Science.gov

Sample records for quantitative differential expression

  1. Quantitative Proteomic Analysis of Differentially Expressed Protein Profiles Involved in Pancreatic Ductal Adenocarcinoma

    PubMed Central

    Kuo, Kung-Kai; Kuo, Chao-Jen; Chiu, Chiang-Yen; Liang, Shih-Shin; Huang, Chun-Hao; Chi, Shu-Wen; Tsai, Kun-Bow; Chen, Chiao-Yun; Hsi, Edward; Cheng, Kuang-Hung; Chiou, Shyh-Horng

    2016-01-01

    Objectives The aim of this study was to identify differentially expressed proteins among various stages of pancreatic ductal adenocarcinoma (PDAC) by shotgun proteomics using nano-liquid chromatography coupled tandem mass spectrometry and stable isotope dimethyl labeling. Methods Differentially expressed proteins were identified and compared based on the mass spectral differences of their isotope-labeled peptide fragments generated from protease digestion. Results Our quantitative proteomic analysis of the differentially expressed proteins with stable isotope (deuterium/hydrogen ratio, ≥2) identified a total of 353 proteins, with at least 5 protein biomarker proteins that were significantly differentially expressed between cancer and normal mice by at least a 2-fold alteration. These 5 protein biomarker candidates include α-enolase, α-catenin, 14-3-3 β, VDAC1, and calmodulin with high confidence levels. The expression levels were also found to be in agreement with those examined by Western blot and histochemical staining. Conclusions The systematic decrease or increase of these identified marker proteins may potentially reflect the morphological aberrations and diseased stages of pancreas carcinoma throughout progressive developments leading to PDAC. The results would form a firm foundation for future work concerning validation and clinical translation of some identified biomarkers into targeted diagnosis and therapy for various stages of PDAC. PMID:26262590

  2. Differential and quantitative analyses of mRNA expression of glucosyltransferases from Streptococcus mutans MT8148.

    PubMed

    Fujiwara, T; Hoshino, T; Ooshima, T; Hamada, S

    2002-02-01

    Streptococcus mutans produces three glucosyltransferases, coded by gtfB, gtfC, and gtfD, whose cooperative action is essential for sucrose-dependent cellular adhesion. This cellular adhesion plays an important role in the formation of dental plaque and the initiation of dental caries. Since they bear genetic similarities and are large in size, differentiation of their gene expression has been difficult, and little is known about the dynamic process of gtf expression. Using a real-time reverse-transcription/polymerase chain-reaction, we determined the expression of each gtf. Under various conditions, the relative levels of transcription were gtfB > gtfD > gtfC. Sucrose enhanced gtfD expression, whereas it reduced that of gtfB and gtfC, suggesting the presence of independent promoters. Quantitative analyses demonstrated coincidence between the ratio of expression of each gtf and the ratio previously identified as optimal for sucrose-dependent adhesion in vitro, suggesting that S. mutans produces GTF at an optimal ratio to adhere to the tooth surface.

  3. Quantitative Analysis of Differential Proteome Expression in Bladder Cancer vs. Normal Bladder Cells Using SILAC Method

    PubMed Central

    Yang, Ganglong; Xu, Zhipeng; Lu, Wei; Li, Xiang; Sun, Chengwen; Guo, Jia; Xue, Peng; Guan, Feng

    2015-01-01

    The best way to increase patient survival rate is to identify patients who are likely to progress to muscle-invasive or metastatic disease upfront and treat them more aggressively. The human cell lines HCV29 (normal bladder epithelia), KK47 (low grade nonmuscle invasive bladder cancer, NMIBC), and YTS1 (metastatic bladder cancer) have been widely used in studies of molecular mechanisms and cell signaling during bladder cancer (BC) progression. However, little attention has been paid to global quantitative proteome analysis of these three cell lines. We labeled HCV29, KK47, and YTS1 cells by the SILAC method using three stable isotopes each of arginine and lysine. Labeled proteins were analyzed by 2D ultrahigh-resolution liquid chromatography LTQ Orbitrap mass spectrometry. Among 3721 unique identified and annotated proteins in KK47 and YTS1 cells, 36 were significantly upregulated and 74 were significantly downregulated with >95% confidence. Differential expression of these proteins was confirmed by western blotting, quantitative RT-PCR, and cell staining with specific antibodies. Gene ontology (GO) term and pathway analysis indicated that the differentially regulated proteins were involved in DNA replication and molecular transport, cell growth and proliferation, cellular movement, immune cell trafficking, and cell death and survival. These proteins and the advanced proteome techniques described here will be useful for further elucidation of molecular mechanisms in BC and other types of cancer. PMID:26230496

  4. Identification and validation of differentially expressed proteins in epithelial ovarian cancers using quantitative proteomics

    PubMed Central

    Cao, Guangming; Liu, Chongdong; Xu, Jiatong; Deng, Haiteng; Zhang, Zhenyu

    2016-01-01

    Ovarian cancer is the most lethal gynecological malignant tumor because of its high recurrence rate. In the present work, in order to find new therapeutic targets, we identified 8480 proteins in thirteen pairs of ovarian cancer tissues and normal ovary tissues through quantitative proteomics. 498 proteins were found to be differentially expressed in ovarian cancer, which involved in various cellular processes, including metabolism, response to stimulus and biosynthetic process. The expression levels of chloride intracellular channel protein 1 (CLIC1) and lectin galactoside-binding soluble 3 binding protein (LGALS3BP) in epithelial ovarian cancer tissues were significantly higher than those in normal ovary tissues as confirmed by western blotting and immunohistochemistry. The knockdown of CLIC1 in A2780 cell line downregulated expression of CTPS1, leading to the decrease of CTP and an arrest of cell cycle G1 phase, which results into a slower proliferation. CLIC1-knockdown can also slow down the tumor growth in vivo. Besides, CLIC1-knockdown cells showed an increased sensitivity to hydrogen peroxide and cisplatin, suggesting that CLIC1 was involved in regulation of redox and drug resistance in ovarian cancer cells. These results indicate CLIC1 promotes tumorgenesis, and is a potential therapeutic target in epithelial ovarian cancer treatment. PMID:27825122

  5. Quantitative proteomics reveals differential regulation of protein expression in recipient myocardium after trilineage cardiovascular cell transplantation

    PubMed Central

    Chang, Ying-Hua; Ye, Lei; Cai, Wenxuan; Lee, Yoonkyu; Guner, Huseyin; Lee, Youngsook; Kamp, Timothy J.; Zhang, Jianyi; Ge, Ying

    2015-01-01

    Intramyocardial transplantation of cardiomyocytes (CMs), endothelial cells (ECs), and smooth muscle cells (SMCs) derived from human induced pluripotent stem cells (hiPSCs) has beneficial effects on the post-infarction heart. However, the mechanisms underlying the functional improvements remain undefined. We employed large-scale label-free quantitative proteomics to identify proteins that were differentially regulated following cellular transplantation in a swine model of myocardial infarction (MI). We identified 22 proteins that were significantly up-regulated after trilineage cell transplantation compared to both MI and Sham groups. Among them, 12 proteins, including adenylyl cyclase-associated protein 1 and tropomodulin-1, are associated with positive regulation of muscular contraction whereas 11 proteins, such as desmoplakin and zyxin, are involved in embryonic and muscular development and regeneration. Moreover, we identified 21 proteins up-regulated and another 21 down-regulated in MI, but reversed after trilineage cell transplantation. Proteins up-regulated after MI but reversed by transplantation are related to fibrosis and apoptosis. Conversely, proteins down-regulated in MI but restored after cell therapy are regulators of protein nitrosylation. Our results show that the functionally beneficial effects of trilineage cell therapy are accompanied by differential regulation of protein expression in the recipient myocardium, which may contribute to the improved cardiac function. PMID:26033914

  6. Quantitative proteomics reveals differential regulation of protein expression in recipient myocardium after trilineage cardiovascular cell transplantation.

    PubMed

    Chang, Ying-Hua; Ye, Lei; Cai, Wenxuan; Lee, Yoonkyu; Guner, Huseyin; Lee, Youngsook; Kamp, Timothy J; Zhang, Jianyi; Ge, Ying

    2015-08-01

    Intramyocardial transplantation of cardiomyocytes (CMs), endothelial cells (ECs), and smooth muscle cells (SMCs) derived from human induced pluripotent stem cells (hiPSCs) has beneficial effects on the post-infarction heart. However, the mechanisms underlying the functional improvements remain undefined. We employed large-scale label-free quantitative proteomics to identify proteins that were differentially regulated following cellular transplantation in a swine model of myocardial infarction (MI). We identified 22 proteins that were significantly up-regulated after trilineage cell transplantation compared to both MI and Sham groups. Among them, 12 proteins, including adenylyl cyclase-associated protein 1 and tropomodulin-1, are associated with positive regulation of muscular contraction whereas 11 proteins, such as desmoplakin and zyxin, are involved in embryonic and muscular development and regeneration. Moreover, we identified 21 proteins up-regulated and another 21 down-regulated in MI, but reversed after trilineage cell transplantation. Proteins up-regulated after MI but reversed by transplantation are related to fibrosis and apoptosis. Conversely, proteins down-regulated in MI but restored after cell therapy are regulators of protein nitrosylation. Our results show that the functionally beneficial effects of trilineage cell therapy are accompanied by differential regulation of protein expression in the recipient myocardium, which may contribute to the improved cardiac function.

  7. Proteomic analysis of cow, yak, buffalo, goat and camel milk whey proteins: quantitative differential expression patterns.

    PubMed

    Yang, Yongxin; Bu, Dengpan; Zhao, Xiaowei; Sun, Peng; Wang, Jiaqi; Zhou, Lingyun

    2013-04-05

    To aid in unraveling diverse genetic and biological unknowns, a proteomic approach was used to analyze the whey proteome in cow, yak, buffalo, goat, and camel milk based on the isobaric tag for relative and absolute quantification (iTRAQ) techniques. This analysis is the first to produce proteomic data for the milk from the above-mentioned animal species: 211 proteins have been identified and 113 proteins have been categorized according to molecular function, cellular components, and biological processes based on gene ontology annotation. The results of principal component analysis showed significant differences in proteomic patterns among goat, camel, cow, buffalo, and yak milk. Furthermore, 177 differentially expressed proteins were submitted to advanced hierarchical clustering. The resulting clustering pattern included three major sample clusters: (1) cow, buffalo, and yak milk; (2) goat, cow, buffalo, and yak milk; and (3) camel milk. Certain proteins were chosen as characterization traits for a given species: whey acidic protein and quinone oxidoreductase for camel milk, biglycan for goat milk, uncharacterized protein (Accession Number: F1MK50 ) for yak milk, clusterin for buffalo milk, and primary amine oxidase for cow milk. These results help reveal the quantitative milk whey proteome pattern for analyzed species. This provides information for evaluating adulteration of specific specie milk and may provide potential directions for application of specific milk protein production based on physiological differences among animal species.

  8. Identification of stromal differentially expressed proteins in the colon carcinoma by quantitative proteomics.

    PubMed

    Mu, Yibing; Chen, Yongheng; Zhang, Guiying; Zhan, Xianquan; Li, Yuanyuan; Liu, Ting; Li, Guoqing; Li, Maoyu; Xiao, Zhefeng; Gong, Xiaoxiang; Chen, Zhuchu

    2013-06-01

    Tumor microenvironment plays very important roles in the carcinogenesis. A variety of stromal cells in the microenvironment have been modified to support the unique needs of the malignant state. This study was to discover stromal differentially expressed proteins (DEPs) that were involved in colon carcinoma carcinogenesis. Laser capture microdissection (LCM) was captured and isolated the stromal cells from colon adenocarcinoma (CAC) and non-neoplastic colon mucosa (NNCM) tissues, respectively. Seventy DEPs were identified between the pooled LCM-enriched CAC and NNCM stroma samples by iTRAQ-based quantitative proteomics. Gene Ontology (GO) relationship analysis revealed that DEPs were hierarchically grouped into 10 clusters, and were involved in multiple biological functions that were altered during carcinogenesis, including extracellular matrix organization, cytoskeleton, transport, metabolism, inflammatory response, protein polymerization, and cell motility. Pathway network analysis revealed 6 networks and 56 network eligible proteins with Ingenuity pathway analysis. Four significant networks functioned in digestive system development and its function, inflammatory disease, and developmental disorder. Eight DEPs (DCN, FN1, PKM2, HSP90B1, S100A9, MYH9, TUBB, and YWHAZ) were validated by Western blotting, and four DEPs (DCN, FN1, PKM2, and HSP90B1) were validated by immunohistochemical analysis. It is the first report of stromal DEPs between CAC and NNCM tissues. It will be helpful to recognize the roles of stromas in the colon carcinoma microenvironment, and improve the understanding of carcinogenesis in colon carcinoma. The present data suggest that DCN, FN1, PKM2, HSP90B1, S100A9, MYH9, TUBB, and YWHAZ might be the potential targets for colon cancer prevention and therapy.

  9. TeratoScore: Assessing the Differentiation Potential of Human Pluripotent Stem Cells by Quantitative Expression Analysis of Teratomas

    PubMed Central

    Avior, Yishai; Biancotti, Juan Carlos; Benvenisty, Nissim

    2015-01-01

    Summary Teratoma formation is the gold standard assay for testing the capacity of human pluripotent stem cells to differentiate into all embryonic germ layers. Although widely used, little effort has been made to transform this qualitative assay into a quantitative one. Using gene expression data from a wide variety of cells, we created a scorecard representing tissues from all germ layers and extraembryonic tissues. TeratoScore, an online, open-source platform based on this scorecard, distinguishes pluripotent stem cell-derived teratomas from malignant tumors, translating cell potency into a quantitative measure (http://benvenisty.huji.ac.il/teratoscore.php). The teratomas used for the algorithm also allowed us to examine gene expression differences between tumors with a diploid karyotype and those initiated by aneuploid cells. Chromosomally aberrant teratomas show a significantly different gene expression signature from that of teratomas originating from diploid cells, particularly in central nervous system-specific genes, congruent with human chromosomal syndromes. PMID:26070610

  10. QPROT: Statistical method for testing differential expression using protein-level intensity data in label-free quantitative proteomics.

    PubMed

    Choi, Hyungwon; Kim, Sinae; Fermin, Damian; Tsou, Chih-Chiang; Nesvizhskii, Alexey I

    2015-11-03

    We introduce QPROT, a statistical framework and computational tool for differential protein expression analysis using protein intensity data. QPROT is an extension of the QSPEC suite, originally developed for spectral count data, adapted for the analysis using continuously measured protein-level intensity data. QPROT offers a new intensity normalization procedure and model-based differential expression analysis, both of which account for missing data. Determination of differential expression of each protein is based on the standardized Z-statistic based on the posterior distribution of the log fold change parameter, guided by the false discovery rate estimated by a well-known Empirical Bayes method. We evaluated the classification performance of QPROT using the quantification calibration data from the clinical proteomic technology assessment for cancer (CPTAC) study and a recently published Escherichia coli benchmark dataset, with evaluation of FDR accuracy in the latter. QPROT is a statistical framework with computational software tool for comparative quantitative proteomics analysis. It features various extensions of QSPEC method originally built for spectral count data analysis, including probabilistic treatment of missing values in protein intensity data. With the increasing popularity of label-free quantitative proteomics data, the proposed method and accompanying software suite will be immediately useful for many proteomics laboratories. This article is part of a Special Issue entitled: Computational Proteomics. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Identification of genes differentially expressed during adventitious shoot induction in Pinus pinea cotyledons by subtractive hybridization and quantitative PCR.

    PubMed

    Alonso, Pablo; Cortizo, Millán; Cantón, Francisco R; Fernández, Belén; Rodríguez, Ana; Centeno, Maria L; Cánovas, Francisco M; Ordás, Ricardo J

    2007-12-01

    As part of a study aimed at understanding the physiological and molecular mechanisms involved in adventitious shoot bud formation in pine cotyledons, we conducted a transcriptome analysis to identify early-induced genes during the first phases of adventitious caulogenesis in Pinus pinea L. cotyledons cultured in the presence of benzyladenine. A subtractive cDNA library with more than 700 clones was constructed. Of these clones, 393 were sequenced, analyzed and grouped according to their putative function. Quantitative real-time PCR analysis was performed to confirm the differential expression of 30 candidate genes. Results are contrasted with available data for other species.

  12. Allelic variations and differential expressions detected at quantitative trait loci for salt stress tolerance in wheat.

    PubMed

    Oyiga, Benedict C; Sharma, Ram C; Baum, Michael; Ogbonnaya, Francis C; Léon, Jens; Ballvora, Agim

    2017-01-03

    The increasing salinization of agricultural lands is a threat to global wheat production. Understanding of the mechanistic basis of salt tolerance (ST) is essential for developing breeding and selection strategies that would allow for increased wheat production under saline conditions to meet the increasing global demand. We used a set that consists of 150 internationally derived winter and facultative wheat cultivars genotyped with a 90K SNP chip and phenotyped for ST across three growth stages and for ionic (leaf K(+) and Na(+)  contents) traits to dissect the genetic architecture regulating ST in wheat. Genome-wide association mapping revealed 187 Single Nucleotide Polymorphism (SNPs) (R(2)  = 3.00-30.67%), representing 37 quantitative trait loci (QTL), significantly associated with the ST traits. Of these, four QTL on 1BS, 2AL, 2BS and 3AL were associated with ST across the three growth stages and with the ionic traits. Novel QTL were also detected on 1BS and 1DL. Candidate genes linked to these polymorphisms were uncovered, and expression analyses were performed and validated on them under saline and non-saline conditions using transcriptomics and qRT-PCR data. Expressed sequence comparisons in contrasting ST wheat genotypes identified several non-synonymous/missense mutation sites that are contributory to the ST trait variations, indicating the biological relevance of these polymorphisms that can be exploited in breeding for ST in wheat. © 2017 The Authors. Plant, Cell & Environment published by John Wiley & Sons Ltd.

  13. Using Quantitative Real-Time PCR to Detect MicroRNA Expression Profile During Embryonic Stem Cell Differentiation.

    PubMed

    Pan, Xiaoping; Murashov, Alexander K; Stellwag, Edmund J; Zhang, Baohong

    2017-01-01

    Quantitative real-time PCR (qRT-PCR) is a reliable method to determine and monitor microRNA (miRNA) expression profiles in different cells, tissues, and organisms. Although there are several different strategies in performing qRT-PCR to determine miRNA expression, all of them have two steps in common: reverse transcription for obtaining cDNA from mature miRNA sequencing and standard real-time PCR for amplification of cDNA. This chapter demonstrates the application of quantitative real-time PCR for determining miRNA expression profiles during mouse embryonic stem cell differentiation. In this method, a mature miRNA sequence is first reverse transcribed into a long cDNA with a 40-50 nt miRNA-specific stem-loop primer; then, a standard real-time PCR reaction is performed for determining miRNA expression using a forward miRNA-specific primer and a universal reverse primer.

  14. Quantitative set analysis for gene expression: a method to quantify gene set differential expression including gene-gene correlations.

    PubMed

    Yaari, Gur; Bolen, Christopher R; Thakar, Juilee; Kleinstein, Steven H

    2013-10-01

    Enrichment analysis of gene sets is a popular approach that provides a functional interpretation of genome-wide expression data. Existing tests are affected by inter-gene correlations, resulting in a high Type I error. The most widely used test, Gene Set Enrichment Analysis, relies on computationally intensive permutations of sample labels to generate a null distribution that preserves gene-gene correlations. A more recent approach, CAMERA, attempts to correct for these correlations by estimating a variance inflation factor directly from the data. Although these methods generate P-values for detecting gene set activity, they are unable to produce confidence intervals or allow for post hoc comparisons. We have developed a new computational framework for Quantitative Set Analysis of Gene Expression (QuSAGE). QuSAGE accounts for inter-gene correlations, improves the estimation of the variance inflation factor and, rather than evaluating the deviation from a null hypothesis with a P-value, it quantifies gene-set activity with a complete probability density function. From this probability density function, P-values and confidence intervals can be extracted and post hoc analysis can be carried out while maintaining statistical traceability. Compared with Gene Set Enrichment Analysis and CAMERA, QuSAGE exhibits better sensitivity and specificity on real data profiling the response to interferon therapy (in chronic Hepatitis C virus patients) and Influenza A virus infection. QuSAGE is available as an R package, which includes the core functions for the method as well as functions to plot and visualize the results.

  15. Quantitative proteomics identifies 38 proteins that are differentially expressed in cucumber in response to cucumber green mottle mosaic virus infection.

    PubMed

    Liu, Hua-Wei; Liang, Chao-Qiong; Liu, Peng-Fei; Luo, Lai-Xin; Li, Jian-Qiang

    2015-12-15

    Since it was first reported in 1935, Cucumber green mottle mosaic virus (CGMMV) has become a serious pathogen in a range of cucurbit crops. The virus is generally transmitted by propagation materials, and to date no effective chemical or cultural methods of control have been developed to combat its spread. The current study presents a preliminary analysis of the pathogenic mechanisms from the perspective of protein expression levels in an infected cucumber host, with the objective of elucidating the infection process and potential strategies to reduce both the economic and yield losses associated with CGMMV. Isobaric tags for relative and absolute quantitation (iTRAQ) technology coupled with liquid chromatography-tandem mass spectrometric (LC-MS/MS) were used to identify the differentially expressed proteins in cucumber plants infected with CGMMV compared with mock-inoculated plants. The functions of the proteins were deduced by functional annotation and their involvement in metabolic processes explored by KEGG pathway analysis to identify their interactions during CGMMV infection, while their in vivo expression was further verified by qPCR. Infection by CGMMV altered both the expression level and absolute quantity of 38 proteins (fold change >0.6) in cucumber hosts. Of these, 23 were found to be up-regulated, while 15 were down-regulated. Gene ontology (GO) analysis revealed that 22 of the proteins had a combined function and were associated with molecular function (MF), biological process (BP) and cellular component (CC). Several other proteins had a dual function with 1, 7, and 2 proteins being associated with BP/CC, BP/MF, CC/MF, respectively. The remaining 3 proteins were only involved in MF. In addition, Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis identified 18 proteins that were involved in 13 separate metabolic pathways. These pathways were subsequently merged to generate three network diagrams illustrating the interactions between the different

  16. Quantitative RT-PCR analysis of differentially expressed genes in Quercus suber in response to Phytophthora cinnamomi infection.

    PubMed

    Ebadzad, Ghazal; Cravador, Alfredo

    2014-01-01

    cDNA-AFLP methodology was used to gain insight into gene fragments differentially present in the mRNA profiles of Quercus suber roots infected with zoospores of Phytophthora cinnamomi at different post challenge time points. Fifty-three transcript-derived fragments (TDFs) were identified and sequenced. Six candidate genes were selected based on their expression patterns and homology to genes known to play a role in defence. They encode a cinnamyl alcohol dehydrogenase2 (QsCAD2), a protein disulphide isomerase (QsPDI), a CC-NBS-LRR resistance protein (QsRPc), a thaumatin-like protein (QsTLP), a chitinase (QsCHI) and a 1,3-β-glucanase (QsGlu). Evaluation of the expression of these genes by quantitative polymerase chain reaction (qPCR) revealed that transcript levels of QsRPc, QsCHI, QsCAD2 and QsPDI increased during the first 24 h post-inoculation, while those of thaumatin-like protein decreased. No differential expression was observed for 1,3-β-glucanase (QsGlu). Four candidate reference genes, polymerase II (QsRPII), eukaryotic translation initiation factor 5A (QsEIF-5A), β-tubulin (QsTUB) and a medium subunit family protein of clathrin adaptor complexes (QsCACs) were assessed to determine the most stable internal references for qRT-PCR normalization in the Phytophthora-Q. suber pathosystem in root tissues. Those found to be more stable, QsRPII and QsCACs, were used as internal reference in the present work. Knowledge on the Quercus defence mechanisms against biotic stress is scarce. This study provides an insight into the gene profiling of a few important genes of Q. suber in response to P. cinnamomi infection contributing to the knowledge of the molecular interactions involving Quercus and root pathogens that can be useful in the future to understand the mechanisms underlying oak resistance to soil-borne oomycetes.

  17. Identification of suitable reference genes for quantitative gene expression analysis in rat adipose stromal cells induced to trilineage differentiation.

    PubMed

    Santos, Bruno Paiva Dos; da Costa Diesel, Luciana Fraga; da Silva Meirelles, Lindolfo; Nardi, Nance Beyer; Camassola, Melissa

    2016-12-15

    This study was designed to (i) identify stable reference genes for the analysis of gene expression during in vitro differentiation of rat adipose stromal cells (rASCs), (ii) recommend stable genes for individual treatment conditions, and (iii) validate these genes by comparison with normalization results from stable and unstable reference genes. On the basis of a literature review, eight genes were selected: Actb, B2m, Hprt1, Ppia, Rplp0, Rpl13a, Rpl5, and Ywhaz. Genes were ranked according to their stability under different culture conditions as assessed using GenNorm, NormFinder, and RefFinder algorithms. Although the employed algorithms returned different rankings, the most frequently top-ranked genes were: B2m and/or Ppia for all 28day treatments (ALL28); Ppia and Hprt1 (adipogenic differentiation; A28), B2m (chondrogenic differentiation; C28), Rpl5 (controls maintained in complete culture medium; CCM), Rplp0 (osteogenic differentiation for 3days; O3), Rpl13a and Actb (osteogenic differentiation for 7days; O7), Rplp0 and Ppia (osteogenic differentiation for 14days; O14), Hprt1 and Ppia (osteogenic differentiation for 28days; O28), as well as Actb (all osteogenesis time points combined; ALLOSTEO). The obtained results indicate that the performance of reference genes depends on the differentiation protocol and on the analysis time, thus providing valuable information for the design of RT-PCR experiments.

  18. Differentiation of five body fluids from forensic samples by expression analysis of four microRNAs using quantitative PCR.

    PubMed

    Sauer, Eva; Reinke, Ann-Kathrin; Courts, Cornelius

    2016-05-01

    Applying molecular genetic approaches for the identification of forensically relevant body fluids, which often yield crucial information for the reconstruction of a potential crime, is a current topic of forensic research. Due to their body fluid specific expression patterns and stability against degradation, microRNAs (miRNA) emerged as a promising molecular species, with a range of candidate markers published. The analysis of miRNA via quantitative Real-Time PCR, however, should be based on a relevant strategy of normalization of non-biological variances to deliver reliable and biologically meaningful results. The herein presented work is the as yet most comprehensive study of forensic body fluid identification via miRNA expression analysis based on a thoroughly validated qPCR procedure and unbiased statistical decision making to identify single source samples. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  19. Proteomic analysis from haploid and diploid embryos of Quercus suber L. identifies qualitative and quantitative differential expression patterns.

    PubMed

    Gómez, Aranzazu; López, Juan Antonio; Pintos, Beatriz; Camafeita, Emilio; Bueno, Ma Angeles

    2009-09-01

    Quercus suber L. is a Mediterranean forest species with ecological, social and economic value. Clonal propagation of Q. suber elite trees has been successfully obtained from in vitro-derived somatic and gametic embryos. These clonal lines play a main role in breeding and genetic studies of Q. suber. To aid in unravelling diverse genetic and biological unknowns, a proteomic approach is proposed. The proteomic analysis of Q. suber somatic and gametic in vitro culture-derived embryos, based on DIGE and MALDI-MS, has produced for the first time proteomic data on this species. Seventeen differentially expressed proteins have been identified which display significantly altered levels between gametic and somatic embryos. These proteins are involved in a variety of cellular processes, most of which had been neither previously associated with embryo development nor identified in the genus Quercus. Some of these proteins are involved in stress and pollen development and others play a role in the metabolism of tannins and phenylpropanoids, which represent two of the major pathways for the synthesis of cork chemical components. Furthermore, the augmented expression levels found for specific proteins are probably related to the homozygous state of a doubled-haploid sample. Proteins involved in synthesis of cork components can be detected at such early stages of development, showing the potential of the method to be useful in searching for biomarkers related to cork quality.

  20. Quantitative proteomics analysis of varicose veins: identification of a set of differentially expressed proteins related to ATP generation and utilization.

    PubMed

    Kuo, Chao-Jen; Liang, Shih-Shin; Hsi, Edward; Chiou, Shyh-Horng; Lin, Sin-Daw

    2013-11-01

    Although morphological and anatomical studies indicate that varicose veins are characterized by venous wall weakening and subendothelial fibrosis, the exact underlying biochemical mechanism of their development remains unknown. Additionally, no quantitative proteomic study of venous proteins leading to decreased contractility of varicose veins has been reported to date. Therefore, to elucidate the molecular mechanism of altered vascular contractility, this study performed shotgun proteomic analysis to obtain protein expression profiles in patients with varicose veins. Stable isotope dimethyl labeling coupled with nanoLC-MS/MS revealed downregulation in 12 polypeptides, including myosin light chain kinase, creatine kinase B-type, ATP synthase, phosphoglycerate kinase, and pyruvate kinase. However, analyses of protein species associated with cytoskeletal assembly or with cellular morphology showed no clear up- or down-regulation. These results indicate that defects in ATP generation and utilization may account for the dysfunction of vascular smooth muscle following formation of varicose veins. Collectively, the severity of varicose veins depends on the regulatory roles of various protein factors in the metabolic coordination of physiological functions. This pilot study improves understanding of the pathogenesis of varicose veins and lays the foundation for further validation and clinical translation of biomarkers for targeted therapies in treating this disease. Copyright © 2013. Published by Elsevier B.V.

  1. The differential expression of alternatively polyadenylated transcripts is a common stress-induced response mechanism that modulates mammalian mRNA expression in a quantitative and qualitative fashion

    PubMed Central

    Hollerer, Ina; Curk, Tomaz; Haase, Bettina; Benes, Vladimir; Hauer, Christian; Neu-Yilik, Gabriele; Bhuvanagiri, Madhuri; Hentze, Matthias W.; Kulozik, Andreas E.

    2016-01-01

    Stress adaptation plays a pivotal role in biological processes and requires tight regulation of gene expression. In this study, we explored the effect of cellular stress on mRNA polyadenylation and investigated the implications of regulated polyadenylation site usage on mammalian gene expression. High-confidence polyadenylation site mapping combined with global pre-mRNA and mRNA expression profiling revealed that stress induces an accumulation of genes with differentially expressed polyadenylated mRNA isoforms in human cells. Specifically, stress provokes a global trend in polyadenylation site usage toward decreased utilization of promoter-proximal poly(A) sites in introns or ORFs and increased utilization of promoter-distal polyadenylation sites in intergenic regions. This extensively affects gene expression beyond regulating mRNA abundance by changing mRNA length and by altering the configuration of open reading frames. Our study highlights the impact of post-transcriptional mechanisms on stress-dependent gene regulation and reveals the differential expression of alternatively polyadenylated transcripts as a common stress-induced mechanism in mammalian cells. PMID:27407180

  2. The differential expression of alternatively polyadenylated transcripts is a common stress-induced response mechanism that modulates mammalian mRNA expression in a quantitative and qualitative fashion.

    PubMed

    Hollerer, Ina; Curk, Tomaz; Haase, Bettina; Benes, Vladimir; Hauer, Christian; Neu-Yilik, Gabriele; Bhuvanagiri, Madhuri; Hentze, Matthias W; Kulozik, Andreas E

    2016-09-01

    Stress adaptation plays a pivotal role in biological processes and requires tight regulation of gene expression. In this study, we explored the effect of cellular stress on mRNA polyadenylation and investigated the implications of regulated polyadenylation site usage on mammalian gene expression. High-confidence polyadenylation site mapping combined with global pre-mRNA and mRNA expression profiling revealed that stress induces an accumulation of genes with differentially expressed polyadenylated mRNA isoforms in human cells. Specifically, stress provokes a global trend in polyadenylation site usage toward decreased utilization of promoter-proximal poly(A) sites in introns or ORFs and increased utilization of promoter-distal polyadenylation sites in intergenic regions. This extensively affects gene expression beyond regulating mRNA abundance by changing mRNA length and by altering the configuration of open reading frames. Our study highlights the impact of post-transcriptional mechanisms on stress-dependent gene regulation and reveals the differential expression of alternatively polyadenylated transcripts as a common stress-induced mechanism in mammalian cells. © 2016 Hollerer et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  3. A quantitative assessment of gene expression (QAGE) reveals differential overexpression of DOPEY2, a candidate gene for mental retardation, in Down syndrome brain regions.

    PubMed

    Rachidi, Mohammed; Delezoide, Anne-Lize; Delabar, Jean-Maurice; Lopes, Carmela

    2009-06-01

    The brain alterations and mental retardation in Down syndrome are associated with overdosage of chromosome 21 genes. To shed light on the understanding of the molecular effect of this genetic overdosage, gene expression studies have crucial importance to quantify expression variations in Down syndrome tissues compared to normal ones. Herein, an in situ Quantitative Assessment of Gene Expression (QAGE) was used to quantify and statistically analyze, for the first time, DOPEY2 expression variations in different regions of the Down syndrome human fetal brains and to compare them to corresponding normal brains. DOPEY2, which is localized in the Down Syndrome Critical Region (DSCR) and is a candidate gene for neurological alterations in Down syndrome, showed a delimited regional and cellular expression pattern in the cortex, hippocampus and cerebellum, characterized by different transcriptional intensities in both normal and trisomic brains. DOPEY2 is overexpressed more than 50% (1.79-, 1.97- and 2.12-folds in the cortex, cerebellum and hippocampus, respectively), and showed statistically significant differences in the overexpression ratios in the three brain regions expressing DOPEY2. The demonstration of differential DOPEY2 expression and overexpression in human fetal brains suggests that this gene is submitted to a complex transcriptional control and could depend from other human chromosome 21 genes. Moreover, DOPEY2 overexpression in the brain regions, that are altered in Down syndrome patients and involved in learning and memory processes, is in agreement to the hypothesis that this gene plays a potential role in functional brain alterations and in the pathogenesis of mental retardation in Down syndrome. This new in situ QAGE approach allowed quantitative measurements of transcriptional changes and statistical evaluations of the expression and overexpression patterns of DOPEY2 at specific regions of the brain, which is a complementary approach to qRT-PCR and

  4. Differentially expressed genes of Tetrahymena thermophila in response to tributyltin (TBT) identified by suppression subtractive hybridization and real time quantitative PCR.

    PubMed

    Feng, Lifang; Miao, Wei; Wu, Yuxuan

    2007-02-15

    Tributyltin (TBT) is widely used as antifouling paints, agriculture biocides, and plastic stabilizers around the world, resulting in great pollution problem in aquatic environments. However, it has been short of the biomonitor to detect TBT in freshwater. We constructed the suppression subtractive hybridization library of Tetrahymena thermophila exposed to TBT, and screened out 101 Expressed Sequence Tags whose expressions were significantly up- or down-regulated with TBT treatment. From this, a series of genes related to the TBT toxicity were discovered, such as glutathione-S-transferase gene (down-regulated), plasma membrane Ca2+ ATPase isoforms 3 gene (up-regulated) and NgoA (up-regulated). Furthermore, their expressions under different concentrations of TBT treatment (0.5-40 ppb) were detected by real time fluorescent quantitative PCR. The differentially expressed genes of T. thermophila in response to TBT were identified, which provide the basic to make Tetrahymena as a sensitive, rapid and convenient TBT biomonitor in freshwater based on rDNA inducible expression system.

  5. Quantitative analysis of the mRNA expression levels of BCL2 and BAX genes in human osteoarthritis and normal articular cartilage: An investigation into their differential expression.

    PubMed

    Karaliotas, Georgios I; Mavridis, Konstantinos; Scorilas, Andreas; Babis, George C

    2015-09-01

    Osteoarthritis (OA) is primarily characterized by articular cartilage degeneration and chondrocyte loss. Although the role of apoptosis in cartilage pathobiology remains to be elucidated, the apoptotic B‑cell CLL/lymphoma 2 (BCL2) gene family is considered to be involved in OA. The purpose of the present study was to quantitatively analyze the mRNA expression profiles of the BCL2‑associated X protein (BAX) and BCL2 genes in human OA and in normal cartilage. Cartilage tissue samples were obtained from 78 patients undergoing total knee arthroplasty for OA (OA group) and orthopedic interventions for causes other than OA (control group). Total RNA was isolated from the cartilage tissue specimens and reverse transcribed into cDNA. A highly sensitive and specific reverse transcription quantitative polymerase chain reaction assay was developed for quantification of the mRNA levels of BAX and BCL2, using beta‑2 microglobulin as an endogenous control for normalization purposes. Gene expression analysis was performed using the comparative Ct (2(‑ΔΔCt)) method. The mRNA expression of BAX presented an increasing trend in the OA group compared with the control group, although without statistically significace (P=0.099). By contrast, the expression ratio of BCL2/BAX was found to be significantly decreased (2.76‑fold) in the OA group compared with the normal cartilage control group (P=0.022). A notable 4.6‑fold overexpression of median mRNA levels of BAX was also observed in patients with stage III OA compared with the control (P=0.034), while the BCL2/BAX ratio was markedly (2.5‑fold) decreased (P=0.024). A marked positive correlation was observed between the mRNA levels of BAX and BCL2 in the control group (r(s)=0.728; P<0.001), which was also present in the OA group, although to a lesser degree (r(s)=0.532; P<0.001). These results further implicate apoptosis in the pathogenesis of OA, through molecular mechanisms, which include the aberrant expression of the

  6. Performing statistical analyses on quantitative data in Taverna workflows: An example using R and maxdBrowse to identify differentially-expressed genes from microarray data

    PubMed Central

    Li, Peter; Castrillo, Juan I; Velarde, Giles; Wassink, Ingo; Soiland-Reyes, Stian; Owen, Stuart; Withers, David; Oinn, Tom; Pocock, Matthew R; Goble, Carole A; Oliver, Stephen G; Kell, Douglas B

    2008-01-01

    Background There has been a dramatic increase in the amount of quantitative data derived from the measurement of changes at different levels of biological complexity during the post-genomic era. However, there are a number of issues associated with the use of computational tools employed for the analysis of such data. For example, computational tools such as R and MATLAB require prior knowledge of their programming languages in order to implement statistical analyses on data. Combining two or more tools in an analysis may also be problematic since data may have to be manually copied and pasted between separate user interfaces for each tool. Furthermore, this transfer of data may require a reconciliation step in order for there to be interoperability between computational tools. Results Developments in the Taverna workflow system have enabled pipelines to be constructed and enacted for generic and ad hoc analyses of quantitative data. Here, we present an example of such a workflow involving the statistical identification of differentially-expressed genes from microarray data followed by the annotation of their relationships to cellular processes. This workflow makes use of customised maxdBrowse web services, a system that allows Taverna to query and retrieve gene expression data from the maxdLoad2 microarray database. These data are then analysed by R to identify differentially-expressed genes using the Taverna RShell processor which has been developed for invoking this tool when it has been deployed as a service using the RServe library. In addition, the workflow uses Beanshell scripts to reconcile mismatches of data between services as well as to implement a form of user interaction for selecting subsets of microarray data for analysis as part of the workflow execution. A new plugin system in the Taverna software architecture is demonstrated by the use of renderers for displaying PDF files and CSV formatted data within the Taverna workbench. Conclusion Taverna can

  7. Performing statistical analyses on quantitative data in Taverna workflows: an example using R and maxdBrowse to identify differentially-expressed genes from microarray data.

    PubMed

    Li, Peter; Castrillo, Juan I; Velarde, Giles; Wassink, Ingo; Soiland-Reyes, Stian; Owen, Stuart; Withers, David; Oinn, Tom; Pocock, Matthew R; Goble, Carole A; Oliver, Stephen G; Kell, Douglas B

    2008-08-07

    There has been a dramatic increase in the amount of quantitative data derived from the measurement of changes at different levels of biological complexity during the post-genomic era. However, there are a number of issues associated with the use of computational tools employed for the analysis of such data. For example, computational tools such as R and MATLAB require prior knowledge of their programming languages in order to implement statistical analyses on data. Combining two or more tools in an analysis may also be problematic since data may have to be manually copied and pasted between separate user interfaces for each tool. Furthermore, this transfer of data may require a reconciliation step in order for there to be interoperability between computational tools. Developments in the Taverna workflow system have enabled pipelines to be constructed and enacted for generic and ad hoc analyses of quantitative data. Here, we present an example of such a workflow involving the statistical identification of differentially-expressed genes from microarray data followed by the annotation of their relationships to cellular processes. This workflow makes use of customised maxdBrowse web services, a system that allows Taverna to query and retrieve gene expression data from the maxdLoad2 microarray database. These data are then analysed by R to identify differentially-expressed genes using the Taverna RShell processor which has been developed for invoking this tool when it has been deployed as a service using the RServe library. In addition, the workflow uses Beanshell scripts to reconcile mismatches of data between services as well as to implement a form of user interaction for selecting subsets of microarray data for analysis as part of the workflow execution. A new plugin system in the Taverna software architecture is demonstrated by the use of renderers for displaying PDF files and CSV formatted data within the Taverna workbench. Taverna can be used by data analysis

  8. Mapping quantitative trait loci for expression abundance.

    PubMed

    Jia, Zhenyu; Xu, Shizhong

    2007-05-01

    Mendelian loci that control the expression levels of transcripts are called expression quantitative trait loci (eQTL). When mapping eQTL, we often deal with thousands of expression traits simultaneously, which complicates the statistical model and data analysis. Two simple approaches may be taken in eQTL analysis: (1) individual transcript analysis in which a single expression trait is mapped at a time and the entire eQTL mapping involves separate analysis of thousands of traits and (2) individual marker analysis where differentially expressed transcripts are detected on the basis of their association with the segregation pattern of an individual marker and the entire analysis requires scanning markers of the entire genome. Neither approach is optimal because data are not analyzed jointly. We develop a Bayesian clustering method that analyzes all expressed transcripts and markers jointly in a single model. A transcript may be simultaneously associated with multiple markers. Additionally, a marker may simultaneously alter the expression of multiple transcripts. This is a model-based method that combines a Gaussian mixture of expression data with segregation of multiple linked marker loci. Parameter estimation for each variable is obtained via the posterior mean drawn from a Markov chain Monte Carlo sample. The method allows a regular quantitative trait to be included as an expression trait and subject to the same clustering assignment. If an expression trait links to a locus where a quantitative trait also links, the expressed transcript is considered to be associated with the quantitative trait. The method is applied to a microarray experiment with 60 F(2) mice measured for 25 different obesity-related quantitative traits. In the experiment, approximately 40,000 transcripts and 145 codominant markers are investigated for their associations. A program written in SAS/IML is available from the authors on request.

  9. Quantitative proteomics analysis of differential protein expression and oxidative modification of specific proteins in the brains of old mice.

    PubMed

    Poon, H Fai; Vaishnav, Radhika A; Getchell, Thomas V; Getchell, Marilyn L; Butterfield, D Allan

    2006-07-01

    The brain is susceptible to oxidative stress, which is associated with age-related brain dysfunction, because of its high content of peroxidizable unsaturated fatty acids, high oxygen consumption per unit weight, high content of key components for oxidative damage, and the relative scarcity of antioxidant defense systems. Protein oxidation, which results in functional disruption, is not random but appears to be associated with increased oxidation in specific proteins. By using a proteomics approach, we have compared the protein levels and specific protein carbonyl levels, an index of oxidative damage in the brains of old mice, to these parameters in the brains of young mice and have identified specific proteins that are altered as a function of aging. We show here that the expression levels of dihydropyrimidinase-like 2 (DRP2), alpha-enolase (ENO1), dynamin-1 (DNM1), and lactate dehydrogenase 2 (LDH2) were significantly increased in the brains of old versus young mice; the expression levels of three unidentified proteins were significantly decreased. The specific carbonyl levels of beta-actin (ACTB), glutamine synthase (GS), and neurofilament 66 (NF-66) as well as a novel protein were significantly increased, indicating protein oxidation, in the brains of old versus young mice. These results were validated by immunochemistry. In addition, enzyme activity assays demonstrated that oxidation was associated with decreased GS activity, while the activity of lactate dehydrogenase was unchanged in spite of an up-regulation of LDH2 levels. Several of the up-regulated and oxidized proteins in the brains of old mice identified in this report are known to be oxidized in neurodegenerative diseases as well, suggesting that these proteins may be particularly susceptible to processes associated with neurodegeneration. Our results establish an initial basis for understanding protein alterations that may lead to age-related cellular dysfunction in the brain.

  10. Differential Expression Analysis for Pathways

    PubMed Central

    Haynes, Winston A.; Higdon, Roger; Stanberry, Larissa; Collins, Dwayne; Kolker, Eugene

    2013-01-01

    Life science technologies generate a deluge of data that hold the keys to unlocking the secrets of important biological functions and disease mechanisms. We present DEAP, Differential Expression Analysis for Pathways, which capitalizes on information about biological pathways to identify important regulatory patterns from differential expression data. DEAP makes significant improvements over existing approaches by including information about pathway structure and discovering the most differentially expressed portion of the pathway. On simulated data, DEAP significantly outperformed traditional methods: with high differential expression, DEAP increased power by two orders of magnitude; with very low differential expression, DEAP doubled the power. DEAP performance was illustrated on two different gene and protein expression studies. DEAP discovered fourteen important pathways related to chronic obstructive pulmonary disease and interferon treatment that existing approaches omitted. On the interferon study, DEAP guided focus towards a four protein path within the 26 protein Notch signalling pathway. PMID:23516350

  11. Preliminary Quantitative Profile of Differential Expression between Rat L6 Myoblasts and Myotubes by Stable Isotope Labeling by Amino acids in Cell Culture

    PubMed Central

    Cui, Ziyou; Chen, Xiulan; Lu, Bingwen; Park, Sung Kyu; Xu, Tao; Xie, Zhensheng; Xue, Peng; Hou, Junjie; Hang, Haiying; Yates, John R.; Yang, Fuquan

    2010-01-01

    Defining the mechanisms governing myogenesis has advanced in recent years. Skeletal-muscle differentiation is a multi-step process controlled spatially and temporally by various factors at the transcription level. To explore those factors involved in myogenesis, stable isotope labeling with amino acids in cell culture (SILAC), coupled with high accuracy mass spectrometry (LTQ-Orbitrap), was applied successfully. Rat L6 cell line is an excellent model system for studying muslce myogenesis in vitro. When mononucleate L6 myoblast cells reach confluent in culture plate, they could transform into multinucleate myotubes by serum starvation. By comparing protein expression of L6 myoblasts and terminally differentiated multinucleated myotubes, 1170 proteins were quantified and 379 proteins changed significantly in fully differentiated myotubes in contrast to myoblasts. These differentially expressed proteins are mainly involved in inter-or intracellular signaling, protein synthesis and degradation, protein folding, cell adhesion and extracelluar matrix, cell structure and motility, metabolism, substance transportation, etc. These findings were supported by many previous studies on myogenic differentiation, of which many up-regulated proteins were found to be involved in promoting skeletal muscle differentiation for the first time in our study. In sum, our results provide new clues for understanding the mechanism of myogenesis. PMID:19253283

  12. Quantitative proteomics of fractionated membrane and lumen exosome proteins from isogenic metastatic and nonmetastatic bladder cancer cells reveal differential expression of EMT factors.

    PubMed

    Jeppesen, Dennis Kjølhede; Nawrocki, Arkadiusz; Jensen, Steffen Grann; Thorsen, Kasper; Whitehead, Bradley; Howard, Kenneth A; Dyrskjøt, Lars; Ørntoft, Torben Falck; Larsen, Martin R; Ostenfeld, Marie Stampe

    2014-03-01

    Cancer cells secrete soluble factors and various extracellular vesicles, including exosomes, into their tissue microenvironment. The secretion of exosomes is speculated to facilitate local invasion and metastatic spread. Here, we used an in vivo metastasis model of human bladder carcinoma cell line T24 without metastatic capacity and its two isogenic derivate cell lines SLT4 and FL3, which form metastases in the lungs and liver of mice, respectively. Cultivation in CLAD1000 bioreactors rather than conventional culture flasks resulted in a 13- to 16-fold increased exosome yield and facilitated quantitative proteomics of fractionated exosomes. Exosomes from T24, SLT4, and FL3 cells were partitioned into membrane and luminal fractions and changes in protein abundance related to the gain of metastatic capacity were identified by quantitative iTRAQ proteomics. We identified several proteins linked to epithelial-mesenchymal transition, including increased abundance of vimentin and hepatoma-derived growth factor in the membrane, and casein kinase II α and annexin A2 in the lumen of exosomes, respectively, from metastatic cells. The change in exosome protein abundance correlated little, although significant for FL3 versus T24, with changes in cellular mRNA expression. Our proteomic approach may help identification of proteins in the membrane and lumen of exosomes potentially involved in the metastatic process.

  13. Beef quality with different intramuscular fat content and proteomic analysis using isobaric tag for relative and absolute quantitation of differentially expressed proteins.

    PubMed

    Mao, Yanwei; Hopkins, David L; Zhang, Yimin; Li, Peng; Zhu, Lixian; Dong, Pengcheng; Liang, Rongrong; Dai, Jin; Wang, Xiaoyun; Luo, Xin

    2016-08-01

    Intramuscular fat (IMF) is an important trait for beef eating quality. The mechanism of how IMF is deposited in beef cattle muscle is not clear at the molecular level. The muscle (M. longissimus lumborum: LL) of a group of Xiangxi yellow×Angus cattle with high fat levels (HF), was compared to the muscle of a low fat group (LF). The meat quality and the expressed protein patterns were compared. It was shown that LL from the HF animals had a greater fat content (P<0.05) and lower moisture content (P<0.05) than LL from LF animals. Forty seven sarcoplasmic proteins were differentially expressed and identified between the two groups. These proteins are involved in 6 molecular functions and 16 biological processes, and affect the Mitogen-activated protein kinases pathway, insulin pathway and c-Jun N-terminal kinases leading to greater IMF deposition. Cattle in the HF group had greater oxidative capacity and lower glycolytic levels suggesting a greater energetic efficiency. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Differential gene expression in glaucoma.

    PubMed

    Jakobs, Tatjana C

    2014-07-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  15. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.

    2014-01-01

    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  16. Differential Aminoacylase Expression in Neuroblastoma

    PubMed Central

    Long, Patrick M.; Stradecki, Holly M.; Minturn, Jane E.; Wesley, Umadevi V.; Jaworski, Diane M.

    2012-01-01

    Neuroblastoma, a cancer of the sympathetic nervous system, is the most common extracranial solid tumor in children. MYCN amplification and increased BDNF/TrkB signaling are features of high-risk tumors; yet, only ~25% of malignant tumors display these features. Thus, the identification of additional biomarkers and therapeutic targets is essential. Since aminoacylase 1 (ACY1), an amino acid deacetylase, is a putative tumor suppressor in small cell lung and renal cell carcinomas, we investigated whether it or the other family members aspartoacylase (ASPA, aminoacylase 2) or aminoacylase 3 (ACY3) could serve a similar function in neuroblastoma. Aminoacylase expression was examined in TrkB-positive, MYCN-amplified (SMS-KCNR and SK-N-BE) and TrkB-negative, non-MYCN amplified (SK-N-AS, SK-N-SH, SH-SY5Y, and SH-EP) neuroblastoma cell lines. Each aminoacylase exhibited distinct spatial localization (i.e., cytosolic ACY1, membrane-associated ASPA, and nuclear ACY3). When SK-N-SH cells were treated with neural differentiation agents (e.g., retinoic acid, cAMP) in media containing 10% serum ACY1 was the only aminoacylase whose expression was up-regulated. ASPA was primarily expressed in SH-EP cells of a glial sublineage. ACY3 was more highly expressed in the TrkB-positive, MYCN-amplified lines. All three aminoacylases were expressed in normal human adrenal gland, a common site of neuroblastoma origin, but only ACY1 and ACY3 displayed detectable expression in primary neuroblastoma tumor. Bioinformatics data mining of Kaplan-Meier survival revealed that high ACY3 expression is correlated with poor prognosis; while, low expression of ACY1 or ASPA is correlated with poor prognosis. These data suggest that aminoacylase expression is dysregulated in neuroblastoma. PMID:21128244

  17. Quantitative susceptibility mapping differentiates between parkinsonian disorders.

    PubMed

    Sjöström, Henrik; Granberg, Tobias; Westman, Eric; Svenningsson, Per

    2017-09-01

    It is often challenging to clinically distinguish between Parkinson's disease (PD), multiple system atrophy (MSA) and progressive supranuclear palsy (PSP). Quantitative susceptibility mapping (QSM) is an accurate indirect method for estimating brain iron levels in vivo. This method has yet to be applied in atypical parkinsonism. We aimed to investigate differences in brain iron accumulation parkinsonian disorders and healthy controls using QSM. 15 patients with PSP, 11 patients with MSA, 62 patients with PD and 14 healthy controls were included in the study and their phase and magnitude data from susceptibility-weighted magnetic resonance imaging were retrospectively analyzed with an in-house pipeline to create susceptibility maps. Two-way ANCOVA were used to assess group differences. Pairwise comparisons within the ANCOVA were corrected for multiple comparisons. Red nucleus susceptibility was higher in PSP compared with PD (p < 0.001), MSA (p < 0.001) and controls (p < 0.001), which separated PSP from these groups with areas under receiver operating characteristic curve of 0.97, 0.75 and 0.98 respectively. PSP showed higher globus pallidus susceptibility compared with PD (p < 0.001), MSA (p = 0.006) and controls (p < 0.001). Putamen susceptibility was higher in MSA than in PD (p = 0.022) and controls (p = 0.026). Substantia nigra susceptibility was increased in PD compared to controls (p = 0.030). We show that all studied parkinsonian disorders have increased susceptibility subcortically, reflecting distinct topographical patterns of abnormal brain iron accumulation. QSM, particularly of the red nucleus, is a promising biomarker in differentiating parkinsonian disorders, and would be interesting to study longitudinally for monitoring disease progression and treatment effects. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. DNA microarray analysis of genes differentially expressed in adipocyte differentiation.

    PubMed

    Yin, Chunyan; Xiao, Yanfeng; Zhang, Wei; Xu, Erdi; Liu, Weihua; Yi, Xiaoqing; Chang, Ming

    2014-06-01

    In the present study, the human liposarcoma cell line SW872 was used to identify global changes in gene expression profiles occurring during adipogenesis. We further explored some of the genes expressed during the late phase of adipocyte differentiation. These genes may play a major role in promoting excessive proliferation and accumulation of lipid droplets, which contribute to the development of obesity. By using microarray-based technology, we examined differential gene expression in early differentiated adipocytes and late differentiated adipocytes. Validated genes exhibited a greater than or equal to 10-fold increase in the late phase of adipocyte differentiation by polymerase chain reaction (RT-PCR). Compared with undifferentiated preadipocytes, we found that 763 genes were increased in early differentiated adipocytes, and 667 genes were increased in later differentiated adipocytes. Furthermore, 21 genes were found being expressed 10-fold higher in the late phase of adipocyte differentiation. The results were in accordance with the RTPCR test, which validated 11 genes, namely, CIDEC, PID1, LYRM1, ADD1, PPAR?2, ANGPTL4, ADIPOQ, ACOX1, FIP1L1, MAP3K2 and PEX14. Most of these genes were found being expressed in the later phase of adipocyte differentiation involved in obesity-related diseases. The findings may help to better understand the mechanism of obesity and related diseases.

  19. Uncovering stem cell differentiation factors for salivary gland regeneration by quantitative analysis of differential proteomes

    PubMed Central

    Park, Yun-Jong; Koh, Jin; Kwon, Jin Teak; Park, Yong-Seok; Yang, Lijun; Cha, Seunghee

    2017-01-01

    Severe xerostomia (dry mouth) compromises the quality of life in patients with Sjögren’s syndrome or radiation therapy for head and neck cancer. A clinical management of xerostomia is often unsatisfactory as most interventions are palliative with limited efficacy. Following up our previous study demonstrating that mouse BM-MSCs are capable of differentiating into salivary epithelial cells in a co-culture system, we further explored the molecular basis that governs the MSC reprogramming by utilizing high-throughput iTRAQ-2D-LC-MS/MS-based proteomics. Our data revealed the novel induction of pancreas-specific transcription factor 1a (PTF1α), muscle, intestine and stomach expression-1 (MIST-1), and achaete-scute complex homolog 3 (ASCL3) in 7 day co-cultured MSCs but not in control MSCs. More importantly, a common notion of pancreatic-specific expression of PTF1 α was challenged for the first time by our verification of PTF1 α expression in the mouse salivary glands. Furthermore, a molecular network simulation of our selected putative MSC reprogramming factors demonstrated evidence for their perspective roles in salivary gland development. In conclusion, quantitative proteomics with extensive data analyses narrowed down a set of MSC reprograming factors potentially contributing to salivary gland regeneration. Identification of their differential/synergistic impact on MSC conversion warrants further investigation. PMID:28158262

  20. Uncovering stem cell differentiation factors for salivary gland regeneration by quantitative analysis of differential proteomes.

    PubMed

    Park, Yun-Jong; Koh, Jin; Kwon, Jin Teak; Park, Yong-Seok; Yang, Lijun; Cha, Seunghee

    2017-01-01

    Severe xerostomia (dry mouth) compromises the quality of life in patients with Sjögren's syndrome or radiation therapy for head and neck cancer. A clinical management of xerostomia is often unsatisfactory as most interventions are palliative with limited efficacy. Following up our previous study demonstrating that mouse BM-MSCs are capable of differentiating into salivary epithelial cells in a co-culture system, we further explored the molecular basis that governs the MSC reprogramming by utilizing high-throughput iTRAQ-2D-LC-MS/MS-based proteomics. Our data revealed the novel induction of pancreas-specific transcription factor 1a (PTF1α), muscle, intestine and stomach expression-1 (MIST-1), and achaete-scute complex homolog 3 (ASCL3) in 7 day co-cultured MSCs but not in control MSCs. More importantly, a common notion of pancreatic-specific expression of PTF1 α was challenged for the first time by our verification of PTF1 α expression in the mouse salivary glands. Furthermore, a molecular network simulation of our selected putative MSC reprogramming factors demonstrated evidence for their perspective roles in salivary gland development. In conclusion, quantitative proteomics with extensive data analyses narrowed down a set of MSC reprograming factors potentially contributing to salivary gland regeneration. Identification of their differential/synergistic impact on MSC conversion warrants further investigation.

  1. Genetic complexity at expression quantitative trait loci.

    PubMed

    Cantor, Rita M; Pan, Calvin; Siegmund, Kimberly

    2016-01-01

    Identifying variants that regulate gene expression and delineating their genetic architecture is a critical next step in our endeavors to better understand the genetic etiology of complex diseases. The appropriate genomic tools are in place, and preliminary analytic strategies have been developed. Here we used Genetic Analysis Workshop (GAW) 19 data to investigate the genetic complexity of expression quantitative trait loci (eQTL), chromosomal regions likely to harbor regulatory elements responsible for gene expression. For this investigation, we analyzed the lymphocyte expression profiles of 653 individuals in 20 pedigrees who were also genotyped by single nucleotide polymorphism (SNP) arrays, followed by sequencing and imputation. We used these data to examine the degree of allelic heterogeneity, a contributor to genetic complexity at eQTL, by sequentially conditioning on the most significantly associated SNPs. SOLAR (Sequential Oligogenic Linkage Analysis Routines)-MGA (measured genotype approach) and FaST-LMM (Factored Spectrally Transformed Linear Mixed Model) software allowed us to analyze pedigree data. The power and Type 1 error rates for single SNP association testing and multiple SNP sequential association testing were consistent for these programs. Sequential conditioning of the real expression data revealed substantial levels of allelic heterogeneity at the 2 eQTL examined, illustrating this feature of genetic complexity. eQTL exhibit substantial genetic complexity among and within pedigrees.

  2. Identification of quantitative trait loci affecting ectomycorrhizal symbiosis in an interspecific F1 poplar cross and differential expression of genes in ectomycorrhizas of the two parents: Populus deltoides and Populus trichocarpa

    SciTech Connect

    Labbe, Jessy L; Jorge, Veronique; Vion, Patrice; Marcais, Benoit; Bastien, Catherine; Tuskan, Gerald A; Martin, Francis; Le Tacon, F

    2011-01-01

    A Populus deltoides Populus trichocarpa F1 pedigree was analyzed for quantitative trait loci (QTLs) affecting ectomycorrhizal development and for microarray characterization of gene networks involved in this symbiosis. A 300 genotype progeny set was evaluated for its ability to form ectomycorrhiza with the basidiomycete Laccaria bicolor. The percentage of mycorrhizal root tips was determined on the root systems of all 300 progeny and their two parents. QTL analysis identified four significant QTLs, one on the P. deltoides and three on the P. trichocarpa genetic maps. These QTLs were aligned to the P. trichocarpa genome and each contained several megabases and encompass numerous genes. NimbleGen whole-genome microarray, using cDNA from RNA extracts of ectomycorrhizal root tips from the parental genotypes P. trichocarpa and P. deltoides, was used to narrow the candidate gene list. Among the 1,543 differentially expressed genes (p value 0.05; 5.0-fold change in transcript level) having different transcript levels in mycorrhiza of the two parents, 41 transcripts were located in the QTL intervals: 20 in Myc_d1, 14 in Myc_t1, and seven in Myc_t2, while no significant differences among transcripts were found in Myc_t3. Among these 41 transcripts, 25 were overrepresented in P. deltoides relative to P. trichocarpa; 16 were overrepresented in P. trichocarpa. The transcript showing the highest overrepresentation in P. trichocarpa mycorrhiza libraries compared to P. deltoides mycorrhiza codes for an ethylene-sensitive EREBP-4 protein which may repress defense mechanisms in P. trichocarpa while the highest overrepresented transcripts in P. deltoides code for proteins/genes typically associated with pathogen resistance.

  3. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.

    2009-01-01

    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  4. Differential media for quantitative recovery of waterborne Aeromonas hydrophila.

    PubMed

    Handfield, M; Simard, P; Letarte, R

    1996-09-01

    Because of the ubiquity of Aeromonas spp., their prevalence in drinking water, and the increasing number of reports on Aeromonas sp.-related infections, a standard method for routine and quantitative recovery had to be defined. On the basis of a survey of 10 media for recovery analysis and subsequent differentiation assays in mixed cultures, we conclude that ampicillin-dextrin agar performed the best for the recovery of Aeromonas spp. in drinking water and the differentiation by simple criteria of that genus from other common waterborne bacteria.

  5. Differential media for quantitative recovery of waterborne Aeromonas hydrophila.

    PubMed Central

    Handfield, M; Simard, P; Letarte, R

    1996-01-01

    Because of the ubiquity of Aeromonas spp., their prevalence in drinking water, and the increasing number of reports on Aeromonas sp.-related infections, a standard method for routine and quantitative recovery had to be defined. On the basis of a survey of 10 media for recovery analysis and subsequent differentiation assays in mixed cultures, we conclude that ampicillin-dextrin agar performed the best for the recovery of Aeromonas spp. in drinking water and the differentiation by simple criteria of that genus from other common waterborne bacteria. PMID:8795251

  6. Quantitative phosphoproteome analysis of embryonic stem cell differentiation toward blood

    PubMed Central

    Piazzi, Manuela; Williamson, Andrew; Lee, Chia-Fang; Pearson, Stella; Lacaud, Georges; Kouskoff, Valerie; McCubrey, James A.; Cocco, Lucio; Whetton, Anthony D.

    2015-01-01

    Murine embryonic stem (ES) cells can differentiate in vitro into three germ layers (endodermic, mesodermic, ectodermic). Studies on the differentiation of these cells to specific early differentiation stages has been aided by an ES cell line carrying the Green Fluorescent Protein (GFP) targeted to the Brachyury (Bry) locus which marks mesoderm commitment. Furthermore, expression of the Vascular Endothelial Growth Factor receptor 2 (Flk1) along with Bry defines hemangioblast commitment. Isobaric-tag for relative and absolute quantification (iTRAQTM) and phosphopeptide enrichment coupled to liquid chromatography separation and mass spectrometry allow the study of phosphorylation changes occurring at different stages of ES cell development using Bry and Flk1 expression respectively. We identified and relatively quantified 37 phosphoentities which are modulated during mesoderm-induced ES cells differentiation, comparing epiblast-like, early mesoderm and hemangioblast-enriched cells. Among the proteins differentially phosphorylated toward mesoderm differentiation were: the epigenetic regulator Dnmt3b, the protein kinase GSK3b, the chromatin remodeling factor Smarcc1, the transcription factor Utf1; as well as protein specifically related to stem cell differentiation, as Eomes, Hmga2, Ints1 and Rif1. As most key factors regulating early hematopoietic development have also been implicated in various types of leukemia, understanding the post-translational modifications driving their regulation during normal development could result in a better comprehension of their roles during abnormal hematopoiesis in leukemia. PMID:25890499

  7. Quantitative proteome analysis of colorectal cancer-related differential proteins.

    PubMed

    Zhang, Yanbin; Liu, Yue; Ye, Yingjiang; Shen, Danhua; Zhang, Hui; Huang, Hongyan; Li, Sha; Wang, Shan; Ren, Jun

    2017-02-01

    To evaluate a new strategy for profiling proteomic changes in colorectal cancer (CRC). We used laser capture microdissection (LCM) to obtain cells from 20 CRC and paired normal mucosal tissues. The differential proteins between the microdissected tumor cells and normal mucosa epithelia were analyzed by acetylation stable isotopic labeling coupled with L linear ion trap Fourier transform ion cyclotron resonance mass spectrometry (LTQ-FT MS). Western blotting was used to assess the differential expression of proteins. We used bioinformatics tools for cluster and ingenuity pathway analysis of the differential proteins. In total, 798 confident proteins were quantified and 137 proteins were differentially expressed by at least twofold, including 67 that were upregulated and 70 that were downregulated in cancer. Two differential proteins, solute carrier family 12 member 2 (SLC12A2) and Ras-related protein Rab-10, were validated by Western blotting, and the results were consistent with acetylation stable isotopic labeling analysis. According to gene ontology analysis, CRC-related differential proteins covered a wide range of subcellular locations and were involved in many biological processes. According to ingenuity pathway analysis of the differential proteins, the most relevant canonical pathway associated with CRC was the 14-3-3-mediated signaling pathway, and seven reliable functional networks including cellular growth and proliferation, amino acid metabolism, inflammatory response, embryonic development, carbohydrate metabolism, cellular assembly and organization, and cell morphology were obtained. Combination of LCM, acetylation stable isotopic labeling analysis and LTQ-FT MS is effective for profiling proteomic changes in CRC cells.

  8. Differential expression of microRNAs in mouse embryonic bladder

    SciTech Connect

    Liu, Benchun; Cunha, Gerald R.; Baskin, Laurence S.

    2009-08-07

    MicroRNAs (miRNAs) are involved in several biological processes including development, differentiation and proliferation. Analysis of miRNA expression patterns in the process of embryogenesis may have substantial value in determining the mechanism of embryonic bladder development as well as for eventual therapeutic intervention. The miRNA expression profiles are distinct among the cellular types and embryonic stages as demonstrated by microarray technology and validated by quantitative real-time RT-PCR approach. Remarkably, the miRNA expression patterns suggested that unique miRNAs from epithelial and submucosal areas are responsible for mesenchymal cellular differentiation, especially regarding bladder smooth muscle cells. Our data show that miRNA expression patterns are unique in particular cell types of mouse bladder at specific developmental stages, reflecting the apparent lineage and differentiation status within the embryonic bladder. The identification of unique miRNAs expression before and after smooth muscle differentiation in site-specific area of the bladder indicates their roles in embryogenesis and may aid in future clinical intervention.

  9. In vitro quantitative and relative gene expression analysis of pancreatic transcription factors Pdx-1, Ngn-3, Isl-1, Pax-4, Pax-6 and Nkx-6.1 in trans-differentiated human hepatic progenitors.

    PubMed

    Vishwakarma, Sandeep Kumar; Rahamathulla, Syed; Bardia, Avinash; Tiwari, Santosh K; Srinivas, Gunda; Raj, Avinash; Tripura, Chaturvedula; Sandhya, Annamaneni; Habeeb, Mohammed Aejaz; Khan, Aleem A; Pande, Gopal; Reddy, K Pratap; Reddy, P Yugandhar

    2014-09-01

    Diabetes is a major health concern throughout the world because of its increasing prevalence in epidemic proportions. β-Cell deterioration in the pancreas is a crucial factor for the progression of diabetes mellitus. Therefore, the restoration of β-cell mass and its function is of vital importance for the development of effective therapeutic strategies and most accessible cell sources for the treatment of diabetes mellitus. Human fetuses (12-20 weeks gestation age) were used to isolate human hepatic progenitor cells (hHPCs) from fetal liver using a two-step collagenase digestion method. Epithelial cell adhesion molecule-positive (EpCAM+ve)-enriched hHPCs were cultured in vitro and induced with 5-30 mmol/L concentration of glucose for 0-32 h. Pdx-1 expression and insulin secretion was analyzed using immunophenotypic and chemifluorescence assays, respectively. Relative gene expression was quantified in induced hHPCs, and compared with uninduced and pancreatic cells to identify the activated transcription factors (Pdx-1, Ngn-3, Isl-1, Pax-4, Pax-6 and Nkx-6.1) involved in β-cell production. EpCAM+ve cells derived from human fetal liver showed high in vitro trans-differentiation potential towards the β-cell phenotype with 23 mmol/L glucose induction after 24 h. The transcription factors showed eminent expression in induced cells. The expression level of transcription factors was found significantly high in 23 mmol/L-induced hHPCs as compared with the uninduced cells. The present study has shown an exciting new insight into β-cell development from hHPCs trans-differentiation. Relative quantification of gene expression in trans-differentiated cells offers vast possibility for the production of a maximum number of functionally active pancreatic β-cells for a future cure of diabetes.

  10. From inverse problems in mathematical physiology to quantitative differential diagnoses.

    PubMed

    Zenker, Sven; Rubin, Jonathan; Clermont, Gilles

    2007-11-01

    The improved capacity to acquire quantitative data in a clinical setting has generally failed to improve outcomes in acutely ill patients, suggesting a need for advances in computer-supported data interpretation and decision making. In particular, the application of mathematical models of experimentally elucidated physiological mechanisms could augment the interpretation of quantitative, patient-specific information and help to better target therapy. Yet, such models are typically complex and nonlinear, a reality that often precludes the identification of unique parameters and states of the model that best represent available data. Hypothesizing that this non-uniqueness can convey useful information, we implemented a simplified simulation of a common differential diagnostic process (hypotension in an acute care setting), using a combination of a mathematical model of the cardiovascular system, a stochastic measurement model, and Bayesian inference techniques to quantify parameter and state uncertainty. The output of this procedure is a probability density function on the space of model parameters and initial conditions for a particular patient, based on prior population information together with patient-specific clinical observations. We show that multimodal posterior probability density functions arise naturally, even when unimodal and uninformative priors are used. The peaks of these densities correspond to clinically relevant differential diagnoses and can, in the simplified simulation setting, be constrained to a single diagnosis by assimilating additional observations from dynamical interventions (e.g., fluid challenge). We conclude that the ill-posedness of the inverse problem in quantitative physiology is not merely a technical obstacle, but rather reflects clinical reality and, when addressed adequately in the solution process, provides a novel link between mathematically described physiological knowledge and the clinical concept of differential diagnoses

  11. Introducing Knowledge into Differential Expression Analysis

    PubMed Central

    Biecek, Przemysław; Tiuryn, Jerzy; Vingron, Martin

    2010-01-01

    Abstract Gene expression measurements allow determining sets of up- or down-regulated, or unchanged genes in a particular experimental condition. Additional biological knowledge can suggest examples of genes from one of these sets. For instance, known target genes of a transcriptional activator are expected, but are not certain to go down after this activator is knocked out. Available differential expression analysis tools do not take such imprecise examples into account. Here we put forward a novel partially supervised mixture modeling methodology for differential expression analysis. Our approach, guided by imprecise examples, clusters expression data into differentially expressed and unchanged genes. The partially supervised methodology is implemented by two methods: a newly introduced belief-based mixture modeling, and soft-label mixture modeling, a method proved efficient in other applications. We investigate on synthetic data the input example settings favorable for each method. In our tests, both belief-based and soft-label methods prove their advantage over semi-supervised mixture modeling in correcting for erroneous examples. We also compare them to alternative differential expression analysis approaches, showing that incorporation of knowledge yields better performance. We present a broad range of knowledge sources and data to which our partially supervised methodology can be applied. First, we determine targets of Ste12 based on yeast knockout data, guided by a Ste12 DNA-binding experiment. Second, we distinguish miR-1 from miR-124 targets in human by clustering expression data under transfection experiments of both microRNAs, using their computationally predicted targets as examples. Finally, we utilize literature knowledge to improve clustering of time-course expression profiles. PMID:20726790

  12. Transcriptome study of differential expression in schizophrenia

    PubMed Central

    Sanders, Alan R.; Göring, Harald H. H.; Duan, Jubao; Drigalenko, Eugene I.; Moy, Winton; Freda, Jessica; He, Deli; Shi, Jianxin; Gejman, Pablo V.

    2013-01-01

    Schizophrenia genome-wide association studies (GWAS) have identified common SNPs, rare copy number variants (CNVs) and a large polygenic contribution to illness risk, but biological mechanisms remain unclear. Bioinformatic analyses of significantly associated genetic variants point to a large role for regulatory variants. To identify gene expression abnormalities in schizophrenia, we generated whole-genome gene expression profiles using microarrays on lymphoblastoid cell lines (LCLs) from 413 cases and 446 controls. Regression analysis identified 95 transcripts differentially expressed by affection status at a genome-wide false discovery rate (FDR) of 0.05, while simultaneously controlling for confounding effects. These transcripts represented 89 genes with functions such as neurotransmission, gene regulation, cell cycle progression, differentiation, apoptosis, microRNA (miRNA) processing and immunity. This functional diversity is consistent with schizophrenia's likely significant pathophysiological heterogeneity. The overall enrichment of immune-related genes among those differentially expressed by affection status is consistent with hypothesized immune contributions to schizophrenia risk. The observed differential expression of extended major histocompatibility complex (xMHC) region histones (HIST1H2BD, HIST1H2BC, HIST1H2BH, HIST1H2BG and HIST1H4K) converges with the genetic evidence from GWAS, which find the xMHC to be the most significant susceptibility locus. Among the differentially expressed immune-related genes, B3GNT2 is implicated in autoimmune disorders previously tied to schizophrenia risk (rheumatoid arthritis and Graves’ disease), and DICER1 is pivotal in miRNA processing potentially linking to miRNA alterations in schizophrenia (e.g. MIR137, the second strongest GWAS finding). Our analysis provides novel candidate genes for further study to assess their potential contribution to schizophrenia. PMID:23904455

  13. Quantitative proteomic analysis for high-throughput screening of differential glycoproteins in hepatocellular carcinoma serum

    PubMed Central

    Gao, Hua-Jun; Chen, Ya-Jing; Zuo, Duo; Xiao, Ming-Ming; Li, Ying; Guo, Hua; Zhang, Ning; Chen, Rui-Bing

    2015-01-01

    Objective Hepatocellular carcinoma (HCC) is a leading cause of cancer-related deaths. Novel serum biomarkers are required to increase the sensitivity and specificity of serum screening for early HCC diagnosis. This study employed a quantitative proteomic strategy to analyze the differential expression of serum glycoproteins between HCC and normal control serum samples. Methods Lectin affinity chromatography (LAC) was used to enrich glycoproteins from the serum samples. Quantitative mass spectrometric analysis combined with stable isotope dimethyl labeling and 2D liquid chromatography (LC) separations were performed to examine the differential levels of the detected proteins between HCC and control serum samples. Western blot was used to analyze the differential expression levels of the three serum proteins. Results A total of 2,280 protein groups were identified in the serum samples from HCC patients by using the 2D LC-MS/MS method. Up to 36 proteins were up-regulated in the HCC serum, whereas 19 proteins were down-regulated. Three differential glycoproteins, namely, fibrinogen gamma chain (FGG), FOS-like antigen 2 (FOSL2), and α-1,6-mannosylglycoprotein 6-β-N-acetylglucosaminyltransferase B (MGAT5B) were validated by Western blot. All these three proteins were up-regulated in the HCC serum samples. Conclusion A quantitative glycoproteomic method was established and proven useful to determine potential novel biomarkers for HCC. PMID:26487969

  14. IAA8 expression during vascular cell differentiation

    Treesearch

    Andrew T. Groover; Amy Pattishall; Alan M. Jones

    2003-01-01

    We report the characterization of a member of the auxin-induced IAA gene family from zinnia, designated zIAA8, which is expressed by mesophyll cells differentiating as tracheary elements in vitro. Transcription of zIAA8 is upregulated within 3 h after cell isolation in inductive medium,...

  15. OakContigDF159.1, a reference library for studying differential gene expression in Quercus robur during controlled biotic interactions: use for quantitative transcriptomic profiling of oak roots in ectomycorrhizal symbiosis.

    PubMed

    Tarkka, Mika T; Herrmann, Sylvie; Wubet, Tesfaye; Feldhahn, Lasse; Recht, Sabine; Kurth, Florence; Mailänder, Sarah; Bönn, Markus; Neef, Maren; Angay, Oguzhan; Bacht, Michael; Graf, Marcel; Maboreke, Hazel; Fleischmann, Frank; Grams, Thorsten E E; Ruess, Liliane; Schädler, Martin; Brandl, Roland; Scheu, Stefan; Schrey, Silvia D; Grosse, Ivo; Buscot, François

    2013-07-01

    Oaks (Quercus spp.), which are major forest trees in the northern hemisphere, host many biotic interactions, but molecular investigation of these interactions is limited by fragmentary genome data. To date, only 75 oak expressed sequence tags (ESTs) have been characterized in ectomycorrhizal (EM) symbioses. We synthesized seven beneficial and detrimental biotic interactions between microorganisms and animals and a clone (DF159) of Quercus robur. Sixteen 454 and eight Illumina cDNA libraries from leaves and roots were prepared and merged to establish a reference for RNA-Seq transcriptomic analysis of oak EMs with Piloderma croceum. Using the Mimicking Intelligent Read Assembly (MIRA) and Trinity assembler, the OakContigDF159.1 hybrid assembly, containing 65 712 contigs with a mean length of 1003 bp, was constructed, giving broad coverage of metabolic pathways. This allowed us to identify 3018 oak contigs that were differentially expressed in EMs, with genes encoding proline-rich cell wall proteins and ethylene signalling-related transcription factors showing up-regulation while auxin and defence-related genes were down-regulated. In addition to the first report of remorin expression in EMs, the extensive coverage provided by the study permitted detection of differential regulation within large gene families (nitrogen, phosphorus and sugar transporters, aquaporins). This might indicate specific mechanisms of genome regulation in oak EMs compared with other trees.

  16. Differential gene detection incorporating common expression patterns

    NASA Astrophysics Data System (ADS)

    Oba, Shigeyuki; Ishii, Shin

    2009-12-01

    In detection of differentially expressed (DE) genes between different groups of samples based on a high-throughput expression measurement system, we often use a classical statistical testing based on a simple assumption that the expression of a certain DE gene in one group is higher or lower in average than that in the other group. Based on this simple assumption, the theory of optimal discovery procedure (ODP) (Storey, 2005) provided an optimal thresholding function for DE gene detection. However, expression patterns of DE genes over samples may have such a structure that is not exactly consistent with group labels assigned to the samples. Appropriate treatment of such a structure can increase the detection ability. Namely, genes showing similar expression patterns to other biologically meaningful genes can be regarded as statistically more significant than those showing expression patterns independent of other genes, even if differences in mean expression levels are comparable. In this study, we propose a new statistical thresholding function based on a latent variable model incorporating expression patterns together with the ODP theory. The latent variable model assumes hidden common signals behind expression patterns over samples and the ODP theory is extended to involve the latent variables. When applied to several gene expression data matrices which include cluster structures or 'cancer outlier' structures, the newly-proposed thresholding functions showed prominently better detection performance of DE genes than the original ODP thresholding function did. We also demonstrate how the proposed methods behave through analyses of real breast cancer and lymphoma datasets.

  17. Expression of dystrophin Dp71 during PC12 cell differentiation.

    PubMed

    Cisneros, B; Rendon, A; Genty, V; Aranda, G; Marquez, F; Mornet, D; Montañez, C

    1996-08-02

    The expression of dystrophin-protein 71 (Dp71) was investigated during nerve growth factor (NGF) induced differentiation of PC12 cells. A semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) assay was designed to measure Dp71 mRNA, whereas the Dp71 protein amount was evaluated by immunoblot analysis using an anti-dystrophin monoclonal antibody. Comparison with control cultures showed that Dp71 mRNA and protein levels increased in parallel with NGF treatment peaking with increments of 60% and 1.4 times, respectively. The upregulation of Dp71 expression during PC12 cells differentiation point at PC12 cells as a suitable model for studying the function of Dp71 in neuronal cells.

  18. Quantitative Proteomics Uncovers Novel Factors Involved in Developmental Differentiation of Trypanosoma brucei

    PubMed Central

    Dejung, Mario; Subota, Ines; Bucerius, Ferdinand; Dindar, Gülcin; Freiwald, Anja; Engstler, Markus; Boshart, Michael; Butter, Falk; Janzen, Christian J.

    2016-01-01

    Developmental differentiation is a universal biological process that allows cells to adapt to different environments to perform specific functions. African trypanosomes progress through a tightly regulated life cycle in order to survive in different host environments when they shuttle between an insect vector and a vertebrate host. Transcriptomics has been useful to gain insight into RNA changes during stage transitions; however, RNA levels are only a moderate proxy for protein abundance in trypanosomes. We quantified 4270 protein groups during stage differentiation from the mammalian-infective to the insect form and provide classification for their expression profiles during development. Our label-free quantitative proteomics study revealed previously unknown components of the differentiation machinery that are involved in essential biological processes such as signaling, posttranslational protein modifications, trafficking and nuclear transport. Furthermore, guided by our proteomic survey, we identified the cause of the previously observed differentiation impairment in the histone methyltransferase DOT1B knock-out strain as it is required for accurate karyokinesis in the first cell division during differentiation. This epigenetic regulator is likely involved in essential chromatin restructuring during developmental differentiation, which might also be important for differentiation in higher eukaryotic cells. Our proteome dataset will serve as a resource for detailed investigations of cell differentiation to shed more light on the molecular mechanisms of this process in trypanosomes and other eukaryotes. PMID:26910529

  19. Quantitative Proteomics Uncovers Novel Factors Involved in Developmental Differentiation of Trypanosoma brucei.

    PubMed

    Dejung, Mario; Subota, Ines; Bucerius, Ferdinand; Dindar, Gülcin; Freiwald, Anja; Engstler, Markus; Boshart, Michael; Butter, Falk; Janzen, Christian J

    2016-02-01

    Developmental differentiation is a universal biological process that allows cells to adapt to different environments to perform specific functions. African trypanosomes progress through a tightly regulated life cycle in order to survive in different host environments when they shuttle between an insect vector and a vertebrate host. Transcriptomics has been useful to gain insight into RNA changes during stage transitions; however, RNA levels are only a moderate proxy for protein abundance in trypanosomes. We quantified 4270 protein groups during stage differentiation from the mammalian-infective to the insect form and provide classification for their expression profiles during development. Our label-free quantitative proteomics study revealed previously unknown components of the differentiation machinery that are involved in essential biological processes such as signaling, posttranslational protein modifications, trafficking and nuclear transport. Furthermore, guided by our proteomic survey, we identified the cause of the previously observed differentiation impairment in the histone methyltransferase DOT1B knock-out strain as it is required for accurate karyokinesis in the first cell division during differentiation. This epigenetic regulator is likely involved in essential chromatin restructuring during developmental differentiation, which might also be important for differentiation in higher eukaryotic cells. Our proteome dataset will serve as a resource for detailed investigations of cell differentiation to shed more light on the molecular mechanisms of this process in trypanosomes and other eukaryotes.

  20. Differentiation among parkinsonisms using quantitative diffusion kurtosis imaging.

    PubMed

    Ito, Kenji; Sasaki, Makoto; Ohtsuka, Chigumi; Yokosawa, Suguru; Harada, Taisuke; Uwano, Ikuko; Yamashita, Fumio; Higuchi, Satomi; Terayama, Yasuo

    2015-03-25

    Differential diagnoses among Parkinson's disease (PD), multiple system atrophy (MSA), and progressive supranuclear palsy syndrome (PSPS) are often difficult. Hence, we investigated whether diffusion kurtosis imaging (DKI) could detect pathological changes that occur in these disorders and be used to differentiate between such patients. Fourteen patients (five with PD, four MSA, and five PSPS) and six healthy controls were examined using a 1.5-T scanner. Mean kurtosis (MK), fractional anisotropy, and mean diffusivity maps were generated, and these values of the midbrain tegmentum (MBT) and pontine crossing tract (PCT), as well as MBT/PCT ratios, were obtained. We found no significant differences in MBT and PCT values on DKI maps among the groups. In contrast, MBT/PCT ratios from MK maps were significantly increased in the MSA group and decreased in the PSPS group compared with the other groups. MBT/PCT ratios from mean diffusivity maps showed a significant increase in the PSPS group. Therefore, quantitative DKI analyses, particularly the MBT/PCT ratio from MK maps, can differentiate patients with parkinsonisms. Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.

  1. Identification of differentially expressed genes associated with differential body size in mandarin fish (Siniperca chuatsi).

    PubMed

    Tian, Changxu; Li, Ling; Liang, Xu-Fang; He, Shan; Guo, Wenjie; Lv, Liyuan; Wang, Qingchao; Song, Yi

    2016-08-01

    Body size is an obvious and important characteristic of fish. Mandarin fish Siniperca chuatsi (Basilewsky) is one of the most valuable perciform species widely cultured in China. Individual differences in body size are common in mandarin fish and significantly influence the aquaculture production. However, little is currently known about its genetic control. In this study, digital gene expression profiling and transcriptome sequencing were performed in mandarin fish with differential body size at 30 and 180 days post-hatch (dph), respectively. Body weight, total length and body length of fish with big-size were significantly higher than those with small-size at both 30 and 180 dph (P < 0.05). 2171 and 2014 differentially expressed genes were identified between small-size and big-size fish at 30 and 180 dph, respectively. RT quantitative PCR (qPCR) analysis showed that the differential expression of 10 selected genes in mandarin fish that went through the same training procedure. The genes were involved in the growth hormone-insulin-like growth factor axis, cell proliferation and differentiation, appetite control, glucose metabolism, reproduction and sexual size dimorphism pathways. This study will help toward a comprehensive understanding of the complexity of regulation of body size in mandarin fish individuals and provide valuable information for future research.

  2. Bayesian modeling of differential gene expression.

    PubMed

    Lewin, Alex; Richardson, Sylvia; Marshall, Clare; Glazier, Anne; Aitman, Tim

    2006-03-01

    We present a Bayesian hierarchical model for detecting differentially expressing genes that includes simultaneous estimation of array effects, and show how to use the output for choosing lists of genes for further investigation. We give empirical evidence that expression-level dependent array effects are needed, and explore different nonlinear functions as part of our model-based approach to normalization. The model includes gene-specific variances but imposes some necessary shrinkage through a hierarchical structure. Model criticism via posterior predictive checks is discussed. Modeling the array effects (normalization) simultaneously with differential expression gives fewer false positive results. To choose a list of genes, we propose to combine various criteria (for instance, fold change and overall expression) into a single indicator variable for each gene. The posterior distribution of these variables is used to pick the list of genes, thereby taking into account uncertainty in parameter estimates. In an application to mouse knockout data, Gene Ontology annotations over- and underrepresented among the genes on the chosen list are consistent with biological expectations.

  3. Differential Expression of Proteoglycans by Corneal Stromal Cells in Keratoconus.

    PubMed

    García, Beatriz; García-Suárez, Olivia; Merayo-Lloves, Jesús; Alcalde, Ignacio; Alfonso, José F; Fernández-Vega Cueto, Luis; Meana, Álvaro; Vázquez, Fernando; Quirós, Luis M

    2016-05-01

    Keratoconus is a heterogeneous disease associated with a range of pathologies, including disorders that involve proteoglycans (PGs). Some PG alterations, mainly in keratan sulfate (KS), occur in keratoconus. In this article, we studied the differential expression of the genes encoding PGs in cells isolated from keratoconus patients and healthy controls, as well as in corneal sections. Human central corneal tissue was obtained from cadaver donors and patients undergoing penetrating keratoplasty surgery. A transcriptomic approach was used, employing quantitative PCR, to analyze both the expression of the enzymes involved in glycosaminoglycan (GAG) biosynthesis and the PG core proteins. The expressions of the differentially expressed core proteins and of the GAG chains were also analyzed by immunocytochemistry in the cultured cells, as well as by immunohistochemistry in corneal sections. The mRNA levels of most major matrix PG mRNAs in the cultured keratoconic stromal cells decreased except collagen XVIII, which increased. At keratocyte surfaces, some heparan sulfate PGs were down-regulated. With respect to GAGs, there were changes in gene expression for the polymerization of the GAG chains, mainly KS and chondroitin sulfate, and in the modification of the saccharidic chains, pointing to an alteration of the sulfation patterns of all GAG species. Most of the PG core proteins underwent significant changes in cultured keratoconic cells and corneas. With regard to GAG chains, the polymerization of the chains and their chemical modification was modified in way that depended on the specific type of GAG involved.

  4. Differential gene expression during multistage carcinogenesis

    SciTech Connect

    Bowden, G.T. ); Krieg, P. )

    1991-06-01

    The use of the mouse skin multistage model of carcinogenesis has aided our understanding of critical target genes in chemical carcinogenesis. The mutagenic activation of the Harvey-ras proto-oncogene has been found to be an early event associated with the initiation of mouse skin tumors by the polycyclic aromatic hydrocarbon 7,12 dimethylbenz(a)anthracene and the pure initiator ethyl carbamate (urethane). In contrast to chemical initiation of mouse skin tumors, ionizing radiation-initiated malignant skin tumors have been shown to possess distinct non-ras transforming gene(s). Differential screening of cDNA libraries made from chemically initiated malignant skin tumors has been used to identify a number of cellular gene transcripts that are overexpressed during mouse skin tumor progression. These differentially expressed genes include {beta}-actin, ubiquitin, a hyperproliferative keratin (K6), a gene whose product is a member of a fatty acid or lipid-binding protein family, and a gene called transin or stromelysin. The overexpression of the stromelysin gene, which encodes a metalloproteinase that degrades proteins in the basement membrane, is hypothesized to play a functional role in malignant tumor cell invasion and metastasis. The authors believe that the cloning, identification, and characterization of gene sequences that are differentially expressed during tumor progression could lead to the discovery of gene products that either play functional roles in skin tumor progression or in the maintenance of various progressive tumor phenotypes.

  5. Differential toxicity and venom gland gene expression in Centruroides vittatus.

    PubMed

    McElroy, Thomas; McReynolds, C Neal; Gulledge, Alyssa; Knight, Kelci R; Smith, Whitney E; Albrecht, Eric A

    2017-01-01

    Variation in venom toxicity and composition exists in many species. In this study, venom potency and venom gland gene expression was evaluated in Centruroides vittatus, size class I-II (immature) and size class IV (adults/penultimate instars) size classes. Venom toxicity was evaluated by probit analysis and returned ED50 values of 50.1 μg/g for class IV compared to 134.2 μg/g for class I-II 24 hours post injection, suggesting size class IV was 2.7 fold more potent. Next generation sequencing (NGS and qPCR were used to characterize venom gland gene expression. NGS data was assembled into 36,795 contigs, and annotated using BLASTx with UNIPROT. EdgeR analysis of the sequences showed statistically significant differential expression in transcripts associated with sodium and potassium channel modulation. Sodium channel modulator expression generally favored size class IV; in contrast, potassium channel modulators were favored in size class I-II expression. Real-time quantitative PCR of 14 venom toxin transcripts detected relative expression ratios that paralleled NGS data and identified potential family members or splice variants for several sodium channel modulators. Our data suggests ontogenetic differences in venom potency and venom related genes expression exist between size classes I-II and IV.

  6. Global expression differences and tissue specific expression differences in rice evolution result in two contrasting types of differentially expressed genes.

    PubMed

    Horiuchi, Youko; Harushima, Yoshiaki; Fujisawa, Hironori; Mochizuki, Takako; Fujita, Masahiro; Ohyanagi, Hajime; Kurata, Nori

    2015-12-23

    Since the development of transcriptome analysis systems, many expression evolution studies characterized evolutionary forces acting on gene expression, without explicit discrimination between global expression differences and tissue specific expression differences. However, different types of gene expression alteration should have different effects on an organism, the evolutionary forces that act on them might be different, and different types of genes might show different types of differential expression between species. To confirm this, we studied differentially expressed (DE) genes among closely related groups that have extensive gene expression atlases, and clarified characteristics of different types of DE genes including the identification of regulating loci for differential expression using expression quantitative loci (eQTL) analysis data. We detected differentially expressed (DE) genes between rice subspecies in five homologous tissues that were verified using japonica and indica transcriptome atlases in public databases. Using the transcriptome atlases, we classified DE genes into two types, global DE genes and changed-tissues DE genes. Global type DE genes were not expressed in any tissues in the atlas of one subspecies, however changed-tissues type DE genes were expressed in both subspecies with different tissue specificity. For the five tissues in the two japonica-indica combinations, 4.6 ± 0.8 and 5.9 ± 1.5 % of highly expressed genes were global and changed-tissues DE genes, respectively. Changed-tissues DE genes varied in number between tissues, increasing linearly with the abundance of tissue specifically expressed genes in the tissue. Molecular evolution of global DE genes was rapid, unlike that of changed-tissues DE genes. Based on gene ontology, global and changed-tissues DE genes were different, having no common GO terms. Expression differences of most global DE genes were regulated by cis-eQTLs. Expression evolution of changed-tissues DE

  7. Quantitative temporal proteomic analysis of human embryonic stem cell differentiation into oligodendrocyte progenitor cells

    PubMed Central

    Chaerkady, Raghothama; Letzen, Brian; Renuse, Santosh; Sahasrabuddhe, Nandini A.; Kumar, Praveen; All, Angelo H.; Thakor, Nitish V.; Delanghe, Bernard; Gearhart, John D.; Pandey, Akhilesh; Kerr, Candace L.

    2013-01-01

    Oligodendrocytes (OLs) are glial cells of the central nervous system which produce myelin. Cultured OLs provide immense therapeutic opportunities for treating a variety of neurological conditions. One of the most promising sources for such therapies is human embryonic stem cells (ESCs), as well as providing a model to study human oligodendrocyte development. For these purposes, an investigation of proteome level changes is critical for understanding the process of OL differentiation. In this report, an iTRAQ-based quantitative proteomic approach was used to study multiple steps during oligodendrocyte differentiation including neural precursors (NPCs), glial precursors (GPCs), and oligodendrocyte progenitors (OPCs) compared to undifferentiated embryonic stem cells. Using a 1% false discovery rate cutoff, ~3,145 proteins were quantitated and several demonstrated progressive stage-specific expression. Proteins such as TF, NCAM1, APOE, and WNT5A showed increased expression from the NPC to OPC stage. Several proteins that have demonstrated evidence or been suspected in OL maturation were also found upregulated in OPCs including FABP4, THBS1, BMP1, CRYAB, TF, TNC, COL3A1, TGFBI and EPB41L3. Thus, by providing the first extensive proteomic profiling of human embryonic stem cell differentiation into oligodendrocyte progenitor cells, this study provides many novel proteins that are potentially involved in OL development. PMID:21770034

  8. Cancer outlier differential gene expression detection.

    PubMed

    Wu, Baolin

    2007-07-01

    We study statistical methods to detect cancer genes that are over- or down-expressed in some but not all samples in a disease group. This has proven useful in cancer studies where oncogenes are activated only in a small subset of samples. We propose the outlier robust t-statistic (ORT), which is intuitively motivated from the t-statistic, the most commonly used differential gene expression detection method. Using real and simulation studies, we compare the ORT to the recently proposed cancer outlier profile analysis (Tomlins and others, 2005) and the outlier sum statistic of Tibshirani and Hastie (2006). The proposed method often has more detection power and smaller false discovery rates. Supplementary information can be found at http://www.biostat.umn.edu/~baolin/research/ort.html.

  9. Quantitative changes in gene transcription during induction of differentiation in porcine neural progenitor cells

    PubMed Central

    Yang, Jing; Gu, Ping; Menges, Steven

    2012-01-01

    Purpose Differentiation of neural stem/progenitor cells involves changes in the gene expression of these cells. Less clear is the extent to which incremental changes occur and the time course of such changes, particularly in non-rodents. Methods Using porcine genome microarrays, we analyzed changes in the expression of 23,256 genes in porcine neural progenitor cells (pNPCs) subject to two established differentiation protocols. In addition, we performed sequential quantitative assessment of a defined transcription profile consisting of 15 progenitor- and lineage-associated genes following exposure to the same treatment protocols, to examine the temporal dynamics of phenotypic changes following induction of differentiation. Immunocytochemistry was also used to examine the expression of seven of these phenotypically important genes at the protein level. Initial primary isolates were passaged four times in proliferation medium containing 20 ng/ml epidermal growth factor (EGF) and 20 ng/ml basic fibroblast growth factor (bFGF) before differentiation was induced. Differentiation was induced by medium without EGF or bFGF and containing either 10 ng/ml ciliary neurotrophic factor or 10% fetal bovine serum (FBS). Cultures were fed every two days and harvested on days 0, 1, 3, and 5 for quantitative real-time PCR. Results The microarray results illustrated and contrasted the global shifts in the porcine transcriptome associated with both treatment conditions. PCR confirmed dramatic upregulation of transcripts for myelin basic protein (up to 88 fold), claudin 11 (up to 32 fold), glial fibrillary acidic protein (GFAP; up to 26 fold), together with notable (>twofold) increases in message for microtubule associated protein 2 (MAP2) and C-X-C chemokine receptor type 4 (CXCR4), Janus kinase 1 (Jak1), signal transducer and activator of transcription 1 (STAT1), and signal transducer and activator of transcription 3 (STAT3). Transcripts for nestin and Krüppel-like factor 4 (KLF4

  10. Novel markers of osteogenic and adipogenic differentiation of human bone marrow stromal cells identified using a quantitative proteomics approach.

    PubMed

    Granéli, Cecilia; Thorfve, Anna; Ruetschi, Ulla; Brisby, Helena; Thomsen, Peter; Lindahl, Anders; Karlsson, Camilla

    2014-01-01

    Today, the tool that is most commonly used to evaluate the osteogenic differentiation of bone marrow stromal cells (BMSCs) in vitro is the demonstration of the expression of multiple relevant markers, such as ALP, RUNX2 and OCN. However, as yet, there is no single surface marker or panel of markers which clearly defines human BMSCs (hBMSCs) differentiating towards the osteogenic lineage. The aim of this study was therefore to examine this issue. Stable isotope labeling by amino acids in cell culture (SILAC)-based quantitative proteomics was utilized to investigate differently expressed surface markers in osteogenically differentiated and undifferentiated hBMSCs. Labeled membrane proteins were analyzed by mass spectrometry (MS) and 52 proteins with an expression ratio above 2, between osteogenically differentiated and undifferentiated cells, were identified. Subsequent validation, by flow cytometry and ELISA, of the SILAC expression ratios for a number of these proteins and investigations of the lineage specificity of three candidate markers were performed. The surface markers, CD10 and CD92, demonstrated significantly increased expression in hBMSCs differentiated towards the osteogenic and adipogenic lineages. In addition, there was a slight increase in CD10 expression during chondrogenic differentiation. Furthermore, the expression of the intracellular protein, crystalline-αB (CRYaB), was only significantly increased in osteogenically differentiated hBMSCs and not affected during differentiation towards the chondrogenic or adipogenic lineages. It has been concluded from the present results that CD10 and CD92 are potential markers of osteogenic and adipogenic differentiation and that CRYaB is a potential novel osteogenic marker specifically expressed during the osteogenic differentiation of hBMSCs in vitro.

  11. Quantitative EEG patterns of differential in-flight workload

    NASA Technical Reports Server (NTRS)

    Sterman, M. B.; Mann, C. A.; Kaiser, D. A.

    1993-01-01

    Four test pilots were instrumented for in-flight EEG recordings using a custom portable recording system. Each flew six, two minute tracking tasks in the Calspan NT-33 experimental trainer at Edwards AFB. With the canopy blacked out, pilots used a HUD display to chase a simulated aircraft through a random flight course. Three configurations of flight controls altered the flight characteristics to achieve low, moderate, and high workload, as determined by normative Cooper-Harper ratings. The test protocol was administered by a command pilot in the back seat. Corresponding EEG and tracking data were compared off-line. Tracking performance was measured as deviation from the target aircraft and combined with control difficulty to achieve an estimate of 'cognitive workload'. Trended patterns of parietal EEG activity at 8-12 Hz were sorted according to this classification. In all cases, high workload produced a significantly greater suppression of 8-12 Hz activity than low workload. Further, a clear differentiation of EEG trend patterns was obtained in 80 percent of the cases. High workload produced a sustained suppression of 8-12 Hz activity, while moderate workload resulted in an initial suppression followed by a gradual increment. Low workload was associated with a modulated pattern lacking any periods of marked or sustained suppression. These findings suggest that quantitative analysis of appropriate EEG measures may provide an objective and reliable in-flight index of cognitive effort that could facilitate workload assessment.

  12. Quantitative orientation-independent differential interference contrast (DIC) microscopy

    NASA Astrophysics Data System (ADS)

    Shribak, Michael; LaFountain, James; Biggs, David; Inoué, Shinya

    2007-02-01

    We describe a new DIC technique, which records phase gradients within microscopic specimens independently of their orientation. The proposed system allows the generation of images representing the distribution of dry mass (optical path difference) in the specimen. Unlike in other forms of interference microscopes, this approach does not require a narrow illuminating cone. The orientation-independent differential interference contrast (OI-DIC) system can also be combined with orientation-independent polarization (OI-Pol) measurements to yield two complementary images: one showing dry mass distribution (which is proportional to refractive index) and the other showing distribution of birefringence (due to structural or internal anisotropy). With a model specimen used for this work -- living spermatocytes from the crane fly, Nephrotoma suturalis --- the OI-DIC image clearly reveals the detailed shape of the chromosomes while the polarization image quantitatively depicts the distribution of the birefringent microtubules in the spindle, both without any need for staining or other modifications of the cell. We present examples of a pseudo-color combined image incorporating both orientation-independent DIC and polarization images of a spermatocyte at diakinesis and metaphase of meiosis I. Those images provide clear evidence that the proposed technique can reveal fine architecture and molecular organization in live cells without perturbation associated with staining or fluorescent labeling. The phase image was obtained using optics having a numerical aperture 1.4, thus achieving a level of resolution never before achieved with any interference microscope.

  13. Towards quantitative atmospheric water vapor profiling with differential absorption lidar.

    PubMed

    Dinovitser, Alex; Gunn, Lachlan J; Abbott, Derek

    2015-08-24

    Differential Absorption Lidar (DIAL) is a powerful laser-based technique for trace gas profiling of the atmosphere. However, this technique is still under active development requiring precise and accurate wavelength stabilization, as well as accurate spectroscopic parameters of the specific resonance line and the effective absorption cross-section of the system. In this paper we describe a novel master laser system that extends our previous work for robust stabilization to virtually any number of multiple side-line laser wavelengths for the future probing to greater altitudes. In this paper, we also highlight the significance of laser spectral purity on DIAL accuracy, and illustrate a simple re-arrangement of a system for measuring effective absorption cross-section. We present a calibration technique where the laser light is guided to an absorption cell with 33 m path length, and a quantitative number density measurement is then used to obtain the effective absorption cross-section. The same absorption cell is then used for on-line laser stabilization, while microwave beat-frequencies are used to stabilize any number of off-line lasers. We present preliminary results using ∼300 nJ, 1 μs pulses at 3 kHz, with the seed laser operating as a nanojoule transmitter at 822.922 nm, and a receiver consisting of a photomultiplier tube (PMT) coupled to a 356 mm mirror.

  14. Microarray data analysis for differential expression: a tutorial.

    PubMed

    Suárez, Erick; Burguete, Ana; Mclachlan, Geoffrey J

    2009-06-01

    DNA microarray is a technology that simultaneously evaluates quantitative measurements for the expression of thousands of genes. DNA microarrays have been used to assess gene expression between groups of cells of different organs or different populations. In order to understand the role and function of the genes, one needs the complete information about their mRNA transcripts and proteins. Unfortunately, exploring the protein functions is very difficult, due to their unique 3-dimentional complicated structure. To overcome this difficulty, one may concentrate on the mRNA molecules produced by the gene expression. In this paper, we describe some of the methods for preprocessing data for gene expression and for pairwise comparison from genomic experiments. Previous studies to assess the efficiency of different methods for pairwise comparisons have found little agreement in the lists of significant genes. Finally, we describe the procedures to control false discovery rates, sample size approach for these experiments, and available software for microarray data analysis. This paper is written for those professionals who are new in microarray data analysis for differential expression and want to have an overview of the specific steps or the different approaches for this sort of analysis.

  15. Quantitative Monitoring of Gene Expression Patterns with a Complementary DNA Microarray

    NASA Astrophysics Data System (ADS)

    Schena, Mark; Shalon, Dari; Davis, Ronald W.; Brown, Patrick O.

    1995-10-01

    A high-capacity system was developed to monitor the expression of many genes in parallel. Microarrays prepared by high-speed robotic printing of complementary DNAs on glass were used for quantitative expression measurements of the corresponding genes. Because of the small format and high density of the arrays, hybridization volumes of 2 microliters could be used that enabled detection of rare transcripts in probe mixtures derived from 2 micrograms of total cellular messenger RNA. Differential expression measurements of 45 Arabidopsis genes were made by means of simultaneous, two-color fluorescence hybridization.

  16. Differential gene expression in ripening banana fruit.

    PubMed

    Clendennen, S K; May, G D

    1997-10-01

    During banana (Musa acuminata L.) fruit ripening ethylene production triggers a developmental cascade that is accompanied by a massive conversion of starch to sugars, an associated burst of respiratory activity, and an increase in protein synthesis. Differential screening of cDNA libraries representing banana pulp at ripening stages 1 and 3 has led to the isolation of 11 nonredundant groups of differentially expressed mRNAs. Identification of these transcripts by partial sequence analysis indicates that two of the mRNAs encode proteins involved in carbohydrate metabolism, whereas others encode proteins thought to be associated with pathogenesis, senescence, or stress responses in plants. Their relative abundance in the pulp and tissue-specific distribution in greenhouse-grown banana plants were determined by northern-blot analyses. The relative abundance of transcripts encoding starch synthase, granule-bound starch synthase, chitinase, lectin, and a type-2 metallothionein decreased in pulp during ripening. Transcripts encoding endochitinase, beta-1,3-glucanase, a thaumatin-like protein, ascorbate peroxidase, metallothionein, and a putative senescence-related protein increased early in ripening. The elucidation of the molecular events associated with banana ripening will facilitate a better understanding and control of these processes, and will allow us to attain our long-term goal of producing candidate oral vaccines in transgenic banana plants.

  17. Collagen gene expression during limb cartilage differentiation

    PubMed Central

    1986-01-01

    As limb mesenchymal cells differentiate into chondrocytes, they initiate the synthesis of type II collagen and cease synthesizing type I collagen. Changes in the cytoplasmic levels of type I and type II collagen mRNAs during the course of limb chondrogenesis in vivo and in vitro were examined using cloned cDNA probes. A striking increase in cytoplasmic type II collagen mRNA occurs coincident with the crucial condensation stage of chondrogenesis in vitro, in which prechondrogenic mesenchymal cells become closely juxtaposed before depositing a cartilage matrix. Thereafter, a continuous and progressive increase in the accumulation of cytoplasmic type II collagen mRNA occurs which parallels the progressive accumulation of cartilage matrix by cells. The onset of overt chondrogenesis, however, does not involve activation of the transcription of the type II collagen gene. Low levels of type II collagen mRNA are present in the cytoplasm of prechondrogenic mesenchymal cells at the earliest stages of limb development, well before the accumulation of detectable levels of type II collagen. Type I collagen gene expression during chondrogenesis is regulated, at least in part, at the translational level. Type I collagen mRNAs are present in the cytoplasm of differentiated chondrocytes, which have ceased synthesizing detectable amounts of type I collagen. PMID:3754261

  18. Differential expression of Dlk-1 in bovine adipose tissue depots.

    PubMed

    Vuocolo, T; Pearson, R; Campbell, P; Tellam, R L

    2003-02-01

    Dlk-1, a type 1 membrane glycoprotein, is a member of the Epidermal Growth Factor-like family of homeotic proteins that are typically involved in cell fate decisions and in mice it has been implicated in the control of differentiation of adipocytes. The aim of this study was to determine whether there were tissue-specific expression patterns of Dlk-1 splice variants in bovine tissues. Only the Dlk-1-C2 variant was expressed in adult bovine tissues while both Dlk-1-C2 and Dlk-1-A variants were expressed in foetal tissues. Quantitative real-time PCR revealed large differences in the relative levels of expression of the Dlk-1-C2 variant in adult adipose tissue depots with no expression in subcutaneous and brisket adipose tissues. Expression was also demonstrated in three adult skeletal muscle samples. The large variation in the level of expression of Dlk-1-C2 in different adult tissues may reflect the relative preadipocyte content of those tissues and consequently their potential for generating new adipocytes. A low abundance soluble glycoprotein (bFA1) was purified from bovine amniotic fluid. Analyses of its amino acid sequence revealed that it corresponded to most of the extracellular domain of bovine Dlk-1 and was derived by proteolytic processing from the full-length Dlk-1 protein encoded by the Dlk-1-A variant. The tissues expressing the Dlk-1-A variant have not been identified but are likely to be foetal in origin. Splice variants of Dlk-1 may have varied functional roles with the foetal Dlk-1-A form capable of generating a protein that undergoes proteolytic processing to release a soluble ecto-domain of Dlk-1. In contrast the Dlk-1-C2 splice variant codes for a protein lacking this processing site and therefore it probably remains bound to the cell membrane.

  19. Building quantitative, three dimensional atlases of gene expression and morphology at cellular resolution

    PubMed Central

    Knowles, David W.; Biggin, Mark D.

    2013-01-01

    Animals comprise dynamic three-dimensional arrays of cells that express gene products in intricate spatial and temporal patterns that determine cellular differentiation and morphogenesis. A rigorous understanding of these developmental processes requires automated methods that quantitatively record and analyze complex morphologies and their associated patterns of gene expression at cellular resolution. Here we summarize light microscopy based approaches to establish permanent, quantitative datasets—atlases—that record this information. We focus on experiments that capture data for whole embryos or large areas of tissue in three dimensions, often at multiple time points. We compare and contrast the advantages and limitations of different methods and highlight some of the discoveries made. We emphasize the need for interdisciplinary collaborations and integrated experimental pipelines that link sample preparation, image acquisition, image analysis, database design, visualization and quantitative analysis. PMID:24123936

  20. Identification of differentially expressed genes in cutaneous squamous cell carcinoma by microarray expression profiling

    PubMed Central

    Nindl, Ingo; Dang, Chantip; Forschner, Tobias; Kuban, Ralf J; Meyer, Thomas; Sterry, Wolfram; Stockfleth, Eggert

    2006-01-01

    Background Carcinogenesis is a multi-step process indicated by several genes up- or down-regulated during tumor progression. This study examined and identified differentially expressed genes in cutaneous squamous cell carcinoma (SCC). Results Three different biopsies of 5 immunosuppressed organ-transplanted recipients each normal skin (all were pooled), actinic keratosis (AK) (two were pooled), and invasive SCC and additionally 5 normal skin tissues from immunocompetent patients were analyzed. Thus, total RNA of 15 specimens were used for hybridization with Affymetrix HG-U133A microarray technology containing 22,283 genes. Data analyses were performed by prediction analysis of microarrays using nearest shrunken centroids with the threshold 3.5 and ANOVA analysis was independently performed in order to identify differentially expressed genes (p < 0.05). Verification of 13 up- or down-regulated genes was performed by quantitative real-time reverse transcription (RT)-PCR and genes were additionally confirmed by sequencing. Broad coherent patterns in normal skin vs. AK and SCC were observed for 118 genes. Conclusion The majority of identified differentially expressed genes in cutaneous SCC were previously not described. PMID:16893473

  1. Highly multiplexed quantitation of gene expression on single cells

    PubMed Central

    Dominguez, Maria H.; Chattopadhyay, Pratip K.; Ma, Steven; Lamoreaux, Laurie; McDavid, Andrew; Finak, Greg; Gottardo, Raphael; Koup, Richard A.; Roederer, Mario

    2013-01-01

    Highly multiplexed, single-cell technologies reveal important heterogeneity within cell populations. Recently, technologies to simultaneously measure expression of 96 (or more) genes from a single cell have been developed for immunologic monitoring. Here, we report a rigorous, optimized, quantitative methodology for using this technology. Specifically: we describe a unique primer/probe qualification method necessary for quantitative results; we show that primers do not compete in highly multiplexed amplifications; we define the limit of detection for this assay as a single mRNA transcript; and, we show that the technical reproducibility of the system is very high. We illustrate two disparate applications of the platform: a “bulk” approach that measures expression patterns from 100 cells at a time in high throughput to define gene signatures, and a single-cell approach to define the coordinate expression patterns of multiple genes and reveal unique subsets of cells. PMID:23500781

  2. Microarray analysis of differentially expressed genes in preeclamptic and normal placental tissues.

    PubMed

    Ma, K; Lian, Y; Zhou, S; Hu, R; Xiong, Y; Ting, P; Xiong, Y; Li, X; Wang, X

    2014-01-01

    To detect the candidate genes for preeclampsia (PE). The gene expression profiles in preeclamptic and normal placental tissues were analyzed using cDNA microarray approach and the altered expression of important genes were further confirmed by real-time RT-PCR (reverse transcription polymerase chain reaction) technique. Total RNA was extracted from placental tissues of three cases with severe PE and from three cases with normal pregnancy. After scanning, differentially expressed genes were detected by software. In two experiments (the fluorescent labels were exchanged), a total of 111 differentially expressed genes were detected. In placental tissue ofpreeclamptic pregnancy, 68 differentially expressed genes were up-regulated, and 44 differentially expressed genes were down-regulated. Of these genes, 16 highly differentially expressed genes were confirmed by real-time fluorescent quantitative RT-PCR, and the result showed that the ratio of gene expression differences was comparable to that detected by cDNA microarray. The results of bioinformatic analysis showed that encoding products of differentially expressed genes were correlated to infiltration of placenta trophoblastic cells, immunomodulatory factors, pregnancy-associated plasma protein, signal transduction pathway, and cell adhesion. Further studies on the biological function and regulating mechanism of these genes will provide new clues for better understanding of etiology and pathogenesis of PE.

  3. Expression of Tight Junction Components in Hepatocyte-Like Cells Differentiated from Human Embryonic Stem Cells.

    PubMed

    Erdélyi-Belle, Boglárka; Török, György; Apáti, Ágota; Sarkadi, Balázs; Schaff, Zsuzsa; Kiss, András; Homolya, László

    2015-09-01

    Human embryonic stem cells can be differentiated in vitro into a wide variety of progeny cells by addition of different morphogens and growth factors. Our aim was to monitor the expression pattern of tight junction (TJ) components and various cellular markers during differentiation of stem cell lines toward the hepatic lineage. Human embryonic stem cell lines (HUES1, HUES9) were differentiated into endoderm-like cells, and further differentiated to hepatocyte-like cells. Gene expressions of Oct3/4, Nanog, alpha-fetoprotein, albumin, cytokeratins (CK-7, CK-8, CK-18, CK-19), ATP-binding cassette (ABC) transporters (ABCC2, ABCC7, ABCG2), and various TJ components, including claudin-1, claudin-4, claudin-5, claudin-7, and tricellulin, as well as an extracellular matrix component, agrin were monitored during hepatic differentiation by real-time quantitative PCR. The differentiated cells exhibit epithelial morphology and functional assessments similar to that of hepatocytes. The expression level of stem cell marker genes (Oct3/4 and Nanog) significantly and gradually decreased, while liver-associated genes (alpha-fetoprotein, albumin) reached their highest expression at the end of the differentiation. The endoderm-like cells expressed claudin-1, which declined eventually. The expression levels of cholangiocyte markers including claudin-4, CK-7, CK-19, and agrin gradually increased and reached their highest level at the final stage of differentiation. In contrast, these cells did not express notable level of claudin-7, CK-8 and tricellulin. The marker set used for monitoring differentiation revealed both hepatocyte and cholangiocyte characteristics of the differentiated cells at the final stage. This is the first report describing the expression level changes of various TJ components, and underlining their importance in hepatic differentiation.

  4. Reference genes for gene expression analysis in proliferating and differentiating human keratinocytes.

    PubMed

    Lanzafame, Manuela; Botta, Elena; Teson, Massimo; Fortugno, Paola; Zambruno, Giovanna; Stefanini, Miria; Orioli, Donata

    2015-04-01

    Abnormalities in keratinocyte growth and differentiation have a pathogenic significance in many skin disorders and result in gene expression alterations detectable by quantitative real-time RT-PCR (qRT-PCR). Relative quantification based on endogenous control (EC) genes is the commonly adopted approach, and the use of multiple reference genes from independent pathways is considered a best practice guideline, unless fully validated EC genes are available. The literature on optimal reference genes during in vitro calcium-induced differentiation of normal human epidermal keratinocytes (NHEK) is inconsistent. In many studies, the expression of target genes is compared to that of housekeeping genes whose expression, however, significantly varies during keratinocyte differentiation. Here, we report the results of our investigations on the expression stability of 15 candidate EC genes, including those commonly used as reference in expression analysis by qRT-PCR, during NHEK calcium-induced differentiation. We demonstrate that YWHAZ and UBC are extremely stable genes, and therefore, they represent optimal EC genes for expression studies in proliferating and calcium-induced differentiating NHEK. Furthermore, we demonstrate that YWHAZ/14-3-3-zeta is a suitable reference for quantitative comparison of both transcript and protein levels.

  5. Defining breast cancer intrinsic subtypes by quantitative receptor expression.

    PubMed

    Cheang, Maggie C U; Martin, Miguel; Nielsen, Torsten O; Prat, Aleix; Voduc, David; Rodriguez-Lescure, Alvaro; Ruiz, Amparo; Chia, Stephen; Shepherd, Lois; Ruiz-Borrego, Manuel; Calvo, Lourdes; Alba, Emilio; Carrasco, Eva; Caballero, Rosalia; Tu, Dongsheng; Pritchard, Kathleen I; Levine, Mark N; Bramwell, Vivien H; Parker, Joel; Bernard, Philip S; Ellis, Matthew J; Perou, Charles M; Di Leo, Angelo; Carey, Lisa A

    2015-05-01

    To determine intrinsic breast cancer subtypes represented within categories defined by quantitative hormone receptor (HR) and HER2 expression. We merged 1,557 cases from three randomized phase III trials into a single data set. These breast tumors were centrally reviewed in each trial for quantitative ER, PR, and HER2 expression by immunohistochemistry (IHC) stain and by reverse transcription-quantitative polymerase chain reaction (RT-qPCR), with intrinsic subtyping by research-based PAM50 RT-qPCR assay. Among 283 HER2-negative tumors with <1% HR expression by IHC, 207 (73%) were basal-like; other subtypes, particularly HER2-enriched (48, 17%), were present. Among the 1,298 HER2-negative tumors, borderline HR (1%-9% staining) was uncommon (n = 39), and these tumors were heterogeneous: 17 (44%) luminal A/B, 12 (31%) HER2-enriched, and only 7 (18%) basal-like. Including them in the definition of triple-negative breast cancer significantly diminished enrichment for basal-like cancer (p < .05). Among 106 HER2-positive tumors with <1% HR expression by IHC, the HER2-enriched subtype was the most frequent (87, 82%), whereas among 127 HER2-positive tumors with strong HR (>10%) expression, only 69 (54%) were HER2-enriched and 55 (43%) were luminal (39 luminal B, 16 luminal A). Quantitative HR expression by RT-qPCR gave similar results. Regardless of methodology, basal-like cases seldom expressed ER/ESR1 or PR/PGR and were associated with the lowest expression level of HER2/ERBB2 relative to other subtypes. Significant discordance remains between clinical assay-defined subsets and intrinsic subtype. For identifying basal-like breast cancer, the optimal HR IHC cut point was <1%, matching the American Society of Clinical Oncology and College of American Pathologists guidelines. Tumors with borderline HR staining are molecularly diverse and may require additional assays to clarify underlying biology. ©AlphaMed Press.

  6. Profiling of differentially expressed genes in haemophilia A with inhibitor.

    PubMed

    Hwang, S H; Lim, J A; Kim, M J; Kim, H C; Lee, H W; Yoo, K Y; You, C W; Lee, K S; Kim, H S

    2012-05-01

    Inhibitor development is the most significant complication in the therapy of haemophilia A (HA) patients. In spite of many studies, not much is known regarding the mechanism underlying inhibitor development. To understand the mechanism, we analysed profiles of differentially expressed genes (DEGs) between inhibitor and non-inhibitor HA via a microarray technique. Twenty unrelated Korean HAs were studied: 11 were non-inhibitor and nine were HA with inhibitor (≥5 BU mL(-1)). Microarray analysis was conducted using a Human Ref-8 expression Beadchip system (Illumina) and the data were analysed using Beadstudio software. We identified 545 DEGs in inhibitor HA as compared with the non-inhibitor patients; 384 genes were up-regulated and 161 genes were down-regulated. Among them, 75 genes whose expressions were altered by at least two-fold (>+2 or <-2) were selected and classified via the PANTHER classification method. The expressions of signal transduction and immunity-related genes differed significantly in the two groups. For validation of the DEGs, semi-quantitative RT-PCR (semi-qRT-PCR) was conducted with the six selected DEGs. The results corresponded to the microarray data, with the exception of one gene. We also examined the expression of the genes associated with the antigen presentation process via real-time PCR. The average levels of IL10, CTLA4 and TNFα slightly reduced, whereas that of IFNγ increased in the inhibitor HA group. We are currently unable to explain whether this phenomenon is a function of the inhibitor-inducing factor or is an epiphenomenon of antibody production. Nevertheless, our results provide a possible explanation for inhibitor development.

  7. Quantitative gene expression profiles in real time from expressed sequence tag databases.

    PubMed

    Funari, Vincent A; Voevodski, Konstantin; Leyfer, Dimitry; Yerkes, Laura; Cramer, Donald; Tolan, Dean R

    2010-01-01

    An accumulation of expressed sequence tag (EST) data in the public domain and the availability of bioinformatic programs have made EST gene expression profiling a common practice. However, the utility and validity of using EST databases (e.g., dbEST) has been criticized, particularly for quantitative assessment of gene expression. Problems with EST sequencing errors, library construction, EST annotation, and multiple paralogs make generation of specific and sensitive qualitative arid quantitative expression profiles a concern. In addition, most EST-derived expression data exists in previously assembled databases. The Virtual Northern Blot (VNB) (http: //tlab.bu.edu/vnb.html) allows generation, evaluation, and optimization of expression profiles in real time, which is especially important for alternatively spliced, novel, or poorly characterized genes. Representative gene families with variable nucleotide sequence identity, tissue specificity, and levels of expression (bcl-xl, aldoA, and cyp2d9) are used to assess the quality of VNB's output. The profiles generated by VNB are more sensitive and specific than those constructed with ESTs listed in preindexed databases at UCSC and NCBI. Moreover, quantitative expression profiles produced by VNB are comparable to quantization obtained from Northern blots and qPCR. The VNB pipeline generates real-time gene expression profiles for single-gene queries that are both qualitatively and quantitatively reliable.

  8. Quantitative Gene Expression Profiles in Real Time From Expressed Sequence Tag Databases

    PubMed Central

    FUNARI, VINCENT A.; VOEVODSKI, KONSTANTIN; LEYFER, DIMITRY; YERKES, LAURA; CRAMER, DONALD; TOLAN, DEAN R.

    2010-01-01

    An accumulation of expressed sequence tag (EST) data in the public domain and the availability of bioinformatic programs have made EST gene expression profiling a common practice. However, the utility and validity of using EST databases (e.g., dbEST) has been criticized, particularly for quantitative assessment of gene expression. Problems with EST sequencing errors, library construction, EST annotation, and multiple paralogs make generation of specific and sensitive qualitative and quantitative expression profiles a concern. In addition, most EST-derived expression data exists in previously assembled databases. The Virtual Northern Blot (VNB) (http://tlab.bu.edu/vnb.html) allows generation, evaluation, and optimization of expression profiles in real time, which is especially important for alternatively spliced, novel, or poorly characterized genes. Representative gene families with variable nucleotide sequence identity, tissue specificity, and levels of expression (bcl-xl, aldoA, and cyp2d9) are used to assess the quality of VNB’s output. The profiles generated by VNB are more sensitive and specific than those constructed with ESTs listed in preindexed databases at UCSI and NCBI. Moreover, quantitative expression profiles produced by VNB are comparable to quantization obtained from Northern blots and qPCR. The VNB pipeline generates real-time gene expression profiles for single-gene queries that are both qualitatively and quantitatively reliable. PMID:20635574

  9. A Hybrid Approach to Protein Differential Expression in Mass Spectrometry-Based Proteomics

    SciTech Connect

    Wang, Xuan; Anderson, Gordon A.; Smith, Richard D.; Dabney, Alan R.

    2012-04-19

    Motivation: Quantitative mass spectrometry-based proteomics involves statistical inference on protein abundance, based on the intensities of each protein's associated spectral peaks. However, typical MS-based proteomics data sets have substantial proportions of missing observations, due at least in part to censoring of low intensities. This complicates intensity-based differential expression analysis. Results: We outline a statistical method for protein differential expression, based on a simple Binomial likelihood. By modeling peak intensities as binary, in terms of 'presence/ absence,' we enable the selection of proteins not typically amendable to quantitative analysis; e.g., 'one-state' proteins that are present in one condition but absent in another. In addition, we present an analysis protocol that combines quantitative and presence/ absence analysis of a given data set in a principled way, resulting in a single list of selected proteins with a single associated FDR.

  10. Screening of differentially expressed genes in pathological scar tissues using expression microarray.

    PubMed

    Huang, L P; Mao, Z; Zhang, L; Liu, X X; Huang, C; Jia, Z S

    2015-09-09

    Pathological scar tissues and normal skin tissues were differentiated by screening for differentially expressed genes in pathologic scar tissues via gene expression microarray. The differentially expressed gene data was analyzed by gene ontology and pathway analyses. There were 5001 up- or down-regulated genes in 2-fold differentially expressed genes, 956 up- or down-regulated genes in 5-fold differentially expressed genes, and 114 up- or down-regulated genes in 20-fold differentially expressed genes. Therefore, significant differences were observed in the gene expression in pathological scar tissues and normal foreskin tissues. The development of pathological scar tissues has been correlated to changes in multiple genes and pathways, which are believed to form a dynamic network connection.

  11. Lipin-1 expression is critical for keratinocyte differentiation.

    PubMed

    Chae, Minjung; Jung, Ji-Yong; Bae, Il-Hong; Kim, Hyoung-June; Lee, Tae Ryong; Shin, Dong Wook

    2016-04-01

    Lipin-1 is an Mg(2+)-dependent phosphatidate phosphatase that facilitates the dephosphorylation of phosphatidic acid to generate diacylglycerol. Little is known about the expression and function of lipin-1 in normal human epidermal keratinocytes (NHEKs). Here, we demonstrate that lipin-1 is present in basal and spinous layers of the normal human epidermis, and lipin-1 expression is gradually downregulated during NHEK differentiation. Interestingly, lipin-1 knockdown (KD) inhibited keratinocyte differentiation and caused G1 arrest by upregulating p21 expression. Cell cycle arrest by p21 is required for commitment of keratinocytes to differentiation, but must be downregulated for the progress of keratinocyte differentiation. Therefore, reduced keratinocyte differentiation results from sustained upregulation of p21 by lipin-1 KD. Lipin-1 KD also decreased the phosphorylation/activation of protein kinase C (PKC)α, whereas lipin-1 overexpression increased PKCα phosphorylation. Treatment with PKCα inhibitors, like lipin-1 KD, stimulated p21 expression, while lipin-1 overexpression reduced p21 expression, implicating PKCα in lipin-1-induced regulation of p21 expression. Taken together, these results suggest that lipin-1-mediated downregulation of p21 is critical for the progress of keratinocyte differentiation after the initial commitment of keratinocytes to differentiation induced by p21, and that PKCα is involved in p21 expression regulation by lipin-1. Copyright © 2016 by the American Society for Biochemistry and Molecular Biology, Inc.

  12. Differential Object Marking in Spanish: A Quantitative Variationist Study

    ERIC Educational Resources Information Center

    Tippets, Ian Robert

    2010-01-01

    This dissertation addresses the variable nature of the linguistic phenomenon known as Differential Object Marking (DOM) as it is manifested in Spanish. More commonly known in the literature as the personal "a" or the accusative "a", this phenomenon has been attributed primarily to marking animate, predominantly human, direct…

  13. Quantitative Analysis of HSV Gene Expression during Lytic Infection.

    PubMed

    Turner, Anne-Marie W; Arbuckle, Jesse H; Kristie, Thomas M

    2014-11-03

    Herpes Simplex Virus (HSV) is a human pathogen that establishes latency and undergoes periodic reactivation, resulting in chronic recurrent lytic infection. HSV lytic infection is characterized by an organized cascade of three gene classes; however, successful transcription and expression of the first, the immediate early class, is critical to the overall success of viral infection. This initial event of lytic infection is also highly dependent on host cell factors. This unit uses RNA interference and small molecule inhibitors to examine the role of host and viral proteins in HSV lytic infection. Methods detailing isolation of viral and host RNA and genomic DNA followed by quantitative real-time PCR allow characterization of impacts on viral transcription and replication, respectively. Western blots can be used to confirm quantitative PCR results. This combination of protocols represents a starting point for researchers interested in virus-host interactions during HSV lytic infection. Copyright © 2014 John Wiley & Sons, Inc.

  14. Differential proteomics analysis of liver failure in peripheral blood mononuclear cells using isobaric tags for relative and absolute quantitation

    PubMed Central

    Lin, Hua; Tan, Qiu-Pei; Sui, Wei-Guo; Chen, Wen-Biao; Peng, Wu-Jian; Liu, Xing-Chao; Dai, Yong

    2017-01-01

    The aim of the present study was to examine differentially expressed proteome profiles for candidate biomarkers in peripheral blood mononuclear cells (PBMCs) of liver failure (LF) patients. Ten patients were diagnosed as LF and 10 age- and gender-matched subjects were recruited as healthy controls. Isobaric tags for relative and absolute quantitation (iTRAQ)-based quantitative proteomic technology is efficiently applicable for identification and relative quantitation of the proteomes of PBMCs. Eight-plex iTRAQ coupled with strong cation exchange chromatography, and liquid chromatography coupled with tandem mass spectrometry were used to analyze total proteins in LF patients and healthy control subjects. Molecular variations were detected using the iTRAQ method, and western blotting was used to verify the results. LF is a complex type of medical emergency that evolves following a catastrophic insult to the liver, and its outcome remains the most ominous of all gastroenterologic diseases. Serious complications tend to occur during the course of the disease and further exacerbate the problems. Using the iTRAQ method, differentially expressed proteome profiles of LF patients were determined. In the present study, 627 proteins with different expression levels were identified in LF patients compared with the control subjects; with 409 proteins upregulated and 218 proteins downregulated. Among them, four proteins were significantly differentially expressed; acylaminoacyl-peptide hydrolase and WW domain binding protein 2 were upregulated, and resistin and tubulin β 2A class IIa were downregulated. These proteins demonstrated differences in their expression levels compared with other proteins with normal expression levels and the significant positive correlation with LF. The western blot results were consistent with the results from iTRAQ. Thus, investigation of the molecular mechanism of the proteins involved in LF may facilitate an improved understanding of the

  15. Gene expression kinetics in individual plasmodial cells reveal alternative programs of differential regulation during commitment and differentiation.

    PubMed

    Rätzel, Viktoria; Marwan, Wolfgang

    2015-05-26

    During its life cycle, the amoebozoon Physarum polycephalum forms multinucleate plasmodial cells that can grow to macroscopic size while maintaining a naturally synchronous population of nuclei. Sporulation-competent plasmodia were stimulated through photoactivation of the phytochrome photoreceptor and the expression of sporulation marker genes was analyzed quantitatively by repeatedly taking samples of the same plasmodial cell at successive time points after the stimulus pulse. Principal component analysis of the gene expression data revealed that plasmodial cells take different trajectories leading to cell fate decision and differentiation and suggested that averaging over individual cells is inappropriate. Queries for genes with pairwise correlated expression kinetics revealed qualitatively different patterns of co-regulation, indicating that alternative programs of differential regulation are operational in individual plasmodial cells. At the single cell level, the response to stimulation of a non-sporulating mutant was qualitatively different as compared to the wild type with respect to the differentially regulated genes and their patterns of co-regulation. The observation of individual differences during commitment and differentiation supports the concept of a Waddington-type quasipotential landscape for the regulatory control of cell differentiation. Comparison of wild type and sporulation mutant data further supports the idea that mutations may impact the topology of this landscape.

  16. Robust PCA based method for discovering differentially expressed genes.

    PubMed

    Liu, Jin-Xing; Wang, Yu-Tian; Zheng, Chun-Hou; Sha, Wen; Mi, Jian-Xun; Xu, Yong

    2013-01-01

    How to identify a set of genes that are relevant to a key biological process is an important issue in current molecular biology. In this paper, we propose a novel method to discover differentially expressed genes based on robust principal component analysis (RPCA). In our method, we treat the differentially and non-differentially expressed genes as perturbation signals S and low-rank matrix A, respectively. Perturbation signals S can be recovered from the gene expression data by using RPCA. To discover the differentially expressed genes associated with special biological progresses or functions, the scheme is given as follows. Firstly, the matrix D of expression data is decomposed into two adding matrices A and S by using RPCA. Secondly, the differentially expressed genes are identified based on matrix S. Finally, the differentially expressed genes are evaluated by the tools based on Gene Ontology. A larger number of experiments on hypothetical and real gene expression data are also provided and the experimental results show that our method is efficient and effective.

  17. Infants' perception of expressive behaviors: differentiation of multimodal information.

    PubMed

    Walker-Andrews, A S

    1997-05-01

    The literature on infants' perception of facial and vocal expressions, combined with data from studies on infant-directed speech, mother-infant interaction, and social referencing, supports the view that infants come to recognize the affective expressions of others through a perceptual differentiation process. Recognition of affective expressions changes from a reliance on multimodally presented information to the recognition of vocal expressions and then of facial expressions alone. Face or voice properties become differentiated and discriminated from the whole, standing for the entire emotional expression. Initially, infants detect information that potentially carries the meaning of emotional expressions; only later do infants discriminate and then recognize those expressions. The author reviews data supporting this view and draws parallels between the perceptions of affective expressions and of speech.

  18. Random Monoallelic Gene Expression Increases upon Embryonic Stem Cell Differentiation

    PubMed Central

    Eckersley-Maslin, Mélanie A.; Thybert, David; Bergmann, Jan H.; Marioni, John C.; Flicek, Paul; Spector, David L.

    2014-01-01

    Summary Random autosomal monoallelic gene expression refers to the transcription of a gene from one of two homologous alleles. We assessed the dynamics of monoallelic expression during development through an allele-specific RNA sequencing screen in clonal populations of hybrid mouse embryonic stem cells (ESCs) and neural progenitor cells (NPCs). We identified 67 and 376 inheritable autosomal random monoallelically expressed genes in ESCs and NPCs respectively, a 5.6-fold increase upon differentiation. While DNA methylation and nuclear positioning did not distinguish the active and inactive alleles, specific histone modifications were differentially enriched between the two alleles. Interestingly, expression levels of 8% of the monoallelically expressed genes remained similar between monoallelic and biallelic clones. These results support a model in which random monoallelic expression occurs stochastically during differentiation, and for some genes is compensated for by the cell to maintain the required transcriptional output of these genes. PMID:24576421

  19. Micro RNA expression pattern of undifferentiated and differentiated human embryonic stem cells

    PubMed Central

    Lakshmipathy, Uma; Love, Brad; Goff, Loyal A.; Jörnsten, Rebecka; Graichen, Ralph; Hart, Ronald P.; Chesnut, Jonathan D.

    2009-01-01

    Many of the currently established human embryonic stem cell lines have been characterized extensively in terms of their gene expression profiles and genetic stability in culture. Recent studies have indicated that miRNA, a class of non-coding small RNA that participate in the regulation of gene expression, may play a key role in stem cell self renewal and differentiation. Using both microarrays and quantitative PCR, we report here the differences in miRNA expression between undifferentiated human embryonic stem cells (hESC) and their corresponding differentiated cells that underwent differentiation in vitro over a period of two weeks. Our results confirm the identity of a signature miRNA profile in pluripotent cells, comprising a small subset of differentially expressed miRNAs in hESCs. Examining both mRNA and miRNA profiles under multiple conditions using cross-correlation, we find clusters of miRNAs grouped with specific, biologically-interpretable mRNAs. We identify patterns of expression in the progression from hESC to differentiated cells that suggest a role for selected miRNAs in maintenance of the undifferentiated, pluripotent state. Profiling of the hESC “miRNA-ome” provides an insight into molecules that control cellular differentiation and maintenance of the pluripotent state, findings that have broad implications in development, homeostasis and human disease states. PMID:18004940

  20. Determining causality and consequence of expression quantitative trait loci

    PubMed Central

    Battle, A.J.; Montgomery, S.B.

    2014-01-01

    Expression quantitative trait loci (eQTLs) are currently the most abundant and systematically-surveyed class of functional consequence for genetic variation. Recent genetic studies of gene expression have identified thousands of eQTLs in diverse tissue types for the majority of human genes. Application of this large eQTL catalogue provides an important resource for understanding the molecular basis of common genetic diseases. However, only now has both the availability of individuals with full genomes and corresponding advances in functional genomics provided the opportunity to dissect eQTLs to identify causal regulatory variants. Resolving the properties of such causal regulatory variants is improving understanding of the molecular mechanisms that influence traits and guiding the development of new genome-scale approaches to variant interpretation. In this review, we provide an overview of current computational and experimental methods for identifying causal regulatory variants and predicting their phenotypic consequences. PMID:24770875

  1. Rapid and robust association mapping of expression quantitative trait loci.

    PubMed

    Lam, Alex C; Schouten, Michael; Aulchenko, Yurii S; Haley, Chris S; de Koning, Dirk-Jan

    2007-01-01

    We applied a simple and efficient two-step method to analyze a family-based association study of gene expression quantitative trait loci (eQTL) in a mixed model framework. This two-step method produces very similar results to the full mixed model method, with our method being significantly faster than the full model. Using the Genetic Analysis Workshop 15 (GAW15) Problem 1 data, we demonstrated the value of data filtering for reducing the number of tests and controlling the number of false positives. Specifically, we showed that removing non-expressed genes by filtering on expression variability effectively reduced the number of tests by nearly 50%. Furthermore, we demonstrated that filtering on genotype counts substantially reduced spurious detection. Finally, we restricted our analysis to the markers and transcripts that were closely located. We found five times more signals in close proximity (cis-) to transcripts than in our genome-wide analysis. Our results suggest that careful pre-filtering and partitioning of data are crucial for controlling false positives and allowing detection of genuine effects in genetic analysis of gene expression.

  2. Identification of differentially expressed genes in uveal melanoma using suppressive subtractive hybridization

    PubMed Central

    Landreville, Solange; Lupien, Caroline B.; Vigneault, Francois; Gaudreault, Manon; Mathieu, Mélissa; Rousseau, Alain P.; Guérin, Sylvain L.

    2011-01-01

    Purpose Uveal melanoma (UM) is the most common primary cancer of the eye, resulting not only in vision loss, but also in metastatic death. This study attempts to identify changes in the patterns of gene expression that lead to malignant transformation and proliferation of normal uveal melanocytes (UVM) using the Suppressive Subtractive Hybridization (SSH) technique. Methods The SSH technique was used to isolate genes that are differentially expressed in the TP31 cell line derived from a primary UM compared to UVM. The expression level of selected genes was further validated by microarray, semi-quantitative RT–PCR and western blot analyses. Results Analysis of the subtracted libraries revealed that 37 and 36 genes were, respectively, up- and downregulated in TP31 cells compared to UVM. Differential expression of the majority of these genes was confirmed by comparing UM cells with UVM by microarray. The expression pattern of selected genes was analyzed by semi-quantitative RT–PCR and western blot, and was found to be consistent with the SSH findings. Conclusions We demonstrated that the SSH technique is efficient to detect differentially expressed genes in UM. The genes identified in this study represent valuable candidates for further functional analysis in UM and should be informative in studying the biology of this tumor. PMID:21647268

  3. Lentivirus Live Cell Array for Quantitative Assessment of Gene and Pathway Activation during Myogenic Differentiation of Mesenchymal Stem Cells

    PubMed Central

    Tian, Jun; Gaile, Daniel P.; Andreadis, Stelios T.

    2015-01-01

    Stem cell differentiation involves multiple cascades of transcriptional regulation that govern the cell fate. To study the real-time dynamics of this complex process, quantitative and high throughput live cell assays are required. Herein, we developed a lentiviral library of promoters and transcription factor binding sites to quantitatively capture the gene expression dynamics over a period of several days during myogenic differentiation of human mesenchymal stem cells (MSCs) harvested from two different anatomic locations, bone marrow and hair follicle. Our results enabled us to monitor the sequential activation of signaling pathways and myogenic gene promoters at various stages of differentiation. In conjunction with chemical inhibitors, the lentiviral array (LVA) results also revealed the relative contribution of key signaling pathways that regulate the myogenic differentiation. Our study demonstrates the potential of LVA to monitor the dynamics of gene and pathway activation during MSC differentiation as well as serve as a platform for discovery of novel molecules, genes and pathways that promote or inhibit complex biological processes. PMID:26505747

  4. [Screening of differentially expressed genes during adipocyte differentiation by suppression subtractive hybridization technique].

    PubMed

    Yi, Xiao-qing; Xiao, Yan-feng; Yin, Chun-yan; Xu, Er-di

    2012-05-01

    To screening differentially expressed genes related to adipocyte differentiation. Total RNA extracted from the preadipocyte cell line SW872 was taken as the Driver and the total RNA from the differentiated adipocytes SW872 as the Tester. Suppression subtractive hybridization (SSH) was used to isolate the cDNA fragments of differentially expressed genes. The products of SSH were inserted into pGM-T vector to establish the subtractive library. The library was amplified through E.coli transformation and positive clones of the transformants were screened. Positive clones were sequenced. Nucleic acid similarity was subsequently analyzed by comparing with the data from GenBank. There were 135 white clones in the cDNA library, 64 positive clones were chosen randomly and sequenced and similarity search revealed 34 genes which expressed differentially in adipocyte differentiation. The subtracted cDNA library for differentially expressed in adipocyte differentiation has been successfully constructed and the interesting candidate genes related to adipocyte differentiation have been identified.

  5. Characterization and differentiation of three solid tumors using quantitative ultrasound

    NASA Astrophysics Data System (ADS)

    Oelze, Michael L.; O'Brien, William D.; Zachary, James F.

    2004-05-01

    Three kinds of solid tumors were acquired and scanned in vivo ultrasonically. The first tumor series (fibroadenoma) was acquired from tumors that had spontaneously developed in rats. The second tumor series was acquired by culturing a carcinoma cell line (4T1-MMT) in culture media and injecting the cells into Balb/c mice. The third tumor was acquired by transplanting a soft-tissue sarcoma cell line (EHS) into C57BL mice. The tumors were allowed to grow to 1 cm in size and then scanned ultrasonically. The scatterer properties of average scatterer diameter and acoustic concentration were estimated using a Gaussian form factor from the backscattered ultrasound measured from the tumors. Parametric images of the tumors were constructed utilizing estimated scatterer properties for regions of interest inside the tumors. The parametric images showed distinct differences between the various tumor types. Quantitatively, the tumors could be distinguished through feature analysis plots of average scatterer size versus acoustic concentration. Comparison with photomicrographs of the tumors showed structures similar in size to the ultrasound estimates. [Work supported by NIH Grant F32 CA96419 to MLO and by the University of Illinois Research Board.

  6. High throughput, quantitative analysis of human osteoclast differentiation and activity.

    PubMed

    Diepenhorst, Natalie A; Nowell, Cameron J; Rueda, Patricia; Henriksen, Kim; Pierce, Tracie; Cook, Anna E; Pastoureau, Philippe; Sabatini, Massimo; Charman, William N; Christopoulos, Arthur; Summers, Roger J; Sexton, Patrick M; Langmead, Christopher J

    2017-02-15

    Osteoclasts are multinuclear cells that degrade bone under both physiological and pathophysiological conditions. Osteoclasts are therefore a major target of osteoporosis therapeutics aimed at preserving bone. Consequently, analytical methods for osteoclast activity are useful for the development of novel biomarkers and/or pharmacological agents for the treatment of osteoporosis. The nucleation state of an osteoclast is indicative of its maturation and activity. To date, activity is routinely measured at the population level with only approximate consideration of the nucleation state (an 'osteoclast population' is typically defined as cells with ≥3 nuclei). Using a fluorescent substrate for tartrate-resistant acid phosphatase (TRAP), a routinely used marker of osteoclast activity, we developed a multi-labelled imaging method for quantitative measurement of osteoclast TRAP activity at the single cell level. Automated image analysis enables interrogation of large osteoclast populations in a high throughput manner using open source software. Using this methodology, we investigated the effects of receptor activator of nuclear factor kappa-B ligand (RANK-L) on osteoclast maturation and activity and demonstrated that TRAP activity directly correlates with osteoclast maturity (i.e. nuclei number). This method can be applied to high throughput screening of osteoclast-targeting compounds to determine changes in maturation and activity.

  7. Nuclear staining and relative distance for quantifying epidermal differentiation in biomarker expression profiling

    PubMed Central

    Pommerencke, Thora; Steinberg, Thorsten; Dickhaus, Hartmut; Tomakidi, Pascal; Grabe, Niels

    2008-01-01

    Background The epidermal physiology results from a complex regulated homeostasis of keratinocyte proliferation, differentiation and death and is tightly regulated by a specific protein expression during cellular maturation. Cellular in silico models are considered a promising and inevitable tool for the understanding of this complex system. Hence, we need to incorporate the information of the differentiation dependent protein expression in cell based systems biological models of tissue homeostasis. Such methods require measuring tissue differentiation quantitatively while correlating it with biomarker expression intensities. Results Differentiation of a keratinocyte is characterized by its continuously changing morphology concomitant with its movement from the basal layer to the surface, leading to a decreased average nuclei density throughout the tissue. Based thereon, we designed and evaluated three different mathematical measures (nuclei based, distance based, and joint approach) for quantifying differentiation in epidermal keratinocytes. We integrated them with an immunofluorescent staining and image analysis method for tissue sections, automatically quantifying epidermal differentiation and measuring the corresponding expression of biomarkers. When studying five well-known differentiation related biomarkers in an epidermal neck sample only the resulting biomarker profiles incorporating the relative distance information of cells to the tissue borders (distance based and joint approach) provided a high-resolution view on the whole process of keratinocyte differentiation. By contrast, the inverse nuclei density approach led to an increased resolution at early but heavily decreased resolution at late differentiation. This effect results from the heavy non-linear decay of DAPI intensity per area, probably caused by cytoplasmic growth and chromatin decondensation. In the joint approach this effect could be compensated again by incorporating distance information

  8. Differential expression of Ran GTPase during HMBA-induced differentiation in murine erythroleukemia cells.

    PubMed

    Vanegas, N; García-Sacristán, A; López-Fernández, L A; Párraga, M; del Mazo, J; Hernández, P; Schvartzman, J B; Krimer, D B

    2003-07-01

    Murine erythroleukemia (MEL) cells undergo erythroid differentiation in vitro when treated with hexamethylene bisacetamide (HMBA). To identify genes involved in the commitment of MEL cells to differentiate, we screened a cDNA library constructed from HMBA-induced cells by differential hybridization and isolated GTPase Ran as a down-regulated gene. We observed that Ran was expressed in a biphasic mode. Following a decrease in mRNA level during the initial hours of induction, Ran re-expressed at 24-48 h, and gradually declined again. To investigate the role of Ran during MEL differentiation we constructed MEL transfectants capable to express or block Ran mRNA production constitutively. No effects were observed on cell growth and proliferation. Blockage of Ran, however, interfered with MEL cell differentiation resulting in a decrease of cell survival in the committed population.

  9. α-Syntrophin Modulates Myogenin Expression in Differentiating Myoblasts

    PubMed Central

    Kim, Min Jeong; Hwang, Sung Ho; Lim, Jeong A.; Froehner, Stanley C.; Adams, Marvin E.; Kim, Hye Sun

    2010-01-01

    Background α-Syntrophin is a scaffolding protein linking signaling proteins to the sarcolemmal dystrophin complex in mature muscle. However, α-syntrophin is also expressed in differentiating myoblasts during the early stages of muscle differentiation. In this study, we examined the relationship between the expression of α-syntrophin and myogenin, a key muscle regulatory factor. Methods and Findings The absence of α-syntrophin leads to reduced and delayed myogenin expression. This conclusion is based on experiments using muscle cells isolated from α-syntrophin null mice, muscle regeneration studies in α-syntrophin null mice, experiments in Sol8 cells (a cell line that expresses only low levels of α-syntrophin) and siRNA studies in differentiating C2 cells. In primary cultured myocytes isolated from α-syntrophin null mice, the level of myogenin was less than 50% that from wild type myocytes (p<0.005) 40 h after differentiation induction. In regenerating muscle, the expression of myogenin in the α-syntrophin null muscle was reduced to approximately 25% that of wild type muscle (p<0.005). Conversely, myogenin expression is enhanced in primary cultures of myoblasts isolated from a transgenic mouse over-expressing α-syntrophin and in Sol8 cells transfected with a vector to over-express α-syntrophin. Moreover, we find that myogenin mRNA is reduced in the absence of α-syntrophin and increased by α-syntrophin over-expression. Immunofluorescence microscopy shows that α-syntrophin is localized to the nuclei of differentiating myoblasts. Finally, immunoprecipitation experiments demonstrate that α-syntrophin associates with Mixed-Lineage Leukemia 5, a regulator of myogenin expression. Conclusions We conclude that α-syntrophin plays an important role in regulating myogenesis by modulating myogenin expression. PMID:21179410

  10. Differential gene expression of two extreme honey bee (Apis mellifera) colonies showing varroa tolerance and susceptibility.

    PubMed

    Jiang, S; Robertson, T; Mostajeran, M; Robertson, A J; Qiu, X

    2016-06-01

    Varroa destructor, an ectoparasitic mite of honey bees (Apis mellifera), is the most serious pest threatening the apiculture industry. In our honey bee breeding programme, two honey bee colonies showing extreme phenotypes for varroa tolerance/resistance (S88) and susceptibility (G4) were identified by natural selection from a large gene pool over a 6-year period. To investigate potential defence mechanisms for honey bee tolerance to varroa infestation, we employed DNA microarray and real time quantitative (PCR) analyses to identify differentially expressed genes in the tolerant and susceptible colonies at pupa and adult stages. Our results showed that more differentially expressed genes were identified in the tolerant bees than in bees from the susceptible colony, indicating that the tolerant colony showed an increased genetic capacity to respond to varroa mite infestation. In both colonies, there were more differentially expressed genes identified at the pupa stage than at the adult stage, indicating that pupa bees are more responsive to varroa infestation than adult bees. Genes showing differential expression in the colony phenotypes were categorized into several groups based on their molecular functions, such as olfactory signalling, detoxification processes, exoskeleton formation, protein degradation and long-chain fatty acid metabolism, suggesting that these biological processes play roles in conferring varroa tolerance to naturally selected colonies. Identification of differentially expressed genes between the two colony phenotypes provides potential molecular markers for selecting and breeding varroa-tolerant honey bees. © 2016 The Royal Entomological Society.

  11. [Mechanism on differential gene expression and heterosis formation].

    PubMed

    Xu, Chen-Lu; Sun, Xiao-Mei; Zhang, Shou-Gong

    2013-06-01

    Despite the rediscovery of heterosis about a century ago and the suggestion of various genetic models to explain this phenomenon, little consensus has yet been reached about the genetic basis of heterosis. Following the genome organization variation and gene effects, an understanding of gene differential expression in hybrids and its parents provides a new opportunity to speculate on mechanisms that might lead to heterosis. Investigation on allele-specific gene expression in hybrid and gene differential expression between hybrids and its parents might contribute to improve our understanding of the molecular basis of heterosis and eventually guide breeding practices. In this review, we discussed the recent researches on allelic-specific expression in hybrid which was frequently observed in recent studies and analyzed its regulatory mechanism. All possible modes of gene action, including additivity, high- and low-parent dominance, underdominance, and over-dominance, were observed when investigating gene differential expression between hybrids and its parents. Data from transcriptomic studies screened several heterosis-associated genes and highlighted the importance of certain key biochemical pathways that may prove to be quintessential for the manifestation of heterosis. So far, no uniform global expression pat-terns were observed in these gene expression studies. Most heterosis-associated gene expression analyses have not revealed a predominant functional category to which differentially expressed genes belong. However, these gene expression profiling studies represent a first step towards the definition of the complex gene expression networks that might be relevant in the context of heterosis. New technique on gene expression profile and advancements in bioinformatics will facilitate our understanding of the genetic basis of heterosis at the gene-expression level.

  12. Quantitative RT-PCR analysis of estrogen receptor gene expression in laser microdissected prostate cancer tissue.

    PubMed

    Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C

    2009-06-01

    Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P < 0.01). In contrast, PGR expression was significantly down-regulated in the cancer group (P < 0.05). There were no significant differences in AR, ERalpha or PSA expression between the groups. This study represents the first to show an upregulation of ERbeta gene expression in laser microdissected prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.

  13. Transcriptome Analysis of Differentially Expressed Genes Relevant to Variegation in Peach Flowers

    PubMed Central

    Yu, Faxin; Li, Shuxian; Yin, Tongming

    2014-01-01

    Background Variegation in flower color is commonly observed in many plant species and also occurs on ornamental peaches (Prunus persica f. versicolor [Sieb.] Voss). Variegated plants are highly valuable in the floricultural market. To gain a global perspective on genes differentially expressed in variegated peach flowers, we performed large-scale transcriptome sequencing of white and red petals separately collected from a variegated peach tree. Results A total of 1,556,597 high-quality reads were obtained, with an average read length of 445 bp. The ESTs were assembled into 16,530 contigs and 42,050 singletons. The resulting unigenes covered about 60% of total predicted genes in the peach genome. These unigenes were further subjected to functional annotation and biochemical pathway analysis. Digital expression analysis identified a total of 514 genes differentially expressed between red and white flower petals. Since peach flower coloration is determined by the expression and regulation of structural genes relevant to flavonoid biosynthesis, a detailed examination detected four key structural genes, including C4H, CHS, CHI and F3H, expressed at a significantly higher level in red than in white petal. Except for the structural genes, we also detected 11 differentially expressed regulatory genes relating to flavonoid biosynthesis. Using the differentially expressed structural genes as the test objects, we validated the digital expression results by using quantitative real-time PCR, and the differential expression of C4H, CHS and F3H were confirmed. Conclusion In this study, we generated a large EST collection from flower petals of a variegated peach. By digital expression analysis, we identified an informative list of candidate genes associated with variegation in peach flowers, which offered a unique opportunity to uncover the genetic mechanisms underlying flower color variegation. PMID:24603808

  14. Gene expression during normal and malignant differentiation

    SciTech Connect

    Andersson, L.C.; Gahmberg, C.G.; Ekblom, P.

    1985-01-01

    This book contains 18 selections. Some of the titles are: Exploring Carcinogenesis with Retroviral and Cellular Oncogenes; Retroviruses, Oncogenes and Evolution; HTLV and Human Neoplasi; Modes of Activation of cMyc Oncogene in B and T Lymphoid Tumors; The Structure and Function of the Epidermal Growth Factor Receptor: Its Relationship to the Protein Product of the V-ERB-B Oncogene; and Expression of Human Retrovirus Genes in Normal and Neoplastic Epithelial Cells.

  15. Identification of suitable reference genes for quantitative RT-PCR during 3T3-L1 adipocyte differentiation.

    PubMed

    Zhang, Juan; Tang, Hongju; Zhang, Yuqing; Deng, Ruyuan; Shao, Li; Liu, Yun; Li, Fengying; Wang, Xiao; Zhou, Libin

    2014-05-01

    Quantitative reverse transcription PCR (qRT-PCR) is becoming increasingly important in the effort to gain insight into the molecular mechanisms underlying adipogenesis. However, the expression profile of a target gene may be misinterpreted due to the unstable expression of the reference genes under different experimental conditions. Therefore, in this study, we investigated the expression stability of 10 commonly used reference genes during 3T3-L1 adipocyte differentiation. The mRNA expression levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and transferrin receptor (TFRC) significantly increased during the course of 3T3-L1 adipocyte differentiation, which was decreased by berberine, an inhibitor of adipogenesis. Three popular algorithms, GeNorm, NormFinder and BestKeeper, identified 18 ribosomal RNA and hydroxymethylbilane synthase (HMBS) as the most stable reference genes, while GAPDH and TFRC were the least stable ones. Peptidylprolyl isomerase A [PIPA (cyclophilin A)], ribosomal protein, large, P0 (36-B4), beta-2-microglobulin (B2M), α1-tubulin, hypoxanthine-guanine phosphoribosyltransferase (HPRT) and β-actin showed relatively stable expression levels. The choice of reference genes with various expression stabilities exerted a profound influence on the expression profiles of 2 target genes, peroxisome proliferator-activated receptor (PPAR)γ2 and C/EBPα. In addition, western blot analysis revealed that the increased protein expression of GAPDH was markedly inhibited by berberine during adipocyte differentiation. This study highlights the importance of selecting suitable reference genes for qRT-PCR studies of gene expression during the process of adipogenesis.

  16. Differential expression of somatostatin receptors in medulloblastoma.

    PubMed

    Guyotat, J; Champier, J; Pierre, G S; Jouvet, A; Bret, P; Brisson, C; Belin, M F; Signorelli, F; Montange, M F

    2001-01-01

    Somatostatin receptors have been found on a variety of tumours like neuroendocrine breast or brain tumours. Their detection opens new diagnostic and therapeutic paths. The aim of this work was to investigate their expression in medulloblastomas. Using both techniques, reverse transcriptase-polymerase chain reaction and immunohistochemistry, we analysed mRNA of different subtypes of somatostatin receptors in 15 medulloblastomas and the localisation of the subtype SSTR2 receptor at the cellular level in 13 medulloblastomas. All five subtypes mRNA were variably expressed in each medulloblastoma. The signal obtained after Southern blotting for SSTR2 receptor amplification was the highest as compared to the signal obtained for the other receptor subtypes. Immunostaining for SSTR2A receptor was present in every tumour specimen and was specifically located to the cellular membrane of neoplastic cells. No staining was identified at the level of peritumoral veins. The evidence of predominant expression of SSTR2 receptors in medulloblastomas opens interesting prospects for their diagnosis and therapy.

  17. Regulation of mda-7 gene expression during human melanoma differentiation.

    PubMed

    Madireddi, M T; Dent, P; Fisher, P B

    2000-03-02

    Induction of irreversible growth arrest and terminal differentiation in human melanoma cells following treatment with recombinant human fibroblast interferon (IFN-beta) and mezerein (MEZ) results in elevated expression of a specific melanoma differentiation associated gene, mda-7. Experiments were conducted to define the mechanism involved in the regulation of mda-7 expression in differentiating human melanoma cells. The mda-7 gene is actively transcribed in uninduced HO-1 human melanoma cells and the rate of transcription of mda-7 is not significantly enhanced by treatment with IFN-beta, MEZ or IFN-beta+MEZ. The high basal activity of the mda-7 promoter in uninduced melanoma cells and the absence of enhancing effect upon treatment with differentiation inducers is corroborated by transfection studies using the promoter region of mda-7 linked to a luciferase reporter gene containing the SV40 polyadenylation signal sequence. RT - PCR analysis detects the presence of low levels of mda-7 transcripts in uninduced and concomitant increases in differentiation inducer treated HO-1 cells. However, steady-state mda-7 mRNA is detected only in IFN-beta+MEZ and to a lesser degree in MEZ treated cells. We show that induction of terminal differentiation of HO-1 cells with IFN-beta+MEZ dramatically increases the half-life of mda-7 mRNA while treatment with cycloheximide results in detectable mda-7 mRNA in control and inducer treated cells. These observations confirm constitutive activity of the mda-7 promoter in HO-1 cells irrespective of differentiation status suggesting posttranscriptional processes as important determinants of mda-7 expression during terminal differentiation. The 3' UTR region of mda-7 contains AU-rich elements (ARE) that contribute to rapid mda-7 mRNA turnover during proliferation and reversible differentiation, a process controlled by a labile protein factor(s). Substitution of the SV40 polyadenylation signal sequence in the luciferase reporter plasmid with

  18. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  19. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  20. Differentiating hippocampal subregions by means of quantitative magnetization transfer and relaxometry: preliminary results.

    PubMed

    Kiefer, Claus; Slotboom, Johannes; Buri, Caroline; Gralla, Jan; Remonda, Luca; Dierks, Thomas; Strik, Werner K; Schroth, Gerhard; Kalus, Peter

    2004-11-01

    The hippocampal formation (HF) of healthy control subjects and schizophrenic patients was examined using an MRI experiment that implements sequences for relaxometry and magnetization transfer (MT) quantification. In addition to the semi-quantitative magnetization transfer ratio (MTR), all of the observable properties of the binary spin bath model were included. The study demonstrates that, in contrast to the MTR, quantitative MT parameters (especially the T2 relaxation time of restricted protons, T2b) are capable to differentiate functionally significant subregions within the HF. The MT methodology appears to be a promising new tool for the differential microstructural evaluation of the HF in neuropsychiatric disorders accompanied by memory disturbances.

  1. Differential expression of c-kit in mouse undifferentiated and differentiating type A spermatogonia.

    PubMed

    Schrans-Stassen, B H; van de Kant, H J; de Rooij, D G; van Pelt, A M

    1999-12-01

    The proto-oncogene c-kit is encoded at the white-spotting locus and in the mouse mutations at this locus affect the precursor cells of melanocytes, hematopoietic cells, and germ cells. c-kit is expressed in type A spermatogonia, but whether or not c-kit is present both in undifferentiated and differentiating type A spermatogonia or only in the latter cell type is still a matter of debate. Using the vitamin A-deficient mouse model, we studied messenger RNA (mRNA) and protein expression in undifferentiated and differentiating type A spermatogonia. Furthermore, we quantified the immuno-positive type A spermatogonia in the epithelial stages VI, VII, IX/X, and XII in normal mice to correlate c-kit expression in type A spermatogonia with the differentiation of these cells. Our results show that in the VAD situation undifferentiated type A spermatogonia express little c-kit mRNA. The A spermatogonia with a larger nucleus expressed c-Kit protein, whereas the A spermatogonia with a smaller one did not. After induction of differentiation of these cells into type A1 spermatogonia, c-kit mRNA was enhanced. The percentage of A spermatogonia expressing c-Kit protein did not change during this process, suggesting that A spermatogonia, which are committed to differentiate express c-kit. Under normal circumstances in epithelial stage VI 16%+/-2% (mean +/- SD), in VII 45%+/-15%, in IX/X 78%+/-14% and in XII 90%+/-1.9% of the type A spermatogonia were c-kit positive, suggesting that Aaligned spermatogonia gradually change from c-Kit negative to c-Kit positive cells before their differentiation into A1 spermatogonia. It is concluded that c-kit can be used as a marker for differentiation of undifferentiated into differentiating type A spermatogonia.

  2. Quantitative Proteomics Reveals GIMAP Family Proteins 1 and 4 to Be Differentially Regulated during Human T Helper Cell Differentiation *S⃞

    PubMed Central

    Filén, Jan-Jonas; Filén, Sanna; Moulder, Robert; Tuomela, Soile; Ahlfors, Helena; West, Anne; Kouvonen, Petri; Kantola, Suvi; Björkman, Mari; Katajamaa, Mikko; Rasool, Omid; Nyman, Tuula A.; Lahesmaa, Riitta

    2009-01-01

    T helper (Th) cells differentiate into functionally distinct effector cell subsets of which Th1 and Th2 cells are best characterized. Besides T cell receptor signaling, IL-12-induced STAT4 and T-bet- and IL-4-induced STAT6 and GATA3 signaling pathways are the major players regulating the Th1 and Th2 differentiation process, respectively. However, there are likely to be other yet unknown factors or pathways involved. In this study we used quantitative proteomics exploiting cleavable ICAT labeling and LC-MS/MS to identify IL-4-regulated proteins from the microsomal fractions of CD4+ cells extracted from umbilical cord blood. We were able to identify 557 proteins of which 304 were also quantified. This study resulted in the identification of the down-regulation of small GTPases GIMAP1 and GIMAP4 by IL-4 during Th2 differentiation. We also showed that both GIMAP1 and GIMAP4 genes are up-regulated by IL-12 and other Th1 differentiation-inducing cytokines in cells induced to differentiate toward Th1 lineage and down-regulated by IL-4 in cells induced to Th2. Our results indicate that the GIMAP (GTPase of the immunity-associated protein) family of proteins is differentially regulated during Th cell differentiation. PMID:18701445

  3. Quantitative analysis of the expression of ACAT genes in human tissues by real-time PCR.

    PubMed

    Smith, Jeffery L; Rangaraj, Kavitha; Simpson, Robert; Maclean, Donald J; Nathanson, Les K; Stuart, Katherine A; Scott, Shaun P; Ramm, Grant A; de Jersey, John

    2004-04-01

    ACAT (also called sterol o-acyltransferase) catalyzes the esterification of cholesterol by reaction with long-chain acyl-CoA derivatives and plays a pivotal role in the regulation of cholesterol homeostasis. Although two human ACAT genes termed ACAT-1 and ACAT-2 have been reported, prior research on differential tissue expression is qualitative and incomplete. We have developed a quantitative multiplex assay for each ACAT isoform after RT treatment of total RNA using TaqMan real-time quantitative PCR normalized to beta-actin in the same reaction tube. This enabled us to calculate the relative abundance of transcripts in several human tissues as an ACAT-2/ACAT-1 ratio. In liver (n = 17), ACAT-1 transcripts were on average 9-fold (range, 1.7- to 167-fold) more abundant than ACAT-2, whereas in duodenal samples (n = 10), ACAT-2 transcripts were on average 3-fold (range, 0.39- to 12.2-fold) more abundant than ACAT-1. ACAT-2 was detected for the first time in peripheral blood mononuclear cells. Interesting differences in ACAT-2 mRNA expression were evident in subgroup analysis of samples from different sources. These results demonstrate quantitatively that ACAT-1 transcripts predominate in human liver and ACAT-2 transcripts predominate in human duodenum and support the notion that ACAT-2 has an important regulatory role in liver and intestine.

  4. An integrated analysis of differential miRNA and mRNA expressions in human gallstones.

    PubMed

    Yang, Bin; Liu, Bin; Bi, Pinduan; Wu, Tao; Wang, Qiang; Zhang, Jie

    2015-04-01

    Gallstone disease, including cholesterol precipitation in bile, increased bile salt hydrophobicity and gallbladder inflammation. Here, we investigated miRNA and mRNA involved in the formation of gallstones, and explored the molecular mechanisms in the development of gallstones. Differentially expressed 17 miRNAs and 525 mRNA were identified based on Illumina sequencing from gallbladder mucosa of patients with or without gallstones, and were validated by randomly selected 6 miRNAs and 8 genes using quantitative RT-PCR. 114 miRNA target genes were identified, whose functions and regulating pathways were related to gallstones. The differentially expressed genes were enriched upon lipoprotein binding and some metabolic pathways, and differentially expressed miRNAs enriched upon ABC transportation and cancer related pathways. A molecular regulatory network consisting of 17 differentially expressed miRNAs, inclusive of their target genes, was constructed. miR-210 and its potential target gene ATP11A were found to be differentially expressed in both miRNA and mRNA profiles. ATP11A was a direct target of miR-210, which was predicted to regulate the ABC-transporters pathway. The expression levels of ATP11A in the gallstone showed inverse correlation with miR-210 expression, and up-regulation of miR-210 could reduce ATP11A expression in HGBEC. This is the first report that indicates the existence of differences in miRNA and mRNA expression in patients with or without gallstones. Our data shed light on further investigating the mechanisms of gallstone formation.

  5. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  6. Polyester: simulating RNA-seq datasets with differential transcript expression

    PubMed Central

    Frazee, Alyssa C.; Jaffe, Andrew E.; Langmead, Ben; Leek, Jeffrey T.

    2015-01-01

    Motivation: Statistical methods development for differential expression analysis of RNA sequencing (RNA-seq) requires software tools to assess accuracy and error rate control. Since true differential expression status is often unknown in experimental datasets, artificially constructed datasets must be utilized, either by generating costly spike-in experiments or by simulating RNA-seq data. Results: Polyester is an R package designed to simulate RNA-seq data, beginning with an experimental design and ending with collections of RNA-seq reads. Its main advantage is the ability to simulate reads indicating isoform-level differential expression across biological replicates for a variety of experimental designs. Data generated by Polyester is a reasonable approximation to real RNA-seq data and standard differential expression workflows can recover differential expression set in the simulation by the user. Availability and implementation: Polyester is freely available from Bioconductor (http://bioconductor.org/). Contact: jtleek@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25926345

  7. In-depth cDNA library sequencing provides quantitative gene expression profiling in cancer biomarker discovery.

    PubMed

    Yang, Wanling; Ying, Dingge; Lau, Yu-Lung

    2009-06-01

    Quantitative gene expression analysis plays an important role in identifying differentially expressed genes in various pathological states, gene expression regulation and co-regulation, shedding light on gene functions. Although microarray is widely used as a powerful tool in this regard, it is suboptimal quantitatively and unable to detect unknown gene variants. Here we demonstrated effective detection of differential expression and co-regulation of certain genes by expressed sequence tag analysis using a selected subset of cDNA libraries. We discussed the issues of sequencing depth and library preparation, and propose that increased sequencing depth and improved preparation procedures may allow detection of many expression features for less abundant gene variants. With the reduction of sequencing cost and the emerging of new generation sequencing technology, in-depth sequencing of cDNA pools or libraries may represent a better and powerful tool in gene expression profiling and cancer biomarker detection. We also propose using sequence-specific subtraction to remove hundreds of the most abundant housekeeping genes to increase sequencing depth without affecting relative expression ratio of other genes, as transcripts from as few as 300 most abundantly expressed genes constitute about 20% of the total transcriptome. In-depth sequencing also represents a unique advantage of detecting unknown forms of transcripts, such as alternative splicing variants, fusion genes, and regulatory RNAs, as well as detecting mutations and polymorphisms that may play important roles in disease pathogenesis.

  8. Quantitative expression of the homeobox and integrin genes in human gastric carcinoma.

    PubMed

    Rossi Degl'Innocenti, Duccio; Castiglione, Francesca; Buccoliero, Anna Maria; Bechi, Paolo; Taddei, Gian Luigi; Freschi, Giancarlo; Taddei, Antonio

    2007-10-01

    The homeobox (HOX) genes are a large family of regulator genes involved in the control of developmental processes and cell differentiation. The HOX genes encode transcription factors, and an increasing number of studies have shown that these genes may be implicated in the growth and the progression of many types of tumours. The present study investigated the expression of the HOX and integrin genes and their relationships in gastric carcinoma. We analyzed the RNA expression of 13 HOX genes from HOXA, C and D clusters and alphaV, alpha5 and alpha8 integrin genes in 24 gastric cancer samples by quantitative real-time PCR. The results showed that the HOXA2 gene and the alpha8 integrin gene had a lower expression in tumour samples than in normal gastric mucosas. The comparison between the HOX and integrin genes showed that HOXA2 and alphaV integrin expression presented the same trend in 83% of the samples. Moreover, in cancer samples that expressed the HOXD11 gene, the expression of alphaV integrin was lower with respect to normal mucosas. The different roles of HOX and integrin genes in gastric carcinoma remain to be fully elucidated. These findings suggest that the HOX genes may play a critical role in the genesis, maintenance and diffusion of gastric carcinoma.

  9. Differential Expression and Network Inferences through Functional Data Modeling

    PubMed Central

    Telesca, Donatello; Inoue, Lurdes Y.T.; Neira, Mauricio; Etzioni, Ruth; Gleave, Martin; Nelson, Colleen

    2010-01-01

    Time–course microarray data consist of mRNA expression from a common set of genes collected at different time points. Such data are thought to reflect underlying biological processes developing over time. In this article we propose a model that allows us to examine differential expression and gene network relationships using time course microarray data. We model each gene expression profile as a random functional transformation of the scale, amplitude and phase of a common curve. Inferences about the gene–specific amplitude parameters allow us to examine differential gene expression. Inferences about measures of functional similarity based on estimated time transformation functions allow us to examine gene networks while accounting for features of the gene expression profiles. We discuss applications to simulated data as well as to microarray data on prostate cancer progression. PMID:19053995

  10. Differential Expression of Cysteine Dioxygenase 1 in Complex Karyotype Liposarcomas

    PubMed Central

    Shaker, Mohammed; Pascarelli, Kara M; Plantinga, Matthew J; Love, Miles A; Lazar, Alexander J; Ingram, Davis R; von Mehren, Margaret; Lev, Dina; Kipling, David; Broccoli, Dominique

    2014-01-01

    Altered cysteine dioxygenase 1 (CDO1) gene expression has been observed in several cancers but has not yet been investigated in liposarcomas. The aim of this study was to evaluate CDO1 expression in a cohort of liposarcomas and to determine its association with clinicopathological features. Existing microarray data indicated variable CDO1 expression in liposarcoma subtypes. CDO1 mRNA from a larger cohort of liposarcomas was quantified by real time-PCR, and CDO1 protein expression was determined by immunohistochemistry (IHC) in more than 300 tumor specimens. Well-differentiated liposarcomas (WDLSs) had significantly higher CDO1 gene expression and protein levels than dedifferentiated liposarcomas (DDLSs) (P < 0.001). Location of the tumor was not predictive of the expression level of CDO1 mRNA in any histological subtype of liposarcoma. Recurrent tumors did not show any difference in CDO1 expression when compared to primary tumors. CDO1 expression was upregulated as human mesenchymal stem cells (hMSCs) undergo differentiation into mature adipocytes. Our results suggest that CDO1 is a marker of liposarcoma progression and adipogenic differentiation. PMID:24741338

  11. Pomelo II: finding differentially expressed genes.

    PubMed

    Morrissey, Edward R; Diaz-Uriarte, Ramón

    2009-07-01

    Pomelo II (http://pomelo2.bioinfo.cnio.es) is an open-source, web-based, freely available tool for the analysis of gene (and protein) expression and tissue array data. Pomelo II implements: permutation-based tests for class comparisons (t-test, ANOVA) and regression; survival analysis using Cox model; contingency table analysis with Fisher's exact test; linear models (of which t-test and ANOVA are especial cases) that allow additional covariates for complex experimental designs and use empirical Bayes moderated statistics. Permutation-based and Cox model analysis use parallel computing, which permits taking advantage of multicore CPUs and computing clusters. Access to, and further analysis of, additional biological information and annotations (PubMed references, Gene Ontology terms, KEGG and Reactome pathways) are available either for individual genes (from clickable links in tables and figures) or sets of genes. The source code is available, allowing for extending and reusing the software. A comprehensive test suite is also available, and covers both the user interface and the numerical results. The possibility of including additional covariates, parallelization of computation, open-source availability of the code and comprehensive testing suite make Pomelo II a unique tool.

  12. Pomelo II: finding differentially expressed genes

    PubMed Central

    Morrissey, Edward R.; Diaz-Uriarte, Ramón

    2009-01-01

    Pomelo II (http://pomelo2.bioinfo.cnio.es) is an open-source, web-based, freely available tool for the analysis of gene (and protein) expression and tissue array data. Pomelo II implements: permutation-based tests for class comparisons (t-test, ANOVA) and regression; survival analysis using Cox model; contingency table analysis with Fisher's exact test; linear models (of which t-test and ANOVA are especial cases) that allow additional covariates for complex experimental designs and use empirical Bayes moderated statistics. Permutation-based and Cox model analysis use parallel computing, which permits taking advantage of multicore CPUs and computing clusters. Access to, and further analysis of, additional biological information and annotations (PubMed references, Gene Ontology terms, KEGG and Reactome pathways) are available either for individual genes (from clickable links in tables and figures) or sets of genes. The source code is available, allowing for extending and reusing the software. A comprehensive test suite is also available, and covers both the user interface and the numerical results. The possibility of including additional covariates, parallelization of computation, open-source availability of the code and comprehensive testing suite make Pomelo II a unique tool. PMID:19435879

  13. Identification of genes differentially expressed in menstrual breakdown and repair.

    PubMed

    Paiva, Premila; Lockhart, Michelle G; Girling, Jane E; Olshansky, Moshe; Woodrow, Nicole; Marino, Jennifer L; Hickey, Martha; Rogers, Peter A W

    2016-12-01

    Does the changing molecular profile of the endometrium during menstruation correlate with the histological profile of menstruation. We identified several genes not previously associated with menstruation; on Day 2 of menstruation (early-menstruation), processes related to inflammation are predominantly up-regulated and on Day 4 (late-menstruation), the endometrium is predominantly repairing and regenerating. Menstruation is induced by progesterone withdrawal at the end of the menstrual cycle and involves endometrial tissue breakdown, regeneration and repair. Perturbations in the regulation of menstruation may result in menstrual disorders including abnormal uterine bleeding. Endometrial samples were collected by Pipelle biopsy on Days 2 (n = 9), 3 (n = 9) or 4 (n = 6) of menstruation. RNA was extracted from endometrial biopsies and analysed by genome wide expression Illumina Sentrix Human HT12 arrays. Data were analysed using 'Remove Unwanted Variation-inverse (RUV-inv)'. Ingenuity pathway analysis (IPA) and the Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.7 were used to identify canonical pathways, upstream regulators and functional gene clusters enriched between Days 2, 3 and 4 of menstruation. Selected individual genes were validated by quantitative PCR. Overall, 1753 genes were differentially expressed in one or more comparisons. Significant canonical pathways, gene clusters and upstream regulators enriched during menstrual bleeding included those associated with immune cell trafficking, inflammation, cell cycle regulation, extracellular remodelling and the complement and coagulation cascade. We provide the first evidence for a role for glutathione-mediated detoxification (glutathione-S-transferase mu 1 and 2; GSTM1 and GSTM2) during menstruation. The largest number of differentially expressed genes was between Days 2 and 4 of menstruation (n = 1176). We identified several genes not previously associated with menstruation

  14. Identification of genes differentially expressed in ectomycorrhizal roots during the Pinus pinaster-Laccaria bicolor interaction.

    PubMed

    Flores-Monterroso, Aranzazu; Canales, Javier; de la Torre, Fernando; Ávila, Concepción; Cánovas, Francisco M

    2013-06-01

    Ectomycorrhizal associations are of major ecological importance in temperate and boreal forests. The development of a functional ectomycorrhiza requires many genetic and biochemical changes. In this study, suppressive subtraction hybridization was used to identify differentially expressed genes in the roots of maritime pine (Pinus pinaster Aiton) inoculated with Laccaria bicolor, a mycorrhizal fungus. A total number of 200 unigenes were identified as being differentially regulated in maritime pine roots during the development of mycorrhiza. These unigenes were classified into 10 categories according to the function of their homologues in the GenBank database. Approximately, 40 % of the differentially expressed transcripts were genes that coded for unknown proteins in the databases or that had no homology to known genes. A group of these differentially expressed genes was selected to validate the results using quantitative real-time PCR. The transcript levels of the representative genes were compared between the non-inoculated and inoculated plants at 1, 5, 15 and 30 days after inoculation. The observed expression patterns indicate (1) changes in the composition of the wall cell, (2) tight regulation of defence genes during the development of mycorrhiza and (3) changes in carbon and nitrogen metabolism. Ammonium excess or deficiency dramatically affected the stability of ectomycorrhiza and altered gene expression in maritime pine roots.

  15. Differentially expressed proteins underlying childhood cortical dysplasia with epilepsy identified by iTRAQ proteomic profiling

    PubMed Central

    Liu, Shiyong; Liu, Yi; Yang, Yixuan; Yang, Hui; Chen, Yangmei; Chen, Lifen

    2017-01-01

    Cortical dysplasia accounts for at least 14% of epilepsy cases, and is mostly seen in children. However, the understanding of molecular mechanisms and pathogenesis underlying cortical dysplasia is limited. The aim of this cross-sectional study is to identify potential key molecules in the mechanisms of cortical dysplasia by screening the proteins expressed in brain tissues of childhood cortical dysplasia patients with epilepsy using isobaric tags for relative and absolute quantitation-based tandem mass spectrometry compared to controls, and several differentially expressed proteins that are not reported to be associated with cortical dysplasia previously were selected for validation using real-time polymerase chain reaction, immunoblotting and immunohistochemistry. 153 out of 3340 proteins were identified differentially expressed between childhood cortical dysplasia patients and controls. And FSCN1, CRMP1, NDRG1, DPYSL5, MAP4, and FABP3 were selected for validation and identified to be increased in childhood cortical dysplasia patients, while PRDX6 and PSAP were identified decreased. This is the first report on differentially expressed proteins in childhood cortical dysplasia. We identified differential expression of FSCN1, CRMP1, NDRG1, DPYSL5, MAP4, FABP3, PRDX6 and PSAP in childhood cortical dysplasia patients, these proteins are involved in various processes and have various function. These results may provide new directions or targets for the research of childhood cortical dysplasia, and may be helpful in revealing molecular mechanisms and pathogenesis and/or pathophysiology of childhood cortical dysplasia if further investigated. PMID:28222113

  16. Quantitative Analysis of Protein Expression to Study Lineage Specification in Mouse Preimplantation Embryos

    PubMed Central

    Saiz, Nestor; Kang, Minjung; Schrode, Nadine; Lou, Xinghua; Hadjantonakis, Anna-Katerina

    2016-01-01

    This protocol presents a method to perform quantitative, single-cell in situ analyses of protein expression to study lineage specificationin mouse preimplantation embryos. The procedures necessary for embryo collection, immunofluorescence, imaging on a confocal microscope, and image segmentation and analysis are described. This method allows quantitation of the expression of multiple nuclear markers and the spatial (XYZ) coordinates of all cells in the embryo. It takes advantage of MINS, an image segmentation software tool specifically developed for the analysis of confocal images of preimplantation embryos and embryonic stem cell (ESC) colonies. MINS carries out unsupervised nuclear segmentation across the X, Y and Z dimensions, and produces information on cell position in three-dimensional space, as well as nuclear fluorescence levels for all channels with minimal user input. While this protocol has been optimized for the analysis of images of preimplantation stage mouse embryos, it can easily be adapted to the analysis of any other samples exhibiting a good signal-to-noise ratio and where high nuclear density poses a hurdle to image segmentation (e.g., expression analysis of embryonic stem cell (ESC) colonies, differentiating cells in culture, embryos of other species or stages, etc.). PMID:26967230

  17. Differential expression of pancreatic protein and chemosensing receptor mRNAs in NKCC1-null intestine

    PubMed Central

    Bradford, Emily M; Vairamani, Kanimozhi; Shull, Gary E

    2016-01-01

    AIM: To investigate the intestinal functions of the NKCC1 Na+-K+-2Cl cotransporter (SLC12a2 gene), differential mRNA expression changes in NKCC1-null intestine were analyzed. METHODS: Microarray analysis of mRNA from intestines of adult wild-type mice and gene-targeted NKCC1-null mice (n = 6 of each genotype) was performed to identify patterns of differential gene expression changes. Differential expression patterns were further examined by Gene Ontology analysis using the online Gorilla program, and expression changes of selected genes were verified using northern blot analysis and quantitative real time-polymerase chain reaction. Histological staining and immunofluorescence were performed to identify cell types in which upregulated pancreatic digestive enzymes were expressed. RESULTS: Genes typically associated with pancreatic function were upregulated. These included lipase, amylase, elastase, and serine proteases indicative of pancreatic exocrine function, as well as insulin and regenerating islet genes, representative of endocrine function. Northern blot analysis and immunohistochemistry showed that differential expression of exocrine pancreas mRNAs was specific to the duodenum and localized to a subset of goblet cells. In addition, a major pattern of changes involving differential expression of olfactory receptors that function in chemical sensing, as well as other chemosensing G-protein coupled receptors, was observed. These changes in chemosensory receptor expression may be related to the failure of intestinal function and dependency on parenteral nutrition observed in humans with SLC12a2 mutations. CONCLUSION: The results suggest that loss of NKCC1 affects not only secretion, but also goblet cell function and chemosensing of intestinal contents via G-protein coupled chemosensory receptors. PMID:26909237

  18. Differential expression of pancreatic protein and chemosensing receptor mRNAs in NKCC1-null intestine.

    PubMed

    Bradford, Emily M; Vairamani, Kanimozhi; Shull, Gary E

    2016-02-15

    To investigate the intestinal functions of the NKCC1 Na(+)-K(+)-2Cl cotransporter (SLC12a2 gene), differential mRNA expression changes in NKCC1-null intestine were analyzed. Microarray analysis of mRNA from intestines of adult wild-type mice and gene-targeted NKCC1-null mice (n = 6 of each genotype) was performed to identify patterns of differential gene expression changes. Differential expression patterns were further examined by Gene Ontology analysis using the online Gorilla program, and expression changes of selected genes were verified using northern blot analysis and quantitative real time-polymerase chain reaction. Histological staining and immunofluorescence were performed to identify cell types in which upregulated pancreatic digestive enzymes were expressed. Genes typically associated with pancreatic function were upregulated. These included lipase, amylase, elastase, and serine proteases indicative of pancreatic exocrine function, as well as insulin and regenerating islet genes, representative of endocrine function. Northern blot analysis and immunohistochemistry showed that differential expression of exocrine pancreas mRNAs was specific to the duodenum and localized to a subset of goblet cells. In addition, a major pattern of changes involving differential expression of olfactory receptors that function in chemical sensing, as well as other chemosensing G-protein coupled receptors, was observed. These changes in chemosensory receptor expression may be related to the failure of intestinal function and dependency on parenteral nutrition observed in humans with SLC12a2 mutations. The results suggest that loss of NKCC1 affects not only secretion, but also goblet cell function and chemosensing of intestinal contents via G-protein coupled chemosensory receptors.

  19. Dynamic changes in gene expression during human trophoblast differentiation.

    PubMed

    Handwerger, Stuart; Aronow, Bruce

    2003-01-01

    The genetic program that directs human placental differentiation is poorly understood. In a recent study, we used DNA microarray analyses to determine genes that are dynamically regulated during human placental development in an in vitro model system in which highly purified cytotrophoblast cells aggregate spontaneously and fuse to form a multinucleated syncytium that expresses placental lactogen, human chorionic gonadotropin, and other proteins normally expressed by fully differentiated syncytiotrophoblast cells. Of the 6918 genes present on the Incyte Human GEM V microarray that we analyzed over a 9-day period, 141 were induced and 256 were downregulated by more than 2-fold. The dynamically regulated genes fell into nine distinct kinetic patterns of induction or repression, as detected by the K-means algorithm. Classifying the genes according to functional characteristics, the regulated genes could be divided into six overall categories: cell and tissue structural dynamics, cell cycle and apoptosis, intercellular communication, metabolism, regulation of gene expression, and expressed sequence tags and function unknown. Gene expression changes within key functional categories were tightly coupled to the morphological changes that occurred during trophoblast differentiation. Within several key gene categories (e.g., cell and tissue structure), many genes were strongly activated, while others with related function were strongly repressed. These findings suggest that trophoblast differentiation is augmented by "categorical reprogramming" in which the ability of induced genes to function is enhanced by diminished synthesis of other genes within the same category. We also observed categorical reprogramming in human decidual fibroblasts decidualized in vitro in response to progesterone, estradiol, and cyclic AMP. While there was little overlap between genes that are dynamically regulated during trophoblast differentiation versus decidualization, many of the categories

  20. Differential modulation of gene expression in the NMDA postsynaptic density of schizophrenic and control smokers.

    PubMed

    Mexal, S; Frank, M; Berger, R; Adams, C E; Ross, R G; Freedman, R; Leonard, S

    2005-10-03

    Nicotine is known to induce the release of multiple neurotransmitters, including glutamate and dopamine, through activation of nicotinic receptors. Gene expression in the N-methyl-d-aspartate postsynaptic density (NMDA-PSD), as well as other functional groups, was compared in postmortem hippocampus of schizophrenic and nonmentally ill smokers and nonsmokers utilizing a microarray and quantitative RT-PCR approach. The expression of 277 genes was significantly changed between all smokers and nonsmokers. Specific gene groups, most notably genes expressed in the NMDA-PSD, were prevalent among these transcripts. Analysis of the interaction between smoking and schizophrenia identified several genes in the NMDA-PSD that were differentially affected by smoking in patients. The present findings suggest that smoking may differentially modulate glutamatergic function in schizophrenic patients and control subjects. The biological mechanisms underlying chronic tobacco use are likely to differ substantially between these two groups.

  1. Assessing Differential Expression Measurements by Highly Parallel Pyrosequencing and DNA Microarrays: A Comparative Study

    PubMed Central

    Ariño, Joaquín; Casamayor, Antonio; Pérez, Julián Perez; Pedrola, Laia; Álvarez-Tejado, Miguel; Marbà, Martina; Santoyo, Javier

    2013-01-01

    Abstract To explore the feasibility of pyrosequencing for quantitative differential gene expression analysis we have performed a comparative study of the results of the sequencing experiments to those obtained by a conventional DNA microarray platform. A conclusion from our analysis is that, over a threshold of 35 normalized reads per gene, the measurements of gene expression display a good correlation with the references. The observed concordance between pyrosequencing and DNA microarray platforms beyond the threshold was of 0.8, measured as a Pearson's correlation coefficient. In differential gene expression the initial aim is the quantification the differences among transcripts when comparing experimental conditions. Thus, even in a scenario of low coverage the concordance in the measurements is quite acceptable. On the other hand, the comparatively longer read size obtained by pyrosequencing allows detecting unconventional splicing forms. PMID:21919703

  2. Differential network analysis from cross-platform gene expression data

    PubMed Central

    Zhang, Xiao-Fei; Ou-Yang, Le; Zhao, Xing-Ming; Yan, Hong

    2016-01-01

    Understanding how the structure of gene dependency network changes between two patient-specific groups is an important task for genomic research. Although many computational approaches have been proposed to undertake this task, most of them estimate correlation networks from group-specific gene expression data independently without considering the common structure shared between different groups. In addition, with the development of high-throughput technologies, we can collect gene expression profiles of same patients from multiple platforms. Therefore, inferring differential networks by considering cross-platform gene expression profiles will improve the reliability of network inference. We introduce a two dimensional joint graphical lasso (TDJGL) model to simultaneously estimate group-specific gene dependency networks from gene expression profiles collected from different platforms and infer differential networks. TDJGL can borrow strength across different patient groups and data platforms to improve the accuracy of estimated networks. Simulation studies demonstrate that TDJGL provides more accurate estimates of gene networks and differential networks than previous competing approaches. We apply TDJGL to the PI3K/AKT/mTOR pathway in ovarian tumors to build differential networks associated with platinum resistance. The hub genes of our inferred differential networks are significantly enriched with known platinum resistance-related genes and include potential platinum resistance-related genes. PMID:27677586

  3. Quantitative characterization of x-ray differential interference contrast microscopy using modulation transfer function.

    PubMed

    Nakamura, Takashi; Chang, Chang

    2011-08-01

    Performance of two types of differential interference contrast objectives, i.e., the XOR pattern and the zone-plate doublet, is quantitatively characterized and compared using modulation transfer function. Effects of partial coherence, finite absorption and phase in a complex object, as well as bias retardation are also examined.

  4. Expression of Molecular Differentiation Markers Does Not Correlate with Histological Differentiation Grade in Intrahepatic Cholangiocarcinoma

    PubMed Central

    Demarez, Céline; Hubert, Catherine; Sempoux, Christine; Lemaigre, Frédéric P.

    2016-01-01

    The differentiation status of tumor cells, defined by histomorphological criteria, is a prognostic factor for survival of patients affected with intrahepatic cholangiocarcinoma (ICC). To strengthen the value of morphological differentiation criteria, we wished to correlate histopathological differentiation grade with expression of molecular biliary differentiation markers and of microRNAs previously shown to be dysregulated in ICC. We analysed a series of tumors that were histologically classified as well, moderately or poorly differentiated, and investigated the expression of cytokeratin 7, 19 and 903 (CK7, CK19, CK903), SRY-related HMG box transcription factors 4 and 9 (SOX4, SOX9), osteopontin (OPN), Hepatocyte Nuclear Factor-1 beta (HNF1β), Yes-associated protein (YAP), Epithelial cell adhesion molecule (EPCAM), Mucin 1 (MUC1) and N-cadherin (NCAD) by qRT-PCR and immunostaining, and of miR-31, miR-135b, miR-132, miR-200c, miR-221 and miR-222. Unexpectedly, except for subcellular location of SOX9 and OPN, no correlation was found between the expression levels of these molecular markers and histopathological differentiation grade. Therefore, our data point toward necessary caution when investigating the evolution and prognosis of ICC on the basis of cell differentiation criteria. PMID:27280413

  5. Analysis of differentially expressed genes in human hepatocellular carcinoma using suppression subtractive hybridization

    PubMed Central

    Miyasaka, Y; Enomoto, N; Nagayama, K; Izumi, N; Marumo, F; Watanabe, M; Sato, C

    2001-01-01

    The genetic basis of hepatocellular carcinoma (HCC) has not yet been fully understood. Although various methods have been developed to detect differentially expressed genes in malignant diseases, efficient analysis from clinical specimens is generally difficult to perform due to the requirement of a large amount of samples. In the present study, we analysed differentially expressed genes with a small amount of human HCC samples using suppression subtractive hybridization (SSH). Total RNA were obtained from the hepatitis C virus-associated HCC and adjacent non-HCC liver tissues. cDNA was synthesized using modified RT-PCR, and then tester cDNA was ligated with 2 different kinds of adaptors and hybridized with an excess amount of driver cDNA. Tester specific cDNA was obtained by suppression PCR and the final PCR product was subcloned and sequenced. We identified 7 known genes (focal adhesion kinase, deleted in colon cancer, guanine binding inhibitory protein α, glutamine synthetase, ornithine aminotransferase, M130, and pepsinogen C) and 2 previously unknown genes as being overexpressed in HCC, and 1 gene (decorin) as suppressed in HCC. Quantitative analysis of gene expression using quantitative RT-PCR demonstrated the differential expression of these genes in the original and other HCC samples. These findings demonstrated that it is possible to identify the previously unknown, differential gene expression from a small amount of clinical samples. Information about such alterations in gene expression could be useful for elucidating the genetic events in HCC pathogenesis, developing the new diagnosic markers, or determining novel therapeutic targets. © 2001 Cancer Research Campaign http://www.bjcancer.com PMID:11461082

  6. Use of MRI in Differentiation of Papillary Renal Cell Carcinoma Subtypes: Qualitative and Quantitative Analysis.

    PubMed

    Doshi, Ankur M; Ream, Justin M; Kierans, Andrea S; Bilbily, Matthew; Rusinek, Henry; Huang, William C; Chandarana, Hersh

    2016-03-01

    The purpose of this study was to determine whether qualitative and quantitative MRI feature analysis is useful for differentiating type 1 from type 2 papillary renal cell carcinoma (PRCC). This retrospective study included 21 type 1 and 17 type 2 PRCCs evaluated with preoperative MRI. Two radiologists independently evaluated various qualitative features, including signal intensity, heterogeneity, and margin. For the quantitative analysis, a radiology fellow and a medical student independently drew 3D volumes of interest over the entire tumor on T2-weighted HASTE images, apparent diffusion coefficient parametric maps, and nephrographic phase contrast-enhanced MR images to derive first-order texture metrics. Qualitative and quantitative features were compared between the groups. For both readers, qualitative features with greater frequency in type 2 PRCC included heterogeneous enhancement, indistinct margin, and T2 heterogeneity (all, p < 0.035). Indistinct margins and heterogeneous enhancement were independent predictors (AUC, 0.822). Quantitative analysis revealed that apparent diffusion coefficient, HASTE, and contrast-enhanced entropy were greater in type 2 PRCC (p < 0.05; AUC, 0.682-0.716). A combined quantitative and qualitative model had an AUC of 0.859. Qualitative features within the model had interreader concordance of 84-95%, and the quantitative data had intraclass coefficients of 0.873-0.961. Qualitative and quantitative features can help discriminate between type 1 and type 2 PRCC. Quantitative analysis may capture useful information that complements the qualitative appearance while benefiting from high interobserver agreement.

  7. [Quantitative analysis of Tiam1 expression in lung cancer and its clinical significance].

    PubMed

    Li, Yu-mei; Qi, Wen-juan; Shen, Hong

    2011-10-01

    To investigate the relationship between the expression of T lymphoma invasion and metastasis inducing factor 1 (Tiam1) and the progression, metastasis, TNM stage, and histological types of lung carcinoma. Immunohistochemistry was performed to detect the expression of Tiam1 in 116 lung carcinoma specimens. The expression intensity (measured in positive unit, PU) of Tiam1 in these tissues was assessed quantitatively using Imagepro Plus image analysis software. The PU of Tiam1 was significantly greater in primary lung carcinomas with lymph node metastases than in those without metastases (t=-2.089, P=0.039). Lung cancers of TNM stage II-IV had stronger expression than those of stage I (t=-2.272, P=0.025). The PU of Tiam1 differed significantly between different histological types of lung cancer, and squamouscell cell carcinoma had a lower PU than adenocarcinoma, large cell carcinoma and small cell carcinoma (P<0.05). The intensity of Tiam1 expression was not associated with the patients' gender, age, general types, smoking history, pneumoconiosis or differentiation of lung carcinoma. These results strongly suggest that Tiam1 is an invasion and metastasis inducing factor of lung carcinoma. The overexpression of Tiam1 is closely associated with lymph node metastases, TNM stage and histological types of lung carcinoma.

  8. Molecular and quantitative genetic differentiation in Sitobion avenae populations from both sides of the Qinling Mountains.

    PubMed

    Huang, Xianliang; Liu, Deguang; Wang, Da; Shi, Xiaoqin; Simon, Jean-Christophe

    2015-01-01

    Quantitative trait differences are often assumed to be correlated with molecular variation, but the relationship is not certain, and empirical evidence is still scarce. To address this issue, we sampled six populations of the cereal aphid Sitobion avenae from areas north and south of the Qinling Mountains, and characterized their molecular variation at seven microsatellite loci and quantitative variation at nine life-history traits. Our results demonstrated that southern populations had slightly longer developmental times of nymphs but much higher lifetime fecundity, compared to northern populations. Of the nine tested quantitative characters, eight differed significantly among populations within regions, as well as between northern and southern regions. Genetic differentiation in neutral markers was likely to have been caused by founder events and drift. Increased subdivision for quantitative characters was found in northern populations, but reduced in southern populations. This phenomenon was not found for molecular characters, suggesting the decoupling between molecular and quantitative variation. The pattern of relationships between FST and QST indicated divergent selection and suggested that local adaptation play a role in the differentiation of life-history traits in tested S. avenae populations, particularly in those traits closely related to reproduction. The main role of natural selection over genetic drift was also supported by strong structural differences in G-matrices among S. avenae populations. However, cluster analyses did not result in two groups corresponding to northern and southern regions. Genetic differentiation between northern and southern populations in neutral markers was low, indicating considerable gene flow between them. The relationship between molecular and quantitative variation, as well as its implications for differentiation and evolution of S. avenae populations, was discussed.

  9. Differentially-Expressed Pseudogenes in HIV-1 Infection

    PubMed Central

    Gupta, Aditi; Brown, C. Titus; Zheng, Yong-Hui; Adami, Christoph

    2015-01-01

    Not all pseudogenes are transcriptionally silent as previously thought. Pseudogene transcripts, although not translated, contribute to the non-coding RNA pool of the cell that regulates the expression of other genes. Pseudogene transcripts can also directly compete with the parent gene transcripts for mRNA stability and other cell factors, modulating their expression levels. Tissue-specific and cancer-specific differential expression of these “functional” pseudogenes has been reported. To ascertain potential pseudogene:gene interactions in HIV-1 infection, we analyzed transcriptomes from infected and uninfected T-cells and found that 21 pseudogenes are differentially expressed in HIV-1 infection. This is interesting because parent genes of one-third of these differentially-expressed pseudogenes are implicated in HIV-1 life cycle, and parent genes of half of these pseudogenes are involved in different viral infections. Our bioinformatics analysis identifies candidate pseudogene:gene interactions that may be of significance in HIV-1 infection. Experimental validation of these interactions would establish that retroviruses exploit this newly-discovered layer of host gene expression regulation for their own benefit. PMID:26426037

  10. Differential Expression Profile of MicroRNAs during Differentiation of Cardiomyocytes Exposed to Polychlorinated Biphenyls

    PubMed Central

    Zhu, Chun; Yu, Zhang-Bin; Zhu, Jin-Gai; Hu, Xiao-Shan; Chen, Yu-Lin; Qiu, Yu-Fang; Xu, Zheng-Feng; Qian, Lin-Mei; Han, Shu-Ping

    2012-01-01

    Exposure to persistent environmental pollutants, such as polychlorinated biphenyls (PCBs), is a risk factor for the development of congenital heart defects. MicroRNAs (miRNAs) have been shown to be involved in cardiac development. The objective of this study was to investigate changes in miRNA expression profiles during the differentiation of cardiomyocytes exposed to PCBs. For that purpose, PCBs (Aroclor 1254) at a concentration of 2.5 μmol/L were added on day 0 of differentiation of P19 mouse embryonal carcinoma cells into cardiac myocytes. The relative expression of miRNA genes was determined by miRNA microarray and real-time reverse transcriptase polymerase chain reaction (real-time RT-PCR) analyses. The microarray results revealed that 45 miRNAs, of which 14 were upregulated and 31 were downregulated, were differentially expressed in P19 cells treated with PCBs compared with control cells. The miRNA expression data was validated with real-time RT-PCR. The expression of certain potential target genes (Wnt1) was found to be reduced in P19 cells treated with PCBs, whereas the expression of other potential predicted target genes (GSK3β) was increased. Our results demonstrate a critical role of miRNAs in mediating the effect of PCBs during the differentiation of P19 cells into cardiac myocytes. PMID:23443104

  11. Differential Expression of CXCL12 and CXCR4 During Human Fetal Neural Progenitor Cell Differentiation

    PubMed Central

    Peng, Hui; Kolb, Ryan; Kennedy, J. E.

    2007-01-01

    Stromal cell-derived factor 1 alpha (SDF-1α, CXCL12) and its receptor CXCR4 play an important role in the central nervous system (CNS) development and adulthood by mediating cell migration, enhancing precursor cell proliferation, assisting in neuronal circuit formation, and possibly regulating migration during repair. The expression pattern of CXCR4 and CXCL12 during neurogenesis has not been thoroughly elucidated. In this study, we investigated the expression of CXCL12 and CXCR4 during neural progenitor cells (NPC) differentiation by microarray analysis and reverse transcriptase-polymerase chain reaction (RT-PCR) using human fetal NPC as a model system. The production of CXCL12 was measured by enzyme-linked immunosorbent assay (ELISA). CXCR4 expression was determined by florescence-activated cell sorting (FACS) analysis, immunocytochemical staining, and CXCR4-mediated inhibition of cyclic AMP (cAMP) accumulation. Our data demonstrated that CXCR4 expression is significantly upregulated when NPC are differentiated into neuronal precursors, whereas CXCL12 is upregulated when differentiated into astrocytes. We also provide evidence that CXCR4 localization changes as neurons mature. In neuronal precursors, CXCR4 is localized in both neuronal processes and the cell body, whereas in mature neurons, it is primarily expressed on axons and dendrites. This differential expression of CXCR4 and CXCL12 may be important for the temporal regulation of neuronal migration and circuit formation during development and possibly in adult neurogenesis and repair. PMID:18040858

  12. From 'differential expression' to 'differential networking' - identification of dysfunctional regulatory networks in diseases.

    PubMed

    de la Fuente, Alberto

    2010-07-01

    Understanding diseases requires identifying the differences between healthy and affected tissues. Gene expression data have revolutionized the study of diseases by making it possible to simultaneously consider thousands of genes. The identification of disease-associated genes requires studying the genes in the context of the regulatory systems they are involved in. A major goal is to identify specific regulatory networks that are dysfunctional in a given disease state. Although we still have not reached a stage where the elucidation of differential regulatory networks is commonly feasible, recent advances have described the first steps towards this goal - the identification of differential coexpression networks. This review describes the shift from differential gene expression to differential networking and outlines how this shift will affect the study of the genetic basis of disease.

  13. Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia.

    PubMed

    Li, Chun Ge; Wang, Hui; Chen, Hong Ju; Zhao, Yan; Fu, Pei Sheng; Ji, Xiang Shan

    2014-01-01

    Nowadays, high temperature effects on the molecular pathways during sex differentiation in teleosts need to be deciphered. In this study, a systematic differential expression analysis of genes involved in high temperature-induced sex differentiation was done in the Nile tilapia gonad and brain. Our results showed that high temperature caused significant down-regulation of CYP19A1A in the gonad of both sexes in induction group, and FOXL2 in the ovary of the induction group. The expressions of GTHα, LHβ and ERα were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. On the contrary, the expression of CYP11B2 was significantly up-regulated in the ovary, but not in the testis in both groups. Spearman rank correlation analysis showed that there are significant correlations between the expressions of CYP19A1A, FOXL2, or DMRT1 in the gonads and the expression of some genes in the brain. Another result in this study showed that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, and DNMT1 and DNMT3A in the female brain of both groups. The expression and correlation analysis of HSPs showed that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes in the gonads. These findings provide new insights on TSD and suggest that sex differentiation related genes, heat shock proteins, and DNA methylation genes are new candidates for studying TSD in fish species.

  14. Quantitative high-throughput gene expression profiling of human striatal development to screen stem cell–derived medium spiny neurons

    PubMed Central

    Straccia, Marco; Garcia-Diaz Barriga, Gerardo; Sanders, Phil; Bombau, Georgina; Carrere, Jordi; Mairal, Pedro Belio; Vinh, Ngoc-Nga; Yung, Sun; Kelly, Claire M; Svendsen, Clive N; Kemp, Paul J; Arjomand, Jamshid; Schoenfeld, Ryan C; Alberch, Jordi; Allen, Nicholas D; Rosser, Anne E; Canals, Josep M

    2015-01-01

    A systematic characterization of the spatio-temporal gene expression during human neurodevelopment is essential to understand brain function in both physiological and pathological conditions. In recent years, stem cell technology has provided an in vitro tool to recapitulate human development, permitting also the generation of human models for many diseases. The correct differentiation of human pluripotent stem cell (hPSC) into specific cell types should be evaluated by comparison with specific cells/tissue profiles from the equivalent adult in vivo organ. Here, we define by a quantitative high-throughput gene expression analysis the subset of specific genes of the whole ganglionic eminence (WGE) and adult human striatum. Our results demonstrate that not only the number of specific genes is crucial but also their relative expression levels between brain areas. We next used these gene profiles to characterize the differentiation of hPSCs. Our findings demonstrate a temporal progression of gene expression during striatal differentiation of hPSCs from a WGE toward an adult striatum identity. Present results establish a gene expression profile to qualitatively and quantitatively evaluate the telencephalic hPSC-derived progenitors eventually used for transplantation and mature striatal neurons for disease modeling and drug-screening. PMID:26417608

  15. Differential gene expression profiling and biological process analysis in proximal nerve segments after sciatic nerve transection.

    PubMed

    Li, Shiying; Liu, Qianqian; Wang, Yongjun; Gu, Yun; Liu, Dong; Wang, Chunming; Ding, Guohui; Chen, Jianping; Liu, Jie; Gu, Xiaosong

    2013-01-01

    After traumatic injury, peripheral nerves can spontaneously regenerate through highly sophisticated and dynamic processes that are regulated by multiple cellular elements and molecular factors. Despite evidence of morphological changes and of expression changes of a few regulatory genes, global knowledge of gene expression changes and related biological processes during peripheral nerve injury and regeneration is still lacking. Here we aimed to profile global mRNA expression changes in proximal nerve segments of adult rats after sciatic nerve transection. According to DNA microarray analysis, the huge number of genes was differentially expressed at different time points (0.5 h-14 d) post nerve transection, exhibiting multiple distinct temporal expression patterns. The expression changes of several genes were further validated by quantitative real-time RT-PCR analysis. The gene ontology enrichment analysis was performed to decipher the biological processes involving the differentially expressed genes. Collectively, our results highlighted the dynamic change of the important biological processes and the time-dependent expression of key regulatory genes after peripheral nerve injury. Interestingly, we, for the first time, reported the presence of olfactory receptors in sciatic nerves. Hopefully, this study may provide a useful platform for deeply studying peripheral nerve injury and regeneration from a molecular-level perspective.

  16. Differential expression of androgen, estrogen, and progesterone receptors in benign prostatic hyperplasia

    PubMed Central

    Song, Lingmin; Shen, Wenhao; Zhang, Heng; Wang, Qiwu; Wang, Yongquan; Zhou, Zhansong

    2016-01-01

    This study aimed to identify the differential expression levels of androgen receptor (AR), estrogen receptors (ERα, ERβ), and progesterone receptor (PGR) between normal prostate and benign prostatic hyperplasia (BPH). The combination of immunohistochemistry, quantitative real-time reverse transcription polymerase chain reaction, and Western blotting assay was used to identify the distribution and differential expression of these receptors at the immunoactive biomarker, transcriptional, and protein levels between 5 normal human prostate tissues and 40 BPH tissues. The results were then validated in a rat model of BPH induced by testosterone propionate and estradiol benzoate. In both human and rat prostate tissues, AR was localized mainly to epithelial and stromal cell nuclei; ERα was distributed mainly to stromal cells, but not exclusively; ERβ was interspersed in the basal layer of epithelium, but sporadically in epithelial and stromal cells; PGR was expressed abundantly in cytoplasm of epithelial and stromal cells. There were decreased expression of ERα and increased expression of PGR, but no difference in the expression of ERβ in the BPH compared to the normal prostate of both human and rat. Increased expression of AR in the BPH compared to the normal prostate of human was observed, however, the expression of AR in the rat prostate tissue was decreased. This study identified the activation of AR and PGR and repression of ERα in BPH, which indicate a promoting role of AR and PGR and an inhibitory role of ERα in the pathogenesis of BPH. PMID:27294569

  17. Differential Gene Expression Profiling and Biological Process Analysis in Proximal Nerve Segments after Sciatic Nerve Transection

    PubMed Central

    Wang, Yongjun; Gu, Yun; Liu, Dong; Wang, Chunming; Ding, Guohui; Chen, Jianping; Liu, Jie; Gu, Xiaosong

    2013-01-01

    After traumatic injury, peripheral nerves can spontaneously regenerate through highly sophisticated and dynamic processes that are regulated by multiple cellular elements and molecular factors. Despite evidence of morphological changes and of expression changes of a few regulatory genes, global knowledge of gene expression changes and related biological processes during peripheral nerve injury and regeneration is still lacking. Here we aimed to profile global mRNA expression changes in proximal nerve segments of adult rats after sciatic nerve transection. According to DNA microarray analysis, the huge number of genes was differentially expressed at different time points (0.5 h–14 d) post nerve transection, exhibiting multiple distinct temporal expression patterns. The expression changes of several genes were further validated by quantitative real-time RT-PCR analysis. The gene ontology enrichment analysis was performed to decipher the biological processes involving the differentially expressed genes. Collectively, our results highlighted the dynamic change of the important biological processes and the time-dependent expression of key regulatory genes after peripheral nerve injury. Interestingly, we, for the first time, reported the presence of olfactory receptors in sciatic nerves. Hopefully, this study may provide a useful platform for deeply studying peripheral nerve injury and regeneration from a molecular-level perspective. PMID:23437294

  18. Differential expression of Notch family members in astrocytomas and medulloblastomas.

    PubMed

    Xu, Peng; Yu, Shizhu; Jiang, Rongcai; Kang, Chunsheng; Wang, Guangxiu; Jiang, Hao; Pu, Peiyu

    2009-12-01

    Notch signaling pathway plays an integral role in determining cell fates in development. Growing evidence demonstrates that Notch signaling pathway has versatile effects in tumorigenesis depending on the tumor type, grade and stage. Notch signaling pathway is deregulated in some brain tumors. To examine the differential expression of Notch family members (Notch1, 2, 3, 4) in human astrocytomas and medulloblastomas, and to evaluate their roles in the development of both tumor types. Immunohistochemical staining and Western blot analysis were used to detect Notch1, 2, 3, 4 expression in tissue microarray and freshly resected tissue samples of normal brain, astrocytomas and medulloblastomas. Notch family members were not expressed or barely detectable in normal brain tissues. Notch1, 3, 4 were highly expressed but Notch2 was not expressed in astrocytomas. The percentage of immunopositive tumor cells and level of Notch1 expression was increased with tumor grade. In addition, overexpression of Notch2 was detected in medulloblastomas in contrast to low or no expression of Notch1, 3, 4. Differential expression of Notch1, 2, 3, 4 is detected in astrocytomas and medulloblastomas, that may be related to their different roles playing in the development of brain tumors.

  19. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-05-01

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  20. Qualitative and quantitative analysis with a novel shear wave speed imaging for differential diagnosis of breast lesions

    PubMed Central

    Yang, Yu-Ping; Xu, Xiao-Hong; Guo, Le-Hang; He, Ya-Ping; Wang, Dan; Liu, Bo-Ji; Zhao, Chong-Ke; Chen, Bao-Ding; Xu, Hui-Xiong

    2017-01-01

    To evaluate the diagnostic performance of a new two-dimensional shear wave speed (SWS) imaging (i.e. Toshiba shear wave elastography, T-SWE) in differential diagnosis of breast lesions. 225 pathologically confirmed breast lesions in 218 patients were subject to conventional ultrasound and T-SWE examinations. The mean, standard deviation and ratio of SWS values (m/s) and elastic modulus (KPa) on T-SWE were computed. Besides, the 2D elastic images were classified into four color patterns. The area under the receiver operating characteristic (AUROC) curve analysis was performed to evaluate the diagnostic performance of T-SWE in differentiation of breast lesions. Compared with other quantitative T-SWE parameters, mean value expressed in KPa had the highest AUROC value (AUROC = 0.943), with corresponding cut-off value of 36.1 KPa, sensitivity of 85.1%, specificity of 96.6%, accuracy of 94.2%, PPV of 87.0%, and NPV of 96.1%. The AUROC of qualitative color patterns in this study obtained the best performance (AUROC = 0.957), while the differences were not significant except for that of Eratio expressed in m/s (AUROC = 0.863) (P = 0.03). In summary, qualitative color patterns of T-SWE obtained the best performance in all parameters, while mean stiffness (36.05 KPa) provided the best diagnostic performance in the quantitative parameters. PMID:28102328

  1. Isolation of differentially expressed cDNAs during ferret tracheal development: application of differential display PCR.

    PubMed

    Sehgal, A; Presente, A; Dudus, L; Engelhardt, J F

    1996-01-01

    The technique of differential display polymerase chain reaction (DD-PCR) was used to identify cDNA sequences, which are temporally expressed during ferret tracheal airway development. Such differentially expressed cDNAs may ultimately prove to be useful markers in elucidating mechanisms of epithelial differentiation and submucosal gland development in the airway. Using two sets of oligonucleotide primers 15 differentially amplified cDNAs were isolated by comparative reverse transcriptase (RT) PCR of 6-h and 3-day postnatal tracheal poly-A mRNA. In situ hybridization was used to assess the reliability of this method and confirm the differential mRNA expression patterns of cloned cDNAs. Results of in situ hybridization analysis demonstrated that 10 of the 15 cDNA sequences gave a temporally regulated pattern of expression, which was concordant with that of the differential display. Furthermore, sequence analysis of the 15 isolated cDNAs revealed that the majority of clones were amplified from two inverted decamer primers. These findings demonstrate the lack of poly-T priming in the differential display reaction, which suggests that this method may yield substantially more information regarding the coding sequence of cloned genes. In support of this observation, 6 of the 15 cDNA sequences contained one complete open reading frame. Although the majority of cDNAs demonstrated no homology to sequence data bases at the DNA or amino acid level, clone FT-4, which demonstrated a differential expression pattern limited to 3-day tracheal time points, was composed of a 10-amino acid repeat domain that was structurally similar to neuropeptide anthoRFamide and barley D hordein seed protein. A second interesting clone, FT-3, demonstrated an infrequent pattern of expression within a subset of epithelial cells limited to early developmental time points (6 h) and was dramatically reduced by 3 days postnatally. Several additional clones with no homologies to previously cloned genes

  2. Schlafen 12 expression modulates prostate cancer cell differentiation.

    PubMed

    Kovalenko, Pavlo L; Basson, Marc D

    2014-07-01

    Schlafen proteins have previously been linked to leukocyte and intestinal epithelial differentiation. We hypothesized that Schlafen 12 (SLFN12) overexpression in human prostate epithelial cells would modulate expression of prostate-specific antigen (PSA) and dipeptidyl peptidase 4 (DPP4), markers of prostatic epithelial differentiation. Differentiation of the human prostate cancer cell lines LNCaP and PC-3 was compared after infection with an adenoviral vector coding for SLFN12 (Ad-SLFN12) or green fluorescent protein (GFP) only expressing virus (control). Transcript levels of SLFN12, PSA, and DPP4 were evaluated by real-time reverse transcription PCR and protein levels by Western blotting. Because mixed lineage kinase (MLK) and one of its downstream effectors (extracellular signal-regulated kinases [ERK]) have previously been implicated in some aspects of prostate epithelial differentiation, we conducted further studies in which LNCaP cells were cotreated with dimethyl sulfoxide (control), PD98059 (ERK inhibitor), or MLK inhibitor during transfection with Ad-SLFN12 for 72 h. Treatment of LNCaP or PC-3 cells with Ad-SLFN12 reduced PSA expression by 56.6±4.6% (P<0.05) but increased DPP4 transcript level by 4.8±1.0 fold (P<0.05) versus Ad-GFP-treated controls. Further studies in LNCaP cells showed that Ad-SLFN12 overexpression increased the ratio of the mature E-cadherin protein to its precursor protein. Furthermore, SLFN12 overexpression promoted DPP4 expression either when MLK or ERK was blocked. ERK inhibition did not reverse SLFN12-induced changes in PSA, E-cadherin, or DPP4. SLFN12 may regulate differentiation in prostate epithelial cells, at least in part independently of ERK or MLK. Understanding how SLFN12 influences prostatic epithelial differentiation may ultimately identify targets to influence the phenotype of prostatic malignancy. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Schlafen 12 expression modulates prostate cancer cell differentiation

    PubMed Central

    Kovalenko, Pavlo L.; Basson, Marc D.

    2014-01-01

    Background Schlafen proteins have previously been linked to leukocyte and intestinal epithelial differentiation. We hypothesized that Schlafen 12 (SLFN12) overexpression in prostate epithelial cells would modulate expression of prostate-specific antigen (PSA) and dipeptidyl peptidase-4 (DPP4), markers of prostatic epithelial differentiation. Materials and Methods Differentiation of the prostate cancer cell line LNCaP and PC-3 was compared after infection with an adenoviral vector coding for SLFN12-GFP (Ad-SLFN12) or GFP only expressing virus (control). Transcript levels of SLFN12, PSA and DPP4 were evaluated by RT-PCR and protein levels by Western blotting. Because Mixed Lineage Kinase (MLK) and one of its downstream effectors (ERK) have previously been implicated in some aspects of prostate epithelial differentiation, we conducted further studies in which LNCaP cells were co-treated with DMSO (control), PD98059 (ERK inhibitor) or MLK inhibitor during transfection with Ad-GFP-SLFN12 for 72 hours. Results Treatment of LNCaP or PC-3 cells with Ad-SLFN12 reduced PSA expression by 56.6±4.6% (p<0.05) but increased DPP4 transcript level by 4.8±1.0 fold (p<0.05) vs. Ad-GFP-treated controls. Further studies in LNCaP cells showed that Ad-SLFN12 overexpression increased the ratio of the mature E-cadherin protein to its precursor protein. Furthermore, SLFN12 overexpression promoted DPP4 expression either when MLK or ERK were blocked. ERK inhibition did not reverse SLFN12-induced changes in PSA, E-cadherin or DPP4. Conclusions SLFN12 may regulate differentiation in prostate epithelial cells, at least in part independently of ERK or MLK. Understanding how SLFN12 influences prostatic epithelial differentiation may ultimately identify targets to influence the phenotype of prostatic malignancy. PMID:24768141

  4. Prion Protein Expression Regulates Embryonic Stem Cell Pluripotency and Differentiation

    PubMed Central

    Miranda, Alberto; Pericuesta, Eva

    2011-01-01

    Cellular prion protein (PRNP) is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs). Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB) differentiation in mouse Prnp-null (KO) and WT embryonic stem cell (ESC) lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC) markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5) in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel) and SPRN (Shadoo), whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis. PMID:21483752

  5. Prion protein expression regulates embryonic stem cell pluripotency and differentiation.

    PubMed

    Miranda, Alberto; Pericuesta, Eva; Ramírez, Miguel Ángel; Gutierrez-Adan, Alfonso

    2011-04-04

    Cellular prion protein (PRNP) is a glycoprotein involved in the pathogenesis of transmissible spongiform encephalopathies (TSEs). Although the physiological function of PRNP is largely unknown, its key role in prion infection has been extensively documented. This study examines the functionality of PRNP during the course of embryoid body (EB) differentiation in mouse Prnp-null (KO) and WT embryonic stem cell (ESC) lines. The first feature observed was a new population of EBs that only appeared in the KO line after 5 days of differentiation. These EBs were characterized by their expression of several primordial germ cell (PGC) markers until Day 13. In a comparative mRNA expression analysis of genes playing an important developmental role during ESC differentiation to EBs, Prnp was found to participate in the transcription of a key pluripotency marker such as Nanog. A clear switching off of this gene on Day 5 was observed in the KO line as opposed to the WT line, in which maximum Prnp and Nanog mRNA levels appeared at this time. Using a specific antibody against PRNP to block PRNP pathways, reduced Nanog expression was confirmed in the WT line. In addition, antibody-mediated inhibition of ITGB5 (integrin αvβ5) in the KO line rescued the low expression of Nanog on Day 5, suggesting the regulation of Nanog transcription by Prnp via this Itgb5. mRNA expression analysis of the PRNP-related proteins PRND (Doppel) and SPRN (Shadoo), whose PRNP function is known to be redundant, revealed their incapacity to compensate for the absence of PRNP during early ESC differentiation. Our findings provide strong evidence for a relationship between Prnp and several key pluripotency genes and attribute Prnp a crucial role in regulating self-renewal/differentiation status of ESC, confirming the participation of PRNP during early embryogenesis.

  6. Differential gene expression patterns between smokers and non-smokers: cause or consequence?

    PubMed

    Vink, Jacqueline M; Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H; Penninx, Brenda W; Boomsma, Dorret I

    2017-03-01

    The molecular mechanisms causing smoking-induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome-wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex-smokers were available from two population-based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty-two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10(-6) , Bonferroni correction). The most significant genes were G protein-coupled receptor 15 (P < 1 × 10(-150) ) and leucine-rich repeat neuronal 3 (P < 1 × 10(-44) ). The smoking-related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex-smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis-expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome-wide association meta-analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene expression.

  7. Differential gene expression patterns between smokers and non‐smokers: cause or consequence?

    PubMed Central

    Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H.; Penninx, Brenda W.; Boomsma, Dorret I.

    2015-01-01

    Abstract The molecular mechanisms causing smoking‐induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome‐wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex‐smokers were available from two population‐based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty‐two genes were differentially expressed between current smokers and never smokers (P < 1.2 × 10−6, Bonferroni correction). The most significant genes were G protein‐coupled receptor 15 (P < 1 × 10−150) and leucine‐rich repeat neuronal 3 (P < 1 × 10−44). The smoking‐related genes were enriched for immune system, blood coagulation, natural killer cell and cancer pathways. By taking the data of ex‐smokers into account, expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis‐expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome‐wide association meta‐analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene

  8. Differential expression of the fractalkine chemokine receptor (CX3CR1) in human monocytes during differentiation

    PubMed Central

    Panek, Cecilia Analia; Ramos, Maria Victoria; Mejias, Maria Pilar; Abrey-Recalde, Maria Jimena; Fernandez-Brando, Romina Jimena; Gori, Maria Soledad; Salamone, Gabriela Verónica; Palermo, Marina Sandra

    2015-01-01

    Circulating monocytes (Mos) may continuously repopulate macrophage (MAC) or dendritic cell (DC) populations to maintain homeostasis. MACs and DCs are specialized cells that play different and complementary immunological functions. Accordingly, they present distinct migratory properties. Specifically, whereas MACs largely remain in tissues, DCs are capable of migrating from peripheral tissues to lymphoid organs. The aim of this work was to analyze the expression of the fractalkine receptor (CX3CR1) during the monocytic differentiation process. Freshly isolated Mos express high levels of both CX3CR1 mRNA and protein. During the Mo differentiation process, CX3CR1 is downregulated in both DCs and MACs. However, MACs showed significantly higher CX3CR1 expression levels than did DC. We also observed an antagonistic CX3CR1 regulation by interferon (IFN)-γ and interleukin (IL)-4 during MAC activation through the classical and alternative MAC pathways, respectively. IFN-γ inhibited the loss of CX3CR1, but IL-4 induced it. Additionally, we demonstrated an association between CX3CR1 expression and apoptosis prevention by soluble fractalkine (sCX3CL1) in Mos, DCs and MACs. This is the first report demonstrating sequential and differential CX3CR1 modulation during Mo differentiation. Most importantly, we demonstrated a functional link between CX3CR1 expression and cell survival in the presence of sCX3CL1. PMID:25502213

  9. Differential expression of the fractalkine chemokine receptor (CX3CR1) in human monocytes during differentiation.

    PubMed

    Panek, Cecilia Analia; Ramos, Maria Victoria; Mejias, Maria Pilar; Abrey-Recalde, Maria Jimena; Fernandez-Brando, Romina Jimena; Gori, Maria Soledad; Salamone, Gabriela Verónica; Palermo, Marina Sandra

    2015-11-01

    Circulating monocytes (Mos) may continuously repopulate macrophage (MAC) or dendritic cell (DC) populations to maintain homeostasis. MACs and DCs are specialized cells that play different and complementary immunological functions. Accordingly, they present distinct migratory properties. Specifically, whereas MACs largely remain in tissues, DCs are capable of migrating from peripheral tissues to lymphoid organs. The aim of this work was to analyze the expression of the fractalkine receptor (CX3CR1) during the monocytic differentiation process. Freshly isolated Mos express high levels of both CX3CR1 mRNA and protein. During the Mo differentiation process, CX3CR1 is downregulated in both DCs and MACs. However, MACs showed significantly higher CX3CR1 expression levels than did DC. We also observed an antagonistic CX3CR1 regulation by interferon (IFN)-γ and interleukin (IL)-4 during MAC activation through the classical and alternative MAC pathways, respectively. IFN-γ inhibited the loss of CX3CR1, but IL-4 induced it. Additionally, we demonstrated an association between CX3CR1 expression and apoptosis prevention by soluble fractalkine (sCX3CL1) in Mos, DCs and MACs. This is the first report demonstrating sequential and differential CX3CR1 modulation during Mo differentiation. Most importantly, we demonstrated a functional link between CX3CR1 expression and cell survival in the presence of sCX3CL1.

  10. Medaka tert produces multiple variants with differential expression during differentiation in vitro and in vivo

    PubMed Central

    Rao, Feng; Wang, Tiansu; Li, Mingyou; Li, Zhendong; Hong, Ni; Zhao, Haobin; Yan, Yan; Lu, Wenqing; Chen, Tiansheng; Wang, Weijia; Lim, Menghuat; Yuan, Yongming; Liu, Ling; Zeng, Lingbing; Wei, Qiwei; Guan, Guijun; Li, Changming; Hong, Yunhan

    2011-01-01

    Embryonic stem (ES) cells have immortality for self-renewal and pluripotency. Differentiated human cells undergo replicative senescence. In human, the telomerase reverse transcriptase (Tert), namely the catalytic subunit of telomerase, exhibits differential expression to regulate telomerase activity governing cellular immortality or senescence, and telomerase activity or tert expression is a routine marker of pluripotent ES cells. Here we have identified the medaka tert gene and determined its expression and telomerase activity in vivo and in vitro. We found that the medaka tert locus produces five variants called terta to terte encoding isoforms TertA to TertE. The longest TertA consists of 1090 amino acid residues and displays a maximum of 34% identity to the human TERT and all the signature motifs of the Tert family. TertB to TertE are novel isoforms and have considerable truncation due to alternative splicing. The terta RNA is ubiquitous in embryos, adult tissues and cell lines, and accompanies ubiquitous telomerase activity in vivo and in vitro as revealed by TRAP assays. The tertb RNA was restricted to the testis, absent in embryos before gastrulation and barely detectable in various cell lines The tertc transcript was absent in undifferentiated ES cells but became evident upon ES cell differentiation, in vivo it was barely detectable in early embryos and became evident when embryogenesis proceeds. Therefore, ubiquitous terta expression correlates with ubiquitous telomerase activity in medaka, and expression of other tert variants appears to delineate cell differentiation in vitro and in vivo. PMID:21547060

  11. Microarray analysis reveals differential gene expression in hybrid sunflower species

    PubMed Central

    LAI, ZHAO; GROSS, BRIANA L.; YIZOU; ANDREWS, JUSTEN; RIESEBERG, LOREN H.

    2008-01-01

    This paper describes the creation of a cDNA microarray for annual sunflowers and its use to elucidate patterns of gene expression in Helianthus annuus, Helianthus petiolaris, and the homoploid hybrid species Helianthus deserticola. The array comprises 3743 ESTs (expressed sequence tags) representing approximately 2897 unique genes. It has an average clone/EST identity rate of 91%, is applicable across species boundaries within the annual sunflowers, and shows patterns of gene expression that are highly reproducible according to real-time RT–PCR (reverse transcription–polymerase chain reaction) results. Overall, 12.8% of genes on the array showed statistically significant differential expression across the three species. Helianthus deserticola displayed transgressive, or extreme, expression for 58 genes, with roughly equal numbers exhibiting up- or down-regulation relative to both parental species. Transport-related proteins were strongly over-represented among the transgressively expressed genes, which makes functional sense given the extreme desert floor habitat of H. deserticola. The potential adaptive value of differential gene expression was evaluated for five genes in two populations of early generation (BC2) hybrids between the parental species grown in the H. deserticola habitat. One gene (a G protein-coupled receptor) had a significant association with fitness and maps close to a QTL controlling traits that may be adaptive in the desert habitat. PMID:16626449

  12. Digital Gene Expression Profiling to Explore Differentially Expressed Genes Associated with Terpenoid Biosynthesis during Fruit Development in Litsea cubeba.

    PubMed

    Gao, Ming; Lin, Liyuan; Chen, Yicun; Wang, Yangdong

    2016-09-20

    Mountain pepper (Litseacubeba (Lour.) Pers.) (Lauraceae) is an important industrial crop as an ingredient in cosmetics, pesticides, food additives and potential biofuels. These properties are attributed to monoterpenes and sesquiterpenes. However, there is still no integrated model describing differentially expressed genes (DEGs) involved in terpenoid biosynthesis during the fruit development of L. cubeba. Here, we performed digital gene expression (DGE) using the Illumina NGS platform to evaluated changes in gene expression during fruit development in L. cubeba. DGE generated expression data for approximately 19354 genes. Fruit at 60 days after flowering (DAF) served as the control, and a total of 415, 1255, 449 and 811 up-regulated genes and 505, 1351, 1823 and 1850 down-regulated genes were identified at 75, 90, 105 and 135 DAF, respectively. Pathway analysis revealed 26 genes involved in terpenoid biosynthesis pathways. Three DEGs had continued increasing or declining trends during the fruit development. The quantitative real-time PCR (qRT-PCR) results of five differentially expressed genes were consistent with those obtained from Illumina sequencing. These results provide a comprehensive molecular biology background for research on fruit development, and information that should aid in metabolic engineering to increase the yields of L. cubeba essential oil.

  13. Wilms' tumor (WT1) gene expression in rat decidual differentiation.

    PubMed

    Zhou, J; Rauscher, F J; Bondy, C

    1993-09-01

    The Wilm's tumor suppressor gene (WT1) encodes a zinc-finger containing transcription factor that is selectively expressed in the developing urogenital tract, where it is thought to play a role in the differentiation of these tissues. We have used immunocytochemistry and in situ hybridization to study WT1 expression in the rat uterus during normal development and pregnancy from 0 to 20 days post coitum (p.c.). WT1 mRNA was abundant in uterine stroma from juvenile rats, but was much less abundant in uterine tissue from sexually mature rats; WT1 expression is not affected by ovariectomy or by treatment with estradiol or estradiol plus progesterone. WT1 gene was highly expressed, however, in the endometrial cells of early pregnancy. On day 6 p.c. WT1 mRNA was detected in anti-mesometrial decidual cells, and WT1 immunoreactivity was concentrated in the nuclei of these cells. All cells of fully-developed deciduoma at 7-8 days p.c. demonstrated WT1 expression. WT1 was not detected in trophoblast/placental tissues but remained abundant in the decidua basalis until parturition. The expression of WT1 was compared with insulin-like growth factor-II (IGF-II) and its receptor in the decidual since it has been shown that IGF-II gene transcription is repressed by WT1 in vitro. However, no spatiotemporal correlation in the expression of these three genes was found in differentiation of the rat decidua. In summary, these data suggest a role for WT1 in decidualization, since its expression is activated during the differentiation of uterine stromal cells into decidual cells.

  14. Quantitative expression analysis and prognostic significance of L-DOPA decarboxylase in colorectal adenocarcinoma

    PubMed Central

    Kontos, C K; Papadopoulos, I N; Fragoulis, E G; Scorilas, A

    2010-01-01

    Background: L-DOPA decarboxylase (DDC) is an enzyme that catalyses, mainly, the decarboxylation of L-DOPA to dopamine and was found to be involved in many malignancies. The aim of this study was to investigate the mRNA expression levels of the DDC gene and to evaluate its clinical utility in tissues with colorectal adenocarcinoma. Methods: Total RNA was isolated from colorectal adenocarcinoma tissues of 95 patients. After having tested RNA quality, we prepared cDNA by reverse transcription. Highly sensitive quantitative real-time PCR method for DDC mRNA quantification was developed using the SYBR Green chemistry. GAPDH served as a housekeeping gene. Relative quantification analysis was performed using the comparative CT method (2−ΔΔCT). Results: DDC mRNA expression varied remarkably among colorectal tumours examined in this study. High DDC mRNA expression levels were found in well-differentiated and Dukes' stage A and B tumours. Kaplan–Meier survival curves showed that patients with DDC-positive tumours have significantly longer disease-free survival (P=0.009) and overall survival (P=0.027). In Cox regression analysis of the entire cohort of patients, negative DDC proved to be a significant predictor of reduced disease-free (P=0.021) and overall survival (P=0.047). Conclusions: The results of the study suggest that DDC mRNA expression may be regarded as a novel potential tissue biomarker in colorectal adenocarcinoma. PMID:20424616

  15. Identification of differentially expressed microRNAs involved in non-traumatic osteonecrosis through microRNA expression profiling.

    PubMed

    Wu, Xingjing; Zhang, Yongtao; Guo, Xiong; Xu, Hongguang; Xu, Zhujun; Duan, Dapeng; Wang, Kunzheng

    2015-07-01

    Accumulating evidence has recently indicated a vital role of microRNAs (miRNAs) in the development of various bone diseases. However, the biological role of miRNAs in the pathogenesis of non-traumatic osteonecrosis of femoral head (ONFH) has not yet been investigated. The present study aimed to profile the differential miRNA expression between non-traumatic ONFH and femoral neck fracture and to develop further understanding of the molecular mechanisms involved in the pathogenesis of non-traumatic ONFH. Femoral heads from 4 patients with non-traumatic ONFH and 4 with femoral neck fracture were used to analyze the miRNA expression profiles in bone tissue using the Exiqon miRCURY™ LNA Array (v.18.0). The results of miRNA microarray analysis were further confirmed by real-time quantitative polymerase chain reaction (qPCR). The differentially expressed miRNA target genes and signaling pathways involved were predicted by bioinformatics analysis. MiRNA microarray chip analysis revealed that 22 miRNAs were significantly up-regulated and 17 were significantly down-regulated in the non-traumatic ONFH samples compared with the femoral neck fracture samples. The real-time qPCR also confirmed the microarray data. Bioinformatics analysis demonstrated that toll-like receptor (TLR), neurotrophin and NOD-like receptor signaling pathway were most likely to be regulated by these differential miRNAs. This miRNA microarray study reveals significant differences in miRNA expression between patients with non-traumatic ONFH and those with femoral neck fracture. Our data also manifests that the signaling pathways regulated by these differentially expressed miRNAs might be important in the pathogenesis of non-traumatic ONFH.

  16. Inhibition of human primary megakaryocyte differentiation by anagrelide: a gene expression profiling analysis.

    PubMed

    Sakurai, Kazuki; Fujiwara, Tohru; Hasegawa, Shin; Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi; Yamada-Fujiwara, Minami; Ichinohasama, Ryo; Harigae, Hideo

    2016-08-01

    Anagrelide is a treatment option for patients with essential thrombocythemia. Although the clinical efficacy of anagrelide has been established, there is limited knowledge of the molecular mechanism underlying its effect. Here, we evaluated the effect of anagrelide on primary megakaryocytic progenitors from cord blood-derived CD34-positive cells. Anagrelide treatment reduced the expression of megakaryocytic markers (CD41 and CD61). Microarray analysis was performed to characterize gene profiles altered by exposure to anagrelide. The analysis demonstrated upregulation and downregulation (>2-fold) of eight and 34 genes, respectively, in anagrelide-treated megakaryocyte progenitors. This included genes encoding prototypical megakaryocytic proteins, such as PPBP, PF4, and GP6. Gene ontology analysis of genes suppressed by anagrelide treatment revealed significant enrichment of genes involved in platelet activation and degranulation. Expression levels of transcription factors involved in megakaryocyte commitment/differentiation were further evaluated by quantitative RT-PCR, demonstrating significant downregulation of FLI1 and TAL1 in anagrelide-treated megakaryocyte progenitors. Knockdown of TAL1 in primary megakaryocyte progenitors confirmed significant downregulation of FLI1 and megakaryocytic genes. Anagrelide had no significant effect on the surface expression of erythroid markers or on the expression of transcription factors involved in erythroid commitment/differentiation. In conclusion, anagrelide suppresses megakaryocytic differentiation, partly through decreasing the expression of megakaryocytic transcription factors.

  17. Anatrophic nephrolithotomy: preservation of renal function demonstrated by differential quantitative radionuclide renal scans

    SciTech Connect

    Belis, J.A.; Morabito, R.A.; Kandzari, S.J.; Lai, J.C.; Gabriele, O.F.

    1981-06-01

    Differential quantitative radionuclide renal scans have been used to confirm that early removal of staghorn calculi by anatrophic nephrolithotomy preserves renal parenchyma without significant renal damage by the surgical procedure. The /sup 99m/technetium diethylenetriaminepentaacetic acid scan was useful in predicting recovery of function in the involved kidney, while the /sup 131/iodine orthoiodohippurate scan provided a quantitative evaluation of the effect of the surgical procedure on individual kidney function. All of 13 consecutive patients evaluated by /sup 131/iodine orthoiodohippurate renal scans had stable or improved effective renal plasma flow to the involved kidney and an unchanged or improved total excretory index 6 months after nephrolithotomy.

  18. Anatrophic nephrolithotomy: preservation of renal function demonstrated by differential quantitative radionuclide renal scans.

    PubMed

    Belis, J A; Morabito, R A; Kandzari, S J; Lai, J C; Gabriele, O F

    1981-06-01

    Differential quantitative radionuclide renal scans have been used to confirm that early removal of staghorn calculi by anatrophic nephrolithotomy preserves renal parenchyma without significant renal damage by the surgical procedure. The 99mtechnetium diethylenetriaminepentaacetic acid scan was useful in predicting recovery of function in the involved kidney, while the 131iodine orthoiodohippurate scan provided a quantitative evaluation of the effect of the surgical procedure on individual kidney function. All of 13 consecutive patients evaluated by 131iodine orthoiodohippurate renal scans had stable or improved effective renal plasma flow to the involved kidney and an unchanged or improved total excretory index 6 months after nephrolithotomy.

  19. WEBSAGE: a web tool for visual analysis of differentially expressed human SAGE tags.

    PubMed

    Pylouster, Jean; Sénamaud-Beaufort, Catherine; Saison-Behmoaras, Tula Ester

    2005-07-01

    The serial analysis of gene expression (SAGE) is a powerful method to compare gene expression of mRNA populations. To provide quantitative expression levels on a genome-wide scale, the Cancer Genome Anatomy Project (CGAP) uses SAGE. Over 7 million SAGE tags, from 171 human cell types have been assembled. The growing number of laboratories involved in SAGE research necessitates the use of software that provides statistical analysis of raw data, allowing the rapid visualization and interpretation of results. We have created the first simple tool that performs statistical analysis on SAGE data, identifies the tags differentially expressed and shows the results in a scatter plot. It is freely available and accessible at http://bioserv.rpbs.jussieu.fr/websage/index.php.

  20. Proteomic analysis of differentially expressed proteins in the two developmental stages of Ichthyophthirius multifiliis.

    PubMed

    Yao, Jia-Yun; Xu, Yang; Yuan, Xue-Mei; Yin, Wen-Lin; Yang, Gui-Lian; Lin, Ling-Yun; Pan, Xiao-Yi; Wang, Chun-Feng; Shen, Jin-Yu

    2017-02-01

    Ichthyophthirius is a severe disease of farmed freshwater fish caused by the parasitic ciliate Ichthyophthirius multifiliis (Ich). This disease can lead to considerable economic loss, but the protein profiles in different developmental stages of the parasite remain unknown. In the present study, proteins from trophonts and theronts of Ich were identified by isobaric tags for relative and absolute quantitation (iTRAQ). A total of 2300 proteins were identified in the two developmental stages, of which 1520 proteins were differentially expressed. Among them, 84 proteins were uniquely expressed in the theronts stage, while 656 proteins were expressed only in trophonts. The differentially expressed proteins were catalogued (assorted) to various functions of Ich life cycle, including biological process, cellular component, and molecular function that occur at distinct stages. Using a 1.5-fold change in expression as a physiologically significant benchmark, a lot of differentially expressed proteins were reliably quantified by iTRAQ analysis. Two hundred forty upregulated and 57 downregulated proteins in the trophonts stage were identified as compared with theronts. The identified proteins were involved in various functions of the I. multifiliis life cycle, including binding, catalytic activity, structural molecule activity, and transporter activity. Further investigation of the transcriptional levels of periplasmic immunogenic protein, transketolase, zinc finger, isocitrate dehydrogenase, etc., from the different protein profiles using quantitative RT-PCR showed identical results to the iTRAQ analysis. This work provides an effective resource to further our understanding of Ich biology, and lays the groundwork for the identification of potential drug targets and vaccines candidates for the control of this devastating fish pathogen.

  1. [Differential expression of genes that encode glycolysis enzymes in kidney and lung cancer in humans].

    PubMed

    Oparina, N Yu; Snezhkina, A V; Sadritdinova, A F; Veselovskii, V A; Dmitriev, A A; Senchenko, V N; Mel'nikova, N V; Speranskaya, A S; Darii, M V; Stepanov, O A; Barkhatov, I M; Kudryavtseva, A V

    2013-07-01

    Glycolysis is a main catabolic pathway of glucose metabolism, accompanied by ATP synthesis. More than 30 enzymes are involved in glycolysis, and genes that encode them can be considered housekeeping genes due to the high conservatism and evolutionary antiquity of the process. We studied the expression of these genes in kidney papillary cancer and planocellular lung cancer via the bioinformatic analysis of transcriptome database and method of quantitative real time PCR. Quantitative analysis of mRNA level demonstrated that only a part ofgenes that encode glycolysis enzymes maintain relatively stable mRNA level, including the HK1, ADPGK, GPI, PGK1, and PKM2 genes in kidney papillary cancer and the ADPGK, ALDOA, GAPDH, PGK1, BPGM, ENO1, and PKM2 genes in planocellular lung cancer. The frequent increase in the mRNA expression of PFKP, ALDOA, and GAPDH genes in kidney cancer, as well as the GPI gene in lung cancer, were detected for the first time by real time PCR. For other genes, their differential expression was demonstrated; the cases of both a decrease and increase in the mRNA level were detected. Thus, several genes that can be used as control genes in transcriptome analysis by real time PCR in kidney and lung cancer, as well as a number of differentially expressed genes that can be potential oncomarkers, were identified.

  2. Differential Expression of Sclerostin In Adult and Juvenile Mouse Calvaria

    PubMed Central

    Kwan, Matthew D.; Quarto, Natalina; Gupta, Deepak M.; Slater, Bethany; Wan, Derrick C.; Longaker, Michael T.

    2010-01-01

    Background An understanding of the molecular mechanisms controlling bone formation is central to skeletal tissue engineering efforts. The observation that immature animals are able to heal calvarial defects while adult animals are not has proven to be a useful tool for examining these mechanisms. Thus, we compared expression of sclerostin, a bone inhibitor, between the calvaria of juvenile and adult mice. Methods Parietal bone was harvested from juvenile (6 day old, n=20) and adult (60 day old, n=20) mice. Sclerostin transcript and protein levels were compared between the parietal bone of juvenile and adult mice using polymerase chain reaction (PCR), Western blotting, and immunohistochemistry (IHC). Finally, osteoblasts from the parietal bone of juvenile and adult mice were harvested and cultured under osteogenic differentiation conditions with and without recombinant sclerostin (200ng/ml). Terminal osteogenic differentiation was assessed at 21 days with Alizarin red staining. Results PCR, Western blot analysis, and IHC all confirmed greater expression of sclerostin in the parietal bone of adult mice when compared to that of juvenile mice. Osteoblasts, whether from juvenile or adult parietal bones, demonstrated reduced capacity for osteogenic differentiation when exposed to recombinant sclerostin. Conclusion Given sclerostin’s role in inhibiting bone formation, our findings suggest that differences in expression levels of sclerostin may play a role in the differential regenerative capacity of calvaria from juvenile and adult animals. These findings suggest it as a potential target to abrogate in future tissue engineering studies. PMID:21285764

  3. 5' and 3' untranslated regions contribute to the differential expression of specific HLA-A alleles.

    PubMed

    René, Céline; Lozano, Claire; Villalba, Martin; Eliaou, Jean-François

    2015-12-01

    In hematopoietic stem cell transplantation (HSCT), when no HLA full-matched donor is available, alternative donors could include one HLA-mismatched donor. Recently, the low expressed HLA-C alleles have been identified as permissive mismatches for the best donor choice. Concerning HLA-A, the degree of variability of expression is poorly understood. Here, we evaluated HLA-A expression in healthy individuals carrying HLA-A*02 allele in different genotypes using flow cytometry and allele-specific quantitative RT-PCR. While an interindividual variability of HLA-A*02 cell surface expression, not due to the allele associated, was observed, no difference of the mRNA expression level was shown, suggesting the involvement of the posttranscriptional regulation. The results of qRT-PCR analyses exhibit a differential expression of HLA-A alleles with HLA-A*02 as the strongest expressed allele independently of the second allele. The associated non-HLA-A*02 alleles were differentially expressed, particularly the HLA-A*31 and HLA-A*33 alleles (strong expression) and the HLA-A*29 (low expression). The presence of specific polymorphisms in the 5' and 3' untranslated regions of the HLA-A*31 and HLA-A*33 alleles could contribute to this high level of expression. As previously described for HLA-C, low-expressed HLA-A alleles, such as HLA-A*29, could be considered as a permissive mismatch, although this needs to be confirmed by clinical studies.

  4. Expression Quantitative Trait Loci Analysis Identifies Associations Between Genotype and Gene Expression in Human Intestine

    PubMed Central

    KABAKCHIEV, BOYKO; SILVERBERG, MARK S.

    2013-01-01

    BACKGROUND & AIMS Genome-wide association studies have greatly increased our understanding of intestinal disease. However, little is known about how genetic variations result in phenotypic changes. Some polymorphisms have been shown to modulate quantifiable phenotypic traits; these are called quantitative trait loci. Quantitative trait loci that affect levels of gene expression are called expression quantitative trait loci (eQTL), which can provide insight into the biological relevance of data from genome-wide association studies. We performed a comprehensive eQTL scan of intestinal tissue. METHODS Total RNA was extracted from ileal biopsy specimens and genomic DNA was obtained from whole-blood samples from the same cohort of individuals. Cis- and trans-eQTL analyses were performed using a custom software pipeline for samples from 173 subjects. The analyses determined the expression levels of 19,047 unique autosomal genes listed in the US National Center for Biotechnology Information database and more than 580,000 variants from the Single Nucleotide Polymorphism database. RESULTS The presence of more than 15,000 cis- and trans-eQTL was detected with statistical significance. eQTL associated with the same expression trait were in high linkage disequilibrium. Comparative analysis with previous eQTL studies showed that 30% to 40% of genes identified as eQTL in monocytes, liver tissue, lymphoblastoid cell lines, T cells, and fibroblasts are also eQTL in ileal tissue. Conversely, most of the significant eQTL have not been previously identified and could be tissue specific. These are involved in many cell functions, including division and antigen processing and presentation. Our analysis confirmed that previously published cis-eQTL are single nucleotide polymorphisms associated with inflammatory bowel disease: rs2298428/UBE2L3, rs1050152/SLC22A4, and SLC22A5. We identified many new associations between inflammatory bowel disease susceptibility loci and gene expression

  5. Differential expression of ferritin genes in response to abiotic stresses and hormones in pear (Pyrus pyrifolia).

    PubMed

    Xi, Li; Xu, Kuanyong; Qiao, Yushan; Qu, Shenchun; Zhang, Zhen; Dai, Wenhao

    2011-10-01

    In this study, the expression patterns of four ferritin genes (PpFer1, PpFer2, PpFer3, and PpFer4) in pear were investigated using quantitative real-time PCR. Analysis of tissue-specific expression revealed higher expression level of these genes in leaves than in other tested tissues. These ferritin genes were differentially expressed in response to various abiotic stresses and hormones treatments. The expression of ferritin wasn't affected by Fe(III)-citrate treatment. Abscisic acid significantly enhanced the expression of all four ferritin genes, especially PpFer2, followed by N-benzylyminopurine, gibberellic acid, and indole-3-acetic acid. The expression peaks of PpFer1 and PpFer3 in leaves appeared at 6, 6, and 12 h, respectively, after pear plant was exposed to oxidative stress (5 mM H(2)O(2)), salt stress (200 mM NaCl), and heat stress (40°C). A significant increase in PpFer4 expression was detected at 6 h after salt stress or heat stress. The expression of ferritin genes was not altered by cold stress. These results suggested that ferritin genes might be functionally important in acclimation of pear to salt and oxidative stresses. Hormone treatments had no significant effect on expression of ferritin genes compared to abiotic stresses. This showed accumulation of ferritin genes could be operated by different transduction pathways under abiotic stresses and hormones treatments.

  6. Differential subtraction display: a unified approach for isolation of cDNAs from differentially expressed genes.

    PubMed

    Pardinas, J R; Combates, N J; Prouty, S M; Stenn, K S; Parimoo, S

    1998-03-15

    We have developed a novel efficient approach, termed differential subtraction display, for the identification of differentially expressed genes. Several critical parameters for the reproducibility and enhanced sensitivity of display, as well as steps to reduce the number of false positive cDNA species, have been defined. These include- (a) use of standardized oligo(dT)-primed cDNA pools rather than total RNA as the starting material for differential display, (b) critical role of optimal cDNA input for each distinct class of primers, (c) phenomena of primer dominance and interference, and (d) design of a novel set of enhanced specificity anchor primers. Introduction of an efficient subtractive hybridization step prior to cloning of cDNA species enriches the bona fide cDNA species that are either exclusively present in one sample (+/-) or show altered expression (up-/down-regulation) in RNA samples from two different tissues or cell types. This approach, in comparison to differential display, has several advantages in terms of reproducibility and enhanced sensitivity of display coupled to the cloning of enriched bona fide cDNA species corresponding to differentially expressed RNAs.

  7. A quantitative dynamical systems approach to differential learning: self-organization principle and order parameter equations.

    PubMed

    Frank, T D; Michelbrink, M; Beckmann, H; Schöllhorn, W I

    2008-01-01

    Differential learning is a learning concept that assists subjects to find individual optimal performance patterns for given complex motor skills. To this end, training is provided in terms of noisy training sessions that feature a large variety of between-exercises differences. In several previous experimental studies it has been shown that performance improvement due to differential learning is higher than due to traditional learning and performance improvement due to differential learning occurs even during post-training periods. In this study we develop a quantitative dynamical systems approach to differential learning. Accordingly, differential learning is regarded as a self-organized process that results in the emergence of subject- and context-dependent attractors. These attractors emerge due to noise-induced bifurcations involving order parameters in terms of learning rates. In contrast, traditional learning is regarded as an externally driven process that results in the emergence of environmentally specified attractors. Performance improvement during post-training periods is explained as an hysteresis effect. An order parameter equation for differential learning involving a fourth-order polynomial potential is discussed explicitly. New predictions concerning the relationship between traditional and differential learning are derived.

  8. Expression of YY1 in Differentiated Thyroid Cancer.

    PubMed

    Arribas, Jéssica; Castellví, Josep; Marcos, Ricard; Zafón, Carles; Velázquez, Antonia

    2015-05-01

    The transcription factor Yin Yang 1 (YY1) has an important regulatory role in tumorigenesis, but its implication in thyroid cancer has not been yet investigated. In the present study, we have analyzed the expression of YY1 in differentiated thyroid cancer and assessed the association of YY1 expression with clinical features. Expression of YY1 was evaluated in human thyroid cancer cell lines, a series of matched normal/tumor thyroid tissues and in a thyroid cancer tissue microarray, using real-time PCR, Western blot, and/or immunohistochemistry. YY1 was overexpressed in thyroid cancer cells, at transcription and protein levels. A significant increase of YY1 mRNA was also observed in tumor thyroid tissues. Moreover, immunohistochemical analysis of the thyroid cancer tissue microarray revealed that both papillary thyroid cancer (PTC) and follicular thyroid cancer (FTC) present increased YY1 protein levels (48 and 19%, respectively). After stratification by the level of YY1 protein, positive YY1 expression identifies 88% of patients with PTC. The association of YY1 expression with clinicopathological features in PTC and FTC showed that YY1 expression was related with age at diagnosis. Our data indicates for the first time overexpression of YY1 in differentiated thyroid cancer, with YY1 being more frequently overexpressed in the PTC subtype.

  9. New differentially expressed genes and differential DNA methylation underlying refractory epilepsy

    PubMed Central

    Xu, Tao; Liu, Shiyong; Yuan, Jinxian; Huang, Hao; Qin, Lu; Yang, Hui; Chen, Lifen; Tan, Xinjie; Chen, Yangmei

    2016-01-01

    Epigenetics underlying refractory epilepsy is poorly understood, especially in patients without distinctive genetic alterations. DNA methylation may affect gene expression in epilepsy without affecting DNA sequences. Herein, we analyzed genome-wide DNA methylation and gene expression in brain tissues of 10 patients with refractory epilepsy using methylated DNA immunoprecipitation linked with sequencing and mRNA Sequencing. Diverse distribution of differentially methylated genes was found in X chromosome, while differentially methylated genes appeared rarely in Y chromosome. 62 differentially expressed genes, such as MMP19, AZGP1, DES, and LGR6 were correlated with refractory epilepsy for the first time. Although general trends of differentially enriched gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways in this study are consistent with previous researches, differences also exist in many specific gene ontology terms and Kyoto Encyclopedia of Genes and Genome pathways. These findings provide a new genome-wide profiling of DNA methylation and gene expression in brain tissues of patients with refractory epilepsy, which may provide a basis for further study on the etiology and mechanisms of refractory epilepsy. PMID:27903967

  10. Single-shot quantitative phase microscopy with color-multiplexed differential phase contrast (cDPC)

    PubMed Central

    2017-01-01

    We present a new technique for quantitative phase and amplitude microscopy from a single color image with coded illumination. Our system consists of a commercial brightfield microscope with one hardware modification—an inexpensive 3D printed condenser insert. The method, color-multiplexed Differential Phase Contrast (cDPC), is a single-shot variant of Differential Phase Contrast (DPC), which recovers the phase of a sample from images with asymmetric illumination. We employ partially coherent illumination to achieve resolution corresponding to 2× the objective NA. Quantitative phase can then be used to synthesize DIC and phase contrast images or extract shape and density. We demonstrate amplitude and phase recovery at camera-limited frame rates (50 fps) for various in vitro cell samples and c. elegans in a micro-fluidic channel. PMID:28152023

  11. Single-shot quantitative phase microscopy with color-multiplexed differential phase contrast (cDPC).

    PubMed

    Phillips, Zachary F; Chen, Michael; Waller, Laura

    2017-01-01

    We present a new technique for quantitative phase and amplitude microscopy from a single color image with coded illumination. Our system consists of a commercial brightfield microscope with one hardware modification-an inexpensive 3D printed condenser insert. The method, color-multiplexed Differential Phase Contrast (cDPC), is a single-shot variant of Differential Phase Contrast (DPC), which recovers the phase of a sample from images with asymmetric illumination. We employ partially coherent illumination to achieve resolution corresponding to 2× the objective NA. Quantitative phase can then be used to synthesize DIC and phase contrast images or extract shape and density. We demonstrate amplitude and phase recovery at camera-limited frame rates (50 fps) for various in vitro cell samples and c. elegans in a micro-fluidic channel.

  12. Quantitative Differentiation of Bloodstain Patterns Resulting from Gunshot and Blunt Force Impacts.

    PubMed

    Siu, Sonya; Pender, Jennifer; Springer, Faye; Tulleners, Frederic; Ristenpart, William

    2017-02-10

    Bloodstain pattern analysis (BPA) provides significant evidentiary value in crime scene interpretation and reconstruction. In this work, we develop a quantitative methodology using digital image analysis techniques to differentiate impact bloodstain patterns. The bloodstain patterns were digitally imaged and analyzed using image analysis algorithms. Our analysis of 72 unique bloodstain patterns, comprising more than 490,000 individual droplet stains, indicates that the mean drop size in a gunshot spatter pattern is at most 30% smaller than the mean drop stain size in blunt instrument patterns. In contrast, we demonstrate that the spatial distribution of the droplet stains-their density as a function of position in the pattern-significantly differs between gunshot and blunt instrument patterns, with densities as much as 400% larger for gunshot impacts. Thus, quantitative metrics involving the spatial distribution of droplet stains within a bloodstain pattern can be useful for objective differentiation between blunt instrument and gunshot bloodstain patterns.

  13. Differential gene expression in auristatin PHE-treated Cryptococcus neoformans.

    PubMed

    Woyke, Tanja; Berens, Michael E; Hoelzinger, Dominique B; Pettit, George R; Winkelmann, Günther; Pettit, Robin K

    2004-02-01

    The antifungal pentapeptide auristatin PHE was recently shown to interfere with microtubule dynamics and nuclear and cellular division in the opportunistic pathogen Cryptococcus neoformans. To gain a broader understanding of the cellular response of C. neoformans to auristatin PHE, mRNA differential display (DD) and reverse transcriptase PCR (RT-PCR) were applied. Examination of approximately 60% of the cell transcriptome from cells treated with 1.5 times the MIC (7.89 micro M) of auristatin PHE for 90 min revealed 29 transcript expression differences between control and drug-treated populations. Differential expression of seven of the transcripts was confirmed by RT-PCR, as was drug-dependent modulation of an additional seven transcripts by RT-PCR only. Among genes found to be differentially expressed were those encoding proteins involved in transport, cell cycle regulation, signal transduction, cell stress, DNA repair, nucleotide metabolism, and capsule production. For example, RHO1 and an open reading frame (ORF) encoding a protein with 91% similarity to the Schizophyllum commune 14-3-3 protein, both involved in cell cycle regulation, were down-regulated, as was the gene encoding the multidrug efflux pump Afr1p. An ORF encoding a protein with 57% identity to the heat shock protein HSP104 in Pleurotus sajor-caju was up-regulated. Also, three transcripts of unknown function were responsive to auristatin PHE, which may eventually contribute to the elucidation of the function of their gene products. Further study of these differentially expressed genes and expression of their corresponding proteins are warranted to evaluate how they may be involved in the mechanism of action of auristatin PHE. This information may also contribute to an explanation of the selectivity of auristatin PHE for C. neoformans. This is the first report of drug action using DD in C. neoformans.

  14. Differential Gene Expression in Auristatin PHE-Treated Cryptococcus neoformans

    PubMed Central

    Woyke, Tanja; Berens, Michael E.; Hoelzinger, Dominique B.; Pettit, George R.; Winkelmann, Günther; Pettit, Robin K.

    2004-01-01

    The antifungal pentapeptide auristatin PHE was recently shown to interfere with microtubule dynamics and nuclear and cellular division in the opportunistic pathogen Cryptococcus neoformans. To gain a broader understanding of the cellular response of C. neoformans to auristatin PHE, mRNA differential display (DD) and reverse transcriptase PCR (RT-PCR) were applied. Examination of approximately 60% of the cell transcriptome from cells treated with 1.5 times the MIC (7.89 μM) of auristatin PHE for 90 min revealed 29 transcript expression differences between control and drug-treated populations. Differential expression of seven of the transcripts was confirmed by RT-PCR, as was drug-dependent modulation of an additional seven transcripts by RT-PCR only. Among genes found to be differentially expressed were those encoding proteins involved in transport, cell cycle regulation, signal transduction, cell stress, DNA repair, nucleotide metabolism, and capsule production. For example, RHO1 and an open reading frame (ORF) encoding a protein with 91% similarity to the Schizophyllum commune 14-3-3 protein, both involved in cell cycle regulation, were down-regulated, as was the gene encoding the multidrug efflux pump Afr1p. An ORF encoding a protein with 57% identity to the heat shock protein HSP104 in Pleurotus sajor-caju was up-regulated. Also, three transcripts of unknown function were responsive to auristatin PHE, which may eventually contribute to the elucidation of the function of their gene products. Further study of these differentially expressed genes and expression of their corresponding proteins are warranted to evaluate how they may be involved in the mechanism of action of auristatin PHE. This information may also contribute to an explanation of the selectivity of auristatin PHE for C. neoformans. This is the first report of drug action using DD in C. neoformans. PMID:14742210

  15. Defining Developmental Potency and Cell Lineage Trajectories by Expression Profiling of Differentiating Mouse Embryonic Stem Cells

    PubMed Central

    Aiba, Kazuhiro; Nedorezov, Timur; Piao, Yulan; Nishiyama, Akira; Matoba, Ryo; Sharova, Lioudmila V.; Sharov, Alexei A.; Yamanaka, Shinya; Niwa, Hitoshi; Ko, Minoru S. H.

    2009-01-01

    Biologists rely on morphology, function and specific markers to define the differentiation status of cells. Transcript profiling has expanded the repertoire of these markers by providing the snapshot of cellular status that reflects the activity of all genes. However, such data have been used only to assess relative similarities and differences of these cells. Here we show that principal component analysis of global gene expression profiles map cells in multidimensional transcript profile space and the positions of differentiating cells progress in a stepwise manner along trajectories starting from undifferentiated embryonic stem (ES) cells located in the apex. We present three ‘cell lineage trajectories’, which represent the differentiation of ES cells into the first three lineages in mammalian development: primitive endoderm, trophoblast and primitive ectoderm/neural ectoderm. The positions of the cells along these trajectories seem to reflect the developmental potency of cells and can be used as a scale for the potential of cells. Indeed, we show that embryonic germ cells and induced pluripotent cells are mapped near the origin of the trajectories, whereas mouse embryo fibroblast and fibroblast cell lines are mapped near the far end of the trajectories. We suggest that this method can be used as the non-operational semi-quantitative definition of cell differentiation status and developmental potency. Furthermore, the global expression profiles of cell lineages provide a framework for the future study of in vitro and in vivo cell differentiation. PMID:19112179

  16. Differential gene expression in anterior and posterior annulus fibrosus.

    PubMed

    Koerner, John D; Markova, Dessislava Z; Yadla, Sanjay; Mendelis, Joseph; Hilibrand, Alan; Vaccaro, Alexander R; Risbud, Makarand V; Albert, Todd J; Anderson, D Greg; Kepler, Christopher K

    2014-11-01

    Laboratory study. To evaluate the differential gene expression of cytokines and growth factors in anterior versus posterior annulus fibrosus (AF) intervertebral disc (IVD) specimens. Histological analysis has demonstrated regional differences in vascular and neural ingrowth in the IVD, and similar differences may exist for cytokine and growth factor expression in patients with degenerative disc disease (DDD). Regional expression of these cytokines may also be related to the pain experienced in DDD. IVD tissue was obtained from patients undergoing anterior lumbar interbody fusion surgery for back pain with radiological evidence of disc degeneration. For a control group, the discs of patients undergoing anterior lumbar discectomy for degenerative scoliosis were obtained as well. The tissue was carefully removed and separated into anterior and posterior AF. After tissue processing, an antibody array was completed to determine expression levels of 42 cytokines and growth factors. Nine discs from 7 patients with DDD and 5 discs from 2 patients with scoliosis were analyzed. In the DDD group, there were 10 cytokines and growth factors with significantly increased expression in the posterior AF versus the anterior AF ([interleukin] IL-4, IL-5, IL-6, M-CSF, MDC, tumor necrosis factor β, EGF, IGF-1, angiogenin, leptin). In the scoliosis group, only angiogenin and PDGF-BB demonstrated increased expression in the posterior AF. No cytokines or growth factors had increased expression in the anterior AF compared with posterior AF. The posterior AF expresses increased levels of cytokines and growth factors compared with the anterior AF in patients with DDD. This differential expression may be important for targeting treatment of painful IVDs. N/A.

  17. ATF3 represses PPARγ expression and inhibits adipocyte differentiation

    SciTech Connect

    Jang, Min-Kyung; Jung, Myeong Ho

    2014-11-07

    Highlights: • ATF3 decrease the expression of PPARγ and its target gene in 3T3-L1 adipocytes. • ATF3 represses the promoter activity of PPARγ2 gene. • ATF/CRE (−1537/−1530) is critical for ATF3-mediated downregulation of PPARγ. • ATF3 binds to the promoter region containing the ATF/CRE. • ER stress inhibits adipocyte differentiation through downregulation of PPARγ by ATF3. - Abstract: Activating transcription factor 3 (ATF3) is a stress-adaptive transcription factor that mediates cellular stress response signaling. We previously reported that ATF3 represses CCAAT/enhancer binding protein α (C/EBPα) expression and inhibits 3T3-L1 adipocyte differentiation. In this study, we explored potential role of ATF3 in negatively regulating peroxisome proliferator activated receptor-γ (PPARγ). ATF3 decreased the expression of PPARγ and its target gene in 3T3-L1 adipocytes. ATF3 also repressed the activity of −2.6 Kb promoter of mouse PPARγ2. Overexpression of PPARγ significantly prevented the ATF3-mediated inhibition of 3T3-L1 differentiation. Transfection studies with 5′ deleted-reporters showed that ATF3 repressed the activity of −2037 bp promoter, whereas it did not affect the activity of −1458 bp promoter, suggesting that ATF3 responsive element is located between the −2037 and −1458. An electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that ATF3 binds to ATF/CRE site (5′-TGACGTTT-3′) between −1537 and −1530. Mutation of the ATF/CRE site abrogated ATF3-mediated transrepression of the PPARγ2 promoter. Treatment with thapsigargin, endoplasmic reticulum (ER) stress inducer, increased ATF3 expression, whereas it decreased PPARγ expression. ATF3 knockdown significantly blocked the thapsigargin-mediated downregulation of PPARγ expression. Furthermore, overexpression of PPARγ prevented inhibition of 3T3-L1 differentiation by thapsigargin. Collectively, these results suggest that ATF3-mediated

  18. Expression of early developmental markers predicts the efficiency of embryonic stem cell differentiation into midbrain dopaminergic neurons.

    PubMed

    Salti, Ahmad; Nat, Roxana; Neto, Sonya; Puschban, Zoe; Wenning, Gregor; Dechant, Georg

    2013-02-01

    Dopaminergic neurons derived from pluripotent stem cells are among the best investigated products of in vitro stem cell differentiation owing to their potential use for neurorestorative therapy of Parkinson's disease. However, the classical differentiation protocols for both mouse and human pluripotent stem cells generate a limited percentage of dopaminergic neurons and yield a considerable cellular heterogeneity comprising numerous scarcely characterized cell populations. To improve pluripotent stem cell differentiation protocols for midbrain dopaminergic neurons, we established extensive and strictly quantitative gene expression profiles, including markers for pluripotent cells, neural progenitors, non-neural cells, pan-neuronal and glial cells, neurotransmitter phenotypes, midbrain and nonmidbrain populations, floor plate and basal plate populations, as well as for Hedgehog, Fgf, and Wnt signaling pathways. The profiles were applied to discrete stages of in vitro differentiation of mouse embryonic stem cells toward the dopaminergic lineage and after transplantation into the striatum of 6-hydroxy-dopamine-lesioned rats. The comparison of gene expression in vitro with stages in the developing ventral midbrain between embryonic day 11.5 and 13.5 ex vivo revealed dynamic changes in the expression of transcription factors and signaling molecules. Based on these profiles, we propose quantitative gene expression milestones that predict the efficiency of dopaminergic differentiation achieved at the end point of the protocol, already at earlier stages of differentiation.

  19. Dynamic changes in the expression of apoptosis-related genes in differentiating gonocytes and in seminomas.

    PubMed

    Manku, Gurpreet; Culty, Martine

    2015-01-01

    Apoptosis is an integral part of the spermatogenic process, necessary to maintain a proper ratio of Sertoli to germ cell numbers and provide an adequate microenvironment to germ cells. Apoptosis may also represent a protective mechanism mediating the elimination of abnormal germ cells. Extensive apoptosis occurs between the first and second postnatal weeks, at the point when gonocytes, precursors of spermatogonial stem cells, should have migrated toward the basement membrane of the tubules and differentiated into spermatogonia. The mechanisms regulating this process are not well-understood. Gonocytes undergo phases of proliferation, migration, and differentiation which occur in a timely and closely regulated manner. Gonocytes failing to migrate and differentiate properly undergo apoptosis. Inadequate gonocyte differentiation has been suggested to lead to testicular germ cell tumor (TGCT) formation. Here, we examined the expression levels of apoptosis-related genes during gonocyte differentiation by quantitative real-time polymerase chain reaction, identifying 48 pro- and anti-apoptotic genes increased by at least two-fold in rat gonocytes induced to differentiate by retinoic acid, when compared to untreated gonocytes. Further analysis of the most highly expressed genes identified the pro-apoptotic genes Gadd45a and Cycs as upregulated in differentiating gonocytes and in spermatogonia compared with gonocytes. These genes were also significantly downregulated in seminomas, the most common type of TGCT, compared with normal human testicular tissues. These results indicate that apoptosis-related genes are actively regulated during gonocyte differentiation. Moreover, the down-regulation of pro-apoptotic genes in seminomas suggests that they could represent new therapeutic targets in the treatment of TGCTs.

  20. QDMR: a quantitative method for identification of differentially methylated regions by entropy

    PubMed Central

    Zhang, Yan; Liu, Hongbo; Lv, Jie; Xiao, Xue; Zhu, Jiang; Liu, Xiaojuan; Su, Jianzhong; Li, Xia; Wu, Qiong; Wang, Fang; Cui, Ying

    2011-01-01

    DNA methylation plays critical roles in transcriptional regulation and chromatin remodeling. Differentially methylated regions (DMRs) have important implications for development, aging and diseases. Therefore, genome-wide mapping of DMRs across various temporal and spatial methylomes is important in revealing the impact of epigenetic modifications on heritable phenotypic variation. We present a quantitative approach, quantitative differentially methylated regions (QDMRs), to quantify methylation difference and identify DMRs from genome-wide methylation profiles by adapting Shannon entropy. QDMR was applied to synthetic methylation patterns and methylation profiles detected by methylated DNA immunoprecipitation microarray (MeDIP-chip) in human tissues/cells. This approach can give a reasonable quantitative measure of methylation difference across multiple samples. Then DMR threshold was determined from methylation probability model. Using this threshold, QDMR identified 10 651 tissue DMRs which are related to the genes enriched for cell differentiation, including 4740 DMRs not identified by the method developed by Rakyan et al. QDMR can also measure the sample specificity of each DMR. Finally, the application to methylation profiles detected by reduced representation bisulphite sequencing (RRBS) in mouse showed the platform-free and species-free nature of QDMR. This approach provides an effective tool for the high-throughput identification of potential functional regions involved in epigenetic regulation. PMID:21306990

  1. Differential diagnosis of breast cancer using quantitative, label-free and molecular vibrational imaging.

    PubMed

    Yang, Yaliang; Li, Fuhai; Gao, Liang; Wang, Zhiyong; Thrall, Michael J; Shen, Steven S; Wong, Kelvin K; Wong, Stephen T C

    2011-08-01

    We present a label-free, chemically-selective, quantitative imaging strategy to identify breast cancer and differentiate its subtypes using coherent anti-Stokes Raman scattering (CARS) microscopy. Human normal breast tissue, benign proliferative, as well as in situ and invasive carcinomas, were imaged ex vivo. Simply by visualizing cellular and tissue features appearing on CARS images, cancerous lesions can be readily separated from normal tissue and benign proliferative lesion. To further distinguish cancer subtypes, quantitative disease-related features, describing the geometry and distribution of cancer cell nuclei, were extracted and applied to a computerized classification system. The results show that in situ carcinoma was successfully distinguished from invasive carcinoma, while invasive ductal carcinoma (IDC) and invasive lobular carcinoma were also distinguished from each other. Furthermore, 80% of intermediate-grade IDC and 85% of high-grade IDC were correctly distinguished from each other. The proposed quantitative CARS imaging method has the potential to enable rapid diagnosis of breast cancer.

  2. Differential expression in RNA-seq: a matter of depth.

    PubMed

    Tarazona, Sonia; García-Alcalde, Fernando; Dopazo, Joaquín; Ferrer, Alberto; Conesa, Ana

    2011-12-01

    Next-generation sequencing (NGS) technologies are revolutionizing genome research, and in particular, their application to transcriptomics (RNA-seq) is increasingly being used for gene expression profiling as a replacement for microarrays. However, the properties of RNA-seq data have not been yet fully established, and additional research is needed for understanding how these data respond to differential expression analysis. In this work, we set out to gain insights into the characteristics of RNA-seq data analysis by studying an important parameter of this technology: the sequencing depth. We have analyzed how sequencing depth affects the detection of transcripts and their identification as differentially expressed, looking at aspects such as transcript biotype, length, expression level, and fold-change. We have evaluated different algorithms available for the analysis of RNA-seq and proposed a novel approach--NOISeq--that differs from existing methods in that it is data-adaptive and nonparametric. Our results reveal that most existing methodologies suffer from a strong dependency on sequencing depth for their differential expression calls and that this results in a considerable number of false positives that increases as the number of reads grows. In contrast, our proposed method models the noise distribution from the actual data, can therefore better adapt to the size of the data set, and is more effective in controlling the rate of false discoveries. This work discusses the true potential of RNA-seq for studying regulation at low expression ranges, the noise within RNA-seq data, and the issue of replication.

  3. A predictive approach to identify genes differentially expressed

    NASA Astrophysics Data System (ADS)

    Saraiva, Erlandson F.; Louzada, Francisco; Milan, Luís A.; Meira, Silvana; Cobre, Juliana

    2012-10-01

    The main objective of gene expression data analysis is to identify genes that present significant changes in expression levels between a treatment and a control biological condition. In this paper, we propose a Bayesian approach to identify genes differentially expressed calculating credibility intervals from predictive densities which are constructed using sampled mean treatment effect from all genes in study excluding the treatment effect of genes previously identified with statistical evidence for difference. We compare our Bayesian approach with the standard ones based on the use of the t-test and modified t-tests via a simulation study, using small sample sizes which are common in gene expression data analysis. Results obtained indicate that the proposed approach performs better than standard ones, especially for cases with mean differences and increases in treatment variance in relation to control variance. We also apply the methodologies to a publicly available data set on Escherichia coli bacteria.

  4. Surface markers and gene expression to characterize the differentiation of monolayer expanded human articular chondrocytes.

    PubMed

    Hamada, Takashi; Sakai, Tadahiro; Hiraiwa, Hideki; Nakashima, Motoshige; Ono, Yohei; Mitsuyama, Hirohito; Ishiguro, Naoki

    2013-02-01

    Autologous chondrocyte implantation (ACI) is a method of cartilage repair. To improve the quality of regenerated tissue by ACI, it is essential to identify surface marker expression correlated with the differentiation status of monolayer expanded human articular chondrocytes and to define the index for discriminating dedifferentiated cells from monolayer expanded human articular chondrocytes. Normal human articular chondrocytes were cultured in monolayer until passage 4. At each passage, mRNA expression of collagen type I, II, and X and aggrecan was analyzed by real-time quantitative PCR, and the surface marker expression of CD14, CD26, CD44, CD49a, CD49c, CD54, and CD151 was analyzed by fluorescence-activated cell sorting (FACS). The ratios of mRNA levels of collagen type II to I (Col II/Col I) represented the differentiation status of chondrocytes more appropriately during monolayer culture. The surface marker expression of CD44, CD49c, and CD151 was upregulated according to the dedifferentiation status, whereas that of CD14, CD49a, and CD54 was downregulated. The most appropriate combination of the ratio of Col II/Col I was CD54 and CD44. Cell sorting was performed using a magnetic cell sorting system (MACS) according to CD54 and CD44, and real-time quantitative PCR was performed for the cell subpopulations before and after cell sorting. The expression of collagen type II and aggrecan of the chondrocytes after MACS was higher than that before sorting, but not significantly. The mean fluorescence intensity (MFI) ratio of CD54 to CD44 could be an adequate candidate as the index of the differentiation status.

  5. Strontium Promotes Cementoblasts Differentiation through Inhibiting Sclerostin Expression In Vitro

    PubMed Central

    Bao, Xingfu; Liu, Xianjun; Zhang, Yi; Cui, Yue; Yao, Jindan

    2014-01-01

    Cementogenesis, performed by cementoblasts, is important for the repair of root resorption caused by orthodontic treatment. Based on recent studies, strontium has been applied for osteoporosis treatment due to its positive effect on osteoblasts. Although promising, the effect of strontium on cementoblasts is still unclear. So the aim of this research was to clarify and investigate the effect of strontium on cementogenesis via employing cementoblasts as model. A series of experiments including MTT, alkaline phosphatase activity, gene analysis, alizarin red staining, and western blot were carried out to evaluate the proliferation and differentiation of cementoblasts. In addition, expression of sclerostin was checked to analyze the possible mechanism. Our results show that strontium inhibits the proliferation of cementoblasts with a dose dependent manner; however, it can promote the differentiation of cementoblasts via downregulating sclerostin expression. Taking together, strontium may facilitate cementogenesis and benefit the treatment of root resorption at a low dose. PMID:25003114

  6. Strontium promotes cementoblasts differentiation through inhibiting sclerostin expression in vitro.

    PubMed

    Bao, Xingfu; Liu, Xianjun; Zhang, Yi; Cui, Yue; Yao, Jindan; Hu, Min

    2014-01-01

    Cementogenesis, performed by cementoblasts, is important for the repair of root resorption caused by orthodontic treatment. Based on recent studies, strontium has been applied for osteoporosis treatment due to its positive effect on osteoblasts. Although promising, the effect of strontium on cementoblasts is still unclear. So the aim of this research was to clarify and investigate the effect of strontium on cementogenesis via employing cementoblasts as model. A series of experiments including MTT, alkaline phosphatase activity, gene analysis, alizarin red staining, and western blot were carried out to evaluate the proliferation and differentiation of cementoblasts. In addition, expression of sclerostin was checked to analyze the possible mechanism. Our results show that strontium inhibits the proliferation of cementoblasts with a dose dependent manner; however, it can promote the differentiation of cementoblasts via downregulating sclerostin expression. Taking together, strontium may facilitate cementogenesis and benefit the treatment of root resorption at a low dose.

  7. Differential gene expression in human abdominal aortic aneurysm and aortic occlusive disease

    PubMed Central

    Moran, Corey S.; Schreurs, Charlotte; Lindeman, Jan H. N.; Walker, Philip J.; Nataatmadja, Maria; West, Malcolm; Holdt, Lesca M.; Hinterseher, Irene; Pilarsky, Christian; Golledge, Jonathan

    2015-01-01

    Abdominal aortic aneurysm (AAA) and aortic occlusive disease (AOD) represent common causes of morbidity and mortality in elderly populations which were previously believed to have common aetiologies. The aim of this study was to assess the gene expression in human AAA and AOD. We performed microarrays using aortic specimen obtained from 20 patients with small AAAs (≤ 55mm), 29 patients with large AAAs (> 55mm), 9 AOD patients, and 10 control aortic specimens obtained from organ donors. Some differentially expressed genes were validated by quantitative-PCR (qRT-PCR)/immunohistochemistry. We identified 840 and 1,014 differentially expressed genes in small and large AAAs, respectively. Immune-related pathways including cytokine-cytokine receptor interaction and T-cell-receptor signalling were upregulated in both small and large AAAs. Examples of validated genes included CTLA4 (2.01-fold upregulated in small AAA, P = 0.002), NKTR (2.37-and 2.66-fold upregulated in small and large AAA with P = 0.041 and P = 0.015, respectively), and CD8A (2.57-fold upregulated in large AAA, P = 0.004). 1,765 differentially expressed genes were identified in AOD. Pathways upregulated in AOD included metabolic and oxidative phosphorylation categories. The UCP2 gene was downregulated in AOD (3.73-fold downregulated, validated P = 0.017). In conclusion, the AAA and AOD transcriptomes were very different suggesting that AAA and AOD have distinct pathogenic mechanisms. PMID:25944698

  8. Biological network module-based model for the analysis of differential expression in shotgun proteomics.

    PubMed

    Xu, Jia; Wang, Lily; Li, Jing

    2014-12-05

    Protein differential expression analysis plays an important role in the understanding of molecular mechanisms as well as the pathogenesis of complex diseases. With the rapid development of mass spectrometry, shotgun proteomics using spectral counts has become a prevailing method for the quantitative analysis of complex protein mixtures. Existing methods in differential proteomics expression typically carry out analysis at the single-protein level. However, it is well-known that proteins interact with each other when they function in biological processes. In this study, focusing on biological network modules, we proposed a negative binomial generalized linear model for differential expression analysis of spectral count data in shotgun proteomics. In order to show the efficacy of the model in protein expression analysis at the level of protein modules, we conducted two simulation studies using synthetic data sets generated from theoretical distribution of count data and a real data set with shuffled counts. Then, we applied our method to a colorectal cancer data set and a nonsmall cell lung cancer data set. When compared with single-protein analysis methods, the results showed that module-based statistical model which takes account of the interactions among proteins led to more effective identification of subtle but coordinated changes at the systems level.

  9. Differential expression of oxygen-regulated genes in bovine blastocysts.

    PubMed

    Harvey, A J; Navarrete Santos, A; Kirstein, M; Kind, K L; Fischer, B; Thompson, J G

    2007-03-01

    Low oxygen conditions (2%) during post-compaction culture of bovine blastocysts improve embryo quality, which is associated with a small yet significant increase in the expression of glucose transporter 1 (GLUT-1), suggesting a role of oxygen in embryo development mediated through oxygen-sensitive gene expression. However, bovine embryos to at least the blastocyst stage lack a key regulator of oxygen-sensitive gene expression, hypoxia-inducible factor 1alpha (HIF1alpha). A second, less well-characterized protein (HIF2alpha) is, however, detectable from the 8-cell stage of development. Here we use differential display to determine additional gene targets in bovine embryos in response to low oxygen conditions. While development to the blastocyst stage was unaffected by the oxygen concentration used during post-compaction culture, differential display identified oxygen-regulation of myotrophin and anaphase promoting complex 1 expression, with significantly lower levels observed following culture under 20% oxygen than 2% oxygen. These results further support the hypothesis that the level of gene expression of specific transcripts by bovine embryos alters in response to changes in the oxygen environment post-compaction. Specifically, we have identified two oxygen-sensitive genes that are potentially regulated by HIF2 in the bovine blastocyst.

  10. Differentially Expressed Genes Associated with Low-Dose Gamma Radiation

    NASA Astrophysics Data System (ADS)

    Hegyesi, Hargita; Sándor, Nikolett; Schilling, Boglárka; Kis, Enikő; Lumniczky, Katalin; Sáfrány, Géza

    We have studied low dose radiation induced gene expression alterations in a primary human fibroblast cell line using Agilent's whole human genome microarray. Cells were irradiated with 60Co γ-rays (0; 0.1; 0.5 Gy) and 2 hours later total cellular RNA was isolated. We observed differential regulation of approximately 300-500 genes represented on the microarray. Of these, 126 were differentially expressed at both doses, among them significant elevation of GDF-15 and KITLG was confirmed by qRT-PCR. Based on the transcriptional studies we selected GDF-15 to assess its role in radiation response, since GDF-15 is one of the p53 gene targets and is believed to participate in mediating p53 activities. First we confirmed gamma-radiation induced dose-dependent changes in GDF-15 expression by qRT-PCR. Next we determined the effect of GDF-15 silencing on radiosensitivity. Four GDF-15 targeting shRNA expressing lentiviral vectors were transfected into immortalized human fibroblast cells. We obtained efficient GDF-15 silencing in one of the four constructs. RNA interference inhibited GDF-15 gene expression and enhanced the radiosensitivity of the cells. Our studies proved that GDF-15 plays an essential role in radiation response and may serve as a promising target in radiation therapy.

  11. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  12. miRNA expression profile during osteogenic differentiation of human adipose-derived stem cells.

    PubMed

    Zhang, Zi-ji; Zhang, Hao; Kang, Yan; Sheng, Pu-yi; Ma, Yuan-chen; Yang, Zi-bo; Zhang, Zhi-qi; Fu, Ming; He, Ai-shan; Liao, Wei-ming

    2012-03-01

    Human adipose-derived stem cells (hADSC) are capable of differentiating into an osteogenic lineage. It is believed that microRNAs (miRNAs) play important roles in regulating this osteogenic differentiation of human adipose-derived cells, although its molecular mechanism remains unclear. We investigated the miRNA expression profile during osteogenic differentiation of hADSCs, and assessed the roles of involved miRNAs during the osteogenic differentiation. We obtained and cultured human adipose-derived stems cells from donors who underwent elective liposuction or other abdominal surgery at our institution. miRNA expression profiles pre- and post-osteogenic induction were obtained using microarray essay, and differently expressed miRNAs were verified using quantitative real-time polymerase chain reaction (qRT-PCR). The expression of osteogenic proteins was detected using an enzyme-linked immunosorbent assay. Putative targets of the miRNAs were predicted using online software MiRanda, TargetScan, and miRBase. Eight miRNAs were found differently expressed pre- and post-osteogenic induction, among which four miRNAs (miR-17, miR-20a, miR-20b, and miR-106a) were up-regulated and four miRNAs (miR-31, miR-125a-5p, miR-125b, and miR-193a) were down-regulated. qRT-PCR analysis further confirmed the results. Predicted target genes of the differentially expressed miRNAs based on the overlap from three public prediction algorithms: MiRanda, TargetScan, and miRBase Target have the known functions of regulating stem cell osteogenic differentiation, self-renewal, signal transduction, and cell cycle control. We identified a group of miRNAs that may play important roles in regulating hADSC cell differentiation toward an osteoblast lineage. Further study of these miRNAs may elucidate the mechanism of hADSC differentiation into adipose tissue, and thus provide basis for tissue engineering. © 2011 Wiley Periodicals, Inc.

  13. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua

    PubMed Central

    Nakamura, Aline Minali; Chahad-Ehlers, Samira; Lima, André Luís A.; Taniguti, Cristiane Hayumi; Sobrinho Jr., Iderval; Torres, Felipe Rafael; de Brito, Reinaldo Alves

    2016-01-01

    The West Indian fruit fly, Anastrepha obliqua, is an important agricultural pest in the New World. The use of pesticide-free methods to control invasive species such as this reinforces the search for genes potentially useful in their genetic control. Therefore, the study of chemosensory proteins involved with a range of responses to the chemical environment will help not only on the understanding of the species biology but may also help the development of environmentally friendly pest control strategies. Here we analyzed the expression patterns of three OBP genes, Obp19d_2, Obp56a and Obp99c, across different phases of A. obliqua development by qPCR. In order to do so, we tested eight and identified three reference genes for data normalization, rpl17, rpl18 and ef1a, which displayed stability for the conditions here tested. All OBPs showed differential expression on adults and some differential expression among adult stages. Obp99c had an almost exclusive expression in males and Obp56a showed high expression in virgin females. Thereby, our results provide relevant data not only for other gene expression studies in this species, as well as for the search of candidate genes that may help in the development of new pest control strategies. PMID:26818909

  14. Bcl-2-related protein family gene expression during oligodendroglial differentiation.

    PubMed

    Itoh, Takayuki; Itoh, Aki; Pleasure, David

    2003-06-01

    Oligodendroglial lineage cells (OLC) vary in susceptibility to both necrosis and apoptosis depending on their developmental stages, which might be regulated by differential expression of Bcl-2-related genes. As an initial step to test this hypothesis, we examined the expression of 19 Bcl-2-related genes in purified cultures of rat oligodendroglial progenitors, immature and mature oligodendrocytes. All 'multidomain' anti-apoptotic members (Bcl-x, Bcl-2, Mcl-1, Bcl-w and Bcl2l10/Diva/Boo) except Bcl2a1/A1 are expressed in OLC. Semiquantitative and real-time RT-PCR revealed that Bcl-xL and Mcl-1 mRNAs are the dominant anti-apoptotic members and increase four- and twofold, respectively, with maturation. Bcl-2 mRNA is less abundant than Bcl-xL mRNA in progenitors and falls an additional 10-fold during differentiation. Bcl-w mRNA also increases, with significant changes in its splicing pattern, as OLC mature. Transfection studies demonstrated that Bcl-xL overexpression protects against kainate-induced excitotoxicity, whereas Bcl-2 overexpression does not. As for 'multidomain' pro-apoptotic members (Bax, Bad and Bok/Mtd), Bax and Bak are highly expressed throughout differentiation. Among 'BH3 domain-only' members examined (Bim, Biklk, DP5/Hrk, Bad, Bid, Noxa, Puma/Bbc3, Bmf, BNip3 and BNip3L), BNip3 and Bmf mRNAs increase markedly during differentiation. These results provide basic information to guide further studies on the roles for Bcl-2-related family proteins in OLC death.

  15. Flow Cytometry and Transplantation-Based Quantitative Assays for Satellite Cell Self-Renewal and Differentiation.

    PubMed

    Arpke, Robert W; Kyba, Michael

    2016-01-01

    In response to muscle damage, satellite cells proliferate and undertake both differentiation and self-renewal, generating new functional muscle tissue and repopulating this new muscle with stem cells for future injury responses. For many questions relating to the physiological regulation of satellite cells, quantitative readouts of self-renewal and differentiation can be very useful. There is a particular need for a quantitative assay for satellite cell self-renewal that does not rely solely upon sectioning, staining and counting cells in sections. In this chapter, we provide detailed methods for quantifying the self-renewal and differentiation potential of a given population of satellite cells using an assay involving transplantation into injured, regenerating muscle together with specific markers for donor cell identity and state of differentiation. In particular, using the Pax7-ZsGreen transgene as a marker of satellite cell state, self-renewal can be quantified by FACS on transplanted muscle to actually count the total number of resident satellite cells at time points following transplantation.

  16. Differential expression of CART in ewes with differing ovulation rates.

    PubMed

    Juengel, Jennifer L; French, Michelle C; Quirke, Laurel D; Kauff, Alexia; Smith, George W; Johnstone, Peter D

    2017-04-01

    We hypothesised that cocaine- and amphetamine-regulated transcript (CARTPT) would be differentially expressed in ewes with differing ovulation rates. Expression of mRNA for CARTPT, as well as LHCGR, FSHR, CYP19A1 and CYP17A1 was determined in antral follicles ≥1 mm in diameter collected during the follicular phase in ewes heterozygous for the Booroola and Inverdale genes (I+B+; average ovulation rate 4) and ++ contemporaries (++; average ovulation rate 1.8). In ++ ewes (n = 6), CARTPT was expressed in small follicles (1 to <3 mm diameter), where 18.8 ± 2.5% follicles expressed CARTPT CART peptide was also detected in follicular fluid of some follicles of ++ ewes. In I+B+ ewes, 5/6 ewes did not have any follicles that expressed CARTPT, and no CART peptide was detected in any follicle examined. Expression pattern of CYP19A1 differed between I+B+ and ++ ewes with an increased percentage of small and medium follicles (3 to <4.5 mm diameter) but decreased percentage of large follicles (≥4.5 mm diameter) expressing CYP19A1 in the I+B+ ewes. Many of the large follicles from the I+B+ ewes appeared non-functional and expression of LHCGR, FSHR, CYP17A1 and CYP19A1 was less than that observed in ++ ewes. Expression of FSHR and CYP17A1 was not different between groups in small and medium follicles, but LHCGR expression was approximately double in I+B+ ewes compared to that in ++ ewes. Thus, ewes with high ovulation rates had a distinct pattern of expression of CARTPT mRNA and protein compared to ewes with normal ovulation rates, providing evidence for CART being important in the regulation of ovulation rate. © 2017 Society for Reproduction and Fertility.

  17. RBM4 promotes pancreas cell differentiation and insulin expression.

    PubMed

    Lin, Jung-Chun; Yan, Yu-Ting; Hsieh, Wen-Kou; Peng, Pey-Jey; Su, Chun-Hao; Tarn, Woan-Yuh

    2013-01-01

    The RNA-binding protein RNA-binding motif protein 4 (RBM4) modulates alternative splicing of muscle-specific mRNA isoforms during muscle cell differentiation. To better understand the physiological function of RBM4, we exploited a gene knockout strategy in the present study. Mice with targeted disruption of one of the two Rbm4 genes exhibited hyperglycemia coincident with reduced levels of serum insulin and reduced size of pancreatic islets. The embryonic pancreases of Rbm4-deficient mice showed reduced expression or aberrant splicing of many transcripts encoding factors required for pancreas cell differentiation and function. Using pancreatic acinar AR42J cells, we demonstrated that RBM4 promoted insulin gene expression by altering the isoform balance of the transcription factors Isl1 and Pax4 via alternative splicing control. RBM4 overexpression was sufficient to convert AR42J cells into insulin-producing cells. Moreover, RBM4 may mediate glucose-induced insulin expression and insulin receptor isoform switches. These results suggest that RBM4 may have role in promoting pancreas cell differentiation and endocrine function, essentially via alternative splicing regulation.

  18. Amyloid precursor protein expression and processing are differentially regulated during cortical neuron differentiation.

    PubMed

    Bergström, Petra; Agholme, Lotta; Nazir, Faisal Hayat; Satir, Tugce Munise; Toombs, Jamie; Wellington, Henrietta; Strandberg, Joakim; Bontell, Thomas Olsson; Kvartsberg, Hlin; Holmström, Maria; Boreström, Cecilia; Simonsson, Stina; Kunath, Tilo; Lindahl, Anders; Blennow, Kaj; Hanse, Eric; Portelius, Erik; Wray, Selina; Zetterberg, Henrik

    2016-07-07

    Amyloid precursor protein (APP) and its cleavage product amyloid β (Aβ) have been thoroughly studied in Alzheimer's disease. However, APP also appears to be important for neuronal development. Differentiation of induced pluripotent stem cells (iPSCs) towards cortical neurons enables in vitro mechanistic studies on human neuronal development. Here, we investigated expression and proteolytic processing of APP during differentiation of human iPSCs towards cortical neurons over a 100-day period. APP expression remained stable during neuronal differentiation, whereas APP processing changed. α-Cleaved soluble APP (sAPPα) was secreted early during differentiation, from neuronal progenitors, while β-cleaved soluble APP (sAPPβ) was first secreted after deep-layer neurons had formed. Short Aβ peptides, including Aβ1-15/16, peaked during the progenitor stage, while processing shifted towards longer peptides, such as Aβ1-40/42, when post-mitotic neurons appeared. This indicates that APP processing is regulated throughout differentiation of cortical neurons and that amyloidogenic APP processing, as reflected by Aβ1-40/42, is associated with mature neuronal phenotypes.

  19. Amyloid precursor protein expression and processing are differentially regulated during cortical neuron differentiation

    PubMed Central

    Bergström, Petra; Agholme, Lotta; Nazir, Faisal Hayat; Satir, Tugce Munise; Toombs, Jamie; Wellington, Henrietta; Strandberg, Joakim; Bontell, Thomas Olsson; Kvartsberg, Hlin; Holmström, Maria; Boreström, Cecilia; Simonsson, Stina; Kunath, Tilo; Lindahl, Anders; Blennow, Kaj; Hanse, Eric; Portelius, Erik; Wray, Selina; Zetterberg, Henrik

    2016-01-01

    Amyloid precursor protein (APP) and its cleavage product amyloid β (Aβ) have been thoroughly studied in Alzheimer’s disease. However, APP also appears to be important for neuronal development. Differentiation of induced pluripotent stem cells (iPSCs) towards cortical neurons enables in vitro mechanistic studies on human neuronal development. Here, we investigated expression and proteolytic processing of APP during differentiation of human iPSCs towards cortical neurons over a 100-day period. APP expression remained stable during neuronal differentiation, whereas APP processing changed. α-Cleaved soluble APP (sAPPα) was secreted early during differentiation, from neuronal progenitors, while β-cleaved soluble APP (sAPPβ) was first secreted after deep-layer neurons had formed. Short Aβ peptides, including Aβ1-15/16, peaked during the progenitor stage, while processing shifted towards longer peptides, such as Aβ1-40/42, when post-mitotic neurons appeared. This indicates that APP processing is regulated throughout differentiation of cortical neurons and that amyloidogenic APP processing, as reflected by Aβ1-40/42, is associated with mature neuronal phenotypes. PMID:27383650

  20. Comparative proteomic analysis of differentially expressed proteins between peripheral sensory and motor nerves.

    PubMed

    He, Qianru; Man, Lili; Ji, Yuhua; Zhang, Shuqiang; Jiang, Maorong; Ding, Fei; Gu, Xiaosong

    2012-06-01

    Peripheral sensory and motor nerves have different functions and different approaches to regeneration, especially their distinct ability to accurately reinervate terminal nerve pathways. To understand the molecular aspects underlying these differences, the proteomics technique by coupling isobaric tags for relative and absolute quantitation (iTRAQ) with online two-dimensional liquid chromatography tandem mass spectrometry (2D LC-MS/MS) was used to investigate the protein profile of sensory and motor nerve samples from rats. A total of 1472 proteins were identified in either sensory or motor nerve. Of them, 100 proteins showed differential expressions between both nerves, and some of them were validated by quantitative real time RT-PCR, Western blot analysis, and immunohistochemistry. In the light of functional categorization, the differentially expressed proteins in sensory and motor nerves, belonging to a broad range of classes, were related to a diverse array of biological functions, which included cell adhesion, cytoskeleton, neuronal plasticity, neurotrophic activity, calcium-binding, signal transduction, transport, enzyme catalysis, lipid metabolism, DNA-binding, synaptosome function, actin-binding, ATP-binding, extracellular matrix, and commitment to other lineages. The relatively higher expressed proteins in either sensory or motor nerve were tentatively discussed in combination with their specific molecular characteristics. It is anticipated that the database generated in this study will provide a solid foundation for further comprehensive investigation of functional differences between sensory and motor nerves, including the specificity of their regeneration.

  1. Differential expression of neuroleukin in osseous tissues and its involvement in mineralization during osteoblast differentiation

    NASA Technical Reports Server (NTRS)

    Zhi, J.; Sommerfeldt, D. W.; Rubin, C. T.; Hadjiargyrou, M.

    2001-01-01

    Osteoblast differentiation is a multistep process that involves critical spatial and temporal regulation of cellular processes marked by the presence of a large number of differentially expressed molecules. To identify key functional molecules, we used differential messenger RNA (mRNA) display and compared RNA populations isolated from the defined transition phases (proliferation, matrix formation, and mineralization) of the MC3T3-E1 osteoblast-like cell line. Using this approach, a complementary DNA (cDNA) fragment was isolated and identified as neuroleukin (NLK), a multifunctional cytokine also known as autocrine motility factor (AMF), phosphoglucose isomerase (PGI; phosphohexose isomerase [PHI]), and maturation factor (MF). Northern analysis showed NLK temporal expression during MC3T3-E1 cell differentiation with a 3.5-fold increase during matrix formation and mineralization. Immunocytochemical studies revealed the presence of NLK in MC3T3-E1 cells as well as in the surrounding matrix, consistent with a secreted molecule. In contrast, the NLK receptor protein was detected primarily on the cell membrane. In subsequent studies, a high level of NLK expression was identified in osteoblasts and superficial articular chondrocytes in bone of 1-, 4-, and 8-month-old normal mice, as well as in fibroblasts, proliferating chondrocytes, and osteoblasts within a fracture callus. However, NLK was not evident in hypertrophic chondrocytes or osteocytes. In addition, treatment of MC3T3 cells with 6-phosphogluconic acid (6PGA; a NLK inhibitor) resulted in diminishing alkaline phosphatase (ALP) activity and mineralization in MC3T3-E1 cells, especially during the matrix formation stage of differentiating cells. Taken together, these data show specific expression of NLK in discrete populations of bone and cartilage cells and suggest a possible role for this secreted protein in bone development and regeneration.

  2. Differential expression of neuroleukin in osseous tissues and its involvement in mineralization during osteoblast differentiation

    NASA Technical Reports Server (NTRS)

    Zhi, J.; Sommerfeldt, D. W.; Rubin, C. T.; Hadjiargyrou, M.

    2001-01-01

    Osteoblast differentiation is a multistep process that involves critical spatial and temporal regulation of cellular processes marked by the presence of a large number of differentially expressed molecules. To identify key functional molecules, we used differential messenger RNA (mRNA) display and compared RNA populations isolated from the defined transition phases (proliferation, matrix formation, and mineralization) of the MC3T3-E1 osteoblast-like cell line. Using this approach, a complementary DNA (cDNA) fragment was isolated and identified as neuroleukin (NLK), a multifunctional cytokine also known as autocrine motility factor (AMF), phosphoglucose isomerase (PGI; phosphohexose isomerase [PHI]), and maturation factor (MF). Northern analysis showed NLK temporal expression during MC3T3-E1 cell differentiation with a 3.5-fold increase during matrix formation and mineralization. Immunocytochemical studies revealed the presence of NLK in MC3T3-E1 cells as well as in the surrounding matrix, consistent with a secreted molecule. In contrast, the NLK receptor protein was detected primarily on the cell membrane. In subsequent studies, a high level of NLK expression was identified in osteoblasts and superficial articular chondrocytes in bone of 1-, 4-, and 8-month-old normal mice, as well as in fibroblasts, proliferating chondrocytes, and osteoblasts within a fracture callus. However, NLK was not evident in hypertrophic chondrocytes or osteocytes. In addition, treatment of MC3T3 cells with 6-phosphogluconic acid (6PGA; a NLK inhibitor) resulted in diminishing alkaline phosphatase (ALP) activity and mineralization in MC3T3-E1 cells, especially during the matrix formation stage of differentiating cells. Taken together, these data show specific expression of NLK in discrete populations of bone and cartilage cells and suggest a possible role for this secreted protein in bone development and regeneration.

  3. Differential effects of detergents on keratinocyte gene expression.

    PubMed

    van Ruissen, F; Le, M; Carroll, J M; van der Valk, P G; Schalkwijk, J

    1998-04-01

    We have studied the effect of various detergents on keratinocyte gene expression in vitro, using an anionic detergent (sodium dodecyl sulfate), a cationic detergent cetyltrimethylammoniumbromide (CTAB), and two nonionic detergents, Nonidet P-40 and Tween-20. We measured the effect of these detergents on direct cellular toxicity (lactate dehydrogenase release), on the expression of markers for normal differentiation (cytokeratin 1 and involucrin expression), and on disturbed keratinocyte differentiation (SKALP) by northern blot analysis. As reported in other studies, large differences were noted in direct cellular toxicity. In a culture model that mimics normal epidermal differentiation we found that low concentrations of sodium dodecyl sulfate could induce the expression of SKALP, a proteinase inhibitor that is not normally expressed in human epidermis but is found in hyperproliferative skin. Sodium dodecyl sulfate caused upregulation of involucrin and downregulation of cytokeratin 1 expression, which is associated with the hyperproliferative/inflammatory epidermal phenotype found in psoriasis, wound healing, and skin irritation. These changes were not induced after treatment of cultures with CTAB, Triton X-100, and Nonidet-P40. This effect appeared to be specific for the class of anionic detergents because sodium dodecyl benzene sulfonate and sodium laurate also induced SKALP expression. These in vitro findings showed only a partial correlation with the potential of different detergents to induce clinical, biophysical, and cell biologic changes in vivo in human skin. Both sodium dodecyl sulfate and CTAB were found to cause induction and upregulation of SKALP and involucrin at low doses following a 24 h patch test, whereas high concentrations of Triton X-100 did not. Sodium dodecyl sulfate induced higher rates of transepidermal water loss, whereas CTAB treated skin showed more signs of cellular toxicity. We conclude that the action of anionic detergents on

  4. Differential expression of antimicrobial peptides in margins of chronic wounds.

    PubMed

    Dressel, Stefanie; Harder, Jürgen; Cordes, Jesko; Wittersheim, Maike; Meyer-Hoffert, Ulf; Sunderkötter, Cord; Gläser, Regine

    2010-07-01

    Skin wounds usually heal without major infections, although the loss of the mechanical epithelial barrier exposes the tissue to various bacteria. One reason may be the expression of antimicrobial peptides (AMP) of which some [human beta-defensins (hBD) and LL-37] were recently shown to support additionally certain steps of wound healing. There are no studies which have compared expression patterns of different classes of AMP in chronic wounds. The aim of our study was therefore to analyse the expression profile of hBD-2, hBD-3, LL-37, psoriasin and RNase 7 by immunohistochemistry from defined wound margins of chronic venous ulcers. We detected a strong induction of psoriasin and hBD-2 in chronic wounds in comparison with healthy skin. Except for stratum corneum, no expression of RNase 7 and LL-37 was detected in the epidermis while expression of hBD-3 was heterogeneous. Bacterial swabs identified Staphylococcus aureus and additional bacterial populations, but no association between colonization and AMP expression was found. The differential expression of AMP is noteworthy considering the high bacterial load of chronic ulcers. Clinically, supplementation of AMP with the capability to enhance wound healing besides restricting bacterial overgrowth could present a physiological support for treatment of disturbed wound healing.

  5. Detection of differentially expressed genes in the early developmental stage of the mouse mandible.

    PubMed

    Yamaza, H; Matsuo, K; Kiyoshima, T; Shigemura, N; Kobayashi, I; Wada, H; Akamime, A; Sakai, H

    2001-06-01

    We previously examined the development of the mouse mandible, and demonstrated that odontogenesis occurs between embryonic day 10.5 (E10.5) and E12. Based on the histological findings, we performed cDNA subtraction between the E10.5 and E12 mandibles to detect any differentially expressed genes which might be involved in the initiation of odontogenesis. By sequencing, homology search and semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), we thus found Pgk-1, Ccte, Hsp86, Nucleolin, Hsc73, Frg1, N-ras, Set alpha and Hsj2 from the E10.5 mandible, and E25, ATPase6, Mum2, Thymosin beta4 and L21 from the E12 mandible to be differentially expressed genes. These genes are functionally related to protein transport, signal transduction, transcription, translation and molecular chaperon activity. In situ hybridization analyses of Set alpha and E25 showed that Set alpha was detected in the tooth germ at E12 and E14.5, thus indicating a close relationship of this gene to odontogenesis. Meanwhile, the in situ signal of E25 was found in the muscular layer of the tongue, thus suggesting E25 to be related to the differentiation of muscular tissue. In conclusion, we found 15 differentially expressed genes in the course of the early developmental stage of the mouse mandible using a combination of the cDNA subtraction and semi-quantitative RT-PCR methods, while in addition, two genes were demonstrated to be related to the initiation and the development of both tooth germ and the tongue according to the in situ hybridization technique.

  6. PATHOME: an algorithm for accurately detecting differentially expressed subpathways

    PubMed Central

    Nam, S; Chang, H R; Kim, K-T; Kook, M-C; Hong, D; Kwon, C H; Jung, H R; Park, H S; Powis, G; Liang, H; Park, T; Kim, Y H

    2014-01-01

    The translation of high-throughput gene expression data into biologically meaningful information remains a bottleneck. We developed a novel computational algorithm, PATHOME, for detecting differentially expressed biological pathways. This algorithm employs straightforward statistical tests to evaluate the significance of differential expression patterns along subpathways. Applying it to gene expression data sets of gastric cancer (GC), we compared its performance with those of other leading programs. Based on a literature-driven reference set, PATHOME showed greater consistency in identifying known cancer-related pathways. For the WNT pathway uniquely identified by PATHOME, we validated its involvement in gastric carcinogenesis through experimental perturbation of both cell lines and animal models. We identified HNF4α-WNT5A regulation in the cross-talk between the AMPK metabolic pathway and the WNT signaling pathway, and further identified WNT5A as a potential therapeutic target for GC. We have demonstrated PATHOME to be a powerful tool, with improved sensitivity for identifying disease-related dysregulated pathways. PMID:24681952

  7. Quantitative flow cytometric analysis of membrane antigen expression.

    PubMed

    D'hautcourt, Jean-Luc

    2002-11-01

    Immunological analysis for cell antigens has been performed by flow cytometry in a qualitative fashion for over thirty years. During that time it has become increasingly apparent that quantitative measurements such as number of antigens per cell provide unique and useful information. This unit on quantitative flow cytometry (QFCM) describes the most commonly used protocols, both direct and indirect, and the major methods of analysis for the number of antibody binding sites on a cell or particle. Practical applications include detection of antigen under- or overexpression in hematological malignancies, distinguishing between B cell lymphoproliferative disorders, and precise diagnosis of certain rare diseases.

  8. Identifying the optimal gene and gene set in hepatocellular carcinoma based on differential expression and differential co-expression algorithm.

    PubMed

    Dong, Li-Yang; Zhou, Wei-Zhong; Ni, Jun-Wei; Xiang, Wei; Hu, Wen-Hao; Yu, Chang; Li, Hai-Yan

    2017-02-01

    The objective of this study was to identify the optimal gene and gene set for hepatocellular carcinoma (HCC) utilizing differential expression and differential co-expression (DEDC) algorithm. The DEDC algorithm consisted of four parts: calculating differential expression (DE) by absolute t-value in t-statistics; computing differential co-expression (DC) based on Z-test; determining optimal thresholds on the basis of Chi-squared (χ2) maximization and the corresponding gene was the optimal gene; and evaluating functional relevance of genes categorized into different partitions to determine the optimal gene set with highest mean minimum functional information (FI) gain (Δ*G). The optimal thresholds divided genes into four partitions, high DE and high DC (HDE-HDC), high DE and low DC (HDE-LDC), low DE and high DC (LDE‑HDC), and low DE and low DC (LDE-LDC). In addition, the optimal gene was validated by conducting reverse transcription-polymerase chain reaction (RT-PCR) assay. The optimal threshold for DC and DE were 1.032 and 1.911, respectively. Using the optimal gene, the genes were divided into four partitions including: HDE-HDC (2,053 genes), HED-LDC (2,822 genes), LDE-HDC (2,622 genes), and LDE-LDC (6,169 genes). The optimal gene was microtubule‑associated protein RP/EB family member 1 (MAPRE1), and RT-PCR assay validated the significant difference between the HCC and normal state. The optimal gene set was nucleoside metabolic process (GO\\GO:0009116) with Δ*G = 18.681 and 24 HDE-HDC partitions in total. In conclusion, we successfully investigated the optimal gene, MAPRE1, and gene set, nucleoside metabolic process, which may be potential biomarkers for targeted therapy and provide significant insight for revealing the pathological mechanism underlying HCC.

  9. Trichomonas vaginalis adherence mediates differential gene expression in human vaginal epithelial cells

    PubMed Central

    Kucknoor, Ashwini; Mundodi, Vasanthakrishna; Alderete, John F.

    2007-01-01

    Summary Trichomonas vaginalis, an ancient protist, colonizes the vaginal mucosa causing trichomonosis, a vaginitis that sometimes leads to severe health complications. Preparatory to colonization of the vagina is the adhesion to vaginal epithelial cells (VECs) by trichomonads. We hypothesized that VECs alter the gene expression to form a complex signalling cascade in response to trichomonal adherence. In order to identify the genes that are upregulated, we constructed a subtraction cDNA library after contact with parasites that is enriched for differentially expressed genes from the immortalized MS-74 VECs. Sixty cDNA clones were sequenced and to our knowledge for the first time, differentially regulated genes were identified in response to early trichomonal infection. The identified genes were found to encode functional proteins with specific functions associated with cell structure maintenance and extracellular matrix components, proinflammatory molecules and apoptosis. Semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) confirmed expression of selected genes. Further, cyclooxygenase 2 (COX-2) protein expression was analysed using Western blot and immunofluorescence assays. Data suggest that p38 mitogen-activated protein (MAP) kinase and tyrosine kinases play a role in COX-2 induction. Finally, T. vaginalis and Tritrichomonas foetus but not Pentatrichomonas hominis induce expression of COX-2. This is a first attempt at elucidating the basis of interaction of trichomonads with host cells and the corresponding host responses triggered by the parasites. PMID:15888089

  10. Differential gene expression by Moniliophthora roreri while overcoming cacao tolerance in the field.

    PubMed

    Bailey, Bryan A; Melnick, Rachel L; Strem, Mary D; Crozier, Jayne; Shao, Jonathan; Sicher, Richard; Phillips-Mora, Wilberth; Ali, Shahin S; Zhang, Dapeng; Meinhardt, Lyndel

    2014-09-01

    Frosty pod rot (FPR) of Theobroma cacao (cacao) is caused by the hemibiotrophic fungus Moniliophthora roreri. Cacao clones tolerant to FPR are being planted throughout Central America. To determine whether M. roreri shows a differential molecular response during successful infections of tolerant clones, we collected field-infected pods at all stages of symptomatology for two highly susceptible clones (Pound-7 and CATIE-1000) and three tolerant clones (UF-273, CATIE-R7 and CATIE-R4). Metabolite analysis was carried out on clones Pound-7, CATIE-1000, CATIE-R7 and CATIE-R4. As FPR progressed, the concentrations of sugars in pods dropped, whereas the levels of trehalose and mannitol increased. Associations between symptoms and fungal loads and some organic and amino acid concentrations varied depending on the clone. RNA-Seq analysis identified 873 M. roreri genes that were differentially expressed between clones, with the primary difference being whether the clone was susceptible or tolerant. Genes encoding transcription factors, heat shock proteins, transporters, enzymes modifying membranes or cell walls and metabolic enzymes, such as malate synthase and alternative oxidase, were differentially expressed. The differential expression between clones of 43 M. roreri genes was validated by real-time quantitative reverse transcription polymerase chain reaction. The expression profiles of some genes were similar in susceptible and tolerant clones (other than CATIE-R4) and varied with the biotrophic/necrotropic shift. Moniliophthora roreri genes associated with stress metabolism and responses to heat shock and anoxia were induced early in tolerant clones, their expression profiles resembling that of the necrotrophic phase. Moniliophthora roreri stress response genes, induced during the infection of tolerant clones, may benefit the fungus in overcoming cacao defense mechanisms. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  11. Differential gene expression profiling of large and small retinal ganglion cells

    PubMed Central

    Ivanov, Dmitry; Dvoriantchikova, Galina; Barakat, David J.; Nathanson, Lubov; Shestopalov, Valery I.

    2014-01-01

    Different sub-populations of retinal ganglion cells (RGCs) vary in their sensitivity to pathological conditions such as retinal ischemia, diabetic retinopathy and glaucoma. Comparative transcriptomic analysis of such groups will likely reveal molecular determinants of differential sensitivity to stress. However, gene expression profiling of primary neuronal sub-populations represent a challenge due to the cellular heterogeneity of retinal tissue. In this manuscript, we report the use of a fluorescent neural tracer to specifically label and selectively isolate RGCs with different soma sizes by fluorescence-activated cell sorting (FACS) for the purpose of differential gene expression profiling. We identified 145 genes that were more active in the large RGCs and 312 genes in the small RGCs. Differential data were validated by quantitative RT-PCR, several corresponding proteins were confirmed by immunohistochemistry. Functional characterization revealed differential activity of genes implicated in synaptic transmission, neurotransmitter secretion, axon guidance, chemotaxis, ion transport and tolerance to stress. An in silico reconstruction of cellular networks suggested that differences in pathway activity between the two sub-populations of RGCs are controlled by networks interconnected by SP-1, Erk2(MAPK1), Egr1, Egr2 and, potentially, regulated via transcription factors C/EBPbeta, HSF1, STAT1- and c-Myc. The results show that FACS-aided purification of retrogradely labeled cells can be effectively utilized for transcriptional profiling of adult retinal neurons. PMID:18640154

  12. Expression of GATA-3 During Lymphocyte Differentiation and Mouse Embryogenesis

    PubMed Central

    Oosterwegel, Mariëtte; Timmerman, Janneke; Leiden, Jeffrey

    1992-01-01

    The GATA family of C4 zinc-finger transcription factors has been implicated in tissuespecific gene regulation in birds and mammals. One of the members of this family, GATA-3, is reportedly expressed specifically in the T-cell lineage, where it interacts with GATA motifs in the TCR-αα, TCR-β/, and TCR-δ enhancers, thereby controlling the T-cell phenotype. To evaluate the differentiation control properties of GATA-3, we have now documented its expression pattern during lymphoid differentiation and murine embryogenesis. The onset of GATA-3 expression in the lymphoid lineage was studied in a panel of lymphoid (precursor) cell lines by Northern blot analysis. GATA-3 was uniquely expressed in T-lineage lymphocytes expressing TCR and CD3 genes; it was absent from TCR/CD3 mRNA-negative prothymocytes and from all B-lineage cells. In order to obtain information on the expression of GATA-3 outside the immune system, in situ hybridization was performed on mouse embryos on day 11.5-14.5 of gestation. GATA-3 mRNA was detected in fetal thymus and in erythroid cells. Outside the haemopoietic system, we detected GATA-3 mRNA throughout the central nervous system, in kidney, in the epidermis, lens fibers, the inner ear, whisker follicles, and in the primary palate. These data provide new clues about the potential role of GATA-3 during mouse development, and will aid the interpretation of currently ongoing gene knockout experiments. PMID:1343100

  13. Differential expression of GATA-3 in urothelial carcinoma variants.

    PubMed

    Liang, Yu; Heitzman, Joseph; Kamat, Ashish M; Dinney, Colin P; Czerniak, Bogdan; Guo, Charles C

    2014-07-01

    GATA binding protein 3 (GATA-3) is a novel immunohistochemical marker for urothelial carcinoma (UC); however, few studies have investigated GATA-3's role as a marker for UC variants. We used immunohistochemistry to assess GATA-3 expression in different UC variants, including micropapillary (n = 46), sarcomatoid (n = 43), small cell carcinoma (n = 22), and plasmacytoid (n = 16) variants, and we also compared GATA-3 expression in conventional bladder UC (n = 103) to that in squamous cell carcinoma (n = 14). GATA-3 expression was present in 70% (72/103) of conventional bladder UCs and highly concordant between matched primary and metastatic UCs. The GATA-3 expression levels of the micropapillary variants (57%; 26/46) and plasmacytoid variants (44%; 7/16) were not significantly different from that of conventional UC. However, the GATA-3 expression levels of the sarcomatoid variants (16%; 7/43) and small cell carcinoma variants (5%; 1/22), which only weakly expressed the protein, were significantly lower than that of conventional UC (P < .001). Only 7% of squamous cell carcinomas (1/14) expressed GATA-3, and it was also significantly lower than that of conventional UC (P < .001). GATA-3 expression was not significantly associated with tumor stage or patients' clinical outcomes. In conclusion, GATA-3 expression differed among UC variants. GATA-3 is a useful marker for confirming the urothelial origin of micropapillary and plasmacytoid UC variants but not that of sarcomatoid or small cell carcinoma variants. GATA-3 can also be used in differentiating UC from squamous cell carcinoma.

  14. Transcriptomic analysis reveals differential gene expression in response to aluminium in common bean (Phaseolus vulgaris) genotypes

    PubMed Central

    Eticha, Dejene; Zahn, Marc; Bremer, Melanie; Yang, Zhongbao; Rangel, Andrés F.; Rao, Idupulapati M.; Horst, Walter J.

    2010-01-01

    Background and Aims Aluminium (Al) resistance in common bean is known to be due to exudation of citrate from the root after a lag phase, indicating the induction of gene transcription and protein synthesis. The aims of this study were to identify Al-induced differentially expressed genes and to analyse the expression of candidate genes conferring Al resistance in bean. Methods The suppression subtractive hybridization (SSH) method was used to identify differentially expressed genes in an Al-resistant bean genotype (‘Quimbaya’) during the induction period. Using quantitative real-time PCR the expression patterns of selected genes were compared between an Al-resistant and an Al-sensitive genotype (‘VAX 1’) treated with Al for up to 24 h. Key Results Short-term Al treatment resulted in up-regulation of stress-induced genes and down-regulation of genes involved in metabolism. However, the expressions of genes encoding enzymes involved in citrate metabolism were not significantly affected by Al. Al treatment dramatically increased the expression of common bean expressed sequence tags belonging to the citrate transporter gene family MATE (multidrug and toxin extrusion family protein) in both the Al-resistant and -sensitive genotype in close agreement with Al-induced citrate exudation. Conclusions The expression of a citrate transporter MATE gene is crucial for citrate exudation in common bean. However, although the expression of the citrate transporter is a prerequisite for citrate exudation, genotypic Al resistance in common bean particularly depends on the capacity to sustain the synthesis of citrate for maintaining the cytosolic citrate pool that enables exudation. PMID:20237115

  15. Expression of T cell antigen receptor during differentiation

    SciTech Connect

    Allison, J.P.; Lanier, L.L.; Guyden, J.; Richie, E.R.

    1986-03-01

    The authors have used flow cytometry with monoclonal antibodies, radioimmuneprecipitation with a rabbit antiserum to common epitopes of the TCR, and Northern and Southern blot analysis with cloned TCR genes to study antigen receptor (TCR) expression by normal murine and human thymocytes and by primary murine thymomas. L3T4-,Lyt2- murine thymomas corresponding to the earliest stage of thymic differentiation, were found to have rearranged TCR beta genes, and to express low levels of beta transcript, but lacked alpha gene transcript and failed to express TCR on the cell surface. L3T4+,Lyt2+ thymomas were variable, but the majority were found to contain significant levels of both alpha and beta transcripts and to express TCR at the cell surface. Similarly, alpha and beta transcripts and TCR protein were detected in sorted L3T4+,Lyt2+ murine thymocytes. Using three color fluorescence, the authors determined that app. 70% of human T4+T8+ thymocytes also expressed T3, a component of the TCR complex. These data indicate that in mouse and man expression of TCR occurs in the immature, or cortical, thymic population.

  16. Meta-analysis of differentially expressed genes in ankylosing spondylitis.

    PubMed

    Lee, Y H; Song, G G

    2015-05-18

    The purpose of this study was to identify differentially expressed (DE) genes and biological processes associated with changes in gene expression in ankylosing spondylitis (AS). We performed a meta-analysis using the integrative meta-analysis of expression data program on publicly available microarray AS Gene Expression Omnibus (GEO) datasets. We performed Gene Ontology (GO) enrichment analyses and pathway analysis using the Kyoto Encyclopedia of Genes and Genomes. Four GEO datasets, including 31 patients with AS and 39 controls, were available for the meta-analysis. We identified 65 genes across the studies that were consistently DE in patients with AS vs controls (23 upregulated and 42 downregulated). The upregulated gene with the largest effect size (ES; -1.2628, P = 0.020951) was integral membrane protein 2A (ITM2A), which is expressed by CD4+ T cells and plays a role in activation of T cells. The downregulated gene with the largest ES (1.2299, P = 0.040075) was mitochondrial ribosomal protein S11 (MRPS11). The most significant GO enrichment was in the respiratory electron transport chain category (P = 1.67 x 10-9). Therefore, our meta-analysis identified genes that were consistently DE as well as biological pathways associated with gene expression changes in AS.

  17. Neuronal expression of pathological tau accelerates oligodendrocyte progenitor cell differentiation

    PubMed Central

    Ossola, Bernardino; Zhao, Chao; Compston, Alastair; Pluchino, Stefano; Franklin, Robin J. M.

    2015-01-01

    Oligodendrocyte progenitor cell (OPC) differentiation is an important therapeutic target to promote remyelination in multiple sclerosis (MS). We previously reported hyperphosphorylated and aggregated microtubule‐associated protein tau in MS lesions, suggesting its involvement in axonal degeneration. However, the influence of pathological tau‐induced axonal damage on the potential for remyelination is unknown. Therefore, we investigated OPC differentiation in human P301S tau (P301S‐htau) transgenic mice, both in vitro and in vivo following focal demyelination. In 2‐month‐old P301S‐htau mice, which show hyperphosphorylated tau in neurons, we found atrophic axons in the spinal cord in the absence of prominent axonal degeneration. These signs of early axonal damage were associated with microgliosis and an upregulation of IL‐1β and TNFα. Following in vivo focal white matter demyelination we found that OPCs differentiated more efficiently in P301S‐htau mice than wild type (Wt) mice. We also found an increased level of myelin basic protein within the lesions, which however did not translate into increased remyelination due to higher susceptibility of P301S‐htau axons to demyelination‐induced degeneration compared to Wt axons. In vitro experiments confirmed higher differentiation capacity of OPCs from P301S‐htau mice compared with Wt mice‐derived OPCs. Because the OPCs from P301S‐htau mice do not ectopically express the transgene, and when isolated from newborn mice behave like Wt mice‐derived OPCs, we infer that their enhanced differentiation capacity must have been acquired through microenvironmental priming. Our data suggest the intriguing concept that damaged axons may signal to OPCs and promote their differentiation in the attempt at rescue by remyelination. GLIA 2016;64:457–471 PMID:26576485

  18. Improved detection of differentially expressed genes in microarray experiments through multiple scanning and image integration

    PubMed Central

    Romualdi, Chiara; Trevisan, Silvia; Celegato, Barbara; Costa, Germano; Lanfranchi, Gerolamo

    2003-01-01

    The variability of results in microarray technology is in part due to the fact that independent scans of a single hybridised microarray give spot images that are not quite the same. To solve this problem and turn it to our advantage, we introduced the approach of multiple scanning and of image integration of microarrays. To this end, we have developed specific software that creates a virtual image that statistically summarises a series of consecutive scans of a microarray. We provide evidence that the use of multiple imaging (i) enhances the detection of differentially expressed genes; (ii) increases the image homogeneity; and (iii) reveals false-positive results such as differentially expressed genes that are detected by a single scan but not confirmed by successive scanning replicates. The increase in the final number of differentially expressed genes detected in a microarray experiment with this approach is remarkable; 50% more for microarrays hybridised with targets labelled by reverse transcriptase, and 200% more for microarrays developed with the tyramide signal amplification (TSA) technique. The results have been confirmed by semi-quantitative RT–PCR tests. PMID:14627839

  19. Differentially expressed miRNAs in oxygen-induced retinopathy newborn mouse models

    PubMed Central

    Wang, Yunpeng; Wu, Suying; Yang, Yang; Peng, Fen; Li, Qintao; Tian, Peng; Xiang, Erying; Liang, Honglu; Wang, Beibei; Zhou, Xiaoyu; Huang, Hua; Zhou, Xiaoguang

    2016-01-01

    The present study aimed to identify microRNAs (miRNAs) involved in regulating retinal neovascularization and retinopathy of prematurity (ROP). A total of 80 healthy C57BL/6 neonatal mice were randomly divided into the oxygen-induced retinopathy (OIR) group (n=40), in which 7-day-old mice were maintained in 75% oxygen conditions for 5 days, or the control group (n=40). Following collection of retinal tissue, retinal angiography and hematoxylin and eosin (H&E) staining were performed. Total RNA was also extracted from retinal tissue, and miRNA microarrays and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) were performed to identify differentially expressed miRNAs in the two groups. Retinal angiography and H&E staining revealed damage to retinas in the OIR group. Compared with the control group, 67 miRNAs were differentially expressed in the OIR group, of which 34 were upregulated and 33 were downregulated. Of these differentially expressed miRNAs, 32 exhibited a fold change ≥2, of which 21 were upregulated and 11 were downregulated. The results of RT-qPCR for miR-130a-3p and miR-5107-5p were in accordance with those of the miRNA microarray. The newly identified miRNAs may be important in the development of ROP, and may provide a basis for future research into the mechanisms of ROP. PMID:27922698

  20. Beyond differential expression: the quest for causal mutations and effector molecules

    PubMed Central

    2012-01-01

    High throughput gene expression technologies are a popular choice for researchers seeking molecular or systems-level explanations of biological phenomena. Nevertheless, there has been a groundswell of opinion that these approaches have not lived up to the hype because the interpretation of the data has lagged behind its generation. In our view a major problem has been an over-reliance on isolated lists of differentially expressed (DE) genes which – by simply comparing genes to themselves – have the pitfall of taking molecular information out of context. Numerous scientists have emphasised the need for better context. This can be achieved through holistic measurements of differential connectivity in addition to, or in replacement, of DE. However, many scientists continue to use isolated lists of DE genes as the major source of input data for common readily available analytical tools. Focussing this opinion article on our own research in skeletal muscle, we outline our resolutions to these problems – particularly a universally powerful way of quantifying differential connectivity. With a well designed experiment, it is now possible to use gene expression to identify causal mutations and the other major effector molecules with whom they cooperate, irrespective of whether they themselves are DE. We explain why, for various reasons, no other currently available experimental techniques or quantitative analyses are capable of reaching these conclusions. PMID:22849396

  1. Identification of Differentially Expressed Genes Between Osteoblasts and Osteocytes

    PubMed Central

    Paic, Frane; Igwe, John C.; Ravi, Nori; Kronenberg, Mark S.; Franceschetti, Tiziana; Harrington, Patrick; Kuo, Lynn; Shin, Don-Guk; Rowe, David W.; Harris, Stephen E.; Kalajzic, Ivo

    2009-01-01

    Osteocytes represent the most abundant cellular component of mammalian bones with important functions in bone mass maintenance and remodeling. To elucidate the differential gene expression between osteoblasts and osteocytes we completed a comprehensive analysis of their gene profiles. Selective identification of these two mature populations was achieved by utilization of visual markers of bone lineage cells. We have utilized dual GFP reporter mice in which osteocytes are expressing GFP (topaz) directed by the DMP1 promoter, while osteoblasts are identified by expression of GFP (cyan) driven by 2.3kb of the Col1a1 promoter. Histological analysis of 7-day-old neonatal calvaria confirmed the expression pattern of DMP1GFP in osteocytes and Col2.3 in osteoblasts and osteocytes. To isolate distinct populations of cells we utilized fluorescent activated cell sorting (FACS). Cells suspensions were subjected to RNA extraction, in vitro transcription and labeling of cDNA and gene expression was analyzed using the Illumina WG-6v1 BeadChip. Following normalization of raw data from four biological replicates, 3444 genes were called present in all three sorted cell populations: GFP negative, Col2.3cyan+ (osteoblasts), and DMP1topaz+(preosteocytes and osteocytes). We present the genes that showed in excess of a 2-fold change for gene expression between DMP1topaz+ and Col2.3cyan+ cells. The selected genes were classified and grouped according to their associated gene ontology terms. Genes clustered to osteogenesis and skeletal development such as Bmp4, Bmp8a, Dmp1, Enpp1, Phex and Ank were highly expressed in DMP1topaz+cells. Most of the genes encoding extracellular matrix components and secreted proteins had lower expression in DMP1topaz+ cells, while most of the genes encoding plasma membrane proteins were increased. Interestingly a large number of genes associated with muscle development and function and with neuronal phenotype were increased in DMP1topaz+ cells, indicating

  2. Human adipose tissue-derived mesenchymal stem cells differentiate into insulin, somatostatin, and glucagon expressing cells

    SciTech Connect

    Timper, Katharina; Seboek, Dalma; Eberhardt, Michael; Linscheid, Philippe; Christ-Crain, Mirjam; Keller, Ulrich; Mueller, Beat; Zulewski, Henryk . E-mail: henryk.zulewski@unibas.ch

    2006-03-24

    Mesenchymal stem cells (MSC) from mouse bone marrow were shown to adopt a pancreatic endocrine phenotype in vitro and to reverse diabetes in an animal model. MSC from human bone marrow and adipose tissue represent very similar cell populations with comparable phenotypes. Adipose tissue is abundant and easily accessible and could thus also harbor cells with the potential to differentiate in insulin producing cells. We isolated human adipose tissue-derived MSC from four healthy donors. During the proliferation period, the cells expressed the stem cell markers nestin, ABCG2, SCF, Thy-1 as well as the pancreatic endocrine transcription factor Isl-1. The cells were induced to differentiate into a pancreatic endocrine phenotype by defined culture conditions within 3 days. Using quantitative PCR a down-regulation of ABCG2 and up-regulation of pancreatic developmental transcription factors Isl-1, Ipf-1, and Ngn3 were observed together with induction of the islet hormones insulin, glucagon, and somatostatin.

  3. PLAC1 expression increases during trophoblast differentiation: evidence for regulatory interactions with the fibroblast growth factor-7 (FGF-7) axis.

    PubMed

    Massabbal, Eltayab; Parveen, Shanaz; Weisoly, D L; Nelson, D Michael; Smith, S D; Fant, Michael

    2005-07-01

    PLAC1 is a recently described, trophoblast-specific gene that localizes to a region of the X-chromosome important in placental development. Immunohistochemical analysis demonstrated that PLAC1 polypeptide localizes to the differentiated syncytiotrophoblast throughout gestation (8-41 weeks) as well as a small population of villous cytotrophoblasts. Consistent with these observations, quantitative RT-PCR demonstrated that PLAC1 mRNA increases more than 300-fold during cytotrophoblast differentiation in culture to form syncytiotrophoblasts. Agents known to be relevant to trophoblast differentiation were then tested for the ability to influence PLAC1 expression. Fibroblast growth factor-7 (FGF-7), also known as keratinocyte growth factor (KGF), stimulated PLAC1 mRNA expression approximately two-fold in the BeWo(b30) trophoblast cell line. FGF-7 stimulation was significantly inhibited by PD-98059 and wortmannin suggesting mediation via MAP kinase and PI-3 kinase-dependent signaling pathways. Interestingly, epidermal growth factor (EGF) treatment of trophoblasts had no effect on PLAC1 expression alone, but potentiated the effect of FGF-7, suggesting the presence of a regulatory interaction of the two growth factors. FGF-7 and its receptor, FGFR-2b, exhibited spatial overlap with PLAC1 suggesting these regulatory interactions are physiologically relevant during gestation. These data demonstrate PLAC1 expression is upregulated during trophoblast differentiation, localizing primarily to the differentiated syncytiotrophoblast. Furthermore PLAC1 expression is specifically regulated by peptide growth factors relevant to trophoblast differentiation. Copyright 2005 Wiley-Liss, Inc

  4. Differential expression of stress candidate genes for thermal tolerance in the sea urchin Loxechinus albus.

    PubMed

    Vergara-Amado, Jonathan; Silva, Andrea X; Manzi, Catalina; Nespolo, Roberto F; Cárdenas, Leyla

    2017-08-01

    Marine ectotherms inhabiting intertidal and shallow subtidal environments are continuously exposed to diurnal tidal cycles and seasonal variability in temperature. These organisms have adaptive mechanisms to maintain cellular homeostasis, irrespective of thermal environmental variation. In this study, we describe the molecular responses to thermal stress in the edible sea urchin Loxechinus albus. In particular, we determined the differential expression of a set of molecular markers that have been identified as targets of stress-related responses. These include the heat shock proteins (hsp70 and hsp90), cell detoxification proteins (cytochrome P450), and osmorregulatory proteins (α and ß - Na(+)/K(+)ATPase). We exposed individuals to different temperatures; a warm treatment (18±1.0°C), a cold treatment (10±1.0°C), and a control treatment (average local temperature of 14±1.0°C) and differential expression was quantified after 2, 6, 12 and 48h of exposure. Levels of mRNA were quantified by reverse transcription-quantitative polymerase chain reaction, and the relative expression of each gene was calculated using the 18S rRNA gene as a reference, and the control treatment as a calibrator. We found that the expression levels of all studied genes increased during exposure to warmth. The largest increase in expression was observed in cytochrome p450 genes (ca. sixteen-fold); this was followed by increases in the expression of the Na(+)/K(+)ATPase (ca. eight-fold) and by the hsp (ca. six fold) genes. These results indicate that sea urchin thermal stress responses depend on differential gene-regulation, involving heat-shock, membrane potential, and detoxification genes that generate an integrated adaptive response to acute environmental changes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Comparative transcriptome analysis reveals differentially expressed genes associated with sex expression in garden asparagus (Asparagus officinalis).

    PubMed

    Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gao, Wu-Jun

    2017-08-22

    Garden asparagus (Asparagus officinalis) is a highly valuable vegetable crop of commercial and nutritional interest. It is also commonly used to investigate the mechanisms of sex determination and differentiation in plants. However, the sex expression mechanisms in asparagus remain poorly understood. De novo transcriptome sequencing via Illumina paired-end sequencing revealed more than 26 billion bases of high-quality sequence data from male and female asparagus flower buds. A total of 72,626 unigenes with an average length of 979 bp were assembled. In comparative transcriptome analysis, 4876 differentially expressed genes (DEGs) were identified in the possible sex-determining stage of female and male/supermale flower buds. Of these DEGs, 433, including 285 male/supermale-biased and 149 female-biased genes, were annotated as flower related. Of the male/supermale-biased flower-related genes, 102 were probably involved in anther development. In addition, 43 DEGs implicated in hormone response and biosynthesis putatively associated with sex expression and reproduction were discovered. Moreover, 128 transcription factor (TF)-related genes belonging to various families were found to be differentially expressed, and this finding implied the essential roles of TF in sex determination or differentiation in asparagus. Correlation analysis indicated that miRNA-DEG pairs were also implicated in asparagus sexual development. Our study identified a large number of DEGs involved in the sex expression and reproduction of asparagus, including known genes participating in plant reproduction, plant hormone signaling, TF encoding, and genes with unclear functions. We also found that miRNAs might be involved in the sex differentiation process. Our study could provide a valuable basis for further investigations on the regulatory networks of sex determination and differentiation in asparagus and facilitate further genetic and genomic studies on this dioecious species.

  6. Differentially expressed regulatory genes in honey bee caste development

    NASA Astrophysics Data System (ADS)

    Hepperle, C.; Hartfelder, K.

    2001-03-01

    In the honey bee, an eminently fertile queen with up to 200 ovarioles per ovary monopolizes colony level reproduction. In contrast, worker bees have only few ovarioles and are essentially sterile. This phenotype divergence is a result of caste-specifically modulated juvenile hormone and ecdysteroid titers in larval development. In this study we employed a differential-display reverse transcription (DDRT)-PCR protocol to detect ecdysteroid-regulated gene expression during a critical phase of caste development. We identified a Ftz-F1 homolog and a Cut-like transcript. Ftz-F1 could be a putative element of the metamorphic ecdysone response cascade of bees, whereas Cut-like proteins are described as transcription factors involved in maintaining cellular differentiation states. The downregulation of both factors can be interpreted as steps in the metamorphic degradation of ovarioles in worker-bee ovaries.

  7. Genome-Wide Identification of Expression Quantitative Trait Loci (eQTLs) in Human Heart

    PubMed Central

    Moerland, Perry D.; Marsman, Roos F.; Westerveld, Margriet L.; Lal, Sean; Zhang, Taifang; Simmons, Christine Q.; Baczko, Istvan; dos Remedios, Cristobal; Bishopric, Nanette H.; Varro, Andras; George, Alfred L.; Lodder, Elisabeth M.; Bezzina, Connie R.

    2014-01-01

    In recent years genome-wide association studies (GWAS) have uncovered numerous chromosomal loci associated with various electrocardiographic traits and cardiac arrhythmia predisposition. A considerable fraction of these loci lie within inter-genic regions. The underlying trait-associated variants likely reside in regulatory regions and exert their effect by modulating gene expression. Hence, the key to unraveling the molecular mechanisms underlying these cardiac traits is to interrogate variants for association with differential transcript abundance by expression quantitative trait locus (eQTL) analysis. In this study we conducted an eQTL analysis of human heart. For a total of 129 left ventricular samples that were collected from non-diseased human donor hearts, genome-wide transcript abundance and genotyping was determined using microarrays. Each of the 18,402 transcripts and 897,683 SNP genotypes that remained after pre-processing and stringent quality control were tested for eQTL effects. We identified 771 eQTLs, regulating 429 unique transcripts. Overlaying these eQTLs with cardiac GWAS loci identified novel candidates for studies aimed at elucidating the functional and transcriptional impact of these loci. Thus, this work provides for the first time a comprehensive eQTL map of human heart: a powerful and unique resource that enables systems genetics approaches for the study of cardiac traits. PMID:24846176

  8. Genetic susceptibility variants for lung cancer: replication study and assessment as expression quantitative trait loci

    PubMed Central

    Pintarelli, Giulia; Cotroneo, Chiara Elisabetta; Noci, Sara; Dugo, Matteo; Galvan, Antonella; Delli Carpini, Simona; Citterio, Lorena; Manunta, Paolo; Incarbone, Matteo; Tosi, Davide; Santambrogio, Luigi; Dragani, Tommaso A.; Colombo, Francesca

    2017-01-01

    Many single nucleotide polymorphisms (SNPs) have been associated with lung cancer but lack confirmation and functional characterization. We retested the association of 56 candidate SNPs with lung adenocarcinoma risk and overall survival in a cohort of 823 Italian patients and 779 healthy controls, and assessed their function as expression quantitative trait loci (eQTLs). In the replication study, eight SNPs (rs401681, rs3019885, rs732765, rs2568494, rs16969968, rs6495309, rs11634351, and rs4105144) associated with lung adenocarcinoma risk and three (rs9557635, rs4105144, and rs735482) associated with survival. Five of these SNPs acted as cis-eQTLs, being associated with the transcription of IREB2 (rs2568494, rs16969968, rs11634351, rs6495309), PSMA4 (rs6495309) and ERCC1 (rs735482), out of 10,821 genes analyzed in lung. For these three genes, we obtained experimental evidence of differential allelic expression in lung tissue, pointing to the existence of in-cis genomic variants that regulate their transcription. These results suggest that these SNPs exert their effects on cancer risk/outcome through the modulation of mRNA levels of their target genes. PMID:28181565

  9. Identification of differentially expressed genes in potato associated with tuber dormancy release.

    PubMed

    Liu, Bailin; Zhang, Ning; Wen, Yikai; Si, Huaijun; Wang, Di

    2012-12-01

    Potato (Solanum tuberosum L.) tuber dormancy and sprouting is very important to potato cultivation and processing. In the present experiment, suppression subtractive hybridization was employed to identify differentially expressed genes in potato associated with tuber dormancy release. 576 random clones were selected from subtractive library and successfully sequenced. A total of 304 effective expressed sequence tags (ESTs) were obtained ultimately. The ESTs have been deposited in the EMBL\\GenBank\\DDBJ nucleotide sequence data libraries under accession numbers from JK483901 to JK484204. GO annotation showed that 45, 34 and 3 % ESTs were associated with binding, catalytic activity and signaling respectively, some of which were confirmed to be involved in plant dormancy breaking, however, 14 % of the ESTs did not show significant homology to any database proteins. A real-time quantitative PCR (RT-qPCR) analysis of the expression patterns of 14 selectable transcripts showed that 13 selected candidate genes were significantly up-regulated in the development process of tuber from dormancy to sprouting. A full length cDNA of ADP-ribosylation factor (ARF) gene was cloned and found it belonged to potato ARF1 gene. Tissue specific expression analysis showed ARF1 expression level was the highest in tuber. RT-qPCR analysis of the expression profile of ARF1 gene from potato tuber dormancy to sprouting revealed that the ARF1 gene expression was significantly increased after tuber dormancy breaking, which suggested that it probably associated with tuber dormancy and sprouting.

  10. Differential expression of putative drug resistance genes in Mycobacterium tuberculosis clinical isolates.

    PubMed

    González-Escalante, Laura; Peñuelas-Urquides, Katia; Said-Fernández, Salvador; Silva-Ramírez, Beatriz; Bermúdez de León, Mario

    2015-12-01

    Understanding drug resistance in Mycobacterium tuberculosis requires an integrated analysis of strain lineages, mutations and gene expression. Previously, we reported the differential expression of esxG, esxH, infA, groES, rpmI, rpsA and lipF genes in a sensitive M. tuberculosis strain and in a multidrug-resistant clinical isolate. Here, we have evaluated the expression of these genes in 24 clinical isolates that belong to different lineages and have different drug resistance profiles. In vitro, growth kinetics analysis showed no difference in the growth of the clinical isolates, and thus drug resistance occurred without a fitness cost. However, a quantitative reverse transcription PCR analysis of gene expression revealed high variability among the clinical isolates, including those with similar drug resistance profiles. Due to the complexity of gene regulation pathways and the wide diversity of M. tuberculosis lineages, the use of gene expression as a molecular signature for drug resistance is not straightforward. Therefore, we recommend that the expression of M. tuberculosis genes be performed individually, and baseline expression levels should be verified among several different clinical isolates, before any further applications of these findings.

  11. Differentiation of Glioblastoma from Brain Metastasis: Qualitative and Quantitative Analysis Using Arterial Spin Labeling MR Imaging

    PubMed Central

    Sunwoo, Leonard; You, Sung-Hye; Yoo, Roh-Eul; Kang, Koung Mi; Choi, Seung Hong; Kim, Ji-hoon; Sohn, Chul-Ho; Park, Sun-Won; Jung, Cheolkyu; Park, Chul-Kee

    2016-01-01

    Purpose To evaluate the diagnostic performance of cerebral blood flow (CBF) by using arterial spin labeling (ASL) perfusion magnetic resonance (MR) imaging to differentiate glioblastoma (GBM) from brain metastasis. Materials and Methods The institutional review board of our hospital approved this retrospective study. The study population consisted of 128 consecutive patients who underwent surgical resection and were diagnosed as either GBM (n = 89) or brain metastasis (n = 39). All participants underwent preoperative MR imaging including ASL. For qualitative analysis, the tumors were visually graded into five categories based on ASL-CBF maps by two blinded reviewers. For quantitative analysis, the reviewers drew regions of interest (ROIs) on ASL-CBF maps upon the most hyperperfused portion within the tumor and upon peritumoral T2 hyperintensity area. Signal intensities of intratumoral and peritumoral ROIs for each subject were normalized by dividing the values by those of contralateral normal gray matter (nCBFintratumoral and nCBFperitumoral, respectively). Visual grading scales and quantitative parameters between GBM and brain metastasis were compared. In addition, the area under the receiver-operating characteristic curve was used to evaluate the diagnostic performance of ASL-driven CBF to differentiate GBM from brain metastasis. Results For qualitative analysis, GBM group showed significantly higher grade compared to metastasis group (p = 0.001). For quantitative analysis, both nCBFintratumoral and nCBFperitumoral in GBM were significantly higher than those in metastasis (both p < 0.001). The areas under the curve were 0.677, 0.714, and 0.835 for visual grading, nCBFintratumoral, and nCBFperitumoral, respectively (all p < 0.001). Conclusion ASL perfusion MR imaging can aid in the differentiation of GBM from brain metastasis. PMID:27861605

  12. Quantitative Susceptibility Mapping Differentiates between Blood Depositions and Calcifications in Patients with Glioblastoma

    PubMed Central

    Deistung, Andreas; Schweser, Ferdinand; Wiestler, Benedikt; Abello, Mario; Roethke, Matthias; Sahm, Felix; Wick, Wolfgang; Nagel, Armin Michael; Heiland, Sabine; Schlemmer, Heinz-Peter; Bendszus, Martin; Reichenbach, Jürgen Rainer; Radbruch, Alexander

    2013-01-01

    Objectives The application of susceptibility weighted imaging (SWI) in brain tumor imaging is mainly used to assess tumor-related “susceptibility based signals” (SBS). The origin of SBS in glioblastoma is still unknown, potentially representing calcifications or blood depositions. Reliable differentiation between both entities may be important to evaluate treatment response and to identify glioblastoma with oligodendroglial components that are supposed to present calcifications. Since calcifications and blood deposits are difficult to differentiate using conventional MRI, we investigated whether a new post-processing approach, quantitative susceptibility mapping (QSM), is able to distinguish between both entities reliably. Materials and Methods SWI, FLAIR, and T1-w images were acquired from 46 patients with glioblastoma (14 newly diagnosed, 24 treated with radiochemotherapy, 8 treated with radiochemotherapy and additional anti-angiogenic medication). Susceptibility maps were calculated from SWI data. All glioblastoma were evaluated for the appearance of hypointense or hyperintense correlates of SBS on the susceptibility maps. Results 43 of 46 glioblastoma presented only hyperintense intratumoral SBS on susceptibility maps, indicating blood deposits. Additional hypointense correlates of tumor-related SBS on susceptibility maps, indicating calcification, were identified in 2 patients being treated with radiochemotherapy and in one patient being treated with additional anti-angiogenic medication. Histopathologic reports revealed an oligodendroglial component in one patient that presented calcifications on susceptibility maps. Conclusions QSM provides a quantitative, local MRI contrast, which reliably differentiates between blood deposits and calcifications. Thus, quantitative susceptibility mapping appears promising to identify rare variants of glioblastoma with oligodendroglial components non-invasively and may allow monitoring the role of calcification in the

  13. Combining SPECT and Quantitative EEG Analysis for the Automated Differential Diagnosis of Disorders with Amnestic Symptoms

    PubMed Central

    Höller, Yvonne; Bathke, Arne C.; Uhl, Andreas; Strobl, Nicolas; Lang, Adelheid; Bergmann, Jürgen; Nardone, Raffaele; Rossini, Fabio; Zauner, Harald; Kirschner, Margarita; Jahanbekam, Amirhossein; Trinka, Eugen; Staffen, Wolfgang

    2017-01-01

    Single photon emission computed tomography (SPECT) and Electroencephalography (EEG) have become established tools in routine diagnostics of dementia. We aimed to increase the diagnostic power by combining quantitative markers from SPECT and EEG for differential diagnosis of disorders with amnestic symptoms. We hypothesize that the combination of SPECT with measures of interaction (connectivity) in the EEG yields higher diagnostic accuracy than the single modalities. We examined 39 patients with Alzheimer's dementia (AD), 69 patients with depressive cognitive impairment (DCI), 71 patients with amnestic mild cognitive impairment (aMCI), and 41 patients with amnestic subjective cognitive complaints (aSCC). We calculated 14 measures of interaction from a standard clinical EEG-recording and derived graph-theoretic network measures. From regional brain perfusion measured by 99mTc-hexamethyl-propylene-aminoxime (HMPAO)-SPECT in 46 regions, we calculated relative cerebral perfusion in these patients. Patient groups were classified pairwise with a linear support vector machine. Classification was conducted separately for each biomarker, and then again for each EEG- biomarker combined with SPECT. Combination of SPECT with EEG-biomarkers outperformed single use of SPECT or EEG when classifying aSCC vs. AD (90%), aMCI vs. AD (70%), and AD vs. DCI (100%), while a selection of EEG measures performed best when classifying aSCC vs. aMCI (82%) and aMCI vs. DCI (90%). Only the contrast between aSCC and DCI did not result in above-chance classification accuracy (60%). In general, accuracies were higher when measures of interaction (i.e., connectivity measures) were applied directly than when graph-theoretical measures were derived. We suggest that quantitative analysis of EEG and machine-learning techniques can support differentiating AD, aMCI, aSCC, and DCC, especially when being combined with imaging methods such as SPECT. Quantitative analysis of EEG connectivity could become an

  14. Expression of Transthyretin during bovine myogenic satellite cell differentiation.

    PubMed

    Pokharel, Smritee; Kamli, Majid Rasool; Mir, Bilal Ahmad; Malik, Adeel; Lee, Eun Ju; Choi, Inho

    2014-09-01

    Adult myogenesis responsible for the maintenance and repair of muscle tissue is mainly under the control of myogenic regulatory factors (MRFs) and a few other genes. Transthyretin gene (TTR), codes for a carrier protein for thyroxin (T4) and retinol binding protein bound with retinol in blood plasma, plays a critical role during the early stages of myogenesis. Herein, we investigated the relationship of TTR with other muscle-specific genes and report their expression in muscle satellite cells (MSCs), and increased messenger RNA (mRNA) and protein expression of TTR during MSCs differentiation. Silencing of TTR resulted in decreased myotube formation and decreased expression of myosin light chain (MYL2), myosin heavy chain 3 (MYH3), matrix gla protein (MGP), and voltage-dependent L type calcium channel (Cav1.1) genes. Increased mRNA expression observed in TTR and other myogenic genes with the addition of T4 decreased significantly following TTR knockdown, indicating the critical role of TTR in T4 transportation. Similarly, decreased expression of MGP and Cav1.1 following TTR knockdown signifies the dual role of TTR in controlling muscle myogenesis via regulation of T4 and calcium channel. Our computational and experimental evidences indicate that TTR has a relationship with MRFs and may act on calcium channel and related genes.

  15. Differential expression of angiogenic factors in peripheral nerve sheath tumors.

    PubMed

    Wasa, Junji; Nishida, Yoshihiro; Suzuki, Yoshitaka; Tsukushi, Satoshi; Shido, Yoji; Hosono, Kozo; Shimoyama, Yoshie; Nakamura, Shigeo; Ishiguro, Naoki

    2008-01-01

    It is difficult to differentiate some malignant peripheral nerve sheath tumors (MPNST) from benign peripheral nerve sheath tumors (BPNST) histologically, and to predict the clinical outcome of patients with MPNST. In this study, the expression of VEGF and MVD were evaluated immunohistochemically in 22 cases of MPNST, 14 of neurofibroma and 19 of schwannoma and correlation of the staining grade of VEGF or MVD and the various clinical factors were analyzed, and statistically evaluated. Levels of VEGF mRNA expression were also determined with real-time RT-PCR. Statistically higher positive staining for VEGF was observed in MPNST compared to neurofibroma (P=0.004) and schwannoma (P<0.001). Even low grade MPNST showed higher VEGF positive staining than neurofibroma. Moreover, high VEGF expression statistically correlated with the poor prognosis of the patients with MPNST (P=0.015). Although MVD in MPNST was significantly higher than that in neurofibroma (P=0.038) and schwannoma (P<0.001), MVD could not predict the prognosis of the patients with MPNST. Although VEGF mRNA expression tended to be higher in MPNST compared to neurofibroma, the difference was not significant. Levels of VEGF protein expression serve as a novel diagnostic and prognostic tools for peripheral nerve sheath tumors.

  16. Direct quantitative differentiation between Prevotella intermedia and Prevotella nigrescens in clinical specimens.

    PubMed

    Gmür, Rudolf; Thurnheer, Thomas

    2002-05-01

    This paper describes a quantitative fluorescent in situ hybridization (FISH) assay for the differential identification of Prevotella intermedia and Prevotella nigrescens in clinical samples, and compares its performance with less discriminatory culture and quantitative immunofluorescence (IF) assays. Fluorescence-labelled oligonucleotide probes directed to specific 16S rRNA sequences of P. intermedia, P. nigrescens, Prevotella pallens and Prevotella denticola were hybridized under stringent conditions with cultured reference strains or plaque samples from deep periodontal pockets. Probe specificity was defined with strains from multiple oral Prevotella species. The lower detection level of the assays was approximately 3x10(3) target cells per ml of plaque-sample suspension. P. intermedia, P. nigrescens, P. pallens and P. denticola were detected in plaques with prevalences of 69, 67, 0 and 28%, respectively. On average, 3.9 x 10(6) P. intermedia, 3.1 x 10(6) P. nigrescens and 5.6 x 10(5) P. denticola cells were counted per positive sample. All three species were found almost exclusively in dense mixed aggregates. Quantitative FISH data agreed satisfactorily with corresponding IF data (r=0.711). Both FISH and IF enumerations of the sum of P. intermedia and P. nigrescens markedly exceeded the c.f.u. counts of black-pigmented colonies in Porphyromonas gingivalis-free cultured subgingival plaques. The results demonstrate the validity of this new assay. Unlike established IF, culture, PCR or checkerboard DNA hybridization assays, this FISH assay differentiates quantitatively between P. intermedia and P. nigrescens, provides visual accuracy control, and offers insights into the spatial distribution of the target cells within a clinical sample.

  17. Differentially expressed genes and canonical pathway expression in human atherosclerotic plaques – Tampere Vascular Study

    PubMed Central

    Sulkava, Miska; Raitoharju, Emma; Levula, Mari; Seppälä, Ilkka; Lyytikäinen, Leo-Pekka; Mennander, Ari; Järvinen, Otso; Zeitlin, Rainer; Salenius, Juha-Pekka; Illig, Thomas; Klopp, Norman; Mononen, Nina; Laaksonen, Reijo; Kähönen, Mika; Oksala, Niku; Lehtimäki, Terho

    2017-01-01

    Cardiovascular diseases due to atherosclerosis are the leading cause of death globally. We aimed to investigate the potentially altered gene and pathway expression in advanced peripheral atherosclerotic plaques in comparison to healthy control arteries. Gene expression analysis was performed (Illumina HumanHT-12 version 3 Expression BeadChip) for 68 advanced atherosclerotic plaques (15 aortic, 29 carotid and 24 femoral plaques) and 28 controls (left internal thoracic artery (LITA)) from Tampere Vascular Study. Dysregulation of individual genes was compared to healthy controls and between plaques from different arterial beds and Ingenuity pathway analysis was conducted on genes with a fold change (FC) > ±1.5 and false discovery rate (FDR) < 0.05. 787 genes were significantly differentially expressed in atherosclerotic plaques. The most up-regulated genes were osteopontin and multiple MMPs, and the most down-regulated were cell death-inducing DFFA-like effector C and A (CIDEC, CIDEA) and apolipoprotein D (FC > 20). 156 pathways were differentially expressed in atherosclerotic plaques, mostly inflammation-related, especially related with leukocyte trafficking and signaling. In artery specific plaque analysis 50.4% of canonical pathways and 41.2% GO terms differentially expressed were in common for all three arterial beds. Our results confirm the inflammatory nature of advanced atherosclerosis and show novel pathway differences between different arterial beds. PMID:28128285

  18. Quantitative Carré differential interference contrast microscopy to assess phase and amplitude.

    PubMed

    Duncan, Donald D; Fischer, David G; Dayton, Amanda; Prahl, Scott A

    2011-06-01

    We present a method of using an unmodified differential interference contrast microscope to acquire quantitative information on scatter and absorption of thin tissue samples. A simple calibration process is discussed that uses a standard optical wedge. Subsequently, we present a phase-stepping procedure for acquiring phase gradient information exclusive of absorption effects. The procedure results in two-dimensional maps of the local angular (polar and azimuthal) ray deviation. We demonstrate the calibration process, discuss details of the phase-stepping algorithm, and present representative results for a porcine skin sample.

  19. Differential expression profiling of serum proteins and metabolites for biomarker discovery

    NASA Astrophysics Data System (ADS)

    Roy, Sushmita Mimi; Anderle, Markus; Lin, Hua; Becker, Christopher H.

    2004-11-01

    A liquid chromatography-mass spectrometry (LC-MS) proteomics and metabolomics platform is presented for quantitative differential expression analysis. Proteome profiles obtained from 1.5 [mu]L of human serum show ~5000 de-isotoped and quantifiable molecular ions. Approximately 1500 metabolites are observed from 100 [mu]L of serum. Quantification is based on reproducible sample preparation and linear signal intensity as a function of concentration. The platform is validated using human serum, but is generally applicable to all biological fluids and tissues. The median coefficient of variation (CV) for ~5000 proteomic and ~1500 metabolomic molecular ions is approximately 25%. For the case of C-reactive protein, results agree with quantification by immunoassay. The independent contributions of two sources of variance, namely sample preparation and LC-MS analysis, are respectively quantified as 20.4 and 15.1% for the proteome, and 19.5 and 13.5% for the metabolome, for median CV values. Furthermore, biological diversity for ~20 healthy individuals is estimated by measuring the variance of ~6500 proteomic and metabolomic molecular ions in sera for each sample; the median CV is 22.3% for the proteome and 16.7% for the metabolome. Finally, quantitative differential expression profiling is applied to a clinical study comparing healthy individuals and rheumatoid arthritis (RA) patients.

  20. cDNA-AFLP analysis reveals differential gene expression in response to salt stress in foxtail millet (Setaria italica L.).

    PubMed

    Jayaraman, Ananthi; Puranik, Swati; Rai, Neeraj Kumar; Vidapu, Sudhakar; Sahu, Pranav Pankaj; Lata, Charu; Prasad, Manoj

    2008-11-01

    Plant growth and productivity are affected by various abiotic stresses such as heat, drought, cold, salinity, etc. The mechanism of salt tolerance is one of the most important subjects in plant science as salt stress decreases worldwide agricultural production. In our present study we used cDNA-AFLP technique to compare gene expression profiles of a salt tolerant and a salt-sensitive cultivar of foxtail millet (Seteria italica) in response to salt stress to identify early responsive differentially expressed transcripts accumulated upon salt stress and validate the obtained result through quantitative real-time PCR (qRT-PCR). The expression profile was compared between a salt tolerant (Prasad) and susceptible variety (Lepakshi) of foxtail millet in both control condition (L0 and P0) and after 1 h (L1 and P1) of salt stress. We identified 90 transcript-derived fragments (TDFs) that are differentially expressed, out of which 86 TDFs were classified on the basis of their either complete presence or absence (qualitative variants) and 4 on differential expression pattern levels (quantitative variants) in the two varieties. Finally, we identified 27 non-redundant differentially expressed cDNAs that are unique to salt tolerant variety which represent different groups of genes involved in metabolism, cellular transport, cell signaling, transcriptional regulation, mRNA splicing, seed development and storage, etc. The expression patterns of seven out of nine such genes showed a significant increase of differential expression in tolerant variety after 1 h of salt stress in comparison to salt-sensitive variety as analyzed by qRT-PCR. The direct and indirect relationship of identified TDFs with salinity tolerance mechanism is discussed.

  1. dcVar: a method for identifying common variants that modulate differential correlation structures in gene expression data

    PubMed Central

    Lareau, Caleb A.; White, Bill C.; Montgomery, Courtney G.; McKinney, Brett A.

    2015-01-01

    Recent studies have implicated the role of differential co-expression or correlation structure in gene expression data to help explain phenotypic differences. However, few attempts have been made to characterize the function of variants based on their role in regulating differential co-expression. Here, we describe a statistical methodology that identifies pairs of transcripts that display differential correlation structure conditioned on genotypes of variants that regulate co-expression. Additionally, we present a user-friendly, computationally efficient tool, dcVar, that can be applied to expression quantitative trait loci (eQTL) or RNA-Seq datasets to infer differential co-expression variants (dcVars). We apply dcVar to the HapMap3 eQTL dataset and demonstrate the utility of this methodology at uncovering novel function of variants of interest with examples from a height genome-wide association and cancer drug resistance. We provide evidence that differential correlation structure is a valuable intermediate molecular phenotype for further characterizing the function of variants identified in GWAS and related studies. PMID:26539209

  2. P450 aromatase expression in the temperature-sensitive sexual differentiation of salamander (Hynobius retardatus) gonads.

    PubMed

    Sakata, Natsuko; Tamori, Yoichiro; Wakahara, Masami

    2005-01-01

    Sex differentiation of gonads in amphibians is believed to be controlled genetically, but altered epigenetically or environmentally. When larvae of the salamander Hynobius retardatus were reared at defined temperatures from hatching to metamorphic stages, a high temperature (28 degrees C) induced exclusively female gonads (ovaries), whereas intermediate (20 and 23 degrees C) or lower (16 degrees C) temperatures produced a 1:1 sex ratio of the morphological gonads. The thermosensitive period was determined to be restricted from 15 to 30 days after hatching, just before or when sexual differentiation occurred. Hynobius P450 aromatase (P450arom) cDNA was isolated from adult gonads and the partial nucleotide or deduced amino acid sequences were determined, showing a high level of identity with various vertebrate species. The P450arom gene was expressed predominantly in the adult ovary and brain, weakly in testis, but not in other somatic organs. A typical sexual dimorphism in P450arom expression was detected in normally developing larvae by a quantitative competitive RT-PCR; strong expression in the female gonads but very weak in male gonads. The dimorphism was detected much earlier than the morphological sexual differentiation of the gonads. When larvae were reared at the female-producing temperature (28 degrees C), strong expression was detected in all the temperature-treated larvae, suggesting that P450arom was up-regulated, even in genetic males. Our results confirm the importance of the P450arom regulation in the sexual differentiation of gonads and demonstrate that an up-regulation of P450arom is involved in the process of temperature-sensitive sex reversal in this species.

  3. Structural changes and differentially expressed genes in Pseudomonas aeruginosa exposed to meropenem-ciprofloxacin combination.

    PubMed

    Siqueira, Vera Lúcia Dias; Cardoso, Rosilene Fressatti; Caleffi-Ferracioli, Katiany Rizzieri; Scodro, Regiane Bertin de Lima; Fernandez, Maria Aparecida; Fiorini, Adriana; Ueda-Nakamura, Tania; Dias-Filho, Benedito Prado; Nakamura, Celso Vataru

    2014-07-01

    The effect of a meropenem-ciprofloxacin combination (MCC) on the susceptibility of multidrug-resistant (MDR) Pseudomonas aeruginosa (MRPA) clinical isolates was determined using checkerboard and time-kill curve techniques. Structural changes and differential gene expression that resulted from the synergistic action of the MCC against one of the P. aeruginosa isolates (1071-MRPA]) were evaluated using electron microscopy and representational difference analysis (RDA), respectively. The differentially expressed, SOS response-associated, and resistance-associated genes in 1071-MRPA exposed to meropenem, ciprofloxacin, and the MCC were monitored by quantitative PCR. The MCC was synergistic against 25% and 40.6% of MDR P. aeruginosa isolates as shown by the checkerboard and time-kill curves, respectively. The morphological and structural changes that resulted from the synergistic action of the MCC against 1071-MRPA were a summation of the effects observed with each antimicrobial alone. One exception included outer membrane vesicles, which were seen in a greater amount upon ciprofloxacin exposure but were significantly inhibited upon MCC exposure. Cell wall- and DNA repair-associated genes were differentially expressed in 1071-MRPA exposed to meropenem, ciprofloxacin, and the MCC. However, some of the RDA-detected, resistance-associated, and SOS response-associated genes were expressed at significantly lower levels in 1071-MRPA exposed to the MCC. The MCC may be an alternative for the treatment of MDR P. aeruginosa. The effect of this antimicrobial combination may be not only the result of a summation of the effects of meropenem and ciprofloxacin but also a result of differential action that likely inhibits protective mechanisms in the bacteria. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  4. Structural Changes and Differentially Expressed Genes in Pseudomonas aeruginosa Exposed to Meropenem-Ciprofloxacin Combination

    PubMed Central

    Siqueira, Vera Lúcia Dias; Cardoso, Rosilene Fressatti; Caleffi-Ferracioli, Katiany Rizzieri; de Lima Scodro, Regiane Bertin; Fernandez, Maria Aparecida; Fiorini, Adriana; Ueda-Nakamura, Tania; Dias-Filho, Benedito Prado

    2014-01-01

    The effect of a meropenem-ciprofloxacin combination (MCC) on the susceptibility of multidrug-resistant (MDR) Pseudomonas aeruginosa (MRPA) clinical isolates was determined using checkerboard and time-kill curve techniques. Structural changes and differential gene expression that resulted from the synergistic action of the MCC against one of the P. aeruginosa isolates (1071-MRPA]) were evaluated using electron microscopy and representational difference analysis (RDA), respectively. The differentially expressed, SOS response-associated, and resistance-associated genes in 1071-MRPA exposed to meropenem, ciprofloxacin, and the MCC were monitored by quantitative PCR. The MCC was synergistic against 25% and 40.6% of MDR P. aeruginosa isolates as shown by the checkerboard and time-kill curves, respectively. The morphological and structural changes that resulted from the synergistic action of the MCC against 1071-MRPA were a summation of the effects observed with each antimicrobial alone. One exception included outer membrane vesicles, which were seen in a greater amount upon ciprofloxacin exposure but were significantly inhibited upon MCC exposure. Cell wall- and DNA repair-associated genes were differentially expressed in 1071-MRPA exposed to meropenem, ciprofloxacin, and the MCC. However, some of the RDA-detected, resistance-associated, and SOS response-associated genes were expressed at significantly lower levels in 1071-MRPA exposed to the MCC. The MCC may be an alternative for the treatment of MDR P. aeruginosa. The effect of this antimicrobial combination may be not only the result of a summation of the effects of meropenem and ciprofloxacin but also a result of differential action that likely inhibits protective mechanisms in the bacteria. PMID:24798291

  5. An Efficient and Robust Statistical Modeling Approach to Discover Differentially Expressed Genes Using Genomic Expression Profiles

    PubMed Central

    Thomas, Jeffrey G.; Olson, James M.; Tapscott, Stephen J.; Zhao, Lue Ping

    2001-01-01

    We have developed a statistical regression modeling approach to discover genes that are differentially expressed between two predefined sample groups in DNA microarray experiments. Our model is based on well-defined assumptions, uses rigorous and well-characterized statistical measures, and accounts for the heterogeneity and genomic complexity of the data. In contrast to cluster analysis, which attempts to define groups of genes and/or samples that share common overall expression profiles, our modeling approach uses known sample group membership to focus on expression profiles of individual genes in a sensitive and robust manner. Further, this approach can be used to test statistical hypotheses about gene expression. To demonstrate this methodology, we compared the expression profiles of 11 acute myeloid leukemia (AML) and 27 acute lymphoblastic leukemia (ALL) samples from a previous study (Golub et al. 1999) and found 141 genes differentially expressed between AML and ALL with a 1% significance at the genomic level. Using this modeling approach to compare different sample groups within the AML samples, we identified a group of genes whose expression profiles correlated with that of thrombopoietin and found that genes whose expression associated with AML treatment outcome lie in recurrent chromosomal locations. Our results are compared with those obtained using t-tests or Wilcoxon rank sum statistics. PMID:11435405

  6. Aberrant expression of posterior HOX genes in well differentiated histotypes of thyroid cancers.

    PubMed

    Cantile, Monica; Scognamiglio, Giosuè; La Sala, Lucia; La Mantia, Elvira; Scaramuzza, Veronica; Valentino, Elena; Tatangelo, Fabiana; Losito, Simona; Pezzullo, Luciano; Chiofalo, Maria Grazia; Fulciniti, Franco; Franco, Renato; Botti, Gerardo

    2013-11-01

    Molecular etiology of thyroid cancers has been widely studied, and several molecular alterations have been identified mainly associated with follicular and papillary histotypes. However, the molecular bases of the complex pathogenesis of thyroid carcinomas remain poorly understood. HOX genes regulate normal embryonic development, cell differentiation and other critical processes in eukaryotic cell life. Several studies have shown that HOX genes play a role in neoplastic transformation of several human tissues. In particular, the genes belonging to HOX paralogous group 13 seem to hold a relevant role in both tumor development and progression. We have identified a significant prognostic role of HOX D13 in pancreatic cancer and we have recently showed the strong and progressive over-expression of HOX C13 in melanoma metastases and deregulation of HOX B13 expression in bladder cancers. In this study we have investigated, by immunohistochemisty and quantitative Real Time PCR, the HOX paralogous group 13 genes/proteins expression in thyroid cancer evolution and progression, also evaluating its ability to discriminate between main histotypes. Our results showed an aberrant expression, both at gene and protein level, of all members belonging to paralogous group 13 (HOX A13, HOX B13, HOX C13 and HOX D13) in adenoma, papillary and follicular thyroid cancers samples. The data suggest a potential role of HOX paralogous group 13 genes in pathogenesis and differential diagnosis of thyroid cancers.

  7. Protein synthesis rate is the predominant regulator of protein expression during differentiation

    PubMed Central

    Kristensen, Anders R; Gsponer, Joerg; Foster, Leonard J

    2013-01-01

    External perturbations, by forcing cells to adapt to a new environment, often elicit large-scale changes in gene expression resulting in an altered proteome that improves the cell's fitness in the new conditions. Steady-state levels of a proteome depend on transcription, the levels of transcripts, translation and protein degradation but system-level contribution that each of these processes make to the final protein expression change has yet to be explored. We therefore applied a systems biology approach to characterize the regulation of protein expression during cellular differentiation using quantitative proteomics. As a general rule, it seems that protein expression during cellular differentiation is largely controlled by changes in the relative synthesis rate, whereas the relative degradation rate of the majority of proteins stays constant. In these data, we also observe that the proteins in defined sub-structures of larger protein complexes tend to have highly correlated synthesis and degradation rates but that this does not necessarily extend to the holo-complex. Finally, we provide strong evidence that the generally poor correlation observed between transcript and protein levels can fully be explained once the protein synthesis and degradation rates are taken into account. PMID:24045637

  8. Differential expression profiling of microRNAs and their potential involvement in esophageal squamous cell carcinoma.

    PubMed

    Zang, Wenqiao; Wang, Yuanyuan; Du, Yuwen; Xuan, Xiaoyan; Wang, Tao; Li, Min; Ma, Yunyun; Li, Ping; Chen, Xudong; Dong, Ziming; Zhao, Guoqiang

    2014-04-01

    MicroRNAs are small, noncoding RNAs approximately 18-24 nucleotides in length that negatively regulate gene expression at the posttranscriptional and/or translational level by binding to complimentary sequences in the 3'-untranslated regions of target mRNAs. Growing evidence has indicated the important roles for different miRNA species in the development of different cancers. Therefore, miRNAs have the potential to become new biological markers for esophageal squamous cell carcinoma (ESCC) and to be applied in the diagnosis, prognosis, and targeted treatment of ESCC. In this study, we performed a miRNA microarray to analyze the miRNA expression profile in ESCC compared to normal tissues. Then, we made a preliminary analysis of the biological function for the most differentially expressed miRNAs and their potentially target genes regulated. Some microarray results were validated by performing quantitative RT-PCR. The study provided evidence that linked the biological role of miRNAs to ESCC and showed that miRNAs could undertake a variety of mechanisms. Additionally, we also found that altered miR-429 and miR-451 expression levels were associated with the occurrence of lymph node metastases and the differentiation status and TNM stage in ESCC. The study of miRNAs may lead to finding novel methods to diagnose, treat, and prevent ESCC.

  9. Quantitative metabolic imaging using endogenous fluorescence to detect stem cell differentiation

    NASA Astrophysics Data System (ADS)

    Quinn, Kyle P.; Sridharan, Gautham V.; Hayden, Rebecca S.; Kaplan, David L.; Lee, Kyongbum; Georgakoudi, Irene

    2013-12-01

    The non-invasive high-resolution spatial mapping of cell metabolism within tissues could provide substantial advancements in assessing the efficacy of stem cell therapy and understanding tissue development. Here, using two-photon excited fluorescence microscopy, we elucidate the relationships among endogenous cell fluorescence, cell redox state, and the differentiation of human mesenchymal stem cells into adipogenic and osteoblastic lineages. Using liquid chromatography/mass spectrometry and quantitative PCR, we evaluate the sensitivity of an optical redox ratio of FAD/(NADH + FAD) to metabolic changes associated with stem cell differentiation. Furthermore, we probe the underlying physiological mechanisms, which relate a decrease in the redox ratio to the onset of differentiation. Because traditional assessments of stem cells and engineered tissues are destructive, time consuming, and logistically intensive, the development and validation of a non-invasive, label-free approach to defining the spatiotemporal patterns of cell differentiation can offer a powerful tool for rapid, high-content characterization of cell and tissue cultures.

  10. Adaptive differentiation of quantitative traits in the globally distributed weed, wild radish (Raphanus raphanistrum).

    PubMed

    Sahli, Heather F; Conner, Jeffrey K; Shaw, Frank H; Howe, Stephen; Lale, Allison

    2008-10-01

    Weedy species with wide geographical distributions may face strong selection to adapt to new environments, which can lead to adaptive genetic differentiation among populations. However, genetic drift, particularly due to founder effects, will also commonly result in differentiation in colonizing species. To test whether selection has contributed to trait divergence, we compared differentiation at eight microsatellite loci (measured as F(ST)) to differentiation of quantitative floral and phenological traits (measured as Q(ST)) of wild radish (Raphanus raphanistrum) across populations from three continents. We sampled eight populations: seven naturalized populations and one from its native range. By comparing estimates of Q(ST) and F(ST), we found that petal size was the only floral trait that may have diverged more than expected due to drift alone, but inflorescence height, flowering time, and rosette formation have greatly diverged between the native and nonnative populations. Our results suggest the loss of a rosette and the evolution of early flowering time may have been the key adaptations enabling wild radish to become a major agricultural weed. Floral adaptation to different pollinators does not seem to have been as necessary for the success of wild radish in new environments.

  11. Differential expression of intracellular and extracellular CB(2) cannabinoid receptor protein by human peripheral blood leukocytes.

    PubMed

    Castaneda, Julie T; Harui, Airi; Kiertscher, Sylvia M; Roth, Jeffrey D; Roth, Michael D

    2013-03-01

    mRNA encoding for the CB(2) cannabinoid receptor is expressed by many subsets of human peripheral blood leukocytes (PBL), but little is known about the resulting protein expression and function. Employing clones from the A549 and 293T cell lines that were constructed to express both full-length human CB(2) and GFP, we developed a flow cytometry assay for characterizing CB(2) protein expression. A monoclonal antibody directed against human CB(2) selectively stained the surface of transduced but not parental cell lines. When cells were fixed and permeabilized, imaging flow cytometry identified large stores of intracellular protein. Total cellular staining for CB(2) corresponded closely with the level of GFP expression. When exposed to Δ(9)-tetrahydrocannabinol, CB(2)-expressing cells internalized cell surface CB(2) receptors in a time- and dose-dependent manner. Applying these approaches to human PBL, CB(2) protein was identified on the surface of human B cells but not on T cells or monocytes. In contrast, when PBL were fixed and permeabilized, intracellular CB(2) expression was readily detected in all three subsets by both conventional and imaging flow cytometry. Similar to the protein expression pattern observed in fixed and permeabilized PBL, purified B cells, T cells, and monocytes expressed relatively equal levels of CB(2) mRNA by quantitative real-time RT-PCR. Our findings confirm that human PBL express CB(2) protein but that its distribution is predominantly intracellular with only B cells expressing CB(2) protein at the extracellular membrane. The differential role of intracellular and extracellular CB(2) receptors in mediating ligand signaling and immune function remains to be determined.

  12. Role of serum hepatitis B virus marker quantitation to differentiate natural history phases of HBV infection.

    PubMed

    Wang, Li; Zou, Zhi-Qiang; Wang, Kai; Yu, Ji-Guang; Liu, Xiang-Zhong

    2016-01-01

    The purpose of this study was to characterize roles of serum hepatitis B virus marker quantitation in differentiation of natural phases of HBV infection. A total of 184 chronic hepatitis B (CHB) patients were analyzed retrospectively. Patients were classified into four categories: immune tolerant phase (IT, n = 36), immune clearance phase (IC, n = 81), low-replicative phase (LR, n = 31), and HBeAg-negative hepatitis phase (ENH, n = 36), based on clinical, biochemical, serological, HBV DNA level and histological data. Hepatitis B surface antigen (HBsAg) quantitation in four phases were 4.7 ± 0.2, 3.8 ± 0.5, 2.5 ± 1.2 and 3.4 ± 0.4 log10 IU/mL, respectively. There were significant differences between IT and IC (p < 0.001) and between LR and ENH phases (p < 0.001). Quantitation of hepatitis B e antigen (HBeAg) in IT and IC phases are 1317.9 ± 332.9 and 673.4 ± 562.1 S/CO, respectively (p < 0.001). Hepatitis B core antibody (HBcAb) quantitation in the four groups were 9.48 ± 3.3, 11.7 ± 2.8, 11.2 ± 2.6 and 13.2 ± 2.9 S/CO, respectively. Area under receiver operating characteristic curve (AUCs) of HBsAg and HBeAg at cutoff values of 4.41 log10 IU/mL and 1118.96 S/CO for differentiation of IT and IC phases are 0.984 and 0.828, with sensitivity 94.4 and 85.2 %, specificity 98.7 and 75 %, respectively. AUCs of HBsAg and HBcAb at cutoff values of 3.4 log10 IU/mL and 10.5 S/CO for differentiation of LR and ENT phases are 0.796 and 0.705, with sensitivity 58.1 and 85.7 %, and specificity 94.4 and 46.2 %, respectively. HBsAg quantitation has high predictive value and HBeAg quantitation has moderate predictive value for discriminating IT and IC phase. HBsAg and HBcAb quantitations have moderate predictive values for differentiation of LR and ENH phase.

  13. Quantitative single cell analysis of cell population dynamics during submandibular salivary gland development and differentiation

    PubMed Central

    Nelson, Deirdre A.; Manhardt, Charles; Kamath, Vidya; Sui, Yunxia; Santamaria-Pang, Alberto; Can, Ali; Bello, Musodiq; Corwin, Alex; Dinn, Sean R.; Lazare, Michael; Gervais, Elise M.; Sequeira, Sharon J.; Peters, Sarah B.; Ginty, Fiona; Gerdes, Michael J.; Larsen, Melinda

    2013-01-01

    Summary Epithelial organ morphogenesis involves reciprocal interactions between epithelial and mesenchymal cell types to balance progenitor cell retention and expansion with cell differentiation for evolution of tissue architecture. Underlying submandibular salivary gland branching morphogenesis is the regulated proliferation and differentiation of perhaps several progenitor cell populations, which have not been characterized throughout development, and yet are critical for understanding organ development, regeneration, and disease. Here we applied a serial multiplexed fluorescent immunohistochemistry technology to map the progressive refinement of the epithelial and mesenchymal cell populations throughout development from embryonic day 14 through postnatal day 20. Using computational single cell analysis methods, we simultaneously mapped the evolving temporal and spatial location of epithelial cells expressing subsets of differentiation and progenitor markers throughout salivary gland development. We mapped epithelial cell differentiation markers, including aquaporin 5, PSP, SABPA, and mucin 10 (acinar cells); cytokeratin 7 (ductal cells); and smooth muscle α-actin (myoepithelial cells) and epithelial progenitor cell markers, cytokeratin 5 and c-kit. We used pairwise correlation and visual mapping of the cells in multiplexed images to quantify the number of single- and double-positive cells expressing these differentiation and progenitor markers at each developmental stage. We identified smooth muscle α-actin as a putative early myoepithelial progenitor marker that is expressed in cytokeratin 5-negative cells. Additionally, our results reveal dynamic expansion and redistributions of c-kit- and K5-positive progenitor cell populations throughout development and in postnatal glands. The data suggest that there are temporally and spatially discreet progenitor populations that contribute to salivary gland development and homeostasis. PMID:23789091

  14. Utilization of digital differential display to identify differentially expressed genes related to rumen development.

    PubMed

    Kato, Daichi; Suzuki, Yutaka; Haga, Satoshi; So, KyoungHa; Yamauchi, Eri; Nakano, Miwa; Ishizaki, Hiroshi; Choi, Kichoon; Katoh, Kazuo; Roh, Sang-Gun

    2016-04-01

    This study aimed to identify the genes associated with the development of the rumen epithelium by screening for candidate genes by digital differential display (DDD) in silico. Using DDD in NCBI's UniGene database, expressed sequence tag (EST)-based gene expression profiles were analyzed in rumen, reticulum, omasum, abomasum and other tissues in cattle. One hundred and ten candidate genes with high expression in the rumen were derived from a library of all tissues. The expression levels of 11 genes in all candidate genes were analyzed in the rumen, reticulum, omasum and abomasum of nine Japanese Black male calves (5-week-old pre-weaning: n = 3; 15-week-old weaned calves: n = 6). Among the 11 genes, only 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), aldo-keto reductase family 1, member C1-like (AKR1C1), and fatty acid binding protein 3 (FABP3) showed significant changes in the levels of gene expression in the rumen between the pre- and post-weaning of calves. These results indicate that DDD analysis in silico can be useful for screening candidate genes related to rumen development, and that the changes in expression levels of three genes in the rumen may have been caused by weaning, aging or both.

  15. Differential Gene Expression in HIV-Infected Individuals Following ART

    PubMed Central

    Massanella, Marta; Singhania, Akul; Beliakova-Bethell, Nadejda; Pier, Rose; Lada, Steven; White, Cory H.; Pérez-Santiago, Josué; Blanco, Julià; Richman, Douglas D.; Little, Susan J.; Woelk, Christopher H.

    2013-01-01

    Previous studies of the effect of ART on gene expression in HIV-infected individuals have identified small numbers of modulated genes. Since these studies were underpowered or cross-sectional in design, a paired analysis of peripheral blood mononuclear cells (PBMCs), isolated before and after ART, from a robust number of HIV-infected patients (N=32) was performed. Gene expression was assayed by microarray and 4,157 differentially expressed genes (DEGs) were identified following ART using multivariate permutation tests. Pathways and Gene Ontology (GO) terms over-represented for DEGs reflected the transition from a period of active virus replication before ART to one of viral suppression (e.g., repression of JAK-STAT signaling) and possible prolonged drug exposure (e.g. oxidative phosphorylation pathway) following ART. CMYC was the DEG whose product made the greatest number of interactions at the protein level in protein interaction networks (PINs), which has implications for the increased incidence of Hodgkin’s lymphoma (HL) in HIV-infected patients. The differential expression of multiple genes was confirmed by RT-qPCR including well-known drug metabolism genes (e.g., ALOX12 and CYP2S1). Targets not confirmed by RT-qPCR (i.e., GSTM2 and RPL5) were significantly confirmed by droplet digital (ddPCR), which may represent a superior method when confirming DEGs with low fold changes. In conclusion, a paired design revealed that the number of genes modulated following ART was an order of magnitude higher than previously recognized. PMID:23933117

  16. Learning regulatory programs that accurately predict differential expression with MEDUSA.

    PubMed

    Kundaje, Anshul; Lianoglou, Steve; Li, Xuejing; Quigley, David; Arias, Marta; Wiggins, Chris H; Zhang, Li; Leslie, Christina

    2007-12-01

    Inferring gene regulatory networks from high-throughput genomic data is one of the central problems in computational biology. In this paper, we describe a predictive modeling approach for studying regulatory networks, based on a machine learning algorithm called MEDUSA. MEDUSA integrates promoter sequence, mRNA expression, and transcription factor occupancy data to learn gene regulatory programs that predict the differential expression of target genes. Instead of using clustering or correlation of expression profiles to infer regulatory relationships, MEDUSA determines condition-specific regulators and discovers regulatory motifs that mediate the regulation of target genes. In this way, MEDUSA meaningfully models biological mechanisms of transcriptional regulation. MEDUSA solves the problem of predicting the differential (up/down) expression of target genes by using boosting, a technique from statistical learning, which helps to avoid overfitting as the algorithm searches through the high-dimensional space of potential regulators and sequence motifs. Experimental results demonstrate that MEDUSA achieves high prediction accuracy on held-out experiments (test data), that is, data not seen in training. We also present context-specific analysis of MEDUSA regulatory programs for DNA damage and hypoxia, demonstrating that MEDUSA identifies key regulators and motifs in these processes. A central challenge in the field is the difficulty of validating reverse-engineered networks in the absence of a gold standard. Our approach of learning regulatory programs provides at least a partial solution for the problem: MEDUSA's prediction accuracy on held-out data gives a concrete and statistically sound way to validate how well the algorithm performs. With MEDUSA, statistical validation becomes a prerequisite for hypothesis generation and network building rather than a secondary consideration.

  17. Differentiation of Spermatogonia Stem Cells into Functional Mature Neurons Characterized with Differential Gene Expression.

    PubMed

    Bojnordi, Maryam Nazm; Azizi, Hossein; Skutella, Thomas; Movahedin, Mansoureh; Pourabdolhossein, Fereshteh; Shojaei, Amir; Hamidabadi, Hatef Ghasemi

    2016-09-19

    Transplantation of embryonic stem cells (ESCs) is a promising therapeutic approach for the treatment of neurodegenerative diseases. However, ESCs are not usable clinically due to immunological and ethical limitations. The identification of an alternative safe cell source opens novel options via autologous transplantation in neuro-regeneration circumventing these problems. Here, we examined the neurogenic capacity of embryonic stem-like cells (ES-like cells) derived from the testis using neural growth factor inducers and utilized them to generate functional mature neurons. The neuronal differentiation of ES-like cells is induced in three stages. Stage 1 is related to embryoid body (EB) formation. To induce neuroprogenitor cells, EBs were cultured in the presence of retinoic acid, N2 supplement and fibroblast growth factor followed by culturing in a neurobasal medium containing B27, N2 supplements for additional 10 days, to allow the maturation and development of neuronal progenitor cells. The neurogenic differentiation was confirmed by immunostaining for markers of mature neurons. The differentiated neurons were positive for Tuj1 and Tau1. Real-time PCR dates indicated the expression of Nestin and Neuro D (neuroprogenitor markers) in induced cells at the second stage of the differentiation protocol. The differentiated mature neurons exhibited the specific neuron markers Map2 and β-tubulin. The functional maturity of neurons was confirmed by an electrophysiological analysis of passive and active neural membrane properties. These findings indicated a differentiation capacity of ES-like cells derived from the testis to functionally mature neurons, which proposes them as a novel cell source for neuroregenerative medicine.

  18. EntropyExplorer: an R package for computing and comparing differential Shannon entropy, differential coefficient of variation and differential expression.

    PubMed

    Wang, Kai; Phillips, Charles A; Saxton, Arnold M; Langston, Michael A

    2015-12-30

    Differential Shannon entropy (DSE) and differential coefficient of variation (DCV) are effective metrics for the study of gene expression data. They can serve to augment differential expression (DE), and be applied in numerous settings whenever one seeks to measure differences in variability rather than mere differences in magnitude. A general purpose, easily accessible tool for DSE and DCV would help make these two metrics available to data scientists. Automated p value computations would additionally be useful, and are often easier to interpret than raw test statistic values alone. EntropyExplorer is an R package for calculating DSE, DCV and DE. It also computes corresponding p values for each metric. All features are available through a single R function call. Based on extensive investigations in the literature, the Fligner-Killeen test was chosen to compute DCV p values. No standard method was found to be appropriate for DSE, and so permutation testing is used to calculate DSE p values. EntropyExplorer provides a convenient resource for calculating DSE, DCV, DE and associated p values. The package, along with its source code and reference manual, are freely available from the CRAN public repository at http://cran.r-project.org/web/packages/EntropyExplorer/index.html.

  19. Genes involved in epithelial differentiation and development are differentially expressed in oral and genital lichen planus epithelium compared to normal epithelium.

    PubMed

    Danielsson, Karin; Coates, Philip J; Ebrahimi, Majid; Nylander, Elisabet; Wahlin, Ylva Britt; Nylander, Karin

    2014-09-01

    Lichen planus (LP) is a chronic mucocutaneous disease with unknown cause. Patients with LP often have both oral and genital lesions, but these conditions are often considered as separate diseases and treated accordingly. To find out which genes are differently expressed in mucosal LP compared to normal mucosa and establish whether oral and genital LP are in fact the same disease, whole genome expression analysis was performed on epithelium from 13 patients diagnosed with oral and/or genital LP and normal controls. For confirmation of keratin 4 and corneodesmosin expression, quantitative reverse-transcription PCR and immunohistochemistry were used. Many genes involved in epithelial development and differentiation are differently expressed in epithelium from LP compared to normal epithelium. Several of the differentially expressed genes are common for oral and genital LP and the same biological processes are altered which supports the fact that oral and genital LP are manifestations of the same disease. The change in gene expression indicates that differentiation is altered leading to changes in the epithelial barrier.

  20. Quantitative expression of candidate genes affecting eggshell color.

    PubMed

    Zheng, Chuanwei; Li, Zesheng; Yang, Ning; Ning, Zhonghua

    2014-05-01

    There are three pigments that affect the color of an eggshell: protoporphyrin, biliverdin and biliverdin-zinc chelate. Protoporphyrin is the main pigment in brown and light-brown eggshells, whereas very little protoporphyrin is found in white eggshells. Eggshell protoporphyrin is derived from the heme formation in birds. Coproporphyrinogen III oxidase (CPOX) and ferrochelatase (FECH) represent rate-limiting enzymes for the heme-biosynthetic pathway. Breast cancer resistance protein (BCRP), feline leukemia virus receptor (FLVCR), and heme-responsive gene-1 (HRG1) serve as primary transporters for both protoporphyrinogen and heme. Finally, four organic anion transporting polypeptide family members (including solute carrier organic anion transporter family, SLCO1C1, SLCO1A2, SLCO1B3 and LOC418189) may affect pigment transport within eggshells. Here we measured gene expression levels in key tissues of egg-producing hens. We analyzed three different types of hens that generated distinct eggshell colors: white, pink or brown. Our data revealed three ways in which eggshell color was genetically influenced. First, high-level expression of CPOX generated more protoporphyrinogen and a brown eggshell color. In contrast, high expression of FECH likely converted more protoporphyrinogen into heme, reduced protoporphyrinogen levels within the eggshell and generated a light color. Second, heme transporters also affected eggshell color. High-level expression of BCRP, HRG1 and FLVCR were associated with brown, white and generally lighter eggshell colors, respectively. Finally, protoporphyrin precipitation also affected eggshell color, as high expression of both SLCO1A2 and SLCO1C1 were associated with brown eggshell color. As such, we have identified seven genes in which expression levels in different tissues were associated with eggshell color. © 2014 Japanese Society of Animal Science.

  1. Differential miRNA expression profiles in proliferating or differentiated keratinocytes in response to gamma irradiation

    PubMed Central

    2013-01-01

    Background MicroRNAs (miRNAs), a group of short non-coding RNAs that negatively regulate gene expression, have recently emerged as potential modulators of cellular response to ionizing radiations both in vitro and in vivo in various cell types and tissues. However, in epidermal cells, the involvement of the miRNA machinery in the cellular response to ionizing radiations remains to be clarified. Indeed, understanding the mechanisms of cutaneous radiosensitivity is an important issue since skin is the most exposed organ to ionizing radiations and among the most sensitive. Results We settled up an expression study of miRNAs in primary human skin keratinocytes using a microfluidic system of qPCR assay, which permits to assess the expression of almost 700 annotated miRNAs. The keratinocytes were cultured to a proliferative or a differentiated state mimicking basal or suprabasal layers of human epidermis. These cells were irradiated at 10 mGy or 6 Gy and RNA was extracted 3 hours after irradiation. We found that proliferative cells irradiated at 6 Gy display a global fall of miRNA expression whereas differentiated cells exposed to the same dose display a global increase of miRNAs expression. We identified twenty miRNAs weakly but significantly modulated after 6 Gy irradiation, whereas only 2 miRNAs were modulated after low-dose irradiation in proliferating cells. To go further into the biological meaning of this miRNA response, we over-expressed some of the responding miRNA in proliferating cells: we observed a significant decrease of cell viability 72 hours after irradiation. Functional annotation of their predicted targets revealed that G-protein related pathways might be regulated by these responding miRNAs. Conclusions Our results reveal that human primary keratinocytes exposed to ionizing irradiation expressed a miRNA pattern strongly related to the differentiation status of irradiated cells. We also demonstrate that some miRNAs play a role in the radiation

  2. Transgenic Expression of Osteoactivin/gpnmb Enhances Bone Formation In Vivo and Osteoprogenitor Differentiation Ex Vivo.

    PubMed

    Frara, Nagat; Abdelmagid, Samir M; Sondag, Gregory R; Moussa, Fouad M; Yingling, Vanessa R; Owen, Thomas A; Popoff, Steven N; Barbe, Mary F; Safadi, Fayez F

    2016-01-01

    Initial identification of osteoactivin (OA)/glycoprotein non-melanoma clone B (gpnmb) was demonstrated in an osteopetrotic rat model, where OA expression was increased threefold in mutant bones, compared to normal. OA mRNA and protein expression increase during active bone regeneration post-fracture, and primary rat osteoblasts show increased OA expression during differentiation in vitro. To further examine OA/gpnmb as an osteoinductive agent, we characterized the skeletal phenotype of transgenic mouse overexpressing OA/gpnmb under the CMV-promoter (OA-Tg). Western blot analysis showed increased OA/gpnmb in OA-Tg osteoblasts, compared to wild-type (WT). In OA-Tg mouse femurs versus WT littermates, micro-CT analysis showed increased trabecular bone volume and thickness, and cortical bone thickness; histomorphometry showed increased osteoblast numbers, bone formation and mineral apposition rates in OA-Tg mice; and biomechanical testing showed higher peak moment and stiffness. Given that OA/gpnmb is also over-expressed in osteoclasts in OA-Tg mice, we evaluated bone resorption by ELISA and histomorphometry, and observed decreased serum CTX-1 and RANK-L, and decreased osteoclast numbers in OA-Tg, compared to WT mice, indicating decreased bone remodeling in OA-Tg mice. The proliferation rate of OA-Tg osteoblasts in vitro was higher, compared to WT, as was alkaline phosphatase staining and activity, the latter indicating enhanced differentiation of OA-Tg osteoprogenitors. Quantitative RT-PCR analysis showed increased TGF-β1 and TGF-β receptors I and II expression in OA-Tg osteoblasts, compared to WT. Together, these data suggest that OA overexpression has an osteoinductive effect on bone mass in vivo and stimulates osteoprogenitor differentiation ex vivo. © 2015 Wiley Periodicals, Inc.

  3. Transgenic Expression of Osteoactivin/gpnmb Enhances Bone Formation in Vivo and Osteoprogenitor Differentiation ex Vivo

    PubMed Central

    Frara, Nagat; Abdelmagid, Samir M.; Sondag, Gregory R.; Moussa, Fouad M.; Yingling, Vanessa R.; Owen, Thomas A.; Popoff, Steven N.; Barbe, Mary F.; Safadi, Fayez F.

    2015-01-01

    Initial identification of osteoactivin (OA)/glycoprotein non-melanoma clone B (gpnmb) was demonstrated in an osteopetrotic rat model, where OA expression was increased 3-fold in mutant bones, compared to normal. OA mRNA and protein expression increase during active bone regeneration post-fracture, and primary rat osteoblasts show increased OA expression during differentiation in vitro. To further examine OA/gpnmb as an osteoinductive agent, we characterized the skeletal phenotype of transgenic mouse overexpressing OA/gpnmb under the CMV-promoter (OA-Tg). Western blot analysis showed increased OA/gpnmb in OA-Tg osteoblasts, compared to wild-type (WT). In OA-Tg mouse femurs versus WT littermates, micro-CT analysis showed increased trabecular bone volume and thickness, and cortical bone thickness; histomorphometry showed increased osteoblast numbers, bone formation and mineral apposition rates in OA-Tg mice; and biomechanical testing showed higher peak moment and stiffness. Given that OA/gpnmb is also over-expressed in osteoclasts in OA-Tg mice, we evaluated bone resorption by ELISA and histomorphometry, and observed decreased serum CTX-1 and RANK-L, and decreased osteoclast numbers in OA-Tg, compared to WT mice, indicating decreased bone remodeling in OA-Tg mice. The proliferation rate of OA-Tg osteoblasts in vitro was higher, compared to WT, as was alkaline phosphatase staining and activity, the latter indicating enhanced differentiation of OA-Tg osteoprogenitors. Quantitative RT-PCR analysis showed increased TGF-β1 and TGF-β receptors I and II expression in OA-Tg osteoblasts, compared to WT. Together, these data suggest that OA overexpression has an osteoinductive effect on bone mass in vivo and stimulates osteoprogenitor differentiation ex vivo. PMID:25899717

  4. Identification of differentially expressed genes in Mongolian sheep ovaries by suppression subtractive hybridization.

    PubMed

    He, Xiaolong; Li, Bei; Wang, Feng; Tian, Chunying; Rong, Weiheng; Liu, Yongbin

    2012-07-01

    Fecundity is an important trait in sheep. Because it is directly related to production costs and efficiency, it has great economic impact in sheep husbandry. Because Mongolian sheep are a longstanding, indigenous breed, they are genetically related to most other breeds of sheep in China. The study of genes related to reproductive traits is essential to improving the fecundity of Mongolian sheep. In the present study, suppression subtractive hybridization (SSH) was performed using forward and reverse nested primers on cDNA libraries from ovarian tissue of single-bearing (S) and biparous (B) Mongolian sheep (MS). This yielded 768 clones. The length of the inserted fragments ranged from 150 to 1000 bp. From these, dot blot hybridization followed by sequencing and homology blast search in GenBank resolved 373 differentially expressed clones, representing 185 gene sequences (homology >85% and length >200 bp), 10 expressed sequence tags (ESTs; homology >95% and length >100 bp), and 4 unknown ESTs. The analysis of the differentially expressed gene functions allowed these genes to be categorized into seven groups: cell/body or immune defense, metabolism, transportation, nucleic acid modification, cell development, signal transduction, and cell structure. Four differentially expressed genes, a disintegrin and metalloproteinase with thrombospondin motifs 1 (ADAMTS1), inhibitor of DNA binding 3 (ID3), bone morphogenetic protein 6 (BMP6), and integrin beta 1 (ITGB1), were randomly selected and verified using relative quantitative real-time polymerase chain reaction (RQ-PCR). The expression of these genes in BMS ovaries was 30.06, 11.55, 0.82, and 1.12-fold that of SMS ovaries, respectively.

  5. MicroRNA expression profiles differentiate chronic pain condition subtypes

    PubMed Central

    Ciszek, Brittney P.; Khan, Asma A.; Dang, Hong; Slade, Gary D.; Smith, Shad; Bair, Eric; Maixner, William; Zolnoun, Denniz; Nackley, Andrea G.

    2015-01-01

    Chronic pain is a significant healthcare problem, ineffectively treated due to its unclear etiology and heterogeneous clinical presentation. Emerging evidence demonstrates that microRNAs regulate the expression of pain-relevant genes, yet little is known about their role in chronic pain. Here, we evaluate the relationship between pain, psychological characteristics, plasma cytokines and whole blood microRNAs in 22 healthy controls (HC); 33 subjects with chronic pelvic pain (vestibulodynia: VBD); and 23 subjects with VBD and irritable bowel syndrome (VBD+IBS). VBD subjects were similar to HCs in self-reported pain, psychological profiles and remote bodily pain. VBD+IBS subjects reported decreased health and function; and an increase in headaches, somatization and remote bodily pain. Furthermore, VBD subjects exhibited a balance in pro- and anti-inflammatory cytokines, while VBD+IBS subjects failed to exhibit a compensatory increase in anti-inflammatory cytokines. VBD subjects differed from controls in expression of 10 microRNAs of predicted importance for pain and estrogen signaling. VBD+IBS subjects differed from controls in expression of 11 microRNAs of predicted importance for pain, cell physiology and insulin signaling. MicroRNA expression was correlated with pain-relevant phenotypes and cytokine levels. These results suggest microRNAs represent a valuable tool for differentiating VBD subtypes (localized pain with apparent peripheral neurosensory disruption versus widespread pain with a central sensory contribution) that may require different treatment approaches. PMID:26166255

  6. Differential co-expression analysis of a microarray gene expression profiles of pulmonary adenocarcinoma.

    PubMed

    Fu, Shijie; Pan, Xufeng; Fang, Wentao

    2014-08-01

    Lung cancer severely reduces the quality of life worldwide and causes high socioeconomic burdens. However, key genes leading to the generation of pulmonary adenocarcinoma remain elusive despite intensive research efforts. The present study aimed to identify the potential associations between transcription factors (TFs) and differentially co‑expressed genes (DCGs) in the regulation of transcription in pulmonary adenocarcinoma. Gene expression profiles of pulmonary adenocarcinoma were downloaded from the Gene Expression Omnibus, and gene expression was analyzed using a computational method. A total of 37,094 differentially co‑expressed links (DCLs) and 251 DCGs were identified, which were significantly enriched in 10 pathways. The construction of the regulatory network and the analysis of the regulatory impact factors revealed eight crucial TFs in the regulatory network. These TFs regulated the expression of DCGs by promoting or inhibiting their expression. In addition, certain TFs and target genes associated with DCGs did not appear in the DCLs, which indicated that those TFs could be synergistic with other factors. This is likely to provide novel insights for research into pulmonary adenocarcinoma. In conclusion, the present study may enhance the understanding of disease mechanisms and lead to an improved diagnosis of lung cancer. However, further studies are required to confirm these observations.

  7. Differential expression of fertility genes boule and dazl in Chinese sturgeon (Acipenser sinensis), a basal fish.

    PubMed

    Ye, Huan; Li, Chuang-Ju; Yue, Hua-Mei; Yang, Xiao-Ge; Wei, Qi-Wei

    2015-05-01

    The gene family DAZ (deleted in Azoospermia), including boule, dazl and DAZ, performs highly conserved functions in germ cell development and fertility across animal phyla. Differential expression patterns have been demonstrated for the family members in invertebrates and vertebrates including fish. Here, we report the identification of boule and dazl and their expression at both RNA and protein levels in developing and mature gonads of Chinese sturgeon (Acipenser sinensis). Firstly, the isolation of the boule and dazl genes in Chinese sturgeon and the observation of the two genes in coelacanth suggest that dazl originated after the divergence of bony fish from cartilaginous fish but before the emergence of the Actinistia. Quantitative real-time PCR and western blot analyses reveal that boule and dazl RNA and proteins are restricted to the testis and ovary. In situ hybridization and fluorescent immunohistochemistry show that the bisexual mitotic and meiotic germ cell expression of dazl RNA and protein is conserved in vertebrates, while Chinese sturgeon boule RNA and protein exhibit mitotic and meiotic expression in the testis, and also likely display mitotic and meiotic expression in female. Moreover, we directly demonstrate for the first time that sturgeon Balbiani body/mitochondrial cloud disperses in the cytoplasm of early developing oocytes and co-localizes with Dazl to some extent. Finally, urbilaterian boule may also have an ancestral function in oogenesis. Taken together, these results provide useful information on the evolution of DAZ family genes, expression patterns and functions in animal reproduction.

  8. Innate immune gene expression differentiates the early avian intestinal response between Salmonella and Campylobacter.

    PubMed

    Shaughnessy, Ronan G; Meade, Kieran G; Cahalane, Sarah; Allan, Brenda; Reiman, Carla; Callanan, John J; O'Farrelly, Cliona

    2009-12-15

    Salmonella enterica serovar Typhimurium and Campylobacter jejuni are major human pathogens, yet colonise chickens without causing pathology. The aim of this study was to compare intestinal innate immune responses to both bacterial species, in a 4-week-old broiler chicken model. Challenged and control birds were sacrificed and tissue samples taken for histopathology and RNA extraction. No significant clinical or pathological changes were observed in response to infection with either bacterial species. Expression of selected genes involved in pathogen detection and the innate immune response were profiled in caecal tissues by quantitative real-time PCR. TLR4 and TLR21 gene expression was transiently increased in response to both bacterial species (P<0.05). Significant increases in TLR5 and TLR15 gene expression were detected in response to S. Typhimurium but not to C. jejuni. Transient increases of proinflammatory cytokine (IL6 and IFNG) and chemokine (IL8 and K60) genes increased as early as 6h in response to S. Typhimurium. Minimal cytokine gene expression was detected in response to C. jejuni after 20h. IL8 gene expression however, was significantly increased by 24-fold (P<0.01). The differential expression profiles of innate immune genes in both infection models shed light on the tailored responses of the host immune system to specific microbes. It is further evidence that innate regulation of these responses is an important prerequisite to preventing development of disease.

  9. Transcription in space--environmental vs. genetic effects on differential immune gene expression.

    PubMed

    Lenz, Tobias L

    2015-09-01

    Understanding how organisms adapt to their local environment is one of the key goals in molecular ecology. Adaptation can be achieved through qualitative changes in the coding sequence and/or quantitative changes in gene expression, where the optimal dosage of a gene's product in a given environment is being selected for. Differences in gene expression among populations inhabiting distinct environments can be suggestive of locally adapted gene regulation and have thus been studied in different species (Whitehead & Crawford ; Hodgins-Davis & Townsend ). However, in contrast to a gene's coding sequence, its expression level at a given point in time may depend on various factors, including the current environment. Although critical for understanding the extent of local adaptation, it is usually difficult to disentangle the heritable differences in gene regulation from environmental effects. In this issue of Molecular Ecology, Stutz et al. () describe an experiment in which they reciprocally transplanted three-spined sticklebacks (Gasterosteus aculeatus) between independent pairs of small and large lakes. Their experimental design allows them to attribute differences in gene expression among sticklebacks either to lake of origin or destination lake. Interestingly, they find that translocated sticklebacks show a pattern of gene expression more similar to individuals from the destination lake than to individuals from the lake of origin, suggesting that expression of the targeted genes is more strongly regulated by environmental effects than by genetics. The environmental effect by itself is not entirely surprising; however, the relative extent of it is. Especially when put in the context of local adaptation and population differentiation, as done here, these findings cast a new light onto the heritability of differential gene expression and specifically its relative importance during population divergence and ultimately ecological speciation.

  10. Differential gene expression in Symbiodinium microadriaticum clade B following stress.

    PubMed

    Karako-Lampert, S; Hershkovits, G; Stambler, N; Simon-Blecher, N; Achituv, Y; Dubinsky, Z; Katcoff, D J

    2006-01-01

    Coral bleaching is caused by the loss of symbiont zooxanthellae and/or decrease in their pigments. Since the algal symbionts provide the energy basis for corals and whole reefs, their loss or impairment of function leads to widespread mortality. This phenomenon has been documented numerous times in recent years, and has extensively damaged coral reefs all over the world. Temperature has been found to be the major cause of bleaching, and rising sea temperatures have increased the frequency of these catastrophic episodes. To characterize the response of zooxanthellae to temperature stress at the molecular level, we used the mRNA differential display technique to monitor changes in the abundance of specific mRNA species in the cell under different temperature conditions. Axenically grown zooxanthellae were exposed to a range of temperatures (21.7, 17, 26 degrees C) before extraction of their mRNA. Of numerous differentially expressed sequences, seven mRNA species were amplified by the polymerase chain reaction (PCR) and sequenced. One of those sequences was positively identified as encoding a multifunction cell surface aminopeptidase, dipeptidyl peptidase IV, which is active in cell matrix adhesion. Our work illustrates the power of the differential display technique as a useful tool to study the response of zooxanthellae to stressors.

  11. Multiple differential expression networks identify key genes in rectal cancer.

    PubMed

    Li, Ri-Heng; Zhang, Ai-Min; Li, Shuang; Li, Tian-Yang; Wang, Lian-Jing; Zhang, Hao-Ran; Li, Ping; Jia, Xiong-Jie; Zhang, Tao; Peng, Xin-Yu; Liu, Min-Di; Wang, Xu; Lang, Yan; Xue, Wei-Lan; Liu, Jing; Wang, Yan-Yan

    2016-01-01

    Rectal cancer is an important contributor to cancer mortality. The objective of this paper is to identify key genes across three phenotypes (fungating, polypoid and polypoid & small-ulcer) of rectal cancer based on multiple differential expression networks (DENs). Differential interactions and non-differential interactions were evaluated according to Spearman correlation coefficient (SCC) algorithm, and were selected to construct DENs. Topological analysis was performed for exploring hub genes in largest components of DENs. Key genes were denoted as intersections between nodes of DENs and rectal cancer associated genes from Genecards. Finally, we utilized hub genes to classify phenotypes of rectal cancer on the basis of support vector machines (SVM) methodology. We obtained 19 hub genes and total 12 common key genes of three largest components of DENs, and EGFR was the common element. The SVM results revealed that hub genes could classify phenotypes, and validated feasibility of DEN methods. We have successfully identified significant genes (such as EGFR and UBC) across fungating, polypoid and polypoid & small-ulcer phenotype of rectal cancer. They might be potential biomarkers for classification, detection and therapy of this cancer.

  12. LSOSS: Detection of Cancer Outlier Differential Gene Expression.

    PubMed

    Wang, Yupeng; Rekaya, Romdhane

    2010-08-05

    Detection of differential gene expression using microarray technology has received considerable interest in cancer research studies. Recently, many researchers discovered that oncogenes may be activated in some but not all samples in a given disease group. The existing statistical tools for detecting differentially expressed genes in a subset of the disease group mainly include cancer outlier profile analysis (COPA), outlier sum (OS), outlier robust t-statistic (ORT) and maximum ordered subset t-statistics (MOST). In this study, another approach named Least Sum of Ordered Subset Square t-statistic (LSOSS) is proposed. The results of our simulation studies indicated that LSOSS often has more power than previous statistical methods. When applied to real human breast and prostate cancer data sets, LSOSS was competitive in terms of the biological relevance of top ranked genes. Furthermore, a modified hierarchical clustering method was developed to classify the heterogeneous gene activation patterns of human breast cancer samples based on the significant genes detected by LSOSS. Three classes of gene activation patterns, which correspond to estrogen receptor (ER)+, ER- and a mixture of ER+ and ER-, were detected and each class was assigned a different gene signature.

  13. Differential protein expression in Phalaenopsis under low temperature.

    PubMed

    Yuan, Xiu-Yun; Liang, Fang; Jiang, Su-Hua; Wan, Mo-Fei; Ma, Jie; Zhang, Xian-Yun; Cui, Bo

    2015-01-01

    A comparative proteomic analysis was carried out to explore the molecular mechanisms of responses to cold stress in Phalaenopsis after treated by low temperature (13/8 °C day/night) for 15 days. Differentially expressed proteins were examined using two-dimensional electrophoresis (2-DE) and matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF-TOF/MS). Among 85 differentially expressed proteins, 73 distinct proteins were identified. Comparative analysis revealed that the identified proteins mainly participate in photosynthesis, protein synthesis, folding and degradation, respiration, defense response, amino acid metabolism, energy pathway, cytoskeleton, transcription regulation, signal transduction, and seed storage protein, while the functional classification of the remaining four proteins was not determined. These data suggested that the proteins might work cooperatively to establish a new homeostasis under cold stress; 37 % of the identified cold-responsive proteins were associated with various aspects of chloroplast physiology, and 56 % of them were predicted to be located in the chloroplasts, implying that the cold stress tolerance of Phalaenopsis was achieved, at least partly, by regulation of chloroplast function. Moreover, the protein destination control, which was mediated by chaperones and proteases, plays an important role in tolerance to cold stress.

  14. [Screening differentially expressed plasma proteins in cold stress rats based on iTRAQ combined with mass spectrometry technology].

    PubMed

    Liu, Yan-zhi; Guo, Jing-ru; Peng, Meng-ling; Ma, Li; Zhen, Li; Ji, Hong; Yang, Huan-min

    2015-09-01

    Isobaric tags for relative and absolute quantitation (iTRAQ) combined with mass spectrometry were used to screen differentially expressed plasma proteins in cold stress rats. Thirty health SPF Wistar rats were randomly divided into cold stress group A and control group B, then A and B were randomly divided into 3 groups (n = 5): A1, A2, A3 and B1, B2, B3. The temperature of room raising was (24.0 +/- 0.1) degrees C, and the cold stress temperature was (4.0 +/- 0.1) degrees C. The rats were treated with different temperatures until 12 h. The abdominal aortic blood was collected with heparin anticoagulation suction tube. Then, the plasma was separated for protein extraction, quantitative, enzymolysis, iTHAQ labeling, scx fractionation and mass spectrometry analysis. Totally, 1085 proteins were identified in the test, 39 differentially expressed proteins were screened, including 29 up-regulated proteins and 10 down-regulated proteins. Three important differentially expressed proteins related to cold stress were screened by bioinfonnatics analysis (Minor histocompatihility protein HA-1, Has-related protein Rap-1b, Integrin beta-1). In the experiment, the differentially expressed plasma proteins were successfully screened in cold stress rats. iTRAQ technology provided a good platform to screen protein diaguostic markers on cold stress rats, and laid a good foundation for further. study on animal cold stress mechanism.

  15. Importance of renal depth correction for quantitation of differential renal function

    SciTech Connect

    Choi, H.; Kirchner, P.T.

    1985-05-01

    To assess the frequency and magnitude of errors caused by asymmetries in renal depth, when estimates of differential function are based only posterior projections (as in DTPA studies). The authors compared ratios of right-to-left (R/L) DMSA localization derived from posterior camera images with R/L ratios based on geometric mean of posterior and anterior counts of each kidney. The factor (X) required to convert the ratio of R/L posterior counts to the more accurate R/L geometric counts (Rp/Lp.X = Rg/Lg) was determined in 55 randomly selected patients referred for DMSA studies. Frequency distributions for X and l/X reveal that the use of posterior counts alone is likely to produce differential flow/function estimates with errors greater than 30% in 5% of patients, greater than 20% in 16 of patients. Lack of depth correction also widens the normal range derived from normal controls, thus reducing sensitivity and specificity of quantitative renal studies by two different mechanisms. The authors recommend routine application of depth correction by conjugate counting or ultrasound techniques for all quantitations of renal function.

  16. Population size is weakly related to quantitative genetic variation and trait differentiation in a stream fish.

    PubMed

    Wood, Jacquelyn L A; Tezel, Defne; Joyal, Destin; Fraser, Dylan J

    2015-09-01

    How population size influences quantitative genetic variation and differentiation among natural, fragmented populations remains unresolved. Small, isolated populations might occupy poor quality habitats and lose genetic variation more rapidly due to genetic drift than large populations. Genetic drift might furthermore overcome selection as population size decreases. Collectively, this might result in directional changes in additive genetic variation (VA ) and trait differentiation (QST ) from small to large population size. Alternatively, small populations might exhibit larger variation in VA and QST if habitat fragmentation increases variability in habitat types. We explored these alternatives by investigating VA and QST using nine fragmented populations of brook trout varying 50-fold in census size N (179-8416) and 10-fold in effective number of breeders, Nb (18-135). Across 15 traits, no evidence was found for consistent differences in VA and QST with population size and almost no evidence for increased variability of VA or QST estimates at small population size. This suggests that (i) small populations of some species may retain adaptive potential according to commonly adopted quantitative genetic measures and (ii) populations of varying sizes experience a variety of environmental conditions in nature, however extremely large studies are likely required before any firm conclusions can be made. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

  17. Comparing Quantitative Trait Loci and Gene Expression Data

    PubMed Central

    Han, Bing; Altman, Naomi S.; Mong, Jessica A.; Klein, Laura Cousino; Pfaff, Donald W.; Vandenbergh, David J.

    2008-01-01

    We develop methods to compare the positions of quantitative trait loci (QTL) with a set of genes selected by other methods, such as microarray experiments, from a sequenced genome. We apply our methods to QTL for addictive behavior in mouse, and a set of genes upregulated in a region of the brain associated with addictive behavior, the nucleus accumbens (NA). The association between the QTL and NA genes is not significantly stronger than expected by chance. However, chromosomes 2 and 16 do show strong associations suggesting that genes on these chromosomes might be associated with addictive behavior. The statistical methodology developed for this study can be applied to similar studies to assess the mutual information in microarray and QTL analyses. PMID:19920989

  18. Trace elements as quantitative probes of differentiation processes in planetary interiors

    SciTech Connect

    Drake, M.J.

    1980-02-01

    Abundances of trace elements in extrusive igneous rocks may be used as petrological and geochemical probes of the source regions of the rocks if differentiation processes, partition coefficients, phase equilibria, and initial concentrations in the source region are known. The characteristic trace element signature that each mineral in the source region imparts on the magma forms the conceptual basis for trace element modeling. The task of the trace element geochemist is to solve mathematically the inverse problem. Given trace element abundances in a magma, what is the ode of its source region. The most successful modeling has been performed for small planetary bodies which underwent relatively simple igneous differentiation events. An example is the eucrite parent body, a planet which produced basals at approx. =4.6 Gy. and has been quiescent ever since. This simple differentiation history permits the calculation of its bulk composition (a feldspathic peridotite) and has led to the tentative identification of asteroid 4 Westa as the eucrite parent body. The differentiation of iron meteorite groups in parent body cores is amenable to similar treatment. The 'anomalous' behavior of Cr, suggests that IIIA, B irons and main group pallasites equilibrated with troilite, spinel, ferromagnesian silicates, or some combination thereof. The moon has undergone more complex differentiation, and quantitative geochemical modeling is correspondingly more difficult. Nevertheless, modeling the two-stage evolution of mare basals raises the possibility that the primordial moon did not have chondritic relative abundances of such refractory elements as Ca, Al, U, and the rare-earth elements. The nonchondritic element ratios are characteristic of planetary, not nebular, fractionation processes and are consistent with the derivation of the moon from a precursor planet, possibly the earth.

  19. Adipogenic differentiation state-specific gene expression as related to bovine carcass adiposity.

    PubMed

    Pickworth, C L; Loerch, S C; Velleman, S G; Pate, J L; Poole, D H; Fluharty, F L

    2011-02-01

    Genetic regulation of the site of fat deposition is not well defined. The objective of this study was to investigate adipogenic differentiation state-specific gene expression in feedlot cattle (>75% Angus; <25% Simmental parentage) of varying adipose accretion patterns. Four groups of 4 steers were selected via ultrasound for the following adipose tissue characteristics: low subcutaneous-low intramuscular (LSQ-LIM), low subcutaneous-high intramuscular (LSQ-HIM), high subcutaneous-low intramuscular (HSQ-LIM), and high subcutaneous-high intramuscular (HSQ-HIM). Adipose tissue from the subcutaneous (SQ) and intramuscular (IM) depots was collected at slaughter. The relative expression of adipogenic genes was evaluated using quantitative PCR. Data were analyzed using the mixed model of SAS, and gene expression data were analyzed using covariate analysis with ribosomal protein L19 as the covariate. No interactions (P > 0.10) were observed between IM and SQ adipose tissue depots for any of the variables measured. Therefore, only the main effects of high and low accretion within a depot and the effects of depot are reported. Steers with LIM had smaller mean diameter IM adipocytes (P < 0.001) than HIM steers. Steers with HSQ had larger mean diameter SQ adipocytes (P < 0.001) than LSQ. However, there were no differences (P > 0.10) in any of the genes measured due to high or low adipose accretion. Preadipogenic delta-like kinase1 mRNA was greater in the IM than the SQ adipose tissue; conversely, differentiating and adipogenic genes, lipoprotein lipase, PPARγ, fatty acid synthetase, and fatty acid binding protein 4 were greater (P < 0.001) in the SQ than the IM depot. Intramuscular adipocytes were smaller than SQ adipocytes and had greater expression of the preadipogenic gene, indicating that more hyperplasia was occurring. Meanwhile, SQ adipose tissue contained much larger (P < 0.001) adipocytes that had a greater expression (P < 0.001) of differentiating and adipogenic

  20. Differential expression and subcellular distribution of dystrophin Dp71 isoforms during differentiation process.

    PubMed

    Marquez, F G; Cisneros, B; Garcia, F; Ceja, V; Velázquez, F; Depardón, F; Cervantes, L; Rendón, A; Mornet, D; Rosas-vargas, H; Mustre, M; Montañez, C

    2003-01-01

    Dp71 is the major product of the Duchenne muscular dystrophy gene in the brain. In order to study the function of Dp71 in the nervous system we examined the expression of Dp71 isoforms in PC12 rat pheochromocytoma cell line, a well-established system to study neuronal differentiation. We show by reverse transcriptase-polymerase chain reaction and Western blot assays that PC12 cells express two Dp71 isoforms. One isoform lacks exon 71 and the other isoform lacks exons 71 and 78 (Dp71d and Dp71f isoforms respectively). Nerve growth factor-induced neuronal differentiation of PC12 cells results in differential regulation of the expression and subcellular localization of Dp71 isoforms: a) the amount of Dp71f protein increases nine-fold in total extracts while Dp71d increases up to seven-fold in nuclear extracts; b) Dp71f relocates from the cytoplasm to neuritic processes, being prominent at varicosities and the growth cone; c) Dp71d relocates almost entirely to the nucleus and is detected to a lower extent in the cytoplasm and neuritic processes. Dp71f co-localizes with beta-dystroglycan and synaptophysin while Dp71d co-localizes with beta-dystroglycan in the nucleus. Dp71d accumulates at cell-cell contacts where Dp71f is absent. These results suggest that Dp71d and Dp71f associate with different subcellular complexes and therefore may have distinct functions in PC12 cells.

  1. Gene expression related to the differentiation of osteoblastic cells is altered by microgravity.

    PubMed

    Carmeliet, G; Nys, G; Stockmans, I; Bouillon, R

    1998-05-01

    Bone loss is observed after exposure to weightlessness in both astronauts and inflight animals. Histological and biochemical studies on rats have shown a decrease in bone formation, probably as a result of altered osteoblast function. To investigate whether microgravity alters osteoblast differentiation in vitro, the human osteosarcoma cell line MG-63 was used as a model. MG-63 cells can be induced to differentiate by treating the cells with 1,25(OH)2D3 (10(-7) mol/L) and transforming growth factor-beta 2 (TGFbeta2) (10 ng/mL). The message level of differentiation-related genes was quantitated via competitive reverse transcription-polymerase chain reaction (RT-PCR), both in untreated and hormone-treated cells cultured under microgravity for 9 days aboard the unmanned Foton 10 spaceflight, and compared to ground and inflight unit-gravity cultures. At microgravity, gene expression for collagen Ialpha1 following treatment was reduced to 51% of unit-gravity levels (p < 0.05). The amount of alkaline phosphatase messenger ribonucleic acid (mRNA) following treatment at microgravity increased by only a factor of 5 compared to the tenfold increase at unit gravity (p < 0.02). The osteocalcin message level in treated cells cultured at microgravity was only 19% of the level found in cells grown at unit gravity (p < 0.02). In conclusion, microgravity reduces the differentiation of osteoblastic MG-63 cells in response to systemic hormones and growth factors.

  2. [Expression pattern of myeloid differentiation-related transcription factor mRNA in differentiation of NB4 and HL-60 cells induced by all-trans retinoic acid].

    PubMed

    Wu, Yong; Li, Xian-Fang; Yang, Jing-Hui; Liao, Xiao-Ying; Huang, Hui-Fang; Chen, Yuan-Zhong

    2011-08-01

    Hematopoiesis is coordinated by a complex regulatory network of transcription factors that involves proliferation, differentiation and maturation of a very small population of pluripotent hematopoietic stem cells with self-renewing and differentiating into various specialized and distinct blood cell types. Malfunction of transcription factors may lead to diseases such as acute myeloid leukemia (AML). The purpose of this study was to investigate the expression pattern of transcription factor mRNA in acute myeloid leukemia (AML) cells during in vitro differentiation. The 2 human leukemic cell lines HL-60 and NB4 had been used as model cell lines. Differentiation of HL-60 and NB4 cells was induced by all-trans retinoic acid (ATRA) for 4 days. Morphological changes were observed by May-Grunwald Giemsa stainings, the CD11b expression level was detected by flow cytometry. Transcription factor mRNA profiles (PU.1, C/EBPα, ε, γ, GATA-1, GATA-2) were determined by real time RT-PCR during in vitro HL-60 and NB4 differentiation; The expression level of transcription factor mRNA was relatively quantitatively analyzed by using 2(-ΔΔCT) and compared with control group. The results showed that the expression levels of PU.1 and C/EBP ε mRNA in NB4 differentiation group were 5.75 and 6.16, respectively, which were significantly higher than those in untreated group; while the expression level of C/EBPα, γ, GATA-1, GATA-2 mRNA in NB4 differentiation group were 62%, 31%, 63% and 8.7% respectively, which were significantly lower than those in untreated group; In HL-60 differentiation group, the expression levels of PU.1, C/EBPα, ε were 1.97, 1.95 and 2.35 respectively, which were significantly higher than those in untreated group; while the expression levels of C/EBPγ, GATA-1, GATA-2 in HL-60 differentiation group were 20%, 21% and 18% respectively, which were significantly lower than those in untreated group. It is concluded that dysregulation of transcription factors is a

  3. Parameterized algorithms for quantitative differentials in spectrally equivalent medical diagnostic x-ray beams

    SciTech Connect

    Okunade, Akintunde Akangbe

    2005-06-15

    Qualitative and quantitative equivalence of spectra transmitted by two different elemental filters require a good match in terms of shape and size over the entire energy range of 0-150 keV used in medical diagnostic radiology. However, the photoelectric absorptions and Compton scattering involved in the interaction of x rays with matter at these relatively low photon energies differ in a nonuniform manner with energy and atomic number. By careful choice of thicknesses for filter materials with an atomic number between 12 and 39, when compared with aluminum, it is possible to obtain transmitted beams of the same shape (quality) but not of the same size (quantity). In this paper, calculations have been carried out for the matching of the shapes and sizes of beams transmitted through specified thicknesses of aluminium filter and spectrally equivalent thicknesses of other filter materials (different from aluminium) using FORTRAN source codes traceable to the American Association of Physics in Medicine (AAPM), College Park, MD, USA. Parametrized algorithms for the evaluation of quantitative differentials (deficit or surplus) in radiation output (namely, photon fluence, exposure, kerma, energy imparted, absorbed dose, and effective dose) from these transmitted spectrally equivalent beams were developed. These differentials range between 1%, and 4% at 1 mm Al filtration and between 8%, and 25% for filtration of 6 mm Al for different filter materials in comparison with aluminum. Also developed were models for factors for converting measures of photon fluence, exposure-area product, (EAP), and kerma-area product (KAP) to risk related quantities such as energy imparted, absorbed dose, and effective dose from the spectrally equivalent beams. The thicknesses of other filter materials that are spectrally equivalent to given thicknesses of aluminum filter were characterized using polynomial functions. The fact that the use of equivalent spectra in radiological practice can

  4. Detection and differentiation of human parvovirus variants by commercial quantitative real-time PCR tests.

    PubMed

    Hokynar, Kati; Norja, Päivi; Laitinen, Harri; Palomäki, Pekka; Garbarg-Chenon, Antoine; Ranki, Annamari; Hedman, Klaus; Söderlund-Venermo, Maria

    2004-05-01

    Parvovirus B19 causes a variety of diseases in humans, with outcomes ranging from asymptomatic to severe, such as chronic anemia in immunocompromised patients or fetal hydrops and death after maternal infection during pregnancy. The virus may be transmitted via plasma-derived products. According to the results of solvent-detergent safety studies, an upper limit of B19 DNA in plasma pools was recently defined. To restrict the input of B19 virus into production pools, a quantitative nucleic acid test is a prerequisite. We examined the suitability of the two commercial quantitative B19 PCR tests, LightCycler-Parvovirus B19 quantification kit (Roche Diagnostics) and RealArt Parvo B19 LC PCR (Artus) for detection, quantification, and differentiation of the three known B19 genotypes, including the newly described erythrovirus variants (genotypes 2 and 3). The former kit was highly sensitive for genotype 1 but was not suitable for detection of genotype 2 or one of two genotype 3 strains. The latter kit detected and differentiated all three genotypes, albeit with lower sensitivity for one of the genotype-3 strains. We furthermore assessed the prevalence of the three B19 virus genotypes in blood donors, by screening pooled plasma samples derived from 140,160 Finnish blood-donor units. None of the pools contained detectable levels of B19 virus genotypes 2 or 3. The origin, mode of transmission, and clinical significance of these genotypes are unknown and deserve further study. The RealArt Parvo B19 LC PCR is suitable for detection, quantification, and differentiation of all three B19 virus genotypes in molecular and clinical research.

  5. Differential gene expression analysis of Paracoccidioides brasiliensis during keratinocyte infection.

    PubMed

    Peres da Silva, Roberta; Matsumoto, Marcelo Teruyuki; Braz, Jaqueline Derissi; Voltan, Aline Raquel; de Oliveira, Haroldo Cesar; Soares, Christiane Pienna; Mendes Giannini, Maria José Soares

    2011-03-01

    Paracoccidioides brasiliensis is the agent of paracoccidioidomycosis, one of the most important systemic fungal diseases in Latin America. This initiates in lung tissue and can subsequently disseminate to other tissues. Clinical manifestations range from localized forms to disseminated disease that can progress to lethality, probably depending on the relationships among the virulence of the fungus, the immune response and the ability to interact with the surface structures and invade epithelial cells and mononuclear cells of the host. It is generally regarded as a multifocal disease, with oral lesions as the prominent feature. The aim of this study was to evaluate P. brasiliensis yeast infection in normal oral keratinocytes (NOKs). The differential expression of mRNAs and proteins was also determined when the fungus was placed in contact with the cell in order to characterize differentially expressed genes and proteins during P. brasiliensis infection. After contact with NOKs, the fungus appeared to induce alterations in the cells, which showed cellular extensions and cavitations, probably resulting from changes in the actin cytoskeleton seen at 5 and 8 h after infection. Levels of protein expression were higher after reisolation of the fungus from infected NOK culture compared with culture of the fungus in medium. The analysis identified transcripts related to 19 proteins involved in different biological processes. Transcripts were found with multiple functions including induction of cytokines, protein metabolism, alternative carbon metabolism, zinc transport and the stress response during contact with NOKs. The proteins found suggested that the yeast was in a stress situation, as indicated by the presence of RDS1. Nevertheless, the yeast seemed to be proliferating and metabolically active, as shown by the presence of a proteasome, short-chain acetylator, glucosamine-6-phosphate isomerase and ADP/ATP carrier transcripts. Additionally, metabolic pathways may

  6. Brief isoflurane anaesthesia affects differential gene expression, gene ontology and gene networks in rat brain.

    PubMed

    Lowes, Damon A; Galley, Helen F; Moura, Alessandro P S; Webster, Nigel R

    2017-01-15

    Much is still unknown about the mechanisms of effects of even brief anaesthesia on the brain and previous studies have simply compared differential expression profiles with and without anaesthesia. We hypothesised that network analysis, in addition to the traditional differential gene expression and ontology analysis, would enable identification of the effects of anaesthesia on interactions between genes. Rats (n=10 per group) were randomised to anaesthesia with isoflurane in oxygen or oxygen only for 15min, and 6h later brains were removed. Differential gene expression and gene ontology analysis of microarray data was performed. Standard clustering techniques and principal component analysis with Bayesian rules were used along with social network analysis methods, to quantitatively model and describe the gene networks. Anaesthesia had marked effects on genes in the brain with differential regulation of 416 probe sets by at least 2 fold. Gene ontology analysis showed 23 genes were functionally related to the anaesthesia and of these, 12 were involved with neurotransmitter release, transport and secretion. Gene network analysis revealed much greater connectivity in genes from brains from anaesthetised rats compared to controls. Other importance measures were also altered after anaesthesia; median [range] closeness centrality (shortest path) was lower in anaesthetized animals (0.07 [0-0.30]) than controls (0.39 [0.30-0.53], p<0.0001) and betweenness centrality was higher (53.85 [32.56-70.00]% compared to 5.93 [0-30.65]%, p<0.0001). Simply studying the actions of individual components does not fully describe dynamic and complex systems. Network analysis allows insight into the interactions between genes after anaesthesia and suggests future targets for investigation. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Differential expression of GAP-43 and neurofilament during peripheral nerve regeneration through bio-artificial conduits.

    PubMed

    Carriel, Víctor; Garzón, Ingrid; Campos, Antonio; Cornelissen, Maria; Alaminos, Miguel

    2017-02-01

    Nerve conduits are promising alternatives for repairing nerve gaps; they provide a close microenvironment that supports nerve regeneration. In this sense, histological analysis of axonal growth is a determinant to achieve successful nerve regeneration. To evaluate this process, the most-used immunohistochemical markers are neurofilament (NF), β-III tubulin and, infrequently, GAP-43. However, GAP-43 expression in long-term nerve regeneration models is still poorly understood. In this study we analysed GAP-43 expression and its correlation with NF and S-100, using three tissue-engineering approaches with different regeneration profiles. A 10 mm gap was created in the sciatic nerve of 12 rats and repaired using collagen conduits or collagen conduits filled with fibrin-agarose hydrogels or with hydrogels containing autologous adipose-derived mesenchymal stem cells (ADMSCs). After 12 weeks the conduits were harvested for histological analysis. Our results confirm the long-term expression of GAP-43 in all groups. The expression of GAP-43 and NF was significantly higher in the group with ADMSCs. Interestingly, GAP-43 was observed in immature, newly formed axons and NF in thicker and mature axons. These proteins were not co-expressed, demonstrating their differential expression in newly formed nerve fascicles. Our descriptive and quantitative histological analysis of GAP-43 and NFL allowed us to determine, with high accuracy, the heterogenic population of axons at different stages of maturation in three tissue-engineering approaches. Finally, to perform a complete assessment of axonal regeneration, the quantitative immunohistochemical evaluation of both GAP-43 and NF could be a useful quality control in tissue engineering. Copyright © 2014 John Wiley & Sons, Ltd.

  8. Differential expression and interaction of host factors augment HIV-1 gene expression in neonatal mononuclear cells

    SciTech Connect

    Sundaravaradan, Vasudha; Mehta, Roshni; Harris, David T.; Zack, Jerome A.; Ahmad, Nafees

    2010-04-25

    We have previously shown a higher level of HIV-1 replication and gene expression in neonatal (cord) blood mononuclear cells (CBMC) compared with adult blood cells (PBMC), which could be due to differential expression of host factors. We performed the gene expression profile of CBMC and PBMC and found that 8013 genes were expressed at higher levels in CBMC than PBMC and 8028 genes in PBMC than CBMC, including 1181 and 1414 genes upregulated after HIV-1 infection in CBMC and PBMC, respectively. Several transcription factors (NF-kappaB, E2F, HAT-1, TFIIE, Cdk9, Cyclin T1), signal transducers (STAT3, STAT5A) and cytokines (IL-1beta, IL-6, IL-10) were upregulated in CBMC than PBMC, which are known to influence HIV-1 replication. In addition, a repressor of HIV-1 transcription, YY1, was down regulated in CBMC than PBMC and several matrix metalloproteinase (MMP-7, -12, -14) were significantly upregulated in HIV-1 infected CBMC than PBMC. Furthermore, we show that CBMC nuclear extracts interacted with a higher extent to HIV-1 LTR cis-acting sequences, including NF-kappaB, NFAT, AP1 and NF-IL6 compared with PBMC nuclear extracts and retroviral based short hairpin RNA (shRNA) for STAT3 and IL-6 down regulated their own and HIV-1 gene expression, signifying that these factors influenced differential HIV-1 gene expression in CBMC than PBMC.

  9. Differentiating Transudative From Exudative Ascites Using Quantitative B-Mode Gray-Scale Ultrasound Histogram.

    PubMed

    Çekiç, Bulent; Toslak, Iclal Erdem; Şahintürk, Yasin; Cekin, Ayhan Hilmi; Koksel, Yasemin Kocabas; Koroglu, Mert; Demos, Terrence C

    2017-08-01

    The purpose of this article is to differentiate exudative from transudative ascites using B-mode gray-scale ultrasound histogram analysis. Sixty-two consecutive patients with ascites were prospectively studied from June 2014 through June 2015. All underwent ultrasound (US) and paracentesis in the radiology department. Five patients were excluded (three with hemorrhage and two with peritoneal carcinomatosis). The remaining 57 patients were divided into those with exudative and transudative ascites according to results of paracentesis. Electronically recorded US images were transferred to a workstation, and gray-scale histograms were generated. The ascites-to-rectus abdominis muscle echogenicity ratio (ARAER) was obtained from ascites adjacent to the rectus abdominis muscle. ROC curves were used to evaluate the sensitivity and specificity of this method in differentiating exudative from transudative ascites. ARAERs for exudative ascites were significantly higher than those for transudative ascites (p < 0.001). ROC was done to evaluate ARAERs for exudative ascites. The best cutoff value for ARAER histogram was 0.002. The sensitivity and specificity of ARAER were 87.5% and 79.2% (AUC = 0.843), respectively. ARAER is an easily applicable noninvasive quantitative sonographic method with high sensitivity and specificity in differentiating exudative from transudative ascites.

  10. Differential expression of growth factors at the cellular level in virus-infected brain

    PubMed Central

    Prosniak, Mikhail; Zborek, Anna; Scott, Gwen S.; Roy, Anirban; Phares, Timothy W.; Koprowski, Hilary; Hooper, D. Craig

    2003-01-01

    The contribution of host factors to rabies virus (RV) transcription/replication and axonal/transsynaptic spread is largely unknown. We previously identified several host genes that are up-regulated in the mouse brain during RV infection, including neuroleukin, which is involved in neuronal growth and survival, cell motility, and differentiation, and fibroblast growth factor homologous factor 4 (FHF4), which has been implicated in limb and nervous system development. In this study, we used real-time quantitative RT-PCR to assess the expression of mRNAs specific for neuroleukin, the two isoforms of FHF4 (FHF4-1a and -1b) encoded by the FHF4 gene, and N protein of RV in neurons and astrocytes isolated by laser capture microdissection from mouse brains infected with the laboratory-adapted RV strain CVS-N2c or with a street RV of silver-haired bat origin. Differences in the gene expression patterns suggest that the capacity of RV strains to infect nonneuronal cells and differentially modulate host gene expression may be important in virus replication and spread in the CNS. PMID:12736376

  11. Identification of differentially expressed genes in parasitic phase Miamiensis avidus (Ciliophora: Scuticociliatia) using suppression subtractive hybridization.

    PubMed

    Lee, Eun Hye; Kim, Ki Hong

    2011-04-06

    Miamiensis avidus, a causative agent of scuticociliatosis in cultured marine fish, can live not only in seawater as a free-living organism but also in fish as a parasite. In this study, a cDNA library of representative mRNAs more specific to parasitic phase M. avidus was generated using suppression subtractive hybridization (SSH), and 520 clones selected from the SSH library were single-run sequenced. The differential gene expression patterns were confirmed by semi-quantitative reverse-transcription PCR. Of the 510 SSH clones, 21 clones of 6 putative genes did not match sequences in the public database. The expectation values (E-values) of 117 clones encoding 9 putative genes were greater than 1 x 10(-5). The other 372 clones that met the criterion of E value <1 x 10-5 were matched to 26 known sequences in the database. Genes associated with signal transduction, cell proliferation, membrane transportation, protein translocation, and transcription regulation were preferentially expressed in parasitic phase M. avidus. The differential gene expression may be needed for the ciliates to survive in the host fish, and the corresponding proteins might be used as antigen candidates for development of scuticociliatosis vaccines.

  12. Differential gene expression identified in Uigur women cervical squamous cell carcinoma by suppression subtractive hybridization.

    PubMed

    Pan, Z; Chen, S; Pan, X; Wang, Z; Han, H; Zheng, W; Wang, X; Li, F; Qu, S; Shao, R

    2010-01-01

    Cervical cancer is one of the most common gynecological cancers worldwide. Over the past decade, much progress has been made in understanding the genetic changes associated with the development and progression of cervical cancer. However, the precise mechanisms of cervical carcinogenesis in Uigur women remain unclear. To screen differential gene expression in squamous cell carcinoma (SCC) of the cervix in Uigur women, suppressive subtractive hybridization (SSH) was performed on the cervical squamous cell carcinoma and corresponding normal cervical tissues of a Uigur patient. Thus we were be able to find the genes that are related with cervical tumors of Uigur women. A total of 300 samples were subject to DNA sequencing analysis and 46 genes were found to express differentially in tumors compared with normal tissues. Of the 46 genes, 24 genes were up-regulated whereas 22 genes were down-regulated in cervical tumors. The expression profiles of 5 of the 46 genes were further confirmed in 15 other Uigur patients by semi-quantitative reverse-transcription polymerase chain reaction. Our results revealed that ACADVL, CEBPB, IFITM1 and DNAJC9 are involved in cervical carcinogenesis.

  13. Oligonucleotide microarray identifies genes differentially expressed during tumorigenesis of DMBA-induced pancreatic cancer in rats.

    PubMed

    Guo, Jun-Chao; Li, Jian; Yang, Ying-Chi; Zhou, Li; Zhang, Tai-Ping; Zhao, Yu-Pei

    2013-01-01

    The extremely dismal prognosis of pancreatic cancer (PC) is attributed, at least in part, to lack of early diagnosis. Therefore, identifying differentially expressed genes in multiple steps of tumorigenesis of PC is of great interest. In the present study, a 7,12-dimethylbenzanthraene (DMBA)-induced PC model was established in male Sprague-Dawley rats. The gene expression profile was screened using an oligonucleotide microarray, followed by real-time quantitative polymerase chain reaction (qRT-PCR) and immunohistochemical staining validation. A total of 661 differentially expressed genes were identified in stages of pancreatic carcinogenesis. According to GO classification, these genes were involved in multiple molecular pathways. Using two-way hierarchical clustering analysis, normal pancreas, acute and chronic pancreatitis, PanIN, early and advanced pancreatic cancer were completely discriminated. Furthermore, 11 upregulated and 142 downregulated genes (probes) were found by Mann-Kendall trend Monotone test, indicating homologous genes of rat and human. The qRT-PCR and immunohistochemistry analysis of CXCR7 and UBe2c, two of the identified genes, confirmed the microarray results. In human PC cell lines, knockdown of CXCR7 resulted in decreased migration and invasion. Collectively, our data identified several promising markers and therapeutic targets of PC based on a comprehensive screening and systemic validation.

  14. Differential gene expression in patients with subsyndromal symptomatic depression and major depressive disorder.

    PubMed

    Yang, Chengqing; Hu, Guoqin; Li, Zezhi; Wang, Qingzhong; Wang, Xuemei; Yuan, Chengmei; Wang, Zuowei; Hong, Wu; Lu, Weihong; Cao, Lan; Chen, Jun; Wang, Yong; Yu, Shunying; Zhou, Yimin; Yi, Zhenghui; Fang, Yiru

    2017-01-01

    Subsyndromal symptomatic depression (SSD) is a subtype of subthreshold depressive and can lead to significant psychosocial functional impairment. Although the pathogenesis of major depressive disorder (MDD) and SSD still remains poorly understood, a set of studies have found that many same genetic factors play important roles in the etiology of these two disorders. Nowadays, the differential gene expression between MDD and SSD is still unknown. In our previous study, we compared the expression profile and made the classification with the leukocytes by using whole-genome cRNA microarrays among drug-free first-episode subjects with SSD, MDD and matched healthy controls (8 subjects in each group), and finally determined 48 gene expression signatures. Based on these findings, we further clarify whether these genes mRNA was different expressed in peripheral blood in patients with SSD, MDD and healthy controls (60 subjects respectively). With the help of the quantitative real-time reverse transcription-polymerase chain reaction (RT-qPCR), we gained gene relative expression levels among the three groups. We found that there are three of the forty eight co-regulated genes had differential expression in peripheral blood among the three groups, which are CD84, STRN, CTNS gene (F = 3.528, p = 0.034; F = 3.382, p = 0.039; F = 3.801, p = 0.026, respectively) while there were no significant differences for other genes. CD84, STRN, CTNS gene may have significant value for performing diagnostic functions and classifying SSD, MDD and healthy controls.

  15. Differential gene expression in patients with subsyndromal symptomatic depression and major depressive disorder

    PubMed Central

    Li, Zezhi; Wang, Qingzhong; Wang, Xuemei; Yuan, Chengmei; Wang, Zuowei; Hong, Wu; Lu, Weihong; Cao, Lan; Chen, Jun; Wang, Yong; Yu, Shunying; Zhou, Yimin; Yi, Zhenghui; Fang, Yiru

    2017-01-01

    Background Subsyndromal symptomatic depression (SSD) is a subtype of subthreshold depressive and can lead to significant psychosocial functional impairment. Although the pathogenesis of major depressive disorder (MDD) and SSD still remains poorly understood, a set of studies have found that many same genetic factors play important roles in the etiology of these two disorders. Nowadays, the differential gene expression between MDD and SSD is still unknown. In our previous study, we compared the expression profile and made the classification with the leukocytes by using whole-genome cRNA microarrays among drug-free first-episode subjects with SSD, MDD and matched healthy controls (8 subjects in each group), and finally determined 48 gene expression signatures. Based on these findings, we further clarify whether these genes mRNA was different expressed in peripheral blood in patients with SSD, MDD and healthy controls (60 subjects respectively) Method With the help of the quantitative real-time reverse transcription-polymerase chain reaction (RT-qPCR), we gained gene relative expression levels among the three groups. Results We found that there are three of the forty eight co-regulated genes had differential expression in peripheral blood among the three groups, which are CD84, STRN, CTNS gene (F = 3.528, p = 0.034; F = 3.382, p = 0.039; F = 3.801, p = 0.026, respectively) while there were no significant differences for other genes. Conclusion CD84, STRN, CTNS gene may have significant value for performing diagnostic functions and classifying SSD, MDD and healthy controls. PMID:28333931

  16. Switch of rhodopsin expression in terminally differentiated Drosophila sensory neurons.

    PubMed

    Sprecher, Simon G; Desplan, Claude

    2008-07-24

    Specificity of sensory neurons requires restricted expression of one sensory receptor gene and the exclusion of all others within a given cell. In the Drosophila retina, functional identity of photoreceptors depends on light-sensitive Rhodopsins (Rhs). The much simpler larval eye (Bolwig organ) is composed of about 12 photoreceptors, eight of which are green-sensitive (Rh6) and four blue-sensitive (Rh5). The larval eye becomes the adult extraretinal 'eyelet' composed of four green-sensitive (Rh6) photoreceptors. Here we show that, during metamorphosis, all Rh6 photoreceptors die, whereas the Rh5 photoreceptors switch fate by turning off Rh5 and then turning on Rh6 expression. This switch occurs without apparent changes in the programme of transcription factors that specify larval photoreceptor subtypes. We also show that the transcription factor Senseless (Sens) mediates the very different cellular behaviours of Rh5 and Rh6 photoreceptors. Sens is restricted to Rh5 photoreceptors and must be excluded from Rh6 photoreceptors to allow them to die at metamorphosis. Finally, we show that Ecdysone receptor (EcR) functions autonomously both for the death of larval Rh6 photoreceptors and for the sensory switch of Rh5 photoreceptors to express Rh6. This fate switch of functioning, terminally differentiated neurons provides a novel, unexpected example of hard-wired sensory plasticity.

  17. Divergent fructokinase genes are differentially expressed in tomato.

    PubMed Central

    Kanayama, Y; Dai, N; Granot, D; Petreikov, M; Schaffer, A; Bennett, A B

    1997-01-01

    Two cDNA clones (Frk1 and Frk2) encoding fructokinase (EC 2.7.1.4) were isolated from tomato (Lycopersicon esculentum). The Frk2 cDNA encoded a deduced protein of 328 amino acids that was more than 90% identical with a previously characterized potato (Solanum tuberosum) fructokinase. In contrast, the Frk1 cDNA encoded a deduced protein of 347 amino acids that shared only 55% amino acid identity with Frk2. Both deduced proteins possessed and ATP-binding motif and putative substrate recognition site sequences identified in bacterial fructokinases. The Frk1 cDNA was expressed in a mutant yeast (Saccharomyces cerevisiae) line, which lacks the ability to phosphorylate glucose and fructose and is unable to grow on glucose or fructose. Mutant cells expressing Frk1 were complemented to grow on fructose but not glucose, indicating that Frk1 phosphorylates fructose but not glucose, and this activity was verified in extracts of transformed yeast. The mRNA corresponding to Frk2 accumulated to high levels in young, developing tomato fruit, whereas the Frk1 mRNA accumulated to higher levels late in fruit development. The results indicate that fructokinase in tomato is encoded by two divergent genes, which exhibit a differential pattern of expression during fruit development. PMID:9112782

  18. Differential expression of ribosome-inactivating protein genes during somatic embryogenesis in spinach (Spinacia oleracea).

    PubMed

    Kawade, Kensuke; Ishizaki, Takuma; Masuda, Kiyoshi

    2008-10-01

    Root segments from spinach (Spinacia oleracea L. cv. Jiromaru) seedlings form embryogenic callus (EC) that responded to exogenous GA(3) by accumulating a 31-kDa glycoprotein [BP31 or S. oleracea ribosome-inactivating protein (EC 3.2.2.22) (SoRIP1)] in association with the expression of embryogenic potential. Microsequencing of this protein revealed significant similarity with type 1 RIPs. We identified cDNAs for SoRIP1 and S. oleracea RIP2 (SoRIP2), a novel RIP having a consensus shiga/ricin toxic domain and performed a comparative analysis of the expression of SoRIPs during somatic embryogenesis. Western blotting and quantitative polymerase chain reaction analyses revealed that the expression of SoRIP1 in calli increased remarkably in association with the acquisition of embryogenic potential, although the expression in somatic embryos decreased moderately with their development. However, the expression of SoRIP2 in calli remained low and constant but increased markedly with the development of somatic embryos. Treatment of callus with GA(3) and/or ABA for 24 h, or with ABA for a longer period, failed to stimulate the expression of either gene. Immunohistochemistry showed that SoRIP1 preferentially accumulated in the proembryos and peripheral meristem of somatic embryos early in development. Appreciable expression of SoRIP2 was not detected in the callus, but intense expression was found in the epidermis of somatic embryos. These results suggest that the expression of spinach RIP genes is differentially regulated in a development-dependent fashion during somatic embryogenesis in spinach.

  19. Analysis of differentially co-expressed genes based on microarray data of hepatocellular carcinoma.

    PubMed

    Wang, Y; Jiang, T; Li, Z; Lu, L; Zhang, R; Zhang, D; Wang, X; Tan, J

    2017-01-01

    Hepatocellular carcinoma (HCC) is the third leading cause of cancer related death worldwide. Although great progress in diagnosis and management of HCC have been made, the exact molecular mechanisms remain poorly understood. The study aims to identify potential biomarkers for HCC progression, mainly at transcription level. In this study, chip data GSE 29721 was utilized, which contains 10 HCC samples and 10 normal adjacent tissue samples. Differentially expressed genes (DEGs) between two sample types were selected by t-test method. Following, the differentially co-expressed genes (DCGs) and differentially co-expressed Links (DCLs) were identified by DCGL package in R with the threshold of q < 0.25. Afterwards, pathway enrichment analysis of the DCGs was carried out by DAVID. Then, DCLs were mapped to TRANSFAC database to reveal associations between relevant transcriptional factors (TFs) and their target genes. Quantitative real-time RT-PCR was performed for TFs or genes of interest. As a result, a total of 388 DCGs and 35,771 DCLs were obtained. The predominant pathways enriched by these genes were Cytokine-cytokine receptor interaction, ECM-receptor interaction and TGF-β signaling pathway. Three TF-target interactions, LEF1-NCAM1, EGR1-FN1 and FOS-MT2A were predicted. Compared with control, expressions of the TF genes EGR1, FOS and ETS2 were all up-regulated in the HCC cell line, HepG2; while LEF1 was down-regulated. Except NCAM1, all the target genes were up-regulated in HepG2. Our findings suggest these TFs and genes might play important roles in the pathogenesis of HCC and may be used as therapeutic targets for HCC management.

  20. Differential neuroglycan C expression during retinal degeneration in Rpe65−/− mice

    PubMed Central

    Cottet, Sandra; Aono, Saichiko; Oohira, Atsuhiko; Schorderet, Daniel F.

    2008-01-01

    Purpose An increased mRNA expression of the genes coding for the extracellular matrix proteins neuroglycan C (NGC), interphotoreceptor matrix proteoglycan 2 (IMPG2), and CD44 antigen (CD44) has been observed during retinal degeneration in mice with a targeted disruption of the Rpe65 gene (Rpe65−/− mouse). To validate these data, we analyzed this differential expression in more detail by characterizing retinal NGC mRNA isoform and protein expression during disease progression. Methods Retinas from C57/Bl6 wild-type and Rpe65−/− mice, ranging 2 to 18 months of age, were used. NGC, IMPG2, and CD44 mRNA expression was assessed by oligonucleotide microarray, quantitative PCR, and in situ hybridization. Retinal NGC protein expression was analyzed by western blot and immunohistochemistry. Results As measured by quantitative PCR, mRNA expression of NGC and CD44 was induced by about 2 fold to 3 fold at all time points in Rpe65−/− retinas, whereas initially 4 fold elevated IMPG2 mRNA levels progressively declined. NGC and IMPG2 mRNAs were expressed in the ganglion cell layer, the inner nuclear layer, and at the outer limiting membrane. NGC mRNA was also detected in retinal pigment epithelium cells (RPE), where its mRNA expression was not induced during retinal degeneration. NGC-I was the major isoform detected in the retina and the RPE, whereas NGC-III was barely detected and NGC-II could not be assessed. NGC protein expression was at its highest levels on the apical membrane of the RPE. NGC protein levels were induced in retinas from 2- and 4-month-old Rpe65−/− mice, and an increased amount of the activity-cleaved NGC ectodomain containing an epidermal growth factor (EGF)-like domain was detected. Conclusions During retinal degeneration in Rpe65−/− mice, NGC expression is induced in the neural retina, but not in the RPE, where NGC is expressed at highest levels. PMID:19050768

  1. Differential Gene Expression in Foxtail Millet during Incompatible Interaction with Uromyces setariae-italicae

    PubMed Central

    Dong, Li; Bai, Hui; Quan, Jian Zhang; Liu, Lei; Dong, Zhi-Ping

    2015-01-01

    Foxtail millet (Setaria italica) is an important food and fodder grain crop that is grown for human consumption. Production of this species is affected by several plant diseases, such as rust. The cultivar Shilixiang has been identified as resistant to the foxtail millet rust pathogen, Uromyces setariae-italicae. In order to identify signaling pathways and genes related to the plant’s defense mechanisms against rust, the Shilixiang cultivar was used to construct a digital gene expression (DGE) library during the interaction of foxtail millet with U. setariae-italicae. In this study, we determined the most abundant differentially expressed signaling pathways of up-regulated genes in foxtail millet and identified significantly up-regulated genes. Finally, quantitative real-time polymerase chain reaction (qRT-PCR) analysis was used to analyze the expression of nine selected genes, and the patterns observed agreed well with DGE analysis. Expression levels of the genes were also compared between a resistant cultivar Shilixiang and a susceptible cultivar Yugu-1, and the result indicated that expression level of Shilixiang is higher than that of Yugu-1. This study reveals the relatively comprehensive mechanisms of rust-responsive transcription in foxtail millet. PMID:25885767

  2. Quantification of differentially expressed genes in Daphnia magna exposed to rubber wastewater.

    PubMed

    Jo, Hun-Je; Jung, Jinho

    2008-09-01

    In this study, differentially expressed genes (DEGs) were investigated in Daphnia magna exposed to rubber wastewater using an annealing control primer (ACP)-based polymerase chain reaction (PCR) and real-time PCR. Among three identified DEGs, two genes (DEG1 and DEG2) were up-regulated, and DEG1 expression was well-correlated to a logarithm of rubber wastewater concentration (r2=0.971, p<0.0001). In addition, DEG1 expression in D. magna exposed to rubber wastewater was strongly correlated with that of D. magna exposed to Zn (r2=0.9513, p<0.05), suggesting that the induction of DEG1 was caused by Zn, which is the dominant toxicant in rubber wastewater. In addition, DEG1 expression was more sensitive to toxicants than immobility, which is the conventional endpoint in toxicity tests using D. magna. The lowest observed effect concentrations (LOEC) determined using immobility tests were 2.5% for rubber wastewater and 1.6mgl(-1) for Zn. In contrast, a significant increase in DEG1 expression was observed at exposure concentrations of as low as 0.6% rubber wastewater and 0.2mgl(-1) Zn. These results indicate that DEG1 is a sensitive and quantitative biomarker of water and wastewater containing Zn.

  3. Differential pattern of integrin receptor expression in differentiated and anaplastic thyroid cancer cell lines.

    PubMed

    Hoffmann, S; Maschuw, K; Hassan, I; Reckzeh, B; Wunderlich, A; Lingelbach, S; Zielke, A

    2005-09-01

    Adhesion of tumor cells to the extracellular matrix (ECM) is a crucial step for the development of metastatic disease and is mediated by specific integrin receptor molecules (IRM). The pattern of metastatic spread differs substantially among the various histotypes of thyroid cancer (TC). However, IRM have only occasionally been characterized in TC until now. IRM expression was investigated in 10 differentiated (FTC133, 236, 238, HTC, HTC TSHr, XTC, PTC4.0/4.2, TPC1, Kat5) and two anaplastic TC cell lines (ATC, C643, Hth74), primary cultures of normal thyroid tissue (Thy1,3), and thyroid cancer specimens (TCS). Expression of 16 IRM (beta1-4, beta7, alpha1-6, alphaV, alphaIIb, alphaL, alphaM, alphaX) and of four IRM heterodimers (alpha2beta1, alpha5beta1, alphaVbeta3, alphaVbeta5), was analyzed by fluorescent-activated cell sorter (FACS) and immunohistochemical staining. Thyroid tumor cell adhesion to ECM proteins and their IRM expression in response to thyrotropin (TSH) was assessed. Follicular TC cell lines presented high levels of integrins alpha2, alpha3, alpha5, beta1, beta3 and low levels of alpha1, whereas papillary lines expressed a heterogenous pattern of IRM, dominated by alpha5 and beta1. ATC mainly displayed integrins alpha2, alpha3, alpha5, alpha6, beta1 and low levels of alpha1, alpha4 and alphaV. Integrin heterodimers correlated with monomer expression. Evaluation of TCS largely confirmed these results with few exceptions, namely alpha4, alpha6, and beta3. The ability of TC cell lines to adhere to purified ECM proteins correlated with IRM expression. TSH induced TC cell adhesion in a dose-dependent fashion, despite an unchanged array of IRM expression or level of a particular IRM. Thyroid carcinoma cell lines of different histogenetic background display profoundly different patterns of IRM expression that appear to correlate with tumor aggressiveness. In vitro adhesion to ECM proteins and IRM expression concur. Finally, TSH-stimulated adhesion of

  4. Information theory, gene expression, and combinatorial regulation: a quantitative analysis.

    PubMed

    Jost, Jürgen; Scherrer, Klaus

    2014-03-01

    According to a functional definition of the term "gene", a protein-coding gene corresponds to a polypeptide and, hence, a coding sequence. It is therefore as such not yet present at the DNA level, but assembled from possibly heterogeneous pieces in the course of RNA processing. Assembly and regulation of genes require, thus, information about when and in which quantity specific polypeptides are to be produced. To assess this, we draw upon precise biochemical data. On the basis of our conceptual framework, we also develop formal models for the coordinated expression of specific sets of genes through the interaction of transcripts and mRNAs and with proteins via a precise putative regulatory code. Thus, the nucleotides in transcripts and mRNA are not only arranged into amino acid-coding triplets, but at the same time may participate in regulatory oligomotifs that provide binding sites for specific proteins. We can then quantify and compare product and regulatory information involved in gene expression and regulation.

  5. Phylogenetic ANOVA: The Expression Variance and Evolution Model for Quantitative Trait Evolution.

    PubMed

    Rohlfs, Rori V; Nielsen, Rasmus

    2015-09-01

    A number of methods have been developed for modeling the evolution of a quantitative trait on a phylogeny. These methods have received renewed interest in the context of genome-wide studies of gene expression, in which the expression levels of many genes can be modeled as quantitative traits. We here develop a new method for joint analyses of quantitative traits within- and between species, the Expression Variance and Evolution (EVE) model. The model parameterizes the ratio of population to evolutionary expression variance, facilitating a wide variety of analyses, including a test for lineage-specific shifts in expression level, and a phylogenetic ANOVA that can detect genes with increased or decreased ratios of expression divergence to diversity, analogous to the famous Hudson Kreitman Aguadé (HKA) test used to detect selection at the DNA level. We use simulations to explore the properties of these tests under a variety of circumstances and show that the phylogenetic ANOVA is more accurate than the standard ANOVA (no accounting for phylogeny) sometimes used in transcriptomics. We then apply the EVE model to a mammalian phylogeny of 15 species typed for expression levels in liver tissue. We identify genes with high expression divergence between species as candidates for expression level adaptation, and genes with high expression diversity within species as candidates for expression level conservation and/or plasticity. Using the test for lineage-specific expression shifts, we identify several candidate genes for expression level adaptation on the catarrhine and human lineages, including genes putatively related to dietary changes in humans. We compare these results to those reported previously using a model which ignores expression variance within species, uncovering important differences in performance. We demonstrate the necessity for a phylogenetic model in comparative expression studies and show the utility of the EVE model to detect expression divergence

  6. Identification of differentially expressed circular RNAs in human colorectal cancer.

    PubMed

    Zhang, Peili; Zuo, Zhigui; Shang, Wenjing; Wu, Aihua; Bi, Ruichun; Wu, Jianbo; Li, Shaotang; Sun, Xuecheng; Jiang, Lei

    2017-03-01

    Circular RNA, a class of non-coding RNA, is a new group of RNAs and is related to tumorigenesis. Circular RNAs are suggested to be ideal candidate biomarkers with potential diagnostic and therapeutic implications. However, little is known about their expression in human colorectal cancer. In our study, differentially expressed circular RNAs were detected using circular RNA array in paired tumor and adjacent non-tumorous tissues from six colorectal cancer patients. Expression levels of selected circular RNAs (hsa_circRNA_103809 and hsa_circRNA_104700) were measured by real-time polymerase chain reaction in 170 paired colorectal cancer samples for validation. Statistical analyses were conducted to investigate the association between hsa_circRNA_103809 and hsa_circRNA_104700 expression levels and respective patient clinicopathological features. Receiver operating characteristic curve was constructed to evaluate the diagnostic values. Our results indicated that there were 125 downregulated and 76 upregulated circular RNAs in colorectal cancer tissues compared with normal tissues. We also first demonstrated that the expression levels of hsa_circRNA_103809 ( p < 0.0001) and hsa_circRNA_104700 ( p = 0.0003) were significantly lower in colorectal cancer than in normal tissues. The expression level of hsa_circRNA_103809 was significantly correlated with lymph node metastasis ( p = 0.021) and tumor-node-metastasis stage ( p = 0.011), and the expression level of hsa_circRNA_104700 was significantly correlated with distal metastasis ( p = 0.036). The area under receiver operating characteristic curves of hsa_circRNA_103809 and hsa_circRNA_104700 were 0.699 ( p < 0.0001) and 0.616 ( p < 0.0001), respectively. In conclusion, these results suggest that hsa_circRNA_103809 and hsa_circRNA_104700 may be potentially involved in the development of colorectal cancer and serve as potential biomarkers for the diagnosis of colorectal cancer.

  7. Differential Shannon entropy and differential coefficient of variation: alternatives and augmentations to differential expression in the search for disease-related genes.

    PubMed

    Wang, Kai; Phillips, Charles A; Rogers, Gary L; Barrenas, Fredrik; Benson, Mikael; Langston, Michael A

    2014-01-01

    Differential expression has been a standard tool for analysing case-control transcriptomic data since the advent of microarray technology. It has proved invaluable in characterising the molecular mechanisms of disease. Nevertheless, the expression profile of a gene across samples can be perturbed in ways that leave the expression level unaltered, while a biological effect is nonetheless present. This paper describes and analyses differential Shannon entropy and differential coefficient of variation, two alternate techniques for identifying genes of interest. Ontological analysis across 16 human disease datasets demonstrates that these alternatives are effective at identifying disease-related genes not found by mere differential expression alone. Because the two alternate techniques are based on somewhat different mathematical formulations, they tend to produce somewhat different gene lists. Moreover, each may pinpoint genes completely overlooked by the other. Thus, measures of entropy and variation can be used to replace or better yet augment standard differential expression computations.

  8. Differential expression of endocannabinoid system-related genes in the dorsal hippocampus following expression and reinstatement of morphine conditioned place preference in mice.

    PubMed

    Li, Wei; Zhang, Cong-Li; Qiu, Zheng-Guo

    2017-03-16

    The endocannabinoid signaling plays a critical role in mediating rewarding effects to morphine. The relative stability for the expression and reinstatement of morphine conditioned place preference (CPP) suggests the involvement of differential neuroadaptations in learned associations between environmental cues and morphine. Changes in gene expression in hippocampus through the endogenous cannabinoid system (eCB) may accompany and mediate the development of such neuroadaptations to repeated morphine stimulation. To test this possibility, we systematically compared the expression of eCB-related genes in the dorsal hippocampus following the expression, extinction, and reinstatement of morphine CPP using quantitative RT-PCR analyses. We found that expression of morphine CPP was associated with significant increases in mRNA expression for the primary clearance routes for anandamide (AEA) and 2-AG (fatty acid amide hydrolase [FAAH] and monoacylglycerol lipase [MAGL], respectively), but with reductions in cannabinoid 1 receptors (CB1R) and CB2R in dorsal hippocampus following the expression of CPP. However, our results indicated that decreased in MAGL and increased CB1R mRNA levels were accompanied with morphine CPP reinstatement. No significant changes in mRNA expression for enzymes involved in AEA and 2-AG biosynthesis (N-acylphosphatidylethanolamine phospholipase D [NAPEPLD] and diacylglycerol lipase-α/β [DAGLα/β], respectively) were found in all conditions. These results suggest that differential regulation of the synthesis and/or degradation of the eCB system contribute to the expression and reinstatement of morphine CPP.

  9. Differentially expressed profiles in the larval testes of Wolbachia infected and uninfected Drosophila

    PubMed Central

    2011-01-01

    Background Wolbachia are endosymbiotic bacteria that are frequently found in arthropods and nematodes. These maternally inherited bacteria manipulate host reproduction by several mechanisms including cytoplasmic incompatibility (CI). CI is the most common phenotype induced by Wolbachia and results in the developmental arrest of embryos derived from crosses between Wolbachia-infected males and uninfected females. Although the molecular mechanisms of CI are currently unknown, several studies suggest that host sperm is modified by Wolbachia during spermatogenesis. Results We compared the gene expression of Drosophila melanogaster larval testes with and without the wMel strain of Wolbachia to identify candidate genes that could be involved in the interaction between Wolbachia and the insect host. Microarray, quantitative RT-PCR and in situ hybridization analyses were carried out on D. melanogaster larval testes to determine the effect of Wolbachia infection on host gene expression. A total of 296 genes were identified by microarray analysis to have at least a 1.5 fold change [q-value < 5%] in expression. When comparing Wolbachia-infected flies to uninfected flies, 167 genes were up-regulated and 129 genes down-regulated. Differential expression of genes related to metabolism, immunity, reproduction and other functions were observed. Quantitative RT-PCR (qRT-PCR) confirmed 12 genes are differentially expressed in the testes of the 3rd instar larvae of Wolbachia-infected and uninfected flies. In situ hybridization demonstrated that Wolbachia infection changes the expression of several genes putatively associated with spermatogenesis including JH induced protein-26 and Mst84Db, or involved in immune (kenny) or metabolism (CG4988-RA). Conclusions Wolbachia change the gene expression of 296 genes in the larval testes of D. melanogaster including genes related to metabolism, immunity and reproduction. Interestingly, most of the genes putatively involved in immunity were up

  10. Screening and identification of differentially expressed genes in goose hepatocytes exposed to free fatty acid.

    PubMed

    Pan, Zhixiong; Wang, Jiwen; Kang, Bo; Lu, Lizhi; Han, Chunchun; Tang, Hui; Li, Liang; Xu, Feng; Zhou, Zehui; Lv, Jia

    2010-12-15

    The overaccumulation of triglycerides in hepatocytes induces hepatic steatosis; however, little is known about the mechanism of goose hepatic steatosis. The aim of this study was to define an experimental model of hepatocellular steatosis with TG overaccumulation and minimal cytotoxicity, using a mixture of various proportions of oleate and palmitate free fatty acids (FFAs) to induce fat-overloading, then using suppressive subtractive hybridization and a quantitative PCR approach to identify genes with higher or lower expression levels after the treatment of cells with FFA mixtures. Overall, 502 differentially expressed clones, representing 21 novel genes and 87 known genes, were detected by SSH. Based on functional clustering, up- and down-regulated genes were mostly related to carbohydrate and lipid metabolism, enzyme activity and signal transduction. The expression of 20 selected clones involved with carbohydrate and lipid metabolism pathways was further studied by quantitative PCR. The data indicated that six clones similar to the genes ChREBP, FoxO1, apoB, IHPK2, KIF1B, and FSP27, which participate in de novo synthesis of fatty acid and secretion of very low density lipoproteins, had significantly lower expression levels in the hepatocytes treated with FFA mixtures. Meanwhile, 13 clones similar to the genes DGAT-1, ACSL1, DHRS7, PPARα, L-FABP, DGAT-2, PCK, ACSL3, CPT-1, A-FABP, PPARβ, MAT, and ALDOB had significantly higher expression levels in the hepatocytes treated with FFA mixtures. These results suggest that several metabolic pathways are altered in goose hepatocytes, which may be useful for further research into the molecular mechanism of goose hepatic steatosis.

  11. Quantitative large scale gene expression profiling from human stem cell culture micro samples using multiplex pre-amplification.

    PubMed

    Kibschull, Mark; Lye, Stephen J; Okino, Steven T; Sarras, Haya

    2016-01-01

    Transcriptional profiling is a powerful tool to study biological mechanisms during stem cell differentiation and reprogramming. Genome-wide methods like microarrays or next generation sequencing are expensive, time consuming, and require special equipment and bioinformatics expertise. Quantitative RT-PCR remains one of today's most widely accepted and used methods for analyzing gene expression in biological samples. However, limitations in the amount of starting materials often hinder the quantity and quality of information that could be obtained from a given sample. Here, we present a fast 4-step workflow allowing direct, column-free RNA isolation from limited human pluripotent stem cell (hPSC) cultures that is directly compatible with subsequent reverse transcription, target specific multiplex pre-amplification, and standard SYBR-Green quantitative PCR (qPCR) analysis. The workflow delivers excellent correlations in normalized gene-expression data obtained from different samples of hPSCs over a wide range of cell numbers (500-50,000 cells). We demonstrate accurate and unbiased target gene quantification in limiting stem cell cultures which allows for monitoring embryoid body differentiation and induced pluripotent stem cell (iPSC) reprogramming. This method highlights a rapid and cost effective screening process, allowing reduction of culture formats and increase of processing throughputs for various stem cell applications.

  12. Differential proteomic and tissue expression analyses identify valuable diagnostic biomarkers of hepatocellular differentiation and hepatoid adenocarcinomas.

    PubMed

    Reis, Henning; Padden, Juliet; Ahrens, Maike; Pütter, Carolin; Bertram, Stefanie; Pott, Leona L; Reis, Anna-Carinna; Weber, Frank; Juntermanns, Benjamin; Hoffmann, Andreas-C; Eisenacher, Martin; Schlaak, Joörg F; Canbay, Ali; Meyer, Helmut E; Sitek, Barbara; Baba, Hideo A

    2015-10-01

    The exact discrimination of lesions with true hepatocellular differentiation from secondary tumours and neoplasms with hepatocellular histomorphology like hepatoid adenocarcinomas (HAC) is crucial. Therefore, we aimed to identify ancillary protein biomarkers by using complementary proteomic techniques (2D-DIGE, label-free MS). The identified candidates were immunohistochemically validated in 14 paired samples of hepatocellular carcinoma (HCC) and non-tumourous liver tissue (NT). The candidates and HepPar1/Arginase1 were afterwards tested for consistency in a large cohort of hepatocellular lesions and NT (n = 290), non-hepatocellular malignancies (n = 383) and HAC (n = 13). Eight non-redundant, differentially expressed proteins were suitable for further immunohistochemical validation and four (ABAT, BHMT, FABP1, HAOX1) for further evaluation. Sensitivity and specificity rates for HCC/HAC were as follows: HepPar1 80.2%, 94.3% / 80.2%, 46.2%; Arginase1 82%, 99.4% / 82%, 69.2%; BHMT 61.4%, 93.8% / 61.4%, 100%; ABAT 84.4%, 33.7% / 84.4%, 30.8%; FABP1 87.2%, 95% / 87.2%, 69.2%; HAOX1 95.5%, 36.3% / 95.5%, 46.2%. The best 2×/3× biomarker panels for the diagnosis of HCC consisted of Arginase1/HAOX1 and BHMT/Arginase1/HAOX1 and for HAC consisted of Arginase1/FABP1 and BHMT/Arginase1/FABP1. In summary, we successfully identified, validated and benchmarked protein biomarker candidates of hepatocellular differentiation. BHMT in particular exhibited superior diagnostic characteristics in hepatocellular lesions and specifically in HAC. BHMT is therefore a promising (panel based) biomarker candidate in the differential diagnostic process of lesions with hepatocellular aspect.

  13. Molecular identification and expression of the Foxl2 gene during gonadal sex differentiation in northern snakehead Channa argus.

    PubMed

    Wang, Dan-Dan; Zhang, Gui-Rong; Wei, Kai-Jian; Ji, Wei; Gardner, Jonathan P A; Yang, Rui-Bin; Chen, Kun-Ci

    2015-12-01

    Channa argus is one of the most commercially important fish species in China. Studies show that males of C. argus grow faster than females at the same age. In order to explore the sex differentiation mechanism of C. argus, we isolated the full length of the sex-related gene Foxl2 cDNA and analysed its expression patterns during gonadal sex differentiation. Alignment of known Foxl2 amino acid sequences from vertebrates confirmed the conservation of the Foxl2 open reading frame, especially the forkhead domain and C-terminal region. Quantitative RT-PCR revealed that Foxl2 is predominantly expressed in brain, pituitary, gill and ovary, with its highest level in ovary but low levels in testis and other tissues, reflecting a potential role for Foxl2 in the brain-pituitary-gonad axis in C. argus. Our ontogenetic stage data showed that C. argus Foxl2 expression was significantly upregulated from 1 to 11 days posthatching (dph) and that the initiation of expression preceded the first anatomical ovarian differentiation (27 dph), suggesting that Foxl2 might play a potential role in early gonadal sex differentiation in C. argus. In addition, the Foxl2 protein was primarily located in granulosa cells surrounding the oocytes of mature C. argus, implying that Foxl2 may have a basic function in granulosa cell differentiation and the maintenance of oocytes.

  14. Differential expression of CD14, CD36 and the LDL receptor on human monocyte-derived macrophages. A novel cell culture system to study macrophage differentiation and heterogeneity.

    PubMed

    Wintergerst, E S; Jelk, J; Asmis, R

    1998-09-01

    Macrophages are key players in many aspects of human physiology and disease. It has been hypothesized that in a given microenvironment monocytes differentiate into specific subpopulations with distinct functions. In order to study the role of macrophage heterogeneity in atherogenesis, we established a novel isolation and culture technique for human monocyte-derived macrophages. The present technique does not select for monocyte subpopulations prior to the onset of differentiation. Monocytes were cultured for 2 weeks in the presence of autologous lymphocytes before being plated quantitatively. They differentiated into mature macrophages in terms of morphology, lipid composition, and biological activity. Based on phagocytic activity as well as on the expression of CD14, CD36, and the low-density lipoprotein (LDL) receptor, we have identified macrophage subpopulations that may play distinct roles in atherogenesis. While virtually all adherence-purified monocytes expressed CD14, CD36, and the LDL-R, we characterized three subpopulations of macrophages based on the expression of these antigens: CD36+CD14-LDL-R-(58+/-12%), CD36+CD14+LDL-R+(18+/-5%), the remaining cells being CD36-CD14- LDL-R-. The first two subsets decreased in size during further differentiation (51+/-12% and 8+/-3%, respectively). Our culture technique may also serve as a good model for studying the implications of macrophage heterogeneity in diseases other than atherosclerosis.

  15. Differential expression of interleukin-1/Toll-like receptor signaling regulators in microscopic and ulcerative colitis.

    PubMed

    Günaltay, Sezin; Nyhlin, Nils; Kumawat, Ashok Kumar; Tysk, Curt; Bohr, Johan; Hultgren, Olof; Hultgren Hörnquist, Elisabeth

    2014-09-14

    To investigate Toll-like receptor (TLR) signaling regulators in microscopic and ulcerative colitis patients. Total RNA and microRNA were isolated from fresh frozen colonic biopsies of non-inflamed controls and patients with active or in-remission collagenous colitis (CC), lymphocytic colitis (LC), or ulcerative colitis (UC). We compared expressions of interleukin-1 receptor-associated kinase (IRAK)-2, IRAK-M, interleukin (IL)-37, microRNA (miR)-146a, miR-155, and miR-21 using quantitative real time reverse transcription polymerase chain reaction. IRAK-M expression was increased in LC patients with active disease in histopathological remission (LC-HR; P = 0.02) and UC patients (P = 0.01), but no differences in IRAK-2 expression were detected compared to controls. miR-146a, -155 and -21 expressions were increased in LC-HR (P = 0.04, 0.07, and 0.004) and UC (P = 0.02, 0.04 and 0.03) patients. miR-146a and miR-21 expressions were significantly enhanced in UC patients compared to UC remission (UC-R; P = 0.01 and 0.04). Likewise, active CC patients showed significantly increased expression of miR-155 (P = 0.003) and miR-21 (P = 0.006). IL-37 expression was decreased in both CC (P = 0.03) and LC (P = 0.04) patients with a similar trend in UC patients but not statistically significant, whilst it was increased in UC-R patients compared to controls (P = 0.02) and active UC (P = 0.001). The identification of differentially expressed miRNAs, IL-37, and IRAK-M suggests different pathophysiologic mechanisms in various disease stages in LC, CC, and UC.

  16. Differential expression of interleukin-1/Toll-like receptor signaling regulators in microscopic and ulcerative colitis

    PubMed Central

    Günaltay, Sezin; Nyhlin, Nils; Kumawat, Ashok Kumar; Tysk, Curt; Bohr, Johan; Hultgren, Olof; Hultgren Hörnquist, Elisabeth

    2014-01-01

    AIM: To investigate Toll-like receptor (TLR) signaling regulators in microscopic and ulcerative colitis patients. METHODS: Total RNA and microRNA were isolated from fresh frozen colonic biopsies of non-inflamed controls and patients with active or in-remission collagenous colitis (CC), lymphocytic colitis (LC), or ulcerative colitis (UC). We compared expressions of interleukin-1 receptor-associated kinase (IRAK)-2, IRAK-M, interleukin (IL)-37, microRNA (miR)-146a, miR-155, and miR-21 using quantitative real time reverse transcription polymerase chain reaction. RESULTS: IRAK-M expression was increased in LC patients with active disease in histopathological remission (LC-HR; P = 0.02) and UC patients (P = 0.01), but no differences in IRAK-2 expression were detected compared to controls. miR-146a, -155 and -21 expressions were increased in LC-HR (P = 0.04, 0.07, and 0.004) and UC (P = 0.02, 0.04 and 0.03) patients. miR-146a and miR-21 expressions were significantly enhanced in UC patients compared to UC remission (UC-R; P = 0.01 and 0.04). Likewise, active CC patients showed significantly increased expression of miR-155 (P = 0.003) and miR-21 (P = 0.006). IL-37 expression was decreased in both CC (P = 0.03) and LC (P = 0.04) patients with a similar trend in UC patients but not statistically significant, whilst it was increased in UC-R patients compared to controls (P = 0.02) and active UC (P = 0.001). CONCLUSION: The identification of differentially expressed miRNAs, IL-37, and IRAK-M suggests different pathophysiologic mechanisms in various disease stages in LC, CC, and UC. PMID:25232259

  17. Quantitative Changes in Gimap3 and Gimap5 Expression Modify Mitochondrial DNA Segregation in Mice

    PubMed Central

    Jokinen, Riikka; Lahtinen, Taina; Marttinen, Paula; Myöhänen, Maarit; Ruotsalainen, Pilvi; Yeung, Nicolas; Shvetsova, Antonina; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Öhman, Tiina; Nyman, Tuula A.; Weiler, Hartmut; Battersby, Brendan J.

    2015-01-01

    Mammalian mitochondrial DNA (mtDNA) is a high-copy maternally inherited genome essential for aerobic energy metabolism. Mutations in mtDNA can lead to heteroplasmy, the co-occurence of two different mtDNA variants in the same cell, which can segregate in a tissue-specific manner affecting the onset and severity of mitochondrial dysfunction. To investigate mechanisms regulating mtDNA segregation we use a heteroplasmic mouse model with two polymorphic neutral mtDNA haplotypes (NZB and BALB) that displays tissue-specific and age-dependent selection for mtDNA haplotypes. In the hematopoietic compartment there is selection for the BALB mtDNA haplotype, a phenotype that can be modified by allelic variants of Gimap3. Gimap3 is a tail-anchored member of the GTPase of the immunity-associated protein (Gimap) family of protein scaffolds important for leukocyte development and survival. Here we show how the expression of two murine Gimap3 alleles from Mus musculus domesticus and M. m. castaneus differentially affect mtDNA segregation. The castaneus allele has incorporated a uORF (upstream open reading frame) in-frame with the Gimap3 mRNA that impairs translation and imparts a negative effect on the steady-state protein abundance. We found that quantitative changes in the expression of Gimap3 and the paralogue Gimap5, which encodes a lysosomal protein, affect mtDNA segregation in the mouse hematopoietic tissues. We also show that Gimap3 localizes to the endoplasmic reticulum and not mitochondria as previously reported. Collectively these data show that the abundance of protein scaffolds on the endoplasmic reticulum and lysosomes are important to the segregation of the mitochondrial genome in the mouse hematopoietic compartment. PMID:25808953

  18. Relation between qualitative and quantitative 3-dimensional ultrasound and ki-67 expression in breast cancer.

    PubMed

    Wang, Xiao-Yan; Zhang, Bing; He, Yan; Ning, Bing; Nong, Mei-Fen; Wei, Hai-Ming; Huang, Xiang-Hong

    2015-01-01

    To investigate the relation between quantitative blood flow parameters on 3-dimensional (3D) color histogram, 3D ultrasound characteristics and Ki-67 expression in breast cancer. Three-dimensional ultrasound characteristics and histological classifications of 76 breast tumors in 75 confirmed cases were analyzed. Relations of tumor volume (V), vascularization index (VI), flow index (FI) and vascularization-flow index (VFI) on 3D color histogram to Ki-67 expression were studied by statistical methods. VI and VFI measurements of tumors in positive Ki-67 expression group were obviously increased compared with the negative expression group (P<0.05). V and FI measurements of positive expression group were higher than those of the negative expression group, but the difference was not significant (P>0.05). Cases showing positive expression of Ki-67 were more likely to have lymph node metastases (P<0.05), and Ki-67 expression positively correlated with histological classification (P<0.05). However, the two groups did not show significant differences in the findings of "sun-like symptom" (P>0.05). Qualitative and quantitative 3D ultrasound characteristics correlated with positive expression of Ki-67 in breast cancer. Quantitative analysis with 3D color histogram more accurately evaluates blood supply of breast tumors, providing references for predicting biological behaviors and prognosis of breast cancer.

  19. Quantitative assessment of gene expression network module-validation methods.

    PubMed

    Li, Bing; Zhang, Yingying; Yu, Yanan; Wang, Pengqian; Wang, Yongcheng; Wang, Zhong; Wang, Yongyan

    2015-10-16

    Validation of pluripotent modules in diverse networks holds enormous potential for systems biology and network pharmacology. An arising challenge is how to assess the accuracy of discovering all potential modules from multi-omic networks and validating their architectural characteristics based on innovative computational methods beyond function enrichment and biological validation. To display the framework progress in this domain, we systematically divided the existing Computational Validation Approaches based on Modular Architecture (CVAMA) into topology-based approaches (TBA) and statistics-based approaches (SBA). We compared the available module validation methods based on 11 gene expression datasets, and partially consistent results in the form of homogeneous models were obtained with each individual approach, whereas discrepant contradictory results were found between TBA and SBA. The TBA of the Zsummary value had a higher Validation Success Ratio (VSR) (51%) and a higher Fluctuation Ratio (FR) (80.92%), whereas the SBA of the approximately unbiased (AU) p-value had a lower VSR (12.3%) and a lower FR (45.84%). The Gray area simulated study revealed a consistent result for these two models and indicated a lower Variation Ratio (VR) (8.10%) of TBA at 6 simulated levels. Despite facing many novel challenges and evidence limitations, CVAMA may offer novel insights into modular networks.

  20. Quantitative assessment of gene expression network module-validation methods

    PubMed Central

    Li, Bing; Zhang, Yingying; Yu, Yanan; Wang, Pengqian; Wang, Yongcheng; Wang, Zhong; Wang, Yongyan

    2015-01-01

    Validation of pluripotent modules in diverse networks holds enormous potential for systems biology and network pharmacology. An arising challenge is how to assess the accuracy of discovering all potential modules from multi-omic networks and validating their architectural characteristics based on innovative computational methods beyond function enrichment and biological validation. To display the framework progress in this domain, we systematically divided the existing Computational Validation Approaches based on Modular Architecture (CVAMA) into topology-based approaches (TBA) and statistics-based approaches (SBA). We compared the available module validation methods based on 11 gene expression datasets, and partially consistent results in the form of homogeneous models were obtained with each individual approach, whereas discrepant contradictory results were found between TBA and SBA. The TBA of the Zsummary value had a higher Validation Success Ratio (VSR) (51%) and a higher Fluctuation Ratio (FR) (80.92%), whereas the SBA of the approximately unbiased (AU) p-value had a lower VSR (12.3%) and a lower FR (45.84%). The Gray area simulated study revealed a consistent result for these two models and indicated a lower Variation Ratio (VR) (8.10%) of TBA at 6 simulated levels. Despite facing many novel challenges and evidence limitations, CVAMA may offer novel insights into modular networks. PMID:26470848

  1. Global gene expression profiling reveals genes expressed differentially in cattle with high and low residual feed intake.

    PubMed

    Chen, Y; Gondro, C; Quinn, K; Herd, R M; Parnell, P F; Vanselow, B

    2011-10-01

    Feed efficiency is an economically important trait in beef production. It can be measured as residual feed intake. This is the difference between actual feed intake recorded over a test period and the expected feed intake of an animal based on its size and growth rate. DNA-based marker-assisted selection would help beef breeders to accelerate genetic improvement for feed efficiency by reducing the generation interval and would obviate the high cost of measuring residual feed intake. Although numbers of quantitative trait loci and candidate genes have been identified with the advance of molecular genetics, our understanding of the physiological mechanisms and the nature of genes underlying residual feed intake is limited. The aim of the study was to use global gene expression profiling by microarray to identify genes that are differentially expressed in cattle, using lines genetically selected for low and high residual feed intake, and to uncover candidate genes for residual feed intake. A long-oligo microarray with 24 000 probes was used to profile the liver transcriptome of 44 cattle selected for high or low residual feed intake. One hundred and sixty-one unique genes were identified as being differentially expressed between animals with high and low residual feed intake. These genes were involved in seven gene networks affecting cellular growth and proliferation, cellular assembly and organization, cell signalling, drug metabolism, protein synthesis, lipid metabolism, and carbohydrate metabolism. Analysis of functional data using a transcriptional approach allows a better understanding of the underlying biological processes involved in residual feed intake and also allows the identification of candidate genes for marker-assisted selection. © 2011 The Authors, Animal Genetics © 2011 Stichting International Foundation for Animal Genetics.

  2. Transcriptome Profiling Reveals Differentially Expressed Transcripts Between the Human Adrenal Zona Fasciculata and Zona Reticularis

    PubMed Central

    Rege, Juilee; Nakamura, Yasuhiro; Wang, Tao; Merchen, Todd D.; Sasano, Hironobu

    2014-01-01

    Context: The human adrenal zona fasciculata (ZF) and zona reticularis (ZR) are responsible for the production of cortisol and 19-carbon steroids (often called adrenal androgens), respectively. However, the gene profiles and exact molecular mechanisms leading to the functional phenotype of the ZF and ZR are still not clearly defined. In the present study, we identified the transcripts that are differentially expressed in the ZF and ZR. Objective: The objective of the study was to compare the transcriptome profiles of ZF and ZR. Design and Methods: ZF and ZR were microdissected from 10 human adrenals. Total RNA was extracted from 10 ZF/ZR pairs and hybridized to Illumina microarray chips. The 10 most differentially expressed transcripts were studied with quantitative RT-PCR (qPCR). Immunohistochemistry was also performed on four zone-specific genes. Results: Microarray results demonstrated that only 347 transcripts of the 47 231 were significantly different by 2-fold or greater in the ZF and ZR. ZF had 195 transcripts with 2-fold or greater increase compared with its paired ZR, whereas ZR was found to have 152 transcripts with 2-fold or greater higher expression than in ZF. Microarray and qPCR analysis of transcripts encoding steroidogenic enzymes (n = 10) demonstrated that only 3β-hydroxysteroid dehydrogenase, steroid sulfotransferase, type 5 17β-hydroxysteroid dehydrogenase, and cytochrome b5 were significantly different. Immunohistochemistry and qPCR studies confirmed that the ZF had an increased expression of lymphoid enhancer-binding factor 1 and nephroblastoma overexpressed, whereas ZR showed an increased expression of solute carrier family 27 (fatty acid transporter) (SLC27A2), member 2 and TSPAN12 (tetraspanin 12) Conclusion: Microarray revealed several novel candidate genes for elucidating the molecular mechanisms governing the ZF and ZR, thereby increasing our understanding of the functional zonation of these two adrenocortical zones. PMID:24423296

  3. New CD20 alternative splice variants: molecular identification and differential expression within hematological B cell malignancies.

    PubMed

    Gamonet, Clémentine; Bole-Richard, Elodie; Delherme, Aurélia; Aubin, François; Toussirot, Eric; Garnache-Ottou, Francine; Godet, Yann; Ysebaert, Loïc; Tournilhac, Olivier; Caroline, Dartigeas; Larosa, Fabrice; Deconinck, Eric; Saas, Philippe; Borg, Christophe; Deschamps, Marina; Ferrand, Christophe

    2015-01-01

    CD20 is a B cell lineage-specific marker expressed by normal and leukemic B cells and targeted by several antibody immunotherapies. We have previously shown that the protein from a CD20 mRNA splice variant (D393-CD20) is expressed at various levels in leukemic B cells or lymphoma B cells but not in resting, sorted B cells from the peripheral blood of healthy donors. Western blot (WB) analysis of B malignancy primary samples showed additional CD20 signals. Deep molecular PCR analysis revealed four new sequences corresponding to in-frame CD20 splice variants (D657-CD20, D618-CD20, D480-CD20, and D177-CD20) matching the length of WB signals. We demonstrated that the cell spliceosome machinery can process ex vivo D480-, D657-, and D618-CD20 transcript variants by involving canonical sites associated with cryptic splice sites. Results of specific and quantitative RT-PCR assays showed that these CD20 splice variants are differentially expressed in B malignancies. Moreover, Epstein-Barr virus (EBV) transformation modified the CD20 splicing profile and mainly increased the D393-CD20 variant transcripts. Finally, investigation of three cohorts of chronic lymphocytic leukemia (CLL) patients showed that the total CD20 splice variant expression was higher in a stage B and C sample collection compared to routinely collected CLL samples or relapsed refractory stage A, B, or C CLL. The involvement of these newly discovered alternative CD20 transcript variants in EBV transformation makes them interesting molecular indicators, as does their association with oncogenesis rather than non-oncogenic B cell diseases, differential expression in B cell malignancies, and correlation with CLL stage and some predictive CLL markers. This potential should be investigated in further studies.

  4. Expression profiling of chickpea genes differentially regulated during a resistance response to Ascochyta rabiei.

    PubMed

    Coram, Tristan E; Pang, Edwin C K

    2006-11-01

    Using microarray technology and a set of chickpea (Cicer arietinum L.) unigenes, grasspea (Lathyrus sativus L.) expressed sequence tags (ESTs) and lentil (Lens culinaris Med.) resistance gene analogues, the ascochyta blight (Ascochyta rabiei (Pass.) L.) resistance response was studied in four chickpea genotypes, including resistant, moderately resistant, susceptible and wild relative (Cicer echinospermum L.) genotypes. The experimental system minimized environmental effects and was conducted in reference design, in which samples from mock-inoculated controls acted as reference against post-inoculation samples. Robust data quality was achieved through the use of three biological replicates (including a dye swap), the inclusion of negative controls and strict selection criteria for differentially expressed genes, including a fold change cut-off determined by self-self hybridizations, Student's t-test and multiple testing correction (P < 0.05). Microarray observations were also validated by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). The time course expression patterns of 756 microarray features resulted in the differential expression of 97 genes in at least one genotype at one time point. k-means clustering grouped the genes into clusters of similar observations for each genotype, and comparisons between A. rabiei-resistant and A. rabiei-susceptible genotypes revealed potential gene 'signatures' predictive of effective A. rabiei resistance. These genes included several pathogenesis-related proteins, SNAKIN2 antimicrobial peptide, proline-rich protein, disease resistance response protein DRRG49-C, environmental stress-inducible protein, leucine-zipper protein, polymorphic antigen membrane protein, Ca-binding protein and several unknown proteins. The potential involvement of these genes and their pathways of induction are discussed. This study represents the first large-scale gene expression profiling in chickpea, and future work will focus

  5. Comparative Transcriptional Analysis Reveals Differential Gene Expression between Asymmetric and Symmetric Zygotic Divisions in Tobacco

    PubMed Central

    Zhao, Jie

    2011-01-01

    Asymmetric cell divisions occur widely during many developmental processes in plants. In most angiosperms, the first zygotic cell division is asymmetric resulting in two daughter cells of unequal size and with distinct fates. However, the critical molecular mechanisms regulating this division remain unknown. Previously we showed that treatment of tobacco zygotes with beta-glucosyl Yariv (βGlcY) could dramatically alter the first zygotic asymmetric division to produce symmetric two-celled proembryos. In the present study, we isolated zygotes and two-celled asymmetric proembryos in vivo by micromanipulation, and obtained symmetric, two-celled proembryos by in vitro cell cultures. Using suppression-subtractive hybridization (SSH) and macroarray analysis differential gene expression between the zygote and the asymmetric and symmetric two-celled proembryos was investigated. After sequencing of the differentially expressed clones, a total of 1610 EST clones representing 685 non-redundant transcripts were obtained. Gene ontology (GO) term analysis revealed that these transcripts include those involved in physiological processes such as response to stimulus, regulation of gene expression, and localization and formation of anatomical structures. A homology search against known genes from Arabidopsis indicated that some of the above transcripts are involved in asymmetric cell division and embryogenesis. Quantitative real-time PCR confirmed the up- or down-regulation of the selected candidate transcripts during zygotic division. A few of these transcripts were expressed exclusively in the zygote, or in either type of the two-celled proembryos. Expression analyses of select genes in different tissues and organs also revealed potential roles of these transcripts in fertilization, seed maturation and organ development. The putative roles of few of the identified transcripts in the regulation of zygotic division are discussed. Further functional work on these candidate

  6. Differential and quantitative molecular analysis of ischemia complexity reduction by isotopic labeling of proteins using a neural embryonic stem cell model.

    PubMed

    Schrattenholz, A; Wozny, W; Klemm, M; Schroer, K; Stegmann, W; Cahill, M A

    2005-03-15

    The analysis of rapid changes of protein expression in living systems in response to insults requires rigorous methods of complexity reduction. To control dynamic pattern of hundreds or even thousands of protein isoforms, we applied a novel method of differential molecular analysis to a cellular model which is suited to study ischemia. Neural derivatives of murine embryonic stem cells were exposed to chemical ischemia. The model was used to obtain starting material for a quantitative differential proteomics analysis. Fractionation of phosphoproteins from these samples and subsequent identification by mass spectrometry of differential proteins provide proof of principle of how novel molecular analytical tools provide new insight into the network of neuroprotective molecular events during specific situations of neuronal stress and related pharmaceutical intervention. Our results indicate a particular role of an isoform of the acidic calcium-independent phospholipase A2 in this type of insult.

  7. Density based pruning for identification of differentially expressed genes from microarray data

    PubMed Central

    2010-01-01

    Motivation Identification of differentially expressed genes from microarray datasets is one of the most important analyses for microarray data mining. Popular algorithms such as statistical t-test rank genes based on a single statistics. The false positive rate of these methods can be improved by considering other features of differentially expressed genes. Results We proposed a pattern recognition strategy for identifying differentially expressed genes. Genes are mapped to a two dimension feature space composed of average difference of gene expression and average expression levels. A density based pruning algorithm (DB Pruning) is developed to screen out potential differentially expressed genes usually located in the sparse boundary region. Biases of popular algorithms for identifying differentially expressed genes are visually characterized. Experiments on 17 datasets from Gene Omnibus Database (GEO) with experimentally verified differentially expressed genes showed that DB pruning can significantly improve the prediction accuracy of popular identification algorithms such as t-test, rank product, and fold change. Conclusions Density based pruning of non-differentially expressed genes is an effective method for enhancing statistical testing based algorithms for identifying differentially expressed genes. It improves t-test, rank product, and fold change by 11% to 50% in the numbers of identified true differentially expressed genes. The source code of DB pruning is freely available on our website http://mleg.cse.sc.edu/degprune PMID:21047384

  8. Widespread DNA hypomethylation and differential gene expression in Turner syndrome

    PubMed Central

    Trolle, Christian; Nielsen, Morten Muhlig; Skakkebæk, Anne; Lamy, Philippe; Vang, Søren; Hedegaard, Jakob; Nordentoft, Iver; Ørntoft, Torben Falck; Pedersen, Jakob Skou; Gravholt, Claus Højbjerg

    2016-01-01

    Adults with 45,X monosomy (Turner syndrome) reflect a surviving minority since more than 99% of fetuses with 45,X monosomy die in utero. In adulthood 45,X monosomy is associated with increased morbidity and mortality, although strikingly heterogeneous with some individuals left untouched while others suffer from cardiovascular disease, autoimmune disease and infertility. The present study investigates the leukocyte DNAmethylation profile by using the 450K-Illumina Infinium assay and the leukocyte RNA-expression profile in 45,X monosomy compared with karyotypically normal female and male controls. We present results illustrating that genome wide X-chromosome RNA-expression profile, autosomal DNA-methylation profile, and the X-chromosome methylation profile clearly distinguish Turner syndrome from controls. Our results reveal genome wide hypomethylation with most differentially methylated positions showing a medium level of methylation. Contrary to previous studies, applying a single loci specific analysis at well-defined DNA loci, our results indicate that the hypomethylation extend to repetitive elements. We describe novel candidate genes that could be involved in comorbidity in TS and explain congenital urinary malformations (PRKX), premature ovarian failure (KDM6A), and aortic aneurysm formation (ZFYVE9 and TIMP1). PMID:27687697

  9. ADAR mediates differential expression of polycistronic microRNAs

    PubMed Central

    Chawla, Geetanjali; Sokol, Nicholas S.

    2014-01-01

    Adenosine deaminases acting on RNAs (ADARs) convert adenosine residues to inosines in primary microRNA (pri-miRNA) transcripts to alter the structural conformation of these precursors and the subsequent functions of the encoded microRNAs (miRNAs). Here we show that RNA editing by Drosophila ADAR modulates the expression of three co-transcribed miRNAs encoded by the evolutionarily conserved let-7-Complex (let-7-C) locus. For example, a single A-to-I change at the −6 residue of pri-miR-100, the first miRNA in this let-7-C polycistronic transcript, leads to enhanced miRNA processing by Drosha and consequently enhanced functional miR-100 both in vitro as well as in vivo. In contrast, other editing events, including one at the +43 residue of the pri-miR-125, destabilize the primary transcript and reduce the levels of all three encoded miRNAs. Consequently, loss of adar in vivo leads to reduced miR-100 but increased miR-125. In wild-type animals, the destabilizing editing events in pri-let-7-C increase during the larval-to-adult transition and are critical for the normal downregulation of all three miRNAs seen late in metamorphosis. These findings unravel a new regulatory role for ADAR and raise the possibility that ADAR mediates the differential expression characteristic of many polycistronic miRNA clusters. PMID:24561617

  10. Power analysis for RNA-Seq differential expression studies.

    PubMed

    Yu, Lianbo; Fernandez, Soledad; Brock, Guy

    2017-05-03

    Sample size calculation and power estimation are essential components of experimental designs in biomedical research. It is very challenging to estimate power for RNA-Seq differential expression under complex experimental designs. Moreover, the dependency among genes should be taken into account in order to obtain accurate results. In this paper, we propose a simulation based procedure for power estimation using the negative binomial distribution and assuming a generalized linear model (at the gene level) that considers the dependence between gene expression level and its variance (dispersion) and also allows equal or unequal dispersion across conditions. We compared the performance of both Wald test and likelihood ratio test under different scenarios. The null distribution of the test statistics was simulated for the desired false positive control to avoid excess false positives with the usage of an asymptotic chi-square distribution. We applied this method to the TCGA breast cancer data set. We provide a framework for power estimation of RNA-Seq data. The proposed procedure is able to properly control the false positive error rate at the nominal level.

  11. Successful pod infections by Moniliophthora roreri result in differential Theobroma cacao gene expression depending on the clone's level of tolerance.

    PubMed

    Ali, Shahin S; Melnick, Rachel L; Crozier, Jayne; Phillips-Mora, Wilberth; Strem, Mary D; Shao, Jonathan; Zhang, Dapeng; Sicher, Richard; Meinhardt, Lyndel; Bailey, Bryan A

    2014-09-01

    An understanding of the tolerance mechanisms of Theobroma cacao used against Moniliophthora roreri, the causal agent of frosty pod rot, is important for the generation of stable disease-tolerant clones. A comparative view was obtained of transcript populations of infected pods from two susceptible and two tolerant clones using RNA sequence (RNA-Seq) analysis. A total of 3009 transcripts showed differential expression among clones. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis of differentially expressed genes indicated shifts in 152 different metabolic pathways between the tolerant and susceptible clones. Real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) analyses of 36 genes verified the differential expression. Regression analysis validated a uniform progression in gene expression in association with infection levels and fungal loads in the susceptible clones. Expression patterns observed in the susceptible clones diverged in tolerant clones, with many genes showing higher expression at a low level of infection and fungal load. Principal coordinate analyses of real-time qRT-PCR data separated the gene expression patterns between susceptible and tolerant clones for pods showing malformation. Although some genes were constitutively differentially expressed between clones, most results suggested that defence responses were induced at low fungal load in the tolerant clones. Several elicitor-responsive genes were highly expressed in tolerant clones, suggesting rapid recognition of the pathogen and induction of defence genes. Expression patterns suggested that the jasmonic acid-ethylene- and/or salicylic acid-mediated defence pathways were activated in the tolerant clones, being enhanced by reduced brassinosteroid (BR) biosynthesis and catabolic inactivation of both BR and abscisic acids. Finally, several genes associated with hypersensitive response-like cell death were also induced in tolerant clones. © 2014

  12. Hyperspectral and differential CARS microscopy for quantitative chemical imaging in human adipocytes

    PubMed Central

    Di Napoli, Claudia; Pope, Iestyn; Masia, Francesco; Watson, Peter; Langbein, Wolfgang; Borri, Paola

    2014-01-01

    In this work, we demonstrate the applicability of coherent anti-Stokes Raman scattering (CARS) micro-spectroscopy for quantitative chemical imaging of saturated and unsaturated lipids in human stem-cell derived adipocytes. We compare dual-frequency/differential CARS (D-CARS), which enables rapid imaging and simple data analysis, with broadband hyperspectral CARS microscopy analyzed using an unsupervised phase-retrieval and factorization method recently developed by us for quantitative chemical image analysis. Measurements were taken in the vibrational fingerprint region (1200–2000/cm) and in the CH stretch region (2600–3300/cm) using a home-built CARS set-up which enables hyperspectral imaging with 10/cm resolution via spectral focussing from a single broadband 5 fs Ti:Sa laser source. Through a ratiometric analysis, both D-CARS and phase-retrieved hyperspectral CARS determine the concentration of unsaturated lipids with comparable accuracy in the fingerprint region, while in the CH stretch region D-CARS provides only a qualitative contrast owing to its non-linear behavior. When analyzing hyperspectral CARS images using the blind factorization into susceptibilities and concentrations of chemical components recently demonstrated by us, we are able to determine vol:vol concentrations of different lipid components and spatially resolve inhomogeneities in lipid composition with superior accuracy compared to state-of-the art ratiometric methods. PMID:24877002

  13. Hyperspectral and differential CARS microscopy for quantitative chemical imaging in human adipocytes.

    PubMed

    Di Napoli, Claudia; Pope, Iestyn; Masia, Francesco; Watson, Peter; Langbein, Wolfgang; Borri, Paola

    2014-05-01

    In this work, we demonstrate the applicability of coherent anti-Stokes Raman scattering (CARS) micro-spectroscopy for quantitative chemical imaging of saturated and unsaturated lipids in human stem-cell derived adipocytes. We compare dual-frequency/differential CARS (D-CARS), which enables rapid imaging and simple data analysis, with broadband hyperspectral CARS microscopy analyzed using an unsupervised phase-retrieval and factorization method recently developed by us for quantitative chemical image analysis. Measurements were taken in the vibrational fingerprint region (1200-2000/cm) and in the CH stretch region (2600-3300/cm) using a home-built CARS set-up which enables hyperspectral imaging with 10/cm resolution via spectral focussing from a single broadband 5 fs Ti:Sa laser source. Through a ratiometric analysis, both D-CARS and phase-retrieved hyperspectral CARS determine the concentration of unsaturated lipids with comparable accuracy in the fingerprint region, while in the CH stretch region D-CARS provides only a qualitative contrast owing to its non-linear behavior. When analyzing hyperspectral CARS images using the blind factorization into susceptibilities and concentrations of chemical components recently demonstrated by us, we are able to determine vol:vol concentrations of different lipid components and spatially resolve inhomogeneities in lipid composition with superior accuracy compared to state-of-the art ratiometric methods.

  14. Distinct molecular basis for endothelial differentiation: gene expression profiles of human mesenchymal stem cells versus umbilical vein endothelial cells.

    PubMed

    Liu, Dandan; Wang, Yuezeng; Ye, Yilu; Yin, Guoli; Chen, Liqiong

    2014-01-01

    The capacity for endothelial differentiation has been described in mesenchymal stem cells (MSC) from human bone marrow. To identify genes associated with the endothelial differentiation potential of this cell-type, and search for the optimal regulatory factors, the expression profile of MSC was compared with cDNA from primary human umbilical vein endothelial cells as controls, using cDNA chips with 4096 genes. The data were corroborated by quantitative PCR, Western blotting, and immunocytochemistry. Among the 3948 effective genes, ∼84% (3321) were co-expressed in both cell-types, and 627 were differentially expressed more than twofold in MSC versus EC. MSC highly expressed numerous stem-cell-like genes. Early development genes of endothelial cells, though not up-regulated, had a high expression in MSC, such as EDF1, MDG1, and EDG2. In contrast, mature endothelial growth and signal pathway genes, like VEGF, CXCR4, and CTNNB1, were down-regulated in MSC. In conclusion, human MSC have a distinct molecular basis for endothelial differentiation. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. The Differential Expression and Possible Function of Long Noncoding RNAs in Liver Cells Infected by Dengue Virus.

    PubMed

    Wang, Xiao-Jun; Jiang, Shi-Chen; Wei, Hai-Xia; Deng, Sheng-Qun; He, Cheng; Peng, Hong-Juan

    2017-10-02

    The function of long noncoding RNAs (lncRNAs) in liver injury resulted by dengue virus (DENV) infection have not yet been explored. The differential expression profiles of lncRNAs coupled with mRNAs in L-02 liver cells in the DENV1 infected, DENV2 infected, and untreated control group were analyzed after high throughput RNA sequencing, the significantly upregulated and downregulated lncRNAs or mRNAs comparing with the control group were identified with a cutoff value at log2 (ratio) ≥ 1.5 and log2 (ratio) ≤ -1.5, respectively. Several differentially expressed lncRNAs were verified with reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR). Target gene analysis, pre-miRNA prediction, and the lncRNA-mRNA co-expression network construction were performed to predict the function of the differentially expressed lncRNAs. The differentially expressed lncRNAs were associated with biosynthesis, DNA/RNA related processes, inhibition of estrogen signaling pathway, sterol biosynthetic process, protein dimerization activity, vesicular fraction in DENV1 infection group; and with protein secretion, methyltransferase process, host cell cytoskeleton reorganization and the small GTPase Ras superfamily, inhibition of cell proliferation, induction of apoptosis in DENV2 infection. LncRNAs might be novel diagnostic markers and targets for further researches on dengue infection and liver injury resulted by dengue virus.

  16. Quantitative crystallinity determination for E1010, a novel carbapenem antibiotic, using differential scanning calorimetry.

    PubMed

    Kushida, Ikuo

    2012-03-01

    The objective of this study was to develop a quantitative crystallinity analysis method for the bulk drug of E1010 ((+)-(4R,5S,6S)-6-[(R)-1-hydroxyethyl]-3-[(2S,4S)-2-[(R)-1-hydroxy-1-[(R)-pyrrolidin-3 -yl]methyl]pyrrolidin-4-yl]thio-4-methyl-7-oxo-1-azabicyclo[3.2.0]hept-2-ene-2-carboxylic acid monohydrochloride), a novel carbapenem antibiotic. X-ray analyses, thermal analyses and hygroscopicity measurements were used to elucidate the crystal structure and the solid state properties. To develop a quantitative method for the crystallinity of E1010 bulk drug, the relationship between enthalpy change obtained by differential scanning calorimetry (DSC) and crystalline form ratio was investigated. E1010 bulk drug was found to exist in a crystalline trihydrate formed in two layers, i.e. a layer of E1010 free form, and a layer consisting of chloride ions and water molecules. The thermal analysis showed an endothermic peak derived from dehydration with the loss of crystal lattices at around 100°C as an onset. The enthalpy change value for the endothermic peak correlated well with crystalline content in binary physical mixtures of the crystalline trihydrate and the amorphous form. In addition, for nine lots of the bulk drug, a positive correlation between the enthalpy change and chemical stability in the solid state was observed. This quantitative analysis of crystallinity using DSC could be applicable for the quality control of the bulk drug to detect variability among manufacturing batches and to estimate the chemical stability of partially amorphous samples. © 2011 The Author. JPP © 2011 Royal Pharmaceutical Society.

  17. Transcriptome-based gene expression profiling identifies differentially expressed genes critical for salt stress response in radish (Raphanus sativus L.).

    PubMed

    Sun, Xiaochuan; Xu, Liang; Wang, Yan; Luo, Xiaobo; Zhu, Xianwen; Kinuthia, Karanja Benard; Nie, Shanshan; Feng, Haiyang; Li, Chao; Liu, Liwang

    2016-02-01

    Transcriptome-based gene expression analysis identifies many critical salt-responsive genes in radish and facilitates further dissecting the molecular mechanism underlying salt stress response. Salt stress severely impacts plant growth and development. Radish, a moderately salt-sensitive vegetable crop, has been studied for decades towards the physiological and biochemical performances under salt stress. However, no systematic study on isolation and identification of genes involved in salt stress response has been performed in radish, and the molecular mechanism governing this process is still indistinct. Here, the RNA-Seq technique was applied to analyze the transcriptomic changes on radish roots treated with salt (200 mM NaCl) for 48 h in comparison with those cultured in normal condition. Totally 8709 differentially expressed genes (DEGs) including 3931 up- and 4778 down-regulated genes were identified. Functional annotation analysis indicated that many genes could be involved in several aspects of salt stress response including stress sensing and signal transduction, osmoregulation, ion homeostasis and ROS scavenging. The association analysis of salt-responsive genes and miRNAs exhibited that 36 miRNA-mRNA pairs had negative correlationship in expression trends. Reverse-transcription quantitative PCR (RT-qPCR) analysis revealed that the expression profiles of DEGs were in line with results from the RNA-Seq analysis. Furthermore, the putative model of DEGs and miRNA-mediated gene regulation was proposed to elucidate how radish sensed and responded to salt stress. This study represents the first comprehensive transcriptome-based gene expression profiling under salt stress in radish. The outcomes of this study could facilitate further dissecting the molecular mechanism underlying salt stress response and provide a valuable platform for further genetic improvement of salt tolerance in radish breeding programs.

  18. Analysis of differentially expressed genes in placental tissues of preeclampsia patients using microarray combined with the Connectivity Map database.

    PubMed

    Song, Y; Liu, J; Huang, S; Zhang, L

    2013-12-01

    Preeclampsia (PE), which affects 2-7% of human pregnancies, causes significant maternal and neonatal morbidity and mortality. To better understand the pathophysiology of PE, the gene expression profiles of placental tissue from 5 controls and 5 PE patients were assessed using microarray. A total of 224 transcripts were significantly differentially expressed (>2-fold change and q value <0.05, SAM software). Gene Ontology (GO) enrichment analysis indicated that genes involved in hypoxia and oxidative and reductive processes were significantly changed. Three differentially expressed genes (DEGs) involved in these biological processes were further verified by quantitative real-time PCR. Finally, the potential therapeutic agents for PE were explored via the Connectivity Map database. In conclusion, the data obtained in this study might provide clues to better understand the pathophysiology of PE and to identify potential therapeutic agents for PE patients.

  19. Identification of differentially expressed genes involved in transient regeneration of the neonatal C57BL/6J mouse heart by digital gene expression profiling.

    PubMed

    Liu, Ming; Zhu, Jin-Gai; Yu, Zhang-Bin; Song, Gui-Xian; Shen, Ya-Hui; Liu, Yao-Qiu; Zhu, Chun; Qian, Ling-Mei

    2014-06-01

    Accumulating evidence has revealed that the mammalian heart possesses a measurable capacity for renewal. Neonatal mice retain a regenerative capacity over a short time-frame (≤6 days), but this capacity is lost by 7 days of age. In the present study, differential gene expression profiling of mouse cardiac tissue was performed to further elucidate the mechanisms underlying this process. The global gene expression patterns of the neonatal C57BL/6J mouse heart were examined at three key time-points (1, 6 and 7 days old) using digital gene expression analysis. In the distribution of total clean tags, high-expression tags (>100 copies) were found to be predominant, whereas low expression tags (<5 copies) occupied the majority of distinct tag distributions. In total, 306 differentially expressed genes (DEGs) were detected in cardiac tissue, with the expression levels of 115 genes upregulated and those of 191 genes downregulated in 7-day-old mice compared with expression levels in 1- and 6-day-old mice, respectively. The expression levels of five DEGs were confirmed using quantitative polymerase chain reaction. Gene ontology analysis revealed a large proportion of DEGs distributed throughout the cell, and these DEGs were associated with binding as well as catalytic, hydrolase, transferase and molecular transducer activities. Furthermore, these genes were involved in cellular, metabolic and developmental processes, as well as biological regulation and signaling pathways. Pathway analysis identified the oxidative phosphorylation pathway to be the process most significantly putatively affected by the differential expression of these genes. These data provide the basis for future analysis of the gene expression patterns that regulate the molecular mechanism of cardiac regeneration.

  20. Differential expression and modification of proteins during ontogenesis in Malus domestica.

    PubMed

    Cao, Xin; Gao, Yan; Wang, Yi; Li, Chun M; Zhao, Yong B; Han, Zhen H; Zhang, Xin Z

    2011-12-01

    Many morphological and physiological changes have been widely reported during ontogeny in higher plants. In order for the better understanding of the proteomic differences between ontogenetic phases, protein compositions between leaves of juvenile, adult vegetative and reproductive phases were compared in an apple (Malus domestica Borkh., Jonathan × Golden Delicious) seedling. Totally, 122 differentially expressed or modified protein spots were separated by DIGE. Of the 122 protein spots, 44, 17 and 29 were abundant in the leaf samples from the juvenile, adult vegetative and reproductive phases, respectively, two spots showed a lower level in the adult vegetative tissue, while the amount of protein increased in 21 spots during ontogeny and declined in nine spots. One hundred and fifteen spots were successfully picked and 95 spots were identified by MALDI-TOF-TOF high-resolution tandem mass spectrometry. Twenty-three juvenile phase abundant or down-regulated spots were photosynthesis-associated proteins, implying a juvenile phase-related photosynthesis enhancement. The expression of 10 enzymes and coenzymes involved in protein synthesis and catabolism was elevated in the adult reproductive phase or up-regulated during ontogeny, contributing a phase change-related activation in protein metabolism. Six proteins generated 30 differential gel spots via post-translational modifications. The differential expression of NADP-dependent D-sorbitol-6-phosphate dehydrogenase was confirmed by Western blotting in six seedlings derived from two hybrid populations. The results of semi-quantitative PCR indicate that some but not all of these proteomic changes were transcriptionally regulated. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Differentially expressed miRNAs in trisomy 21 placentas.

    PubMed

    Svobodová, Iveta; Korabečná, Marie; Calda, Pavel; Břešťák, Miroslav; Pazourková, Eva; Pospíšilová, Šárka; Krkavcová, Miroslava; Novotná, Michaela; Hořínek, Aleš

    2016-08-01

    Molecular pathogenesis of Down syndrome (DS) is still incompletely understood. Epigenetic mechanisms, including miRNAs gene expression regulation, belong to potential influencing factors. The aims of this study were to compare miRNAs expressions in placentas with normal and trisomic karyotype and to associate differentially expressed miRNAs with concrete biological pathways. A total of 80 CVS samples - 41 with trisomy 21 and 39 with normal karyotype - were included in our study. Results obtained in the pilot study using real-time PCR technology and TaqMan Human miRNA Array Cards were subsequently validated on different samples using individual TaqMan miRNA Assays. Seven miRNAs were verified as upregulated in DS placentas (miR-99a, miR-542-5p, miR-10b, miR-125b, miR-615, let-7c and miR-654); three of these miRNAs are located on chromosome 21 (miR-99a, miR-125b and let-7c). Many essential biological processes, transcriptional regulation or apoptosis, were identified as being potentially influenced by altered miRNA levels. Moreover, miRNAs overexpressed in DS placenta apparently regulate genes involved in placenta development (GJA1, CDH11, EGF, ERVW-1, ERVFRD-1, LEP or INHA). These findings suggest the possible participation of miRNAs in Down syndrome impaired placentation and connected pregnancy pathologies. © 2016 John Wiley & Sons, Ltd. © 2016 John Wiley & Sons, Ltd.

  2. Integrated analysis of differentially expressed genes in breast cancer pathogenesis

    PubMed Central

    CHEN, DAOBAO; YANG, HONGJIAN

    2015-01-01

    The present study aimed to detect the differences between breast cancer cells and normal breast cells, and investigate the potential pathogenetic mechanisms of breast cancer. The sample GSE9574 series was downloaded, and the microarray data was analyzed to identify differentially expressed genes (DEGs). Gene Ontology (GO) cluster analysis using the GO Enrichment Analysis Software Toolkit platform and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis for DEGs was conducted using the Gene Set Analysis Toolkit V2. In addition, a protein-protein interaction (PPI) network was constructed, and target sites of potential transcription factors and potential microRNA (miRNA) molecules were screened. A total of 106 DEGs were identified in the current study. Based on these DEGs, a number of bio-pathways appear to be altered in breast cancer, including a number of signaling pathways and other disease-associated pathways, as indicated by KEGG pathway clustering analysis. ATF3, JUND, FOSB and JUNB were detected in the PPI network. Finally, the most significant potential target sites of transcription factors and miRNAs in breast cancer, which are important in the regulation of gene expression, were identified. The results indicated that miR-93, miR-302A, miR-302B, miR-302C, miR-302D, miR-372, miR-373, miR-520E and miR-520A were closely associated with the occurrence and development of breast cancer. Therefore, changes in the expression of these miRNAs may alter cell metabolism and trigger the development of breast cancer and its complications. PMID:26137106

  3. Differentially expressed genes in metastatic advanced Egyptian bladder cancer.

    PubMed

    Zekri, Abdel-Rahman N; Hassan, Zeinab Korany; Bahnassy, Abeer A; Khaled, Hussein M; El-Rouby, Mahmoud N; Haggag, Rasha M; Abu-Taleb, Fouad M

    2015-01-01

    Bladder cancer is one of the most common cancers worldwide. Gene expression profiling using microarray technologies improves the understanding of cancer biology. The aim of this study was to determine the gene expression profile in Egyptian bladder cancer patients. Samples from 29 human bladder cancers and adjacent non-neoplastic tissues were analyzed by cDNA microarray, with hierarchical clustering and multidimensional analysis. Five hundred and sixteen genes were differentially expressed of which SOS1, HDAC2, PLXNC1, GTSE1, ULK2, IRS2, ABCA12, TOP3A, HES1, and SRP68 genes were involved in 33 different pathways. The most frequently detected genes were: SOS1 in 20 different pathways; HDAC2 in 5 different pathways; IRS2 in 3 different pathways. There were 388 down-regulated genes. PLCB2 was involved in 11 different pathways, MDM2 in 9 pathways, FZD4 in 5 pathways, p15 and FGF12 in 4 pathways, POLE2 in 3 pathways, and MCM4 and POLR2E in 2 pathways. Thirty genes showed significant differences between transitional cell cancer (TCC) and squamous cell cancer (SCC) samples. Unsupervised cluster analysis of DNA microarray data revealed a clear distinction between low and high grade tumors. In addition 26 genes showed significant differences between low and high tumor stages, including fragile histidine triad, Ras and sialyltransferase 8 (alpha) and 16 showed significant differences between low and high tumor grades, like methionine adenosyl transferase II, beta. The present study identified some genes, that can be used as molecular biomarkers or target genes in Egyptian bladder cancer patients.

  4. Differential expression of laminin receptors in human hepatocellular carcinoma

    PubMed Central

    Ozaki, I; Yamamoto, K; Mizuta, T; Kajihara, S; Fukushima, N; Setoguchi, Y; Morito, F; Sakai, T

    1998-01-01

    Background—Laminin receptors are involved in cell-extracellular matrix interactions in malignant cells that show invasion and metastasis. Hepatocellular carcinoma frequently shows early invasion into blood vessels, and intrahepatic and extrahepatic metastases. However, the role of laminin receptors in hepatocellular carcinoma is unknown. 
Aims—To examine the expression of mRNA for laminin receptors and their isoforms in hepatocellular carcinoma. 
Methods—The expression of several laminin receptors, including α1 integrin, α6 integrin and its isoforms α6A and α6B, β1 integrin and its isoforms β1A and β1B, and 32kD/67kDa laminin binding protein was examined in human hepatocellular carcinomas and non-cancerous liver tissues using the reverse transcription polymerase chain reaction. 
Results—α6 Integrin, β1 integrin, and laminin binding protein showed notably increased expression in hepatocellular carcinoma, compared with non-cancerous liver tissue, although the α1 integrin did not show a significant change. Furthermore, β1B integrin, a splicing variant of β1 integrin, was overexpressed in hepatocellular carcinoma while the β1A integrin isoform did not show significant changes between hepatocellular carcinoma and surrounding non-cancerous liver tissue. 
Conclusions—The differential upregulation of laminin receptors and their splicing isoforms was shown in hepatocellular carcinoma, suggesting that certain laminin receptors and their isoforms may be involved in the development and progression of hepatocellular carcinoma. 

 Keywords: laminin receptor; integrin α6β1; hepatocellular carcinoma PMID:9824613

  5. Twist1 correlates with poor differentiation and progression in gastric adenocarcinoma via elevation of FGFR2 expression

    PubMed Central

    Zhu, Dong-Yuan; Guo, Qi-Sen; Li, Yan-Liang; Cui, Bin; Guo, Jun; Liu, Ji-Xiao; Li, Peng

    2014-01-01

    AIM: To explore the correlation between Twist-related protein (Twist)1, fibroblast growth factor receptor (FGFR)2 and gastric adenocarcinoma differentiation and progression. METHODS: We evaluated Twist1 and FGFR2 in 52 gastric adenocarcinoma samples by immunohistochemistry and quantitative real time polymerase chain reaction, and analyzed the correlation between Twist1, FGFR2 and cancer differentiation. We also detected Twist1 and FGFR2 expression in gastric adenocarcinoma cell lines, and evaluated Twist1 influence on FGFR2 expression. In addition, we studied the role of FGFR2 in Twist1-promoted cancer progression, including proliferation, invasion and epithelial-mesenchymal transition (EMT). RESULTS: Twist1 and FGFR2 were detected in almost all the gastric adenocarcinoma samples. Twist1 (P = 0.0213) and FGFR2 (P = 0.0310) mRNA levels had a significant association with gastric adenocarcinoma differentiation. Moreover, Twist1 and FGFR2 expression in poorly differentiated cells (SNU-1 and SNU-16) was notably higher than in well-differentiated cells (MKN-7 and MKN-28). In poorly differentiated gastric adenocarcinomas, FGFR2 mRNA level was significantly positively correlated with Twist1 mRNA level (P = 0.004). Twist1 was proved to promote FGFR2 by regulating Twist1 expression by knockdown and overexpression. Additionally, Twist1 could induce proliferation, invasion and EMT in gastric cancer; of these, FGFR2 was required for invasion and EMT, rather than proliferation. CONCLUSION: Twist1 and FGFR2 are highly associated with differentiation of gastric adenocarcinoma; Twist1 can facilitate invasion and EMT in gastric adenocarcinoma via promotion of FGFR2 expression. PMID:25561797

  6. INDEED: Integrated differential expression and differential network analysis of omic data for biomarker discovery.

    PubMed

    Zuo, Yiming; Cui, Yi; Di Poto, Cristina; Varghese, Rency S; Yu, Guoqiang; Li, Ruijiang; Ressom, Habtom W

    2016-12-01

    Differential expression (DE) analysis is commonly used to identify biomarker candidates that have significant changes in their expression levels between distinct biological groups. One drawback of DE analysis is that it only considers the changes on single biomolecule level. Recently, differential network (DN) analysis has become popular due to its capability to measure the changes on biomolecular pair level. In DN analysis, network is typically built based on correlation and biomarker candidates are selected by investigating the network topology. However, correlation tends to generate over-complicated networks and the selection of biomarker candidates purely based on network topology ignores the changes on single biomolecule level. In this paper, we propose a novel approach, INDEED, that builds sparse differential network based on partial correlation and integrates DE and DN analyses for biomarker discovery. We applied this approach on real proteomic and glycomic data generated by liquid chromatography coupled with mass spectrometry for hepatocellular carcinoma (HCC) biomarker discovery study. For each omic data, we used one dataset to select biomarker candidates, built a disease classifier and evaluated the performance of the classifier on an independent dataset. The biomarker candidates, selected by INDEED, were more reproducible across independent datasets, and led to a higher classification accuracy in predicting HCC cases and cirrhotic controls compared with those selected by separate DE and DN analyses. INDEED also identified some candidates previously reported to be relevant to HCC, such as intercellular adhesion molecule 2 (ICAM2) and c4b-binding protein alpha chain (C4BPA), which were missed by both DE and DN analyses. In addition, we applied INDEED for survival time prediction based on transcriptomic data acquired by analysis of samples from breast cancer patients. We selected biomarker candidates and built a regression model for survival time prediction

  7. Gene expression profiling of pluripotency and differentiation-related markers in cat oocytes and preimplantation embryos.

    PubMed

    Filliers, Muriel; Goossens, Karen; Van Soom, Ann; Merlo, Barbara; Pope, Charles Earle; de Rooster, Hilde; Smits, Katrien; Vandaele, Leen; Peelman, Luc J

    2012-01-01

    During mammalian preimplantation development, two successive differentiation events lead to the establishment of three committed lineages with separate fates: the trophectoderm, the primitive endoderm and the pluripotent epiblast. In the mouse embryo, the molecular mechanisms underlying these two cell fate decisions have been studied extensively, leading to the identification of lineage-specific transcription factors. Species-specific differences in expression patterns of key regulatory genes have been reported, raising questions regarding their role in different species. The aim of the present study was to characterise the gene expression patterns of pluripotency (OCT4, SOX2, NANOG) and differentiation (CDX2, GATA6)-related markers during feline early development using reverse transcription-quantitative polymerase chain reaction. In addition, we assessed the impact of in vitro development on gene expression by comparing transcript levels of the genes investigated between in vitro and in vivo blastocysts. To normalise quantitative data within different preimplantation embryo stages, we first validated a set of stable reference genes. Transcript levels of all genes investigated were present and changed over the course of preimplantation development; a highly significant embryo-stage effect on gene expression was observed. Transcript levels of OCT4 were significantly reduced in in vitro blastocysts compared with their in vivo counterparts. None of the other genes investigated showed altered expression under in vitro conditions. The different gene expression patterns of OCT4, SOX2, CDX2 and GATA6 in cat embryos resembled those described in mouse embryos, indicative of a preserved role for these genes during early segregation. However, because of the absence of any upregulation of NANOG transcription levels after embryonic genome activation, it is unlikely that NANOG is a key regular of lineage segregation. Such results support the hypothesis that the behaviour of

  8. Transcriptome sequencing of purple petal spot region in tree peony reveals differentially expressed anthocyanin structural genes

    PubMed Central

    Zhang, Yanzhao; Cheng, Yanwei; Ya, Huiyuan; Xu, Shuzhen; Han, Jianming

    2015-01-01

    The pigmented cells in defined region of a petal constitute the petal spots. Petal spots attract pollinators and are found in many angiosperm families. Several cultivars of tree peony contain a single red or purple spot at the base of petal that makes the flower more attractive for the ornamental market. So far, the understanding of the molecular mechanism of spot formation is inadequate. In this study, we sequenced the transcriptome of the purple spot and the white non-spot of tree peony flower. We assembled and annotated 67,892 unigenes. Comparative analyses of the two transcriptomes showed 1,573 differentially expressed genes, among which 933 were up-regulated, and 640 were down-regulated in the purple spot. Subsequently, we examined four anthocyanin structural genes, including PsCHS, PsF3′H, PsDFR, and PsANS, which expressed at a significantly higher level in the purple spot than in the white non-spot. We further validated the digital expression data using quantitative real-time PCR. Our result uncovered transcriptome variance between the spot and non-spot of tree peony flower, and revealed that the co-expression of four anthocyanin structural genes was responsible for spot pigment in tree peony. The data will further help to unravel the genetic mechanism of peony flower spot formation. PMID:26583029

  9. Analysis of differential protein expression in normal and neoplastic human breast epithelial cell lines

    SciTech Connect

    Williams, K.; Chubb, C.; Huberman, E.; Giometti, C.S.

    1997-07-01

    High resolution two dimensional get electrophoresis (2DE) and database analysis was used to establish protein expression patterns for cultured normal human mammary epithelial cells and thirteen breast cancer cell lines. The Human Breast Epithelial Cell database contains the 2DE protein patterns, including relative protein abundances, for each cell line, plus a composite pattern that contains all the common and specifically expressed proteins from all the cell lines. Significant differences in protein expression, both qualitative and quantitative, were observed not only between normal cells and tumor cells, but also among the tumor cell lines. Eight percent of the consistently detected proteins were found in significantly (P < 0.001) variable levels among the cell lines. Using a combination of immunostaining, comigration with purified protein, subcellular fractionation, and amino-terminal protein sequencing, we identified a subset of the differentially expressed proteins. These identified proteins include the cytoskeletal proteins actin, tubulin, vimentin, and cytokeratins. The cell lines can be classified into four distinct groups based on their intermediate filament protein profile. We also identified heat shock proteins; hsp27, hsp60, and hsp70 varied in abundance and in some cases in the relative phosphorylation levels among the cell lines. Finally, we identified IMP dehydrogenase in each of the cell lines, and found the levels of this enzyme in the tumor cell lines elevated 2- to 20-fold relative to the levels in normal cells.

  10. Differential gene expression and bioinformatics analysis of copper resistance gene afe_1073 in Acidithiobacillus ferrooxidans.

    PubMed

    Hu, Qi; Wu, Xueling; Jiang, Ying; Liu, Yuandong; Liang, Yili; Liu, Xueduan; Yin, Huaqun; Baba, Ngom

    2013-04-01

    Copper resistance of acidophilic bacteria is very significant in bioleaching of copper ore since high concentration of copper are harmful to the growth of organisms. Copper resistance gene afe_1073 was putatively considered to be involved in copper homeostasis in Acidithiobacillus ferrooxidans ATCC23270. In the present study, differential expression of afe_1073 in A. ferrooxidans strain DY26 and DC was assessed with quantitative reverse transcription polymerase chain reaction. The results showed the expression of afe_1073 in two strains increased with the increment of copper concentrations. The expression of DY26 was lower than that of DC at the same copper concentration although A. ferrooxidans strain DY26 possessed higher copper resistance than strain DC. In addition, bioinformatics analysis showed AFE_1073 was a typical transmembrane protein P1b1-ATPase, which could reduce the harm of Cu(+) by pumping it out from the cell. There were two mutation sites in AFE_1073 between DY26 and DC and one may change the hydrophobicity of AFE_1073, which could enhance the ability of DY26 to pump out Cu(+). Therefore, DY26 needed less gene expression of afe_1073 for resisting copper toxicity than that of DC at the same copper stress. Our study will be beneficial to understanding the copper resistance mechanism of A. ferrooxidans.

  11. Differential protein expression in the estuarine copepod Eurytemora affinis after diuron and alkylphenol exposures.

    PubMed

    Boulangé-Lecomte, Céline; Rocher, Béatrice; Cailleaud, Kévin; Cosette, Pascal; Legrand, Eléna; Devreker, David; Budzinski, Hélène; Souissi, Sami; Forget-Leray, Joëlle

    2016-07-01

    Proteomics was used in the calanoid copepod Eurytemora affinis for screening of protein expression modifications induced by organic contaminants. The copepods were exposed in a continuous flow-through system for 86 h to environmentally relevant concentrations of contaminants representative of the pollution in the Seine Estuary (Haute-Normandie, France; diuron, 500 ng L(-1) ; alkylphenol mixture, 1000 ng L(-1) ). Proteome analysis of whole-body copepod extracts by 2-dimensional gel electrophoresis revealed that the contaminants induced modifications in protein expression, with the highest quantitative variations occurring after diuron exposure. Specifically, 88 and 41 proteins were differentially expressed after diuron and alkylphenol treatments, respectively. After mass spectrometry analysis, 51 (diuron exposure) and 15 (alkylphenol exposure) proteins were identified. The identified proteins were potentially related to energy metabolism, cell growth, nervous signal conductivity, excitotoxicity, oxidative stress response, and antioxidant defense. The data suggest a massive general disturbance of physiological functions of E. affinis after diuron exposure, whereas alkylphenols induced an alteration of a few targeted physiological functions. The protein expression signatures identified after contaminant exposure deserve further investigation in terms of the development of novel potential biomarkers for water quality assessment. Environ Toxicol Chem 2016;35:1860-1871. © 2015 SETAC. © 2015 SETAC.

  12. Cassava (Manihot esculenta Krantz) genome harbors KNOX genes differentially expressed during storage root development.

    PubMed

    Guo, D; Li, H L; Tang, X; Peng, S Q

    2014-12-18

    In plants, homeodomain proteins play a critical role in regulating various aspects of plant growth and development. KNOX proteins are members of the homeodomain protein family. The KNOX transcription factors have been reported from Arabidopsis, rice, and other higher plants. The recent publication of the draft genome sequence of cassava (Manihot esculenta Krantz) has allowed a genome-wide search for M. esculenta KNOX (MeKNOX) transcription factors and the comparison of these positively identified proteins with their homologs in model plants. In the present study, we identified 12 MeKNOX genes in the cassava genome and grouped them into two distinct subfamilies based on their domain composition and phylogenetic analysis. Furthermore, semi-quantitative reverse transcription polymerase chain reaction analysis was performed to elucidate the expression profiles of these genes in different tissues and during various stages of root development. The analysis of MeKNOX expression profiles of indicated that 12 MeKNOX genes display differential expressions either in their transcript abundance or expression patterns.

  13. Differential response to bacteria, and TOLLIP expression, in the human respiratory tract

    PubMed Central

    Moncayo-Nieto, Olga Lucia; Wilkinson, Thomas S; Brittan, Mairi; McHugh, Brian J; Jones, Richard O; Conway Morris, Andrew; Walker, William S; Davidson, Donald J; Simpson, A John

    2014-01-01

    Objectives The observation that pathogenic bacteria are commonly tolerated in the human nose, yet drive florid inflammation in the lung, is poorly understood, partly due to limited availability of primary human cells from each location. We compared responses to bacterial virulence factors in primary human nasal and alveolar cells, and characterised the distribution of Toll-interacting protein (TOLLIP; an inhibitor of Toll-like receptor (TLR) signalling) in the human respiratory tract. Methods Primary cells were isolated from nasal brushings and lung tissue taken from patients undergoing pulmonary resection. Cells were exposed to lipopolysaccharide, lipoteichoic acid, peptidoglycan, CpG-C DNA or tumour necrosis factor (TNF). Cytokines were measured in cell supernatants. TOLLIP was characterised using quantitative real-time PCR and immunofluorescence. Results In primary alveolar, but not primary nasal, cells peptidoglycan significantly increased secretion of interleukin (IL)-1β, IL-6, IL-8, IL-10 and TNF. TLR2 expression was significantly higher in alveolar cells and correlated with IL-8 production. TOLLIP expression was significantly greater in nasal cells. Conclusion In conclusion, primary human alveolar epithelial cells are significantly more responsive to peptidoglycan than primary nasal epithelial cells. This may partly be explained by differential TLR2 expression. TOLLIP is expressed widely in the human respiratory tract, and may contribute to the regulation of inflammatory responses. PMID:25478190

  14. Identification of differentially expressed genes in the development of osteosarcoma using RNA-seq

    PubMed Central

    Yang, Yihao; Zhang, Ya; Qu, Xin; Xia, Junfeng; Li, Dongqi; Li, Xiaojuan; Wang, Yu; He, Zewei; Li, Su; Zhou, Yonghong; Xie, Lin; Yang, Zuozhang

    2016-01-01

    Objective Osteosarcoma (OS) is a malignant bone tumor with high morbidity in young adults and adolescents. This study aimed to discover potential early diagnosis biomarkers in OS. Results In total, 111 differentially expressed genes (DEGs) were identified in primary OS compared with normal controls and 235 DEGs were identified in metastatic OS compared with primary OS. AURKB and PPP2R2B were the significantly up-regulated and down-regulated hub proteins, respectively, in the PPI protein-protein network (PPI) network of primary OS. ISG15 and BTRC were the significantly up-regulated and down-regulated hub proteins, respectively, in the network of metastatic OS. The DEGs in metastatic OS compared with primary OS were significantly enriched in the arachidonic acid metabolism, malaria, and chemokine signaling pathways. Finally, we employed quantitative real-time polymerase chain reaction (qRT-PCR) to validate the expression levels of candidate DEGs and the results indicated that our bioinformatics approach was acceptable. Materials and Methods The mRNA expression profiling of 20 subjects was obtained through high-throughput RNA-sequencing. DEGs were identified between primary OS and normal Control, and between primary OS and metastatic OS, respectively. Functional annotation and PPI networks were used to obtain insights into the functions of DEGs. qRT-PCR was performed to detect the expression levels of dysregulated genes in OS. Conclusions Our work might provide groundwork for the further exploration of tumorigenesis and metastasis mechanisms of OS. PMID:27888627

  15. Localization and differential regulation of angiotensinogen mRNA expression in the vessel wall.

    PubMed Central

    Naftilan, A J; Zuo, W M; Inglefinger, J; Ryan, T J; Pratt, R E; Dzau, V J

    1991-01-01

    Recent data demonstrate the existence of a vascular renin angiotensin system. In this study we examine the localization of angiotensinogen mRNA in the blood vessel wall of two rat strains, the Wistar and Wistar Kyoto (WKY), as well as the regulation of vascular angiotensinogen mRNA expression by dietary sodium. Northern blot analysis and in situ hybridization histochemistry demonstrate that in both strains angiotensinogen mRNA is detected in the aortic medial smooth muscle layer as well as the periaortic fat. In WKY rats fed a 1.6% sodium diet, angiotensinogen mRNA concentration is 2.6-fold higher in the periaortic fat than in the smooth muscle, as analyzed by quantitative slot blot hybridization. Angiotensinogen mRNA expression in the medial smooth muscle layer is sodium regulated. After 5 d of a low (0.02%) sodium diet, smooth muscle angiotensinogen mRNA levels increase 3.2-fold (P less than 0.005) as compared with the 1.6% sodium diet. In contrast, angiotensinogen mRNA level in the periaortic fat is not influenced by sodium diet. In summary, our data demonstrate regional (smooth muscle vs. periaortic fat) differential regulation of angiotensinogen mRNA levels in the blood vessel wall by sodium. This regional differential regulation by sodium may have important physiological implications. Images PMID:2010543

  16. The impact of amplification on differential expression analyses by RNA-seq

    PubMed Central

    Parekh, Swati; Ziegenhain, Christoph; Vieth, Beate; Enard, Wolfgang; Hellmann, Ines

    2016-01-01

    Currently, quantitative RNA-seq methods are pushed to work with increasingly small starting amounts of RNA that require amplification. However, it is unclear how much noise or bias amplification introduces and how this affects precision and accuracy of RNA quantification. To assess the effects of amplification, reads that originated from the same RNA molecule (PCR-duplicates) need to be identified. Computationally, read duplicates are defined by their mapping position, which does not distinguish PCR- from natural duplicates and hence it is unclear how to treat duplicated reads. Here, we generate and analyse RNA-seq data sets prepared using three different protocols (Smart-Seq, TruSeq and UMI-seq). We find that a large fraction of computationally identified read duplicates are not PCR duplicates and can be explained by sampling and fragmentation bias. Consequently, the computational removal of duplicates does improve neither accuracy nor precision and can actually worsen the power and the False Discovery Rate (FDR) for differential gene expression. Even when duplicates are experimentally identified by unique molecular identifiers (UMIs), power and FDR are only mildly improved. However, the pooling of samples as made possible by the early barcoding of the UMI-protocol leads to an appreciable increase in the power to detect differentially expressed genes. PMID:27156886

  17. Differential expression of a retrotransposable element, Rex6, in Colossoma macropomum fish from different Amazonian environments

    PubMed Central

    Barbosa, Cassiane Martins; Mareco, Edson Assunção; Silva, Maeli Dal Pai; Martins, Cesar; Alves-Costa, Fernanda Antunes

    2014-01-01

    Transposable elements (TEs) are DNA sequences that have the ability to move and replicate within the genomes. TEs can be classified according to their intermediates of transposition, RNA (retrotransposons) or DNA. In some aquatic organisms, it has been observed that environmental factors such as pH, temperature and pollution may stimulate differential transcription and mobilization of retrotransposons. In light of this information, the present study sought to evaluate the expression of Rex6 TE transcripts in Colossoma macropomum, which is a very commercially exploited fish in Brazil. In order to establish a comparative analysis using real-time PCR, the samples were collected from Amazonian rivers with different physical and chemical characteristics (distinguished by clear water and black water). Quantitative RT-PCR analyses revealed a differential pattern of expression between tissues collected from different types of water (clear and black waters). When it came to the hepatic and muscle tissues sampled, the levels of Rex6 transcripts were significantly different between the two Amazonian water types. These results suggest that environmental conditions operate differently in the regulation of Rex6 transcription in C. macropomum, results which have implications in the reshaping of the genome against environmental variations. PMID:25089227

  18. Differential gene expression in Streptococcus pneumoniae in response to various iron sources.

    PubMed

    Gupta, R; Shah, P; Swiatlo, E

    2009-08-01

    Iron is a critical co-factor for several enzymes and is known to regulate gene expression in many pathogens. Streptococcus pneumoniae (pneumococcus) normally colonizes the upper respiratory mucosa, which is an iron-restricted environment. In contrast, during bacteremia available iron from heme and non-heme proteins potentially increases. In iron-depleted medium pneumococcal strain TIGR4 showed reduced growth, however, addition of several physiological iron sources restored growth. Gene expression of selected known and putative pneumococcal virulence factors was analyzed by quantitative RT-PCR in response to iron sources in vitro and during colonization, pneumonia, and bacteremia in a mouse model. Change in mRNA levels relative to transcription in iron-depleted medium was reported. In presence of iron sources, transcription of cps4A, zmpA, pavA, hemolysin and a putative exfoliative toxin was significantly increased, but nanB was suppressed. Hemoglobin at physiological concentration repressed ply and pspA expression. Ferritin, an acute phase protein, increased expression of an iron ABC transporter and repressed expression of a bacterial non-heme iron-containing ferritin. Transcription of cps4A, nanB, hemolysin, and a putative exfoliative toxin were significantly up-regulated during pneumonia and bacteremia, while mRNA of pavA and non-heme ferritin were expressed at higher levels during pneumonia and carriage. An iron ABC transporter was most up-regulated during bacteremia, while pspA and ply were expressed only in pneumonia. Transcription of zmpA was elevated during both pneumonia and bacteremia. These findings suggest that a subset of virulence genes in pneumococci is differentially regulated in response to the quantity and form of iron sources available in a host.

  19. Genetic diversity analysis of buffalo fatty acid synthase (FASN) gene and its differential expression among bovines.

    PubMed

    Niranjan, S K; Goyal, S; Dubey, P K; Kumari, N; Mishra, S K; Mukesh, M; Kataria, R S

    2016-01-10

    Fatty Acid Synthase (FASN) gene seems to be structurally and functionally different in bovines in view of their distinctive fatty acid synthesis process. Structural variation and differential expression of FASN gene is reported in buffalo (Bubalus bubalis), a bovine species close to cattle, in this study. Amino acid sequence and phylogenetic analysis of functionally important thioesterase (TE) domain of FASN revealed its conserved nature across mammals. Amino acid residues at TE domain, responsible for substrate binding and processing, were found to be invariant in all the mammalian species. A total of seven polymorphic nucleotide sites, including two in coding region of TE domain were identified across the 10 buffalo populations of riverine and swamp types. G and C alleles were found almost fixed at g18996 and g19056 loci, respectively in riverine buffaloes. Principal component analysis of three SNPs (g18433, g18996 and g19056) revealed distinct classification of riverine and swamp buffalo populations. Reverse Transcription-PCR amplification of mRNA corresponding to exon 8-10 region of buffalo FASN helped in identification of two transcript variants; one transcript of 565 nucleotides and another alternate transcript of 207 nucleotides, seems to have arisen through alternative splicing. Both the transcripts were found to be expressed in most of the vital tissues of buffalo with the highest expression in mammary gland. Semi-quantitative and real-time expression analysis across 13 different buffalo tissues revealed its highest expression in lactating mammary gland. When compared, expression of FASN was also found to be higher in liver, adipose and skeletal muscle of buffalo tissues, than cattle. However, the FASN expression was highest in adipose among the three tissues in both the species. Results indicate structural and functional distinctiveness of bovine FASN. Presence of alternate splicing in buffalo FASN also seems to be a unique phenomenon to the bovines

  20. Mining differential top-k co-expression patterns from time course comparative gene expression datasets

    PubMed Central

    2013-01-01

    Background Frequent pattern mining analysis applied on microarray dataset appears to be a promising strategy for identifying relationships between gene expression levels. Unfortunately, too many itemsets (co-expressed genes) are identified by this analysis method since it does not consider the importance of each gene within biological processes to a cellular response and does not take into account temporal properties under biological treatment-control matched conditions in a microarray dataset. Results We propose a method termed TIIM (Top-k Impactful Itemsets Miner), which only requires specifying a user-defined number k to explore the top k itemsets with the most significantly differentially co-expressed genes between 2 conditions in a time course. To give genes different weights, a table with impact degrees for each gene was constructed based on the number of neighboring genes that are differently expressed in the dataset within gene regulatory networks. Finally, the resulting top-k impactful itemsets were manually evaluated using previous literature and analyzed by a Gene Ontology enrichment method. Conclusions In this study, the proposed method was evaluated in 2 publicly available time course microarray datasets with 2 different experimental conditions. Both datasets identified potential itemsets with co-expressed genes evaluated from the literature and showed higher accuracies compared to the 2 corresponding control methods: i) performing TIIM without considering the gene expression differentiation between 2 different experimental conditions and impact degrees, and ii) performing TIIM with a constant impact degree for each gene. Our proposed method found that several new gene regulations involved in these itemsets were useful for biologists and provided further insights into the mechanisms underpinning biological processes. The Java source code and other related materials used in this study are available at

  1. Differential gene expression in femoral bone from red junglefowl and domestic chicken, differing for bone phenotypic traits

    PubMed Central

    Rubin, Carl-Johan; Lindberg, Johan; Fitzsimmons, Carolyn; Savolainen, Peter; Jensen, Per; Lundeberg, Joakim; Andersson, Leif; Kindmark, Andreas

    2007-01-01

    Background Osteoporosis is frequently observed among aging hens from egg-producing strains (layers) of domestic chicken. White Leghorn (WL) has been intensively selected for egg production and it manifests striking phenotypic differences for a number of traits including several bone phenotypes in comparison with the wild ancestor of chicken, the red junglefowl (RJ). Previously, we have identified four Quantitative Trait Loci (QTL) affecting bone mineral density and bone strength in an intercross between RJ and WL. With the aim of further elucidating the genetic basis of bone traits in chicken, we have now utilized cDNA-microarray technology in order to compare global RNA-expression in femoral bone from adult RJ and WL (five of each sex and population). Results When contrasting microarray data for all WL-individuals to that of all RJ-individuals we observed differential expression (False discovery rate adjusted p-values < 0.015) for 604 microarray probes. In corresponding male and female contrasts, differential expression was observed for 410 and 270 probes, respectively. Altogether, the three contrasts between WL and RJ revealed differential expression of 779 unique transcripts, 57 of which are located to previously identified QTL-regions for bone traits. Some differentially expressed genes have previously been attributed roles in bone metabolism and these were: WNT inhibitory factor 1 (WIF1), WD repeat-containing protein 5 (WDR5) and Syndecan 3 (SDC3). Among differentially expressed transcripts, those encoding structural ribosomal proteins were highly enriched and all 15 had lower expression in WL. Conclusion We report the identification of 779 differentially expressed transcripts, several residing within QTL-regions for bone traits. Among differentially expressed transcripts, those encoding structural ribosomal proteins were highly enriched and all had lower expression levels in WL. In addition, transcripts encoding four translation initiation and translation

  2. A fuzzy method for RNA-Seq differential expression analysis in presence of multireads.

    PubMed

    Consiglio, Arianna; Mencar, Corrado; Grillo, Giorgio; Marzano, Flaviana; Caratozzolo, Mariano Francesco; Liuni, Sabino

    2016-11-08

    When the reads obtained from high-throughput RNA sequencing are mapped against a reference database, a significant proportion of them - known as multireads - can map to more than one reference sequence. These multireads originate from gene duplications, repetitive regions or overlapping genes. Removing the multireads from the mapping results, in RNA-Seq analyses, causes an underestimation of the read counts, while estimating the real read count can lead to false positives during the detection of differentially expressed sequences. We present an innovative approach to deal with multireads and evaluate differential expression events, entirely based on fuzzy set theory. Since multireads cause uncertainty in the estimation of read counts during gene expression computation, they can also influence the reliability of differential expression analysis results, by producing false positives. Our method manages the uncertainty in gene expression estimation by defining the fuzzy read counts and evaluates the possibility of a gene to be differentially expressed with three fuzzy concepts: over-expression, same-expression and under-expression. The output of the method is a list of differentially expressed genes enriched with information about the uncertainty of the results due to the multiread presence. We have tested the method on RNA-Seq data designed for case-control studies and we have compared the obtained results with other existing tools for read count estimation and differential expression analysis. The management of multireads with the use of fuzzy sets allows to obtain a list of differential expression events which takes in account the uncertainty in the results caused by the presence of multireads. Such additional information can be used by the biologists when they have to select the most relevant differential expression events to validate with laboratory assays. Our method can be used to compute reliable differential expression events and to highlight possible false

  3. Screening and identification of distant metastasis-related differentially expressed genes in human squamous cell lung carcinoma.

    PubMed

    Wang, Na; Zhou, Fachen; Xiong, Hai; Du, Sha; Ma, Jianwei; Okai, Issac; Wang, Jian; Suo, Jing; Hao, Lihong; Song, Yang; Hu, Jun; Shao, Shujuan

    2012-05-01

    Distant metastasis is one of the leading causes of lung cancer death. Detecting the early-stage molecular alternations in primary tumors, such as gene expression differences, provides a "prognostic" value to the precaution of tumor metastasis. The aim of this article is to screen and identify the metastasis-related genes in human squamous cell lung carcinoma. Primary tumor tissues of nine patients with subsequent metastasis and eight patients without metastasis were selected to perform the gene microarray experiment. GO and pathway analyses were used to determine the differentially expressed genes. Two identified genes were further validated by real-time quantitative reverse transcription polymerase chain reaction (PCR) (real-time qRT-PCR). Two hundred and thirty-eight differentially expressed genes were detected in gene chip experiment, including 51 up-regulated genes and 187 down-regulated genes. These genes were involved in several cellular processes, including cell adhesion, cell cycle regulation, and apoptosis. GO analysis showed that the differentially expressed genes participated in a wide ranging of metastasis-related processes, including extracellular region and regulation of liquid surface tension. In addition, pathway analysis demonstrated that the differentially expressed genes were enriched in pathways related to cell cycle and Wnt signaling. Real-time qRT-PCR validation experiment of LCN2 and PDZK1IP1 showed a consistent up-regulation in the metastasis group. The metastasis of human squamous cell lung carcinoma is a complex process that is regulated by multiple gene alternations on the expression levels. The 238 differentially expressed genes identified in this study presumably contain a core set of genes involved in tumor metastasis. The real-time qRT-PCR results of PDZK1IP1 and LCN2 validated the reliability of this gene microarray experiment.

  4. Differentially expressed genes and proteins upon drought acclimation in tolerant and sensitive genotypes of Coffea canephora

    PubMed Central

    Marraccini, Pierre; Vinecky, Felipe; Alves, Gabriel S.C.; Ramos, Humberto J.O.; Elbelt, Sonia; Vieira, Natalia G.; Carneiro, Fernanda A.; Sujii, Patricia S.; Alekcevetch, Jean C.; Silva, Vânia A.; DaMatta, Fábio M.; Ferrão, Maria A.G.; Leroy, Thierry; Pot, David; Vieira, Luiz G.E.; da Silva, Felipe R.; Andrade, Alan C.

    2012-01-01

    The aim of this study was to investigate the molecular mechanisms underlying drought acclimation in coffee plants by the identification of candidate genes (CGs) using different approaches. The first approach used the data generated during the Brazilian Coffee expressed sequence tag (EST) project to select 13 CGs by an in silico analysis (electronic northern). The second approach was based on screening macroarrays spotted with plasmid DNA (coffee ESTs) with separate hybridizations using leaf cDNA probes from drought-tolerant and susceptible clones of Coffea canephora var. Conilon, grown under different water regimes. This allowed the isolation of seven additional CGs. The third approach used two-dimensional gel electrophoresis to identify proteins displaying differential accumulation in leaves of drought-tolerant and susceptible clones of C. canephora. Six of them were characterized by MALDI-TOF-MS/MS (matrix-assisted laser desorption-time of flight-tandem mass spectrometry) and the corresponding proteins were identified. Finally, additional CGs were selected from the literature, and quantitative real-time polymerase chain reaction (qPCR) was performed to analyse the expression of all identified CGs. Altogether, >40 genes presenting differential gene expression during drought acclimation were identified, some of them showing different expression profiles between drought-tolerant and susceptible clones. Based on the obtained results, it can be concluded that factors involved a complex network of responses probably involving the abscisic signalling pathway and nitric oxide are major molecular determinants that might explain the better efficiency in controlling stomata closure and transpiration displayed by drought-tolerant clones of C. canephora. PMID:22511801

  5. Differential expression of tissue repair genes in the pathogenesis of chronic obstructive pulmonary disease.

    PubMed

    Gosselink, John V; Hayashi, Shizu; Elliott, W Mark; Xing, Li; Chan, Becky; Yang, Luojia; Wright, Claire; Sin, Don; Paré, Peter D; Pierce, John A; Pierce, Richard A; Patterson, Alex; Cooper, Joel; Hogg, James C

    2010-06-15

    The airflow limitation that defines severity of chronic obstructive pulmonary disease (COPD) is caused by a combination of small airway obstruction and emphysematous lung destruction. To examine the hypothesis that small airway obstructive and emphysematous destructive lesions are produced by differential expression of genes associated with tissue repair. The expression of 54 genes associated with repair of repetitively damaged tissue was measured in 136 paired samples of small bronchioles and surrounding lung tissue separated by laser capture microdissection. These samples were collected from 63 patients at different levels of disease severity who required surgery for either lung cancer or lung transplantation for very severe COPD. Gene expression was measured by quantitative polymerase chain reaction in these paired samples and compared with the FEV(1) by linear regression analysis. After corrections for false discovery rates, only 2 of 10 genes (serpin peptidase inhibitor/plasminogen activator inhibitor member 2 and matrix metalloproteinase [MMP] 10) increased, whereas 8 (MMP2, integrin-alpha1, vascular endothelial growth factor, a disintegrin and metallopeptidase domain 33, scatter factor/hepatocyte growth factor, tissue inhibitor of matrix metalloproteinase-2, fibronectin, and collagen 3alpha1) decreased in small airways in association with FEV(1). In contrast, 8/12 genes (early growth response factor 1, MMP1, MMP9, MMP10, plasminogen activator urokinase, plasminogen activator urokinase receptor, tumor necrosis factor, and IL13) increased and 4/12 (MMP2, tissue inhibitor of matrix metalloproteinase-1, collagen 1alpha1, and transforming growth factor-beta3) decreased in the surrounding lung tissue in association with progression of COPD. The progression of COPD is associated with the differential expression of a cluster of genes that favor the degradation of the tissue surrounding the small conducting airways.

  6. Differential expression of putative adhesin genes of Actinobacillus suis grown in in vivo-like conditions.

    PubMed

    Bujold, Adina R; Labrie, Josée; Jacques, Mario; MacInnes, Janet I

    2016-11-15

    Actinobacillus suis is an opportunistic pathogen that resides in the tonsils of the soft palate of swine. Unknown stimuli can cause this organism to invade the host, resulting in septicaemia and sequelae including death. To better understand its pathogenesis, the expression of several adhesin genes was evaluated by semi-quantitative real-time PCR in A. suis grown in conditions that mimic the host environment, including different nutrient and oxygen levels, exponential and stationary phases of growth, and in the presence of the stress hormone epinephrine. Fifty micromolar epinephrine did not affect the growth rate or expression of A. suis adhesin genes, but there was a significant growth phase effect for many genes. Most adhesin genes were also differentially expressed during anoxic static growth or aerobic growth, and in this study, all genes were differentially expressed in either exponential or stationary phase. Based on the time*treatment interactions observed in the anoxic study, a model of persistence of A. suis in the host environment in biofilm and planktonic states is proposed. Biofilm dynamics were further studied using wild type and isogenic mutants of the type IVb pilin (Δ flp1), the OmpA outer membrane protein (ΔompA), and the fibronectin-binding (ΔcomE1) genes. Disruption of these adhesin genes affected the early stages of biofilm formation, but in most cases, biofilm formation of the mutant strains was similar to that of the wild type by 24h of incubation. We postulate that other adhesins may have overlapping functions that can compensate for those of the missing adhesins. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Differentially Expressed Genes during Contrasting Growth Stages of Artemisia annua for Artemisinin Content

    PubMed Central

    Nair, Priya; Misra, Amita; Singh, Alka; Shukla, Ashutosh K.; Gupta, Madan M.; Gupta, Anil K.; Gupta, Vikrant; Khanuja, Suman P. S.; Shasany, Ajit K.

    2013-01-01

    Artemisia annua is the source of antimalarial phytomolecule, artemisinin. It is mainly produced and stored in the glandular secretory trichomes present in the leaves of the plant. Since, the artemisinin biosynthesis steps are yet to be worked out, in this investigation a microarray chip was strategized for the first time to shortlist the differentially expressing genes at a stage of plant producing highest artemisinin compared to the stage with no artemisinin. As the target of this study was to analyze differential gene expression associated with contrasting artemisinin content in planta and a genotype having zero/negligible artemisinin content was unavailable, it was decided to compare different stages of the same genotype with contrasting artemisinin content (seedling - negligible artemisinin, mature leaf - high artemisinin). The SCAR-marked artemisinin-rich (∼1.2%) Indian variety ‘CIM-Arogya’ was used in the present study to determine optimal plant stage and leaf ontogenic level for artemisinin content. A representative EST dataset from leaf trichome at the stage of maximal artemisinin biosynthesis was established. The high utility small scale custom microarray chip of A. annua containing all the significant artemisinin biosynthesis-related genes, the established EST dataset, gene sequences isolated in-house and strategically selected candidates from the A. annua Unigene database (NCBI) was employed to compare the gene expression profiles of two stages. The expression data was validated through semiquantitative and quantitative RT-PCR followed by putative annotations through bioinformatics-based approaches. Many candidates having probable role in artemisinin metabolism were identified and described with scope for further functional characterization. PMID:23573249

  8. Gene expression analysis of terminal differentiation of human melanoma cells highlights global reductions in cell cycle-associated genes.

    PubMed

    Huynh, Kim Mai; Kim, Gyoungmi; Kim, Dong-Joon; Yang, Suk-Jin; Park, Seong-min; Yeom, Young-Il; Fisher, Paul B; Kang, Dongchul

    2009-03-15

    Defects in differentiation are frequently observed in cancer cells. By appropriate treatment specific tumor cell types can be induced to terminally differentiate. Metastatic HO-1 human melanoma cells treated with IFN-beta plus mezerein (MEZ) undergo irreversible growth arrest and terminal differentiation followed by apoptosis. In order to define the molecular changes associated with this process, changes in gene expression were analyzed by cDNA microarray hybridization and by semi-quantitative and quantitative RT-PCRs of representative 44 genes. The expression of 210 genes was changed more than two-fold at either 8 or 24 h post-treatment (166 up and 44 down). Major biological processes associated with the up-regulated genes were response to endogenous/exogenous stimuli (38%), cell proliferation (13%), cell death (16%) and development (30%). Approximately 34% of the down-regulated genes were associated with cell cycle, 9% in DNA replication and 11% in chromosome organization, respectively. Suppression of cell cycle associated genes appeared to directly correlate with growth arrest observed in the terminal differentiation process. Expression of Calpain 3 (CAPN3) variant 6 was suppressed by the combined treatment and maintained high in various melanoma cell lines. However, over-expression of the CAPN3 did not significantly affect growth kinetics and cell viability, suggesting that up-regulation of CAPN3 alone may not be a causative, but an associated change with melanoma development. This analysis provides further insights into the spectrum of up-regulated and the first detailed investigation of down-regulated gene changes associated with and potentially causative of induction of loss of proliferative capacity and terminal differentiation in human melanoma cells.

  9. Differential expression analysis of miRNA in peripheral blood mononuclear cells of patients with non-segmental vitiligo.

    PubMed

    Wang, Yi; Wang, Keyu; Liang, Jianhua; Yang, Hong; Dang, Ningning; Yang, Xi; Kong, Yi

    2015-02-01

    Vitiligo is a common depigmentary skin disease that may follow a pattern of multifactorial inheritance. The essential factors of its immunopathogenesis is thought to be the selective destruction of melanocytes. As a new class of microregulators of gene expression, miRNA have been reported to play vital roles in autoimmune diseases, metabolic diseases and cancer. This study sought to characterize the different miRNA expression pattern in the peripheral blood mononuclear cells (PBMC) of patients with non-segmental vitiligo (NSV) and healthy individuals and to examine their direct responses to thymosin α1 (Tα1) treatment. The miRNA expression profile in the PBMC of patients with NSV was analyzed using Exiqon's miRCURY LNA microRNA Array. The differentially expressed miRNA were validated by real-time quantitative polymerase chain reaction. We found that the expression levels of miR-224-3p and miR-4712-3p were upregulated, and miR-3940-5p was downregulated in the PBMC. The common clinical immune modulator Tα1 changed the miRNA expression profile. Our analysis showed that differentially expressed miRNA were associated with the mechanism of immune imbalance of vitiligo and that Tα1 could play an important role in changing the expression of these miRNA in the PBMC of patients with NSV. This study provided further evidence that miRNA may serve as novel drug targets for vitiligo therapeutic evaluation.

  10. Utility of Quantitative Flow Cytometry Immunophenotypic Analysis of CD5 Expression in Small B-cell Neoplasms

    PubMed Central

    Challagundla, Pramoda; Jorgensen, Jeffrey L.; Kanagal-Shamanna, Rashmi; Gurevich, Inga; Pierson, Diane M.; Ferrajoli, Alessandra; Reyes, Steven R.; Medeiros, L. Jeffrey; Miranda, Roberto N.

    2014-01-01

    Background The value of assessing CD5 expression in the differential diagnosis of small B-cell neoplasms is well established. Usually CD5 is assessed qualitatively. Materials and Methods We assessed CD5 expression levels by quantitative flow cytometry immunophenotyping to determine possible differences among various small B-cell neoplasms. We performed 4-color flow cytometry analysis on peripheral blood (PB) and bone marrow (BM) aspirate specimens and quantified CD5 expression in various mature small B-cell lymphomas and leukemias. We also assessed CD5 levels in PB samples of normal donors (controls). Results Cases of chronic lymphocytic leukemia (CLL) and mantle cell lymphoma had higher levels of CD5 compared with control (benign) B-cells (p < 0.001). Cases of marginal zone lymphoma (MZL) and hairy cell leukemia (HCL) had CD5 levels similar to control B-cells (p > 0.05), while cases of follicular lymphoma (FL) and lymphoplasmacytic lymphoma (LPL) had significantly lower CD5 levels than control B-cells (p <0.05). In B-cell neoplasms, a high level of CD5 expression correlated with a homogeneous pattern of positive events whereas lower CD5 levels correlated with a heterogeneous pattern of positive events. Conclusions Using flow cytometric immunophenotypic analysis to quantify CD5 levels can aid in diagnosis. CD5 expression levels are substantially higher in CLL and mantle cell lymphoma and expression is observed in a homogeneous pattern as compared with other B-cell neoplasms that are either negative for CD5 or express this antigen at lower levels with a heterogeneous pattern of expression. However, there is some overlap in CD5 expression levels between a subset of atypical CLL and MZL cases. PMID:24978916

  11. Differential microRNA expression is associated with androgen receptor expression in breast cancer.

    PubMed

    Shi, Yaqin; Yang, Fang; Sun, Zijia; Zhang, Wenwen; Gu, Jun; Guan, Xiaoxiang

    2017-01-01

    The androgen receptor (AR) is frequently expressed in breast cancer; however, its prognostic value remains unclear. AR expression in breast cancer has been associated with improved outcomes in estrogen receptor (ER)‑positive breast cancer compared with ER‑negative disease. Eliminating AR function in breast cancer is critically important for breast cancer progression. However, the mechanism underlying AR regulation remains poorly understood. The study of microRNAs (miRNAs) has provided important insights into the pathogenesis of hormone‑dependent cancer. To determine whether miRNAs function in the AR regulation of breast cancer, the present study performed miRNA expression profiling in AR‑positive and ‑negative breast cancer cell lines. A total of 153 miRNAs were differentially expressed in AR‑positive compared with AR‑negative breast cancer cells; 52 were upregulated and 101 were downregulated. A number of these have been extensively associated with breast cancer cell functions, including proliferation, invasion and drug‑resistance. Furthermore, through pathway enrichment analysis, signaling pathways associated with the prediction targets of the miRNAs were characterized, including the vascular endothelial growth factor and mammalian target of rapamycin signaling pathways. In conclusion, the results of the present study indicated that the expression of miRNAs may be involved in the mechanism underlying AR regulation of breast cancer, and may improve understanding of the role of AR in breast cancer.

  12. Differential microRNA expression is associated with androgen receptor expression in breast cancer

    PubMed Central

    Shi, Yaqin; Yang, Fang; Sun, Zijia; Zhang, Wenwen; Gu, Jun; Guan, Xiaoxiang

    2017-01-01

    The androgen receptor (AR) is frequently expressed in breast cancer; however, its prognostic value remains unclear. AR expression in breast cancer has been associated with improved outcomes in estrogen receptor (ER)-positive breast cancer compared with ER-negative disease. Eliminating AR function in breast cancer is critically important for breast cancer progression. However, the mechanism underlying AR regulation remains poorly understood. The study of microRNAs (miRNAs) has provided important insights into the pathogenesis of hormone-dependent cancer. To determine whether miRNAs function in the AR regulation of breast cancer, the present study performed miRNA expression profiling in AR-positive and -negative breast cancer cell lines. A total of 153 miRNAs were differentially expressed in AR-positive compared with AR-negative breast cancer cells; 52 were upregulated and 101 were downregulated. A number of these have been extensively associated with breast cancer cell functions, including proliferation, invasion and drug-resistance. Furthermore, through pathway enrichment analysis, signaling pathways associated with the prediction targets of the miRNAs were characterized, including the vascular endothelial growth factor and mammalian target of rapamycin signaling pathways. In conclusion, the results of the present study indicated that the expression of miRNAs may be involved in the mechanism underlying AR regulation of breast cancer, and may improve understanding of the role of AR in breast cancer. PMID:27959398

  13. Wavelength Selection Method Based on Differential Evolution for Precise Quantitative Analysis Using Terahertz Time-Domain Spectroscopy.

    PubMed

    Li, Zhi; Chen, Weidong; Lian, Feiyu; Ge, Hongyi; Guan, Aihong

    2017-01-01

    Quantitative analysis of component mixtures is an important application of terahertz time-domain spectroscopy (THz-TDS) and has attracted broad interest in recent research. Although the accuracy of quantitative analysis using THz-TDS is affected by a host of factors, wavelength selection from the sample's THz absorption spectrum is the most crucial component. The raw spectrum consists of signals from the sample and scattering and other random disturbances that can critically influence the quantitative accuracy. For precise quantitative analysis using THz-TDS, the signal from the sample needs to be retained while the scattering and other noise sources are eliminated. In this paper, a novel wavelength selection method based on differential evolution (DE) is investigated. By performing quantitative experiments on a series of binary amino acid mixtures using THz-TDS, we demonstrate the efficacy of the DE-based wavelength selection method, which yields an error rate below 5%.

  14. Differential Expression of the Three Multicopper Oxidases from Myxococcus xanthus▿

    PubMed Central

    Sánchez-Sutil, María Celestina; Gómez-Santos, Nuria; Moraleda-Muñoz, Aurelio; Martins, Lígia O.; Pérez, Juana; Muñoz-Dorado, José

    2007-01-01

    Myxococcus xanthus is a soil bacterium that undergoes a unique life cycle among the prokaryotes upon starvation, which includes the formation of macroscopic structures, the fruiting bodies, and the differentiation of vegetative rods into coccoid myxospores. This peculiarity offers the opportunity to study the copper response in this bacterium in two different stages. In fact, M. xanthus vegetative rods exhibit 15-fold-greater resistance against copper than developing cells. However, cells preadapted to this metal reach the same levels of resistance during both stages. Analysis of the M. xanthus genome reveals that many of the genes involved in copper resistance are redundant, three of which encode proteins of the multicopper oxidase family (MCO). Each MCO gene exhibits a different expression profile in response to external copper addition. Promoters of cuoA and cuoB respond to Cu(II) ions during growth and development; however, they show a 10-fold-increased copper sensitivity during development. The promoter of cuoC shows copper-independent induction upon starvation, but it is copper up-regulated during growth. Phenotypic analyses of deletion mutants reveal that CuoB is involved in the primary copper-adaptive response; CuoA and CuoC are necessary for the maintenance of copper tolerance; and CuoC is required for normal development. These roles seem to be carried out through cuprous oxidase activity. PMID:17483223

  15. Stereolithographic Bone Scaffold Design Parameters: Osteogenic Differentiation and Signal Expression

    PubMed Central

    Kim, Kyobum; Yeatts, Andrew; Dean, David

    2010-01-01

    Scaffold design parameters including porosity, pore size, interconnectivity, and mechanical properties have a significant influence on osteogenic signal expression and differentiation. This review evaluates the influence of each of these parameters and then discusses the ability of stereolithography (SLA) to be used to tailor scaffold design to optimize these parameters. Scaffold porosity and pore size affect osteogenic cell signaling and ultimately in vivo bone tissue growth. Alternatively, scaffold interconnectivity has a great influence on in vivo bone growth but little work has been done to determine if interconnectivity causes changes in signaling levels. Osteogenic cell signaling could be also influenced by scaffold mechanical properties such as scaffold rigidity and dynamic relationships between the cells and their extracellular matrix. With knowledge of the effects of these parameters on cellular functions, an optimal tissue engineering scaffold can be designed, but a proper technology must exist to produce this design to specification in a repeatable manner. SLA has been shown to be capable of fabricating scaffolds with controlled architecture and micrometer-level resolution. Surgical implantation of these scaffolds is a promising clinical treatment for successful bone regeneration. By applying knowledge of how scaffold parameters influence osteogenic cell signaling to scaffold manufacturing using SLA, tissue engineers may move closer to creating the optimal tissue engineering scaffold. PMID:20504065

  16. Preliminary identification of differentially expressed tear proteins in keratoconus

    PubMed Central

    Wasinger, Valerie C.; Pye, David C.; Willcox, Mark D. P.

    2013-01-01

    Purpose To examine the proteins differentially expressed in the tear film of people with keratoconus and normal subjects. Methods Unstimulated tears from people with keratoconus (KC) and controls (C) were collected using a capillary tube. Tear proteins from people with KC and controls were partitioned using a novel in-solution electrophoresis, Microflow 10 (ProteomeSep), and analyzed using linear ion trap quadrupole fourier transform mass spectrometry. Spectral counting was used to quantify the individual tear proteins. Results Elevated levels of cathepsin B (threefold) were evident in the tears of people with KC. Polymeric immunoglobulin receptor (ninefold), fibrinogen alpha chain (eightfold), cystatin S (twofold), and cystatin SN (twofold) were reduced in tears from people with KC. Keratin type-1 cytoskeletal-14 and keratin type-2 cytoskeletal-5 were present only in the tears of people with KC. Conclusions The protein changes in tears, that is, the decrease in protease inhibitors and increase in proteases, found in the present and other previously published studies reflect the pathological events involved in KC corneas. Further investigations into tear proteins may help elucidate the underlying molecular mechanisms of KC, which could result in better treatment options. PMID:24194634

  17. Personalized Identification of Differentially Expressed Modules in Osteosarcoma

    PubMed Central

    Liu, Xiaozhou; Li, Chengjun; Zhang, Lei; Shi, Xin; Wu, Sujia

    2017-01-01

    Background Osteosarcoma (OS), an aggressive malignant neoplasm, is the most common primary bone cancer mainly in adolescents and young adults. Differentially expressed modules tend to distinguish differences integrally. Identifying modules individually has been crucial for understanding OS mechanisms and applications of custom therapeutic decisions in the future. Material/Methods Samples came from individuals were used from control group (n=15) and OS group (n=84). Based on clique-merging, module-identification algorithm was used to identify modules from OS PPI networks. A novel approach – the individualized module aberrance score (iMAS) was performed to distinguish differences, making special use of accumulated normal samples (ANS). We performed biological process ontology to classify functionally modules. Then Support Vector Machine (SVM) was used to test distribution results of normal and OS group with screened modules. Results We identified 83 modules containing 2084 genes from PPI network in which 61 modules were significantly different. Cluster analysis of OS using the iMAS method identified 5 modules clusters. Specificity=1.00 and Sensitivity=1.00 proved the distribution outcomes of screened modules were mainly consistent with that of total data, which suggested the efficiency of 61 modules. Conclusions We conclude that a novel pipeline that identified the dysregulated modules in individuals of OS. The constructed process is expected to aid in personalized health care, which may present fruitful strategies for medical therapy. PMID:28190021

  18. Personalized Identification of Differentially Expressed Modules in Osteosarcoma.

    PubMed

    Liu, Xiaozhou; Li, Chengjun; Zhang, Lei; Shi, Xin; Wu, Sujia

    2017-02-12

    BACKGROUND Osteosarcoma (OS), an aggressive malignant neoplasm, is the most common primary bone cancer mainly in adolescents and young adults. Differentially expressed modules tend to distinguish differences integrally. Identifying modules individually has been crucial for understanding OS mechanisms and applications of custom therapeutic decisions in the future. MATERIAL AND METHODS Samples came from individuals were used from control group (n=15) and OS group (n=84). Based on clique-merging, module-identification algorithm was used to identify modules from OS PPI networks. A novel approach - the individualized module aberrance score (iMAS) was performed to distinguish differences, making special use of accumulated normal samples (ANS). We performed biological process ontology to classify functionally modules. Then Support Vector Machine (SVM) was used to test distribution results of normal and OS group with screened modules. RESULTS We identified 83 modules containing 2084 genes from PPI network in which 61 modules were significantly different. Cluster analysis of OS using the iMAS method identified 5 modules clusters. Specificity=1.00 and Sensitivity=1.00 proved the distribution outcomes of screened modules were mainly consistent with that of total data, which suggested the efficiency of 61 modules. CONCLUSIONS We conclude that a novel pipeline that identified the dysregulated modules in individuals of OS. The constructed process is expected to aid in personalized health care, which may present fruitful strategies for medical therapy.

  19. Differential expression analysis for RNAseq using Poisson mixed models

    PubMed Central

    Sun, Shiquan; Hood, Michelle; Scott, Laura; Peng, Qinke; Mukherjee, Sayan; Tung, Jenny

    2017-01-01

    Abstract Identifying differentially expressed (DE) genes from RNA sequencing (RNAseq) studies is among the most common analyses in genomics. However, RNAseq DE analysis presents several statistical and computational challenges, including over-dispersed read counts and, in some settings, sample non-independence. Previous count-based methods rely on simple hierarchical Poisson models (e.g. negative binomial) to model independent over-dispersion, but do not account for sample non-independence due to relatedness, population structure and/or hidden confounders. Here, we present a Poisson mixed model with two random effects terms that account for both independent over-dispersion and sample non-independence. We also develop a scalable sampling-based inference algorithm using a latent variable representation of the Poisson distribution. With simulations, we show that our method properly controls for type I error and is generally more powerful than other widely used approaches, except in small samples (n <15) with other unfavorable properties (e.g. small effect sizes). We also apply our method to three real datasets that contain related individuals, population stratification or hidden confounders. Our results show that our method increases power in all three data compared to other approaches, though the power gain is smallest in the smallest sample (n = 6). Our method is implemented in MACAU, freely available at www.xzlab.org/software.html. PMID:28369632

  20. Differential expression analysis for RNAseq using Poisson mixed models.

    PubMed

    Sun, Shiquan; Hood, Michelle; Scott, Laura; Peng, Qinke; Mukherjee, Sayan; Tung, Jenny; Zhou, Xiang

    2017-06-20

    Identifying differentially expressed (DE) genes from RNA sequencing (RNAseq) studies is among the most common analyses in genomics. However, RNAseq DE analysis presents several statistical and computational challenges, including over-dispersed read counts and, in some settings, sample non-independence. Previous count-based methods rely on simple hierarchical Poisson models (e.g. negative binomial) to model independent over-dispersion, but do not account for sample non-independence due to relatedness, population structure and/or hidden confounders. Here, we present a Poisson mixed model with two random effects terms that account for both independent over-dispersion and sample non-independence. We also develop a scalable sampling-based inference algorithm using a latent variable representation of the Poisson distribution. With simulations, we show that our method properly controls for type I error and is generally more powerful than other widely used approaches, except in small samples (n <15) with other unfavorable properties (e.g. small effect sizes). We also apply our method to three real datasets that contain related individuals, population stratification or hidden confounders. Our results show that our method increases power in all three data compared to other approaches, though the power gain is smallest in the smallest sample (n = 6). Our method is implemented in MACAU, freely available at www.xzlab.org/software.html. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Genetic identity and differential gene expression between Trichomonas vaginalis and Trichomonas tenax

    PubMed Central

    2009-01-01

    Background Trichomonas vaginalis is a human urogenital pathogen responsible for trichomonosis, the number-one, non-viral sexually transmitted disease (STD) worldwide, while T. tenax is a commensal of the human oral cavity, found particularly in patients with poor oral hygiene and advanced periodontal disease. The extent of genetic identity between T. vaginalis and its oral commensal counterpart is unknown. Results Genes that were differentially expressed in T. vaginalis were identified by screening three independent subtraction cDNA libraries enriched for T. vaginalis genes. The same thirty randomly selected cDNA clones encoding for proteins with specific functions associated with colonization were identified from each of the subtraction cDNA libraries. In addition, a T. vaginalis cDNA expression library was screened with patient sera that was first pre-adsorbed with an extract of T. tenax antigens, and seven specific cDNA clones were identified from this cDNA library. Interestingly, some of the clones identified by the subtraction cDNA screening were also obtained from the cDNA expression library with the pre-adsorbed sera. Moreover and noteworthy, clones identified by both the procedures were found to be up-regulated in expression in T. vaginalis upon contact with vaginal epithelial cells, suggesting a role for these gene products in host colonization. Semi-quantitative RT-PCR analysis of select clones showed that the genes were not unique to T. vaginalis and that these genes were also present in T. tenax, albeit at very low levels of expression. Conclusion These results suggest that T. vaginalis and T. tenax have remarkable genetic identity and that T. vaginalis has higher levels of gene expression when compared to that of T. tenax. The data may suggest that T. tenax could be a variant of T. vaginalis. PMID:19296850

  2. Differential expression patterns of non-symbiotic hemoglobins in sugar beet (Beta vulgaris ssp. vulgaris).

    PubMed

    Leiva-Eriksson, Nélida; Pin, Pierre A; Kraft, Thomas; Dohm, Juliane C; Minoche, André E; Himmelbauer, Heinz; Bülow, Leif

    2014-04-01

    Biennial sugar beet (Beta vulgaris spp. vulgaris) is a Caryophyllidae that has adapted its growth cycle to the seasonal temperature and daylength variation of temperate regions. This is the first time a holistic study of the expression pattern of non-symbiotic hemoglobins (nsHbs) is being carried out in a member of this group and under two essential environmental conditions for flowering, namely vernalization and length of photoperiod. BvHb genes were identified by sequence homology searches against the latest draft of the sugar beet genome. Three nsHb genes (BvHb1.1, BvHb1.2 and BvHb2) and one truncated Hb gene (BvHb3) were found in the genome of sugar beet. Gene expression profiling of the nsHb genes was carried out by quantitative PCR in different organs and developmental stages, as well as during vernalization and under different photoperiods. BvHb1.1 and BvHb2 showed differential expression during vernalization as well as during long and short days. The high expression of BvHb2 indicates that it has an active role in the cell, maybe even taking over some BvHb1.2 functions, except during germination where BvHb1.2 together with BvHb1.1-both Class 1 nsHbs-are highly expressed. The unprecedented finding of a leader peptide at the N-terminus of BvHb1.1, for the first time in an nsHb from higher plants, together with its observed expression indicate that it may have a very specific role due to its suggested location in chloroplasts. Our findings open up new possibilities for research, breeding and engineering since Hbs could be more involved in plant development than previously was anticipated.

  3. Identification and differential expression dynamics of peach small GTPases encoding genes during fruit development and ripening

    PubMed Central

    Falchi, Rachele; Cipriani, Guido; Marrazzo, Teresa; Nonis, Alberto; Vizzotto, Giannina; Ruperti, Benedetto

    2010-01-01

    The function of monomeric GTPases of the RAS superfamily in fruit development and ripening has been partially characterized. Here the identification of peach (Prunus persica) small GTPases of the RAS superfamily expressed in fruit and the characterization of their expression profiles during fruit development are described. Extensive searches on expressed sequence tag (EST) databases led to the selection of a total of 24 genes from peach encoding proteins with significant similarity to Arabidopsis small GTPases. Sequence similarity analyses and identification of conserved motifs, diagnostic of specific RAS families and subfamilies, enabled bona fide assignment of fourteen PpRAB, seven PpARF/ARL/SAR, two PpROP and one PpRAN GTPases. Transcriptional expression profiles of peach monomeric GTPases, analysed by real-time quantitative reverse transcription-PCR, were obtained for mesocarp samples, collected in two consecutive years. Reproducible patterns of expression could be identified for five peach RAB-encoding genes (PpRABA1-1, PpRABA2, PpRABD2-1, PpRABD2-2, and PpRABC2), two ARFs (PpARFA1-1 and PpARLB1), and two ROPs (PpROP3 and PpROP4). Interestingly, the transient transcriptional up-regulation of PpARF genes and of PpRAB genes of the A and D clades, putatively controlling the exocytic delivery of cell wall components and modifying enzymes, appeared to coincide with peaks of growth speed and sugar accumulation and with the final phases of ripening. To our knowledge, this is the first description of the co-ordinated differential expression of a set of genes encoding small GTPases of the ARF and RAB families which takes place during key moments of fruit development and maturation. PMID:20501747

  4. Differential expression and clinical significance of glioblastoma mRNA expression profiles in Uyghur and Han patients in Xinjiang province.

    PubMed

    Liu, Liang; Li, Wenting; Xia, Haicheng; Zhu, Zhengquan; Luan, Xinping

    2014-11-24

    The aim of this study was to investigate differences in glioblastoma RNA gene expression profiles between Uyghur and Han patients in Xinjiang province and to screen and compare differentially expressed genes with respect to their clinical significance in the pathogenesis of high-grade glioma and their relationship to disease prognosis. Illumina HT-12mRNA expression profiles microarray was employed to measure the gene expression profiles of 6 patients with advanced glioma and to screen for differentially expressed genes. GO and KEGG analyses were performed on the differentially expressed genes using Web Gestalt software (P<0.05). Comparison of glioblastoma RNA expression profiles in the Uyghur and Han patients indicated that 1475 genes were significantly differentially expressed, of which 669 showed increased expression, while 807 showed decreased expression. One gene (STRC) corresponded to 2 transcripts, 1 of which showed increased expression and the other showed decreased expression. The differentially expressed genes participate in metabolic processes, biological regulation, stress response, and multi-cellular organic processes, including small GTPase regulatory signaling pathways, Ras signaling pathway, neuronal reactive protein regulation, and myelination of the central nervous system. The genes are also involved in tumor-related signaling pathways, including metabolic pathways, cancer pathways, MAPK signaling pathway, TGF-β signaling pathway, neurotrophic factor signal transduction pathway, and mTOR signaling pathway. Differentially expressed genes were screened by studying the gene expression profiles in glioblastoma from Uyghur and Han patients. The cellular function and location of these genes were further investigated. Based on related molecular markers of glioblastoma, the differences in the mechanism of initiation and development of glioblastoma between Uyghur and Han patients were investigated for polygenic interactions.

  5. Quantitation of Gene Expression in Formaldehyde-Fixed and Fluorescence-Activated Sorted Cells

    PubMed Central

    Russell, Julia N.; Clements, Janice E.; Gama, Lucio

    2013-01-01

    Fluorescence-activated cell sorting (FACS) is a sensitive and valuable technique to characterize cellular subpopulations and great advances have been made using this approach. Cells are often fixed with formaldehyde prior to the sorting process to preserve cell morphology and maintain the expression of surface molecules, as well as to ensure safety in the sorting of infected cells. It is widely recognized that formaldehyde fixation alters RNA and DNA structure and integrity, thus analyzing gene expression in these cells has been difficult. We therefore examined the effects of formaldehyde fixation on the stability and quantitation of nucleic acids in cell lines, primary leukocytes and also cells isolated from SIV-infected pigtailed macaques. We developed a method to extract RNA from fixed cells that yielded the same amount of RNA as our common method of RNA isolation from fresh cells. Quantitation of RNA by RT-qPCR in fixed cells was not always comparable with that in unfixed cells. In comparison, when RNA was measured by the probe-based NanoString system, there was no significant difference in RNA quantitation. In addition, we demonstrated that quantitation of proviral DNA in fixed cells by qPCR is comparable to that in unfixed cells when normalized by a single-copy cellular gene. These results provide a systematic procedure to quantitate gene expression in cells that have been fixed with formaldehyde and sorted by FACS. PMID:24023909

  6. Quantitative differentiation of normal and scarred tissues using second-harmonic generation microscopy.

    PubMed

    Yildirim, Murat; Quinn, Kyle P; Kobler, James B; Zeitels, Steven M; Georgakoudi, Irene; Ben-Yakar, Adela

    2016-11-01

    The aim of this study was to differentiate normal and scarred hamster cheek pouch samples by applying a quantitative image analysis technique for determining collagen fiber direction and density in second-harmonic generation microscopy images. This paper presents a collagen tissue analysis of scarred cheek pouches of four adult male Golden Syrian hamsters as an animal