a strong signature of natural selection. Is the human degree of similarity of cranial and DNA-sequence estimates of among-region genetic differentiation unusual? How do comparisons with other taxa illuminate the evolutionary processes underlying cranial diversification? Chimpanzees provide a useful starting point for placing the human results in a broader comparative context, because common chimpanzees (Pan troglodytes) and bonobos (Pan paniscus) are the extant species most closely related to humans. To address these questions, I used 27 cranial measurements collected on a sample of 861 humans and 263 chimpanzees to estimate the amount of genetic differentiation between pairs of groups (between regions for humans and between species or subspecies for chimpanzees). Consistent with previous results, the human cranial estimates are quite similar to published DNA-sequence estimates. In contrast, the chimpanzee cranial estimates are much smaller than published DNA-sequence estimates. It appears that cranial differentiation has been limited in chimpanzees relative to humans.

  14. Regulation of c-myb expression in human neuroblastoma cells during retinoic acid-induced differentiation.

    PubMed Central

    Thiele, C J; Cohen, P S; Israel, M A


    We detected expression of the c-myb proto-oncogene, which was initially thought to be expressed in a tissue-specific manner in cells of hematopoietic lineage, in human tissues of neuronal origin. Since the level of c-myb expression declined during fetal development, we studied the regulation of its expression in human neuroblastoma cell lines induced to differentiate by retinoic acid. The expression of c-myb declined during the maturation of neuroblastoma cells, and this change was mediated by a decrease in c-myb transcription. Images PMID:3380093

  15. Differential gene expression induced by exposure of captive mink to fuel oil: A model for the sea otter

    USGS Publications Warehouse

    Bowen, L.; Riva, F.; Mohr, C.; Aldridge, B.; Schwartz, J.; Miles, A.K.; Stott, J.L.


    Free-ranging sea otters are subject to hydrocarbon exposure from a variety of sources, both natural and anthropogenic. Effects of direct exposure to unrefined crude oil, such as that associated with the Exxon Valdez oil spill, are readily apparent. However, the impact of subtle but pathophysiologically relevant concentrations of crude oil on sea otters is difficult to assess. The present study was directed at developing a model for assessing the impact of low concentrations of fuel oil on sea otters. Quantitative PCR was used to identify differential gene expression in American mink that were exposed to low concentrations of bunker C fuel oil. A total of 23 genes, representing 10 different physiological systems, were analyzed for perturbation. Six genes with immunological relevance were differentially expressed in oil-fed mink. Interleukin-18 (IL-18), IL-10, inducible nitric oxide synthase (iNOS), cyclooxygenase 2 (COX-2), and complement cytolysis inhibitor (CLI) were down-regulated while IL-2 was up-regulated. Expression of two additional genes was affected; heat shock protein 70 (HSP70) was up-regulated and thyroid hormone receptor (THR) was down-regulated. While the significance of each perturbation is not immediately evident, we identified differential expression of genes that would be consistent with the presence of immune system-modifying and endocrine-disrupting compounds in fuel oil. Application of this approach to identify effects of petroleum contamination on sea otters should be possible following expansion of this mink model to identify a greater number of affected genes in peripheral blood leukocytes. ?? 2007 Ecohealth Journal Consortium.

  16. Quantitative Expression Analysis in Brassica napus by Northern Blot Analysis and Reverse Transcription-Quantitative PCR in a Complex Experimental Setting

    PubMed Central

    Rumlow, Annekathrin; Keunen, Els; Klein, Jan; Pallmann, Philip; Riemenschneider, Anja; Cuypers, Ann


    Analysis of gene expression is one of the major ways to better understand plant reactions to changes in environmental conditions. The comparison of many different factors influencing plant growth challenges the gene expression analysis for specific gene-targeted experiments, especially with regard to the choice of suitable reference genes. The aim of this study is to compare expression results obtained by Northern blot, semi-quantitative PCR and RT-qPCR, and to identify a reliable set of reference genes for oilseed rape (Brassica napus L.) suitable for comparing gene expression under complex experimental conditions. We investigated the influence of several factors such as sulfur deficiency, different time points during the day, varying light conditions, and their interaction on gene expression in oilseed rape plants. The expression of selected reference genes was indeed influenced under these conditions in different ways. Therefore, a recently developed algorithm, called GrayNorm, was applied to validate a set of reference genes for normalizing results obtained by Northern blot analysis. After careful comparison of the three methods mentioned above, Northern blot analysis seems to be a reliable and cost-effective alternative for gene expression analysis under a complex growth regime. For using this method in a quantitative way a number of references was validated revealing that for our experiment a set of three references provides an appropriate normalization. Semi-quantitative PCR was prone to many handling errors and difficult to control while RT-qPCR was very sensitive to expression fluctuations of the reference genes. PMID:27685087

  17. Effects of the differentiated keratinocyte phenotype on expression levels of CYP1-4 family genes in human skin cells

    SciTech Connect

    Du Liping; Neis, Mark M.; Ladd, Patricia A.; Yost, Garold S.; Keeney, Diane S. . E-mail:


    Epoxyeicosatrienoic acids produced by mouse CYP2B19 have been implicated in mechanisms regulating epidermal cornification (Ladd, P.A., Du, L., Capdevila, J.H., Mernaugh, R., Keeney, D.S., 2003. Epoxyeicosatrienoic acids activate transglutaminases in situ and induce cornification of epidermal keratinocytes. J. Biol. Chem. 278, 35184-35192). In this study, we aimed to identify CYPs that are up-regulated during keratinocyte differentiation and potentially responsible for epoxyeicosatrienoic acid formation in human skin. The cellular differentiation state of human epidermal cell cultures was manipulated to resemble the basal, spinous, and granular cell phenotypes in vivo. Changes in CYP mRNA levels were measured as a function of differentiation state for a panel of 15 CYPs that included known and putative arachidonate monooxygenases. Quantitative real-time PCR analyses showed that all of the CYPs were expressed in differentiating epidermal cell cultures and in human epidermis, with the exception of CYP2B6, which was poorly expressed in vitro. Six CYPs were strongly up-regulated at Day 6 and Day 8 of in vitro differentiation (CYP4B1, 2W1, 2C18, 3A4, 2C19, 2C9); the increase in mRNA levels ranged from 27- to 356-fold. Only CYP2U1 mRNA levels decreased (6-fold change) during cellular differentiation. Six CYPs showed little variation (<2-fold change) in mRNA levels during in vitro differentiation (CYP2S1, 2J2, 1B1, 1A1, 2E1, 2D6). No single CYP was identifiable as being a functional counterpart to CYP2B19 in mouse skin since none qualified as being mainly responsible for epidermal epoxyeicosatrienoic acid formation. Rather, the data suggest that epoxyeicosatrienoic acids in human skin are formed by several CYPs expressed in different cell layers of the epidermis. This would predict that CYP-derived eicosanoids have different functions in different epidermal cell layers.

  18. Quantitative Expression and Co-Localization of Wnt Signalling Related Proteins in Feline Squamous Cell Carcinoma

    PubMed Central

    Marote, Georgina; Abramo, Francesca; McKay, Jenny; Thomson, Calum; Beltran, Mariana; Millar, Michael; Priestnall, Simon; Dobson, Jane; Costantino-Casas, Fernando; Petrou, Terry; McGonnell, Imelda M.; Davies, Anthony J.; Weetman, Malcolm; Garden, Oliver A.; Masters, John R.; Thrasivoulou, Christopher; Ahmed, Aamir


    Feline oral squamous cell carcinoma (FOSCC) is an aggressive neoplasm in cats. Little is known about the possible molecular mechanisms that may be involved in the initiation, maintenance and progression of FOSCC. Wnt signalling is critical in development and disease, including many mammalian cancers. In this study, we have investigated the expression of Wnt signalling related proteins using quantitative immunohistochemical techniques on tissue arrays. We constructed tissue arrays with 58 individual replicate tissue samples. We tested for the expression of four key Wnt/ß-catenin transcription targets, namely Cyclin D1 (CCND1 or CD1), FRA1, c-Myc and MMP7. All antibodies showed cross reactivity in feline tissue except MMP7. Quantitative immunohistochemical analysis of single proteins (expressed as area fraction / amount of tissue for normal vs tumor, mean ± SE) showed that the expression of CD1 (3.9 ± 0.5 vs 12.2 ± 0.9), FRA1 (5.5 ± 0.6 vs 16.8 ± 1.1) and c-Myc (5.4 ± 0.5 vs 12.5 ± 0.9) was increased in FOSCC tissue by 2.3 to 3 fold compared to normal controls (p<0.0001). By using a multilabel, quantitative fluorophore technique we further investigated if the co-localization of these proteins (all transcription factors) with each other and in the nucleus (stained with 4',6-diamidino-2-phenylindole, DAPI) was altered in FOSCC compared to normal tissue. The global intersection coefficients, a measure of the proximity of two fluorophore labeled entities, showed that there was a significant change (p < 0.01) in the co-localization for all permutations (e.g. CD1/FRA1 etc), except for the nuclear localization of CD1. Our results show that putative targets of Wnt signalling transcription are up-regulated in FOSCC with alterations in the co-localization of these proteins and could serve as a useful marker for the disease. PMID:27559731

  19. Molecular characterization of growth differentiation factor 9 and its spatio-temporal expression pattern in gibel carp (Carassius auratus gibelio).


    Liu, Zhiwei; Chen, Aqin; Yang, Zhigang; Wei, Hua; Leng, Xiangjun


    Growth differentiation factor 9 (GDF9) is a member of the transforming growth factor β (TGF-β) superfamily with a key role in regulating follicle development. In this study, the GDF9 full-length genomic DNA and cDNA were isolated and characterized from the gibel carp ovary using rapid-amplification of cDNA ends (RACE) and LD-PCR. The full-length genomic DNA and cDNA sequences of GDF9 are 3979 and 2044 bp which code 428 amino acid residues with a specific RKKR protease cleavage site of TGF-β superfamily. Sequence analysis showed that gibel carp was similar to zebrafish and other fish species. Spatio-temporal expression analysis using real-time quantitative PCR revealed that GDF9 mRNA was largely expressed in ovary and testis. GDF9 is mainly present at stage I follicles indicating its important role in early follicles development. The same result was obtained in immunohistochemistry localization of GDF9 protein. Within the follicle, the follicle layer cells were barely expressed whereas GDF9 mRNA was mostly expressed in the oocytes. Supplemented with human chorionic gonadotropin (hCG) in isolated follicles, the expression of GDF9 mRNA was increased firstly and then decreased. The results of this study indicated that GDF9 gene played a role in fish during development of follicles, especially in the early stage follicles.

  20. Combined affinity labelling and mass spectrometry analysis of differential cell surface protein expression in normal and prostate cancer cells.


    Hastie, Claire; Saxton, Malcolm; Akpan, Akunna; Cramer, Rainer; Masters, John R; Naaby-Hansen, Soren


    Differences in the expression of cell surface proteins between a normal prostate epithelial (1542-NP2TX) and a prostate cancer cell line (1542-CP3TX) derived from the same patient were investigated. A combination of affinity chromatographic purification of biotin-tagged surface proteins with mass spectrometry analysis identified 26 integral membrane proteins and 14 peripheral surface proteins. The findings confirm earlier reports of altered expression in prostate cancer for several cell surface proteins, including ALCAM/CD166, the Ephrin type A receptor, EGFR and the prostaglandin F2 receptor regulatory protein. In addition, several novel findings of differential expression were made, including the voltage-dependent anion selective channel proteins Porin 1 and 2, ecto-5'-nucleotidase (CD73) and Scavenger receptor B1. Cell surface protein expression changed both qualitatively and quantitatively when the cells were grown in the presence of either or both interferon INFalpha and INFgamma. Costimulation with type I and II interferons had additive or synergistic effects on the membrane density of several, mainly peripherally attached surface proteins. Concerted upregulation of surface exposed antigens may be of benefit in immuno-adjuvant-based treatment of interferon-responsive prostate cancer. In conclusion, this study demonstrates that differences in the expression of membrane proteins between normal and prostate cancer cells are reproducibly detectable following vectorial labelling with biotin, and that detailed analysis of extracellular-induced surface changes can be achieved by combining surface-specific labelling with high-resolution two-dimensional gel electrophoresis and mass spectrometry.

  1. Characterization of Differentially Expressed Genes Involved in Pathways Associated with Gastric Cancer

    PubMed Central

    Li, Hao; Yu, Beiqin; Li, Jianfang; Su, Liping; Yan, Min; Zhang, Jun; Li, Chen; Zhu, Zhenggang; Liu, Bingya


    To explore the patterns of gene expression in gastric cancer, a total of 26 paired gastric cancer and noncancerous tissues from patients were enrolled for gene expression microarray analyses. Limma methods were applied to analyze the data, and genes were considered to be significantly differentially expressed if the False Discovery Rate (FDR) value was < 0.01, P-value was <0.01 and the fold change (FC) was >2. Subsequently, Gene Ontology (GO) categories were used to analyze the main functions of the differentially expressed genes. According to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, we found pathways significantly associated with the differential genes. Gene-Act network and co-expression network were built respectively based on the relationships among the genes, proteins and compounds in the database. 2371 mRNAs and 350 lncRNAs considered as significantly differentially expressed genes were selected for the further analysis. The GO categories, pathway analyses and the Gene-Act network showed a consistent result that up-regulated genes were responsible for tumorigenesis, migration, angiogenesis and microenvironment formation, while down-regulated genes were involved in metabolism. These results of this study provide some novel findings on coding RNAs, lncRNAs, pathways and the co-expression network in gastric cancer which will be useful to guide further investigation and target therapy for this disease. PMID:25928635

  2. Nuclear factor of activated T cells (NFAT) signaling regulates PTEN expression and intestinal cell differentiation

    PubMed Central

    Wang, Qingding; Zhou, Yuning; Jackson, Lindsey N.; Johnson, Sara M.; Chow, Chi-Wing; Evers, B. Mark


    The nuclear factor of activated T cell (NFAT) proteins are a family of transcription factors (NFATc1–c4) involved in the regulation of cell differentiation and adaptation. Previously we demonstrated that inhibition of phosphatidylinositol 3-kinase or overexpression of PTEN enhanced intestinal cell differentiation. Here we show that treatment of intestinal-derived cells with the differentiating agent sodium butyrate (NaBT) increased PTEN expression, NFAT binding activity, and NFAT mRNA expression, whereas pretreatment with the NFAT signaling inhibitor cyclosporine A (CsA) blocked NaBT-mediated PTEN induction. Moreover, knockdown of NFATc1 or NFATc4, but not NFATc2 or NFATc3, attenuated NaBT-induced PTEN expression. Knockdown of NFATc1 decreased PTEN expression and increased the phosphorylation levels of Akt and downstream targets Foxo1 and GSK-3α/β. Furthermore, overexpression of NFATc1 or the NFATc4 active mutant increased PTEN and p27kip1 expression and decreased Akt phosphorylation. In addition, pretreatment with CsA blocked NaBT-mediated induction of intestinal alkaline phosphatase (IAP) activity and villin and p27kip1 expression; knockdown of either NFATc1 or NFATc4 attenuated NaBT-induced IAP activity. We provide evidence showing that NFATc1 and NFATc4 are regulators of PTEN expression. Importantly, our results suggest that NFATc1 and NFATc4 regulation of intestinal cell differentiation may be through PTEN regulation. PMID:21148296

  3. Expression of liver fatty acid binding protein alters growth and differentiation of embryonic stem cells.


    Schroeder, F; Atshaves, B P; Starodub, O; Boedeker, A L; Smith, R R; Roths, J B; Foxworth, W B; Kier, A B


    Although expression of liver fatty acid binding protein (L-FABP) modulates cell growth, it is not known if L-FABP also alters cell morphology and differentiation. Therefore, pluripotent embryonic stem cells were transfected with cDNA encoding L-FABP and a series of clones expressing increasing levels of L-FABP were isolated. Untransfected ES cells, as well as ES cells transfected only with empty vector, spontaneously differentiated from rounded adipocyte-like to fibroblast-like morphology, concomitant with marked reduction in expression of stage-specific embryonic antigen (SSEA-1). These changes in morphology and expression of SSEA-1 were greatest in ES cell clones expressing L-FABP above a threshold level. Immunofluorescence confocal microscopy revealed that L-FABP was primarily localized in a diffuse-cytosolic pattern along with a lesser degree of punctate L-FABP expression in the nucleus. Nuclear localization of L-FABP was preferentially increased in clones expressing higher levels of L-FABP. In summary, L-FABP expression altered ES cell morphology and expression of SSEA-1. Taken together with the fact that L-FABP was detected in the nucleus, these data suggested that L-FABP may play a more direct, heretofore unknown, role in regulating ES cell differentiation by acting in the nucleus as well as cytoplasm.

  4. /sup 99m/Tc-glucoheptonate for quantitation of differential renal function

    SciTech Connect

    Ziessman, H.A.; Balseiro, J.; Fahey, F.H.; Le, T.V.; Dubiansky, V.


    Differential renal function was calculated by using /sup 99m/Tc-glucoheptonate (Tc-GH) in 51 patients. Computer-acquired background-corrected individual renal function was calculated by using both the 1-3-min uptake counts and the 2-4-hr delayed static counts. The degree of correlation between the two was high (r = .96). An equally high correlation was noted in 16 children who were 12 years old or younger, in 15 patients with renal size disparity greater than 60/40%, and in six patients with abnormal creatinine clearances. Ten patients had a 30-min dynamic /sup 99m/Tc-DTPA study followed immediately by the injection of Tc-GH and acquisition of delayed static images 2-4 hr later. A high degree of correlation (r = .99) was seen between the 1-3-min differential function obtained by using Tc-DTPA and the 2-4-hr delayed differential function obtained by using Tc-GH. This study shows that Tc-GH is a clinically useful and valid tool for calculation of differential renal function and that Tc-GH combines many of the best aspects of Tc-DTPA and Tc-DMSA.

  5. [Differentiated expression of VvSUC12 and VvSUC27 in embryogenic and non-embryogenic calli of Vitis vinifera L].


    Chen, Si; Zeng, Lei; Chen, Shangwu; Sun, Yangwu; Zhang, Wen; Xu, Haiying; Ma, Huiqin


    We induced embryogenic calli (EC) and non-embryogenic calli (NEC) from flower filaments of Vitis vinifera L. cv. Chardonnay about 10 days before full bloom. The callus were sub-cultured, observed and verified by somatic embryo induction. PCR primers for VvSUC12 and VvSCU27 were designed according to the corresponding sequences in GenBank. After RNA extraction with RNAplant for EC and NEC cell lines, we synthesized the 1st strand DNA for semi quantitative RT-PCR, and normalized the density of the bands against house-keeping gene Actin. The results of 31 cycles semi-quantitative RT-PCR showed that VvSUC12 was highly expressed in both EC and NEC, with higher expression intensity in NEC than in EC, but not reached the significant level; while the expression of VvSUC27 was only detected in EC, and the expression level was significantly lower than that of VvSUC12. We increased the semi-quantitative RT-PCR cycle number to 35 and found that VvSUC27 gene was weakly expressed in NEC, in EC the intensity of the band was increased comparing with 31 cycles, and the expression level was higher than that of NEC. The paper discussed the differential expression of the two sucrose transporters and their relationship with the sucrose in the tissue culture medium.

  6. Analysis of differential gene expression under low-temperature stress in Nile tilapia (Oreochromis niloticus) using digital gene expression.


    Yang, Changgeng; Jiang, Ming; Wen, Hua; Tian, Juan; Liu, Wei; Wu, Fan; Gou, Gengwu


    Tilapia (Oreochromis niloticus) do not survive well at low temperatures. Therefore, improvement of the low-temperature resistance has become an important issue for aquaculture development of tilapia. The objective of this study was to construct a digital gene expression tag profile to identify genes potentially related to low temperature in tilapia. In this study, tilapia was treated at 30°C to lethal temperature 10°C in decrement of 1°CD(-1). Digital gene expression analysis was performed using the Illumina technique to investigate differentially expressed genes in tilapia cultured at different temperatures (30°C, 26°C, 20°C, 16°C, and 10°C). A total of 206,861, 188,082, 185,827, 188,067, and 214,171 distinct tags were obtained by sequencing these five libraries, respectively. Compared with the 30°C library, there were 304, 407, 709, and 772 upregulated genes and 342, 793, 771, and 1466 downregulated genes in 26°C, 20°C, 16°C, and 10°C libraries, respectively. Trend analysis of these differentially expressed genes identified six statistically significant trends. Functional annotation analysis of the differentially expressed genes identified various functions associated with the response to low-temperature stress. When tilapia are subjected to low-temperature stress, expression changes were observed in genes associated with nucleic acid synthesis and metabolism, amino acid metabolism and protein synthesis, lipid and carbohydrate content and types, material transport, apoptosis, and immunity. The differentially expressed genes obtained in this study may provide useful insights to help further understand the effects of low temperature on tilapia.

  7. Detecting differential protein expression in large-scale population proteomics

    SciTech Connect

    Ryu, Soyoung; Qian, Weijun; Camp, David G.; Smith, Richard D.; Tompkins, Ronald G.; Davis, Ronald W.; Xiao, Wenzhong


    Mass spectrometry-based high-throughput quantitative proteomics shows great potential in clinical biomarker studies, identifying and quantifying thousands of proteins in biological samples. However, methods are needed to appropriately handle issues/challenges unique to mass spectrometry data in order to detect as many biomarker proteins as possible. One issue is that different mass spectrometry experiments generate quite different total numbers of quantified peptides, which can result in more missing peptide abundances in an experiment with a smaller total number of quantified peptides. Another issue is that the quantification of pep