Convergent and sequential synthesis designs: implications for conducting and reporting systematic reviews of qualitative and quantitative evidence.

PubMed

Hong, Quan Nha; Pluye, Pierre; Bujold, Mathieu; Wassef, Maggy

2017-03-23

Systematic reviews of qualitative and quantitative evidence can provide a rich understanding of complex phenomena. This type of review is increasingly popular, has been used to provide a landscape of existing knowledge, and addresses the types of questions not usually covered in reviews relying solely on either quantitative or qualitative evidence. Although several typologies of synthesis designs have been developed, none have been tested on a large sample of reviews. The aim of this review of reviews was to identify and develop a typology of synthesis designs and methods that have been used and to propose strategies for synthesizing qualitative and quantitative evidence. A review of systematic reviews combining qualitative and quantitative evidence was performed. Six databases were searched from inception to December 2014. Reviews were included if they were systematic reviews combining qualitative and quantitative evidence. The included reviews were analyzed according to three concepts of synthesis processes: (a) synthesis methods, (b) sequence of data synthesis, and (c) integration of data and synthesis results. A total of 459 reviews were included. The analysis of this literature highlighted a lack of transparency in reporting how evidence was synthesized and a lack of consistency in the terminology used. Two main types of synthesis designs were identified: convergent and sequential synthesis designs. Within the convergent synthesis design, three subtypes were found: (a) data-based convergent synthesis design, where qualitative and quantitative evidence is analyzed together using the same synthesis method, (b) results-based convergent synthesis design, where qualitative and quantitative evidence is analyzed separately using different synthesis methods and results of both syntheses are integrated during a final synthesis, and (c) parallel-results convergent synthesis design consisting of independent syntheses of qualitative and quantitative evidence and an interpretation of the results in the discussion. Performing systematic reviews of qualitative and quantitative evidence is challenging because of the multiple synthesis options. The findings provide guidance on how to combine qualitative and quantitative evidence. Also, recommendations are made to improve the conducting and reporting of this type of review.

Prediction of Environmental Impact of High-Energy Materials with Atomistic Computer Simulations

DTIC Science & Technology

2010-11-01

from a training set of compounds. Other methods include Quantitative Struc- ture-Activity Relationship ( QSAR ) and Quantitative Structure-Property...26 28 the development of QSPR/ QSAR models, in contrast to boiling points and critical parameters derived from empirical correlations, to improve...Quadratic Configuration Interaction Singles Doubles QSAR Quantitative Structure-Activity Relationship QSPR Quantitative Structure-Property

Comparative evaluation of two quantitative test methods for determining the efficacy of liquid sporicides and sterilants on a hard surface: a precollaborative study.

PubMed

Tomasino, Stephen F; Hamilton, Martin A

2007-01-01

Two quantitative carrier-based test methods for determining the efficacy of liquid sporicides and sterilants on a hard surface, the Standard Quantitative Carrier Test Method-ASTM E 2111-00 and an adaptation of a quantitative micro-method as reported by Sagripanti and Bonifacino, were compared in this study. The methods were selected based on their desirable characteristics (e.g., well-developed protocol, previous use with spores, fully quantitative, and use of readily available equipment) for testing liquid sporicides and sterilants on a hard surface. In this paper, the Sagripanti-Bonifacino procedure is referred to as the Three Step Method (TSM). AOAC Official Method 966.04 was included in this study as a reference method. Three laboratories participated in the evaluation. Three chemical treatments were tested: (1) 3000 ppm sodium hypochlorite with pH adjusted to 7.0, (2) a hydrogen peroxide/peroxyacetic acid product, and (3) 3000 ppm sodium hypochlorite with pH unadjusted (pH of approximately 10.0). A fourth treatment, 6000 ppm sodium hypochlorite solution with pH adjusted to 7.0, was included only for Method 966.04 as a positive control (high level of efficacy). The contact time was 10 min for all chemical treatments except the 6000 ppm sodium hypochlorite treatment which was tested at 30 min. Each chemical treatment was tested 3 times using each of the methods. Only 2 of the laboratories performed the AOAC method. Method performance was assessed by the within-laboratory variance, between-laboratory variance, and total variance associated with the log reduction (LR) estimates generated by each quantitative method. The quantitative methods performed similarly, and the LR values generated by each method were not statistically different for the 3 treatments evaluated. Based on feedback from the participating laboratories, compared to the TSM, ASTM E 2111-00 was more resource demanding and required more set-up time. The logistical and resource concerns identified for ASTM E 2111-00 were largely associated with the filtration process and counting bacterial colonies on filters. Thus, the TSM was determined to be the most suitable method.

A review of empirical research related to the use of small quantitative samples in clinical outcome scale development.

PubMed

Houts, Carrie R; Edwards, Michael C; Wirth, R J; Deal, Linda S

2016-11-01

There has been a notable increase in the advocacy of using small-sample designs as an initial quantitative assessment of item and scale performance during the scale development process. This is particularly true in the development of clinical outcome assessments (COAs), where Rasch analysis has been advanced as an appropriate statistical tool for evaluating the developing COAs using a small sample. We review the benefits such methods are purported to offer from both a practical and statistical standpoint and detail several problematic areas, including both practical and statistical theory concerns, with respect to the use of quantitative methods, including Rasch-consistent methods, with small samples. The feasibility of obtaining accurate information and the potential negative impacts of misusing large-sample statistical methods with small samples during COA development are discussed.

Diagnostic accuracy of stress perfusion CMR in comparison with quantitative coronary angiography: fully quantitative, semiquantitative, and qualitative assessment.

PubMed

Mordini, Federico E; Haddad, Tariq; Hsu, Li-Yueh; Kellman, Peter; Lowrey, Tracy B; Aletras, Anthony H; Bandettini, W Patricia; Arai, Andrew E

2014-01-01

This study's primary objective was to determine the sensitivity, specificity, and accuracy of fully quantitative stress perfusion cardiac magnetic resonance (CMR) versus a reference standard of quantitative coronary angiography. We hypothesized that fully quantitative analysis of stress perfusion CMR would have high diagnostic accuracy for identifying significant coronary artery stenosis and exceed the accuracy of semiquantitative measures of perfusion and qualitative interpretation. Relatively few studies apply fully quantitative CMR perfusion measures to patients with coronary disease and comparisons to semiquantitative and qualitative methods are limited. Dual bolus dipyridamole stress perfusion CMR exams were performed in 67 patients with clinical indications for assessment of myocardial ischemia. Stress perfusion images alone were analyzed with a fully quantitative perfusion (QP) method and 3 semiquantitative methods including contrast enhancement ratio, upslope index, and upslope integral. Comprehensive exams (cine imaging, stress/rest perfusion, late gadolinium enhancement) were analyzed qualitatively with 2 methods including the Duke algorithm and standard clinical interpretation. A 70% or greater stenosis by quantitative coronary angiography was considered abnormal. The optimum diagnostic threshold for QP determined by receiver-operating characteristic curve occurred when endocardial flow decreased to <50% of mean epicardial flow, which yielded a sensitivity of 87% and specificity of 93%. The area under the curve for QP was 92%, which was superior to semiquantitative methods: contrast enhancement ratio: 78%; upslope index: 82%; and upslope integral: 75% (p = 0.011, p = 0.019, p = 0.004 vs. QP, respectively). Area under the curve for QP was also superior to qualitative methods: Duke algorithm: 70%; and clinical interpretation: 78% (p < 0.001 and p < 0.001 vs. QP, respectively). Fully quantitative stress perfusion CMR has high diagnostic accuracy for detecting obstructive coronary artery disease. QP outperforms semiquantitative measures of perfusion and qualitative methods that incorporate a combination of cine, perfusion, and late gadolinium enhancement imaging. These findings suggest a potential clinical role for quantitative stress perfusion CMR. Copyright © 2014 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Behavioral Changes Based on a Course in Agroecology: A Mixed Methods Study

ERIC Educational Resources Information Center

Harms, Kristyn; King, James; Francis, Charles

2009-01-01

This study evaluated and described student perceptions of a course in agroecology to determine if participants experienced changed perceptions and behaviors resulting from the Agroecosystems Analysis course. A triangulation validating quantitative data mixed methods approach included a written survey comprised of both quantitative and open-ended…

A scoring system for appraising mixed methods research, and concomitantly appraising qualitative, quantitative and mixed methods primary studies in Mixed Studies Reviews.

PubMed

Pluye, Pierre; Gagnon, Marie-Pierre; Griffiths, Frances; Johnson-Lafleur, Janique

2009-04-01

A new form of literature review has emerged, Mixed Studies Review (MSR). These reviews include qualitative, quantitative and mixed methods studies. In the present paper, we examine MSRs in health sciences, and provide guidance on processes that should be included and reported. However, there are no valid and usable criteria for concomitantly appraising the methodological quality of the qualitative, quantitative and mixed methods studies. To propose criteria for concomitantly appraising the methodological quality of qualitative, quantitative and mixed methods studies or study components. A three-step critical review was conducted. 2322 references were identified in MEDLINE, and their titles and abstracts were screened; 149 potentially relevant references were selected and the full-text papers were examined; 59 MSRs were retained and scrutinized using a deductive-inductive qualitative thematic data analysis. This revealed three types of MSR: convenience, reproducible, and systematic. Guided by a proposal, we conducted a qualitative thematic data analysis of the quality appraisal procedures used in the 17 systematic MSRs (SMSRs). Of 17 SMSRs, 12 showed clear quality appraisal procedures with explicit criteria but no SMSR used valid checklists to concomitantly appraise qualitative, quantitative and mixed methods studies. In two SMSRs, criteria were developed following a specific procedure. Checklists usually contained more criteria than needed. In four SMSRs, a reliability assessment was described or mentioned. While criteria for quality appraisal were usually based on descriptors that require specific methodological expertise (e.g., appropriateness), no SMSR described the fit between reviewers' expertise and appraised studies. Quality appraisal usually resulted in studies being ranked by methodological quality. A scoring system is proposed for concomitantly appraising the methodological quality of qualitative, quantitative and mixed methods studies for SMSRs. This scoring system may also be used to appraise the methodological quality of qualitative, quantitative and mixed methods components of mixed methods research.

21 CFR 570.35 - Affirmation of generally recognized as safe (GRAS) status.

Code of Federal Regulations, 2010 CFR

2010-04-01

... to the NAS-NRC GRAS list survey (36 FR 20546), shall submit a petition for GRAS affirmation pursuant... included where applicable.) (g) Quantitative compositions. (h) Manufacturing process (excluding any trade... quantitative methods for determining the substance(s) in food, including the type of analytical procedures used...

21 CFR 570.35 - Affirmation of generally recognized as safe (GRAS) status.

Code of Federal Regulations, 2011 CFR

2011-04-01

... to the NAS-NRC GRAS list survey (36 FR 20546), shall submit a petition for GRAS affirmation pursuant... included where applicable.) (g) Quantitative compositions. (h) Manufacturing process (excluding any trade... quantitative methods for determining the substance(s) in food, including the type of analytical procedures used...

21 CFR 170.35 - Affirmation of generally recognized as safe (GRAS) status.

Code of Federal Regulations, 2014 CFR

2014-04-01

...), except those subject to the NAS/NRC GRAS list survey (36 FR 20546; October 23, 1971), shall submit a... Food Chemicals Codex monograph should be included where applicable.) (g) Quantitative compositions. (h..., including: (a) References to qualitative and quantitative methods for determining the substance(s) in food...

21 CFR 570.35 - Affirmation of generally recognized as safe (GRAS) status.

Code of Federal Regulations, 2013 CFR

2013-04-01

... to the NAS-NRC GRAS list survey (36 FR 20546), shall submit a petition for GRAS affirmation pursuant... included where applicable.) (g) Quantitative compositions. (h) Manufacturing process (excluding any trade... quantitative methods for determining the substance(s) in food, including the type of analytical procedures used...

21 CFR 570.35 - Affirmation of generally recognized as safe (GRAS) status.

Code of Federal Regulations, 2014 CFR

2014-04-01

... to the NAS-NRC GRAS list survey (36 FR 20546), shall submit a petition for GRAS affirmation pursuant... included where applicable.) (g) Quantitative compositions. (h) Manufacturing process (excluding any trade... quantitative methods for determining the substance(s) in food, including the type of analytical procedures used...

21 CFR 570.35 - Affirmation of generally recognized as safe (GRAS) status.

Code of Federal Regulations, 2012 CFR

2012-04-01

... to the NAS-NRC GRAS list survey (36 FR 20546), shall submit a petition for GRAS affirmation pursuant... included where applicable.) (g) Quantitative compositions. (h) Manufacturing process (excluding any trade... quantitative methods for determining the substance(s) in food, including the type of analytical procedures used...

Comparison study on qualitative and quantitative risk assessment methods for urban natural gas pipeline network.

PubMed

Han, Z Y; Weng, W G

2011-05-15

In this paper, a qualitative and a quantitative risk assessment methods for urban natural gas pipeline network are proposed. The qualitative method is comprised of an index system, which includes a causation index, an inherent risk index, a consequence index and their corresponding weights. The quantitative method consists of a probability assessment, a consequences analysis and a risk evaluation. The outcome of the qualitative method is a qualitative risk value, and for quantitative method the outcomes are individual risk and social risk. In comparison with previous research, the qualitative method proposed in this paper is particularly suitable for urban natural gas pipeline network, and the quantitative method takes different consequences of accidents into consideration, such as toxic gas diffusion, jet flame, fire ball combustion and UVCE. Two sample urban natural gas pipeline networks are used to demonstrate these two methods. It is indicated that both of the two methods can be applied to practical application, and the choice of the methods depends on the actual basic data of the gas pipelines and the precision requirements of risk assessment. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

A Targeted LC-MS/MS Method for the Simultaneous Detection and Quantitation of Egg, Milk, and Peanut Allergens in Sugar Cookies.

PubMed

Boo, Chelsea C; Parker, Christine H; Jackson, Lauren S

2018-01-01

Food allergy is a growing public health concern, with many individuals reporting allergies to multiple food sources. Compliance with food labeling regulations and prevention of inadvertent cross-contact in manufacturing requires the use of reliable methods for the detection and quantitation of allergens in processed foods. In this work, a novel liquid chromatography-tandem mass spectrometry multiple-reaction monitoring method for multiallergen detection and quantitation of egg, milk, and peanut was developed and evaluated in an allergen-incurred baked sugar cookie matrix. A systematic evaluation of method parameters, including sample extraction, concentration, and digestion, were optimized for candidate allergen peptide markers. The optimized method enabled the reliable detection and quantitation of egg, milk, and peanut allergens in sugar cookies, with allergen concentrations as low as 5 ppm allergen-incurred ingredient.

Q and you: The application of Q methodology in recreation research

Treesearch

Whitney Ward

2010-01-01

Researchers have used various qualitative and quantitative methods to deal with subjectivity in studying people's recreation experiences. Q methodology has been the most effective approach for analyzing both qualitative and quantitative aspects of experience, including attitudes or perceptions. The method is composed of two main components--Q sorting and Q factor...

Applying quantitative benefit-risk analysis to aid regulatory decision making in diagnostic imaging: methods, challenges, and opportunities.

PubMed

Agapova, Maria; Devine, Emily Beth; Bresnahan, Brian W; Higashi, Mitchell K; Garrison, Louis P

2014-09-01

Health agencies making regulatory marketing-authorization decisions use qualitative and quantitative approaches to assess expected benefits and expected risks associated with medical interventions. There is, however, no universal standard approach that regulatory agencies consistently use to conduct benefit-risk assessment (BRA) for pharmaceuticals or medical devices, including for imaging technologies. Economics, health services research, and health outcomes research use quantitative approaches to elicit preferences of stakeholders, identify priorities, and model health conditions and health intervention effects. Challenges to BRA in medical devices are outlined, highlighting additional barriers in radiology. Three quantitative methods--multi-criteria decision analysis, health outcomes modeling and stated-choice survey--are assessed using criteria that are important in balancing benefits and risks of medical devices and imaging technologies. To be useful in regulatory BRA, quantitative methods need to: aggregate multiple benefits and risks, incorporate qualitative considerations, account for uncertainty, and make clear whose preferences/priorities are being used. Each quantitative method performs differently across these criteria and little is known about how BRA estimates and conclusions vary by approach. While no specific quantitative method is likely to be the strongest in all of the important areas, quantitative methods may have a place in BRA of medical devices and radiology. Quantitative BRA approaches have been more widely applied in medicines, with fewer BRAs in devices. Despite substantial differences in characteristics of pharmaceuticals and devices, BRA methods may be as applicable to medical devices and imaging technologies as they are to pharmaceuticals. Further research to guide the development and selection of quantitative BRA methods for medical devices and imaging technologies is needed. Copyright © 2014 AUR. Published by Elsevier Inc. All rights reserved.

Accurate virus quantitation using a Scanning Transmission Electron Microscopy (STEM) detector in a scanning electron microscope.

PubMed

Blancett, Candace D; Fetterer, David P; Koistinen, Keith A; Morazzani, Elaine M; Monninger, Mitchell K; Piper, Ashley E; Kuehl, Kathleen A; Kearney, Brian J; Norris, Sarah L; Rossi, Cynthia A; Glass, Pamela J; Sun, Mei G

2017-10-01

A method for accurate quantitation of virus particles has long been sought, but a perfect method still eludes the scientific community. Electron Microscopy (EM) quantitation is a valuable technique because it provides direct morphology information and counts of all viral particles, whether or not they are infectious. In the past, EM negative stain quantitation methods have been cited as inaccurate, non-reproducible, and with detection limits that were too high to be useful. To improve accuracy and reproducibility, we have developed a method termed Scanning Transmission Electron Microscopy - Virus Quantitation (STEM-VQ), which simplifies sample preparation and uses a high throughput STEM detector in a Scanning Electron Microscope (SEM) coupled with commercially available software. In this paper, we demonstrate STEM-VQ with an alphavirus stock preparation to present the method's accuracy and reproducibility, including a comparison of STEM-VQ to viral plaque assay and the ViroCyt Virus Counter. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Comprehensive analysis of ß-lactam antibiotics including penicillins, cephalosporins, and carbapenems in poultry muscle using liquid chromatography coupled to tandem mass spectrometry.

PubMed

Berendsen, Bjorn J A; Gerritsen, Henk W; Wegh, Robin S; Lameris, Steven; van Sebille, Ralph; Stolker, Alida A M; Nielen, Michel W F

2013-09-01

A comprehensive method for the quantitative residue analysis of trace levels of 22 ß-lactam antibiotics, including penicillins, cephalosporins, and carbapenems, in poultry muscle by liquid chromatography in combination with tandem mass spectrometric detection is reported. The samples analyzed for ß-lactam residues are hydrolyzed using piperidine in order to improve compound stability and to include the total residue content of the cephalosporin ceftifour. The reaction procedure was optimized using a full experimental design. Following detailed isotope labeling, tandem mass spectrometry studies and exact mass measurements using high-resolution mass spectrometry reaction schemes could be proposed for all ß-lactams studied. The main reaction occurring is the hydrolysis of the ß-lactam ring under formation of the piperidine substituted amide. For some ß-lactams, multiple isobaric hydrolysis reaction products are obtained, in accordance with expectations, but this did not hamper quantitative analysis. The final method was fully validated as a quantitative confirmatory residue analysis method according to Commission Decision 2002/657/EC and showed satisfactory quantitative performance for all compounds with trueness between 80 and 110% and within-laboratory reproducibility below 22% at target level, except for biapenem. For biapenem, the method proved to be suitable for qualitative analysis only.

Comparison and evaluation of fusion methods used for GF-2 satellite image in coastal mangrove area

NASA Astrophysics Data System (ADS)

Ling, Chengxing; Ju, Hongbo; Liu, Hua; Zhang, Huaiqing; Sun, Hua

2018-04-01

GF-2 satellite is the highest spatial resolution Remote Sensing Satellite of the development history of China's satellite. In this study, three traditional fusion methods including Brovey, Gram-Schmidt and Color Normalized (CN were used to compare with the other new fusion method NNDiffuse, which used the qualitative assessment and quantitative fusion quality index, including information entropy, variance, mean gradient, deviation index, spectral correlation coefficient. Analysis results show that NNDiffuse method presented the optimum in qualitative and quantitative analysis. It had more effective for the follow up of remote sensing information extraction and forest, wetland resources monitoring applications.

Quantitative analysis of single-molecule superresolution images

PubMed Central

Coltharp, Carla; Yang, Xinxing; Xiao, Jie

2014-01-01

This review highlights the quantitative capabilities of single-molecule localization-based superresolution imaging methods. In addition to revealing fine structural details, the molecule coordinate lists generated by these methods provide the critical ability to quantify the number, clustering, and colocalization of molecules with 10 – 50 nm resolution. Here we describe typical workflows and precautions for quantitative analysis of single-molecule superresolution images. These guidelines include potential pitfalls and essential control experiments, allowing critical assessment and interpretation of superresolution images. PMID:25179006

Analysis of High School English Curriculum Materials through Rasch Measurement Model and Maxqda

ERIC Educational Resources Information Center

Batdi, Veli; Elaldi, Senel

2016-01-01

The purpose of the study is to analyze high school English curriculum materials (ECM) through FACETS analysis and MAXQDA-11 programs. The mixed methods approach, both quantitative and qualitative methods, were used in three samples including English teachers in Elazig during the 2014-2015 academic year. While the quantitative phase of the study…

Quantitative determination and validation of octreotide acetate using 1 H-NMR spectroscopy with internal standard method.

PubMed

Yu, Chen; Zhang, Qian; Xu, Peng-Yao; Bai, Yin; Shen, Wen-Bin; Di, Bin; Su, Meng-Xiang

2018-01-01

Quantitative nuclear magnetic resonance (qNMR) is a well-established technique in quantitative analysis. We presented a validated 1 H-qNMR method for assay of octreotide acetate, a kind of cyclic octopeptide. Deuterium oxide was used to remove the undesired exchangeable peaks, which was referred to as proton exchange, in order to make the quantitative signals isolated in the crowded spectrum of the peptide and ensure precise quantitative analysis. Gemcitabine hydrochloride was chosen as the suitable internal standard. Experimental conditions, including relaxation delay time, the numbers of scans, and pulse angle, were optimized first. Then method validation was carried out in terms of selectivity, stability, linearity, precision, and robustness. The assay result was compared with that by means of high performance liquid chromatography, which is provided by Chinese Pharmacopoeia. The statistical F test, Student's t test, and nonparametric test at 95% confidence level indicate that there was no significant difference between these two methods. qNMR is a simple and accurate quantitative tool with no need for specific corresponding reference standards. It has the potential of the quantitative analysis of other peptide drugs and standardization of the corresponding reference standards. Copyright © 2017 John Wiley & Sons, Ltd.

Targeted Quantitation of Proteins by Mass Spectrometry

PubMed Central

2013-01-01

Quantitative measurement of proteins is one of the most fundamental analytical tasks in a biochemistry laboratory, but widely used immunochemical methods often have limited specificity and high measurement variation. In this review, we discuss applications of multiple-reaction monitoring (MRM) mass spectrometry, which allows sensitive, precise quantitative analyses of peptides and the proteins from which they are derived. Systematic development of MRM assays is permitted by databases of peptide mass spectra and sequences, software tools for analysis design and data analysis, and rapid evolution of tandem mass spectrometer technology. Key advantages of MRM assays are the ability to target specific peptide sequences, including variants and modified forms, and the capacity for multiplexing that allows analysis of dozens to hundreds of peptides. Different quantitative standardization methods provide options that balance precision, sensitivity, and assay cost. Targeted protein quantitation by MRM and related mass spectrometry methods can advance biochemistry by transforming approaches to protein measurement. PMID:23517332

Targeted quantitation of proteins by mass spectrometry.

PubMed

Liebler, Daniel C; Zimmerman, Lisa J

2013-06-04

Quantitative measurement of proteins is one of the most fundamental analytical tasks in a biochemistry laboratory, but widely used immunochemical methods often have limited specificity and high measurement variation. In this review, we discuss applications of multiple-reaction monitoring (MRM) mass spectrometry, which allows sensitive, precise quantitative analyses of peptides and the proteins from which they are derived. Systematic development of MRM assays is permitted by databases of peptide mass spectra and sequences, software tools for analysis design and data analysis, and rapid evolution of tandem mass spectrometer technology. Key advantages of MRM assays are the ability to target specific peptide sequences, including variants and modified forms, and the capacity for multiplexing that allows analysis of dozens to hundreds of peptides. Different quantitative standardization methods provide options that balance precision, sensitivity, and assay cost. Targeted protein quantitation by MRM and related mass spectrometry methods can advance biochemistry by transforming approaches to protein measurement.

The need and approach for characterization - U.S. air force perspectives on materials state awareness

NASA Astrophysics Data System (ADS)

Aldrin, John C.; Lindgren, Eric A.

2018-04-01

This paper expands on the objective and motivation for NDE-based characterization and includes a discussion of the current approach using model-assisted inversion being pursued within the Air Force Research Laboratory (AFRL). This includes a discussion of the multiple model-based methods that can be used, including physics-based models, deep machine learning, and heuristic approaches. The benefits and drawbacks of each method is reviewed and the potential to integrate multiple methods is discussed. Initial successes are included to highlight the ability to obtain quantitative values of damage. Additional steps remaining to realize this capability with statistical metrics of accuracy are discussed, and how these results can be used to enable probabilistic life management are addressed. The outcome of this initiative will realize the long-term desired capability of NDE methods to provide quantitative characterization to accelerate certification of new materials and enhance life management of engineered systems.

RECENT ADVANCES IN QUANTITATIVE NEUROPROTEOMICS

PubMed Central

Craft, George E; Chen, Anshu; Nairn, Angus C

2014-01-01

The field of proteomics is undergoing rapid development in a number of different areas including improvements in mass spectrometric platforms, peptide identification algorithms and bioinformatics. In particular, new and/or improved approaches have established robust methods that not only allow for in-depth and accurate peptide and protein identification and modification, but also allow for sensitive measurement of relative or absolute quantitation. These methods are beginning to be applied to the area of neuroproteomics, but the central nervous system poses many specific challenges in terms of quantitative proteomics, given the large number of different neuronal cell types that are intermixed and that exhibit distinct patterns of gene and protein expression. This review highlights the recent advances that have been made in quantitative neuroproteomics, with a focus on work published over the last five years that applies emerging methods to normal brain function as well as to various neuropsychiatric disorders including schizophrenia and drug addiction as well as of neurodegenerative diseases including Parkinson’s disease and Alzheimer’s disease. While older methods such as two-dimensional polyacrylamide electrophoresis continued to be used, a variety of more in-depth MS-based approaches including both label (ICAT, iTRAQ, TMT, SILAC, SILAM), label-free (label-free, MRM, SWATH) and absolute quantification methods, are rapidly being applied to neurobiological investigations of normal and diseased brain tissue as well as of cerebrospinal fluid (CSF). While the biological implications of many of these studies remain to be clearly established, that there is a clear need for standardization of experimental design and data analysis, and that the analysis of protein changes in specific neuronal cell types in the central nervous system remains a serious challenge, it appears that the quality and depth of the more recent quantitative proteomics studies is beginning to shed light on a number of aspects of neuroscience that relates to normal brain function as well as of the changes in protein expression and regulation that occurs in neuropsychiatric and neurodegenerative disorders. PMID:23623823

Recent advances in quantitative neuroproteomics.

PubMed

Craft, George E; Chen, Anshu; Nairn, Angus C

2013-06-15

The field of proteomics is undergoing rapid development in a number of different areas including improvements in mass spectrometric platforms, peptide identification algorithms and bioinformatics. In particular, new and/or improved approaches have established robust methods that not only allow for in-depth and accurate peptide and protein identification and modification, but also allow for sensitive measurement of relative or absolute quantitation. These methods are beginning to be applied to the area of neuroproteomics, but the central nervous system poses many specific challenges in terms of quantitative proteomics, given the large number of different neuronal cell types that are intermixed and that exhibit distinct patterns of gene and protein expression. This review highlights the recent advances that have been made in quantitative neuroproteomics, with a focus on work published over the last five years that applies emerging methods to normal brain function as well as to various neuropsychiatric disorders including schizophrenia and drug addiction as well as of neurodegenerative diseases including Parkinson's disease and Alzheimer's disease. While older methods such as two-dimensional polyacrylamide electrophoresis continued to be used, a variety of more in-depth MS-based approaches including both label (ICAT, iTRAQ, TMT, SILAC, SILAM), label-free (label-free, MRM, SWATH) and absolute quantification methods, are rapidly being applied to neurobiological investigations of normal and diseased brain tissue as well as of cerebrospinal fluid (CSF). While the biological implications of many of these studies remain to be clearly established, that there is a clear need for standardization of experimental design and data analysis, and that the analysis of protein changes in specific neuronal cell types in the central nervous system remains a serious challenge, it appears that the quality and depth of the more recent quantitative proteomics studies is beginning to shed light on a number of aspects of neuroscience that relates to normal brain function as well as of the changes in protein expression and regulation that occurs in neuropsychiatric and neurodegenerative disorders. Copyright © 2013. Published by Elsevier Inc.

A method for the extraction and quantitation of phycoerythrin from algae

NASA Technical Reports Server (NTRS)

Stewart, D. E.

1982-01-01

A summary of a new technique for the extraction and quantitation of phycoerythrin (PHE) from algal samples is described. Results of analysis of four extracts representing three PHE types from algae including cryptomonad and cyanophyte types are presented. The method of extraction and an equation for quantitation are given. A graph showing the relationship of concentration and fluorescence units that may be used with samples fluorescing around 575-580 nm (probably dominated by cryptophytes in estuarine waters) and 560 nm (dominated by cyanophytes characteristics of the open ocean) is provided.

A thioacidolysis method tailored for higher-throughput quantitative analysis of lignin monomers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harman-Ware, Anne E.; Foster, Cliff; Happs, Renee M.

Thioacidolysis is a method used to measure the relative content of lignin monomers bound by β-O-4 linkages. Current thioacidolysis methods are low-throughput as they require tedious steps for reaction product concentration prior to analysis using standard GC methods. A quantitative thioacidolysis method that is accessible with general laboratory equipment and uses a non-chlorinated organic solvent and is tailored for higher-throughput analysis is reported. The method utilizes lignin arylglycerol monomer standards for calibration, requires 1-2 mg of biomass per assay and has been quantified using fast-GC techniques including a Low Thermal Mass Modular Accelerated Column Heater (LTM MACH). Cumbersome steps, includingmore » standard purification, sample concentrating and drying have been eliminated to help aid in consecutive day-to-day analyses needed to sustain a high sample throughput for large screening experiments without the loss of quantitation accuracy. As a result, the method reported in this manuscript has been quantitatively validated against a commonly used thioacidolysis method and across two different research sites with three common biomass varieties to represent hardwoods, softwoods, and grasses.« less

A thioacidolysis method tailored for higher-throughput quantitative analysis of lignin monomers

DOE PAGES

Harman-Ware, Anne E.; Foster, Cliff; Happs, Renee M.; ...

2016-09-14

Thioacidolysis is a method used to measure the relative content of lignin monomers bound by β-O-4 linkages. Current thioacidolysis methods are low-throughput as they require tedious steps for reaction product concentration prior to analysis using standard GC methods. A quantitative thioacidolysis method that is accessible with general laboratory equipment and uses a non-chlorinated organic solvent and is tailored for higher-throughput analysis is reported. The method utilizes lignin arylglycerol monomer standards for calibration, requires 1-2 mg of biomass per assay and has been quantified using fast-GC techniques including a Low Thermal Mass Modular Accelerated Column Heater (LTM MACH). Cumbersome steps, includingmore » standard purification, sample concentrating and drying have been eliminated to help aid in consecutive day-to-day analyses needed to sustain a high sample throughput for large screening experiments without the loss of quantitation accuracy. As a result, the method reported in this manuscript has been quantitatively validated against a commonly used thioacidolysis method and across two different research sites with three common biomass varieties to represent hardwoods, softwoods, and grasses.« less

Quantitative magnetic resonance imaging in traumatic brain injury.

PubMed

Bigler, E D

2001-04-01

Quantitative neuroimaging has now become a well-established method for analyzing magnetic resonance imaging in traumatic brain injury (TBI). A general review of studies that have examined quantitative changes following TBI is presented. The consensus of quantitative neuroimaging studies is that most brain structures demonstrate changes in volume or surface area after injury. The patterns of atrophy are consistent with the generalized nature of brain injury and diffuse axonal injury. Various clinical caveats are provided including how quantitative neuroimaging findings can be used clinically and in predicting rehabilitation outcome. The future of quantitative neuroimaging also is discussed.

Quantitative determination of atmospheric hydroperoxyl radical

DOEpatents

Springston, Stephen R.; Lloyd, Judith; Zheng, Jun

2007-10-23

A method for the quantitative determination of atmospheric hydroperoxyl radical comprising: (a) contacting a liquid phase atmospheric sample with a chemiluminescent compound which luminesces on contact with hydroperoxyl radical; (b) determining luminescence intensity from the liquid phase atmospheric sample; and (c) comparing said luminescence intensity from the liquid phase atmospheric sample to a standard luminescence intensity for hydroperoxyl radical. An apparatus for automating the method is also included.

Mixing qualitative and quantitative research in developmental science: uses and methodological choices.

PubMed

Yoshikawa, Hirokazu; Weisner, Thomas S; Kalil, Ariel; Way, Niobe

2008-03-01

Multiple methods are vital to understanding development as a dynamic, transactional process. This article focuses on the ways in which quantitative and qualitative methodologies can be combined to enrich developmental science and the study of human development, focusing on the practical questions of "when" and "how." Research situations that may be especially suited to mixing qualitative and quantitative approaches are described. The authors also discuss potential choices for using mixed quantitative- qualitative approaches in study design, sampling, construction of measures or interview protocols, collaborations, and data analysis relevant to developmental science. Finally, they discuss some common pitfalls that occur in mixing these methods and include suggestions for surmounting them.

Simple and rapid method for isolation and quantitation of polyhydroxyalkanoate by SDS-sonication treatment.

PubMed

Arikawa, Hisashi; Sato, Shunsuke; Fujiki, Tetsuya; Matsumoto, Keiji

2017-08-01

We developed a new method for isolation and quantitation of polyhydroxyalkanoate (PHA) from culture broth. In this method, the cells were sonicated in sodium dodecyl sulfate (SDS) solution and centrifuged to recover PHA. The recovered PHA was rinsed with deionized water and ethanol, and then weighed after drying. Hazardous chemicals such as chloroform, methanol, and sulfuric acid were not used, and no expensive analytical instruments were needed. We applied this method to Cupriavidus necator culture broths that included various amounts of poly(3-hydroxybutyrate) (PHB) or poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) (PHBHHx) from flasks and jar fermentors. The quantitation by this method was practical for use with a wide range of production amounts and PHA monomer compositions compared to the conventional whole-cell methanolysis method with gas chromatographic analysis, and besides, the recovered PHAs were adequately pure (≥96% purity). Therefore, this new method would be valuable not only for quantitation of PHA but also for preparation of samples to characterize their mechanical properties. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Quantitation of valve regurgitation severity by three-dimensional vena contracta area is superior to flow convergence method of quantitation on transesophageal echocardiography.

PubMed

Abudiab, Muaz M; Chao, Chieh-Ju; Liu, Shuang; Naqvi, Tasneem Z

2017-07-01

Quantitation of regurgitation severity using the proximal isovelocity acceleration (PISA) method to calculate effective regurgitant orifice (ERO) area has limitations. Measurement of three-dimensional (3D) vena contracta area (VCA) accurately grades mitral regurgitation (MR) severity on transthoracic echocardiography (TTE). We evaluated 3D VCA quantitation of regurgitant jet severity using 3D transesophageal echocardiography (TEE) in 110 native mitral, aortic, and tricuspid valves and six prosthetic valves in patients with at least mild valvular regurgitation. The ASE-recommended integrative method comprising semiquantitative and quantitative assessment of valvular regurgitation was used as a reference method, including ERO area by 2D PISA for assigning severity of regurgitation grade. Mean age was 62.2±14.4 years; 3D VCA quantitation was feasible in 91% regurgitant valves compared to 78% by the PISA method. When both methods were feasible and in the presence of a single regurgitant jet, 3D VCA and 2D PISA were similar in differentiating assigned severity (ANOVAP<.001). In valves with multiple jets, however, 3D VCA had a better correlation to assigned severity (ANOVAP<.0001). The agreement of 2D PISA and 3D VCA with the integrative method was 47% and 58% for moderate and 65% and 88% for severe regurgitation, respectively. Measurement of 3D VCA by TEE is superior to the 2D PISA method in determination of regurgitation severity in multiple native and prosthetic valves. © 2017, Wiley Periodicals, Inc.

The ACCE method: an approach for obtaining quantitative or qualitative estimates of residual confounding that includes unmeasured confounding

PubMed Central

Smith, Eric G.

2015-01-01

Background:  Nonrandomized studies typically cannot account for confounding from unmeasured factors.  Method:  A method is presented that exploits the recently-identified phenomenon of  “confounding amplification” to produce, in principle, a quantitative estimate of total residual confounding resulting from both measured and unmeasured factors.  Two nested propensity score models are constructed that differ only in the deliberate introduction of an additional variable(s) that substantially predicts treatment exposure.  Residual confounding is then estimated by dividing the change in treatment effect estimate between models by the degree of confounding amplification estimated to occur, adjusting for any association between the additional variable(s) and outcome. Results:  Several hypothetical examples are provided to illustrate how the method produces a quantitative estimate of residual confounding if the method’s requirements and assumptions are met.  Previously published data is used to illustrate that, whether or not the method routinely provides precise quantitative estimates of residual confounding, the method appears to produce a valuable qualitative estimate of the likely direction and general size of residual confounding. Limitations:  Uncertainties exist, including identifying the best approaches for: 1) predicting the amount of confounding amplification, 2) minimizing changes between the nested models unrelated to confounding amplification, 3) adjusting for the association of the introduced variable(s) with outcome, and 4) deriving confidence intervals for the method’s estimates (although bootstrapping is one plausible approach). Conclusions:  To this author’s knowledge, it has not been previously suggested that the phenomenon of confounding amplification, if such amplification is as predictable as suggested by a recent simulation, provides a logical basis for estimating total residual confounding. The method's basic approach is straightforward.  The method's routine usefulness, however, has not yet been established, nor has the method been fully validated. Rapid further investigation of this novel method is clearly indicated, given the potential value of its quantitative or qualitative output. PMID:25580226

PCR-free quantitative detection of genetically modified organism from raw materials – A novel electrochemiluminescence-based bio-barcode method

PubMed Central

Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R.

2018-01-01

Bio-barcode assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio-barcode assay requires lengthy experimental procedures including the preparation and release of barcode DNA probes from the target-nanoparticle complex, and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio-barcode assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2’2’-bipyridyl) ruthenium (TBR)-labele barcode DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products. PMID:18386909

PCR-free quantitative detection of genetically modified organism from raw materials. An electrochemiluminescence-based bio bar code method.

PubMed

Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R

2008-05-15

A bio bar code assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio bar code assay requires lengthy experimental procedures including the preparation and release of bar code DNA probes from the target-nanoparticle complex and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio bar code assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2,2'-bipyridyl) ruthenium (TBR)-labeled bar code DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products.

Is the worldview of qualitative inquiry a proper guide for psychological research?

PubMed

Capaldi, E J; Proctor, Robert W

2005-01-01

Qualitative methods are becoming increasingly popular in psychology. Although the distinction between qualitative and quantitative often is stated in terms of methods, the real distinction is between worldviews: that favored by most qualitative methodologists, which emphasizes subjective experience and multiple realities, and that commonly accepted in science. The worldview accepted by most adherents of qualitative inquiry suggests the exclusive use of methods that include verbal reports of lived experience. Qualitative methods serve an important function in psychology, but their use as recommended by their adherents is limited in 2 respects: The adherents use a narrow and unconventional approach to qualitative methods that differs from that normally understood, and they favor use of a restricted range of qualitative methods over other qualitative methods and quantitative methods. If qualitative inquiry is to make a greater contribution to psychology, researchers in that tradition must acquire a better understanding of contemporary science, correct their misunderstandings of the rationale for quantitative methods, and address the apparent limitations of their methods emphasizing reported experience.

Quantitative Assessment of In-solution Digestion Efficiency Identifies Optimal Protocols for Unbiased Protein Analysis*

PubMed Central

León, Ileana R.; Schwämmle, Veit; Jensen, Ole N.; Sprenger, Richard R.

2013-01-01

The majority of mass spectrometry-based protein quantification studies uses peptide-centric analytical methods and thus strongly relies on efficient and unbiased protein digestion protocols for sample preparation. We present a novel objective approach to assess protein digestion efficiency using a combination of qualitative and quantitative liquid chromatography-tandem MS methods and statistical data analysis. In contrast to previous studies we employed both standard qualitative as well as data-independent quantitative workflows to systematically assess trypsin digestion efficiency and bias using mitochondrial protein fractions. We evaluated nine trypsin-based digestion protocols, based on standard in-solution or on spin filter-aided digestion, including new optimized protocols. We investigated various reagents for protein solubilization and denaturation (dodecyl sulfate, deoxycholate, urea), several trypsin digestion conditions (buffer, RapiGest, deoxycholate, urea), and two methods for removal of detergents before analysis of peptides (acid precipitation or phase separation with ethyl acetate). Our data-independent quantitative liquid chromatography-tandem MS workflow quantified over 3700 distinct peptides with 96% completeness between all protocols and replicates, with an average 40% protein sequence coverage and an average of 11 peptides identified per protein. Systematic quantitative and statistical analysis of physicochemical parameters demonstrated that deoxycholate-assisted in-solution digestion combined with phase transfer allows for efficient, unbiased generation and recovery of peptides from all protein classes, including membrane proteins. This deoxycholate-assisted protocol was also optimal for spin filter-aided digestions as compared with existing methods. PMID:23792921

Genetic toxicology at the crossroads-from qualitative hazard evaluation to quantitative risk assessment.

PubMed

White, Paul A; Johnson, George E

2016-05-01

Applied genetic toxicology is undergoing a transition from qualitative hazard identification to quantitative dose-response analysis and risk assessment. To facilitate this change, the Health and Environmental Sciences Institute (HESI) Genetic Toxicology Technical Committee (GTTC) sponsored a workshop held in Lancaster, UK on July 10-11, 2014. The event included invited speakers from several institutions and the contents was divided into three themes-1: Point-of-departure Metrics for Quantitative Dose-Response Analysis in Genetic Toxicology; 2: Measurement and Estimation of Exposures for Better Extrapolation to Humans and 3: The Use of Quantitative Approaches in Genetic Toxicology for human health risk assessment (HHRA). A host of pertinent issues were discussed relating to the use of in vitro and in vivo dose-response data, the development of methods for in vitro to in vivo extrapolation and approaches to use in vivo dose-response data to determine human exposure limits for regulatory evaluations and decision-making. This Special Issue, which was inspired by the workshop, contains a series of papers that collectively address topics related to the aforementioned themes. The Issue includes contributions that collectively evaluate, describe and discuss in silico, in vitro, in vivo and statistical approaches that are facilitating the shift from qualitative hazard evaluation to quantitative risk assessment. The use and application of the benchmark dose approach was a central theme in many of the workshop presentations and discussions, and the Special Issue includes several contributions that outline novel applications for the analysis and interpretation of genetic toxicity data. Although the contents of the Special Issue constitutes an important step towards the adoption of quantitative methods for regulatory assessment of genetic toxicity, formal acceptance of quantitative methods for HHRA and regulatory decision-making will require consensus regarding the relationships between genetic damage and disease, and the concomitant ability to use genetic toxicity results per se. © Her Majesty the Queen in Right of Canada 2016. Reproduced with the permission of the Minister of Health.

Qualitative and Quantitative Analysis of the Major Constituents in Chinese Medical Preparation Lianhua-Qingwen Capsule by UPLC-DAD-QTOF-MS

PubMed Central

Jia, Weina; Wang, Chunhua; Wang, Yuefei; Pan, Guixiang; Jiang, Miaomiao; Li, Zheng; Zhu, Yan

2015-01-01

Lianhua-Qingwen capsule (LQC) is a commonly used Chinese medical preparation to treat viral influenza and especially played a very important role in the fight against severe acute respiratory syndrome (SARS) in 2002-2003 in China. In this paper, a rapid ultraperformance liquid chromatography coupled with diode-array detector and quadrupole time-of-flight mass spectrometry (UPLC-DAD-QTOF-MS) method was established for qualitative and quantitative analysis of the major constituents of LQC. A total of 61 compounds including flavonoids, phenylpropanoids, anthraquinones, triterpenoids, iridoids, and other types of compounds were unambiguously or tentatively identified by comparing the retention times and accurate mass measurement with reference compounds or literature data. Among them, twelve representative compounds were further quantified as chemical markers in quantitative analysis, including salidroside, chlorogenic acid, forsythoside E, cryptochlorogenic acid, amygdalin, sweroside, hyperin, rutin, forsythoside A, phillyrin, rhein, and glycyrrhizic acid. The UPLC-DAD method was evaluated with linearity, limit of detection (LOD), limit of quantification (LOQ), precision, stability, repeatability, and recovery tests. The results showed that the developed quantitative method was linear, sensitive, and precise for the quality control of LQC. PMID:25654135

Some Epistemological Considerations Concerning Quantitative Analysis

ERIC Educational Resources Information Center

Dobrescu, Emilian

2008-01-01

This article presents the author's address at the 2007 "Journal of Applied Quantitative Methods" ("JAQM") prize awarding festivity. The festivity was included in the opening of the 4th International Conference on Applied Statistics, November 22, 2008, Bucharest, Romania. In the address, the author reflects on three theses that…

40 CFR 125.95 - As an owner or operator of a Phase II existing facility, what must I collect and submit when I...

Code of Federal Regulations, 2010 CFR

2010-07-01

... appropriate for a quantitative survey and include consideration of the methods used in other studies performed... basis for any assumptions and quantitative estimates. If you plan to use an entrainment survival rate...

40 CFR 125.95 - As an owner or operator of a Phase II existing facility, what must I collect and submit when I...

Code of Federal Regulations, 2013 CFR

2013-07-01

... appropriate for a quantitative survey and include consideration of the methods used in other studies performed... basis for any assumptions and quantitative estimates. If you plan to use an entrainment survival rate...

40 CFR 125.95 - As an owner or operator of a Phase II existing facility, what must I collect and submit when I...

Code of Federal Regulations, 2014 CFR

2014-07-01

... appropriate for a quantitative survey and include consideration of the methods used in other studies performed... basis for any assumptions and quantitative estimates. If you plan to use an entrainment survival rate...

40 CFR 125.95 - As an owner or operator of a Phase II existing facility, what must I collect and submit when I...

Code of Federal Regulations, 2011 CFR

2011-07-01

... appropriate for a quantitative survey and include consideration of the methods used in other studies performed... basis for any assumptions and quantitative estimates. If you plan to use an entrainment survival rate...

40 CFR 125.95 - As an owner or operator of a Phase II existing facility, what must I collect and submit when I...

Code of Federal Regulations, 2012 CFR

2012-07-01

... appropriate for a quantitative survey and include consideration of the methods used in other studies performed... basis for any assumptions and quantitative estimates. If you plan to use an entrainment survival rate...

Perceptions of Mentoring: Examining the Experiences of Women Superintendents

ERIC Educational Resources Information Center

Copeland, Scarlett M.; Calhoun, Daniel W.

2014-01-01

This descriptive mixed methods study gathered both quantitative and qualitative data on the mentoring experiences of women superintendents in a Southeastern state. The quantitative participants included 39 women superintendents from this state and the qualitative portion of the study was comprised of eight female superintendents purposefully…

Linguistic complex networks as a young field of quantitative linguistics. Comment on "Approaching human language with complex networks" by J. Cong and H. Liu

NASA Astrophysics Data System (ADS)

Köhler, Reinhard

2014-12-01

We have long been used to the domination of qualitative methods in modern linguistics. Indeed, qualitative methods have advantages such as ease of use and wide applicability to many types of linguistic phenomena. However, this shall not overshadow the fact that a great part of human language is amenable to quantification. Moreover, qualitative methods may lead to over-simplification by employing the rigid yes/no scale. When variability and vagueness of human language must be taken into account, qualitative methods will prove inadequate and give way to quantitative methods [1, p. 11]. In addition to such advantages as exactness and precision, quantitative concepts and methods make it possible to find laws of human language which are just like those in natural sciences. These laws are fundamental elements of linguistic theories in the spirit of the philosophy of science [2,3]. Theorization effort of this type is what quantitative linguistics [1,4,5] is devoted to. The review of Cong and Liu [6] has provided an informative and insightful survey of linguistic complex networks as a young field of quantitative linguistics, including the basic concepts and measures, the major lines of research with linguistic motivation, and suggestions for future research.

Environmental Sustainability - Including Land and Water Use

EPA Science Inventory

Assessments of environmental sustainability can be conducted in many ways with one of the most quantitative methods including Life Cycle Impact Assessment (LCIA). While historically LCIA has included a comprehensive list of impact categories including: ozone depletion, global c...

Quantitative characterization of genetic parts and circuits for plant synthetic biology.

PubMed

Schaumberg, Katherine A; Antunes, Mauricio S; Kassaw, Tessema K; Xu, Wenlong; Zalewski, Christopher S; Medford, June I; Prasad, Ashok

2016-01-01

Plant synthetic biology promises immense technological benefits, including the potential development of a sustainable bio-based economy through the predictive design of synthetic gene circuits. Such circuits are built from quantitatively characterized genetic parts; however, this characterization is a significant obstacle in work with plants because of the time required for stable transformation. We describe a method for rapid quantitative characterization of genetic plant parts using transient expression in protoplasts and dual luciferase outputs. We observed experimental variability in transient-expression assays and developed a mathematical model to describe, as well as statistical normalization methods to account for, this variability, which allowed us to extract quantitative parameters. We characterized >120 synthetic parts in Arabidopsis and validated our method by comparing transient expression with expression in stably transformed plants. We also tested >100 synthetic parts in sorghum (Sorghum bicolor) protoplasts, and the results showed that our method works in diverse plant groups. Our approach enables the construction of tunable gene circuits in complex eukaryotic organisms.

Optical coherence tomography for the quantitative study of cerebrovascular physiology

PubMed Central

Srinivasan, Vivek J; Atochin, Dmitriy N; Radhakrishnan, Harsha; Jiang, James Y; Ruvinskaya, Svetlana; Wu, Weicheng; Barry, Scott; Cable, Alex E; Ayata, Cenk; Huang, Paul L; Boas, David A

2011-01-01

Doppler optical coherence tomography (DOCT) and OCT angiography are novel methods to investigate cerebrovascular physiology. In the rodent cortex, DOCT flow displays features characteristic of cerebral blood flow, including conservation along nonbranching vascular segments and at branch points. Moreover, DOCT flow values correlate with hydrogen clearance flow values when both are measured simultaneously. These data validate DOCT as a noninvasive quantitative method to measure tissue perfusion over a physiologic range. PMID:21364599

Family Adjustment to Childhood Cancer: A Systematic Review

ERIC Educational Resources Information Center

Long, Kristin A.; Marsland, Anna L.

2011-01-01

This systematic review integrates qualitative and quantitative research findings regarding family changes in the context of childhood cancer. Twenty-eight quantitative, 42 qualitative, and one mixed-method studies were reviewed. Included studies focused on family functioning, marital quality, and/or parenting in the context of pediatric cancer,…

Using Facebook as a LMS?

ERIC Educational Resources Information Center

Arabacioglu, Taner; Akar-Vural, Ruken

2014-01-01

The main purpose of this research was to compare the communication media according to effective teaching. For this purpose, in the research, the mixed method, including quantitative and qualitative data collecting techniques, was applied. For the quantitative part of the research, the static group comparison design was implemented as one of the…

21 CFR 170.35 - Affirmation of generally recognized as safe (GRAS) status.

Code of Federal Regulations, 2010 CFR

2010-04-01

... as provided in § 170.30(e), except those subject to the NAS/NRC GRAS list survey (36 FR 20546...) Quantitative compositions. (h) Manufacturing process (excluding any trade secrets). (ii) Use of the substance... the substance in food, including: (a) References to qualitative and quantitative methods for...

21 CFR 170.35 - Affirmation of generally recognized as safe (GRAS) status.

Code of Federal Regulations, 2012 CFR

2012-04-01

... as provided in § 170.30(e), except those subject to the NAS/NRC GRAS list survey (36 FR 20546...) Quantitative compositions. (h) Manufacturing process (excluding any trade secrets). (ii) Use of the substance... the substance in food, including: (a) References to qualitative and quantitative methods for...

21 CFR 170.35 - Affirmation of generally recognized as safe (GRAS) status.

Code of Federal Regulations, 2011 CFR

2011-04-01

... as provided in § 170.30(e), except those subject to the NAS/NRC GRAS list survey (36 FR 20546...) Quantitative compositions. (h) Manufacturing process (excluding any trade secrets). (ii) Use of the substance... the substance in food, including: (a) References to qualitative and quantitative methods for...

21 CFR 170.35 - Affirmation of generally recognized as safe (GRAS) status.

Code of Federal Regulations, 2013 CFR

2013-04-01

... as provided in § 170.30(e), except those subject to the NAS/NRC GRAS list survey (36 FR 20546...) Quantitative compositions. (h) Manufacturing process (excluding any trade secrets). (ii) Use of the substance... the substance in food, including: (a) References to qualitative and quantitative methods for...

Examining the Teachers' Emotional Labor Behavior

ERIC Educational Resources Information Center

Tösten, Rasim; Sahin, Çigdem Çelik

2017-01-01

The aim of this research is to investigate the teachers' emotional labour behaviours and to determine the reasons of the differences. In the research, mixed research methods including both quantitative and qualitative techniques were used. The population of the study was comprised of 280 teachers (266 for quantitative, 14 for qualitative…

Seniors' Online Communities: A Quantitative Content Analysis

ERIC Educational Resources Information Center

Nimrod, Galit

2010-01-01

Purpose: To examine the contents and characteristics of seniors' online communities and to explore their potential benefits to older adults. Design and Methods: Quantitative content analysis of a full year's data from 14 leading online communities using a novel computerized system. The overall database included 686,283 messages. Results: There was…

Light scattering application for quantitative estimation of apoptosis

NASA Astrophysics Data System (ADS)

Bilyy, Rostyslav O.; Stoika, Rostyslav S.; Getman, Vasyl B.; Bilyi, Olexander I.

2004-05-01

Estimation of cell proliferation and apoptosis are in focus of instrumental methods used in modern biomedical sciences. Present study concerns monitoring of functional state of cells, specifically the development of their programmed death or apoptosis. The available methods for such purpose are either very expensive, or require time-consuming operations. Their specificity and sensitivity are frequently not sufficient for making conclusions which could be used in diagnostics or treatment monitoring. We propose a novel method for apoptosis measurement based on quantitative determination of cellular functional state taking into account their physical characteristics. This method uses the patented device -- laser microparticle analyser PRM-6 -- for analyzing light scattering by the microparticles, including cells. The method gives an opportunity for quick, quantitative, simple (without complicated preliminary cell processing) and relatively cheap measurement of apoptosis in cellular population. The elaborated method was used for studying apoptosis expression in murine leukemia cells of L1210 line and human lymphoblastic leukemia cells of K562 line. The results obtained by the proposed method permitted measuring cell number in tested sample, detecting and quantitative characterization of functional state of cells, particularly measuring the ratio of the apoptotic cells in suspension.

Combining qualitative and quantitative research within mixed method research designs: a methodological review.

PubMed

Östlund, Ulrika; Kidd, Lisa; Wengström, Yvonne; Rowa-Dewar, Neneh

2011-03-01

It has been argued that mixed methods research can be useful in nursing and health science because of the complexity of the phenomena studied. However, the integration of qualitative and quantitative approaches continues to be one of much debate and there is a need for a rigorous framework for designing and interpreting mixed methods research. This paper explores the analytical approaches (i.e. parallel, concurrent or sequential) used in mixed methods studies within healthcare and exemplifies the use of triangulation as a methodological metaphor for drawing inferences from qualitative and quantitative findings originating from such analyses. This review of the literature used systematic principles in searching CINAHL, Medline and PsycINFO for healthcare research studies which employed a mixed methods approach and were published in the English language between January 1999 and September 2009. In total, 168 studies were included in the results. Most studies originated in the United States of America (USA), the United Kingdom (UK) and Canada. The analytic approach most widely used was parallel data analysis. A number of studies used sequential data analysis; far fewer studies employed concurrent data analysis. Very few of these studies clearly articulated the purpose for using a mixed methods design. The use of the methodological metaphor of triangulation on convergent, complementary, and divergent results from mixed methods studies is exemplified and an example of developing theory from such data is provided. A trend for conducting parallel data analysis on quantitative and qualitative data in mixed methods healthcare research has been identified in the studies included in this review. Using triangulation as a methodological metaphor can facilitate the integration of qualitative and quantitative findings, help researchers to clarify their theoretical propositions and the basis of their results. This can offer a better understanding of the links between theory and empirical findings, challenge theoretical assumptions and develop new theory. Copyright © 2010 Elsevier Ltd. All rights reserved.

Model-Based Linkage Analysis of a Quantitative Trait.

PubMed

Song, Yeunjoo E; Song, Sunah; Schnell, Audrey H

2017-01-01

Linkage Analysis is a family-based method of analysis to examine whether any typed genetic markers cosegregate with a given trait, in this case a quantitative trait. If linkage exists, this is taken as evidence in support of a genetic basis for the trait. Historically, linkage analysis was performed using a binary disease trait, but has been extended to include quantitative disease measures. Quantitative traits are desirable as they provide more information than binary traits. Linkage analysis can be performed using single-marker methods (one marker at a time) or multipoint (using multiple markers simultaneously). In model-based linkage analysis the genetic model for the trait of interest is specified. There are many software options for performing linkage analysis. Here, we use the program package Statistical Analysis for Genetic Epidemiology (S.A.G.E.). S.A.G.E. was chosen because it also includes programs to perform data cleaning procedures and to generate and test genetic models for a quantitative trait, in addition to performing linkage analysis. We demonstrate in detail the process of running the program LODLINK to perform single-marker analysis, and MLOD to perform multipoint analysis using output from SEGREG, where SEGREG was used to determine the best fitting statistical model for the trait.

Prediction of Solvent Physical Properties using the Hierarchical Clustering Method

EPA Science Inventory

Recently a QSAR (Quantitative Structure Activity Relationship) method, the hierarchical clustering method, was developed to estimate acute toxicity values for large, diverse datasets. This methodology has now been applied to the estimate solvent physical properties including sur...

General Methods for Evolutionary Quantitative Genetic Inference from Generalized Mixed Models.

PubMed

de Villemereuil, Pierre; Schielzeth, Holger; Nakagawa, Shinichi; Morrissey, Michael

2016-11-01

Methods for inference and interpretation of evolutionary quantitative genetic parameters, and for prediction of the response to selection, are best developed for traits with normal distributions. Many traits of evolutionary interest, including many life history and behavioral traits, have inherently nonnormal distributions. The generalized linear mixed model (GLMM) framework has become a widely used tool for estimating quantitative genetic parameters for nonnormal traits. However, whereas GLMMs provide inference on a statistically convenient latent scale, it is often desirable to express quantitative genetic parameters on the scale upon which traits are measured. The parameters of fitted GLMMs, despite being on a latent scale, fully determine all quantities of potential interest on the scale on which traits are expressed. We provide expressions for deriving each of such quantities, including population means, phenotypic (co)variances, variance components including additive genetic (co)variances, and parameters such as heritability. We demonstrate that fixed effects have a strong impact on those parameters and show how to deal with this by averaging or integrating over fixed effects. The expressions require integration of quantities determined by the link function, over distributions of latent values. In general cases, the required integrals must be solved numerically, but efficient methods are available and we provide an implementation in an R package, QGglmm. We show that known formulas for quantities such as heritability of traits with binomial and Poisson distributions are special cases of our expressions. Additionally, we show how fitted GLMM can be incorporated into existing methods for predicting evolutionary trajectories. We demonstrate the accuracy of the resulting method for evolutionary prediction by simulation and apply our approach to data from a wild pedigreed vertebrate population. Copyright © 2016 de Villemereuil et al.

Optofluidic time-stretch quantitative phase microscopy.

PubMed

Guo, Baoshan; Lei, Cheng; Wu, Yi; Kobayashi, Hirofumi; Ito, Takuro; Yalikun, Yaxiaer; Lee, Sangwook; Isozaki, Akihiro; Li, Ming; Jiang, Yiyue; Yasumoto, Atsushi; Di Carlo, Dino; Tanaka, Yo; Yatomi, Yutaka; Ozeki, Yasuyuki; Goda, Keisuke

2018-03-01

Innovations in optical microscopy have opened new windows onto scientific research, industrial quality control, and medical practice over the last few decades. One of such innovations is optofluidic time-stretch quantitative phase microscopy - an emerging method for high-throughput quantitative phase imaging that builds on the interference between temporally stretched signal and reference pulses by using dispersive properties of light in both spatial and temporal domains in an interferometric configuration on a microfluidic platform. It achieves the continuous acquisition of both intensity and phase images with a high throughput of more than 10,000 particles or cells per second by overcoming speed limitations that exist in conventional quantitative phase imaging methods. Applications enabled by such capabilities are versatile and include characterization of cancer cells and microalgal cultures. In this paper, we review the principles and applications of optofluidic time-stretch quantitative phase microscopy and discuss its future perspective. Copyright © 2017 Elsevier Inc. All rights reserved.

Radiologic methods of evaluating generalized osteopenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schneider, R.

1984-10-01

Noninvasive methods of evaluating generalized osteopenia include radiography, radionuclide studies, and various quantitative studies. These methods differ in availability, cost, accuracy, precision, radiation dose, and information supplied about bony change. A combination of methods is necessary to detect and follow the course and treatment of osteopenia.

Quantitation of TGF-beta1 mRNA in porcine mesangial cells by comparative kinetic RT/PCR: comparison with ribonuclease protection assay and in situ hybridization.

PubMed

Ceol, M; Forino, M; Gambaro, G; Sauer, U; Schleicher, E D; D'Angelo, A; Anglani, F

2001-01-01

Gene expression can be examined with different techniques including ribonuclease protection assay (RPA), in situ hybridisation (ISH), and quantitative reverse transcription-polymerase chain reaction (RT/PCR). These methods differ considerably in their sensitivity and precision in detecting and quantifying low abundance mRNA. Although there is evidence that RT/PCR can be performed in a quantitative manner, the quantitative capacity of this method is generally underestimated. To demonstrate that the comparative kinetic RT/PCR strategy-which uses a housekeeping gene as internal standard-is a quantitative method to detect significant differences in mRNA levels between different samples, the inhibitory effect of heparin on phorbol 12-myristate 13-acetate (PMA)-induced-TGF-beta1 mRNA expression was evaluated by RT/PCR and RPA, the standard method of mRNA quantification, and the results were compared. The reproducibility of RT/PCR amplification was calculated by comparing the quantity of G3PDH and TGF-beta1 PCR products, generated during the exponential phases, estimated from two different RT/PCR (G3PDH, r = 0.968, P = 0.0000; TGF-beta1, r = 0.966, P = 0.0000). The quantitative capacity of comparative kinetic RT/PCR was demonstrated by comparing the results obtained from RPA and RT/PCR using linear regression analysis. Starting from the same RNA extraction, but using only 1% of the RNA for the RT/PCR compared to RPA, significant correlation was observed (r = 0.984, P = 0.0004). Moreover the morphometric analysis of ISH signal was applied for the semi-quantitative evaluation of the expression and localisation of TGF-beta1 mRNA in the entire cell population. Our results demonstrate the close similarity of the RT/PCR and RPA methods in giving quantitative information on mRNA expression and indicate the possibility to adopt the comparative kinetic RT/PCR as reliable quantitative method of mRNA analysis. Copyright 2001 Wiley-Liss, Inc.

Semi-quantitative methods yield greater inter- and intraobserver agreement than subjective methods for interpreting 99m technetium-hydroxymethylene-diphosphonate uptake in equine thoracic processi spinosi.

PubMed

van Zadelhoff, Claudia; Ehrle, Anna; Merle, Roswitha; Jahn, Werner; Lischer, Christoph

2018-05-09

Scintigraphy is a standard diagnostic method for evaluating horses with back pain due to suspected thoracic processus spinosus pathology. Lesion detection is based on subjective or semi-quantitative assessments of increased uptake. This retrospective, analytical study is aimed to compare semi-quantitative and subjective methods in the evaluation of scintigraphic images of the processi spinosi in the equine thoracic spine. Scintigraphic images of 20 Warmblood horses, presented for assessment of orthopedic conditions between 2014 and 2016, were included in the study. Randomized, blinded image evaluation was performed by 11 veterinarians using subjective and semi-quantitative methods. Subjective grading was performed for the analysis of red-green-blue and grayscale scintigraphic images, which were presented in full-size or as masked images. For the semi-quantitative assessment, observers placed regions of interest over each processus spinosus. The uptake ratio of each processus spinosus in comparison to a reference region of interest was determined. Subsequently, a modified semi-quantitative calculation was developed whereby only the highest counts-per-pixel for a specified number of pixels was processed. Inter- and intraobserver agreement was calculated using intraclass correlation coefficients. Inter- and intraobserver intraclass correlation coefficients were 41.65% and 71.39%, respectively, for the subjective image assessment. Additionally, a correlation between intraobserver agreement, experience, and grayscale images was identified. The inter- and intraobserver agreement was significantly increased when using semi-quantitative analysis (97.35% and 98.36%, respectively) or the modified semi-quantitative calculation (98.61% and 98.82%, respectively). The proposed modified semi-quantitative technique showed a higher inter- and intraobserver agreement when compared to other methods, which makes it a useful tool for the analysis of scintigraphic images. The association of the findings from this study with clinical and radiological examinations requires further investigation. © 2018 American College of Veterinary Radiology.

Quantitative ultrasonic evaluation of concrete structures using one-sided access

NASA Astrophysics Data System (ADS)

Khazanovich, Lev; Hoegh, Kyle

2016-02-01

Nondestructive diagnostics of concrete structures is an important and challenging problem. A recent introduction of array ultrasonic dry point contact transducer systems offers opportunities for quantitative assessment of the subsurface condition of concrete structures, including detection of defects and inclusions. The methods described in this paper are developed for signal interpretation of shear wave impulse response time histories from multiple fixed distance transducer pairs in a self-contained ultrasonic linear array. This included generalizing Kirchoff migration-based synthetic aperture focusing technique (SAFT) reconstruction methods to handle the spatially diverse transducer pair locations, creating expanded virtual arrays with associated reconstruction methods, and creating automated reconstruction interpretation methods for reinforcement detection and stochastic flaw detection. Interpretation of the reconstruction techniques developed in this study were validated using the results of laboratory and field forensic studies. Applicability of the developed methods for solving practical engineering problems was demonstrated.

DNA DAMAGE QUANTITATION BY ALKALINE GEL ELECTROPHORESIS.

DOE Office of Scientific and Technical Information (OSTI.GOV)

SUTHERLAND,B.M.; BENNETT,P.V.; SUTHERLAND, J.C.

2004-03-24

Physical and chemical agents in the environment, those used in clinical applications, or encountered during recreational exposures to sunlight, induce damages in DNA. Understanding the biological impact of these agents requires quantitation of the levels of such damages in laboratory test systems as well as in field or clinical samples. Alkaline gel electrophoresis provides a sensitive (down to {approx} a few lesions/5Mb), rapid method of direct quantitation of a wide variety of DNA damages in nanogram quantities of non-radioactive DNAs from laboratory, field, or clinical specimens, including higher plants and animals. This method stems from velocity sedimentation studies of DNAmore » populations, and from the simple methods of agarose gel electrophoresis. Our laboratories have developed quantitative agarose gel methods, analytical descriptions of DNA migration during electrophoresis on agarose gels (1-6), and electronic imaging for accurate determinations of DNA mass (7-9). Although all these components improve sensitivity and throughput of large numbers of samples (7,8,10), a simple version using only standard molecular biology equipment allows routine analysis of DNA damages at moderate frequencies. We present here a description of the methods, as well as a brief description of the underlying principles, required for a simplified approach to quantitation of DNA damages by alkaline gel electrophoresis.« less

Constrained CVT meshes and a comparison of triangular mesh generators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Hoa; Burkardt, John; Gunzburger, Max

2009-01-01

Mesh generation in regions in Euclidean space is a central task in computational science, and especially for commonly used numerical methods for the solution of partial differential equations, e.g., finite element and finite volume methods. We focus on the uniform Delaunay triangulation of planar regions and, in particular, on how one selects the positions of the vertices of the triangulation. We discuss a recently developed method, based on the centroidal Voronoi tessellation (CVT) concept, for effecting such triangulations and present two algorithms, including one new one, for CVT-based grid generation. We also compare several methods, including CVT-based methods, for triangulatingmore » planar domains. To this end, we define several quantitative measures of the quality of uniform grids. We then generate triangulations of several planar regions, including some having complexities that are representative of what one may encounter in practice. We subject the resulting grids to visual and quantitative comparisons and conclude that all the methods considered produce high-quality uniform grids and that the CVT-based grids are at least as good as any of the others.« less

Photogrammetry Applied to Wind Tunnel Testing

NASA Technical Reports Server (NTRS)

Liu, Tian-Shu; Cattafesta, L. N., III; Radeztsky, R. H.; Burner, A. W.

2000-01-01

In image-based measurements, quantitative image data must be mapped to three-dimensional object space. Analytical photogrammetric methods, which may be used to accomplish this task, are discussed from the viewpoint of experimental fluid dynamicists. The Direct Linear Transformation (DLT) for camera calibration, used in pressure sensitive paint, is summarized. An optimization method for camera calibration is developed that can be used to determine the camera calibration parameters, including those describing lens distortion, from a single image. Combined with the DLT method, this method allows a rapid and comprehensive in-situ camera calibration and therefore is particularly useful for quantitative flow visualization and other measurements such as model attitude and deformation in production wind tunnels. The paper also includes a brief description of typical photogrammetric applications to temperature- and pressure-sensitive paint measurements and model deformation measurements in wind tunnels.

Systems Biology in Immunology – A Computational Modeling Perspective

PubMed Central

Germain, Ronald N.; Meier-Schellersheim, Martin; Nita-Lazar, Aleksandra; Fraser, Iain D. C.

2011-01-01

Systems biology is an emerging discipline that combines high-content, multiplexed measurements with informatic and computational modeling methods to better understand biological function at various scales. Here we present a detailed review of the methods used to create computational models and conduct simulations of immune function, We provide descriptions of the key data gathering techniques employed to generate the quantitative and qualitative data required for such modeling and simulation and summarize the progress to date in applying these tools and techniques to questions of immunological interest, including infectious disease. We include comments on what insights modeling can provide that complement information obtained from the more familiar experimental discovery methods used by most investigators and why quantitative methods are needed to eventually produce a better understanding of immune system operation in health and disease. PMID:21219182

Abseq: Ultrahigh-throughput single cell protein profiling with droplet microfluidic barcoding.

PubMed

Shahi, Payam; Kim, Samuel C; Haliburton, John R; Gartner, Zev J; Abate, Adam R

2017-03-14

Proteins are the primary effectors of cellular function, including cellular metabolism, structural dynamics, and information processing. However, quantitative characterization of proteins at the single-cell level is challenging due to the tiny amount of protein available. Here, we present Abseq, a method to detect and quantitate proteins in single cells at ultrahigh throughput. Like flow and mass cytometry, Abseq uses specific antibodies to detect epitopes of interest; however, unlike these methods, antibodies are labeled with sequence tags that can be read out with microfluidic barcoding and DNA sequencing. We demonstrate this novel approach by characterizing surface proteins of different cell types at the single-cell level and distinguishing between the cells by their protein expression profiles. DNA-tagged antibodies provide multiple advantages for profiling proteins in single cells, including the ability to amplify low-abundance tags to make them detectable with sequencing, to use molecular indices for quantitative results, and essentially limitless multiplexing.

Abseq: Ultrahigh-throughput single cell protein profiling with droplet microfluidic barcoding

NASA Astrophysics Data System (ADS)

Shahi, Payam; Kim, Samuel C.; Haliburton, John R.; Gartner, Zev J.; Abate, Adam R.

2017-03-01

Proteins are the primary effectors of cellular function, including cellular metabolism, structural dynamics, and information processing. However, quantitative characterization of proteins at the single-cell level is challenging due to the tiny amount of protein available. Here, we present Abseq, a method to detect and quantitate proteins in single cells at ultrahigh throughput. Like flow and mass cytometry, Abseq uses specific antibodies to detect epitopes of interest; however, unlike these methods, antibodies are labeled with sequence tags that can be read out with microfluidic barcoding and DNA sequencing. We demonstrate this novel approach by characterizing surface proteins of different cell types at the single-cell level and distinguishing between the cells by their protein expression profiles. DNA-tagged antibodies provide multiple advantages for profiling proteins in single cells, including the ability to amplify low-abundance tags to make them detectable with sequencing, to use molecular indices for quantitative results, and essentially limitless multiplexing.

Abseq: Ultrahigh-throughput single cell protein profiling with droplet microfluidic barcoding

PubMed Central

Shahi, Payam; Kim, Samuel C.; Haliburton, John R.; Gartner, Zev J.; Abate, Adam R.

2017-01-01

Proteins are the primary effectors of cellular function, including cellular metabolism, structural dynamics, and information processing. However, quantitative characterization of proteins at the single-cell level is challenging due to the tiny amount of protein available. Here, we present Abseq, a method to detect and quantitate proteins in single cells at ultrahigh throughput. Like flow and mass cytometry, Abseq uses specific antibodies to detect epitopes of interest; however, unlike these methods, antibodies are labeled with sequence tags that can be read out with microfluidic barcoding and DNA sequencing. We demonstrate this novel approach by characterizing surface proteins of different cell types at the single-cell level and distinguishing between the cells by their protein expression profiles. DNA-tagged antibodies provide multiple advantages for profiling proteins in single cells, including the ability to amplify low-abundance tags to make them detectable with sequencing, to use molecular indices for quantitative results, and essentially limitless multiplexing. PMID:28290550

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Full skin quantitative optical coherence elastography achieved by combining vibration and surface acoustic wave methods

NASA Astrophysics Data System (ADS)

Li, Chunhui; Guan, Guangying; Huang, Zhihong; Wang, Ruikang K.; Nabi, Ghulam

2015-03-01

By combining with the phase sensitive optical coherence tomography (PhS-OCT), vibration and surface acoustic wave (SAW) methods have been reported to provide elastography of skin tissue respectively. However, neither of these two methods can provide the elastography in full skin depth in current systems. This paper presents a feasibility study on an optical coherence elastography method which combines both vibration and SAW in order to give the quantitative mechanical properties of skin tissue with full depth range, including epidermis, dermis and subcutaneous fat. Experiments are carried out on layered tissue mimicking phantoms and in vivo human forearm and palm skin. A ring actuator generates vibration while a line actuator were used to excited SAWs. A PhS-OCT system is employed to provide the ultrahigh sensitive measurement of the generated waves. The experimental results demonstrate that by the combination of vibration and SAW method the full skin bulk mechanical properties can be quantitatively measured and further the elastography can be obtained with a sensing depth from ~0mm to ~4mm. This method is promising to apply in clinics where the quantitative elasticity of localized skin diseases is needed to aid the diagnosis and treatment.

Conflicts Management Model in School: A Mixed Design Study

ERIC Educational Resources Information Center

Dogan, Soner

2016-01-01

The object of this study is to evaluate the reasons for conflicts occurring in school according to perceptions and views of teachers and resolution strategies used for conflicts and to build a model based on the results obtained. In the research, explanatory design including quantitative and qualitative methods has been used. The quantitative part…

Determination of Factors Affecting Preschool Teacher Candidates' Attitudes towards Science Teaching

ERIC Educational Resources Information Center

Timur, Betul

2012-01-01

The purpose of this study was to determine preschool teacher candidates' attitudes towards science teaching and to examine the reasons behind their attitudes in depth. In this study, mixed methods were used including quantitative and qualitative data. Quantitative data gained by attitudes towards science teaching scale, qualitative data gained by…

Quantitative measures for redox signaling.

PubMed

Pillay, Ché S; Eagling, Beatrice D; Driscoll, Scott R E; Rohwer, Johann M

2016-07-01

Redox signaling is now recognized as an important regulatory mechanism for a number of cellular processes including the antioxidant response, phosphokinase signal transduction and redox metabolism. While there has been considerable progress in identifying the cellular machinery involved in redox signaling, quantitative measures of redox signals have been lacking, limiting efforts aimed at understanding and comparing redox signaling under normoxic and pathogenic conditions. Here we have outlined some of the accepted principles for redox signaling, including the description of hydrogen peroxide as a signaling molecule and the role of kinetics in conferring specificity to these signaling events. Based on these principles, we then develop a working definition for redox signaling and review a number of quantitative methods that have been employed to describe signaling in other systems. Using computational modeling and published data, we show how time- and concentration- dependent analyses, in particular, could be used to quantitatively describe redox signaling and therefore provide important insights into the functional organization of redox networks. Finally, we consider some of the key challenges with implementing these methods. Copyright © 2016 Elsevier Inc. All rights reserved.

Orthogonal Comparison of GC-MS and 1H NMR Spectroscopy for Short Chain Fatty Acid Quantitation.

PubMed

Cai, Jingwei; Zhang, Jingtao; Tian, Yuan; Zhang, Limin; Hatzakis, Emmanuel; Krausz, Kristopher W; Smith, Philip B; Gonzalez, Frank J; Patterson, Andrew D

2017-08-01

Short chain fatty acids (SCFAs) are important regulators of host physiology and metabolism and may contribute to obesity and associated metabolic diseases. Interest in SCFAs has increased in part due to the recognized importance of how production of SCFAs by the microbiota may signal to the host. Therefore, reliable, reproducible, and affordable methods for SCFA profiling are required for accurate identification and quantitation. In the current study, four different methods for SCFA (acetic acid, propionic acid, and butyric acid) extraction and quantitation were compared using two independent platforms including gas chromatography coupled with mass spectrometry (GC-MS) and 1 H nuclear magnetic resonance (NMR) spectroscopy. Sensitivity, recovery, repeatability, matrix effect, and validation using mouse fecal samples were determined across all methods. The GC-MS propyl esterification method exhibited superior sensitivity for acetic acid and butyric acid measurement (LOD < 0.01 μg mL -1 , LOQ < 0.1 μg mL -1 ) and recovery accuracy (99.4%-108.3% recovery rate for 100 μg mL -1 SCFA mixed standard spike in and 97.8%-101.8% recovery rate for 250 μg mL -1 SCFAs mixed standard spike in). NMR methods by either quantitation relative to an internal standard or quantitation using a calibration curve yielded better repeatability and minimal matrix effects compared to GC-MS methods. All methods generated good calibration curve linearity (R 2 > 0.99) and comparable measurement of fecal SCFA concentration. Lastly, these methods were used to quantitate fecal SCFAs obtained from conventionally raised (CONV-R) and germ free (GF) mice. Results from global metabolomic analysis of feces generated by 1 H NMR and bomb calorimetry were used to further validate these approaches.

Critical Appraisal of Mixed Methods Studies

ERIC Educational Resources Information Center

Heyvaert, Mieke; Hannes, Karin; Maes, Bea; Onghena, Patrick

2013-01-01

In several subdomains of the social, behavioral, health, and human sciences, research questions are increasingly answered through mixed methods studies, combining qualitative and quantitative evidence and research elements. Accordingly, the importance of including those primary mixed methods research articles in systematic reviews grows. It is…

Apparatus for rapid measurement of aerosol bulk chemical composition

DOEpatents

Lee, Yin-Nan E.; Weber, Rodney J.

2003-01-01

An apparatus and method for continuous on-line measurement of chemical composition of aerosol particles with a fast time resolution are provided. The apparatus includes a modified particle size magnifier for producing activated aerosol particles and a collection device which collects the activated aerosol particles into a liquid stream for quantitative analysis by analytical methods. The method provided for on-line measurement of chemical composition of aerosol particles includes exposing aerosol carrying sample air to hot saturated steam thereby forming activated aerosol particles; collecting the activated aerosol particles by a collection device for delivery as a jet stream onto an impaction surface; flushing off the activated aerosol particles from the impaction surface into a liquid stream for delivery of the collected liquid stream to an analytical instrument for quantitative measurement.

The detection of large deletions or duplications in genomic DNA.

PubMed

Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

2002-11-01

While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

NNAlign: A Web-Based Prediction Method Allowing Non-Expert End-User Discovery of Sequence Motifs in Quantitative Peptide Data

PubMed Central

Andreatta, Massimo; Schafer-Nielsen, Claus; Lund, Ole; Buus, Søren; Nielsen, Morten

2011-01-01

Recent advances in high-throughput technologies have made it possible to generate both gene and protein sequence data at an unprecedented rate and scale thereby enabling entirely new “omics”-based approaches towards the analysis of complex biological processes. However, the amount and complexity of data that even a single experiment can produce seriously challenges researchers with limited bioinformatics expertise, who need to handle, analyze and interpret the data before it can be understood in a biological context. Thus, there is an unmet need for tools allowing non-bioinformatics users to interpret large data sets. We have recently developed a method, NNAlign, which is generally applicable to any biological problem where quantitative peptide data is available. This method efficiently identifies underlying sequence patterns by simultaneously aligning peptide sequences and identifying motifs associated with quantitative readouts. Here, we provide a web-based implementation of NNAlign allowing non-expert end-users to submit their data (optionally adjusting method parameters), and in return receive a trained method (including a visual representation of the identified motif) that subsequently can be used as prediction method and applied to unknown proteins/peptides. We have successfully applied this method to several different data sets including peptide microarray-derived sets containing more than 100,000 data points. NNAlign is available online at http://www.cbs.dtu.dk/services/NNAlign. PMID:22073191

NNAlign: a web-based prediction method allowing non-expert end-user discovery of sequence motifs in quantitative peptide data.

PubMed

Andreatta, Massimo; Schafer-Nielsen, Claus; Lund, Ole; Buus, Søren; Nielsen, Morten

2011-01-01

Recent advances in high-throughput technologies have made it possible to generate both gene and protein sequence data at an unprecedented rate and scale thereby enabling entirely new "omics"-based approaches towards the analysis of complex biological processes. However, the amount and complexity of data that even a single experiment can produce seriously challenges researchers with limited bioinformatics expertise, who need to handle, analyze and interpret the data before it can be understood in a biological context. Thus, there is an unmet need for tools allowing non-bioinformatics users to interpret large data sets. We have recently developed a method, NNAlign, which is generally applicable to any biological problem where quantitative peptide data is available. This method efficiently identifies underlying sequence patterns by simultaneously aligning peptide sequences and identifying motifs associated with quantitative readouts. Here, we provide a web-based implementation of NNAlign allowing non-expert end-users to submit their data (optionally adjusting method parameters), and in return receive a trained method (including a visual representation of the identified motif) that subsequently can be used as prediction method and applied to unknown proteins/peptides. We have successfully applied this method to several different data sets including peptide microarray-derived sets containing more than 100,000 data points. NNAlign is available online at http://www.cbs.dtu.dk/services/NNAlign.

Benefit Finding in Maternal Caregivers of Pediatric Cancer Survivors: A Mixed Methods Approach.

PubMed

Willard, Victoria W; Hostetter, Sarah A; Hutchinson, Katherine C; Bonner, Melanie J; Hardy, Kristina K

2016-09-01

Benefit finding has been described as the identification of positive effects resulting from otherwise stressful experiences. In this mixed methods study, we examined the relations between qualitative themes related to benefit finding and quantitative measures of psychosocial adjustment and coping as reported by maternal caregivers of survivors of pediatric cancer. Female caregivers of survivors of pediatric cancer (n = 40) completed a qualitative questionnaire about their experiences caring for their child, along with several quantitative measures. Qualitative questionnaires were coded for salient themes, including social support and personal growth. Correlation matrices evaluated associations between qualitative themes and quantitative measures of stress and coping. Identified benefits included social support and personal growth, as well as child-specific benefits. Total benefits reported were significantly positively correlated with availability of emotional resources. Coping methods were also associated, with accepting responsibility associated with fewer identified benefits. Despite the stress of their child's illness, many female caregivers of survivors of pediatric cancer reported finding benefits associated with their experience. Benefit finding in this sample was associated with better adjustment. © 2016 by Association of Pediatric Hematology/Oncology Nurses.

Quantitative phase microscopy for cellular dynamics based on transport of intensity equation.

PubMed

Li, Ying; Di, Jianglei; Ma, Chaojie; Zhang, Jiwei; Zhong, Jinzhan; Wang, Kaiqiang; Xi, Teli; Zhao, Jianlin

2018-01-08

We demonstrate a simple method for quantitative phase imaging of tiny transparent objects such as living cells based on the transport of intensity equation. The experiments are performed using an inverted bright field microscope upgraded with a flipping imaging module, which enables to simultaneously create two laterally separated images with unequal defocus distances. This add-on module does not include any lenses or gratings and is cost-effective and easy-to-alignment. The validity of this method is confirmed by the measurement of microlens array and human osteoblastic cells in culture, indicating its potential in the applications of dynamically measuring living cells and other transparent specimens in a quantitative, non-invasive and label-free manner.

Methods and apparatus for managing corrosion in buildings

DOEpatents

Chey, S Jay; Hamann, Hendrik F; Klein, Levente Ioan; Schappert, Michael Alan; Stepanchuk, Andriy

2015-02-03

Principles of the invention provide methods and apparatus for providing corrosion management in buildings. In one aspect, an exemplary method includes the step of receiving first data relating corrosion rate to a plurality of environmental conditions. This first data is subsequently utilized to determine a quantitative relationship between corrosion rate and the plurality of environmental conditions. In another step, second data indicative of one or more environmental conditions within a building is received. A corrosion rate in the building is then determined at least in part by applying the determined quantitative relationship to this second data.

Quantitative thermal sensory testing -- value of testing for both cold and warm sensation detection in evaluation of small fiber neuropathy.

PubMed

Shukla, Garima; Bhatia, Manvir; Behari, Madhuri

2005-10-01

Small fiber neuropathy is a common neurological disorder, often missed or ignored by physicians, since examination and routine nerve conduction studies are usually normal in this condition. Many methods including quantitative thermal sensory testing are currently being used for early detection of this condition, so as to enable timely investigation and treatment. This study was conducted to assess the yield of quantitative thermal sensory testing in diagnosis of small fiber neuropathy. We included patients presenting with history suggestive of positive and/or negative sensory symptoms, with normal examination findings, clinically suggestive of small fiber neuropathy, with normal or minimally abnormal routine nerve conduction studies. These patients were subjected to quantitative thermal sensory testing using a Medoc TSA-II Neurosensory analyser at two sites and for two modalities. QST data were compared with those in 120 normal healthy controls. Twenty-five patients (16 males, 9 females) with mean age 46.8+/-16.6 years (range: 21-75 years) were included in the study. The mean duration of symptoms was 1.6+/-1.6 years (range: 3 months-6 years). Eighteen patients (72%) had abnormal thresholds in at least one modality. Thermal thresholds were normal in 7 out of the 25 patients. This study demonstrates that quantitative thermal sensory testing is a fairly sensitive method for detection of small fiber neuropathy especially in patients with normal routine nerve conduction studies.

Technology-based self-care methods of improving antiretroviral adherence: a systematic review.

PubMed

Saberi, Parya; Johnson, Mallory O

2011-01-01

As HIV infection has shifted to a chronic condition, self-care practices have emerged as an important topic for HIV-positive individuals in maintaining an optimal level of health. Self-care refers to activities that patients undertake to maintain and improve health, such as strategies to achieve and maintain high levels of antiretroviral adherence. Technology-based methods are increasingly used to enhance antiretroviral adherence; therefore, we systematically reviewed the literature to examine technology-based self-care methods that HIV-positive individuals utilize to improve adherence. Seven electronic databases were searched from 1/1/1980 through 12/31/2010. We included quantitative and qualitative studies. Among quantitative studies, the primary outcomes included ARV adherence, viral load, and CD4+ cell count and secondary outcomes consisted of quality of life, adverse effects, and feasibility/acceptability data. For qualitative/descriptive studies, interview themes, reports of use, and perceptions of use were summarized. Thirty-six publications were included (24 quantitative and 12 qualitative/descriptive). Studies with exclusive utilization of medication reminder devices demonstrated less evidence of enhancing adherence in comparison to multi-component methods. This systematic review offers support for self-care technology-based approaches that may result in improved antiretroviral adherence. There was a clear pattern of results that favored individually-tailored, multi-function technologies, which allowed for periodic communication with health care providers rather than sole reliance on electronic reminder devices.

Mechanistic and quantitative insight into cell surface targeted molecular imaging agent design.

PubMed

Zhang, Liang; Bhatnagar, Sumit; Deschenes, Emily; Thurber, Greg M

2016-05-05

Molecular imaging agent design involves simultaneously optimizing multiple probe properties. While several desired characteristics are straightforward, including high affinity and low non-specific background signal, in practice there are quantitative trade-offs between these properties. These include plasma clearance, where fast clearance lowers background signal but can reduce target uptake, and binding, where high affinity compounds sometimes suffer from lower stability or increased non-specific interactions. Further complicating probe development, many of the optimal parameters vary depending on both target tissue and imaging agent properties, making empirical approaches or previous experience difficult to translate. Here, we focus on low molecular weight compounds targeting extracellular receptors, which have some of the highest contrast values for imaging agents. We use a mechanistic approach to provide a quantitative framework for weighing trade-offs between molecules. Our results show that specific target uptake is well-described by quantitative simulations for a variety of targeting agents, whereas non-specific background signal is more difficult to predict. Two in vitro experimental methods for estimating background signal in vivo are compared - non-specific cellular uptake and plasma protein binding. Together, these data provide a quantitative method to guide probe design and focus animal work for more cost-effective and time-efficient development of molecular imaging agents.

Assessment of cleaning and disinfection in Salmonella-contaminated poultry layer houses using qualitative and semi-quantitative culture techniques.

PubMed

Wales, Andrew; Breslin, Mark; Davies, Robert

2006-09-10

Salmonella infection of laying flocks in the UK is predominantly a problem of the persistent contamination of layer houses and associated wildlife vectors by Salmonella Enteritidis. Methods for its control and elimination include effective cleaning and disinfection of layer houses between flocks, and it is important to be able to measure the success of such decontamination. A method for the environmental detection and semi-quantitative enumeration of salmonellae was used and compared with a standard qualitative method, in 12 Salmonella-contaminated caged layer houses before and after cleaning and disinfection. The quantitative technique proved to have comparable sensitivity to the standard method, and additionally provided insights into the numerical Salmonella challenge that replacement flocks would encounter. Elimination of S. Enteritidis was not achieved in any of the premises examined although substantial reductions in the prevalence and numbers of salmonellae were demonstrated, whilst in others an increase in contamination was observed after cleaning and disinfection. Particular problems with feeders and wildlife vectors were highlighted. The use of a quantitative method assisted the identification of problem areas, such as those with a high initial bacterial load or those experiencing only a modest reduction in bacterial count following decontamination.

Evaluation of a High Intensity Focused Ultrasound-Immobilized Trypsin Digestion and 18O-Labeling Method for Quantitative Proteomics

PubMed Central

López-Ferrer, Daniel; Hixson, Kim K.; Smallwood, Heather; Squier, Thomas C.; Petritis, Konstantinos; Smith, Richard D.

2009-01-01

A new method that uses immobilized trypsin concomitant with ultrasonic irradiation results in ultra-rapid digestion and thorough 18O labeling for quantitative protein comparisons. The reproducible and highly efficient method provided effective digestions in <1 min with a minimized amount of enzyme required compared to traditional methods. This method was demonstrated for digestion of both simple and complex protein mixtures, including bovine serum albumin, a global proteome extract from the bacteria Shewanella oneidensis, and mouse plasma, as well as 18O labeling of such complex protein mixtures, which validated the application of this method for differential proteomic measurements. This approach is simple, reproducible, cost effective, rapid, and thus well-suited for automation. PMID:19555078

Comparison of blood flow models and acquisitions for quantitative myocardial perfusion estimation from dynamic CT

NASA Astrophysics Data System (ADS)

Bindschadler, Michael; Modgil, Dimple; Branch, Kelley R.; La Riviere, Patrick J.; Alessio, Adam M.

2014-04-01

Myocardial blood flow (MBF) can be estimated from dynamic contrast enhanced (DCE) cardiac CT acquisitions, leading to quantitative assessment of regional perfusion. The need for low radiation dose and the lack of consensus on MBF estimation methods motivates this study to refine the selection of acquisition protocols and models for CT-derived MBF. DCE cardiac CT acquisitions were simulated for a range of flow states (MBF = 0.5, 1, 2, 3 ml (min g)-1, cardiac output = 3, 5, 8 L min-1). Patient kinetics were generated by a mathematical model of iodine exchange incorporating numerous physiological features including heterogenenous microvascular flow, permeability and capillary contrast gradients. CT acquisitions were simulated for multiple realizations of realistic x-ray flux levels. CT acquisitions that reduce radiation exposure were implemented by varying both temporal sampling (1, 2, and 3 s sampling intervals) and tube currents (140, 70, and 25 mAs). For all acquisitions, we compared three quantitative MBF estimation methods (two-compartment model, an axially-distributed model, and the adiabatic approximation to the tissue homogeneous model) and a qualitative slope-based method. In total, over 11 000 time attenuation curves were used to evaluate MBF estimation in multiple patient and imaging scenarios. After iodine-based beam hardening correction, the slope method consistently underestimated flow by on average 47.5% and the quantitative models provided estimates with less than 6.5% average bias and increasing variance with increasing dose reductions. The three quantitative models performed equally well, offering estimates with essentially identical root mean squared error (RMSE) for matched acquisitions. MBF estimates using the qualitative slope method were inferior in terms of bias and RMSE compared to the quantitative methods. MBF estimate error was equal at matched dose reductions for all quantitative methods and range of techniques evaluated. This suggests that there is no particular advantage between quantitative estimation methods nor to performing dose reduction via tube current reduction compared to temporal sampling reduction. These data are important for optimizing implementation of cardiac dynamic CT in clinical practice and in prospective CT MBF trials.

Breakthroughs In Low-profile Leaky-Wave HPM Antennas

DTIC Science & Technology

2015-06-18

this approach to help us finally to include, and manage quantitatively, this essential piece of the theoretical puzzle as we continue to revise and...appreciate ONR’s continuing support for this R&D. 10 http://www.uttyler.edu/ math /faculty...dkoslover.php & https://www.uttyler.edu/ math /curriculavitae/dkoslover.pdf 11 These include Variational Methods, Integral Equation Method, Equivalent

Rapid Quadrupole-Time-of-Flight Mass Spectrometry Method Quantifies Oxygen-Rich Lignin Compound in Complex Mixtures

NASA Astrophysics Data System (ADS)

Boes, Kelsey S.; Roberts, Michael S.; Vinueza, Nelson R.

2018-03-01

Complex mixture analysis is a costly and time-consuming task facing researchers with foci as varied as food science and fuel analysis. When faced with the task of quantifying oxygen-rich bio-oil molecules in a complex diesel mixture, we asked whether complex mixtures could be qualitatively and quantitatively analyzed on a single mass spectrometer with mid-range resolving power without the use of lengthy separations. To answer this question, we developed and evaluated a quantitation method that eliminated chromatography steps and expanded the use of quadrupole-time-of-flight mass spectrometry from primarily qualitative to quantitative as well. To account for mixture complexity, the method employed an ionization dopant, targeted tandem mass spectrometry, and an internal standard. This combination of three techniques achieved reliable quantitation of oxygen-rich eugenol in diesel from 300 to 2500 ng/mL with sufficient linearity (R2 = 0.97 ± 0.01) and excellent accuracy (percent error = 0% ± 5). To understand the limitations of the method, it was compared to quantitation attained on a triple quadrupole mass spectrometer, the gold standard for quantitation. The triple quadrupole quantified eugenol from 50 to 2500 ng/mL with stronger linearity (R2 = 0.996 ± 0.003) than the quadrupole-time-of-flight and comparable accuracy (percent error = 4% ± 5). This demonstrates that a quadrupole-time-of-flight can be used for not only qualitative analysis but also targeted quantitation of oxygen-rich lignin molecules in complex mixtures without extensive sample preparation. The rapid and cost-effective method presented here offers new possibilities for bio-oil research, including: (1) allowing for bio-oil studies that demand repetitive analysis as process parameters are changed and (2) making this research accessible to more laboratories. [Figure not available: see fulltext.

Rapid Quadrupole-Time-of-Flight Mass Spectrometry Method Quantifies Oxygen-Rich Lignin Compound in Complex Mixtures

NASA Astrophysics Data System (ADS)

Boes, Kelsey S.; Roberts, Michael S.; Vinueza, Nelson R.

2017-12-01

Complex mixture analysis is a costly and time-consuming task facing researchers with foci as varied as food science and fuel analysis. When faced with the task of quantifying oxygen-rich bio-oil molecules in a complex diesel mixture, we asked whether complex mixtures could be qualitatively and quantitatively analyzed on a single mass spectrometer with mid-range resolving power without the use of lengthy separations. To answer this question, we developed and evaluated a quantitation method that eliminated chromatography steps and expanded the use of quadrupole-time-of-flight mass spectrometry from primarily qualitative to quantitative as well. To account for mixture complexity, the method employed an ionization dopant, targeted tandem mass spectrometry, and an internal standard. This combination of three techniques achieved reliable quantitation of oxygen-rich eugenol in diesel from 300 to 2500 ng/mL with sufficient linearity (R2 = 0.97 ± 0.01) and excellent accuracy (percent error = 0% ± 5). To understand the limitations of the method, it was compared to quantitation attained on a triple quadrupole mass spectrometer, the gold standard for quantitation. The triple quadrupole quantified eugenol from 50 to 2500 ng/mL with stronger linearity (R2 = 0.996 ± 0.003) than the quadrupole-time-of-flight and comparable accuracy (percent error = 4% ± 5). This demonstrates that a quadrupole-time-of-flight can be used for not only qualitative analysis but also targeted quantitation of oxygen-rich lignin molecules in complex mixtures without extensive sample preparation. The rapid and cost-effective method presented here offers new possibilities for bio-oil research, including: (1) allowing for bio-oil studies that demand repetitive analysis as process parameters are changed and (2) making this research accessible to more laboratories. [Figure not available: see fulltext.

Rapid Quadrupole-Time-of-Flight Mass Spectrometry Method Quantifies Oxygen-Rich Lignin Compound in Complex Mixtures.

PubMed

Boes, Kelsey S; Roberts, Michael S; Vinueza, Nelson R

2018-03-01

Complex mixture analysis is a costly and time-consuming task facing researchers with foci as varied as food science and fuel analysis. When faced with the task of quantifying oxygen-rich bio-oil molecules in a complex diesel mixture, we asked whether complex mixtures could be qualitatively and quantitatively analyzed on a single mass spectrometer with mid-range resolving power without the use of lengthy separations. To answer this question, we developed and evaluated a quantitation method that eliminated chromatography steps and expanded the use of quadrupole-time-of-flight mass spectrometry from primarily qualitative to quantitative as well. To account for mixture complexity, the method employed an ionization dopant, targeted tandem mass spectrometry, and an internal standard. This combination of three techniques achieved reliable quantitation of oxygen-rich eugenol in diesel from 300 to 2500 ng/mL with sufficient linearity (R 2 = 0.97 ± 0.01) and excellent accuracy (percent error = 0% ± 5). To understand the limitations of the method, it was compared to quantitation attained on a triple quadrupole mass spectrometer, the gold standard for quantitation. The triple quadrupole quantified eugenol from 50 to 2500 ng/mL with stronger linearity (R 2 = 0.996 ± 0.003) than the quadrupole-time-of-flight and comparable accuracy (percent error = 4% ± 5). This demonstrates that a quadrupole-time-of-flight can be used for not only qualitative analysis but also targeted quantitation of oxygen-rich lignin molecules in complex mixtures without extensive sample preparation. The rapid and cost-effective method presented here offers new possibilities for bio-oil research, including: (1) allowing for bio-oil studies that demand repetitive analysis as process parameters are changed and (2) making this research accessible to more laboratories. Graphical Abstract ᅟ.

Systematic Comparison of Label-Free, Metabolic Labeling, and Isobaric Chemical Labeling for Quantitative Proteomics on LTQ Orbitrap Velos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Zhou; Adams, Rachel M; Chourey, Karuna

2012-01-01

A variety of quantitative proteomics methods have been developed, including label-free, metabolic labeling, and isobaric chemical labeling using iTRAQ or TMT. Here, these methods were compared in terms of the depth of proteome coverage, quantification accuracy, precision, and reproducibility using a high-performance hybrid mass spectrometer, LTQ Orbitrap Velos. Our results show that (1) the spectral counting method provides the deepest proteome coverage for identification, but its quantification performance is worse than labeling-based approaches, especially the quantification reproducibility; (2) metabolic labeling and isobaric chemical labeling are capable of accurate, precise, and reproducible quantification and provide deep proteome coverage for quantification. Isobaricmore » chemical labeling surpasses metabolic labeling in terms of quantification precision and reproducibility; (3) iTRAQ and TMT perform similarly in all aspects compared in the current study using a CID-HCD dual scan configuration. Based on the unique advantages of each method, we provide guidance for selection of the appropriate method for a quantitative proteomics study.« less

Quantitative imaging methods in osteoporosis.

PubMed

Oei, Ling; Koromani, Fjorda; Rivadeneira, Fernando; Zillikens, M Carola; Oei, Edwin H G

2016-12-01

Osteoporosis is characterized by a decreased bone mass and quality resulting in an increased fracture risk. Quantitative imaging methods are critical in the diagnosis and follow-up of treatment effects in osteoporosis. Prior radiographic vertebral fractures and bone mineral density (BMD) as a quantitative parameter derived from dual-energy X-ray absorptiometry (DXA) are among the strongest known predictors of future osteoporotic fractures. Therefore, current clinical decision making relies heavily on accurate assessment of these imaging features. Further, novel quantitative techniques are being developed to appraise additional characteristics of osteoporosis including three-dimensional bone architecture with quantitative computed tomography (QCT). Dedicated high-resolution (HR) CT equipment is available to enhance image quality. At the other end of the spectrum, by utilizing post-processing techniques such as the trabecular bone score (TBS) information on three-dimensional architecture can be derived from DXA images. Further developments in magnetic resonance imaging (MRI) seem promising to not only capture bone micro-architecture but also characterize processes at the molecular level. This review provides an overview of various quantitative imaging techniques based on different radiological modalities utilized in clinical osteoporosis care and research.

A Multidimensional Analysis Tool for Visualizing Online Interactions

ERIC Educational Resources Information Center

Kim, Minjeong; Lee, Eunchul

2012-01-01

This study proposes and verifies the performance of an analysis tool for visualizing online interactions. A review of the most widely used methods for analyzing online interactions, including quantitative analysis, content analysis, and social network analysis methods, indicates these analysis methods have some limitations resulting from their…

Old wine in new bottles: decanting systemic family process research in the era of evidence-based practice.

PubMed

Rohrbaugh, Michael J

2014-09-01

Social cybernetic (systemic) ideas from the early Family Process era, though emanating from qualitative clinical observation, have underappreciated heuristic potential for guiding quantitative empirical research on problem maintenance and change. The old conceptual wines we have attempted to repackage in new, science-friendly bottles include ironic processes (when "solutions" maintain problems), symptom-system fit (when problems stabilize relationships), and communal coping (when we-ness helps people change). Both self-report and observational quantitative methods have been useful in tracking these phenomena, and together the three constructs inform a team-based family consultation approach to working with difficult health and behavior problems. In addition, a large-scale, quantitatively focused effectiveness trial of family therapy for adolescent drug abuse highlights the importance of treatment fidelity and qualitative approaches to examining it. In this sense, echoing the history of family therapy research, our experience with juxtaposing quantitative and qualitative methods has gone full circle-from qualitative to quantitative observation and back again. © 2014 FPI, Inc.

Old Wine in New Bottles: Decanting Systemic Family Process Research in the Era of Evidence-Based Practice†

PubMed Central

Rohrbaugh, Michael J.

2015-01-01

Social cybernetic (systemic) ideas from the early Family Process era, though emanating from qualitative clinical observation, have underappreciated heuristic potential for guiding quantitative empirical research on problem maintenance and change. The old conceptual wines we have attempted to repackage in new, science-friendly bottles include ironic processes (when “solutions” maintain problems), symptom-system fit (when problems stabilize relationships), and communal coping (when we-ness helps people change). Both self-report and observational quantitative methods have been useful in tracking these phenomena, and together the three constructs inform a team-based family consultation (FAMCON) approach to working with difficult health and behavior problems. In addition, a large-scale, quantitatively focused effectiveness trial of family therapy for adolescent drug abuse highlights the importance of treatment fidelity and qualitative approaches to examining it. In this sense, echoing the history of family therapy research, our experience with juxtaposing quantitative and qualitative methods has gone full circle – from qualitative to quantitative observation and back again. PMID:24905101

Calibrated Passive Sampling--Multi-plot Field Measurements of NH3 Emissions with a Combination of Dynamic Tube Method and Passive Samplers.

PubMed

Pacholski, Andreas

2016-03-21

Agricultural ammonia (NH3) emissions (90% of total EU emissions) are responsible for about 45% airborne eutrophication, 31% soil acidification and 12% fine dust formation within the EU15. But NH3 emissions also mean a considerable loss of nutrients. Many studies on NH3 emission from organic and mineral fertilizer application have been performed in recent decades. Nevertheless, research related to NH3 emissions after application fertilizers is still limited in particular with respect to relationships to emissions, fertilizer type, site conditions and crop growth. Due to the variable response of crops to treatments, effects can only be validated in experimental designs including field replication for statistical testing. The dominating ammonia loss methods yielding quantitative emissions require large field areas, expensive equipment or current supply, which restricts their application in replicated field trials. This protocol describes a new methodology for the measurement of NH3 emissions on many plots linking a simple semi-quantitative measuring method used in all plots, with a quantitative method by simultaneous measurements using both methods on selected plots. As a semi-quantitative measurement method passive samplers are used. The second method is a dynamic chamber method (Dynamic Tube Method) to obtain a transfer quotient, which converts the semi-quantitative losses of the passive sampler to quantitative losses (kg nitrogen ha(-1)). The principle underlying this approach is that passive samplers placed in a homogeneous experimental field have the same NH3 absorption behavior under identical environmental conditions. Therefore, a transfer co-efficient obtained from single passive samplers can be used to scale the values of all passive samplers used in the same field trial. The method proved valid under a wide range of experimental conditions and is recommended to be used under conditions with bare soil or small canopies (<0.3 m). Results obtained from experiments with taller plants should be treated more carefully.

Calibrated Passive Sampling - Multi-plot Field Measurements of NH3 Emissions with a Combination of Dynamic Tube Method and Passive Samplers

PubMed Central

Pacholski, Andreas

2016-01-01

Agricultural ammonia (NH3) emissions (90% of total EU emissions) are responsible for about 45% airborne eutrophication, 31% soil acidification and 12% fine dust formation within the EU15. But NH3 emissions also mean a considerable loss of nutrients. Many studies on NH3 emission from organic and mineral fertilizer application have been performed in recent decades. Nevertheless, research related to NH3 emissions after application fertilizers is still limited in particular with respect to relationships to emissions, fertilizer type, site conditions and crop growth. Due to the variable response of crops to treatments, effects can only be validated in experimental designs including field replication for statistical testing. The dominating ammonia loss methods yielding quantitative emissions require large field areas, expensive equipment or current supply, which restricts their application in replicated field trials. This protocol describes a new methodology for the measurement of NH3 emissions on many plots linking a simple semi-quantitative measuring method used in all plots, with a quantitative method by simultaneous measurements using both methods on selected plots. As a semi-quantitative measurement method passive samplers are used. The second method is a dynamic chamber method (Dynamic Tube Method) to obtain a transfer quotient, which converts the semi-quantitative losses of the passive sampler to quantitative losses (kg nitrogen ha-1). The principle underlying this approach is that passive samplers placed in a homogeneous experimental field have the same NH3 absorption behavior under identical environmental conditions. Therefore, a transfer co-efficient obtained from single passive samplers can be used to scale the values of all passive samplers used in the same field trial. The method proved valid under a wide range of experimental conditions and is recommended to be used under conditions with bare soil or small canopies (<0.3 m). Results obtained from experiments with taller plants should be treated more carefully. PMID:27023010

The effect and importance of physical activity on behavioural and psychological symptoms in people with dementia: A systematic mixed studies review.

PubMed

Junge, Tina; Ahler, Jonas; Knudsen, Hans K; Kristensen, Hanne K

2018-01-01

Background People with dementia may benefit from the effect of physical activity on behavioural and psychological symptoms of dementia. Qualitative synthesis of the importance of physical activity might complement and help clarify quantitative findings on this topic. The purpose of this systematic mixed studies review was to evaluate findings from both quantitative and qualitative methods about the effect and importance of physical activity on behavioural and psychological symptoms of dementia in people with dementia. Methods The systematic literature search was conducted in EMBASE, CINAHL, PubMed, PEDro and PsycINFO. Inclusion criteria were: people with a light to moderate degree of dementia, interventions including physical activity and outcomes focusing on behavioural and psychological symptoms of dementia or quality of life. To assess the methodological quality of the studies, the AMSTAR and GRADE checklists were applied for the quantitative studies and the CASP qualitative checklist for the qualitative studies. Results A small reduction in depression level and improved mood were seen in some quantitative studies of multi-component physical activity interventions, including walking. Due to high heterogeneity in the quantitative studies, a single summary of the effect of physical activity on behavioural and psychological symptoms of dementia should be interpreted with some caution. Across the qualitative studies, the common themes about the importance of physical activity were its 'socially rewarding' nature, the 'benefits of walking outdoors' and its contribution to 'maintaining self-hood'. Conclusion For people with dementia, there was a small, quantitative effect of multi-component physical activity including walking, on depression level and mood. People with dementia reported the importance of walking outdoors, experiencing the social rewards of physical activity in groups, as well as physical activity were a means toward maintaining self-hood.

Designing a mixed methods study in primary care.

PubMed

Creswell, John W; Fetters, Michael D; Ivankova, Nataliya V

2004-01-01

Mixed methods or multimethod research holds potential for rigorous, methodologically sound investigations in primary care. The objective of this study was to use criteria from the literature to evaluate 5 mixed methods studies in primary care and to advance 3 models useful for designing such investigations. We first identified criteria from the social and behavioral sciences to analyze mixed methods studies in primary care research. We then used the criteria to evaluate 5 mixed methods investigations published in primary care research journals. Of the 5 studies analyzed, 3 included a rationale for mixing based on the need to develop a quantitative instrument from qualitative data or to converge information to best understand the research topic. Quantitative data collection involved structured interviews, observational checklists, and chart audits that were analyzed using descriptive and inferential statistical procedures. Qualitative data consisted of semistructured interviews and field observations that were analyzed using coding to develop themes and categories. The studies showed diverse forms of priority: equal priority, qualitative priority, and quantitative priority. Data collection involved quantitative and qualitative data gathered both concurrently and sequentially. The integration of the quantitative and qualitative data in these studies occurred between data analysis from one phase and data collection from a subsequent phase, while analyzing the data, and when reporting the results. We recommend instrument-building, triangulation, and data transformation models for mixed methods designs as useful frameworks to add rigor to investigations in primary care. We also discuss the limitations of our study and the need for future research.

Using mixed methods when researching communities.

PubMed

Ochieng, Bertha M N; Meetoo, Danny

2015-09-01

To argue for the use of mixed methods when researching communities. Although research involving minority communities is now advanced, not enough effort has been made to formulate methodological linkages between qualitative and quantitative methods in most studies. For instance, the quantitative approaches used by epidemiologists and others in examining the wellbeing of communities are usually empirical. While the rationale for this is sound, quantitative findings can be expanded with data from in-depth qualitative approaches, such as interviews or observations, which are likely to provide insights into the experiences of people in those communities and their relationships with their wellbeing. Academic databases including The Cochrane Library, MEDLINE, CINAHL, AMED, INTERNURSE, Science Direct, Web of Knowledge and PubMed. An iterative process of identifying eligible literature was carried out by comprehensively searching electronic databases. Using mixed-methods approaches is likely to address any potential drawbacks of individual methods by exploiting the strengths of each at the various stages of research. Combining methods can provide additional ways of looking at a complex problem and improve the understanding of a community's experiences. However, it is important for researchers to use the different methods interactively during their research. The use of qualitative and quantitative methods is likely to enrich our understanding of the interrelationship between wellbeing and the experiences of communities. This should help researchers to explore socio-cultural factors and experiences of health and healthcare practice more effectively.

Using qualitative methods to understand factors contributing to patient satisfaction among dermatology patients: a systematic review.

PubMed

Gibbons, Caitlin; Singh, Sanminder; Gibbons, Brittany; Clark, Caitlin; Torres, Josefina; Cheng, Michelle Y; Wang, Elizabeth A; Armstrong, April W

2018-05-01

In this systematic review, we aimed to synthesize data that identify factors contributing to patient satisfaction in dermatology care using qualitative methods. We performed a comprehensive search of the literature using the PubMed database for articles published between January 1, 2000 and February 9, 2015. The initial search yielded 186 articles, of which 13 were included after applying inclusion and exclusion criteria. The systematic review of 13 articles included a total of 330 patients. Using in-field observations and semistructured interviews, studies found that qualitative methods and analysis increased the provider's sensitivity to patient needs and enhanced patient care. Analyses using qualitative methods found increased patient satisfaction in their healthcare provider is associated with (1) confidence in the provider's diagnosis, (2) perception of patient-centered, individualized recommendations and (3) quality of patient education and provider explanation during a visit. Patient satisfaction is measured using either quantitative or qualitative methods. Quantitative methods result in standardized data that often does not capture the nuances of patient experience. In contrast, qualitative methodology is integral to gathering patient perspectives on patient care and satisfaction and should be included in future research models.

Guidance for using mixed methods design in nursing practice research.

PubMed

Chiang-Hanisko, Lenny; Newman, David; Dyess, Susan; Piyakong, Duangporn; Liehr, Patricia

2016-08-01

The mixed methods approach purposefully combines both quantitative and qualitative techniques, enabling a multi-faceted understanding of nursing phenomena. The purpose of this article is to introduce three mixed methods designs (parallel; sequential; conversion) and highlight interpretive processes that occur with the synthesis of qualitative and quantitative findings. Real world examples of research studies conducted by the authors will demonstrate the processes leading to the merger of data. The examples include: research questions; data collection procedures and analysis with a focus on synthesizing findings. Based on experience with mixed methods studied, the authors introduce two synthesis patterns (complementary; contrasting), considering application for practice and implications for research. Copyright © 2015 Elsevier Inc. All rights reserved.

A-TEEMTM, a new molecular fingerprinting technique: simultaneous absorbance-transmission and fluorescence excitation-emission matrix method

NASA Astrophysics Data System (ADS)

Quatela, Alessia; Gilmore, Adam M.; Steege Gall, Karen E.; Sandros, Marinella; Csatorday, Karoly; Siemiarczuk, Alex; (Ben Yang, Boqian; Camenen, Loïc

2018-04-01

We investigate the new simultaneous absorbance-transmission and fluorescence excitation-emission matrix method for rapid and effective characterization of the varying components from a mixture. The absorbance-transmission and fluorescence excitation-emission matrix method uniquely facilitates correction of fluorescence inner-filter effects to yield quantitative fluorescence spectral information that is largely independent of component concentration. This is significant because it allows one to effectively monitor quantitative component changes using multivariate methods and to generate and evaluate spectral libraries. We present the use of this novel instrument in different fields: i.e. tracking changes in complex mixtures including natural water, wine as well as monitoring stability and aggregation of hormones for biotherapeutics.

Quantitative comparison of in situ soil CO2 flux measurement methods

Treesearch

Jennifer D. Knoepp; James M. Vose

2002-01-01

Development of reliable regional or global carbon budgets requires accurate measurement of soil CO2 flux. We conducted laboratory and field studies to determine the accuracy and comparability of methods commonly used to measure in situ soil CO2 fluxes. Methods compared included CO2...

Quantitative evaluation methods of skin condition based on texture feature parameters.

PubMed

Pang, Hui; Chen, Tianhua; Wang, Xiaoyi; Chang, Zhineng; Shao, Siqi; Zhao, Jing

2017-03-01

In order to quantitatively evaluate the improvement of the skin condition after using skin care products and beauty, a quantitative evaluation method for skin surface state and texture is presented, which is convenient, fast and non-destructive. Human skin images were collected by image sensors. Firstly, the median filter of the 3 × 3 window is used and then the location of the hairy pixels on the skin is accurately detected according to the gray mean value and color information. The bilinear interpolation is used to modify the gray value of the hairy pixels in order to eliminate the negative effect of noise and tiny hairs on the texture. After the above pretreatment, the gray level co-occurrence matrix (GLCM) is calculated. On the basis of this, the four characteristic parameters, including the second moment, contrast, entropy and correlation, and their mean value are calculated at 45 ° intervals. The quantitative evaluation model of skin texture based on GLCM is established, which can calculate the comprehensive parameters of skin condition. Experiments show that using this method evaluates the skin condition, both based on biochemical indicators of skin evaluation methods in line, but also fully consistent with the human visual experience. This method overcomes the shortcomings of the biochemical evaluation method of skin damage and long waiting time, also the subjectivity and fuzziness of the visual evaluation, which achieves the non-destructive, rapid and quantitative evaluation of skin condition. It can be used for health assessment or classification of the skin condition, also can quantitatively evaluate the subtle improvement of skin condition after using skin care products or stage beauty.

Assessing soil compaction on Forest Inventory & Analysis phase 3 field plots using a pocket penetrometer

Treesearch

Michael C. Amacher; Katherine P. O' Neill

2004-01-01

Soil compaction is an important indicator of soil quality, yet few practical methods are available to quantitatively measure this variable. Although an assessment of the areal extent of soil compaction is included as part of the soil indicator portion of the Forest Inventory & Analysis (FIA) program, no quantitative measurement of the degree of soil compaction...

IWGT report on quantitative approaches to genotoxicity risk ...

EPA Pesticide Factsheets

This is the second of two reports from the International Workshops on Genotoxicity Testing (IWGT) Working Group on Quantitative Approaches to Genetic Toxicology Risk Assessment (the QWG). The first report summarized the discussions and recommendations of the QWG related to the need for quantitative dose–response analysis of genetic toxicology data, the existence and appropriate evaluation of threshold responses, and methods to analyze exposure-response relationships and derive points of departure (PoDs) from which acceptable exposure levels could be determined. This report summarizes the QWG discussions and recommendations regarding appropriate approaches to evaluate exposure-related risks of genotoxic damage, including extrapolation below identified PoDs and across test systems and species. Recommendations include the selection of appropriate genetic endpoints and target tissues, uncertainty factors and extrapolation methods to be considered, the importance and use of information on mode of action, toxicokinetics, metabolism, and exposure biomarkers when using quantitative exposure-response data to determine acceptable exposure levels in human populations or to assess the risk associated with known or anticipated exposures. The empirical relationship between genetic damage (mutation and chromosomal aberration) and cancer in animal models was also examined. It was concluded that there is a general correlation between cancer induction and mutagenic and/or clast

Quantitation of intracellular purine intermediates in different Corynebacteria using electrospray LC-MS/MS.

PubMed

Peifer, Susanne; Schneider, Konstantin; Nürenberg, Gudrun; Volmer, Dietrich A; Heinzle, Elmar

2012-11-01

Intermediates of the purine biosynthesis pathway play key roles in cellular metabolism including nucleic acid synthesis and signal mediation. In addition, they are also of major interest to the biotechnological industry as several intermediates either possess flavor-enhancing characteristics or are applied in medical therapy. In this study, we have developed an analytical method for quantitation of 12 intermediates from the purine biosynthesis pathway including important nucleotides and their corresponding nucleosides and nucleobases. The approach comprised a single-step acidic extraction/quenching procedure, followed by quantitative electrospray LC-MS/MS analysis. The assay was validated in terms of accuracy, precision, reproducibility, and applicability for complex biological matrices. The method was subsequently applied for determination of free intracellular pool sizes of purine biosynthetic pathway intermediates in the two Gram-positive bacteria Corynebacterium glutamicum and Corynebacterium ammoniagenes. Importantly, no ion pair reagents were applied in this approach as usually required for liquid chromatography analysis of large classes of diverse metabolites.

Accuracy and Precision of Radioactivity Quantification in Nuclear Medicine Images

PubMed Central

Frey, Eric C.; Humm, John L.; Ljungberg, Michael

2012-01-01

The ability to reliably quantify activity in nuclear medicine has a number of increasingly important applications. Dosimetry for targeted therapy treatment planning or for approval of new imaging agents requires accurate estimation of the activity in organs, tumors, or voxels at several imaging time points. Another important application is the use of quantitative metrics derived from images, such as the standard uptake value commonly used in positron emission tomography (PET), to diagnose and follow treatment of tumors. These measures require quantification of organ or tumor activities in nuclear medicine images. However, there are a number of physical, patient, and technical factors that limit the quantitative reliability of nuclear medicine images. There have been a large number of improvements in instrumentation, including the development of hybrid single-photon emission computed tomography/computed tomography and PET/computed tomography systems, and reconstruction methods, including the use of statistical iterative reconstruction methods, which have substantially improved the ability to obtain reliable quantitative information from planar, single-photon emission computed tomography, and PET images. PMID:22475429

The absolute counting of red cell-derived microparticles with red cell bead by flow rate based assay.

PubMed

Nantakomol, Duangdao; Imwong, Malika; Soontarawirat, Ingfar; Kotjanya, Duangporn; Khakhai, Chulalak; Ohashi, Jun; Nuchnoi, Pornlada

2009-05-01

Activation of red blood cell is associated with the formation of red cell-derived microparticles (RMPs). Analysis of circulating RMPs is becoming more refined and clinically useful. A quantitative Trucount tube method is the conventional method uses for quantitating RMPs. In this study, we validated a quantitative method called "flow rate based assay using red cell bead (FCB)" to measure circulating RMPs in the peripheral blood of healthy subjects. Citrated blood samples collected from 30 cases of healthy subjects were determined the RMPs count by using double labeling of annexin V-FITC and anti-glycophorin A-PE. The absolute RMPs numbers were measured by FCB, and the results were compared with the Trucount or with flow rate based calibration (FR). Statistical correlation and agreement were analyzed using linear regression and Bland-Altman analysis. There was no significant difference in the absolute number of RMPs quantitated by FCB when compared with those two reference methods including the Trucount tube and FR method. The absolute RMPs count obtained from FCB method was highly correlated with those obtained from Trucount tube (r(2) = 0.98, mean bias 4 cell/microl, limit of agreement [LOA] -20.3 to 28.3 cell/microl), and FR method (r(2) = 1, mean bias 10.3 cell/microl, and LOA -5.5 to 26.2 cell/microl). This study demonstrates that FCB is suitable and more affordable for RMPs quantitation in the clinical samples. This method is a low cost and interchangeable to latex bead-based method for generating the absolute counts in the resource-limited areas. (c) 2008 Clinical Cytometry Society.

Nuclear medicine and imaging research: Quantitative studies in radiopharmaceutical science

DOE Office of Scientific and Technical Information (OSTI.GOV)

Copper, M.; Beck, R.N.

1991-06-01

During the past three years the program has undergone a substantial revitalization. There has been no significant change in the scientific direction of this grant, in which emphasis continues to be placed on developing new or improved methods of obtaining quantitative data from radiotracer imaging studies. However, considerable scientific progress has been made in the three areas of interest: Radiochemistry, Quantitative Methodologies, and Experimental Methods and Feasibility Studies, resulting in a sharper focus of perspective and improved integration of the overall scientific effort. Changes in Faculty and staff, including development of new collaborations, have contributed to this, as has acquisitionmore » of additional and new equipment and renovations and expansion of the core facilities. 121 refs., 30 figs., 2 tabs.« less

Designing A Mixed Methods Study In Primary Care

PubMed Central

Creswell, John W.; Fetters, Michael D.; Ivankova, Nataliya V.

2004-01-01

BACKGROUND Mixed methods or multimethod research holds potential for rigorous, methodologically sound investigations in primary care. The objective of this study was to use criteria from the literature to evaluate 5 mixed methods studies in primary care and to advance 3 models useful for designing such investigations. METHODS We first identified criteria from the social and behavioral sciences to analyze mixed methods studies in primary care research. We then used the criteria to evaluate 5 mixed methods investigations published in primary care research journals. RESULTS Of the 5 studies analyzed, 3 included a rationale for mixing based on the need to develop a quantitative instrument from qualitative data or to converge information to best understand the research topic. Quantitative data collection involved structured interviews, observational checklists, and chart audits that were analyzed using descriptive and inferential statistical procedures. Qualitative data consisted of semistructured interviews and field observations that were analyzed using coding to develop themes and categories. The studies showed diverse forms of priority: equal priority, qualitative priority, and quantitative priority. Data collection involved quantitative and qualitative data gathered both concurrently and sequentially. The integration of the quantitative and qualitative data in these studies occurred between data analysis from one phase and data collection from a subsequent phase, while analyzing the data, and when reporting the results. DISCUSSION We recommend instrument-building, triangulation, and data transformation models for mixed methods designs as useful frameworks to add rigor to investigations in primary care. We also discuss the limitations of our study and the need for future research. PMID:15053277

Improving validation methods for molecular diagnostics: application of Bland-Altman, Deming and simple linear regression analyses in assay comparison and evaluation for next-generation sequencing

PubMed Central

Misyura, Maksym; Sukhai, Mahadeo A; Kulasignam, Vathany; Zhang, Tong; Kamel-Reid, Suzanne; Stockley, Tracy L

2018-01-01

Aims A standard approach in test evaluation is to compare results of the assay in validation to results from previously validated methods. For quantitative molecular diagnostic assays, comparison of test values is often performed using simple linear regression and the coefficient of determination (R2), using R2 as the primary metric of assay agreement. However, the use of R2 alone does not adequately quantify constant or proportional errors required for optimal test evaluation. More extensive statistical approaches, such as Bland-Altman and expanded interpretation of linear regression methods, can be used to more thoroughly compare data from quantitative molecular assays. Methods We present the application of Bland-Altman and linear regression statistical methods to evaluate quantitative outputs from next-generation sequencing assays (NGS). NGS-derived data sets from assay validation experiments were used to demonstrate the utility of the statistical methods. Results Both Bland-Altman and linear regression were able to detect the presence and magnitude of constant and proportional error in quantitative values of NGS data. Deming linear regression was used in the context of assay comparison studies, while simple linear regression was used to analyse serial dilution data. Bland-Altman statistical approach was also adapted to quantify assay accuracy, including constant and proportional errors, and precision where theoretical and empirical values were known. Conclusions The complementary application of the statistical methods described in this manuscript enables more extensive evaluation of performance characteristics of quantitative molecular assays, prior to implementation in the clinical molecular laboratory. PMID:28747393

Collaborating to improve the use of free-energy and other quantitative methods in drug discovery

NASA Astrophysics Data System (ADS)

Sherborne, Bradley; Shanmugasundaram, Veerabahu; Cheng, Alan C.; Christ, Clara D.; DesJarlais, Renee L.; Duca, Jose S.; Lewis, Richard A.; Loughney, Deborah A.; Manas, Eric S.; McGaughey, Georgia B.; Peishoff, Catherine E.; van Vlijmen, Herman

2016-12-01

In May and August, 2016, several pharmaceutical companies convened to discuss and compare experiences with Free Energy Perturbation (FEP). This unusual synchronization of interest was prompted by Schrödinger's FEP+ implementation and offered the opportunity to share fresh studies with FEP and enable broader discussions on the topic. This article summarizes key conclusions of the meetings, including a path forward of actions for this group to aid the accelerated evaluation, application and development of free energy and related quantitative, structure-based design methods.

Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

PubMed

Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

2007-02-01

In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

A simultaneous screening and quantitative method for the multiresidue analysis of pesticides in spices using ultra-high performance liquid chromatography-high resolution (Orbitrap) mass spectrometry.

PubMed

Goon, Arnab; Khan, Zareen; Oulkar, Dasharath; Shinde, Raviraj; Gaikwad, Suresh; Banerjee, Kaushik

2018-01-12

A novel screening and quantitation method is reported for non-target multiresidue analysis of pesticides using ultra-HPLC-quadrupole-Orbitrap mass spectrometry in spice matrices, including black pepper, cardamom, chili, coriander, cumin, and turmeric. The method involved sequential full-scan (resolution = 70,000), and variable data independent acquisition (vDIA) with nine consecutive fragmentation events (resolution = 17,500). Samples were extracted by the QuEChERS method. The introduction of an SPE-based clean-up step through hydrophilic-lipophilic-balance (HLB) cartridges proved advantageous in minimizing the false negatives. For coriander, cumin, chili, and cardamom, the screening detection limit was largely at 2 ng/g, while it was 5 ng/g for black pepper, and turmeric. When the method was quantitatively validated for 199 pesticides, the limit of quantification (LOQ) was mostly at 10 ng/g (excluding black pepper, and turmeric with LOQ = 20 ng/g) with recoveries within 70-120%, and precision-RSDs <20%. Furthermore, the method allowed the identification of suspected non-target analytes through retrospective search of the accurate mass of the compound-specific precursor and product ions. Compared to LC-MS/MS, the quantitative performance of this Orbitrap-MS method had agreements in residue values between 78-100%. Copyright © 2017 Elsevier B.V. All rights reserved.

A Database of Reaction Monitoring Mass Spectrometry Assays for Elucidating Therapeutic Response in Cancer

PubMed Central

Remily-Wood, Elizabeth R.; Liu, Richard Z.; Xiang, Yun; Chen, Yi; Thomas, C. Eric; Rajyaguru, Neal; Kaufman, Laura M.; Ochoa, Joana E.; Hazlehurst, Lori; Pinilla-Ibarz, Javier; Lancet, Jeffrey; Zhang, Guolin; Haura, Eric; Shibata, David; Yeatman, Timothy; Smalley, Keiran S.M.; Dalton, William S.; Huang, Emina; Scott, Ed; Bloom, Gregory C.; Eschrich, Steven A.; Koomen, John M.

2012-01-01

Purpose The Quantitative Assay Database (QuAD), http://proteome.moffitt.org/QUAD/, facilitates widespread implementation of quantitative mass spectrometry in cancer biology and clinical research through sharing of methods and reagents for monitoring protein expression and modification. Experimental Design Liquid chromatography coupled to multiple reaction monitoring mass spectrometry (LC-MRM) assays are developed using SDS-PAGE fractionated lysates from cancer cell lines. Pathway maps created using GeneGO Metacore provide the biological relationships between proteins and illustrate concepts for multiplexed analysis; each protein can be selected to examine assay development at the protein and peptide level. Results The coupling of SDS-PAGE and LC-MRM screening has been used to detect 876 peptides from 218 cancer-related proteins in model systems including colon, lung, melanoma, leukemias, and myeloma, which has led to the development of 95 quantitative assays including stable-isotope labeled peptide standards. Methods are published online and peptide standards are made available to the research community. Protein expression measurements for heat shock proteins, including a comparison with ELISA and monitoring response to the HSP90 inhibitor, 17-DMAG, are used to illustrate the components of the QuAD and its potential utility. Conclusions and Clinical Relevance This resource enables quantitative assessment of protein components of signaling pathways and biological processes and holds promise for systematic investigation of treatment responses in cancer. PMID:21656910

Critical factors determining the quantification capability of matrix-assisted laser desorption/ionization– time-of-flight mass spectrometry

PubMed Central

Wang, Chia-Chen; Lai, Yin-Hung; Ou, Yu-Meng; Chang, Huan-Tsung; Wang, Yi-Sheng

2016-01-01

Quantitative analysis with mass spectrometry (MS) is important but challenging. Matrix-assisted laser desorption/ionization (MALDI) coupled with time-of-flight (TOF) MS offers superior sensitivity, resolution and speed, but such techniques have numerous disadvantages that hinder quantitative analyses. This review summarizes essential obstacles to analyte quantification with MALDI-TOF MS, including the complex ionization mechanism of MALDI, sensitive characteristics of the applied electric fields and the mass-dependent detection efficiency of ion detectors. General quantitative ionization and desorption interpretations of ion production are described. Important instrument parameters and available methods of MALDI-TOF MS used for quantitative analysis are also reviewed. This article is part of the themed issue ‘Quantitative mass spectrometry’. PMID:27644968

Modeling of Receptor Tyrosine Kinase Signaling: Computational and Experimental Protocols.

PubMed

Fey, Dirk; Aksamitiene, Edita; Kiyatkin, Anatoly; Kholodenko, Boris N

2017-01-01

The advent of systems biology has convincingly demonstrated that the integration of experiments and dynamic modelling is a powerful approach to understand the cellular network biology. Here we present experimental and computational protocols that are necessary for applying this integrative approach to the quantitative studies of receptor tyrosine kinase (RTK) signaling networks. Signaling by RTKs controls multiple cellular processes, including the regulation of cell survival, motility, proliferation, differentiation, glucose metabolism, and apoptosis. We describe methods of model building and training on experimentally obtained quantitative datasets, as well as experimental methods of obtaining quantitative dose-response and temporal dependencies of protein phosphorylation and activities. The presented methods make possible (1) both the fine-grained modeling of complex signaling dynamics and identification of salient, course-grained network structures (such as feedback loops) that bring about intricate dynamics, and (2) experimental validation of dynamic models.

Diagnostic accuracy of semi-quantitative and quantitative culture techniques for the diagnosis of catheter-related infections in newborns and molecular typing of isolated microorganisms.

PubMed

Riboli, Danilo Flávio Moraes; Lyra, João César; Silva, Eliane Pessoa; Valadão, Luisa Leite; Bentlin, Maria Regina; Corrente, José Eduardo; Rugolo, Ligia Maria Suppo de Souza; da Cunha, Maria de Lourdes Ribeiro de Souza

2014-05-22

Catheter-related bloodstream infections (CR-BSIs) have become the most common cause of healthcare-associated bloodstream infections in neonatal intensive care units (ICUs). Microbiological evidence implicating catheters as the source of bloodstream infection is necessary to establish the diagnosis of CR-BSIs. Semi-quantitative culture is used to determine the presence of microorganisms on the external catheter surface, whereas quantitative culture also isolates microorganisms present inside the catheter. The main objective of this study was to determine the sensitivity and specificity of these two techniques for the diagnosis of CR-BSIs in newborns from a neonatal ICU. In addition, PFGE was used for similarity analysis of the microorganisms isolated from catheters and blood cultures. Semi-quantitative and quantitative methods were used for the culture of catheter tips obtained from newborns. Strains isolated from catheter tips and blood cultures which exhibited the same antimicrobial susceptibility profile were included in the study as positive cases of CR-BSI. PFGE of the microorganisms isolated from catheters and blood cultures was performed for similarity analysis and detection of clones in the ICU. A total of 584 catheter tips from 399 patients seen between November 2005 and June 2012 were analyzed. Twenty-nine cases of CR-BSI were confirmed. Coagulase-negative staphylococci (CoNS) were the most frequently isolated microorganisms, including S. epidermidis as the most prevalent species (65.5%), followed by S. haemolyticus (10.3%), yeasts (10.3%), K. pneumoniae (6.9%), S. aureus (3.4%), and E. coli (3.4%). The sensitivity of the semi-quantitative and quantitative techniques was 72.7% and 59.3%, respectively, and specificity was 95.7% and 94.4%. The diagnosis of CR-BSIs based on PFGE analysis of similarity between strains isolated from catheter tips and blood cultures showed 82.6% sensitivity and 100% specificity. The semi-quantitative culture method showed higher sensitivity and specificity for the diagnosis of CR-BSIs in newborns when compared to the quantitative technique. In addition, this method is easier to perform and shows better agreement with the gold standard, and should therefore be recommended for routine clinical laboratory use. PFGE may contribute to the control of CR-BSIs by identifying clusters of microorganisms in neonatal ICUs, providing a means of determining potential cross-infection between patients.

Breast cancer Ki67 expression preoperative discrimination by DCE-MRI radiomics features

NASA Astrophysics Data System (ADS)

Ma, Wenjuan; Ji, Yu; Qin, Zhuanping; Guo, Xinpeng; Jian, Xiqi; Liu, Peifang

2018-02-01

To investigate whether quantitative radiomics features extracted from dynamic contrast-enhanced magnetic resonance imaging (DCE-MRI) are associated with Ki67 expression of breast cancer. In this institutional review board approved retrospective study, we collected 377 cases Chinese women who were diagnosed with invasive breast cancer in 2015. This cohort included 53 low-Ki67 expression (Ki67 proliferation index less than 14%) and 324 cases with high-Ki67 expression (Ki67 proliferation index more than 14%). A binary-classification of low- vs. high- Ki67 expression was performed. A set of 52 quantitative radiomics features, including morphological, gray scale statistic, and texture features, were extracted from the segmented lesion area. Three most common machine learning classification methods, including Naive Bayes, k-Nearest Neighbor and support vector machine with Gaussian kernel, were employed for the classification and the least absolute shrink age and selection operator (LASSO) method was used to select most predictive features set for the classifiers. Classification performance was evaluated by the area under receiver operating characteristic curve (AUC), accuracy, sensitivity and specificity. The model that used Naive Bayes classification method achieved the best performance than the other two methods, yielding 0.773 AUC value, 0.757 accuracy, 0.777 sensitivity and 0.769 specificity. Our study showed that quantitative radiomics imaging features of breast tumor extracted from DCE-MRI are associated with breast cancer Ki67 expression. Future larger studies are needed in order to further evaluate the findings.

Headspace gas chromatographic method for the measurement of difluoroethane in blood.

PubMed

Broussard, L A; Broussard, A; Pittman, T; Lafferty, D; Presley, L

2001-01-01

To develop a gas chromatographic assay for the analysis of difluoroethane, a volatile substance, in blood and to determine assay characteristics including linearity, limit of quantitation, precision, and specificity. Referral toxicology laboratory Difluoroethane, a colorless, odorless, highly flammable gas used as a refrigerant blend component and aerosol propellant, may be abused via inhalation. A headspace gas chromatographic procedure for the identification and quantitation of difluoroethane in blood is presented. A methanolic stock standard prepared from pure gaseous difluoroethane was used to prepare whole blood calibrators. Quantitation of difluoroethane was performed using a six-point calibration curve and an internal standard of 1-propanol. The assay is linear from 0 to 115 mg/L including a low calibrator at 4 mg/L, the limit of quantitation. Within-run coefficients of variation at mean concentrations of 13.8 mg/L and 38.5 mg/L were 5.8% and 6.8% respectively. Between-run coefficients of variation at mean concentrations of 15.9 mg/L and 45.7 mg/L were 13.4% and 9.8% respectively. Several volatile substances were tested as potential interfering compounds with propane having a retention time identical to that of difluoroethane. This method requires minimal sample preparation, is rapid and reproducible, can be modified for the quantitation of other volatiles, and could be automated using an automatic sampler/injector system.

Normalized Temperature Contrast Processing in Infrared Flash Thermography

NASA Technical Reports Server (NTRS)

Koshti, Ajay M.

2016-01-01

The paper presents further development in normalized contrast processing used in flash infrared thermography method. Method of computing normalized image or pixel intensity contrast, and normalized temperature contrast are provided. Methods of converting image contrast to temperature contrast and vice versa are provided. Normalized contrast processing in flash thermography is useful in quantitative analysis of flash thermography data including flaw characterization and comparison of experimental results with simulation. Computation of normalized temperature contrast involves use of flash thermography data acquisition set-up with high reflectivity foil and high emissivity tape such that the foil, tape and test object are imaged simultaneously. Methods of assessing other quantitative parameters such as emissivity of object, afterglow heat flux, reflection temperature change and surface temperature during flash thermography are also provided. Temperature imaging and normalized temperature contrast processing provide certain advantages over normalized image contrast processing by reducing effect of reflected energy in images and measurements, therefore providing better quantitative data. Examples of incorporating afterglow heat-flux and reflection temperature evolution in flash thermography simulation are also discussed.

Mixed-methods research in pharmacy practice: basics and beyond (part 1).

PubMed

Hadi, Muhammad Abdul; Alldred, David Phillip; Closs, S José; Briggs, Michelle

2013-10-01

This is the first of two papers which explore the use of mixed-methods research in pharmacy practice. In an era of evidence-based medicine and policy, high-quality research evidence is essential for the development of effective pharmacist-led services. Over the past decade, the use of mixed-methods research has become increasingly common in healthcare, although to date its use has been relatively limited in pharmacy practice research. In this article, the basic concepts of mixed-methods research including its definition, typologies and advantages in relation to pharmacy practice research are discussed. Mixed-methods research brings together qualitative and quantitative methodologies within a single study to answer or understand a research problem. There are a number of mixed-methods designs available, but the selection of an appropriate design must always be dictated by the research question. Importantly, mixed-methods research should not be seen as a 'tool' to collect qualitative and quantitative data, rather there should be some degree of 'integration' between the two data sets. If conducted appropriately, mixed-methods research has the potential to generate quality research evidence by combining strengths and overcoming the respective limitations of qualitative and quantitative methodologies. © 2012 Royal Pharmaceutical Society.

High-throughput SISCAPA quantitation of peptides from human plasma digests by ultrafast, liquid chromatography-free mass spectrometry.

PubMed

Razavi, Morteza; Frick, Lauren E; LaMarr, William A; Pope, Matthew E; Miller, Christine A; Anderson, N Leigh; Pearson, Terry W

2012-12-07

We investigated the utility of an SPE-MS/MS platform in combination with a modified SISCAPA workflow for chromatography-free MRM analysis of proteotypic peptides in digested human plasma. This combination of SISCAPA and SPE-MS/MS technology allows sensitive, MRM-based quantification of peptides from plasma digests with a sample cycle time of ∼7 s, a 300-fold improvement over typical MRM analyses with analysis times of 30-40 min that use liquid chromatography upstream of MS. The optimized system includes capture and enrichment to near purity of target proteotypic peptides using rigorously selected, high affinity, antipeptide monoclonal antibodies and reduction of background peptides using a novel treatment of magnetic bead immunoadsorbents. Using this method, we have successfully quantitated LPS-binding protein and mesothelin (concentrations of ∼5000 ng/mL and ∼10 ng/mL, respectively) in human plasma. The method eliminates the need for upstream liquid-chromatography and can be multiplexed, thus facilitating quantitative analysis of proteins, including biomarkers, in large sample sets. The method is ideal for high-throughput biomarker validation after affinity enrichment and has the potential for applications in clinical laboratories.

Quantitative Determination of α-Arbutin, β-Arbutin, Kojic Acid, Nicotinamide, Hydroquinone, Resorcinol, 4-Methoxyphenol, 4-Ethoxyphenol, and Ascorbic Acid from Skin Whitening Products by HPLC-UV.

PubMed

Wang, Yan-Hong; Avonto, Cristina; Avula, Bharathi; Wang, Mei; Rua, Diego; Khan, Ikhlas A

2015-01-01

An HPLC-UV method was developed for the quantitative analysis of nine skin whitening agents in a single injection. These compounds are α-arbutin, β-arbutin, kojic acid, nicotinamide, resorcinol, ascorbic acid, hydroquinone, 4-methoxyphenol, and 4-ethoxyphenol. The separation was achieved on a reversed-phase C18 column within 30 min. The mobile phase was composed of water and methanol, both containing 0.1% acetic acid (v/v). The stability of the analytes was evaluated at different pH values between 2.3 and 7.6, and the extraction procedure was validated for different types of skin whitening product matrixes, which included two creams, a soap bar, and a capsule. The best solvent system for sample preparation was 20 mM NaH2PO4 containing 10% methanol at pH 2.3. The analytical method was validated for accuracy, precision, LOD, and LOQ. The developed HPLC-UV method was applied for the quantitation of the nine analytes in 59 skin whitening products including creams, lotions, sera, foams, gels, mask sheets, soap bars, tablets, and capsules.

Indicators of Family Care for Development for Use in Multicountry Surveys

PubMed Central

Kariger, Patricia; Engle, Patrice; Britto, Pia M. Rebello; Sywulka, Sara M.; Menon, Purnima

2012-01-01

Indicators of family care for development are essential for ascertaining whether families are providing their children with an environment that leads to positive developmental outcomes. This project aimed to develop indicators from a set of items, measuring family care practices and resources important for caregiving, for use in epidemiologic surveys in developing countries. A mixed method (quantitative and qualitative) design was used for item selection and evaluation. Qualitative and quantitative analyses were conducted to examine the validity of candidate items in several country samples. Qualitative methods included the use of global expert panels to identify and evaluate the performance of each candidate item as well as in-country focus groups to test the content validity of the items. The quantitative methods included analyses of item-response distributions, using bivariate techniques. The selected items measured two family care practices (support for learning/stimulating environment and limit-setting techniques) and caregiving resources (adequacy of the alternate caregiver when the mother worked). Six play-activity items, indicative of support for learning/stimulating environment, were included in the core module of UNICEF's Multiple Cluster Indictor Survey 3. The other items were included in optional modules. This project provided, for the first time, a globally-relevant set of items for assessing family care practices and resources in epidemiological surveys. These items have multiple uses, including national monitoring and cross-country comparisons of the status of family care for development used globally. The obtained information will reinforce attention to efforts to improve the support for development of children. PMID:23304914

Method for the melting of metals

DOEpatents

White, Jack C.; Traut, Davis E.

1992-01-01

A method of quantitatively determining the molten pool configuration in melting of metals. The method includes the steps of introducing hafnium metal seeds into a molten metal pool at intervals to form ingots, neutron activating the ingots and determining the hafnium location by radiometric means. Hafnium possesses exactly the proper metallurgical and radiochemical properties for this use.

Quantitation and detection of vanadium in biologic and pollution materials

NASA Technical Reports Server (NTRS)

Gordon, W. A.

1974-01-01

A review is presented of special considerations and methodology for determining vanadium in biological and air pollution materials. In addition to descriptions of specific analysis procedures, general sections are included on quantitation of analysis procedures, sample preparation, blanks, and methods of detection of vanadium. Most of the information presented is applicable to the determination of other trace elements in addition to vanadium.

Nanoscale Magnetism in Next Generation Magnetic Nanoparticles

DTIC Science & Technology

2018-03-17

as dextran coated SPIONs were studied. From the measured T1 and T2 relaxation times, a new method called Quantitative Ultra- Short Time-to-Echo...angiograms with high clarity and definition, and enabled quantitative MRI in biological samples. At UCL, the work included (i) fabricating multi-element...distribution unlimited. I. Introduction Compared to flat biosensor devices, 3D engineered biosensors achievemore intimate and conformal interfaces with cells

US Interpretation of International Space Policies Regarding Commercial Resource Acquisitions

DTIC Science & Technology

2015-06-12

examining research . These include narrative research , phenomenology , grounded theory , ethnography , and case studies . The first four of these......within a case study strategy a methodology of research must be selected. Possible choices in methods used include quantitative, qualitative , or mixed

Quality of life among dermatology patients: a systematic review of investigations using qualitative methods.

PubMed

Singh, Sanminder; Ehsani-Chimeh, Nazanin; Kornmehl, Heather; Armstrong, April W

2017-07-13

Quality of life may be assessed using quantitative or qualitative methods. Quantitative methods are commonly used in research settings; however, they may fail to capture the full range of patient experiences and impact on quality of life. Qualitative methods may be used to address this limitation. In this systematic review, we aim to synthesize data from articles utilizing qualitative methods to assess quality of life in dermatology patients. We performed a systematic review search using the MEDLINE, EMBASE, and SCOPUS databases. The search was conducted using the following search criteria: ("Dermatology" [MeSH]) AND ("Quality of Life" [MeSH]), AND ("Qualitative Research" [MeSH]), searching literature spanning from January 1, 1946- October 5, 2016. The systematic review of 15 articles included 533 dermatology patients. Patients expressed frustration over the unpredictability of disease symptoms and having to compensate for the subsequent limitations by altering their daily routines. Patients also reported profound helplessness due to chronic skin disease and social isolation in an effort to hide their disease. Patients noted the patient-provider relationship as a source of support and information exchange, with the goal to form easy to use treatment plans that met both physician and patient expectations. Qualitative assessment of patient quality of life can provide new insights into the patient experience and the impact of their skin disease. Qualitative methodology may capture meaningful information that may be overlooked by quantitative methods, and it should be included in quality of life research.

Development of CD3 cell quantitation algorithms for renal allograft biopsy rejection assessment utilizing open source image analysis software.

PubMed

Moon, Andres; Smith, Geoffrey H; Kong, Jun; Rogers, Thomas E; Ellis, Carla L; Farris, Alton B Brad

2018-02-01

Renal allograft rejection diagnosis depends on assessment of parameters such as interstitial inflammation; however, studies have shown interobserver variability regarding interstitial inflammation assessment. Since automated image analysis quantitation can be reproducible, we devised customized analysis methods for CD3+ T-cell staining density as a measure of rejection severity and compared them with established commercial methods along with visual assessment. Renal biopsy CD3 immunohistochemistry slides (n = 45), including renal allografts with various degrees of acute cellular rejection (ACR) were scanned for whole slide images (WSIs). Inflammation was quantitated in the WSIs using pathologist visual assessment, commercial algorithms (Aperio nuclear algorithm for CD3+ cells/mm 2 and Aperio positive pixel count algorithm), and customized open source algorithms developed in ImageJ with thresholding/positive pixel counting (custom CD3+%) and identification of pixels fulfilling "maxima" criteria for CD3 expression (custom CD3+ cells/mm 2 ). Based on visual inspections of "markup" images, CD3 quantitation algorithms produced adequate accuracy. Additionally, CD3 quantitation algorithms correlated between each other and also with visual assessment in a statistically significant manner (r = 0.44 to 0.94, p = 0.003 to < 0.0001). Methods for assessing inflammation suggested a progression through the tubulointerstitial ACR grades, with statistically different results in borderline versus other ACR types, in all but the custom methods. Assessment of CD3-stained slides using various open source image analysis algorithms presents salient correlations with established methods of CD3 quantitation. These analysis techniques are promising and highly customizable, providing a form of on-slide "flow cytometry" that can facilitate additional diagnostic accuracy in tissue-based assessments.

Quantitation of peptides from non-invasive skin tapings using isotope dilution and tandem mass spectrometry.

PubMed

Reisdorph, Nichole; Armstrong, Michael; Powell, Roger; Quinn, Kevin; Legg, Kevin; Leung, Donald; Reisdorph, Rick

2018-05-01

Previous work from our laboratories utilized a novel skin taping method and mass spectrometry-based proteomics to discover clinical biomarkers of skin conditions; these included atopic dermatitis, Staphylococcus aureus colonization, and eczema herpeticum. While suitable for discovery purposes, semi-quantitative proteomics is generally time-consuming and expensive. Furthermore, depending on the method used, discovery-based proteomics can result in high variation and inadequate sensitivity to detect low abundant peptides. Therefore, we strove to develop a rapid, sensitive, and reproducible method to quantitate disease-related proteins from skin tapings. We utilized isotopically-labeled peptides and tandem mass spectrometry to obtain absolute quantitation values on 14 peptides from 7 proteins; these proteins had shown previous importance in skin disease. The method demonstrated good reproducibility, dynamic range, and linearity (R 2  > 0.993) when n = 3 standards were analyzed across 0.05-2.5 pmol. The method was used to determine if differences exist between skin proteins in a small group of atopic versus non-atopic individuals (n = 12). While only minimal differences were found, peptides were detected in all samples and exhibited good correlation between peptides for 5 of the 7 proteins (R 2  = 0.71-0.98). This method can be applied to larger cohorts to further establish the relationships of these proteins to skin disease. Copyright © 2017. Published by Elsevier B.V.

Differentiated Instruction in the Classroom

ERIC Educational Resources Information Center

Kelly, Gretchen

2013-01-01

Low achievement on standardized tests may be attributed to many factors, including teaching methods. Differentiated instruction has been identified as a teaching method using different learning modalities that appeal to varied student interests with individualized instruction. The purpose of this quantitative study was to compare whole-group…

Ultrasonic NDE Simulation for Composite Manufacturing Defects

NASA Technical Reports Server (NTRS)

Leckey, Cara A. C.; Juarez, Peter D.

2016-01-01

The increased use of composites in aerospace components is expected to continue into the future. The large scale use of composites in aerospace necessitates the development of composite-appropriate nondestructive evaluation (NDE) methods to quantitatively characterize defects in as-manufactured parts and damage incurred during or post manufacturing. Ultrasonic techniques are one of the most common approaches for defect/damage detection in composite materials. One key technical challenge area included in NASA's Advanced Composite's Project is to develop optimized rapid inspection methods for composite materials. Common manufacturing defects in carbon fiber reinforced polymer (CFRP) composites include fiber waviness (in-plane and out-of-plane), porosity, and disbonds; among others. This paper is an overview of ongoing work to develop ultrasonic wavefield based methods for characterizing manufacturing waviness defects. The paper describes the development and implementation of a custom ultrasound simulation tool that is used to model ultrasonic wave interaction with in-plane fiber waviness (also known as marcelling). Wavefield data processing methods are applied to the simulation data to explore possible routes for quantitative defect characterization.

A Method to Measure and Estimate Normalized Contrast in Infrared Flash Thermography

NASA Technical Reports Server (NTRS)

Koshti, Ajay M.

2016-01-01

The paper presents further development in normalized contrast processing used in flash infrared thermography method. Method of computing normalized image or pixel intensity contrast, and normalized temperature contrast are provided. Methods of converting image contrast to temperature contrast and vice versa are provided. Normalized contrast processing in flash thermography is useful in quantitative analysis of flash thermography data including flaw characterization and comparison of experimental results with simulation. Computation of normalized temperature contrast involves use of flash thermography data acquisition set-up with high reflectivity foil and high emissivity tape such that the foil, tape and test object are imaged simultaneously. Methods of assessing other quantitative parameters such as emissivity of object, afterglow heat flux, reflection temperature change and surface temperature during flash thermography are also provided. Temperature imaging and normalized temperature contrast processing provide certain advantages over normalized image contrast processing by reducing effect of reflected energy in images and measurements, therefore providing better quantitative data. Examples of incorporating afterglow heat-flux and reflection temperature evolution in flash thermography simulation are also discussed.

Three-dimensional label-free imaging and quantification of lipid droplets in live hepatocytes

NASA Astrophysics Data System (ADS)

Kim, Kyoohyun; Lee, Seoeun; Yoon, Jonghee; Heo, Jihan; Choi, Chulhee; Park, Yongkeun

2016-11-01

Lipid droplets (LDs) are subcellular organelles with important roles in lipid storage and metabolism and involved in various diseases including cancer, obesity, and diabetes. Conventional methods, however, have limited ability to provide quantitative information on individual LDs and have limited capability for three-dimensional (3-D) imaging of LDs in live cells especially for fast acquisition of 3-D dynamics. Here, we present an optical method based on 3-D quantitative phase imaging to measure the 3-D structural distribution and biochemical parameters (concentration and dry mass) of individual LDs in live cells without using exogenous labelling agents. The biochemical change of LDs under oleic acid treatment was quantitatively investigated, and 4-D tracking of the fast dynamics of LDs revealed the intracellular transport of LDs in live cells.

Effects of Drama Method on Speaking Anxieties of Pre-Service Teachers and Their Opinions about the Method

ERIC Educational Resources Information Center

Sevim, Oguzhan

2014-01-01

The aim of this study is to determine the effects of the drama method on speaking anxieties of pre-service teachers and their opinions about the method. In the study, mixed method including experimental design, quantitative, and basic qualitative research was used. The study was carried out with 77 first grade students from day-time and evening…

A comparative uncertainty study of the calibration of macrolide antibiotic reference standards using quantitative nuclear magnetic resonance and mass balance methods.

PubMed

Liu, Shu-Yu; Hu, Chang-Qin

2007-10-17

This study introduces the general method of quantitative nuclear magnetic resonance (qNMR) for the calibration of reference standards of macrolide antibiotics. Several qNMR experimental conditions were optimized including delay, which is an important parameter of quantification. Three kinds of macrolide antibiotics were used to validate the accuracy of the qNMR method by comparison with the results obtained by the high performance liquid chromatography (HPLC) method. The purities of five common reference standards of macrolide antibiotics were measured by the 1H qNMR method and the mass balance method, respectively. The analysis results of the two methods were compared. The qNMR is quick and simple to use. In a new medicine research and development process, qNMR provides a new and reliable method for purity analysis of the reference standard.

Investigation of a dual modal method for bone pathologies using quantitative ultrasound and photoacoustics

NASA Astrophysics Data System (ADS)

Steinberg, Idan; Gannot, Israel; Eyal, Avishay

2015-03-01

Osteoporosis is a widespread disease that has a catastrophic impact on patient's lives and overwhelming related healthcare costs. In recent works, we have developed a multi-spectral, frequency domain photoacoustic method for the evaluation of bone pathologies. This method has great advantages over pure ultrasonic or optical methods as it provides both molecular information from the bone absorption spectrum and bone mechanical status from the characteristics of the ultrasound propagation. These characteristics include both the Speed of Sound (SOS) and Broadband Ultrasonic Attenuation (BUA). To test the method's quantitative predictions, we have constructed a combined ultrasound and photoacoustic setup. Here, we experimentally present a dual modality system, and compares between the methods on bone samples in-vitro. The differences between the two modalities are shown to provide valuable insight into the bone structure and functional status.

Apparatus for rapid measurement of aerosol bulk chemical composition

DOEpatents

Lee, Yin-Nan E.; Weber, Rodney J.; Orsini, Douglas

2006-04-18

An apparatus for continuous on-line measurement of chemical composition of aerosol particles with a fast time resolution is provided. The apparatus includes an enhanced particle size magnifier for producing activated aerosol particles and an enhanced collection device which collects the activated aerosol particles into a liquid stream for quantitative analysis by analytical means. Methods for on-line measurement of chemical composition of aerosol particles are also provided, the method including exposing aerosol carrying sample air to hot saturated steam thereby forming activated aerosol particles; collecting the activated aerosol particles by a collection device for delivery as a jet stream onto an impaction surface; and flushing off the activated aerosol particles from the impaction surface into a liquid stream for delivery of the collected liquid stream to an analytical instrument for quantitative measurement.

[Variable selection methods combined with local linear embedding theory used for optimization of near infrared spectral quantitative models].

PubMed

Hao, Yong; Sun, Xu-Dong; Yang, Qiang

2012-12-01

Variables selection strategy combined with local linear embedding (LLE) was introduced for the analysis of complex samples by using near infrared spectroscopy (NIRS). Three methods include Monte Carlo uninformation variable elimination (MCUVE), successive projections algorithm (SPA) and MCUVE connected with SPA were used for eliminating redundancy spectral variables. Partial least squares regression (PLSR) and LLE-PLSR were used for modeling complex samples. The results shown that MCUVE can both extract effective informative variables and improve the precision of models. Compared with PLSR models, LLE-PLSR models can achieve more accurate analysis results. MCUVE combined with LLE-PLSR is an effective modeling method for NIRS quantitative analysis.

[Gas chromatography in quantitative analysis of hydrocyanic acid and its salts in cadaveric blood].

PubMed

Iablochkin, V D

2003-01-01

A direct gas chromatography method was designed for the quantitative determination of cyanides (prussic acid) in cadaveric blood. Its sensitivity is 0.05 mg/ml. The routine volatile products, including substances, which emerge due to putrefaction of organic matters, do not affect the accuracy and reproducibility of the method; the exception is H-propanol that was used as the internal standard. The method was used in legal chemical expertise related with acute cyanide poisoning (suicide) as well as with poisoning of products of combustion of nonmetals (foam-rubber). The absolute error does not exceed 10% with a mean quadratic deviation of 0.0029-0.0033 mg.

Colour measurements of pigmented rice grain using flatbed scanning and image analysis

NASA Astrophysics Data System (ADS)

Kaisaat, Khotchakorn; Keawdonree, Nuttapong; Chomkokard, Sakchai; Jinuntuya, Noparit; Pattanasiri, Busara

2017-09-01

Recently, the National Bureau of Agricultural Commodity and Food Standards (ACFS) have drafted a manual of Thai colour rice standards. However, there are no quantitative descriptions of rice colour and its measurement method. These drawbacks might lead to misunderstanding for people who use the manual. In this work, we proposed an inexpensive method, using flatbed scanning together with image analysis, to quantitatively measure rice colour and colour uniformity. To demonstrate its general applicability for colour differentiation of rice, we applied it to different kinds of pigmented rice, including Riceberry rice with and without uniform colour and Chinese black rice.

When to Use What Research Design

ERIC Educational Resources Information Center

Vogt, W. Paul; Gardner, Dianne C.; Haeffele, Lynne M.

2012-01-01

Systematic, practical, and accessible, this is the first book to focus on finding the most defensible design for a particular research question. Thoughtful guidelines are provided for weighing the advantages and disadvantages of various methods, including qualitative, quantitative, and mixed methods designs. The book can be read sequentially or…

Mixed Methods Sampling: A Typology with Examples

ERIC Educational Resources Information Center

Teddlie, Charles; Yu, Fen

2007-01-01

This article presents a discussion of mixed methods (MM) sampling techniques. MM sampling involves combining well-established qualitative and quantitative techniques in creative ways to answer research questions posed by MM research designs. Several issues germane to MM sampling are presented including the differences between probability and…

Methods of Microcomputer Research in Early Childhood Special Education.

ERIC Educational Resources Information Center

Fujiura, Glenn; Johnson, Lawrence J.

1986-01-01

The review of some recent studies on use of microcomputers in early childhood special education highlights methodological issues including the qualitative quantitative distinction and the interdependence of research design and interpretation. Imbedding qualitative methods into quasi- or true-experimental designs can provide more information than…

Current issues involving screening and identification of chemical contaminants in foods by mass spectrometry

USDA-ARS?s Scientific Manuscript database

Although quantitative analytical methods must be empirically validated prior to their actual use in a variety of applications, including regulatory monitoring of chemical adulterants in foods, validation of qualitative method performance for the analytes and matrices of interest is frequently ignore...

Mixed Methods Research Designs in Counseling Psychology

ERIC Educational Resources Information Center

Hanson, William E.; Creswell, John W.; Clark, Vicki L. Plano; Petska, Kelly S.; Creswell, David J.

2005-01-01

With the increased popularity of qualitative research, researchers in counseling psychology are expanding their methodologies to include mixed methods designs. These designs involve the collection, analysis, and integration of quantitative and qualitative data in a single or multiphase study. This article presents an overview of mixed methods…

To Demonstrate the Specificity of an Enzymatic Method for Plasma Paracetamol Estimation.

ERIC Educational Resources Information Center

O'Mullane, John A.

1987-01-01

Describes an experiment designed to introduce biochemistry students to the specificity of an analytical method which uses an enzyme to quantitate its substrate. Includes the use of toxicity charts together with the concept of the biological half-life of a drug. (TW)

Synthesising quantitative and qualitative research in evidence‐based patient information

PubMed Central

Goldsmith, Megan R; Bankhead, Clare R; Austoker, Joan

2007-01-01

Background Systematic reviews have, in the past, focused on quantitative studies and clinical effectiveness, while excluding qualitative evidence. Qualitative research can inform evidence‐based practice independently of other research methodologies but methods for the synthesis of such data are currently evolving. Synthesising quantitative and qualitative research in a single review is an important methodological challenge. Aims This paper describes the review methods developed and the difficulties encountered during the process of updating a systematic review of evidence to inform guidelines for the content of patient information related to cervical screening. Methods Systematic searches of 12 electronic databases (January 1996 to July 2004) were conducted. Studies that evaluated the content of information provided to women about cervical screening or that addressed women's information needs were assessed for inclusion. A data extraction form and quality assessment criteria were developed from published resources. A non‐quantitative synthesis was conducted and a tabular evidence profile for each important outcome (eg “explain what the test involves”) was prepared. The overall quality of evidence for each outcome was then assessed using an approach published by the GRADE working group, which was adapted to suit the review questions and modified to include qualitative research evidence. Quantitative and qualitative studies were considered separately for every outcome. Results 32 papers were included in the systematic review following data extraction and assessment of methodological quality. The review questions were best answered by evidence from a range of data sources. The inclusion of qualitative research, which was often highly relevant and specific to many components of the screening information materials, enabled the production of a set of recommendations that will directly affect policy within the NHS Cervical Screening Programme. Conclusions A practical example is provided of how quantitative and qualitative data sources might successfully be brought together and considered in one review. PMID:17325406

QTest: Quantitative Testing of Theories of Binary Choice.

PubMed

Regenwetter, Michel; Davis-Stober, Clintin P; Lim, Shiau Hong; Guo, Ying; Popova, Anna; Zwilling, Chris; Cha, Yun-Shil; Messner, William

2014-01-01

The goal of this paper is to make modeling and quantitative testing accessible to behavioral decision researchers interested in substantive questions. We provide a novel, rigorous, yet very general, quantitative diagnostic framework for testing theories of binary choice. This permits the nontechnical scholar to proceed far beyond traditionally rather superficial methods of analysis, and it permits the quantitatively savvy scholar to triage theoretical proposals before investing effort into complex and specialized quantitative analyses. Our theoretical framework links static algebraic decision theory with observed variability in behavioral binary choice data. The paper is supplemented with a custom-designed public-domain statistical analysis package, the QTest software. We illustrate our approach with a quantitative analysis using published laboratory data, including tests of novel versions of "Random Cumulative Prospect Theory." A major asset of the approach is the potential to distinguish decision makers who have a fixed preference and commit errors in observed choices from decision makers who waver in their preferences.

A Systematic Review of Mixed Methods Research on Human Factors and Ergonomics in Health Care

PubMed Central

Carayon, Pascale; Kianfar, Sarah; Li, Yaqiong; Xie, Anping; Alyousef, Bashar; Wooldridge, Abigail

2016-01-01

This systematic literature review provides information on the use of mixed methods research in human factors and ergonomics (HFE) research in health care. Using the PRISMA methodology, we searched four databases (PubMed, PsycInfo, Web of Science, and Engineering Village) for studies that met the following inclusion criteria: (1) field study in health care, (2) mixing of qualitative and quantitative data, (3) HFE issues, and (4) empirical evidence. Using an iterative and collaborative process supported by a structured data collection form, the six authors identified a total of 58 studies that primarily address HFE issues in health information technology (e.g., usability) and in the work of healthcare workers. About two-thirds of the mixed methods studies used the convergent parallel study design where quantitative and qualitative data were collected simultaneously. A variety of methods were used for collecting data, including interview, survey and observation. The most frequent combination involved interview for qualitative data and survey for quantitative data. The use of mixed methods in healthcare HFE research has increased over time. However, increasing attention should be paid to the formal literature on mixed methods research to enhance the depth and breadth of this research. PMID:26154228

78 FR 19446 - Marine Mammal Stock Assessment Reports

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-01

... Fisheries Management Council, and one individual. Many comments recommended initiation or repetition of... incorporated in the reports but are not included in the summary of comments and responses below. In some cases... injury for marine mammals, which includes quantitative methods for accounting for injury cases where the...

Nanoscale Structure of Type I Collagen Fibrils: Quantitative Measurement of D-spacing

PubMed Central

Erickson, Blake; Fang, Ming; Wallace, Joseph M.; Orr, Bradford G.; Les, Clifford M.; Holl, Mark M. Banaszak

2012-01-01

This paper details a quantitative method to measure the D-periodic spacing of Type I collagen fibrils using Atomic Force Microscopy coupled with analysis using a 2D Fast Fourier Transform approach. Instrument calibration, data sampling and data analysis are all discussed and comparisons of the data to the complementary methods of electron microscopy and X-ray scattering are made. Examples of the application of this new approach to the analysis of Type I collagen morphology in disease models of estrogen depletion and Osteogenesis Imperfecta are provided. We demonstrate that it is the D-spacing distribution, not the D-spacing mean, that showed statistically significant differences in estrogen depletion associated with early stage Osteoporosis and Osteogenesis Imperfecta. The ability to quantitatively characterize nanoscale morphological features of Type I collagen fibrils will provide important structural information regarding Type I collagen in many research areas, including tissue aging and disease, tissue engineering, and gene knock out studies. Furthermore, we also envision potential clinical applications including evaluation of tissue collagen integrity under the impact of diseases or drug treatments. PMID:23027700

Use of a deuterated internal standard with pyrolysis-GC/MS dimeric marker analysis to quantify tire tread particles in the environment.

PubMed

Unice, Kenneth M; Kreider, Marisa L; Panko, Julie M

2012-11-08

Pyrolysis(pyr)-GC/MS analysis of characteristic thermal decomposition fragments has been previously used for qualitative fingerprinting of organic sources in environmental samples. A quantitative pyr-GC/MS method based on characteristic tire polymer pyrolysis products was developed for tread particle quantification in environmental matrices including soil, sediment, and air. The feasibility of quantitative pyr-GC/MS analysis of tread was confirmed in a method evaluation study using artificial soil spiked with known amounts of cryogenically generated tread. Tread concentration determined by blinded analyses was highly correlated (r2 ≥ 0.88) with the known tread spike concentration. Two critical refinements to the initial pyrolysis protocol were identified including use of an internal standard and quantification by the dimeric markers vinylcyclohexene and dipentene, which have good specificity for rubber polymer with no other appreciable environmental sources. A novel use of deuterated internal standards of similar polymeric structure was developed to correct the variable analyte recovery caused by sample size, matrix effects, and ion source variability. The resultant quantitative pyr-GC/MS protocol is reliable and transferable between laboratories.

Digital Holography, a metrological tool for quantitative analysis: Trends and future applications

NASA Astrophysics Data System (ADS)

Paturzo, Melania; Pagliarulo, Vito; Bianco, Vittorio; Memmolo, Pasquale; Miccio, Lisa; Merola, Francesco; Ferraro, Pietro

2018-05-01

A review on the last achievements of Digital Holography is reported in this paper, showing that this powerful method can be a key metrological tool for the quantitative analysis and non-invasive inspection of a variety of materials, devices and processes. Nowadays, its range of applications has been greatly extended, including the study of live biological matter and biomedical applications. This paper overviews the main progresses and future perspectives of digital holography, showing new optical configurations and investigating the numerical issues to be tackled for the processing and display of quantitative data.

Physical Therapy and Exercise Interventions in Huntington’s Disease: A Mixed Methods Systematic Review

PubMed Central

Fritz, Nora E.; Rao, Ashwini K.; Kegelmeyer, Deb; Kloos, Anne; Busse, Monica; Hartel, Lynda; Carrier, Judith; Quinn, Lori

2017-01-01

Background: A number of studies evaluating physical therapy and exercise interventions in Huntington’s disease have been conducted over the past 15 years. However, an assessment of the quality and strength of the evidence in support of these interventions is lacking. Objective: The purpose of this systematic review was to investigate the effectiveness of physical therapy and exercise interventions in people with Huntington’s disease, and to examine the perceptions of patients, families and caregivers of these interventions. Methods: This mixed-methods systematic review utilized the Joanna Briggs Institute (JBI) approach and extraction tools to evaluate the literature from January 2003 until May 2016. The review considered interventions that included exercise and physical therapy interventions, and included both quantitative and qualitative outcome measures. Results: Twenty (20) studies met the inclusion criteria, including eighteen (18) that had quantitative outcome measures and two (2) that utilized qualitative methods. JBI Levels of evidence for the 18 quantitative studies were as follows: Eight studies were at evidence Level 1, seven were at Level 2, two were at Level 3, and one was at Level 4. Conclusions: Our review suggests that there is preliminary support for the benefits of exercise and physical activity in Huntington’s disease in terms of motor function, gait speed, and balance, as well as a range of physical and social benefits identified through patient-reported outcomes. Variability in mode of intervention as well as outcome measures limits the interpretability of these studies, and high-quality studies that incorporate adaptive trial designs for this rare disease are needed. PMID:28968244

Determinants of fruit and vegetable consumption among children and adolescents: a review of the literature. Part II: qualitative studies

PubMed Central

2011-01-01

Background Large proportions of children do not fulfil the World Health Organization recommendation of eating at least 400 grams of fruit and vegetables (FV) per day. To promote an increased FV intake among children it is important to identify factors which influence their consumption. Both qualitative and quantitative studies are needed. Earlier reviews have analysed evidence from quantitative studies. The aim of this paper is to present a systematic review of qualitative studies of determinants of children's FV intake. Methods Relevant studies were identified by searching Anthropology Plus, Cinahl, CSA illumine, Embase, International Bibliography of the Social Sciences, Medline, PsycINFO, and Web of Science using combinations of synonyms for FV intake, children/adolescents and qualitative methods as search terms. The literature search was completed by December 1st 2010. Papers were included if they applied qualitative methods to investigate 6-18-year-olds' perceptions of factors influencing their FV consumption. Quantitative studies, review studies, studies reported in other languages than English, and non-peer reviewed or unpublished manuscripts were excluded. The papers were reviewed systematically using standardised templates for summary of papers, quality assessment, and synthesis of findings across papers. Results The review included 31 studies, mostly based on US populations and focus group discussions. The synthesis identified the following potential determinants for FV intake which supplement the quantitative knowledge base: Time costs; lack of taste guarantee; satiety value; appropriate time/occasions/settings for eating FV; sensory and physical aspects; variety, visibility, methods of preparation; access to unhealthy food; the symbolic value of food for image, gender identity and social interaction with peers; short term outcome expectancies. Conclusions The review highlights numerous potential determinants which have not been investigated thoroughly in quantitative studies. Future large scale quantitative studies should attempt to quantify the importance of these factors. Further, mechanisms behind gender, age and socioeconomic differences in FV consumption are proposed which should be tested quantitatively in order to better tailor interventions to vulnerable groups. Finally, the review provides input to the conceptualisation and measurements of concepts (i.e. peer influence, availability in schools) which may refine survey instruments and theoretical frameworks concerning eating behaviours. PMID:21999291

Doing Educational Research

ERIC Educational Resources Information Center

Opie, Clive

2004-01-01

Developed as a hands-on guide for students engaged in educational research, this book provides an introduction to key qualitative and quantitative methods necessary for those commencing research for the first time. The reader is shown how these methods work and how their outcomes may be interpreted. The book includes: (1) A variety of examples and…

Interactive Video Usage on Autism Spectrum Disorder Training in Medical Education

ERIC Educational Resources Information Center

Taslibeyaz, Elif; Dursun, Onur Burak; Karaman, Selcuk

2017-01-01

This study aimed to compare the effects of interactive and non-interactive videos concerning the autism spectrum disorder on medical students' achievement. It also evaluated the relation between the interactive videos' interactivity and the students' decision-making process. It used multiple methods, including quantitative and qualitative methods.…

Reflectance spectroscopy: quantitative analysis techniques for remote sensing applications.

USGS Publications Warehouse

Clark, R.N.; Roush, T.L.

1984-01-01

Several methods for the analysis of remotely sensed reflectance data are compared, including empirical methods and scattering theories, both of which are important for solving remote sensing problems. The concept of the photon mean path length and the implications for use in modeling reflectance spectra are presented.-from Authors

Are We There Yet? Evaluating Library Collections, Reference Services, Programs, and Personnel.

ERIC Educational Resources Information Center

Robbins-Carter, Jane; Zweizig, Douglas L.

1985-01-01

This second in a five-lesson tutorial on library evaluation focuses on the evaluation of library collections. Highlights include the seven-step evaluation process described in lesson one; quantitative methods (total size, unfilled requests, circulation, turnover rate); and qualitative methods (impressionistic, list-checking). One required and…

Improving validation methods for molecular diagnostics: application of Bland-Altman, Deming and simple linear regression analyses in assay comparison and evaluation for next-generation sequencing.

PubMed

Misyura, Maksym; Sukhai, Mahadeo A; Kulasignam, Vathany; Zhang, Tong; Kamel-Reid, Suzanne; Stockley, Tracy L

2018-02-01

A standard approach in test evaluation is to compare results of the assay in validation to results from previously validated methods. For quantitative molecular diagnostic assays, comparison of test values is often performed using simple linear regression and the coefficient of determination (R 2 ), using R 2 as the primary metric of assay agreement. However, the use of R 2 alone does not adequately quantify constant or proportional errors required for optimal test evaluation. More extensive statistical approaches, such as Bland-Altman and expanded interpretation of linear regression methods, can be used to more thoroughly compare data from quantitative molecular assays. We present the application of Bland-Altman and linear regression statistical methods to evaluate quantitative outputs from next-generation sequencing assays (NGS). NGS-derived data sets from assay validation experiments were used to demonstrate the utility of the statistical methods. Both Bland-Altman and linear regression were able to detect the presence and magnitude of constant and proportional error in quantitative values of NGS data. Deming linear regression was used in the context of assay comparison studies, while simple linear regression was used to analyse serial dilution data. Bland-Altman statistical approach was also adapted to quantify assay accuracy, including constant and proportional errors, and precision where theoretical and empirical values were known. The complementary application of the statistical methods described in this manuscript enables more extensive evaluation of performance characteristics of quantitative molecular assays, prior to implementation in the clinical molecular laboratory. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Use and misuse of mixed methods in population oral health research: A scoping review.

PubMed

Gupta, A; Keuskamp, D

2018-05-30

Despite the known benefits of a mixed methods approach in health research, little is known of its use in the field of population oral health. To map the extent of literature using a mixed methods approach to examine population oral health outcomes. For a comprehensive search of all the available literature published in the English language, databases including PubMed, Dentistry and Oral Sciences Source (DOSS), CINAHL, Web of Science and EMBASE (including Medline) were searched using a range of keywords from inception to October 2017. Only peer-reviewed, population-based studies of oral health outcomes conducted among non-institutionalised participants and using mixed methods were considered eligible for inclusion. Only nine studies met the inclusion criteria and were included in the review. The most frequent oral health outcome investigated was caries experience. However, most studies lacked a theoretical rationale or framework for using mixed methods, or supporting the use of qualitative data. Concurrent triangulation with a convergent design was the most commonly used mixed methods typology for integrating quantitative and qualitative data. The tools used to collect quantitative and qualitative data were mostly limited to surveys and interviews. With growing complexity recognised in the determinants of oral disease, future studies addressing population oral health outcomes are likely to benefit from the use of mixed methods. Explicit consideration of theoretical framework and methodology will strengthen those investigations. Copyright© 2018 Dennis Barber Ltd.

[The water content reference material of water saturated octanol].

PubMed

Wang, Haifeng; Ma, Kang; Zhang, Wei; Li, Zhanyuan

2011-03-01

The national standards of biofuels specify the technique specification and analytical methods. A water content certified reference material based on the water saturated octanol was developed in order to satisfy the needs of the instrument calibration and the methods validation, assure the accuracy and consistency of results in water content measurements of biofuels. Three analytical methods based on different theories were employed to certify the water content of the reference material, including Karl Fischer coulometric titration, Karl Fischer volumetric titration and quantitative nuclear magnetic resonance. The consistency of coulometric and volumetric titration was achieved through the improvement of methods. The accuracy of the certified result was improved by the introduction of the new method of quantitative nuclear magnetic resonance. Finally, the certified value of reference material is 4.76% with an expanded uncertainty of 0.09%.

Integrating qualitative research into occupational health: a case study among hospital workers.

PubMed

Gordon, Deborah R; Ames, Genevieve M; Yen, Irene H; Gillen, Marion; Aust, Birgit; Rugulies, Reiner; Frank, John W; Blanc, Paul D

2005-04-01

We sought to better use qualitative approaches in occupational health research and integrate them with quantitative methods. We systematically reviewed, selected, and adapted qualitative research methods as part of a multisite study of the predictors and outcomes of work-related musculoskeletal disorders among hospital workers in two large urban tertiary hospitals. The methods selected included participant observation; informal, open-ended, and semistructured interviews with individuals or small groups; and archival study. The nature of the work and social life of the hospitals and the foci of the study all favored using more participant observation methods in the case study than initially anticipated. Exploiting the full methodological spectrum of qualitative methods in occupational health is increasingly relevant. Although labor-intensive, these approaches may increase the yield of established quantitative approaches otherwise used in isolation.

Determinants of fruit and vegetable consumption among children and adolescents: a review of the literature. Part II: qualitative studies.

PubMed

Krølner, Rikke; Rasmussen, Mette; Brug, Johannes; Klepp, Knut-Inge; Wind, Marianne; Due, Pernille

2011-10-14

Large proportions of children do not fulfil the World Health Organization recommendation of eating at least 400 grams of fruit and vegetables (FV) per day. To promote an increased FV intake among children it is important to identify factors which influence their consumption. Both qualitative and quantitative studies are needed. Earlier reviews have analysed evidence from quantitative studies. The aim of this paper is to present a systematic review of qualitative studies of determinants of children's FV intake. Relevant studies were identified by searching Anthropology Plus, Cinahl, CSA illumine, Embase, International Bibliography of the Social Sciences, Medline, PsycINFO, and Web of Science using combinations of synonyms for FV intake, children/adolescents and qualitative methods as search terms. The literature search was completed by December 1st 2010. Papers were included if they applied qualitative methods to investigate 6-18-year-olds' perceptions of factors influencing their FV consumption. Quantitative studies, review studies, studies reported in other languages than English, and non-peer reviewed or unpublished manuscripts were excluded. The papers were reviewed systematically using standardised templates for summary of papers, quality assessment, and synthesis of findings across papers. The review included 31 studies, mostly based on US populations and focus group discussions. The synthesis identified the following potential determinants for FV intake which supplement the quantitative knowledge base: Time costs; lack of taste guarantee; satiety value; appropriate time/occasions/settings for eating FV; sensory and physical aspects; variety, visibility, methods of preparation; access to unhealthy food; the symbolic value of food for image, gender identity and social interaction with peers; short term outcome expectancies. The review highlights numerous potential determinants which have not been investigated thoroughly in quantitative studies. Future large scale quantitative studies should attempt to quantify the importance of these factors. Further, mechanisms behind gender, age and socioeconomic differences in FV consumption are proposed which should be tested quantitatively in order to better tailor interventions to vulnerable groups. Finally, the review provides input to the conceptualisation and measurements of concepts (i.e. peer influence, availability in schools) which may refine survey instruments and theoretical frameworks concerning eating behaviours.

A systematic review of the health and well-being impacts of school gardening: synthesis of quantitative and qualitative evidence.

PubMed

Ohly, Heather; Gentry, Sarah; Wigglesworth, Rachel; Bethel, Alison; Lovell, Rebecca; Garside, Ruth

2016-03-25

School gardening programmes are increasingly popular, with suggested benefits including healthier eating and increased physical activity. Our objectives were to understand the health and well-being impacts of school gardens and the factors that help or hinder their success. We conducted a systematic review of quantitative and qualitative evidence (PROSPERO CRD42014007181). We searched multiple databases and used a range of supplementary approaches. Studies about school gardens were included if they reported on physical or mental health or well-being. Quantitative studies had to include a comparison group. Studies were quality appraised using appropriate tools. Findings were narratively synthesised and the qualitative evidence used to produce a conceptual framework to illustrate how benefits might be accrued. Evidence from 40 articles (21 quantitative studies; 16 qualitative studies; 3 mixed methods studies) was included. Generally the quantitative research was poor. Evidence for changes in fruit and vegetable intake was limited and based on self-report. The qualitative research was better quality and ascribed a range of health and well-being impacts to school gardens, with some idealistic expectations for their impact in the long term. Groups of pupils who do not excel in classroom activities were thought to particularly benefit. Lack of funding and over reliance on volunteers were thought to threaten success, while involvement with local communities and integration of gardening activities into the school curriculum were thought to support success. More robust quantitative research is needed to convincingly support the qualitative evidence suggesting wide ranging benefits from school gardens.

Qualitative to quantitative: linked trajectory of method triangulation in a study on HIV/AIDS in Goa, India.

PubMed

Bailey, Ajay; Hutter, Inge

2008-10-01

With 3.1 million people estimated to be living with HIV/AIDS in India and 39.5 million people globally, the epidemic has posed academics the challenge of identifying behaviours and their underlying beliefs in the effort to reduce the risk of HIV transmission. The Health Belief Model (HBM) is frequently used to identify risk behaviours and adherence behaviour in the field of HIV/AIDS. Risk behaviour studies that apply HBM have been largely quantitative and use of qualitative methodology is rare. The marriage of qualitative and quantitative methods has never been easy. The challenge is in triangulating the methods. Method triangulation has been largely used to combine insights from the qualitative and quantitative methods but not to link both the methods. In this paper we suggest a linked trajectory of method triangulation (LTMT). The linked trajectory aims to first gather individual level information through in-depth interviews and then to present the information as vignettes in focus group discussions. We thus validate information obtained from in-depth interviews and gather emic concepts that arise from the interaction. We thus capture both the interpretation and the interaction angles of the qualitative method. Further, using the qualitative information gained, a survey is designed. In doing so, the survey questions are grounded and contextualized. We employed this linked trajectory of method triangulation in a study on the risk assessment of HIV/AIDS among migrant and mobile men. Fieldwork was carried out in Goa, India. Data come from two waves of studies, first an explorative qualitative study (2003), second a larger study (2004-2005), including in-depth interviews (25), focus group discussions (21) and a survey (n=1259). By employing the qualitative to quantitative LTMT we can not only contextualize the existing concepts of the HBM, but also validate new concepts and identify new risk groups.

HCG blood test - qualitative

MedlinePlus

... pregnancy. Other HCG tests include: HCG urine test Quantitative pregnancy test (checks specific level of HCG in ... eds. Henry's Clinical Diagnosis and Management by Laboratory Methods . 23rd ed. Philadelphia, PA: Elsevier; 2017:chap 74. ...

Quantitative and qualitative approaches in educational research — problems and examples of controlled understanding through interpretive methods

NASA Astrophysics Data System (ADS)

Neumann, Karl

1987-06-01

In the methodological discussion of recent years it has become apparent that many research problems, including problems relating to the theory of educational science, cannot be solved by using quantitative methods. The multifaceted aspects of human behaviour and all its environment-bound subtle nuances, especially the process of education or the development of identity, cannot fully be taken into account within a rigid neopositivist approach. In employing the paradigm of symbolic interactionism as a suitable model for the analysis of processes of education and formation, the research has generally to start out from complex reciprocal social interactions instead of unambigious connections of causes. In analysing several particular methodological problems, the article demonstrates some weaknesses of quantitative approaches and then shows the advantages in and the necessity for using qualitative research tools.

The effectiveness of constructivist science instructional methods on middle school students' student achievement and motivation

NASA Astrophysics Data System (ADS)

Brooks, John

A problem facing science educators is determining the most effective means of science instruction so that students will meet or exceed the new rigorous standards. The theoretical framework for this study was based on reform and research efforts that have informed science teachers that using constructivism is the best method of science instruction. The purpose of this study was to investigate how the constructivist method of science instruction affected student achievement and student motivation in a sixth grade science classroom. The guiding research question involved understanding which method of science instruction would be most effective at improving student achievement in science. Other sub-questions included the factors that contribute to student motivation in science and the method of science instruction students receive that affects motivation to learn science. Quantitative data were collected using a pre-test and post-test single group design. T-test and ANCOVA were used to test quantitative hypotheses. Qualitative data were collected using student reflective journals and classroom discussions. Students' perspectives were transcribed, coded and used to further inform quantitative findings. The findings of this study supported the recommendations made by science reformists that the best method of science instruction was a constructivist method. This study also found that participant comments favored constructivist taught classes. The implications for social change at the local level included potential increases in student achievement in science and possibly increased understanding that can facilitate similar changes at other schools. From a global perspective, constructivist-oriented methods might result in students becoming more interested in majoring in science at the college level and in becoming part of a scientifically literate work force.

Modern quantitative schlieren techniques

NASA Astrophysics Data System (ADS)

Hargather, Michael; Settles, Gary

2010-11-01

Schlieren optical techniques have traditionally been used to qualitatively visualize refractive flowfields in transparent media. Modern schlieren optics, however, are increasingly focused on obtaining quantitative information such as temperature and density fields in a flow -- once the sole purview of interferometry -- without the need for coherent illumination. Quantitative data are obtained from schlieren images by integrating the measured refractive index gradient to obtain the refractive index field in an image. Ultimately this is converted to a density or temperature field using the Gladstone-Dale relationship, an equation of state, and geometry assumptions for the flowfield of interest. Several quantitative schlieren methods are reviewed here, including background-oriented schlieren (BOS), schlieren using a weak lens as a "standard," and "rainbow schlieren." Results are presented for the application of these techniques to measure density and temperature fields across a supersonic turbulent boundary layer and a low-speed free-convection boundary layer in air. Modern equipment, including digital cameras, LED light sources, and computer software that make this possible are also discussed.

"Inject-mix-react-separate-and-quantitate" (IMReSQ) method for screening enzyme inhibitors.

PubMed

Wong, Edmund; Okhonin, Victor; Berezovski, Maxim V; Nozaki, Tomoyoshi; Waldmann, Herbert; Alexandrov, Kirill; Krylov, Sergey N

2008-09-10

Many regulatory enzymes are considered attractive therapeutic targets, and their inhibitors are potential drug candidates. Screening combinatorial libraries for enzyme inhibitors is pivotal to identifying hit compounds for the development of drugs targeting regulatory enzymes. Here, we introduce the first inhibitor screening method that consumes only nanoliters of the reactant solutions and is applicable to regulatory enzymes. The method is termed inject-mix-react-separate-and-quantitate (IMReSQ) and includes five steps. First, nanoliter volumes of substrate, candidate inhibitor, and enzyme solutions are injected by pressure into a capillary as separate plugs. Second, the plugs are mixed inside this capillary microreactor by transverse diffusion of laminar flow profiles. Third, the reaction mixture is incubated to form the enzymatic product. Fourth, the product is separated from the substrate inside the capillary by electrophoresis. Fifth, the amounts of the product and substrate are quantitated. In this proof-of-principle work, we applied IMReSQ to study inhibition of recently cloned protein farnesyltransferase from parasite Entamoeba histolytica. This enzyme is a potential therapeutic target for antiparasitic drugs. We identified three previously unknown inhibitors of this enzyme and proved that IMReSQ could be used for quantitatively ranking the potencies of inhibitors.

Quantitative analysis of sitagliptin using the (19)F-NMR method: a universal technique for fluorinated compound detection.

PubMed

Zhang, Fen-Fen; Jiang, Meng-Hong; Sun, Lin-Lin; Zheng, Feng; Dong, Lei; Shah, Vishva; Shen, Wen-Bin; Ding, Ya

2015-01-07

To expand the application scope of nuclear magnetic resonance (NMR) technology in quantitative analysis of pharmaceutical ingredients, (19)F nuclear magnetic resonance ((19)F-NMR) spectroscopy has been employed as a simple, rapid, and reproducible approach for the detection of a fluorine-containing model drug, sitagliptin phosphate monohydrate (STG). ciprofloxacin (Cipro) has been used as the internal standard (IS). Influential factors, including the relaxation delay time (d1) and pulse angle, impacting the accuracy and precision of spectral data are systematically optimized. Method validation has been carried out in terms of precision and intermediate precision, linearity, limit of detection (LOD) and limit of quantification (LOQ), robustness, and stability. To validate the reliability and feasibility of the (19)F-NMR technology in quantitative analysis of pharmaceutical analytes, the assay result has been compared with that of (1)H-NMR. The statistical F-test and student t-test at 95% confidence level indicate that there is no significant difference between these two methods. Due to the advantages of (19)F-NMR, such as higher resolution and suitability for biological samples, it can be used as a universal technology for the quantitative analysis of other fluorine-containing pharmaceuticals and analytes.

High Throughput Measurement of Extracellular DNA Release and Quantitative NET Formation in Human Neutrophils In Vitro.

PubMed

Sil, Payel; Yoo, Dae-Goon; Floyd, Madison; Gingerich, Aaron; Rada, Balazs

2016-06-18

Neutrophil granulocytes are the most abundant leukocytes in the human blood. Neutrophils are the first to arrive at the site of infection. Neutrophils developed several antimicrobial mechanisms including phagocytosis, degranulation and formation of neutrophil extracellular traps (NETs). NETs consist of a DNA scaffold decorated with histones and several granule markers including myeloperoxidase (MPO) and human neutrophil elastase (HNE). NET release is an active process involving characteristic morphological changes of neutrophils leading to expulsion of their DNA into the extracellular space. NETs are essential to fight microbes, but uncontrolled release of NETs has been associated with several disorders. To learn more about the clinical relevance and the mechanism of NET formation, there is a need to have reliable tools capable of NET quantitation. Here three methods are presented that can assess NET release from human neutrophils in vitro. The first one is a high throughput assay to measure extracellular DNA release from human neutrophils using a membrane impermeable DNA-binding dye. In addition, two other methods are described capable of quantitating NET formation by measuring levels of NET-specific MPO-DNA and HNE-DNA complexes. These microplate-based methods in combination provide great tools to efficiently study the mechanism and regulation of NET formation of human neutrophils.

Simultaneous quantitative analysis of olmesartan, amlodipine and hydrochlorothiazide in their combined dosage form utilizing classical and alternating least squares based chemometric methods.

PubMed

Darwish, Hany W; Bakheit, Ahmed H; Abdelhameed, Ali S

2016-03-01

Simultaneous spectrophotometric analysis of a multi-component dosage form of olmesartan, amlodipine and hydrochlorothiazide used for the treatment of hypertension has been carried out using various chemometric methods. Multivariate calibration methods include classical least squares (CLS) executed by net analyte processing (NAP-CLS), orthogonal signal correction (OSC-CLS) and direct orthogonal signal correction (DOSC-CLS) in addition to multivariate curve resolution-alternating least squares (MCR-ALS). Results demonstrated the efficiency of the proposed methods as quantitative tools of analysis as well as their qualitative capability. The three analytes were determined precisely using the aforementioned methods in an external data set and in a dosage form after optimization of experimental conditions. Finally, the efficiency of the models was validated via comparison with the partial least squares (PLS) method in terms of accuracy and precision.

A selective and sensitive method for quantitation of lysergic acid diethylamide (LSD) in whole blood by gas chromatography-ion trap tandem mass spectrometry.

PubMed

Libong, Danielle; Bouchonnet, Stéphane; Ricordel, Ivan

2003-01-01

A gas chromatography-ion trap tandem mass spectrometry (GC-ion trap MS-MS) method for detection and quantitation of LSD in whole blood is presented. The sample preparation process, including a solid-phase extraction step with Bond Elut cartridges, was performed with 2 mL of whole blood. Eight microliters of the purified extract was injected with a cold on-column injection method. Positive chemical ionization was performed using acetonitrile as reagent gas; LSD was detected in the MS-MS mode. The chromatograms obtained from blood extracts showed the great selectivity of the method. GC-MS quantitation was performed using lysergic acid methylpropylamide as the internal standard. The response of the MS was linear for concentrations ranging from 0.02 ng/mL (detection threshold) to 10.0 ng/mL. Several parameters such as the choice of the capillary column, the choice of the internal standard and that of the ionization mode (positive CI vs. EI) were rationalized. Decomposition pathways under both ionization modes were studied. Within-day and between-day stability were evaluated.

A Comparison of Multivariate and Pre-Processing Methods for Quantitative Laser-Induced Breakdown Spectroscopy of Geologic Samples

NASA Technical Reports Server (NTRS)

Anderson, R. B.; Morris, R. V.; Clegg, S. M.; Bell, J. F., III; Humphries, S. D.; Wiens, R. C.

2011-01-01

The ChemCam instrument selected for the Curiosity rover is capable of remote laser-induced breakdown spectroscopy (LIBS).[1] We used a remote LIBS instrument similar to ChemCam to analyze 197 geologic slab samples and 32 pressed-powder geostandards. The slab samples are well-characterized and have been used to validate the calibration of previous instruments on Mars missions, including CRISM [2], OMEGA [3], the MER Pancam [4], Mini-TES [5], and Moessbauer [6] instruments and the Phoenix SSI [7]. The resulting dataset was used to compare multivariate methods for quantitative LIBS and to determine the effect of grain size on calculations. Three multivariate methods - partial least squares (PLS), multilayer perceptron artificial neural networks (MLP ANNs) and cascade correlation (CC) ANNs - were used to generate models and extract the quantitative composition of unknown samples. PLS can be used to predict one element (PLS1) or multiple elements (PLS2) at a time, as can the neural network methods. Although MLP and CC ANNs were successful in some cases, PLS generally produced the most accurate and precise results.

Methods for assessing geodiversity

NASA Astrophysics Data System (ADS)

Zwoliński, Zbigniew; Najwer, Alicja; Giardino, Marco

2017-04-01

The accepted systematics of geodiversity assessment methods will be presented in three categories: qualitative, quantitative and qualitative-quantitative. Qualitative methods are usually descriptive methods that are suited to nominal and ordinal data. Quantitative methods use a different set of parameters and indicators to determine the characteristics of geodiversity in the area being researched. Qualitative-quantitative methods are a good combination of the collection of quantitative data (i.e. digital) and cause-effect data (i.e. relational and explanatory). It seems that at the current stage of the development of geodiversity research methods, qualitative-quantitative methods are the most advanced and best assess the geodiversity of the study area. Their particular advantage is the integration of data from different sources and with different substantive content. Among the distinguishing features of the quantitative and qualitative-quantitative methods for assessing geodiversity are their wide use within geographic information systems, both at the stage of data collection and data integration, as well as numerical processing and their presentation. The unresolved problem for these methods, however, is the possibility of their validation. It seems that currently the best method of validation is direct filed confrontation. Looking to the next few years, the development of qualitative-quantitative methods connected with cognitive issues should be expected, oriented towards ontology and the Semantic Web.

Recommendations for Quantitative Analysis of Small Molecules by Matrix-assisted laser desorption ionization mass spectrometry

PubMed Central

Wang, Poguang; Giese, Roger W.

2017-01-01

Matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS) has been used for quantitative analysis of small molecules for many years. It is usually preceded by an LC separation step when complex samples are tested. With the development several years ago of “modern MALDI” (automation, high repetition laser, high resolution peaks), the ease of use and performance of MALDI as a quantitative technique greatly increased. This review focuses on practical aspects of modern MALDI for quantitation of small molecules conducted in an ordinary way (no special reagents, devices or techniques for the spotting step of MALDI), and includes our ordinary, preferred Methods The review is organized as 18 recommendations with accompanying explanations, criticisms and exceptions. PMID:28118972

[Study of Cervical Exfoliated Cell's DNA Quantitative Analysis Based on Multi-Spectral Imaging Technology].

PubMed

Wu, Zheng; Zeng, Li-bo; Wu, Qiong-shui

2016-02-01

The conventional cervical cancer screening methods mainly include TBS (the bethesda system) classification method and cellular DNA quantitative analysis, however, by using multiple staining method in one cell slide, which is staining the cytoplasm with Papanicolaou reagent and the nucleus with Feulgen reagent, the study of achieving both two methods in the cervical cancer screening at the same time is still blank. Because the difficulty of this multiple staining method is that the absorbance of the non-DNA material may interfere with the absorbance of DNA, so that this paper has set up a multi-spectral imaging system, and established an absorbance unmixing model by using multiple linear regression method based on absorbance's linear superposition character, and successfully stripped out the absorbance of DNA to run the DNA quantitative analysis, and achieved the perfect combination of those two kinds of conventional screening method. Through a series of experiment we have proved that between the absorbance of DNA which is calculated by the absorbance unmixxing model and the absorbance of DNA which is measured there is no significant difference in statistics when the test level is 1%, also the result of actual application has shown that there is no intersection between the confidence interval of the DNA index of the tetraploid cells which are screened by using this paper's analysis method when the confidence level is 99% and the DNA index's judging interval of cancer cells, so that the accuracy and feasibility of the quantitative DNA analysis with multiple staining method expounded by this paper have been verified, therefore this analytical method has a broad application prospect and considerable market potential in early diagnosis of cervical cancer and other cancers.

Use of Mixed Methods Research in Research on Coronary Artery Disease, Diabetes Mellitus, and Hypertension: A Scoping Review.

PubMed

Campbell, David J T; Tam-Tham, Helen; Dhaliwal, Kirnvir K; Manns, Braden J; Hemmelgarn, Brenda R; Sanmartin, Claudia; King-Shier, Kathryn

2017-01-01

Mixed methods research, the use of both qualitative and quantitative methods within 1 program of study, is becoming increasingly popular to allow investigators to explore patient experiences (qualitative) and also measure outcomes (quantitative). Coronary artery disease and its risk factors are some of the most studied conditions; however, the extent to which mixed methods studies are being conducted in these content areas is unknown. We sought to comprehensively describe the characteristics of published mixed methods studies on coronary artery disease and major risk factors (diabetes mellitus and hypertension). We conducted a scoping review of the literature indexed in PubMed, Medline, EMBASE, and CINAHL. We identified 811 abstracts for screening, of which 254 articles underwent full-text review and 97 reports of 81 studies met criteria for inclusion. The majority of studies in this area were conducted in the past 10 years by nurse researchers from the United States and United Kingdom. Diabetes mellitus was the most common content area for mixed methods investigation (compared with coronary artery disease and hypertension). Most authors described their rationale for using mixed methods as complementarity and did not describe study priority or how they reconciled differences in methodological paradigms. Some mixed methods study designs were more commonly used than others, including concurrent timing and integration at the interpretation stage. Qualitative strands were most commonly descriptive studies using interviews for data collection. Quantitative strands were most commonly cross-sectional observational studies, which relied heavily on self-report data such as surveys and scales. Although mixed methods research is becoming increasingly popular in the area of coronary artery disease and its risk factors, many of the more advanced mixed methods, qualitative, and quantitative techniques have not been commonly used in these areas. © 2016 American Heart Association, Inc.

The Effect of Using Cooperative Learning Method on Tenth Grade Students' Learning Achievement and Attitude towards Biology

ERIC Educational Resources Information Center

Rabgay, Tshewang

2018-01-01

The study investigated the effect of using cooperative learning method on tenth grade students' learning achievement in biology and their attitude towards the subject in a Higher Secondary School in Bhutan. The study used a mixed method approach. The quantitative component included an experimental design where cooperative learning was the…

Physical Therapy and Exercise Interventions in Huntington's Disease: A Mixed Methods Systematic Review.

PubMed

Fritz, Nora E; Rao, Ashwini K; Kegelmeyer, Deb; Kloos, Anne; Busse, Monica; Hartel, Lynda; Carrier, Judith; Quinn, Lori

2017-01-01

A number of studies evaluating physical therapy and exercise interventions in Huntington's disease have been conducted over the past 15 years. However, an assessment of the quality and strength of the evidence in support of these interventions is lacking. The purpose of this systematic review was to investigate the effectiveness of physical therapy and exercise interventions in people with Huntington's disease, and to examine the perceptions of patients, families and caregivers of these interventions. This mixed-methods systematic review utilized the Joanna Briggs Institute (JBI) approach and extraction tools to evaluate the literature from January 2003 until May 2016. The review considered interventions that included exercise and physical therapy interventions, and included both quantitative and qualitative outcome measures. Twenty (20) studies met the inclusion criteria, including eighteen (18) that had quantitative outcome measures and two (2) that utilized qualitative methods. JBI Levels of evidence for the 18 quantitative studies were as follows: Eight studies were at evidence Level 1, seven were at Level 2, two were at Level 3, and one was at Level 4. Our review suggests that there is preliminary support for the benefits of exercise and physical activity in Huntington's disease in terms of motor function, gait speed, and balance, as well as a range of physical and social benefits identified through patient-reported outcomes. Variability in mode of intervention as well as outcome measures limits the interpretability of these studies, and high-quality studies that incorporate adaptive trial designs for this rare disease are needed.

[Correspondence analysis between traditional commercial specifications and quantitative quality indices of Notopterygii Rhizoma et Radix].

PubMed

Jiang, Shun-Yuan; Sun, Hong-Bing; Sun, Hui; Ma, Yu-Ying; Chen, Hong-Yu; Zhu, Wen-Tao; Zhou, Yi

2016-03-01

This paper aims to explore a comprehensive assessment method combined traditional Chinese medicinal material specifications with quantitative quality indicators. Seventy-six samples of Notopterygii Rhizoma et Radix were collected on market and at producing areas. Traditional commercial specifications were described and assigned, and 10 chemical components and volatile oils were determined for each sample. Cluster analysis, Fisher discriminant analysis and correspondence analysis were used to establish the relationship between the traditional qualitative commercial specifications and quantitative chemical indices for comprehensive evaluating quality of medicinal materials, and quantitative classification of commercial grade and quality grade. A herb quality index (HQI) including traditional commercial specifications and chemical components for quantitative grade classification were established, and corresponding discriminant function were figured out for precise determination of quality grade and sub-grade of Notopterygii Rhizoma et Radix. The result showed that notopterol, isoimperatorin and volatile oil were the major components for determination of chemical quality, and their dividing values were specified for every grade and sub-grade of the commercial materials of Notopterygii Rhizoma et Radix. According to the result, essential relationship between traditional medicinal indicators, qualitative commercial specifications, and quantitative chemical composition indicators can be examined by K-mean cluster, Fisher discriminant analysis and correspondence analysis, which provide a new method for comprehensive quantitative evaluation of traditional Chinese medicine quality integrated traditional commodity specifications and quantitative modern chemical index. Copyright© by the Chinese Pharmaceutical Association.

Mammographic features and subsequent risk of breast cancer: a comparison of qualitative and quantitative evaluations in the Guernsey prospective studies.

PubMed

Torres-Mejía, Gabriela; De Stavola, Bianca; Allen, Diane S; Pérez-Gavilán, Juan J; Ferreira, Jorge M; Fentiman, Ian S; Dos Santos Silva, Isabel

2005-05-01

Mammographic features are known to be associated with breast cancer but the magnitude of the effect differs markedly from study to study. Methods to assess mammographic features range from subjective qualitative classifications to computer-automated quantitative measures. We used data from the UK Guernsey prospective studies to examine the relative value of these methods in predicting breast cancer risk. In all, 3,211 women ages > or =35 years who had a mammogram taken in 1986 to 1989 were followed-up to the end of October 2003, with 111 developing breast cancer during this period. Mammograms were classified using the subjective qualitative Wolfe classification and several quantitative mammographic features measured using computer-based techniques. Breast cancer risk was positively associated with high-grade Wolfe classification, percent breast density and area of dense tissue, and negatively associated with area of lucent tissue, fractal dimension, and lacunarity. Inclusion of the quantitative measures in the same model identified area of dense tissue and lacunarity as the best predictors of breast cancer, with risk increasing by 59% [95% confidence interval (95% CI), 29-94%] per SD increase in total area of dense tissue but declining by 39% (95% CI, 53-22%) per SD increase in lacunarity, after adjusting for each other and for other confounders. Comparison of models that included both the qualitative Wolfe classification and these two quantitative measures to models that included either the qualitative or the two quantitative variables showed that they all made significant contributions to prediction of breast cancer risk. These findings indicate that breast cancer risk is affected not only by the amount of mammographic density but also by the degree of heterogeneity of the parenchymal pattern and, presumably, by other features captured by the Wolfe classification.

Synthesising quantitative and qualitative research in evidence-based patient information.

PubMed

Goldsmith, Megan R; Bankhead, Clare R; Austoker, Joan

2007-03-01

Systematic reviews have, in the past, focused on quantitative studies and clinical effectiveness, while excluding qualitative evidence. Qualitative research can inform evidence-based practice independently of other research methodologies but methods for the synthesis of such data are currently evolving. Synthesising quantitative and qualitative research in a single review is an important methodological challenge. This paper describes the review methods developed and the difficulties encountered during the process of updating a systematic review of evidence to inform guidelines for the content of patient information related to cervical screening. Systematic searches of 12 electronic databases (January 1996 to July 2004) were conducted. Studies that evaluated the content of information provided to women about cervical screening or that addressed women's information needs were assessed for inclusion. A data extraction form and quality assessment criteria were developed from published resources. A non-quantitative synthesis was conducted and a tabular evidence profile for each important outcome (eg "explain what the test involves") was prepared. The overall quality of evidence for each outcome was then assessed using an approach published by the GRADE working group, which was adapted to suit the review questions and modified to include qualitative research evidence. Quantitative and qualitative studies were considered separately for every outcome. 32 papers were included in the systematic review following data extraction and assessment of methodological quality. The review questions were best answered by evidence from a range of data sources. The inclusion of qualitative research, which was often highly relevant and specific to many components of the screening information materials, enabled the production of a set of recommendations that will directly affect policy within the NHS Cervical Screening Programme. A practical example is provided of how quantitative and qualitative data sources might successfully be brought together and considered in one review.

Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

PubMed

Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

2017-08-01

The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

Recombinant plasmid-based quantitative Real-Time PCR analysis of Salmonella enterica serotypes and its application to milk samples.

PubMed

Gokduman, Kurtulus; Avsaroglu, M Dilek; Cakiris, Aris; Ustek, Duran; Gurakan, G Candan

2016-03-01

The aim of the current study was to develop, a new, rapid, sensitive and quantitative Salmonella detection method using a Real-Time PCR technique based on an inexpensive, easy to produce, convenient and standardized recombinant plasmid positive control. To achieve this, two recombinant plasmids were constructed as reference molecules by cloning the two most commonly used Salmonella-specific target gene regions, invA and ttrRSBC. The more rapid detection enabled by the developed method (21 h) compared to the traditional culture method (90 h) allows the quantitative evaluation of Salmonella (quantification limits of 10(1)CFU/ml and 10(0)CFU/ml for the invA target and the ttrRSBC target, respectively), as illustrated using milk samples. Three advantages illustrated by the current study demonstrate the potential of the newly developed method to be used in routine analyses in the medical, veterinary, food and water/environmental sectors: I--The method provides fast analyses including the simultaneous detection and determination of correct pathogen counts; II--The method is applicable to challenging samples, such as milk; III--The method's positive controls (recombinant plasmids) are reproducible in large quantities without the need to construct new calibration curves. Copyright © 2016 Elsevier B.V. All rights reserved.

Quantitative trait nucleotide analysis using Bayesian model selection.

PubMed

Blangero, John; Goring, Harald H H; Kent, Jack W; Williams, Jeff T; Peterson, Charles P; Almasy, Laura; Dyer, Thomas D

2005-10-01

Although much attention has been given to statistical genetic methods for the initial localization and fine mapping of quantitative trait loci (QTLs), little methodological work has been done to date on the problem of statistically identifying the most likely functional polymorphisms using sequence data. In this paper we provide a general statistical genetic framework, called Bayesian quantitative trait nucleotide (BQTN) analysis, for assessing the likely functional status of genetic variants. The approach requires the initial enumeration of all genetic variants in a set of resequenced individuals. These polymorphisms are then typed in a large number of individuals (potentially in families), and marker variation is related to quantitative phenotypic variation using Bayesian model selection and averaging. For each sequence variant a posterior probability of effect is obtained and can be used to prioritize additional molecular functional experiments. An example of this quantitative nucleotide analysis is provided using the GAW12 simulated data. The results show that the BQTN method may be useful for choosing the most likely functional variants within a gene (or set of genes). We also include instructions on how to use our computer program, SOLAR, for association analysis and BQTN analysis.

An Improved Method for Measuring Quantitative Resistance to the Wheat Pathogen Zymoseptoria tritici Using High-Throughput Automated Image Analysis.

PubMed

Stewart, Ethan L; Hagerty, Christina H; Mikaberidze, Alexey; Mundt, Christopher C; Zhong, Ziming; McDonald, Bruce A

2016-07-01

Zymoseptoria tritici causes Septoria tritici blotch (STB) on wheat. An improved method of quantifying STB symptoms was developed based on automated analysis of diseased leaf images made using a flatbed scanner. Naturally infected leaves (n = 949) sampled from fungicide-treated field plots comprising 39 wheat cultivars grown in Switzerland and 9 recombinant inbred lines (RIL) grown in Oregon were included in these analyses. Measures of quantitative resistance were percent leaf area covered by lesions, pycnidia size and gray value, and pycnidia density per leaf and lesion. These measures were obtained automatically with a batch-processing macro utilizing the image-processing software ImageJ. All phenotypes in both locations showed a continuous distribution, as expected for a quantitative trait. The trait distributions at both sites were largely overlapping even though the field and host environments were quite different. Cultivars and RILs could be assigned to two or more statistically different groups for each measured phenotype. Traditional visual assessments of field resistance were highly correlated with quantitative resistance measures based on image analysis for the Oregon RILs. These results show that automated image analysis provides a promising tool for assessing quantitative resistance to Z. tritici under field conditions.

Quantitative proteomic analysis of intact plastids.

PubMed

Shiraya, Takeshi; Kaneko, Kentaro; Mitsui, Toshiaki

2014-01-01

Plastids are specialized cell organelles in plant cells that are differentiated into various forms including chloroplasts, chromoplasts, and amyloplasts, and fulfill important functions in maintaining the overall cell metabolism and sensing environmental factors such as sunlight. It is therefore important to grasp the mechanisms of differentiation and functional changes of plastids in order to enhance the understanding of vegetality. In this chapter, details of a method for the extraction of intact plastids that makes analysis possible while maintaining the plastid functions are provided; in addition, a quantitative shotgun method for analyzing the composition and changes in the content of proteins in plastids as a result of environmental impacts is described.

Structural Image Analysis of the Brain in Neuropsychology Using Magnetic Resonance Imaging (MRI) Techniques.

PubMed

Bigler, Erin D

2015-09-01

Magnetic resonance imaging (MRI) of the brain provides exceptional image quality for visualization and neuroanatomical classification of brain structure. A variety of image analysis techniques provide both qualitative as well as quantitative methods to relate brain structure with neuropsychological outcome and are reviewed herein. Of particular importance are more automated methods that permit analysis of a broad spectrum of anatomical measures including volume, thickness and shape. The challenge for neuropsychology is which metric to use, for which disorder and the timing of when image analysis methods are applied to assess brain structure and pathology. A basic overview is provided as to the anatomical and pathoanatomical relations of different MRI sequences in assessing normal and abnormal findings. Some interpretive guidelines are offered including factors related to similarity and symmetry of typical brain development along with size-normalcy features of brain anatomy related to function. The review concludes with a detailed example of various quantitative techniques applied to analyzing brain structure for neuropsychological outcome studies in traumatic brain injury.

An Empirical Review of Research Methodologies and Methods in Creativity Studies (2003-2012)

ERIC Educational Resources Information Center

Long, Haiying

2014-01-01

Based on the data collected from 5 prestigious creativity journals, research methodologies and methods of 612 empirical studies on creativity, published between 2003 and 2012, were reviewed and compared to those in gifted education. Major findings included: (a) Creativity research was predominantly quantitative and psychometrics and experiment…

The Student Affair Organizational Dissertation: A Bounded Qualitative Meta-Study

ERIC Educational Resources Information Center

Banning, James H.; Kuk, Linda

2009-01-01

The purpose of this study was to examine dissertations over the past five years that focused on student affairs organizational issues. A bounded qualitative meta-study was used and the methods, theories, and findings of the dissertations were examined. A variety of research methods were used including quantitative, qualitative and mixed designs.…

Evaluation of fecal indicator and pathogenic bacteria originating from swine manure applied to agricultural lands using culture-based and quantitative real-time PCR methods.

EPA Science Inventory

Fecal bacteria, including those originating from concentrated animal feeding operations, are a leading contributor to water quality impairments in agricultural areas. Rapid and reliable methods are needed that can accurately characterize fecal pollution in agricultural settings....

Evaluation of Fecal Indicator and Pathogenic Bacteria Originating from Swine Manure Applied to Agricultural Lands Using Culture-Based and Quantitative Real-Time PCR Methods

EPA Science Inventory

Fecal bacteria, including those originating from concentrated animal feeding operations, are a leading contributor to water quality impairments in agricultural areas. Rapid and reliable methods are needed that can accurately characterize fecal pollution in agricultural settings....

Process Evaluation of a Parenting Program for Low-Income Families in South Africa

ERIC Educational Resources Information Center

Lachman, Jamie M.; Kelly, Jane; Cluver, Lucie; Ward, Catherine L.; Hutchings, Judy; Gardner, Frances

2018-01-01

Objective: This mixed-methods process evaluation examined the feasibility of a parenting program delivered by community facilitators to reduce the risk of child maltreatment in low-income families with children aged 3-8 years in Cape Town, South Africa (N = 68). Method: Quantitative measures included attendance registers, fidelity checklists,…

Examining the Use of Lecture Capture Technology: Implications for Teaching and Learning

ERIC Educational Resources Information Center

Groen, Jovan F.; Quigley, Brenna; Herry, Yves

2016-01-01

This study sought to provide a better understanding of how lecture capture technology is used by students and how its use is related to student satisfaction, attendance, and academic performance. Using a mixed method design with both quantitative and qualitative methods to collect data, instruments included a student questionnaire, interviews and…

Evaluation of viral removal by nanofiltration using real-time quantitative polymerase chain reaction.

PubMed

Zhao, Xiaowen; Bailey, Mark R; Emery, Warren R; Lambooy, Peter K; Chen, Dayue

2007-06-01

Nanofiltration is commonly introduced into purification processes of biologics produced in mammalian cells to serve as a designated step for removal of potential exogenous viral contaminants and endogenous retrovirus-like particles. The LRV (log reduction value) achieved by nanofiltration is often determined by cell-based infectivity assay, which is time-consuming and labour-intensive. We have explored the possibility of employing QPCR (quantitative PCR) to evaluate LRV achieved by nanofiltration in scaled-down studies using two model viruses, namely xenotropic murine leukemia virus and murine minute virus. We report here the successful development of a QPCR-based method suitable for quantification of virus removal by nanofiltration. The method includes a nuclease treatment step to remove free viral nucleic acids, while viral genome associated with intact virus particles is shielded from the nuclease. In addition, HIV Armored RNA was included as an internal control to ensure the accuracy and reliability of the method. The QPCRbased method described here provides several advantages such as better sensitivity, faster turnaround time, reduced cost and higher throughput over the traditional cell-based infectivity assays.

Portable low-coherence interferometry for quantitatively imaging fast dynamics with extended field of view

NASA Astrophysics Data System (ADS)

Shaked, Natan T.; Girshovitz, Pinhas; Frenklach, Irena

2014-06-01

We present our recent advances in the development of compact, highly portable and inexpensive wide-field interferometric modules. By a smart design of the interferometric system, including the usage of low-coherence illumination sources and common-path off-axis geometry of the interferometers, spatial and temporal noise levels of the resulting quantitative thickness profile can be sub-nanometric, while processing the phase profile in real time. In addition, due to novel experimentally-implemented multiplexing methods, we can capture low-coherence off-axis interferograms with significantly extended field of view and in faster acquisition rates. Using these techniques, we quantitatively imaged rapid dynamics of live biological cells including sperm cells and unicellular microorganisms. Then, we demonstrated dynamic profiling during lithography processes of microscopic elements, with thicknesses that may vary from several nanometers to hundreds of microns. Finally, we present new algorithms for fast reconstruction (including digital phase unwrapping) of off-axis interferograms, which allow real-time processing in more than video rate on regular single-core computers.

76 FR 67668 - Proposed Collection; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-02

... variety of collection methods, including interviews and research, to inform the design, development and.... For example, information collected from consumers will help the CFPB to design model forms... used for quantitative information collections [[Page 67669

Quantitative measurement of a candidate serum biomarker peptide derived from α2-HS-glycoprotein, and a preliminary trial of multidimensional peptide analysis in females with pregnancy-induced hypertension.

PubMed

Hamamura, Kensuke; Yanagida, Mitsuaki; Ishikawa, Hitoshi; Banzai, Michio; Yoshitake, Hiroshi; Nonaka, Daisuke; Tanaka, Kenji; Sakuraba, Mayumi; Miyakuni, Yasuka; Takamori, Kenji; Nojima, Michio; Yoshida, Koyo; Fujiwara, Hiroshi; Takeda, Satoru; Araki, Yoshihiko

2018-03-01

Purpose We previously attempted to develop quantitative enzyme-linked immunosorbent assay (ELISA) systems for the PDA039/044/071 peptides, potential serum disease biomarkers (DBMs) of pregnancy-induced hypertension (PIH), primarily identified by a peptidomic approach (BLOTCHIP®-mass spectrometry (MS)). However, our methodology did not extend to PDA071 (cysteinyl α2-HS-glycoprotein 341-367 ), due to difficulty to produce a specific antibody against the peptide. The aim of the present study was to establish an alternative PDA071 quantitation system using liquid chromatography-multiple reaction monitoring (LC-MRM)/MS, to explore the potential utility of PDA071 as a DBM for PIH. Methods We tested heat/acid denaturation methods in efforts to purify serum PDA071 and developed an LC-MRM/MS method allowing for specific quantitation thereof. We measured serum PDA071 concentrations, and these results were validated including by three-dimensional (3D) plotting against PDA039 (kininogen-1 439-456 )/044 (kininogen-1 438-456 ) concentrations, followed by discriminant analysis. Results PDA071 was successfully extracted from serum using a heat denaturation method. Optimum conditions for quantitation via LC-MRM/MS were developed; the assayed serum PDA071 correlated well with the BLOTCHIP® assay values. Although the PDA071 alone did not significantly differ between patients and controls, 3D plotting of PDA039/044/071 peptide concentrations and construction of a Jackknife classification matrix were satisfactory in terms of PIH diagnostic precision. Conclusions Combination analysis using both PDA071 and PDA039/044 concentrations allowed PIH diagnostic accuracy to be attained, and our method will be valuable in future pathophysiological studies of hypertensive disorders of pregnancy.

Ultrafast gas chromatography method with direct injection for the quantitative determination of benzene, toluene, ethylbenzene, and xylenes in commercial gasoline.

PubMed

Miranda, Nahieh Toscano; Sequinel, Rodrigo; Hatanaka, Rafael Rodrigues; de Oliveira, José Eduardo; Flumignan, Danilo Luiz

2017-04-01

Benzene, toluene, ethylbenzene, and xylenes are some of the most hazardous constituents found in commercial gasoline samples; therefore, these components must be monitored to avoid toxicological problems. We propose a new routine method of ultrafast gas chromatography coupled to flame ionization detection for the direct determination of benzene, toluene, ethylbenzene, and xylenes in commercial gasoline. This method is based on external standard calibration to quantify each compound, including the validation step of the study of linearity, detection and quantification limits, precision, and accuracy. The time of analysis was less than 3.2 min, with quantitative statements regarding the separation and quantification of all compounds in commercial gasoline samples. Ultrafast gas chromatography is a promising alternative method to official analytical techniques. Government laboratories could consider using this method for quality control. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Formation resistivity measurements from within a cased well used to quantitatively determine the amount of oil and gas present

DOEpatents

Vail, III, William B.

1997-01-01

Methods to quantitatively determine the separate amounts of oil and gas in a geological formation adjacent to a cased well using measurements of formation resistivity are disclosed. The steps include obtaining resistivity measurements from within a cased well of a given formation, obtaining the porosity, obtaining the resistivity of formation water present, computing the combined amounts of oil and gas present using Archie's Equations, determining the relative amounts of oil and gas present from measurements within a cased well, and then quantitatively determining the separate amounts of oil and gas present in the formation.

Formation resistivity measurements from within a cased well used to quantitatively determine the amount of oil and gas present

DOEpatents

Vail, W.B. III

1997-05-27

Methods to quantitatively determine the separate amounts of oil and gas in a geological formation adjacent to a cased well using measurements of formation resistivity are disclosed. The steps include obtaining resistivity measurements from within a cased well of a given formation, obtaining the porosity, obtaining the resistivity of formation water present, computing the combined amounts of oil and gas present using Archie`s Equations, determining the relative amounts of oil and gas present from measurements within a cased well, and then quantitatively determining the separate amounts of oil and gas present in the formation. 7 figs.

Development of liquid chromatography-tandem mass spectrometry methods for the quantitation of Anisakis simplex proteins in fish.

PubMed

Fæste, Christiane Kruse; Moen, Anders; Schniedewind, Björn; Haug Anonsen, Jan; Klawitter, Jelena; Christians, Uwe

2016-02-05

The parasite Anisakis simplex is present in many marine fish species that are directly used as food or in processed products. The anisakid larvae infect mostly the gut and inner organs of fish but have also been shown to penetrate into the fillet. Thus, human health can be at risk, either by contracting anisakiasis through the consumption of raw or under-cooked fish, or by sensitisation to anisakid proteins in processed food. A number of different methods for the detection of A. simplex in fish and products thereof have been developed, including visual techniques and PCR for larvae tracing, and immunological assays for the determination of proteins. The recent identification of a number of anisakid proteins by mass spectrometry-based proteomics has laid the groundwork for the development of two quantitative liquid chromatography-tandem mass spectrometry methods for the detection of A. simplex in fish that are described in the present study. Both, the label-free semi-quantitative nLC-nESI-Orbitrap-MS/MS (MS1) and the heavy peptide-applying absolute-quantitative (AQUA) LC-TripleQ-MS/MS (MS2) use unique reporter peptides derived from anisakid hemoglobin and SXP/RAL-2 protein as analytes. Standard curves in buffer and in salmon matrix showed limits of detection at 1μg/mL and 10μg/mL for MS1 and 0.1μg/mL and 2μg/mL for MS2. Preliminary method validation included the assessment of sensitivity, repeatability, reproducibility, and applicability to incurred and naturally-contaminated samples for both assays. By further optimization and full validation in accordance with current recommendations the LC-MS/MS methods could be standardized and used generally as confirmative techniques for the detection of A. simplex protein in fish. Copyright © 2016 Elsevier B.V. All rights reserved.

Optimization and automation of quantitative NMR data extraction.

PubMed

Bernstein, Michael A; Sýkora, Stan; Peng, Chen; Barba, Agustín; Cobas, Carlos

2013-06-18

NMR is routinely used to quantitate chemical species. The necessary experimental procedures to acquire quantitative data are well-known, but relatively little attention has been applied to data processing and analysis. We describe here a robust expert system that can be used to automatically choose the best signals in a sample for overall concentration determination and determine analyte concentration using all accepted methods. The algorithm is based on the complete deconvolution of the spectrum which makes it tolerant of cases where signals are very close to one another and includes robust methods for the automatic classification of NMR resonances and molecule-to-spectrum multiplets assignments. With the functionality in place and optimized, it is then a relatively simple matter to apply the same workflow to data in a fully automatic way. The procedure is desirable for both its inherent performance and applicability to NMR data acquired for very large sample sets.

PANDA-view: An easy-to-use tool for statistical analysis and visualization of quantitative proteomics data.

PubMed

Chang, Cheng; Xu, Kaikun; Guo, Chaoping; Wang, Jinxia; Yan, Qi; Zhang, Jian; He, Fuchu; Zhu, Yunping

2018-05-22

Compared with the numerous software tools developed for identification and quantification of -omics data, there remains a lack of suitable tools for both downstream analysis and data visualization. To help researchers better understand the biological meanings in their -omics data, we present an easy-to-use tool, named PANDA-view, for both statistical analysis and visualization of quantitative proteomics data and other -omics data. PANDA-view contains various kinds of analysis methods such as normalization, missing value imputation, statistical tests, clustering and principal component analysis, as well as the most commonly-used data visualization methods including an interactive volcano plot. Additionally, it provides user-friendly interfaces for protein-peptide-spectrum representation of the quantitative proteomics data. PANDA-view is freely available at https://sourceforge.net/projects/panda-view/. 1987ccpacer@163.com and zhuyunping@gmail.com. Supplementary data are available at Bioinformatics online.

A Hospice Rotation for Military Medical Residents: A Mixed Methods, Multi-Perspective Program Evaluation

PubMed Central

Boyden, Jackelyn Y.; Kalish, Virginia B.; Muir, J. Cameron; Richardson, Suzanne; Connor, Stephen R.

2016-01-01

Abstract Background: An estimated 6,000 to 18,000 additional hospice and palliative medicine (HPM) physicians are needed in the United States. A source could be the military graduate medical education system where 15% of U.S. medical residents are trained. A community-based hospice and palliative care organization created a one-week rotation for military residents including participation in interdisciplinary group visits at patients' homes, facilities, and an inpatient hospice unit. Objective: Our goal was to evaluate the effectiveness of a one-week community HPM rotation for military medical residents. Methods: A mixed-methods, multi-stakeholder perspective program evaluation model was used for program years 2011 to 2013. Data were managed and analyzed using Microsoft Excel and Atlas.ti. Participants in the rotation were residents training at two local military hospitals. Program evaluation data were collected from residents, military program liaisons, and hospice clinical preceptors. Quantitative data included pre- and post-tests based on Accreditation Council for Graduate Medical Education competencies completed by residents. Qualitative data included resident essays and semi-structured interviews with hospice preceptors and military program liaisons. Results: Quantitative and qualitative data suggested that the rotation increased military residents' knowledge, attitudes, and comfort level with HPM. Quantitative analysis of test scores indicated improvements from pre- to post-tests in each of five areas of learning. Qualitative data indicated the rotation created a greater appreciation for the overall importance of HPM and increased understanding of eligibility and methods for pain and symptom management. Conclusions: A one-week community hospice rotation for medical military residents impacts participant's knowledge of and attitudes toward HPM. PMID:27139524

Reinventing the ames test as a quantitative lab that connects classical and molecular genetics.

PubMed

Goodson-Gregg, Nathan; De Stasio, Elizabeth A

2009-01-01

While many institutions use a version of the Ames test in the undergraduate genetics laboratory, students typically are not exposed to techniques or procedures beyond qualitative analysis of phenotypic reversion, thereby seriously limiting the scope of learning. We have extended the Ames test to include both quantitative analysis of reversion frequency and molecular analysis of revertant gene sequences. By giving students a role in designing their quantitative methods and analyses, students practice and apply quantitative skills. To help students connect classical and molecular genetic concepts and techniques, we report here procedures for characterizing the molecular lesions that confer a revertant phenotype. We suggest undertaking reversion of both missense and frameshift mutants to allow a more sophisticated molecular genetic analysis. These modifications and additions broaden the educational content of the traditional Ames test teaching laboratory, while simultaneously enhancing students' skills in experimental design, quantitative analysis, and data interpretation.

A method of combined single-cell electrophysiology and electroporation.

PubMed

Graham, Lyle J; Del Abajo, Ricardo; Gener, Thomas; Fernandez, Eduardo

2007-02-15

This paper describes a method of extracellular recording and subsequent electroporation with the same electrode in single retinal ganglion cells in vitro. We demonstrate anatomical identification of neurons whose receptive fields were measured quantitatively. We discuss how this simple method should also be applicable for the delivery of a variety of intracellular agents, including gene delivery, to physiologically characterized neurons, both in vitro and in vivo.

Quantitative detection of pathogens in centrifugal microfluidic disks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koh, Chung-Yan; Schaff, Ulrich Y.; Sommer, Gregory Jon

A system and methods for detection of a nucleic acid including forming a plurality of nucleic acid detection complexes are described, each of the complexes including a nucleic acid analyte, a detection agent and a functionalized probe. The method further including binding the nucleic acid detection complexes to a plurality of functionalized particles in a fluid sample and separating the functionalized particles having the nucleic acid detection complexes bound thereto from the fluid sample using a density media. The nucleic acid analyte is detected by detecting the detection agent.

Widely-targeted quantitative lipidomics methodology by supercritical fluid chromatography coupled with fast-scanning triple quadrupole mass spectrometry.

PubMed

Takeda, Hiroaki; Izumi, Yoshihiro; Takahashi, Masatomo; Paxton, Thanai; Tamura, Shohei; Koike, Tomonari; Yu, Ying; Kato, Noriko; Nagase, Katsutoshi; Shiomi, Masashi; Bamba, Takeshi

2018-05-03

Lipidomics, the mass spectrometry-based comprehensive analysis of lipids, has attracted attention as an analytical approach to provide novel insight into lipid metabolism and to search for biomarkers. However, an ideal method for both comprehensive and quantitative analysis of lipids has not been fully developed. Herein, we have proposed a practical methodology for widely-targeted quantitative lipidome analysis using supercritical fluid chromatography fast-scanning triple-quadrupole mass spectrometry (SFC/QqQMS) and theoretically calculated a comprehensive lipid multiple reaction monitoring (MRM) library. Lipid classes can be separated by SFC with a normal phase diethylamine-bonded silica column with high-resolution, high-throughput, and good repeatability. Structural isomers of phospholipids can be monitored by mass spectrometric separation with fatty acyl-based MRM transitions. SFC/QqQMS analysis with an internal standard-dilution method offers quantitative information for both lipid class and individual lipid molecular species in the same lipid class. Additionally, data acquired using this method has advantages including reduction of misidentification and acceleration of data analysis. Using the SFC/QqQMS system, alteration of plasma lipid levels in myocardial infarction-prone rabbits to the supplementation of eicosapentaenoic acid was first observed. Our developed SFC/QqQMS method represents a potentially useful tool for in-depth studies focused on complex lipid metabolism and biomarker discovery. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Qualitative Methods in Mental Health Services Research

PubMed Central

Palinkas, Lawrence A.

2014-01-01

Qualitative and mixed methods play a prominent role in mental health services research. However, the standards for their use are not always evident, especially for those not trained in such methods. This paper reviews the rationale and common approaches to using qualitative and mixed methods in mental health services and implementation research based on a review of the papers included in this special series along with representative examples from the literature. Qualitative methods are used to provide a “thick description” or depth of understanding to complement breadth of understanding afforded by quantitative methods, elicit the perspective of those being studied, explore issues that have not been well studied, develop conceptual theories or test hypotheses, or evaluate the process of a phenomenon or intervention. Qualitative methods adhere to many of the same principles of scientific rigor as quantitative methods, but often differ with respect to study design, data collection and data analysis strategies. For instance, participants for qualitative studies are usually sampled purposefully rather than at random and the design usually reflects an iterative process alternating between data collection and analysis. The most common techniques for data collection are individual semi-structured interviews, focus groups, document reviews, and participant observation. Strategies for analysis are usually inductive, based on principles of grounded theory or phenomenology. Qualitative methods are also used in combination with quantitative methods in mixed method designs for convergence, complementarity, expansion, development, and sampling. Rigorously applied qualitative methods offer great potential in contributing to the scientific foundation of mental health services research. PMID:25350675

Qualitative and mixed methods in mental health services and implementation research.

PubMed

Palinkas, Lawrence A

2014-01-01

Qualitative and mixed methods play a prominent role in mental health services research. However, the standards for their use are not always evident, especially for those not trained in such methods. This article reviews the rationale and common approaches to using qualitative and mixed methods in mental health services and implementation research based on a review of the articles included in this special series along with representative examples from the literature. Qualitative methods are used to provide a "thick description" or depth of understanding to complement breadth of understanding afforded by quantitative methods, elicit the perspective of those being studied, explore issues that have not been well studied, develop conceptual theories or test hypotheses, or evaluate the process of a phenomenon or intervention. Qualitative methods adhere to many of the same principles of scientific rigor as quantitative methods but often differ with respect to study design, data collection, and data analysis strategies. For instance, participants for qualitative studies are usually sampled purposefully rather than at random and the design usually reflects an iterative process alternating between data collection and analysis. The most common techniques for data collection are individual semistructured interviews, focus groups, document reviews, and participant observation. Strategies for analysis are usually inductive, based on principles of grounded theory or phenomenology. Qualitative methods are also used in combination with quantitative methods in mixed-method designs for convergence, complementarity, expansion, development, and sampling. Rigorously applied qualitative methods offer great potential in contributing to the scientific foundation of mental health services research.

A systematic review of mixed methods research on human factors and ergonomics in health care.

PubMed

Carayon, Pascale; Kianfar, Sarah; Li, Yaqiong; Xie, Anping; Alyousef, Bashar; Wooldridge, Abigail

2015-11-01

This systematic literature review provides information on the use of mixed methods research in human factors and ergonomics (HFE) research in health care. Using the PRISMA methodology, we searched four databases (PubMed, PsycInfo, Web of Science, and Engineering Village) for studies that met the following inclusion criteria: (1) field study in health care, (2) mixing of qualitative and quantitative data, (3) HFE issues, and (4) empirical evidence. Using an iterative and collaborative process supported by a structured data collection form, the six authors identified a total of 58 studies that primarily address HFE issues in health information technology (e.g., usability) and in the work of healthcare workers. About two-thirds of the mixed methods studies used the convergent parallel study design where quantitative and qualitative data were collected simultaneously. A variety of methods were used for collecting data, including interview, survey and observation. The most frequent combination involved interview for qualitative data and survey for quantitative data. The use of mixed methods in healthcare HFE research has increased over time. However, increasing attention should be paid to the formal literature on mixed methods research to enhance the depth and breadth of this research. Copyright © 2015. Published by Elsevier Ltd.

Mycotoxin analysis: an update.

PubMed

Krska, Rudolf; Schubert-Ullrich, Patricia; Molinelli, Alexandra; Sulyok, Michael; MacDonald, Susan; Crews, Colin

2008-02-01

Mycotoxin contamination of cereals and related products used for feed can cause intoxication, especially in farm animals. Therefore, efficient analytical tools for the qualitative and quantitative analysis of toxic fungal metabolites in feed are required. Current methods usually include an extraction step, a clean-up step to reduce or eliminate unwanted co-extracted matrix components and a separation step with suitably specific detection ability. Quantitative methods of analysis for most mycotoxins use immunoaffinity clean-up with high-performance liquid chromatography (HPLC) separation in combination with UV and/or fluorescence detection. Screening of samples contaminated with mycotoxins is frequently performed by thin layer chromatography (TLC), which yields qualitative or semi-quantitative results. Nowadays, enzyme-linked immunosorbent assays (ELISA) are often used for rapid screening. A number of promising methods, such as fluorescence polarization immunoassays, dipsticks, and even newer methods such as biosensors and non-invasive techniques based on infrared spectroscopy, have shown great potential for mycotoxin analysis. Currently, there is a strong trend towards the use of multi-mycotoxin methods for the simultaneous analysis of several of the important Fusarium mycotoxins, which is best achieved by LC-MS/MS (liquid chromatography with tandem mass spectrometry). This review focuses on recent developments in the determination of mycotoxins with a special emphasis on LC-MS/MS and emerging rapid methods.

Neurient: An Algorithm for Automatic Tracing of Confluent Neuronal Images to Determine Alignment

PubMed Central

Mitchel, J.A.; Martin, I.S.

2013-01-01

A goal of neural tissue engineering is the development and evaluation of materials that guide neuronal growth and alignment. However, the methods available to quantitatively evaluate the response of neurons to guidance materials are limited and/or expensive, and may require manual tracing to be performed by the researcher. We have developed an open source, automated Matlab-based algorithm, building on previously published methods, to trace and quantify alignment of fluorescent images of neurons in culture. The algorithm is divided into three phases, including computation of a lookup table which contains directional information for each image, location of a set of seed points which may lie along neurite centerlines, and tracing neurites starting with each seed point and indexing into the lookup table. This method was used to obtain quantitative alignment data for complex images of densely cultured neurons. Complete automation of tracing allows for unsupervised processing of large numbers of images. Following image processing with our algorithm, available metrics to quantify neurite alignment include angular histograms, percent of neurite segments in a given direction, and mean neurite angle. The alignment information obtained from traced images can be used to compare the response of neurons to a range of conditions. This tracing algorithm is freely available to the scientific community under the name Neurient, and its implementation in Matlab allows a wide range of researchers to use a standardized, open source method to quantitatively evaluate the alignment of dense neuronal cultures. PMID:23384629

An open-source method to analyze optokinetic reflex responses in larval zebrafish.

PubMed

Scheetz, Seth D; Shao, Enhua; Zhou, Yangzhong; Cario, Clinton L; Bai, Qing; Burton, Edward A

2018-01-01

Optokinetic reflex (OKR) responses provide a convenient means to evaluate oculomotor, integrative and afferent visual function in larval zebrafish models, which are commonly used to elucidate molecular mechanisms underlying development, disease and repair of the vertebrate nervous system. We developed an open-source MATLAB-based solution for automated quantitative analysis of OKR responses in larval zebrafish. The package includes applications to: (i) generate sinusoidally-transformed animated grating patterns suitable for projection onto a cylindrical screen to elicit the OKR; (ii) determine and record the angular orientations of the eyes in each frame of a video recording showing the OKR response; and (iii) analyze angular orientation data from the tracking program to yield a set of parameters that quantify essential elements of the OKR. The method can be employed without modification using the operating manual provided. In addition, annotated source code is included, allowing users to modify or adapt the software for other applications. We validated the algorithms and measured OKR responses in normal larval zebrafish, showing good agreement with published quantitative data, where available. We provide the first open-source method to elicit and analyze the OKR in larval zebrafish. The wide range of parameters that are automatically quantified by our algorithms significantly expands the scope of quantitative analysis previously reported. Our method for quantifying OKR responses will be useful for numerous applications in neuroscience using the genetically- and chemically-tractable zebrafish model. Published by Elsevier B.V.

Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods.

PubMed

Seo, K H; Valentin-Bon, I E; Brackett, R E

2006-03-01

Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.

A novel method for morphological pleomorphism and heterogeneity quantitative measurement: Named cell feature level co-occurrence matrix.

PubMed

Saito, Akira; Numata, Yasushi; Hamada, Takuya; Horisawa, Tomoyoshi; Cosatto, Eric; Graf, Hans-Peter; Kuroda, Masahiko; Yamamoto, Yoichiro

2016-01-01

Recent developments in molecular pathology and genetic/epigenetic analysis of cancer tissue have resulted in a marked increase in objective and measurable data. In comparison, the traditional morphological analysis approach to pathology diagnosis, which can connect these molecular data and clinical diagnosis, is still mostly subjective. Even though the advent and popularization of digital pathology has provided a boost to computer-aided diagnosis, some important pathological concepts still remain largely non-quantitative and their associated data measurements depend on the pathologist's sense and experience. Such features include pleomorphism and heterogeneity. In this paper, we propose a method for the objective measurement of pleomorphism and heterogeneity, using the cell-level co-occurrence matrix. Our method is based on the widely used Gray-level co-occurrence matrix (GLCM), where relations between neighboring pixel intensity levels are captured into a co-occurrence matrix, followed by the application of analysis functions such as Haralick features. In the pathological tissue image, through image processing techniques, each nucleus can be measured and each nucleus has its own measureable features like nucleus size, roundness, contour length, intra-nucleus texture data (GLCM is one of the methods). In GLCM each nucleus in the tissue image corresponds to one pixel. In this approach the most important point is how to define the neighborhood of each nucleus. We define three types of neighborhoods of a nucleus, then create the co-occurrence matrix and apply Haralick feature functions. In each image pleomorphism and heterogeneity are then determined quantitatively. For our method, one pixel corresponds to one nucleus feature, and we therefore named our method Cell Feature Level Co-occurrence Matrix (CFLCM). We tested this method for several nucleus features. CFLCM is showed as a useful quantitative method for pleomorphism and heterogeneity on histopathological image analysis.

A novel Raman spectrophotometric method for quantitative measurement of nucleoside triphosphate hydrolysis.

PubMed

Jenkins, R H; Tuma, R; Juuti, J T; Bamford, D H; Thomas, G J

1999-01-01

A novel spectrophotometric method, based upon Raman spectroscopy, has been developed for accurate quantitative determination of nucleoside triphosphate phosphohydrolase (NTPase) activity. The method relies upon simultaneous measurement in real time of the intensities of Raman marker bands diagnostic of the triphosphate (1115 cm(-1)) and diphosphate (1085 cm(-1)) moieties of the NTPase substrate and product, respectively. The reliability of the method is demonstrated for the NTPase-active RNA-packaging enzyme (protein P4) of bacteriophage phi6, for which comparative NTPase activities have been estimated independently by radiolabeling assays. The Raman-determined rate for adenosine triphosphate substrate (8.6 +/- 1.3 micromol x mg(-1) x min(-1) at 40 degrees C) is in good agreement with previous estimates. The versatility of the Raman method is demonstrated by its applicability to a variety of nucleotide substrates of P4, including the natural ribonucleoside triphosphates (ATP, GTP) and dideoxynucleoside triphosphates (ddATP, ddGTP). Advantages of the present protocol include conservative sample requirements (approximately 10(-6) g enzyme/protocol) and relative ease of data collection and analysis. The latter conveniences are particularly advantageous for the measurement of activation energies of phosphohydrolase activity.

QTest: Quantitative Testing of Theories of Binary Choice

PubMed Central

Regenwetter, Michel; Davis-Stober, Clintin P.; Lim, Shiau Hong; Guo, Ying; Popova, Anna; Zwilling, Chris; Cha, Yun-Shil; Messner, William

2014-01-01

The goal of this paper is to make modeling and quantitative testing accessible to behavioral decision researchers interested in substantive questions. We provide a novel, rigorous, yet very general, quantitative diagnostic framework for testing theories of binary choice. This permits the nontechnical scholar to proceed far beyond traditionally rather superficial methods of analysis, and it permits the quantitatively savvy scholar to triage theoretical proposals before investing effort into complex and specialized quantitative analyses. Our theoretical framework links static algebraic decision theory with observed variability in behavioral binary choice data. The paper is supplemented with a custom-designed public-domain statistical analysis package, the QTest software. We illustrate our approach with a quantitative analysis using published laboratory data, including tests of novel versions of “Random Cumulative Prospect Theory.” A major asset of the approach is the potential to distinguish decision makers who have a fixed preference and commit errors in observed choices from decision makers who waver in their preferences. PMID:24999495

3D methodology for evaluating rail crossing roughness.

DOT National Transportation Integrated Search

2015-03-02

Description of Research Project The overall objective of this project is to investigate develop a quantitative method or measure for determining the need to rehabilitate rail crossings. The scope of the project includes investigation of sensor capabi...

Printing 2-dimentional droplet array for single-cell reverse transcription quantitative PCR assay with a microfluidic robot.

PubMed

Zhu, Ying; Zhang, Yun-Xia; Liu, Wen-Wen; Ma, Yan; Fang, Qun; Yao, Bo

2015-04-01

This paper describes a nanoliter droplet array-based single-cell reverse transcription quantitative PCR (RT-qPCR) assay method for quantifying gene expression in individual cells. By sequentially printing nanoliter-scale droplets on microchip using a microfluidic robot, all liquid-handling operations including cell encapsulation, lysis, reverse transcription, and quantitative PCR with real-time fluorescence detection, can be automatically achieved. The inhibition effect of cell suspension buffer on RT-PCR assay was comprehensively studied to achieve high-sensitivity gene quantification. The present system was applied in the quantitative measurement of expression level of mir-122 in single Huh-7 cells. A wide distribution of mir-122 expression in single cells from 3061 copies/cell to 79998 copies/cell was observed, showing a high level of cell heterogeneity. With the advantages of full-automation in liquid-handling, simple system structure, and flexibility in achieving multi-step operations, the present method provides a novel liquid-handling mode for single cell gene expression analysis, and has significant potentials in transcriptional identification and rare cell analysis.

Printing 2-Dimentional Droplet Array for Single-Cell Reverse Transcription Quantitative PCR Assay with a Microfluidic Robot

PubMed Central

Zhu, Ying; Zhang, Yun-Xia; Liu, Wen-Wen; Ma, Yan; Fang, Qun; Yao, Bo

2015-01-01

This paper describes a nanoliter droplet array-based single-cell reverse transcription quantitative PCR (RT-qPCR) assay method for quantifying gene expression in individual cells. By sequentially printing nanoliter-scale droplets on microchip using a microfluidic robot, all liquid-handling operations including cell encapsulation, lysis, reverse transcription, and quantitative PCR with real-time fluorescence detection, can be automatically achieved. The inhibition effect of cell suspension buffer on RT-PCR assay was comprehensively studied to achieve high-sensitivity gene quantification. The present system was applied in the quantitative measurement of expression level of mir-122 in single Huh-7 cells. A wide distribution of mir-122 expression in single cells from 3061 copies/cell to 79998 copies/cell was observed, showing a high level of cell heterogeneity. With the advantages of full-automation in liquid-handling, simple system structure, and flexibility in achieving multi-step operations, the present method provides a novel liquid-handling mode for single cell gene expression analysis, and has significant potentials in transcriptional identification and rare cell analysis. PMID:25828383

Study on the Multi-marker Components Quantitative HPLC Fingerprint of the Compound Chinese Medicine Wuwei Changyanning Granule

PubMed Central

Yang, Xian; Yang, Shui-Ping; Zhang, Xue; Yu, Xiao-Dong; He, Qi-Yi; Wang, Bo-Chu

2014-01-01

The aim of this paper is to develop a rapid and highly sensitive quantitative HPLC fingerprint method with multiple indicators by using the Compound Chinese Medicine Wuwei Changyanning granule and 5 herbs in the prescription. The quantitative fingerprint chromatogram with multiple indicators was investigated. і)6 compositions included rutin, gallic acid, chlorogenic acid, atractylenolide Ⅰ, pachymic acid and apigenin, which originated from 5 herbs respectively, were selected as quantitative compositions, and their contents were determined using HPLC from 11 batches granules and the corresponding 5 medicinal materials. ⅱ) The precision, stability and repeatability of fingerprinting were investigated. In addition, common peaks number, the percentage of non-common peaks and similarity were also studied. Among them, 21 common peaks in the granule could find the source of peaks from the 5 herbs, among of 10 peaks from Niuerfeng, 9 peaks from Laliao, 3 peaks from Baishu, 3 peaks from Fuling and 5 peaks from Guanghuoxiang. The results showed that the identification method of fingerprinting was reliable. PMID:25587307

Method Development in Forensic Toxicology.

PubMed

Peters, Frank T; Wissenbach, Dirk K; Busardo, Francesco Paolo; Marchei, Emilia; Pichini, Simona

2017-01-01

In the field of forensic toxicology, the quality of analytical methods is of great importance to ensure the reliability of results and to avoid unjustified legal consequences. A key to high quality analytical methods is a thorough method development. The presented article will provide an overview on the process of developing methods for forensic applications. This includes the definition of the method's purpose (e.g. qualitative vs quantitative) and the analytes to be included, choosing an appropriate sample matrix, setting up separation and detection systems as well as establishing a versatile sample preparation. Method development is concluded by an optimization process after which the new method is subject to method validation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Use of a Deuterated Internal Standard with Pyrolysis-GC/MS Dimeric Marker Analysis to Quantify Tire Tread Particles in the Environment

PubMed Central

Unice, Kenneth M.; Kreider, Marisa L.; Panko, Julie M.

2012-01-01

Pyrolysis(pyr)-GC/MS analysis of characteristic thermal decomposition fragments has been previously used for qualitative fingerprinting of organic sources in environmental samples. A quantitative pyr-GC/MS method based on characteristic tire polymer pyrolysis products was developed for tread particle quantification in environmental matrices including soil, sediment, and air. The feasibility of quantitative pyr-GC/MS analysis of tread was confirmed in a method evaluation study using artificial soil spiked with known amounts of cryogenically generated tread. Tread concentration determined by blinded analyses was highly correlated (r2 ≥ 0.88) with the known tread spike concentration. Two critical refinements to the initial pyrolysis protocol were identified including use of an internal standard and quantification by the dimeric markers vinylcyclohexene and dipentene, which have good specificity for rubber polymer with no other appreciable environmental sources. A novel use of deuterated internal standards of similar polymeric structure was developed to correct the variable analyte recovery caused by sample size, matrix effects, and ion source variability. The resultant quantitative pyr-GC/MS protocol is reliable and transferable between laboratories. PMID:23202830

Dating Violence among High-Risk Young Women: A Systematic Review Using Quantitative and Qualitative Methods

PubMed Central

Joly, Lauren E.; Connolly, Jennifer

2016-01-01

Our systematic review identified 21 quantitative articles and eight qualitative articles addressing dating violence among high risk young women. The groups of high-risk young women in this review include street-involved, justice-involved, pregnant or parenting, involved with Child Protective Services, and youth diagnosed with a mental health issue. Our meta-analysis of the quantitative articles indicated that 34% (CI = 0.24–0.45) of high-risk young women report that they have been victims of physical dating violence and 45% (CI = 0.31–0.61) of these young women report perpetrating physical dating violence. Significant moderator variables included questionnaire and timeframe. Meta-synthesis of the qualitative studies revealed that high-risk young women report perpetrating dating violence to gain power and respect, whereas women report becoming victims of dating violence due to increased vulnerability. PMID:26840336

Identification and Quantitation of Potent Odorants in Spearmint Oils.

PubMed

Kelley, Lauren E; Cadwallader, Keith R

2018-03-14

Potent odorants in Native spearmint, Scotch spearmint, and Macho mint oils were determined by the combined use of gas chromatography-olfactometry (GCO), gas chromatography-mass spectrometry (GC-MS), and aroma extract dilution analysis (AEDA). Of the 85 odorants detected, ( R)-(-)-carvone was the most potent odorant in all three spearmint oils. Additional predominant odorants in all spearmint oils included eugenol, ethyl ( S)-(+)-2-methylbutanoate, ( E)-β-damascenone, and (3 E,5 Z)-1,3,5-undecatriene. Forty-six compounds were quantitated using various methods, including 19 by gas chromatography with flame ionization detection (GC-FID), 20 by stable isotope dilution analysis (SIDA), and 14 by GCO dilution analysis. Concentrations were used to calculate the odor activity values (OAVs) for predominant odorants in the oils. Among the compounds quantitated, those with the highest OAVs were ( R)-(-)-carvone, 1,8-cineole, ( E, Z)-2,6-nonadienal, ( E)-β-damascenone, and (3 E,5 Z)-1,3,5-undecatriene.

Performing Repeated Quantitative Small-Animal PET with an Arterial Input Function Is Routinely Feasible in Rats.

PubMed

Huang, Chi-Cheng; Wu, Chun-Hu; Huang, Ya-Yao; Tzen, Kai-Yuan; Chen, Szu-Fu; Tsai, Miao-Ling; Wu, Hsiao-Ming

2017-04-01

Performing quantitative small-animal PET with an arterial input function has been considered technically challenging. Here, we introduce a catheterization procedure that keeps a rat physiologically stable for 1.5 mo. We demonstrated the feasibility of quantitative small-animal 18 F-FDG PET in rats by performing it repeatedly to monitor the time course of variations in the cerebral metabolic rate of glucose (CMR glc ). Methods: Aseptic surgery was performed on 2 rats. Each rat underwent catheterization of the right femoral artery and left femoral vein. The catheters were sealed with microinjection ports and then implanted subcutaneously. Over the next 3 wk, each rat underwent 18 F-FDG quantitative small-animal PET 6 times. The CMR glc of each brain region was calculated using a 3-compartment model and an operational equation that included a k* 4 Results: On 6 mornings, we completed 12 18 F-FDG quantitative small-animal PET studies on 2 rats. The rats grew steadily before and after the 6 quantitative small-animal PET studies. The CMR glc of the conscious brain (e.g., right parietal region, 99.6 ± 10.2 μmol/100 g/min; n = 6) was comparable to that for 14 C-deoxyglucose autoradiographic methods. Conclusion: Maintaining good blood patency in catheterized rats is not difficult. Longitudinal quantitative small-animal PET imaging with an arterial input function can be performed routinely. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

A multi-method approach toward de novo glycan characterization: a Man-5 case study.

PubMed

Prien, Justin M; Prater, Bradley D; Cockrill, Steven L

2010-05-01

Regulatory agencies' expectations for biotherapeutic approval are becoming more stringent with regard to product characterization, where minor species as low as 0.1% of a given profile are typically identified. The mission of this manuscript is to demonstrate a multi-method approach toward de novo glycan characterization and quantitation, including minor species at or approaching the 0.1% benchmark. Recently, unexpected isomers of the Man(5)GlcNAc(2) (M(5)) were reported (Prien JM, Ashline DJ, Lapadula AJ, Zhang H, Reinhold VN. 2009. The high mannose glycans from bovine ribonuclease B isomer characterization by ion trap mass spectrometry (MS). J Am Soc Mass Spectrom. 20:539-556). In the current study, quantitative analysis of these isomers found in commercial M(5) standard demonstrated that they are in low abundance (<1% of the total) and therefore an exemplary "litmus test" for minor species characterization. A simple workflow devised around three core well-established analytical procedures: (1) fluorescence derivatization; (2) online rapid resolution reversed-phase separation coupled with negative-mode sequential mass spectrometry (RRRP-(-)-MS(n)); and (3) permethylation derivatization with nanospray sequential mass spectrometry (NSI-MS(n)) provides comprehensive glycan structural determination. All methods have limitations; however, a multi-method workflow is an at-line stopgap/solution which mitigates each method's individual shortcoming(s) providing greater opportunity for more comprehensive characterization. This manuscript is the first to demonstrate quantitative chromatographic separation of the M(5) isomers and the use of a commercially available stable isotope variant of 2-aminobenzoic acid to detect and chromatographically resolve multiple M(5) isomers in bovine ribonuclease B. With this multi-method approach, we have the capabilities to comprehensively characterize a biotherapeutic's glycan array in a de novo manner, including structural isomers at >/=0.1% of the total chromatographic peak area.

Barriers and facilitators to health screening in men: A systematic review.

PubMed

Teo, Chin Hai; Ng, Chirk Jenn; Booth, Andrew; White, Alan

2016-09-01

Men have poorer health status and are less likely to attend health screening compared to women. This systematic review presents current evidence on the barriers and facilitators to engaging men in health screening. We included qualitative, quantitative and mixed-method studies identified through five electronic databases, contact with experts and reference mining. Two researchers selected and appraised the studies independently. Data extraction and synthesis were conducted using the 'best fit' framework synthesis method. 53 qualitative, 44 quantitative and 6 mixed-method studies were included. Factors influencing health screening uptake in men can be categorized into five domains: individual, social, health system, healthcare professional and screening procedure. The most commonly reported barriers are fear of getting the disease and low risk perception; for facilitators, they are perceived risk and benefits of screening. Male-dominant barriers include heterosexual -self-presentation, avoidance of femininity and lack of time. The partner's role is the most common male-dominant facilitator to screening. This systematic review provides a comprehensive overview of barriers and facilitators to health screening in men including the male-dominant factors. The findings are particularly useful for clinicians, researchers and policy makers who are developing interventions and policies to increase screening uptake in men. Copyright © 2016 Elsevier Ltd. All rights reserved.

A writer's guide to education scholarship: Quantitative methodologies for medical education research (part 1).

PubMed

Thoma, Brent; Camorlinga, Paola; Chan, Teresa M; Hall, Andrew Koch; Murnaghan, Aleisha; Sherbino, Jonathan

2018-01-01

Quantitative research is one of the many research methods used to help educators advance their understanding of questions in medical education. However, little research has been done on how to succeed in publishing in this area. We conducted a scoping review to identify key recommendations and reporting guidelines for quantitative educational research and scholarship. Medline, ERIC, and Google Scholar were searched for English-language articles published between 2006 and January 2016 using the search terms, "research design," "quantitative," "quantitative methods," and "medical education." A hand search was completed for additional references during the full-text review. Titles/abstracts were reviewed by two authors (BT, PC) and included if they focused on quantitative research in medical education and outlined reporting guidelines, or provided recommendations on conducting quantitative research. One hundred articles were reviewed in parallel with the first 30 used for calibration and the subsequent 70 to calculate Cohen's kappa coefficient. Two reviewers (BT, PC) conducted a full text review and extracted recommendations and reporting guidelines. A simple thematic analysis summarized the extracted recommendations. Sixty-one articles were reviewed in full, and 157 recommendations were extracted. The thematic analysis identified 86 items, 14 categories, and 3 themes. Fourteen quality evaluation tools and reporting guidelines were found. Discussion This paper provides guidance for junior researchers in the form of key quality markers and reporting guidelines. We hope that quantitative researchers in medical education will be informed by the results and that further work will be done to refine the list of recommendations.

A peptide-retrieval strategy enables significant improvement of quantitative performance without compromising confidence of identification.

PubMed

Tu, Chengjian; Shen, Shichen; Sheng, Quanhu; Shyr, Yu; Qu, Jun

2017-01-30

Reliable quantification of low-abundance proteins in complex proteomes is challenging largely owing to the limited number of spectra/peptides identified. In this study we developed a straightforward method to improve the quantitative accuracy and precision of proteins by strategically retrieving the less confident peptides that were previously filtered out using the standard target-decoy search strategy. The filtered-out MS/MS spectra matched to confidently-identified proteins were recovered, and the peptide-spectrum-match FDR were re-calculated and controlled at a confident level of FDR≤1%, while protein FDR maintained at ~1%. We evaluated the performance of this strategy in both spectral count- and ion current-based methods. >60% increase of total quantified spectra/peptides was respectively achieved for analyzing a spike-in sample set and a public dataset from CPTAC. Incorporating the peptide retrieval strategy significantly improved the quantitative accuracy and precision, especially for low-abundance proteins (e.g. one-hit proteins). Moreover, the capacity of confidently discovering significantly-altered proteins was also enhanced substantially, as demonstrated with two spike-in datasets. In summary, improved quantitative performance was achieved by this peptide recovery strategy without compromising confidence of protein identification, which can be readily implemented in a broad range of quantitative proteomics techniques including label-free or labeling approaches. We hypothesize that more quantifiable spectra and peptides in a protein, even including less confident peptides, could help reduce variations and improve protein quantification. Hence the peptide retrieval strategy was developed and evaluated in two spike-in sample sets with different LC-MS/MS variations using both MS1- and MS2-based quantitative approach. The list of confidently identified proteins using the standard target-decoy search strategy was fixed and more spectra/peptides with less confidence matched to confident proteins were retrieved. However, the total peptide-spectrum-match false discovery rate (PSM FDR) after retrieval analysis was still controlled at a confident level of FDR≤1%. As expected, the penalty for occasionally incorporating incorrect peptide identifications is negligible by comparison with the improvements in quantitative performance. More quantifiable peptides, lower missing value rate, better quantitative accuracy and precision were significantly achieved for the same protein identifications by this simple strategy. This strategy is theoretically applicable for any quantitative approaches in proteomics and thereby provides more quantitative information, especially on low-abundance proteins. Published by Elsevier B.V.

The Effect of Explicit-Reflective and Historical Approach on Preservice Elementary Teachers' Views of Nature of Science

ERIC Educational Resources Information Center

Pekbay, Canay; Yilmaz, Serkan

2015-01-01

This study aims to explore the influence of nature of science (NOS) activities based on explicit-reflective and historical approach on preservice elementary teachers' views of NOS aspects. Mixed-method approach including both qualitative and quantitative methods was used. The sample consisted of 83 preservice elementary teachers of a public…

A Test Method for Monitoring Modulus Changes during Durability Tests on Building Joint Sealants

Treesearch

Christopher C. White; Donald L. Hunston; Kar Tean Tan; Gregory T. Schueneman

2012-01-01

The durability of building joint sealants is generally assessed using a descriptive methodology involving visual inspection of exposed specimens for defects. It is widely known that this methodology has inherent limitations, including that the results are qualitative. A new test method is proposed that provides more fundamental and quantitative information about...

Behavioral Self-Monitoring of Safety and Productivity in the Workplace: A Methodological Primer and Quantitative Literature Review

ERIC Educational Resources Information Center

Olson, Ryan; Winchester, Jamey

2008-01-01

Workplace applications of behavioral self-monitoring (BSM) methods have been studied periodically for over 35 years, yet the literature has never been systematically reviewed. Recent occupational safety interventions including BSM resulted in relatively large behavior changes. Moreover, BSM methods are functional for addressing a broad range of…

Formative Research in School and Community-Based Health Programs and Studies: "State of the Art" and the TAAG Approach

ERIC Educational Resources Information Center

Gittelsohn, Joel; Steckler, Allan; Johnson, Carolyn C.; Pratt, Charlotte; Grieser, Mira; Pickrel, Julie; Stone, Elaine J.; Conway, Terry; Coombs, Derek; Staten, Lisa K.

2006-01-01

Formative research uses qualitative and quantitative methods to provide information for researchers to plan intervention programs. Gaps in the formative research literature include how to define goals, implementation plans, and research questions; select methods; analyze data; and develop interventions. The National Heart, Lung, and Blood…

Evaluation of the Michigan Public School Academy Initiative: Final Report [and] Executive Summary.

ERIC Educational Resources Information Center

Horn, Jerry; Miron, Gary

This is the final report of a one-year evaluation of the Michigan Public School Academy (PSA) initiative. The evaluation involved both formative and summative evaluations and used both qualitative and quantitative methods. The study was conducted between October 1997 and December 1998. Data-collection methods included a charter-school survey and a…

A Mixed Methods Evaluation of the "Aged-Up" STAC Bullying Bystander Intervention for High School Students

ERIC Educational Resources Information Center

Johnston, April D.; Midgett, Aida; Doumas, Diana M.; Moody, Steve

2018-01-01

This mixed methods study assessed the appropriateness of an "aged-up," brief bullying bystander intervention (STAC) and explored the lived experiences of high school students trained in the program. Quantitative results included an increase in knowledge and confidence to intervene in bullying situations, awareness of bullying, and use of…

A quantitative approach to evolution of music and philosophy

NASA Astrophysics Data System (ADS)

Vieira, Vilson; Fabbri, Renato; Travieso, Gonzalo; Oliveira, Osvaldo N., Jr.; da Fontoura Costa, Luciano

2012-08-01

The development of new statistical and computational methods is increasingly making it possible to bridge the gap between hard sciences and humanities. In this study, we propose an approach based on a quantitative evaluation of attributes of objects in fields of humanities, from which concepts such as dialectics and opposition are formally defined mathematically. As case studies, we analyzed the temporal evolution of classical music and philosophy by obtaining data for 8 features characterizing the corresponding fields for 7 well-known composers and philosophers, which were treated with multivariate statistics and pattern recognition methods. A bootstrap method was applied to avoid statistical bias caused by the small sample data set, with which hundreds of artificial composers and philosophers were generated, influenced by the 7 names originally chosen. Upon defining indices for opposition, skewness and counter-dialectics, we confirmed the intuitive analysis of historians in that classical music evolved according to a master-apprentice tradition, while in philosophy changes were driven by opposition. Though these case studies were meant only to show the possibility of treating phenomena in humanities quantitatively, including a quantitative measure of concepts such as dialectics and opposition, the results are encouraging for further application of the approach presented here to many other areas, since it is entirely generic.

Quantitation of N,N-dimethyltryptamine and harmala alkaloids in human plasma after oral dosing with ayahuasca.

PubMed

Callaway, J C; Raymon, L P; Hearn, W L; McKenna, D J; Grob, C S; Brito, G S; Mash, D C

1996-10-01

Harmine, harmaline, tetrahydroharmine (THH), and N,N-dimethyltryptamine (DMT) were quantitated in plasma from 15 healthy male volunteers after the ingestion of ayahuasca, a beverage that has been used for religious purposes in Brazil since pre-Columbian times. A growing awareness of the interest in this ancient shamanistic practice in modern urban cultures and the widespread popular dissemination of the inebriant effects and type and sources of the plant admixtures used to prepare the beverage have provided additional impetus for this study. The three harmala alkaloids were quantitated from protein-precipitated plasma by high-performance liquid chromatography using fluorescence detection. Recovery from blank human plasma was quantitative, and the limit of quantitation (LOQ) was below 2 ng/mL of plasma for each of the harmala alkaloids. Standard concentrations ranged from 10 to 250 ng/mL for harmine and THH and from 1.0 to 25.0 ng/mL for harmaline, respectively. Linearity was observed for harmine, harmaline, and THH within these respective ranges. The highest concentrations of harmala alkaloids in human plasma were found to be 222.3 ng/mL for harmine, 134.5 ng/mL for THH, and 9.4 ng/mL for harmaline. DMT was quantitated by gas chromatography using nitrogen-phosphorus detection after liquid-liquid extraction with diphenhydramine as an internal standard. DMT recovery was quantitative, and the limit of detection and LOQ were 0.5 and 5 ng/mL, respectively. Linearity for DMT was observed from 5 to 1000 ng/mL. The one-step extraction method for DMT and the protein precipitation method for the three harmala alkaloids afford rapid, sensitive, and quantitative analyses of these alkaloids with minimal analyte loss. The analytical methods also may be applicable to other matrices, including whole blood and urine samples and homogenized tissue specimens. These are the first reported observations of DMT and harmala alkaloids in plasma after ritual ingestion of ayahuasca.

Hydro-geomorphological characterization and classification of Chilean river networks using horizontal, vertical and climatological properties

NASA Astrophysics Data System (ADS)

Pereira, A. A.; Gironas, J. A.; Passalacqua, P.; Mejia, A.; Niemann, J. D.

2017-12-01

Previous work has shown that lithological, tectonic and climatic processes have a major influence in shaping the geomorphology of river networks. Accordingly, quantitative classification methods have been developed to identify and characterize network types (dendritic, parallel, pinnate, rectangular and trellis) based solely on the self-affinity of their planform properties, computed from available Digital Elevation Model (DEM) data. In contrast, this research aim is to include both horizontal and vertical properties to evaluate a quantitative classification method for river networks. We include vertical properties to consider the unique surficial conditions (e.g., large and steep height drops, volcanic activity, and complexity of stream networks) of the Andes Mountains. Furthermore, the goal of the research is also to explain the implications and possible relations between the hydro-geomorphological properties and climatic conditions. The classification method is applied to 42 basins in the southern Andes in Chile, ranging in size from 208 Km2 to 8,000 Km2. The planform metrics include the incremental drainage area, stream course irregularity and junction angles, while the vertical metrics include the hypsometric curve and the slope-area relationship. We introduce new network structures (Brush, Funnel and Low Sinuosity Rectangular), possibly unique to the Andes, that can be quantitatively differentiated from previous networks identified in other geographic regions. Then, this research evaluates the effect that excluding different Strahler order streams has on the horizontal properties and therefore in the classification. We found that climatic conditions are not only linked to horizontal parameters, but also to vertical ones, finding significant correlation between climatic variables (average near-surface temperature and rainfall) and vertical measures (parameters associated with the hypsometric curve and slope-area relation). The proposed classification shows differences among basins previously classified as the same type, which are not noticeable in their horizontal properties and helps reduce misclassifications within the old clusters. Additional hydro-geomorphological metrics are to be considered in the classification method to improve the effectiveness of it.

Identification of downy mildew resistance gene candidates by positional cloning in maize (Zea mays subsp. mays; Poaceae)1

PubMed Central

Kim, Jae Yoon; Moon, Jun-Cheol; Kim, Hyo Chul; Shin, Seungho; Song, Kitae; Kim, Kyung-Hee; Lee, Byung-Moo

2017-01-01

Premise of the study: Positional cloning in combination with phenotyping is a general approach to identify disease-resistance gene candidates in plants; however, it requires several time-consuming steps including population or fine mapping. Therefore, in the present study, we suggest a new combined strategy to improve the identification of disease-resistance gene candidates. Methods and Results: Downy mildew (DM)–resistant maize was selected from five cultivars using a spreader row technique. Positional cloning and bioinformatics tools were used to identify the DM-resistance quantitative trait locus marker (bnlg1702) and 47 protein-coding gene annotations. Eventually, five DM-resistance gene candidates, including bZIP34, Bak1, and Ppr, were identified by quantitative reverse-transcription PCR (RT-PCR) without fine mapping of the bnlg1702 locus. Conclusions: The combined protocol with the spreader row technique, quantitative trait locus positional cloning, and quantitative RT-PCR was effective for identifying DM-resistance candidate genes. This cloning approach may be applied to other whole-genome-sequenced crops or resistance to other diseases. PMID:28224059

Quantitation of fumonisin B1 and B2 in feed using FMOC pre-column derivatization with HPLC and fluorescence detection.

PubMed

Smith, Lori L; Francis, Kyle A; Johnson, Joseph T; Gaskill, Cynthia L

2017-11-01

Pre-column derivatization with 9-fluorenylmethyl chloroformate (FMOC-Cl) was determined to be effective for quantitation of fumonisins B 1 and B 2 in feed. Liquid-solid extraction, clean-up using immunoaffinity solid phase extraction chromatography, and FMOC-derivatization preceded analysis by reverse phase HPLC with fluorescence. Instrument response was unchanged in the presence of matrix, indicating no need to use matrix-matched calibrants. Furthermore, high method recoveries indicated calibrants do not need to undergo clean-up to account for analyte loss. Established method features include linear instrument response from 0.04-2.5µg/mL and stable derivatized calibrants over 7days. Fortified cornmeal method recoveries from 0.1-30.0μg/g were determined for FB 1 (75.1%-109%) and FB 2 (96.0%-115.2%). Inter-assay precision ranged from 1.0%-16.7%. Method accuracy was further confirmed using certified reference material. Inter-laboratory comparison with naturally-contaminated field corn demonstrated equivalent results with conventional derivatization. These results indicate FMOC derivatization is a suitable alternative for fumonisins B 1 and B 2 quantitation in corn-based feeds. Copyright © 2017 Elsevier Ltd. All rights reserved.

Computation of the three-dimensional medial surface dynamics of the vocal folds.

PubMed

Döllinger, Michael; Berry, David A

2006-01-01

To increase our understanding of pathological and healthy voice production, quantitative measurement of the medial surface dynamics of the vocal folds is significant, albeit rarely performed because of the inaccessibility of the vocal folds. Using an excised hemilarynx methodology, a new calibration technique, herein referred to as the linear approximate (LA) method, was introduced to compute the three-dimensional coordinates of fleshpoints along the entire medial surface of the vocal fold. The results were compared with results from the direct linear transform. An associated error estimation was presented, demonstrating the improved accuracy of the new method. A test on real data was reported including computation of quantitative measurements of vocal fold dynamics.

Current methods and advances in bone densitometry

NASA Technical Reports Server (NTRS)

Guglielmi, G.; Gluer, C. C.; Majumdar, S.; Blunt, B. A.; Genant, H. K.

1995-01-01

Bone mass is the primary, although not the only, determinant of fracture. Over the past few years a number of noninvasive techniques have been developed to more sensitively quantitate bone mass. These include single and dual photon absorptiometry (SPA and DPA), single and dual X-ray absorptiometry (SXA and DXA) and quantitative computed tomography (QCT). While differing in anatomic sites measured and in their estimates of precision, accuracy, and fracture discrimination, all of these methods provide clinically useful measurements of skeletal status. It is the intent of this review to discuss the pros and cons of these techniques and to present the new applications of ultrasound (US) and magnetic resonance (MRI) in the detection and management of osteoporosis.

dCLIP: a computational approach for comparative CLIP-seq analyses

PubMed Central

2014-01-01

Although comparison of RNA-protein interaction profiles across different conditions has become increasingly important to understanding the function of RNA-binding proteins (RBPs), few computational approaches have been developed for quantitative comparison of CLIP-seq datasets. Here, we present an easy-to-use command line tool, dCLIP, for quantitative CLIP-seq comparative analysis. The two-stage method implemented in dCLIP, including a modified MA normalization method and a hidden Markov model, is shown to be able to effectively identify differential binding regions of RBPs in four CLIP-seq datasets, generated by HITS-CLIP, iCLIP and PAR-CLIP protocols. dCLIP is freely available at http://qbrc.swmed.edu/software/. PMID:24398258

Comparative analysis of quantitative methodologies for Vibrionaceae biofilms.

PubMed

Chavez-Dozal, Alba A; Nourabadi, Neda; Erken, Martina; McDougald, Diane; Nishiguchi, Michele K

2016-11-01

Multiple symbiotic and free-living Vibrio spp. grow as a form of microbial community known as a biofilm. In the laboratory, methods to quantify Vibrio biofilm mass include crystal violet staining, direct colony-forming unit (CFU) counting, dry biofilm cell mass measurement, and observation of development of wrinkled colonies. Another approach for bacterial biofilms also involves the use of tetrazolium (XTT) assays (used widely in studies of fungi) that are an appropriate measure of metabolic activity and vitality of cells within the biofilm matrix. This study systematically tested five techniques, among which the XTT assay and wrinkled colony measurement provided the most reproducible, accurate, and efficient methods for the quantitative estimation of Vibrionaceae biofilms.

Increased Depth and Breadth of Plasma Protein Quantitation via Two-Dimensional Liquid Chromatography/Multiple Reaction Monitoring-Mass Spectrometry with Labeled Peptide Standards.

PubMed

Percy, Andrew J; Yang, Juncong; Chambers, Andrew G; Borchers, Christoph H

2016-01-01

Absolute quantitative strategies are emerging as a powerful and preferable means of deriving concentrations in biological samples for systems biology applications. Method development is driven by the need to establish new-and validate current-protein biomarkers of high-to-low abundance for clinical utility. In this chapter, we describe a methodology involving two-dimensional (2D) reversed-phase liquid chromatography (RPLC), operated under alkaline and acidic pH conditions, combined with multiple reaction monitoring (MRM)-mass spectrometry (MS) (also called selected reaction monitoring (SRM)-MS) and a complex mixture of stable isotope-labeled standard (SIS) peptides, to quantify a broad and diverse panel of 253 proteins in human blood plasma. The quantitation range spans 8 orders of magnitude-from 15 mg/mL (for vitamin D-binding protein) to 450 pg/mL (for protein S100-B)-and includes 31 low-abundance proteins (defined as being <10 ng/mL) of potential disease relevance. The method is designed to assess candidates at the discovery and/or verification phases of the biomarker pipeline and can be adapted to examine smaller or alternate panels of proteins for higher sample throughput. Also detailed here is the application of our recently developed software tool-Qualis-SIS-for protein quantitation (via regression analysis of standard curves) and quality assessment of the resulting data. Overall, this chapter provides the blueprint for the replication of this quantitative proteomic method by proteomic scientists of all skill levels.

Quantitative methods for compensation of matrix effects and self-absorption in Laser Induced Breakdown Spectroscopy signals of solids

NASA Astrophysics Data System (ADS)

Takahashi, Tomoko; Thornton, Blair

2017-12-01

This paper reviews methods to compensate for matrix effects and self-absorption during quantitative analysis of compositions of solids measured using Laser Induced Breakdown Spectroscopy (LIBS) and their applications to in-situ analysis. Methods to reduce matrix and self-absorption effects on calibration curves are first introduced. The conditions where calibration curves are applicable to quantification of compositions of solid samples and their limitations are discussed. While calibration-free LIBS (CF-LIBS), which corrects matrix effects theoretically based on the Boltzmann distribution law and Saha equation, has been applied in a number of studies, requirements need to be satisfied for the calculation of chemical compositions to be valid. Also, peaks of all elements contained in the target need to be detected, which is a bottleneck for in-situ analysis of unknown materials. Multivariate analysis techniques are gaining momentum in LIBS analysis. Among the available techniques, principal component regression (PCR) analysis and partial least squares (PLS) regression analysis, which can extract related information to compositions from all spectral data, are widely established methods and have been applied to various fields including in-situ applications in air and for planetary explorations. Artificial neural networks (ANNs), where non-linear effects can be modelled, have also been investigated as a quantitative method and their applications are introduced. The ability to make quantitative estimates based on LIBS signals is seen as a key element for the technique to gain wider acceptance as an analytical method, especially in in-situ applications. In order to accelerate this process, it is recommended that the accuracy should be described using common figures of merit which express the overall normalised accuracy, such as the normalised root mean square errors (NRMSEs), when comparing the accuracy obtained from different setups and analytical methods.

System and method for determining stability of a neural system

NASA Technical Reports Server (NTRS)

Curtis, Steven A. (Inventor)

2011-01-01

Disclosed are methods, systems, and computer-readable media for determining stability of a neural system. The method includes tracking a function world line of an N element neural system within at least one behavioral space, determining whether the tracking function world line is approaching a psychological stability surface, and implementing a quantitative solution that corrects instability if the tracked function world line is approaching the psychological stability surface.

Systematic assessment of survey scan and MS2-based abundance strategies for label-free quantitative proteomics using high-resolution MS data.

PubMed

Tu, Chengjian; Li, Jun; Sheng, Quanhu; Zhang, Ming; Qu, Jun

2014-04-04

Survey-scan-based label-free method have shown no compelling benefit over fragment ion (MS2)-based approaches when low-resolution mass spectrometry (MS) was used, the growing prevalence of high-resolution analyzers may have changed the game. This necessitates an updated, comparative investigation of these approaches for data acquired by high-resolution MS. Here, we compared survey scan-based (ion current, IC) and MS2-based abundance features including spectral-count (SpC) and MS2 total-ion-current (MS2-TIC), for quantitative analysis using various high-resolution LC/MS data sets. Key discoveries include: (i) study with seven different biological data sets revealed only IC achieved high reproducibility for lower-abundance proteins; (ii) evaluation with 5-replicate analyses of a yeast sample showed IC provided much higher quantitative precision and lower missing data; (iii) IC, SpC, and MS2-TIC all showed good quantitative linearity (R(2) > 0.99) over a >1000-fold concentration range; (iv) both MS2-TIC and IC showed good linear response to various protein loading amounts but not SpC; (v) quantification using a well-characterized CPTAC data set showed that IC exhibited markedly higher quantitative accuracy, higher sensitivity, and lower false-positives/false-negatives than both SpC and MS2-TIC. Therefore, IC achieved an overall superior performance than the MS2-based strategies in terms of reproducibility, missing data, quantitative dynamic range, quantitative accuracy, and biomarker discovery.

Public and patient involvement in quantitative health research: A statistical perspective.

PubMed

Hannigan, Ailish

2018-06-19

The majority of studies included in recent reviews of impact for public and patient involvement (PPI) in health research had a qualitative design. PPI in solely quantitative designs is underexplored, particularly its impact on statistical analysis. Statisticians in practice have a long history of working in both consultative (indirect) and collaborative (direct) roles in health research, yet their perspective on PPI in quantitative health research has never been explicitly examined. To explore the potential and challenges of PPI from a statistical perspective at distinct stages of quantitative research, that is sampling, measurement and statistical analysis, distinguishing between indirect and direct PPI. Statistical analysis is underpinned by having a representative sample, and a collaborative or direct approach to PPI may help achieve that by supporting access to and increasing participation of under-represented groups in the population. Acknowledging and valuing the role of lay knowledge of the context in statistical analysis and in deciding what variables to measure may support collective learning and advance scientific understanding, as evidenced by the use of participatory modelling in other disciplines. A recurring issue for quantitative researchers, which reflects quantitative sampling methods, is the selection and required number of PPI contributors, and this requires further methodological development. Direct approaches to PPI in quantitative health research may potentially increase its impact, but the facilitation and partnership skills required may require further training for all stakeholders, including statisticians. © 2018 The Authors Health Expectations published by John Wiley & Sons Ltd.

Systematic Assessment of Survey Scan and MS2-Based Abundance Strategies for Label-Free Quantitative Proteomics Using High-Resolution MS Data

PubMed Central

2015-01-01

Survey-scan-based label-free method have shown no compelling benefit over fragment ion (MS2)-based approaches when low-resolution mass spectrometry (MS) was used, the growing prevalence of high-resolution analyzers may have changed the game. This necessitates an updated, comparative investigation of these approaches for data acquired by high-resolution MS. Here, we compared survey scan-based (ion current, IC) and MS2-based abundance features including spectral-count (SpC) and MS2 total-ion-current (MS2-TIC), for quantitative analysis using various high-resolution LC/MS data sets. Key discoveries include: (i) study with seven different biological data sets revealed only IC achieved high reproducibility for lower-abundance proteins; (ii) evaluation with 5-replicate analyses of a yeast sample showed IC provided much higher quantitative precision and lower missing data; (iii) IC, SpC, and MS2-TIC all showed good quantitative linearity (R2 > 0.99) over a >1000-fold concentration range; (iv) both MS2-TIC and IC showed good linear response to various protein loading amounts but not SpC; (v) quantification using a well-characterized CPTAC data set showed that IC exhibited markedly higher quantitative accuracy, higher sensitivity, and lower false-positives/false-negatives than both SpC and MS2-TIC. Therefore, IC achieved an overall superior performance than the MS2-based strategies in terms of reproducibility, missing data, quantitative dynamic range, quantitative accuracy, and biomarker discovery. PMID:24635752

[A novel quantitative approach to study dynamic anaerobic process at micro scale].

PubMed

Zhang, Zhong-Liang; Wu, Jing; Jiang, Jian-Kai; Jiang, Jie; Li, Huai-Zhi

2012-11-01

Anaerobic digestion is attracting more and more interests because of its advantages such as low cost and recovery of clean energy etc. In order to overcome the drawbacks of the existed methods to study the dynamic anaerobic process, a novel microscopical quantitative approach at the granule level was developed combining both the microdevice and the quantitative image analysis techniques. This experiment displayed the process and characteristics of the gas production at static state for the first time and the results indicated that the method was of satisfactory repeatability. The gas production process at static state could be divided into three stages including rapid linear increasing stage, decelerated increasing stage and slow linear increasing stage. The rapid linear increasing stage was long and the biogas rate was high under high initial organic loading rate. The results showed that it was feasible to make the anaerobic process to be carried out in the microdevice; furthermore this novel method was reliable and could clearly display the dynamic process of the anaerobic reaction at the micro scale. The results are helpful to understand the anaerobic process.

MR Morphology of Triangular Fibrocartilage Complex: Correlation with Quantitative MR and Biomechanical Properties

PubMed Central

Bae, Won C.; Ruangchaijatuporn, Thumanoon; Chang, Eric Y; Biswas, Reni; Du, Jiang; Statum, Sheronda

2016-01-01

Objective To evaluate pathology of the triangular fibrocartilage complex (TFCC) using high resolution morphologic magnetic resonance (MR) imaging, and compare with quantitative MR and biomechanical properties. Materials and Methods Five cadaveric wrists (22 to 70 yrs) were imaged at 3T using morphologic (proton density weighted spin echo, PD FS, and 3D spoiled gradient echo, 3D SPGR) and quantitative MR sequences to determine T2 and T1rho properties. In eight geographic regions, morphology of TFC disc and laminae were evaluated for pathology and quantitative MR values. Samples were disarticulated and biomechanical indentation testing was performed on the distal surface of the TFC disc. Results On morphologic PD SE images, TFC disc pathology included degeneration and tears, while that of the laminae included degeneration, degeneration with superimposed tear, mucinous transformation, and globular calcification. Punctate calcifications were highly visible on 3D SPGR images and found only in pathologic regions. Disc pathology occurred more frequently in proximal regions of the disc than distal regions. Quantitative MR values were lowest in normal samples, and generally higher in pathologic regions. Biomechanical testing demonstrated an inverse relationship, with indentation modulus being high in normal regions with low MR values. The laminae studied were mostly pathologic, and additional normal samples are needed to discern quantitative changes. Conclusion These results show technical feasibility of morphologic MR, quantitative MR, and biomechanical techniques to characterize pathology of the TFCC. Quantitative MRI may be a suitable surrogate marker of soft tissue mechanical properties, and a useful adjunct to conventional morphologic MR techniques. PMID:26691643

Dissociative conceptual and quantitative problem solving outcomes across interactive engagement and traditional format introductory physics

NASA Astrophysics Data System (ADS)

McDaniel, Mark A.; Stoen, Siera M.; Frey, Regina F.; Markow, Zachary E.; Hynes, K. Mairin; Zhao, Jiuqing; Cahill, Michael J.

2016-12-01

The existing literature indicates that interactive-engagement (IE) based general physics classes improve conceptual learning relative to more traditional lecture-oriented classrooms. Very little research, however, has examined quantitative problem-solving outcomes from IE based relative to traditional lecture-based physics classes. The present study included both pre- and post-course conceptual-learning assessments and a new quantitative physics problem-solving assessment that included three representative conservation of energy problems from a first-semester calculus-based college physics course. Scores for problem translation, plan coherence, solution execution, and evaluation of solution plausibility were extracted for each problem. Over 450 students in three IE-based sections and two traditional lecture sections taught at the same university during the same semester participated. As expected, the IE-based course produced more robust gains on a Force Concept Inventory than did the lecture course. By contrast, when the full sample was considered, gains in quantitative problem solving were significantly greater for lecture than IE-based physics; when students were matched on pre-test scores, there was still no advantage for IE-based physics on gains in quantitative problem solving. Further, the association between performance on the concept inventory and quantitative problem solving was minimal. These results highlight that improved conceptual understanding does not necessarily support improved quantitative physics problem solving, and that the instructional method appears to have less bearing on gains in quantitative problem solving than does the kinds of problems emphasized in the courses and homework and the overlap of these problems to those on the assessment.

Validated reversed phase LC method for quantitative analysis of polymethoxyflavones in citrus peel extracts.

PubMed

Wang, Zhenyu; Li, Shiming; Ferguson, Stephen; Goodnow, Robert; Ho, Chi-Tang

2008-01-01

Polymethoxyflavones (PMFs), which exist exclusively in the citrus genus, have biological activities including anti-inflammatory, anticarcinogenic, and antiatherogenic properties. A validated RPLC method was developed for quantitative analysis of six major PMFs, namely nobiletin, tangeretin, sinensetin, 5,6,7,4'-tetramethoxyflavone, 3,5,6,7,3',4'-hexamethoxyflavone, and 3,5,6,7,8,3',4'-heptamethoxyflavone. The polar embedded LC stationary phase was able to fully resolve the six analogues. The developed method was fully validated in terms of linearity, accuracy, precision, sensitivity, and system suitability. The LOD of the method was calculated as 0.15 microg/mL and the recovery rate was between 97.0 and 105.1%. This analytical method was successfully applied to quantify the individual PMFs in four commercially available citrus peel extracts (CPEs). Each extract shows significant difference in the PMF composition and concentration. This method may provide a simple, rapid, and reliable tool to help reveal the correlation between the bioactivity of the PMF extracts and the individual PMF content.

Factor models for cancer signatures

NASA Astrophysics Data System (ADS)

Kakushadze, Zura; Yu, Willie

2016-11-01

We present a novel method for extracting cancer signatures by applying statistical risk models (http://ssrn.com/abstract=2732453) from quantitative finance to cancer genome data. Using 1389 whole genome sequenced samples from 14 cancers, we identify an ;overall; mode of somatic mutational noise. We give a prescription for factoring out this noise and source code for fixing the number of signatures. We apply nonnegative matrix factorization (NMF) to genome data aggregated by cancer subtype and filtered using our method. The resultant signatures have substantially lower variability than those from unfiltered data. Also, the computational cost of signature extraction is cut by about a factor of 10. We find 3 novel cancer signatures, including a liver cancer dominant signature (96% contribution) and a renal cell carcinoma signature (70% contribution). Our method accelerates finding new cancer signatures and improves their overall stability. Reciprocally, the methods for extracting cancer signatures could have interesting applications in quantitative finance.

A novel evaluation method for building construction project based on integrated information entropy with reliability theory.

PubMed

Bai, Xiao-ping; Zhang, Xi-wei

2013-01-01

Selecting construction schemes of the building engineering project is a complex multiobjective optimization decision process, in which many indexes need to be selected to find the optimum scheme. Aiming at this problem, this paper selects cost, progress, quality, and safety as the four first-order evaluation indexes, uses the quantitative method for the cost index, uses integrated qualitative and quantitative methodologies for progress, quality, and safety indexes, and integrates engineering economics, reliability theories, and information entropy theory to present a new evaluation method for building construction project. Combined with a practical case, this paper also presents detailed computing processes and steps, including selecting all order indexes, establishing the index matrix, computing score values of all order indexes, computing the synthesis score, sorting all selected schemes, and making analysis and decision. Presented method can offer valuable references for risk computing of building construction projects.

Development of an Analytical Method for the Determination of Amoxicillin in Commercial Drugs and Wastewater Samples, and Assessing its Stability in Simulated Gastric Digestion.

PubMed

Unutkan, Tugçe; Bakirdere, Sezgin; Keyf, Seyfullah

2018-01-01

A highly sensitive analytical HPLC-UV method was developed for the determination of amoxicillin in drugs and wastewater samples at a single wavelength (230 nm). In order to substantially predict the in vivo behavior of amoxicillin, drug samples were subjected to simulated gastric conditions. The calibration plot of the method was linear from 0.050 to 500 mg L-1 with a correlation coefficient of 0.9999. The limit of detection and limit of quantitation were found to be 16 and 54 μg L-1, respectively. The percentage recovery of amoxicillin in wastewater was found to be 97.0 ± 1.6%. The method was successfully applied for the qualitative and quantitative determination of amoxicillin in drug samples including tablets and suspensions. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Simultaneous determination of rhamnose, xylitol, arabitol, fructose, glucose, inositol, sucrose, maltose in jujube (Zizyphus jujube Mill.) extract: comparison of HPLC-ELSD, LC-ESI-MS/MS and GC-MS.

PubMed

Sun, Shihao; Wang, Hui; Xie, Jianping; Su, Yue

2016-01-01

Jujube extract is commonly used as a food additive and flavoring. The sensory properties of the extract, especially sweetness, are a critical factor determining the product quality and therefore affecting consumer acceptability. Small molecular carbohydrates make major contribution to the sweetness of the jujube extract, and their types and contents in the extract have direct influence on quality of the product. So, an appropriate qualitative and quantitative method for determination of the carbohydrates is vitally important for quality control of the product. High performance liquid chromatography-evaporative light scattering detection (HPLC-ELSD), liquid chromatography-electronic spay ionization tandem mass spectrometry (LC-ESI-MS/MS), and gas chromatography-mass spectrometry (GC-MS) methods have been developed and applied to determining small molecular carbohydrates in jujube extract, respectively. Eight sugars and alditols were identified from the extract, including rhamnose, xylitol, arabitol, fructose, glucose, inositol, sucrose, and maltose. Comparisons were carried out to investigate the performance of the methods. Although the methods have been found to perform satisfactorily, only three sugars (fructose, glucose and inositol) could be detected by all these methods. Meanwhile, a similar quantitative result for the three sugars can be obtained by the methods. Eight sugars and alditols in the jujube extract were determined by HPLC-ELSD, LC-ESI-MS/MS and GC-MS, respectively. The LC-ELSD method and the LC-ESI-MS/MS method with good precision and accuracy were suitable for quantitative analysis of carbohydrates in jujube extract; although the performance of the GC-MS method for quantitative analysis was inferior to the other methods, it has a wider scope in qualitative analysis. A multi-analysis technique should be adopted in order to obtain complete constituents of about the carbohydrates in jujube extract, and the methods should be employed according to the purpose of analysis.

State-of-the-art radiological techniques improve the assessment of postoperative lung function in patients with non-small cell lung cancer.

PubMed

Ohno, Yoshiharu; Koyama, Hisanobu; Nogami, Munenobu; Takenaka, Daisuke; Onishi, Yumiko; Matsumoto, Keiko; Matsumoto, Sumiaki; Maniwa, Yoshimasa; Yoshimura, Masahiro; Nishimura, Yoshihiro; Sugimura, Kazuro

2011-01-01

The purpose of this study was to compare predictive capabilities for postoperative lung function in non-small cell lung cancer (NSCLC) patients of the state-of-the-art radiological methods including perfusion MRI, quantitative CT and SPECT/CT with that of anatomical method (i.e. qualitative CT) and traditional nuclear medicine methods such as planar imaging and SPECT. Perfusion MRI, CT, nuclear medicine study and measurements of %FEV(1) before and after lung resection were performed for 229 NSCLC patients (125 men and 104 women). For perfusion MRI, postoperative %FEV(1) (po%FEV(1)) was predicted from semi-quantitatively assessed blood volumes within total and resected lungs, for quantitative CT, it was predicted from the functional lung volumes within total and resected lungs, for qualitative CT, from the number of segments of total and resected lungs, and for nuclear medicine studies, from uptakes within total and resected lungs. All SPECTs were automatically co-registered with CTs for preparation of SPECT/CTs. Predicted po%FEV(1)s were then correlated with actual po%FEV(1)s, which were measured %FEV(1)s after operation. The limits of agreement were also evaluated. All predicted po%FEV(1)s showed good correlation with actual po%FEV(1)s (0.83≤r≤0.88, p<0.0001). Perfusion MRI, quantitative CT and SPECT/CT demonstrated better correlation than other methods. The limits of agreement of perfusion MRI (4.4±14.2%), quantitative CT (4.7±14.2%) and SPECT/CT (5.1±14.7%) were less than those of qualitative CT (6.0±17.4%), planar imaging (5.8±18.2%), and SPECT (5.5±16.8%). State-of-the-art radiological methods can predict postoperative lung function in NSCLC patients more accurately than traditional methods. Copyright © 2009 Elsevier Ireland Ltd. All rights reserved.

Combinatorial modification of human histone H4 quantitated by two-dimensional liquid chromatography coupled with top down mass spectrometry.

PubMed

Pesavento, James J; Bullock, Courtney R; LeDuc, Richard D; Mizzen, Craig A; Kelleher, Neil L

2008-05-30

Quantitative proteomics has focused heavily on correlating protein abundances, ratios, and dynamics by developing methods that are protein expression-centric (e.g. isotope coded affinity tag, isobaric tag for relative and absolute quantification, etc.). These methods effectively detect changes in protein abundance but fail to provide a comprehensive perspective of the diversity of proteins such as histones, which are regulated by post-translational modifications. Here, we report the characterization of modified forms of HeLa cell histone H4 with a dynamic range >10(4) using a strictly Top Down mass spectrometric approach coupled with two dimensions of liquid chromatography. This enhanced dynamic range enabled the precise characterization and quantitation of 42 forms uniquely modified by combinations of methylation and acetylation, including those with trimethylated Lys-20, monomethylated Arg-3, and the novel dimethylated Arg-3 (each <1% of all H4 forms). Quantitative analyses revealed distinct trends in acetylation site occupancy depending on Lys-20 methylation state. Because both modifications are dynamically regulated through the cell cycle, we simultaneously investigated acetylation and methylation kinetics through three cell cycle phases and used these data to statistically assess the robustness of our quantitative analysis. This work represents the most comprehensive analysis of histone H4 forms present in human cells reported to date.

Mass spectrometry as a quantitative tool in plant metabolomics

PubMed Central

Jorge, Tiago F.; Mata, Ana T.

2016-01-01

Metabolomics is a research field used to acquire comprehensive information on the composition of a metabolite pool to provide a functional screen of the cellular state. Studies of the plant metabolome include the analysis of a wide range of chemical species with very diverse physico-chemical properties, and therefore powerful analytical tools are required for the separation, characterization and quantification of this vast compound diversity present in plant matrices. In this review, challenges in the use of mass spectrometry (MS) as a quantitative tool in plant metabolomics experiments are discussed, and important criteria for the development and validation of MS-based analytical methods provided. This article is part of the themed issue ‘Quantitative mass spectrometry’. PMID:27644967

A quantitative analysis of the F18 flight control system

NASA Technical Reports Server (NTRS)

Doyle, Stacy A.; Dugan, Joanne B.; Patterson-Hine, Ann

1993-01-01

This paper presents an informal quantitative analysis of the F18 flight control system (FCS). The analysis technique combines a coverage model with a fault tree model. To demonstrate the method's extensive capabilities, we replace the fault tree with a digraph model of the F18 FCS, the only model available to us. The substitution shows that while digraphs have primarily been used for qualitative analysis, they can also be used for quantitative analysis. Based on our assumptions and the particular failure rates assigned to the F18 FCS components, we show that coverage does have a significant effect on the system's reliability and thus it is important to include coverage in the reliability analysis.

Detection of Protein Modifications and Counterfeit Protein Pharmaceuticals Using iTRAQ and MALDI TOF/TOF Mass Spectrometry: Studies with Insulins

PubMed Central

Ye, Hongping; Hill, John; Kauffman, John; Gryniewicz, Connie; Han, Xianlin

2013-01-01

iTRAQ (isotope tags for relative and absolute quantification) reagent coupled with MALDI TOF/TOF mass spectrometric analysis has been evaluated as both a qualitative and quantitative method for the detection of modifications to active pharmaceutical ingredients derived from recombinant DNA technologies, and as a method to detect counterfeit drug products. Five types of insulin (human, bovine, porcine, Lispro, Lantus®) were used as model products in the study because of their minor variations in amino acid sequence. Several experiments were conducted in which each insulin variant was separately digested with Glu-C, and the digestate was labeled with one of four different iTRAQ reagents. All digestates were then combined for desalting and MALDI TOF/TOF mass spectrometric analysis. When the digestion procedure was optimized, the insulin sequence coverage was 100%. Five different types of insulin were readily differentiated, including Human insulin (P28K29) and Lispro (K28P29), which only differ by the interchange of two contiguous residues. Moreover, quantitative analyses show that the results obtained from the iTRAQ method agree well with those determined by other conventional methods. Collectively, the iTRAQ method can be used as a qualitative and quantitative technique for the detection of protein modification and counterfeiting. PMID:18489896

Quantitative, Qualitative and Geospatial Methods to Characterize HIV Risk Environments.

PubMed

Conners, Erin E; West, Brooke S; Roth, Alexis M; Meckel-Parker, Kristen G; Kwan, Mei-Po; Magis-Rodriguez, Carlos; Staines-Orozco, Hugo; Clapp, John D; Brouwer, Kimberly C

2016-01-01

Increasingly, 'place', including physical and geographical characteristics as well as social meanings, is recognized as an important factor driving individual and community health risks. This is especially true among marginalized populations in low and middle income countries (LMIC), whose environments may also be more difficult to study using traditional methods. In the NIH-funded longitudinal study Mapa de Salud, we employed a novel approach to exploring the risk environment of female sex workers (FSWs) in two Mexico/U.S. border cities, Tijuana and Ciudad Juárez. In this paper we describe the development, implementation, and feasibility of a mix of quantitative and qualitative tools used to capture the HIV risk environments of FSWs in an LMIC setting. The methods were: 1) Participatory mapping; 2) Quantitative interviews; 3) Sex work venue field observation; 4) Time-location-activity diaries; 5) In-depth interviews about daily activity spaces. We found that the mixed-methodology outlined was both feasible to implement and acceptable to participants. These methods can generate geospatial data to assess the role of the environment on drug and sexual risk behaviors among high risk populations. Additionally, the adaptation of existing methods for marginalized populations in resource constrained contexts provides new opportunities for informing public health interventions.

Quantitative, Qualitative and Geospatial Methods to Characterize HIV Risk Environments

PubMed Central

Conners, Erin E.; West, Brooke S.; Roth, Alexis M.; Meckel-Parker, Kristen G.; Kwan, Mei-Po; Magis-Rodriguez, Carlos; Staines-Orozco, Hugo; Clapp, John D.; Brouwer, Kimberly C.

2016-01-01

Increasingly, ‘place’, including physical and geographical characteristics as well as social meanings, is recognized as an important factor driving individual and community health risks. This is especially true among marginalized populations in low and middle income countries (LMIC), whose environments may also be more difficult to study using traditional methods. In the NIH-funded longitudinal study Mapa de Salud, we employed a novel approach to exploring the risk environment of female sex workers (FSWs) in two Mexico/U.S. border cities, Tijuana and Ciudad Juárez. In this paper we describe the development, implementation, and feasibility of a mix of quantitative and qualitative tools used to capture the HIV risk environments of FSWs in an LMIC setting. The methods were: 1) Participatory mapping; 2) Quantitative interviews; 3) Sex work venue field observation; 4) Time-location-activity diaries; 5) In-depth interviews about daily activity spaces. We found that the mixed-methodology outlined was both feasible to implement and acceptable to participants. These methods can generate geospatial data to assess the role of the environment on drug and sexual risk behaviors among high risk populations. Additionally, the adaptation of existing methods for marginalized populations in resource constrained contexts provides new opportunities for informing public health interventions. PMID:27191846

Comparative Evaluation of Quantitative Test Methods for Gases on a Hard Surface

DTIC Science & Technology

2017-02-01

COMPARATIVE EVALUATION OF QUANTITATIVE TEST METHODS FOR GASES ON A HARD SURFACE ECBC-TR-1426 Vipin Rastogi...1 COMPARATIVE EVALUATION OF QUANTITATIVE TEST METHODS FOR GASES ON A HARD SURFACE 1. INTRODUCTION Members of the U.S. Environmental...Generator 4 2.4 Experimental Design Each quantitative method was performed three times on three consecutive days. For the CD runs, three

Method of detecting and counting bacteria

NASA Technical Reports Server (NTRS)

Picciolo, G. L.; Chappelle, E. W. (Inventor)

1976-01-01

An improved method is provided for determining bacterial levels, especially in samples of aqueous physiological fluids. The method depends on the quantitative determination of bacterial adenosine triphosphate (ATP) in the presence of nonbacterial ATP. The bacterial ATP is released by cell rupture and is measured by an enzymatic bioluminescent assay. A concentration technique is included to make the method more sensitive. It is particularly useful where the fluid to be measured contains an unknown or low bacteria count.

Advancing the study of violence against women using mixed methods: integrating qualitative methods into a quantitative research program.

PubMed

Testa, Maria; Livingston, Jennifer A; VanZile-Tamsen, Carol

2011-02-01

A mixed methods approach, combining quantitative with qualitative data methods and analysis, offers a promising means of advancing the study of violence. Integrating semi-structured interviews and qualitative analysis into a quantitative program of research on women's sexual victimization has resulted in valuable scientific insight and generation of novel hypotheses for testing. This mixed methods approach is described and recommendations for integrating qualitative data into quantitative research are provided.

Impact of reconstruction parameters on quantitative I-131 SPECT

NASA Astrophysics Data System (ADS)

van Gils, C. A. J.; Beijst, C.; van Rooij, R.; de Jong, H. W. A. M.

2016-07-01

Radioiodine therapy using I-131 is widely used for treatment of thyroid disease or neuroendocrine tumors. Monitoring treatment by accurate dosimetry requires quantitative imaging. The high energy photons however render quantitative SPECT reconstruction challenging, potentially requiring accurate correction for scatter and collimator effects. The goal of this work is to assess the effectiveness of various correction methods on these effects using phantom studies. A SPECT/CT acquisition of the NEMA IEC body phantom was performed. Images were reconstructed using the following parameters: (1) without scatter correction, (2) with triple energy window (TEW) scatter correction and (3) with Monte Carlo-based scatter correction. For modelling the collimator-detector response (CDR), both (a) geometric Gaussian CDRs as well as (b) Monte Carlo simulated CDRs were compared. Quantitative accuracy, contrast to noise ratios and recovery coefficients were calculated, as well as the background variability and the residual count error in the lung insert. The Monte Carlo scatter corrected reconstruction method was shown to be intrinsically quantitative, requiring no experimentally acquired calibration factor. It resulted in a more accurate quantification of the background compartment activity density compared with TEW or no scatter correction. The quantification error relative to a dose calibrator derived measurement was found to be  <1%,-26% and 33%, respectively. The adverse effects of partial volume were significantly smaller with the Monte Carlo simulated CDR correction compared with geometric Gaussian or no CDR modelling. Scatter correction showed a small effect on quantification of small volumes. When using a weighting factor, TEW correction was comparable to Monte Carlo reconstruction in all measured parameters, although this approach is clinically impractical since this factor may be patient dependent. Monte Carlo based scatter correction including accurately simulated CDR modelling is the most robust and reliable method to reconstruct accurate quantitative iodine-131 SPECT images.

Highly Reproducible Label Free Quantitative Proteomic Analysis of RNA Polymerase Complexes*

PubMed Central

Mosley, Amber L.; Sardiu, Mihaela E.; Pattenden, Samantha G.; Workman, Jerry L.; Florens, Laurence; Washburn, Michael P.

2011-01-01

The use of quantitative proteomics methods to study protein complexes has the potential to provide in-depth information on the abundance of different protein components as well as their modification state in various cellular conditions. To interrogate protein complex quantitation using shotgun proteomic methods, we have focused on the analysis of protein complexes using label-free multidimensional protein identification technology and studied the reproducibility of biological replicates. For these studies, we focused on three highly related and essential multi-protein enzymes, RNA polymerase I, II, and III from Saccharomyces cerevisiae. We found that label-free quantitation using spectral counting is highly reproducible at the protein and peptide level when analyzing RNA polymerase I, II, and III. In addition, we show that peptide sampling does not follow a random sampling model, and we show the need for advanced computational models to predict peptide detection probabilities. In order to address these issues, we used the APEX protocol to model the expected peptide detectability based on whole cell lysate acquired using the same multidimensional protein identification technology analysis used for the protein complexes. Neither method was able to predict the peptide sampling levels that we observed using replicate multidimensional protein identification technology analyses. In addition to the analysis of the RNA polymerase complexes, our analysis provides quantitative information about several RNAP associated proteins including the RNAPII elongation factor complexes DSIF and TFIIF. Our data shows that DSIF and TFIIF are the most highly enriched RNAP accessory factors in Rpb3-TAP purifications and demonstrate our ability to measure low level associated protein abundance across biological replicates. In addition, our quantitative data supports a model in which DSIF and TFIIF interact with RNAPII in a dynamic fashion in agreement with previously published reports. PMID:21048197

Assessment of acute myocarditis by cardiac magnetic resonance imaging: Comparison of qualitative and quantitative analysis methods.

PubMed

Imbriaco, Massimo; Nappi, Carmela; Puglia, Marta; De Giorgi, Marco; Dell'Aversana, Serena; Cuocolo, Renato; Ponsiglione, Andrea; De Giorgi, Igino; Polito, Maria Vincenza; Klain, Michele; Piscione, Federico; Pace, Leonardo; Cuocolo, Alberto

2017-10-26

To compare cardiac magnetic resonance (CMR) qualitative and quantitative analysis methods for the noninvasive assessment of myocardial inflammation in patients with suspected acute myocarditis (AM). A total of 61 patients with suspected AM underwent coronary angiography and CMR. Qualitative analysis was performed applying Lake-Louise Criteria (LLC), followed by quantitative analysis based on the evaluation of edema ratio (ER) and global relative enhancement (RE). Diagnostic performance was assessed for each method by measuring the area under the curves (AUC) of the receiver operating characteristic analyses. The final diagnosis of AM was based on symptoms and signs suggestive of cardiac disease, evidence of myocardial injury as defined by electrocardiogram changes, elevated troponin I, exclusion of coronary artery disease by coronary angiography, and clinical and echocardiographic follow-up at 3 months after admission to the chest pain unit. In all patients, coronary angiography did not show significant coronary artery stenosis. Troponin I levels and creatine kinase were higher in patients with AM compared to those without (both P < .001). There were no significant differences among LLC, T2-weighted short inversion time inversion recovery (STIR) sequences, early (EGE), and late (LGE) gadolinium-enhancement sequences for diagnosis of AM. The AUC for qualitative (T2-weighted STIR 0.92, EGE 0.87 and LGE 0.88) and quantitative (ER 0.89 and global RE 0.80) analyses were also similar. Qualitative and quantitative CMR analysis methods show similar diagnostic accuracy for the diagnosis of AM. These findings suggest that a simplified approach using a shortened CMR protocol including only T2-weighted STIR sequences might be useful to rule out AM in patients with acute coronary syndrome and normal coronary angiography.

Studying learning in the healthcare setting: the potential of quantitative diary methods.

PubMed

Ciere, Yvette; Jaarsma, Debbie; Visser, Annemieke; Sanderman, Robbert; Snippe, Evelien; Fleer, Joke

2015-08-01

Quantitative diary methods are longitudinal approaches that involve the repeated measurement of aspects of peoples' experience of daily life. In this article, we outline the main characteristics and applications of quantitative diary methods and discuss how their use may further research in the field of medical education. Quantitative diary methods offer several methodological advantages, such as measuring aspects of learning with great detail, accuracy and authenticity. Moreover, they enable researchers to study how and under which conditions learning in the health care setting occurs and in which way learning can be promoted. Hence, quantitative diary methods may contribute to theory development and the optimization of teaching methods in medical education.

Biology Undergraduates' Misconceptions about Genetic Drift

ERIC Educational Resources Information Center

Andrews, T. M.; Price, R. M.; Mead, L. S.; McElhinny, T. L.; Thanukos, A.; Perez, K. E.; Herreid, C. F.; Terry, D. R.; Lemons, P. P.

2012-01-01

This study explores biology undergraduates' misconceptions about genetic drift. We use qualitative and quantitative methods to describe students' definitions, identify common misconceptions, and examine differences before and after instruction on genetic drift. We identify and describe five overarching categories that include 16 distinct…

A complementary marriage of perspectives: understanding organizational social context using mixed methods.

PubMed

Beidas, Rinad S; Wolk, Courtney L Benjamin; Walsh, Lucia M; Evans, Arthur C; Hurford, Matthew O; Barg, Frances K

2014-11-23

Organizational factors impact the delivery of mental health services in community settings. Mixed-methods analytic approaches have been recommended, though little research within implementation science has explicitly compared inductive and deductive perspectives to understand their relative value in understanding the same constructs. The purpose of our study is to use two different paradigmatic approaches to deepen our understanding of organizational social context. We accomplish this by using a mixed-methods approach in an investigation of organizational social context in community mental health clinics. Nineteen agencies, representing 23 sites, participated. Enrolled participants included 130 therapists, 36 supervisors, and 22 executive administrators. Quantitative data was obtained via the Organizational Social Context (OSC) measure. Qualitative data, comprised of direct observation with spot sampling generated from agency visits, was coded using content analysis and grounded theory. The present study examined elements of organizational social context that would have been missed if only quantitative data had been obtained and utilized mixed methods to investigate if stratifying observations based on quantitative ratings from the OSC resulted in the emergence of differential themes. Four of the six OSC constructs were commonly observed in field observations (i.e., proficiency, rigidity, functionality, stress), while the remaining two constructs were not frequently observed (i.e., resistance, engagement). Constructs emerged related to organizational social context that may have been missed if only quantitative measurement was employed, including those around the physical environment, commentary about evidence-based practice initiatives, leadership, cultural diversity, distrust, and affect. Stratifying agencies by "best," "average," and "worst" organizational social context impacted interpretation for three constructs (affect, stress, and leadership). Results support the additive value of integrating inductive and deductive perspectives in implementation science research. This synthesis of approaches facilitated a more comprehensive understanding and interpretation of the findings than would have been possible if either methodology had been employed in isolation.

Enzymatic browning reactions in apple and apple products.

PubMed

Nicolas, J J; Richard-Forget, F C; Goupy, P M; Amiot, M J; Aubert, S Y

1994-01-01

This review examines the parameters of enzymatic browning in apple and apple products that is, phenolic compounds, polyphenoloxidases, and other factors (ascorbic acid and peroxidases), both qualitatively and quantitatively. Then the relationships between intensity of browning and the browning parameters are discussed, including a paragraph on the methods used for browning evaluation. Finally, the different methods for the control of browning are presented.

A Feasibility Study of Using ICT in Iranian Secondary Schools: The Case of Tehran Province

ERIC Educational Resources Information Center

Fathi Vajargah, Kourosh; Saadattlab, Ayat

2014-01-01

This research presents the results of a feasibility assessment on implementing ICT in Tehran high schools. Mixed method research (both qualitative and quantitative) was employed and due to the nature of research, data collection included two stages: library and field study. Using the cluster method with 362 subjects, data was collected using a…

Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions.

PubMed

Belmonte, Frances R; Martin, James L; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A; Kaufman, Brett A

2016-04-28

Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error.

HPLC analysis and standardization of Brahmi vati - An Ayurvedic poly-herbal formulation.

PubMed

Mishra, Amrita; Mishra, Arun K; Tiwari, Om Prakash; Jha, Shivesh

2013-09-01

The aim of the present study was to standardize Brahmi vati (BV) by simultaneous quantitative estimation of Bacoside A3 and Piperine adopting HPLC-UV method. BV very important Ayurvedic polyherbo formulation used to treat epilepsy and mental disorders containing thirty eight ingredients including Bacopa monnieri L. and Piper longum L. An HPLC-UV method was developed for the standardization of BV in light of simultaneous quantitative estimation of Bacoside A3 and Piperine, the major constituents of B. monnieri L. and P. longum L. respectively. The developed method was validated on parameters including linearity, precision, accuracy and robustness. The HPLC analysis showed significant increase in amount of Bacoside A3 and Piperine in the in-house sample of BV when compared with all three different marketed samples of the same. Results showed variations in the amount of Bacoside A3 and Piperine in different samples which indicate non-uniformity in their quality which will lead to difference in their therapeutic effects. The outcome of the present investigation underlines the importance of standardization of Ayurvedic formulations. The developed method may be further used to standardize other samples of BV or other formulations containing Bacoside A3 and Piperine.

Trace analysis of trimethoprim and sulfonamide, macrolide, quinolone, and tetracycline antibiotics in chlorinated drinking water using liquid chromatography electrospray tandem mass spectrometry

USGS Publications Warehouse

Ye, Z.; Weinberg, H.S.; Meyer, M.T.

2007-01-01

A multirun analytical method has been developed and validated for trace determination of 24 antibiotics including 7 sulfonamides, 3 macrolides, 7 quinolones, 6 tetracyclines, and trimethoprim in chlorine-disinfected drinking water using a single solid-phase extraction method coupled to liquid chromatography with positive electrospray tandem mass spectrometry detection. The analytes were extracted by a hydrophilic-lipophilic balanced resin and eluted with acidified methanol (0.1% formic acid), resulting in analyte recoveries generally above 90%. The limits of quantitation were mostly below 10 ng/L in drinking water. Since the concentrated sample matrix typically caused ion suppression during electrospray ionization, the method of standard addition was used for quantitation. Chlorine residuals in drinking water can react with some antibiotics, but ascorbic acid was found to be an effective chlorine quenching agent without affecting the analysis and stability of the antibiotics in water. A preliminary occurrence study using this method revealed the presence of some antibiotics in drinking waters, including sulfamethoxazole (3.0-3.4 ng/L), macrolides (1.4-4.9 ng/L), and quinolones (1.2-4.0 ng/L). ?? 2007 American Chemical Society.

Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions

PubMed Central

Belmonte, Frances R.; Martin, James L.; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A.; Kaufman, Brett A.

2016-01-01

Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error. PMID:27122135

Quality of data in multiethnic health surveys.

PubMed Central

Pasick, R. J.; Stewart, S. L.; Bird, J. A.; D'Onofrio, C. N.

2001-01-01

OBJECTIVE: There has been insufficient research on the influence of ethno-cultural and language differences in public health surveys. Using data from three independent studies, the authors examine methods to assess data quality and to identify causes of problematic survey questions. METHODS: Qualitative and quantitative methods were used in this exploratory study, including secondary analyses of data from three baseline surveys (conducted in English, Spanish, Cantonese, Mandarin, and Vietnamese). Collection of additional data included interviews with investigators and interviewers; observations of item development; focus groups; think-aloud interviews; a test-retest assessment survey; and a pilot test of alternatively worded questions. RESULTS: The authors identify underlying causes for the 12 most problematic variables in three multiethnic surveys and describe them in terms of ethnic differences in reliability, validity, and cognitive processes (interpretation, memory retrieval, judgment formation, and response editing), and differences with regard to cultural appropriateness and translation problems. CONCLUSIONS: Multiple complex elements affect measurement in a multiethnic survey, many of which are neither readily observed nor understood through standard tests of data quality. Multiethnic survey questions are best evaluated using a variety of quantitative and qualitative methods that reveal different types and causes of problems. PMID:11889288

Novel method for quantitative ANA measurement using near-infrared imaging.

PubMed

Peterson, Lisa K; Wells, Daniel; Shaw, Laura; Velez, Maria-Gabriela; Harbeck, Ronald; Dragone, Leonard L

2009-09-30

Antinuclear antibodies (ANA) have been detected in patients with systemic rheumatic diseases and are used in the screening and/or diagnosis of autoimmunity in patients as well as mouse models of systemic autoimmunity. Indirect immunofluorescence (IIF) on HEp-2 cells is the gold standard for ANA screening. However, its usefulness is limited in diagnosis, prognosis and monitoring of disease activity due to the lack of standardization in performing the technique, subjectivity in interpreting the results and the fact that it is only semi-quantitative. Various immunological techniques have been developed in an attempt to improve upon the method to quantify ANA, including enzyme-linked immunosorbent assays (ELISAs), line immunoassays (LIAs), multiplexed bead immunoassays and IIF on substrates other than HEp-2 cells. Yet IIF on HEp-2 cells remains the most common screening method for ANA. In this study, we describe a simple quantitative method to detect ANA which combines IIF on HEp-2 coated slides with analysis using a near-infrared imaging (NII) system. Using NII to determine ANA titer, 86.5% (32 of 37) of the titers for human patient samples were within 2 dilutions of those determined by IIF, which is the acceptable range for proficiency testing. Combining an initial screening for nuclear staining using microscopy with titration by NII resulted in 97.3% (36 of 37) of the titers detected to be within two dilutions of those determined by IIF. The NII method for quantitative ANA measurements using serum from both patients and mice with autoimmunity provides a fast, relatively simple, objective, sensitive and reproducible assay, which could easily be standardized for comparison between laboratories.

Quantitative prediction of drug side effects based on drug-related features.

PubMed

Niu, Yanqing; Zhang, Wen

2017-09-01

Unexpected side effects of drugs are great concern in the drug development, and the identification of side effects is an important task. Recently, machine learning methods are proposed to predict the presence or absence of interested side effects for drugs, but it is difficult to make the accurate prediction for all of them. In this paper, we transform side effect profiles of drugs as their quantitative scores, by summing up their side effects with weights. The quantitative scores may measure the dangers of drugs, and thus help to compare the risk of different drugs. Here, we attempt to predict quantitative scores of drugs, namely the quantitative prediction. Specifically, we explore a variety of drug-related features and evaluate their discriminative powers for the quantitative prediction. Then, we consider several feature combination strategies (direct combination, average scoring ensemble combination) to integrate three informative features: chemical substructures, targets, and treatment indications. Finally, the average scoring ensemble model which produces the better performances is used as the final quantitative prediction model. Since weights for side effects are empirical values, we randomly generate different weights in the simulation experiments. The experimental results show that the quantitative method is robust to different weights, and produces satisfying results. Although other state-of-the-art methods cannot make the quantitative prediction directly, the prediction results can be transformed as the quantitative scores. By indirect comparison, the proposed method produces much better results than benchmark methods in the quantitative prediction. In conclusion, the proposed method is promising for the quantitative prediction of side effects, which may work cooperatively with existing state-of-the-art methods to reveal dangers of drugs.

Differential Mobility Spectrometry-Mass Spectrometry (DMS-MS) in Radiation Biodosimetry: Rapid and High-Throughput Quantitation of Multiple Radiation Biomarkers in Nonhuman Primate Urine.

PubMed

Chen, Zhidan; Coy, Stephen L; Pannkuk, Evan L; Laiakis, Evagelia C; Fornace, Albert J; Vouros, Paul

2018-05-07

High-throughput methods to assess radiation exposure are a priority due to concerns that include nuclear power accidents, the spread of nuclear weapon capability, and the risk of terrorist attacks. Metabolomics, the assessment of small molecules in an easily accessible sample, is the most recent method to be applied for the identification of biomarkers of the biological radiation response with a useful dose-response profile. Profiling for biomarker identification is frequently done using an LC-MS platform which has limited throughput due to the time-consuming nature of chromatography. We present here a chromatography-free simplified method for quantitative analysis of seven metabolites in urine with radiation dose-response using urine samples provided from the Pannkuk et al. (2015) study of long-term (7-day) radiation response in nonhuman primates (NHP). The stable isotope dilution (SID) analytical method consists of sample preparation by strong cation exchange-solid phase extraction (SCX-SPE) to remove interferences and concentrate the metabolites of interest, followed by differential mobility spectrometry (DMS) ion filtration to select the ion of interest and reduce chemical background, followed by mass spectrometry (overall SID-SPE-DMS-MS). Since no chromatography is used, calibration curves were prepared rapidly, in under 2 h (including SPE) for six simultaneously analyzed radiation biomarkers. The seventh, creatinine, was measured separately after 2500× dilution. Creatinine plays a dual role, measuring kidney glomerular filtration rate (GFR), and indicating kidney damage at high doses. The current quantitative method using SID-SPE-DMS-MS provides throughput which is 7.5 to 30 times higher than that of LC-MS and provides a path to pre-clinical radiation dose estimation. Graphical Abstract.

Differential Mobility Spectrometry-Mass Spectrometry (DMS-MS) in Radiation Biodosimetry: Rapid and High-Throughput Quantitation of Multiple Radiation Biomarkers in Nonhuman Primate Urine

NASA Astrophysics Data System (ADS)

Chen, Zhidan; Coy, Stephen L.; Pannkuk, Evan L.; Laiakis, Evagelia C.; Fornace, Albert J.; Vouros, Paul

2018-05-01

High-throughput methods to assess radiation exposure are a priority due to concerns that include nuclear power accidents, the spread of nuclear weapon capability, and the risk of terrorist attacks. Metabolomics, the assessment of small molecules in an easily accessible sample, is the most recent method to be applied for the identification of biomarkers of the biological radiation response with a useful dose-response profile. Profiling for biomarker identification is frequently done using an LC-MS platform which has limited throughput due to the time-consuming nature of chromatography. We present here a chromatography-free simplified method for quantitative analysis of seven metabolites in urine with radiation dose-response using urine samples provided from the Pannkuk et al. (2015) study of long-term (7-day) radiation response in nonhuman primates (NHP). The stable isotope dilution (SID) analytical method consists of sample preparation by strong cation exchange-solid phase extraction (SCX-SPE) to remove interferences and concentrate the metabolites of interest, followed by differential mobility spectrometry (DMS) ion filtration to select the ion of interest and reduce chemical background, followed by mass spectrometry (overall SID-SPE-DMS-MS). Since no chromatography is used, calibration curves were prepared rapidly, in under 2 h (including SPE) for six simultaneously analyzed radiation biomarkers. The seventh, creatinine, was measured separately after 2500× dilution. Creatinine plays a dual role, measuring kidney glomerular filtration rate (GFR), and indicating kidney damage at high doses. The current quantitative method using SID-SPE-DMS-MS provides throughput which is 7.5 to 30 times higher than that of LC-MS and provides a path to pre-clinical radiation dose estimation. [Figure not available: see fulltext.

ADVANCING THE STUDY OF VIOLENCE AGAINST WOMEN USING MIXED METHODS: INTEGRATING QUALITATIVE METHODS INTO A QUANTITATIVE RESEARCH PROGRAM

PubMed Central

Testa, Maria; Livingston, Jennifer A.; VanZile-Tamsen, Carol

2011-01-01

A mixed methods approach, combining quantitative with qualitative data methods and analysis, offers a promising means of advancing the study of violence. Integrating semi-structured interviews and qualitative analysis into a quantitative program of research on women’s sexual victimization has resulted in valuable scientific insight and generation of novel hypotheses for testing. This mixed methods approach is described and recommendations for integrating qualitative data into quantitative research are provided. PMID:21307032

[Isolation and identification of Cronobacter (Enterobacter sakazakii) strains from food].

PubMed

Dong, Xiaohui; Li, Chengsi; Wu, Qingping; Zhang, Jumei; Mo, Shuping; Guo, Weipeng; Yang, Xiaojuan; Xu, Xiaoke

2013-05-04

This study aimed to detect and quantify Cronobacter in 300 powdered milk samples and 50 non-powdered milk samples. Totally, 24 Cronobacter (formerly Enterobacter sakazakii) strains isolated from powdered milk and other foods were identified and confirmed. Cronobacter strains were detected quantitatively using most probable number (MPN) method and molecular detection method. We identified 24 Cronobacter strains using biochemical patterns, including indole production and dulcitol, malonate, melezitose, turanose, and myo-Inositol utilization. Of the 24 strains, their 16S rRNA genes were sequenced, and constructed phylogenetic tree by N-J (Neighbour-Joining) with the 16S rRNA gene sequences of 17 identified Cronobacter strains and 10 non-Cronobacter strains. Quantitative detection showed that Cronobacter strains were detected in 23 out of 350 samples yielding 6.6% detection rate. Twenty-four Cronobacter strains were isolated from 23 samples and the Cronobacter was more than 100 MPN/100g in 4 samples out of 23 samples. The 24 Cronobacter spp. isolates strains were identified and confirmed, including 19 Cronobacter sakazakii strains, 2 C. malonaticus strains, 2 C. dubliensis subsp. lactaridi strains, and 1 C. muytjensii strain. The combination of molecular detection method and most probable number (MPN) method could be suitable for the detection of Cronobacter in powdered milk, with low rate of contamination and high demand of quantitative detection. 24 isolated strains were confirmed and identified by biochemical patterns and molecular technology, and C. sakazakii could be the dominant species. The problem of Cronobacter in powdered milk should be a hidden danger to nurseling, and should catch the government and consumer's attention.

Using Mixed Methods to Evaluate a Community Intervention for Sexual Assault Survivors: A Methodological Tale.

PubMed

Campbell, Rebecca; Patterson, Debra; Bybee, Deborah

2011-03-01

This article reviews current epistemological and design issues in the mixed methods literature and then examines the application of one specific design, a sequential explanatory mixed methods design, in an evaluation of a community-based intervention to improve postassault care for sexual assault survivors. Guided by a pragmatist epistemological framework, this study collected quantitative and qualitative data to understand how the implementation of a Sexual Assault Nurse Examiner (SANE) program affected prosecution rates of adult sexual assault cases in a large midwestern community. Quantitative results indicated that the program was successful in affecting legal systems change and the qualitative data revealed the mediating mechanisms of the intervention's effectiveness. Challenges of implementing this design are discussed, including epistemological and practical difficulties that developed from blending methodologies into a single project. © The Author(s) 2011.

Quantification of Liver Iron with MRI: State of the Art and Remaining Challenges

PubMed Central

Hernando, Diego; Levin, Yakir S; Sirlin, Claude B; Reeder, Scott B

2015-01-01

Liver iron overload is the histological hallmark of hereditary hemochromatosis and transfusional hemosiderosis, and can also occur in chronic hepatopathies. Iron overload can result in liver damage, with the eventual development of cirrhosis, liver failure and hepatocellular carcinoma. Assessment of liver iron levels is necessary for detection and quantitative staging of iron overload, and monitoring of iron-reducing treatments. This article discusses the need for non-invasive assessment of liver iron, and reviews qualitative and quantitative methods with a particular emphasis on MRI. Specific MRI methods for liver iron quantification include signal intensity ratio as well as R2 and R2* relaxometry techniques. Methods that are in clinical use, as well as their limitations, are described. Remaining challenges, unsolved problems, and emerging techniques to provide improved characterization of liver iron deposition are discussed. PMID:24585403

Establishment of a new method to quantitatively evaluate hyphal fusion ability in Aspergillus oryzae.

PubMed

Tsukasaki, Wakako; Maruyama, Jun-Ichi; Kitamoto, Katsuhiko

2014-01-01

Hyphal fusion is involved in the formation of an interconnected colony in filamentous fungi, and it is the first process in sexual/parasexual reproduction. However, it was difficult to evaluate hyphal fusion efficiency due to the low frequency in Aspergillus oryzae in spite of its industrial significance. Here, we established a method to quantitatively evaluate the hyphal fusion ability of A. oryzae with mixed culture of two different auxotrophic strains, where the ratio of heterokaryotic conidia growing without the auxotrophic requirements reflects the hyphal fusion efficiency. By employing this method, it was demonstrated that AoSO and AoFus3 are required for hyphal fusion, and that hyphal fusion efficiency of A. oryzae was increased by depleting nitrogen source, including large amounts of carbon source, and adjusting pH to 7.0.

Qualitative versus quantitative methods in psychiatric research.

PubMed

Razafsha, Mahdi; Behforuzi, Hura; Azari, Hassan; Zhang, Zhiqun; Wang, Kevin K; Kobeissy, Firas H; Gold, Mark S

2012-01-01

Qualitative studies are gaining their credibility after a period of being misinterpreted as "not being quantitative." Qualitative method is a broad umbrella term for research methodologies that describe and explain individuals' experiences, behaviors, interactions, and social contexts. In-depth interview, focus groups, and participant observation are among the qualitative methods of inquiry commonly used in psychiatry. Researchers measure the frequency of occurring events using quantitative methods; however, qualitative methods provide a broader understanding and a more thorough reasoning behind the event. Hence, it is considered to be of special importance in psychiatry. Besides hypothesis generation in earlier phases of the research, qualitative methods can be employed in questionnaire design, diagnostic criteria establishment, feasibility studies, as well as studies of attitude and beliefs. Animal models are another area that qualitative methods can be employed, especially when naturalistic observation of animal behavior is important. However, since qualitative results can be researcher's own view, they need to be statistically confirmed, quantitative methods. The tendency to combine both qualitative and quantitative methods as complementary methods has emerged over recent years. By applying both methods of research, scientists can take advantage of interpretative characteristics of qualitative methods as well as experimental dimensions of quantitative methods.

The fragmented testis method: development and its advantages of a new quantitative evaluation technique for detection of testis-ova in male fish.

PubMed

Lin, Bin-Le; Hagino, Satoshi; Kagoshima, Michio; Iwamatsu, Takashi

2009-02-01

A new quantitative evaluation technique, termed the fragmented testis method, has been developed for the detection of testis-ova in genotypic male fish using the medaka (Oryzias latipes). The routine traditional histological method for detection of testis-ova in male fish exposed to estrogens or suspected endocrine-disrupting chemicals has several disadvantages, including possible oversight of testis-ova due to limited sampling of selected tissue sections. The method we have developed here allows for the accurate determination of the developmental stages and the number and the size of testis-ova in a whole testis. Each testis was removed from the fish specimen, fixed with 10% buffered formalin solution, and then divided into small fragments on a glass slide with a dissecting needle or scalpel and aciform forceps in glycerin solution containing a small amount of methylene blue or toluidine blue. If present, all developing testis-ova of various sizes in fragmented testicular tissues were clearly stained and were observable under a dissecting microscope. Testis-ova occurred in controls were ascertained, while spermatozoa were also distinguishable using this method. This proved to be a convenient and cost-effective method for quantitatively evaluating testis-ova appearance in fish, and it may help to clarify the mechanism of testis-ova formation and the biological significance of testis-ova in future studies of endocrine disruption.

Improvement of the analog forecasting method by using local thermodynamic data. Application to autumn precipitation in Catalonia

NASA Astrophysics Data System (ADS)

Gibergans-Báguena, J.; Llasat, M. C.

2007-12-01

The objective of this paper is to present the improvement of quantitative forecasting of daily rainfall in Catalonia (NE Spain) from an analogues technique, taking into account synoptic and local data. This method is based on an analogues sorting technique: meteorological situations similar to the current one, in terms of 700 and 1000 hPa geopotential fields at 00 UTC, complemented with the inclusion of some thermodynamic parameters extracted from an historical data file. Thermodynamic analysis acts as a highly discriminating feature for situations in which the synoptic situation fails to explain either atmospheric phenomena or rainfall distribution. This is the case in heavy rainfall situations, where the existence of instability and high water vapor content is essential. With the objective of including these vertical thermodynamic features, information provided by the Palma de Mallorca radiosounding (Spain) has been used. Previously, a selection of the most discriminating thermodynamic parameters for the daily rainfall was made, and then the analogues technique applied to them. Finally, three analog forecasting methods were applied for the quantitative daily rainfall forecasting in Catalonia. The first one is based on analogies from geopotential fields to synoptic scale; the second one is exclusively based on the search of similarity from local thermodynamic information and the third method combines the other two methods. The results show that this last method provides a substantial improvement of quantitative rainfall estimation.

Species Identification of Fox-, Mink-, Dog-, and Rabbit-Derived Ingredients by Multiplex PCR and Real-Time PCR Assay.

PubMed

Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang

2018-05-01

Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2  > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.

Advantages of using tetrahydrofuran-water as mobile phases in the quantitation of cyclosporin A in monkey and rat plasma by liquid chromatography-tandem mass spectrometry.

PubMed

Li, Austin C; Li, Yinghe; Guirguis, Micheal S; Caldwell, Robert G; Shou, Wilson Z

2007-01-04

A new analytical method is described here for the quantitation of anti-inflammatory drug cyclosporin A (CyA) in monkey and rat plasma. The method used tetrahydrofuran (THF)-water mobile phases to elute the analyte and internal standard, cyclosporin C (CyC). The gradient mobile phase program successfully eluted CyA into a sharp peak and therefore improved resolution between the analyte and possible interfering materials compared with previously reported analytical approaches, where CyA was eluted as a broad peak due to the rapid conversion between different conformers. The sharp peak resulted from this method facilitated the quantitative calculation as multiple smoothing and large number of bunching factors were not necessary. The chromatography in the new method was performed at 30 degrees C instead of 65-70 degrees C as reported previously. Other advantages of the method included simple and fast sample extraction-protein precipitation, direct injection of the extraction supernatant to column for analysis, and elimination of evaporation and reconstitution steps, which were needed in solid phase extraction or liquid-liquid extraction reported before. This method is amenable to high-throughput analysis with a total chromatographic run time of 3 min. This approach has been verified as sensitive, linear (0.977-4000 ng/mL), accurate and precise for the quantitation of CyA in monkey and rat plasma. However, compared with the usage of conventional mobile phases, the only drawback of this approach was the reduced detection response from the mass spectrometer that was possibly caused by poor desolvation in the ionization source. This is the first report to demonstrate the advantages of using THF-water mobile phases to elute CyA in liquid chromatography.

Participation in environmental enhancement and conservation activities for health and well-being in adults: a review of quantitative and qualitative evidence.

PubMed

Husk, Kerryn; Lovell, Rebecca; Cooper, Chris; Stahl-Timmins, Will; Garside, Ruth

2016-05-21

There is growing research and policy interest in the potential for using the natural environment to enhance human health and well-being. This resource may be underused as a health promotion tool to address the increasing burden of common health problems such as increased chronic diseases and mental health concerns. Outdoor environmental enhancement and conservation activities (EECA) (for instance unpaid litter picking, tree planting or path maintenance) offer opportunities for physical activity alongside greater connectedness with local environments, enhanced social connections within communities and improved self-esteem through activities that improve the locality which may, in turn, further improve well-being. To assess the health and well-being impacts on adults following participation in environmental enhancement and conservation activities. We contacted or searched the websites of more than 250 EECA organisations to identify grey literature. Resource limitations meant the majority of the websites were from UK, USA, Canada and Australia. We searched the following databases (initially in October 2012, updated October 2014, except CAB Direct, OpenGrey, SPORTDiscus, and TRIP Database), using a search strategy developed with our project advisory groups (predominantly leaders of EECA-type activities and methodological experts): ASSIA; BIOSIS; British Education Index; British Nursing Index; CAB Abstracts; Campbell Collaboration; Cochrane Public Health Specialized Register; DOPHER; EMBASE; ERIC; Global Health; GreenFILE; HMIC; MEDLINE-in-Process; MEDLINE; OpenGrey; PsychINFO; Social Policy and Practice; SPORTDiscus; TRoPHI; Social Services Abstracts; Sociological Abstracts; The Cochrane Library; TRIP database; and Web of Science. Citation and related article chasing was used. Searches were limited to studies in English published after 1990. Two review authors independently screened studies. Included studies examined the impact of EECA on adult health and well-being. Eligible interventions needed to include each of the following: intended to improve the outdoor natural or built environment at either a local or wider level; took place in urban or rural locations in any country; involved active participation; and were NOT experienced through paid employment.We included quantitative and qualitative research. Includable quantitative study designs were: randomised controlled trials (RCTs), cluster RCTs, quasi-RCTs, cluster quasi-RCTs, controlled before-and-after studies, interrupted-time-series, cohort studies (prospective or retrospective), case-control studies and uncontrolled before-and-after studies (uBA). We included qualitative research if it used recognised qualitative methods of data collection and analysis. One reviewer extracted data, and another reviewer checked the data. Two review authors independently appraised study quality using the Effective Public Health Practice Project tool (for quantitative studies) or Wallace criteria (for qualitative studies). Heterogeneity of outcome measures and poor reporting of intervention specifics prevented meta-analysis so we synthesised the results narratively. We synthesised qualitative research findings using thematic analysis. Database searches identified 21,420 records, with 21,304 excluded at title/abstract. Grey literature searches identified 211 records. We screened 327 full-text articles from which we included 21 studies (reported in 28 publications): two case-studies (which were not included in the synthesis due to inadequate robustness), one case-control, one retrospective cohort, five uBA, three mixed-method (uBA, qualitative), and nine qualitative studies. The 19 studies included in the synthesis detailed the impacts to a total of 3,603 participants: 647 from quantitative intervention studies and 2630 from a retrospective cohort study; and 326 from qualitative studies (one not reporting sample size).Included studies shared the key elements of EECA defined above, but the range of activities varied considerably. Quantitative evaluation methods were heterogeneous. The designs or reporting of quantitative studies, or both, were rated as 'weak' quality with high risk of bias due to one or more of the following: inadequate study design, intervention detail, participant selection, outcome reporting and blinding.Participants' characteristics were poorly reported; eight studies did not report gender or age and none reported socio-economic status. Three quantitative studies reported that participants were referred through health or social services, or due to mental ill health (five quantitative studies), however participants' engagement routes were often not clear.Whilst the majority of quantitative studies (n = 8) reported no effect on one or more outcomes, positive effects were reported in six quantitative studies relating to short-term physiological, mental/emotional health, and quality-of-life outcomes. Negative effects were reported in two quantitative studies; one study reported higher levels of anxiety amongst participants, another reported increased mental health stress.The design or reporting, or both, of the qualitative studies was rated as good in three studies or poor in nine; mainly due to missing detail about participants, methods and interventions. Included qualitative evidence provided rich data about the experience of participation. Thematic analysis identified eight themes supported by at least one good quality study, regarding participants' positive experiences and related to personal/social identity, physical activity, developing knowledge, spirituality, benefits of place, personal achievement, psychological benefits and social contact. There was one report of negative experiences. There is little quantitative evidence of positive or negative health and well-being benefits from participating in EECA. However, the qualitative research showed high levels of perceived benefit among participants. Quantitative evidence resulted from study designs with high risk of bias, qualitative evidence lacked reporting detail. The majority of included studies were programme evaluations, conducted internally or funded by the provider.The conceptual framework illustrates the range of interlinked mechanisms through which people believe they potentially achieve health and well-being benefits, such as opportunities for social contact. It also considers potential moderators and mediators of effect.One main finding of the review is the inherent difficulty associated with generating robust evidence of effectiveness for complex interventions. We developed the conceptual framework to illustrate how people believed they benefited. Investigating such mechanisms in a subsequent theory-led review might be one way of examining evidence of effect for these activities.The conceptual framework needs further refinement through linked reviews and more reliable evidence. Future research should use more robust study designs and report key intervention and participant detail.

A collimator optimization method for quantitative imaging: application to Y-90 bremsstrahlung SPECT.

PubMed

Rong, Xing; Frey, Eric C

2013-08-01

Post-therapy quantitative 90Y bremsstrahlung single photon emission computed tomography (SPECT) has shown great potential to provide reliable activity estimates, which are essential for dose verification. Typically 90Y imaging is performed with high- or medium-energy collimators. However, the energy spectrum of 90Y bremsstrahlung photons is substantially different than typical for these collimators. In addition, dosimetry requires quantitative images, and collimators are not typically optimized for such tasks. Optimizing a collimator for 90Y imaging is both novel and potentially important. Conventional optimization methods are not appropriate for 90Y bremsstrahlung photons, which have a continuous and broad energy distribution. In this work, the authors developed a parallel-hole collimator optimization method for quantitative tasks that is particularly applicable to radionuclides with complex emission energy spectra. The authors applied the proposed method to develop an optimal collimator for quantitative 90Y bremsstrahlung SPECT in the context of microsphere radioembolization. To account for the effects of the collimator on both the bias and the variance of the activity estimates, the authors used the root mean squared error (RMSE) of the volume of interest activity estimates as the figure of merit (FOM). In the FOM, the bias due to the null space of the image formation process was taken in account. The RMSE was weighted by the inverse mass to reflect the application to dosimetry; for a different application, more relevant weighting could easily be adopted. The authors proposed a parameterization for the collimator that facilitates the incorporation of the important factors (geometric sensitivity, geometric resolution, and septal penetration fraction) determining collimator performance, while keeping the number of free parameters describing the collimator small (i.e., two parameters). To make the optimization results for quantitative 90Y bremsstrahlung SPECT more general, the authors simulated multiple tumors of various sizes in the liver. The authors realistically simulated human anatomy using a digital phantom and the image formation process using a previously validated and computationally efficient method for modeling the image-degrading effects including object scatter, attenuation, and the full collimator-detector response (CDR). The scatter kernels and CDR function tables used in the modeling method were generated using a previously validated Monte Carlo simulation code. The hole length, hole diameter, and septal thickness of the obtained optimal collimator were 84, 3.5, and 1.4 mm, respectively. Compared to a commercial high-energy general-purpose collimator, the optimal collimator improved the resolution and FOM by 27% and 18%, respectively. The proposed collimator optimization method may be useful for improving quantitative SPECT imaging for radionuclides with complex energy spectra. The obtained optimal collimator provided a substantial improvement in quantitative performance for the microsphere radioembolization task considered.

HPLC analysis and standardization of Brahmi vati – An Ayurvedic poly-herbal formulation

PubMed Central

Mishra, Amrita; Mishra, Arun K.; Tiwari, Om Prakash; Jha, Shivesh

2013-01-01

Objectives The aim of the present study was to standardize Brahmi vati (BV) by simultaneous quantitative estimation of Bacoside A3 and Piperine adopting HPLC–UV method. BV very important Ayurvedic polyherbo formulation used to treat epilepsy and mental disorders containing thirty eight ingredients including Bacopa monnieri L. and Piper longum L. Materials and methods An HPLC–UV method was developed for the standardization of BV in light of simultaneous quantitative estimation of Bacoside A3 and Piperine, the major constituents of B. monnieri L. and P. longum L. respectively. The developed method was validated on parameters including linearity, precision, accuracy and robustness. Results The HPLC analysis showed significant increase in amount of Bacoside A3 and Piperine in the in-house sample of BV when compared with all three different marketed samples of the same. Results showed variations in the amount of Bacoside A3 and Piperine in different samples which indicate non-uniformity in their quality which will lead to difference in their therapeutic effects. Conclusion The outcome of the present investigation underlines the importance of standardization of Ayurvedic formulations. The developed method may be further used to standardize other samples of BV or other formulations containing Bacoside A3 and Piperine. PMID:24396246

Quantitative proteomics in the field of microbiology.

PubMed

Otto, Andreas; Becher, Dörte; Schmidt, Frank

2014-03-01

Quantitative proteomics has become an indispensable analytical tool for microbial research. Modern microbial proteomics covers a wide range of topics in basic and applied research from in vitro characterization of single organisms to unravel the physiological implications of stress/starvation to description of the proteome content of a cell at a given time. With the techniques available, ranging from classical gel-based procedures to modern MS-based quantitative techniques, including metabolic and chemical labeling, as well as label-free techniques, quantitative proteomics is today highly successful in sophisticated settings of high complexity such as host-pathogen interactions, mixed microbial communities, and microbial metaproteomics. In this review, we will focus on the vast range of techniques practically applied in current research with an introduction of the workflows used for quantitative comparisons, a description of the advantages/disadvantages of the various methods, reference to hallmark publications and presentation of applications in current microbial research. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Quantitative classification-based occupational health management for electroplating enterprises in Baoan District of Shenzhen, China].

PubMed

Zhang, Sheng; Huang, Jinsheng; Yang, Baigbing; Lin, Binjie; Xu, Xinyun; Chen, Jinru; Zhao, Zhuandi; Tu, Xiaozhi; Bin, Haihua

2014-04-01

To improve the occupational health management levels in electroplating enterprises with quantitative classification measures and to provide a scientific basis for the prevention and control of occupational hazards in electroplating enterprises and the protection of workers' health. A quantitative classification table was created for the occupational health management in electroplating enterprises. The evaluation indicators included 6 items and 27 sub-items, with a total score of 100 points. Forty electroplating enterprises were selected and scored according to the quantitative classification table. These electroplating enterprises were classified into grades A, B, and C based on the scores. Among 40 electroplating enterprises, 11 (27.5%) had scores of >85 points (grade A), 23 (57.5%) had scores of 60∼85 points (grade B), and 6 (15.0%) had scores of <60 points (grade C). Quantitative classification management for electroplating enterprises is a valuable attempt, which is helpful for the supervision and management by the health department and provides an effective method for the self-management of enterprises.

Using Active Learning to Teach Concepts and Methods in Quantitative Biology.

PubMed

Waldrop, Lindsay D; Adolph, Stephen C; Diniz Behn, Cecilia G; Braley, Emily; Drew, Joshua A; Full, Robert J; Gross, Louis J; Jungck, John A; Kohler, Brynja; Prairie, Jennifer C; Shtylla, Blerta; Miller, Laura A

2015-11-01

This article provides a summary of the ideas discussed at the 2015 Annual Meeting of the Society for Integrative and Comparative Biology society-wide symposium on Leading Students and Faculty to Quantitative Biology through Active Learning. It also includes a brief review of the recent advancements in incorporating active learning approaches into quantitative biology classrooms. We begin with an overview of recent literature that shows that active learning can improve students' outcomes in Science, Technology, Engineering and Math Education disciplines. We then discuss how this approach can be particularly useful when teaching topics in quantitative biology. Next, we describe some of the recent initiatives to develop hands-on activities in quantitative biology at both the graduate and the undergraduate levels. Throughout the article we provide resources for educators who wish to integrate active learning and technology into their classrooms. © The Author 2015. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

Enology (Winemaking) Research.

ERIC Educational Resources Information Center

Gadek, Frank J.

1982-01-01

Describes senior research project centered around three facets of wine made from locally grown grapes: methods of deacidification, effect of pectic enzyme use during vinification, and qualitative/quantitative composition of total phenols of wines. Includes student participation (1975-1980) in and outcomes of the program, and laboratory techniques…

What Factors Contribute to Self-Efficacy

ERIC Educational Resources Information Center

Straus, Hildy; Bondie, Rhonda

2015-01-01

This study examined the self-efficacy of paraeducators serving students with moderate to severe disabilities in a specialized public school. Quantitative methods explored the relationship among paraeducator self-efficacy, personal factors (including work experience, age level of teaching assignment, and disability served), and organizational…

Radiometric Dating in Geology.

ERIC Educational Resources Information Center

Pankhurst, R. J.

1980-01-01

Described are several aspects and methods of quantitatively measuring geologic time using a constant-rate natural process of radioactive decay. Topics include half lives and decay constants, radiogenic growth, potassium-argon dating, rubidium-strontium dating, and the role of geochronology in support of geological exploration. (DS)

Selection of Wavelengths for Optimum Precision in Simultaneous Spectrophotometric Determinations.

ERIC Educational Resources Information Center

DiTusa, Michael R.; Schilt, Alfred A.

1985-01-01

Although many textbooks include a description of simultaneous determinations employing absorption spectrophotometry and treat the mathematics necessary for analytical quantitations, treatment of analytical wavelength selection has been mostly qualitative. Therefore, a general method for selecting wavelengths for optimum precision in simultaneous…

Prospects for Public Library Evaluation.

ERIC Educational Resources Information Center

Van House, Nancy A.; Childers, Thomas

1991-01-01

Discusses methods of evaluation that can be used to measure public library effectiveness, based on a conference sponsored by the Council on Library Resources. Topics discussed include the Public Library Effectiveness Study (PLES), quantitative and qualitative evaluation, using evaluative information for resource acquisition and resource…

Preparing systems engineering and computing science students in disciplined methods, quantitative, and advanced statistical techniques to improve process performance

NASA Astrophysics Data System (ADS)

McCray, Wilmon Wil L., Jr.

The research was prompted by a need to conduct a study that assesses process improvement, quality management and analytical techniques taught to students in U.S. colleges and universities undergraduate and graduate systems engineering and the computing science discipline (e.g., software engineering, computer science, and information technology) degree programs during their academic training that can be applied to quantitatively manage processes for performance. Everyone involved in executing repeatable processes in the software and systems development lifecycle processes needs to become familiar with the concepts of quantitative management, statistical thinking, process improvement methods and how they relate to process-performance. Organizations are starting to embrace the de facto Software Engineering Institute (SEI) Capability Maturity Model Integration (CMMI RTM) Models as process improvement frameworks to improve business processes performance. High maturity process areas in the CMMI model imply the use of analytical, statistical, quantitative management techniques, and process performance modeling to identify and eliminate sources of variation, continually improve process-performance; reduce cost and predict future outcomes. The research study identifies and provides a detail discussion of the gap analysis findings of process improvement and quantitative analysis techniques taught in U.S. universities systems engineering and computing science degree programs, gaps that exist in the literature, and a comparison analysis which identifies the gaps that exist between the SEI's "healthy ingredients " of a process performance model and courses taught in U.S. universities degree program. The research also heightens awareness that academicians have conducted little research on applicable statistics and quantitative techniques that can be used to demonstrate high maturity as implied in the CMMI models. The research also includes a Monte Carlo simulation optimization model and dashboard that demonstrates the use of statistical methods, statistical process control, sensitivity analysis, quantitative and optimization techniques to establish a baseline and predict future customer satisfaction index scores (outcomes). The American Customer Satisfaction Index (ACSI) model and industry benchmarks were used as a framework for the simulation model.

Quantitative measurements of electromechanical response with a combined optical beam and interferometric atomic force microscope

DOE Office of Scientific and Technical Information (OSTI.GOV)

Labuda, Aleksander; Proksch, Roger

An ongoing challenge in atomic force microscope (AFM) experiments is the quantitative measurement of cantilever motion. The vast majority of AFMs use the optical beam deflection (OBD) method to infer the deflection of the cantilever. The OBD method is easy to implement, has impressive noise performance, and tends to be mechanically robust. However, it represents an indirect measurement of the cantilever displacement, since it is fundamentally an angular rather than a displacement measurement. Here, we demonstrate a metrological AFM that combines an OBD sensor with a laser Doppler vibrometer (LDV) to enable accurate measurements of the cantilever velocity and displacement.more » The OBD/LDV AFM allows a host of quantitative measurements to be performed, including in-situ measurements of cantilever oscillation modes in piezoresponse force microscopy. As an example application, we demonstrate how this instrument can be used for accurate quantification of piezoelectric sensitivity—a longstanding goal in the electromechanical community.« less

Quantitative Imaging Biomarkers: A Review of Statistical Methods for Computer Algorithm Comparisons

PubMed Central

2014-01-01

Quantitative biomarkers from medical images are becoming important tools for clinical diagnosis, staging, monitoring, treatment planning, and development of new therapies. While there is a rich history of the development of quantitative imaging biomarker (QIB) techniques, little attention has been paid to the validation and comparison of the computer algorithms that implement the QIB measurements. In this paper we provide a framework for QIB algorithm comparisons. We first review and compare various study designs, including designs with the true value (e.g. phantoms, digital reference images, and zero-change studies), designs with a reference standard (e.g. studies testing equivalence with a reference standard), and designs without a reference standard (e.g. agreement studies and studies of algorithm precision). The statistical methods for comparing QIB algorithms are then presented for various study types using both aggregate and disaggregate approaches. We propose a series of steps for establishing the performance of a QIB algorithm, identify limitations in the current statistical literature, and suggest future directions for research. PMID:24919829

Quantitative live-cell imaging of human immunodeficiency virus (HIV-1) assembly.

PubMed

Baumgärtel, Viola; Müller, Barbara; Lamb, Don C

2012-05-01

Advances in fluorescence methodologies make it possible to investigate biological systems in unprecedented detail. Over the last few years, quantitative live-cell imaging has increasingly been used to study the dynamic interactions of viruses with cells and is expected to become even more indispensable in the future. Here, we describe different fluorescence labeling strategies that have been used to label HIV-1 for live cell imaging and the fluorescence based methods used to visualize individual aspects of virus-cell interactions. This review presents an overview of experimental methods and recent experiments that have employed quantitative microscopy in order to elucidate the dynamics of late stages in the HIV-1 replication cycle. This includes cytosolic interactions of the main structural protein, Gag, with itself and the viral RNA genome, the recruitment of Gag and RNA to the plasma membrane, virion assembly at the membrane and the recruitment of cellular proteins involved in HIV-1 release to the nascent budding site.

A Statistical Framework for Protein Quantitation in Bottom-Up MS-Based Proteomics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karpievitch, Yuliya; Stanley, Jeffrey R.; Taverner, Thomas

2009-08-15

Motivation: Quantitative mass spectrometry-based proteomics requires protein-level estimates and associated confidence measures. Challenges include the presence of low quality or incorrectly identified peptides and informative missingness. Furthermore, models are required for rolling peptide-level information up to the protein level. Results: We present a statistical model that carefully accounts for informative missingness in peak intensities and allows unbiased, model-based, protein-level estimation and inference. The model is applicable to both label-based and label-free quantitation experiments. We also provide automated, model-based, algorithms for filtering of proteins and peptides as well as imputation of missing values. Two LC/MS datasets are used to illustrate themore » methods. In simulation studies, our methods are shown to achieve substantially more discoveries than standard alternatives. Availability: The software has been made available in the opensource proteomics platform DAnTE (http://omics.pnl.gov/software/). Contact: adabney@stat.tamu.edu Supplementary information: Supplementary data are available at Bioinformatics online.« less

Pansharpening on the Narrow Vnir and SWIR Spectral Bands of SENTINEL-2

NASA Astrophysics Data System (ADS)

Vaiopoulos, A. D.; Karantzalos, K.

2016-06-01

In this paper results from the evaluation of several state-of-the-art pansharpening techniques are presented for the VNIR and SWIR bands of Sentinel-2. A procedure for the pansharpening is also proposed which aims at respecting the closest spectral similarities between the higher and lower resolution bands. The evaluation included 21 different fusion algorithms and three evaluation frameworks based both on standard quantitative image similarity indexes and qualitative evaluation from remote sensing experts. The overall analysis of the evaluation results indicated that remote sensing experts disagreed with the outcomes and method ranking from the quantitative assessment. The employed image quality similarity indexes and quantitative evaluation framework based on both high and reduced resolution data from the literature didn't manage to highlight/evaluate mainly the spatial information that was injected to the lower resolution images. Regarding the SWIR bands none of the methods managed to deliver significantly better results than a standard bicubic interpolation on the original low resolution bands.

Quantitative Live-Cell Imaging of Human Immunodeficiency Virus (HIV-1) Assembly

PubMed Central

Baumgärtel, Viola; Müller, Barbara; Lamb, Don C.

2012-01-01

Advances in fluorescence methodologies make it possible to investigate biological systems in unprecedented detail. Over the last few years, quantitative live-cell imaging has increasingly been used to study the dynamic interactions of viruses with cells and is expected to become even more indispensable in the future. Here, we describe different fluorescence labeling strategies that have been used to label HIV-1 for live cell imaging and the fluorescence based methods used to visualize individual aspects of virus-cell interactions. This review presents an overview of experimental methods and recent experiments that have employed quantitative microscopy in order to elucidate the dynamics of late stages in the HIV-1 replication cycle. This includes cytosolic interactions of the main structural protein, Gag, with itself and the viral RNA genome, the recruitment of Gag and RNA to the plasma membrane, virion assembly at the membrane and the recruitment of cellular proteins involved in HIV-1 release to the nascent budding site. PMID:22754649

Reviewing effectiveness of ankle assessment techniques for use in robot-assisted therapy.

PubMed

Zhang, Mingming; Davies, T Claire; Zhang, Yanxin; Xie, Shane

2014-01-01

This article provides a comprehensive review of studies that investigated ankle assessment techniques to better understand those that can be used in the real-time monitoring of rehabilitation progress for implementation in conjunction with robot-assisted therapy. Seventy-six publications published between January 1980 and August 2013 were selected based on eight databases. They were divided into two main categories (16 qualitative and 60 quantitative studies): 13 goniometer studies, 18 dynamometer studies, and 29 studies about innovative techniques. A total of 465 subjects participated in the 29 quantitative studies of innovative measurement techniques that may potentially be integrated in a real-time monitoring device, of which 19 studies included less than 10 participants. Results show that qualitative ankle assessment methods are not suitable for real-time monitoring in robot-assisted therapy, though they are reliable for certain patients, while the quantitative methods show great potential. The majority of quantitative techniques are reliable in measuring ankle kinematics and kinetics but are usually available only for use in the sagittal plane. Limited studies determine kinematics and kinetics in all three planes (sagittal, transverse, and frontal) where motions of the ankle joint and the subtalar joint actually occur.

Quantitative Analysis of Tetramethylenedisulfotetramine ("Tetramine") Spiked into Beverages by Liquid Chromatography Tandem Mass Spectrometry with Validation by Gas Chromatography Mass Spectrometry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Owens, J; Hok, S; Alcaraz, A

Tetramethylenedisulfotetramine, commonly known as tetramine, is a highly neurotoxic rodenticide (human oral LD{sub 50} = 0.1 mg/kg) used in hundreds of deliberate food poisoning events in China. Here we describe a method for quantitation of tetramine spiked into beverages, including milk, juice, tea, cola, and water and cleaned up by C8 solid phase extraction and liquid-liquid extraction. Quantitation by high performance liquid chromatography tandem mass spectrometry (LC/MS/MS) was based upon fragmentation of m/z 347 to m/z 268. The method was validated by gas chromatography mass spectrometry (GC/MS) operated in SIM mode for ions m/z 212, 240, and 360. The limitmore » of quantitation was 0.10 {micro}g/mL by LC/MS/MS versus 0.15 {micro}g/mL for GC/MS. Fortifications of the beverages at 2.5 {micro}g/mL and 0.25 {micro}g/mL were recovered ranging from 73-128% by liquid-liquid extraction for GC/MS analysis, 13-96% by SPE and 10-101% by liquid-liquid extraction for LC/MS/MS analysis.« less

Monte Carlo evaluation of accuracy and noise properties of two scatter correction methods for /sup 201/Tl cardiac SPECT

NASA Astrophysics Data System (ADS)

Narita, Y.; Iida, H.; Ebert, S.; Nakamura, T.

1997-12-01

Two independent scatter correction techniques, transmission dependent convolution subtraction (TDCS) and triple-energy window (TEW) method, were evaluated in terms of quantitative accuracy and noise properties using Monte Carlo simulation (EGS4). Emission projections (primary, scatter and scatter plus primary) were simulated for three numerical phantoms for /sup 201/Tl. Data were reconstructed with ordered-subset EM algorithm including noise-less transmission data based attenuation correction. Accuracy of TDCS and TEW scatter corrections were assessed by comparison with simulated true primary data. The uniform cylindrical phantom simulation demonstrated better quantitative accuracy with TDCS than with TEW (-2.0% vs. 16.7%) and better S/N (6.48 vs. 5.05). A uniform ring myocardial phantom simulation demonstrated better homogeneity with TDCS than TEW in the myocardium; i.e., anterior-to-posterior wall count ratios were 0.99 and 0.76 with TDCS and TEW, respectively. For the MCAT phantom, TDCS provided good visual and quantitative agreement with simulated true primary image without noticeably increasing the noise after scatter correction. Overall TDCS proved to be more accurate and less noisy than TEW, facilitating quantitative assessment of physiological functions with SPECT.

Assessment of calcium scoring performance in cardiac computed tomography.

PubMed

Ulzheimer, Stefan; Kalender, Willi A

2003-03-01

Electron beam tomography (EBT) has been used for cardiac diagnosis and the quantitative assessment of coronary calcium since the late 1980s. The introduction of mechanical multi-slice spiral CT (MSCT) scanners with shorter rotation times opened new possibilities of cardiac imaging with conventional CT scanners. The purpose of this work was to qualitatively and quantitatively evaluate the performance for EBT and MSCT for the task of coronary artery calcium imaging as a function of acquisition protocol, heart rate, spiral reconstruction algorithm (where applicable) and calcium scoring method. A cardiac CT semi-anthropomorphic phantom was designed and manufactured for the investigation of all relevant image quality parameters in cardiac CT. This phantom includes various test objects, some of which can be moved within the anthropomorphic phantom in a manner that mimics realistic heart motion. These tools were used to qualitatively and quantitatively demonstrate the accuracy of coronary calcium imaging using typical protocols for an electron beam (Evolution C-150XP, Imatron, South San Francisco, Calif.) and a 0.5-s four-slice spiral CT scanner (Sensation 4, Siemens, Erlangen, Germany). A special focus was put on the method of quantifying coronary calcium, and three scoring systems were evaluated (Agatston, volume, and mass scoring). Good reproducibility in coronary calcium scoring is always the result of a combination of high temporal and spatial resolution; consequently, thin-slice protocols in combination with retrospective gating on MSCT scanners yielded the best results. The Agatston score was found to be the least reproducible scoring method. The hydroxyapatite mass, being better reproducible and comparable on different scanners and being a physical quantitative measure, appears to be the method of choice for future clinical studies. The hydroxyapatite mass is highly correlated to the Agatston score. The introduced phantoms can be used to quantitatively assess the performance characteristics of, for example, different scanners, reconstruction algorithms, and quantification methods in cardiac CT. This is especially important for quantitative tasks, such as the determination of the amount of calcium in the coronary arteries, to achieve high and constant quality in this field.

Burnout in Nurses Working With Youth With Chronic Pain: A Mixed-Methods Analysis.

PubMed

Rodrigues, Nikita P; Cohen, Lindsey L; Swartout, Kevin M; Trotochaud, Karen; Murray, Eileen

2018-05-01

Nursing is a rewarding but also challenging profession. Nurses are at risk for burnout and premature exit from the profession, which is detrimental to them, their patients, and the healthcare system. There are few studies examining the unique correlates of burnout in nurses working with pediatric populations. The current 2-study project used mixed-methods (qualitative and then quantitative) analysis to explore burnout in nurses working in an inpatient unit with youth with chronic pain. Study I participants included all of the 32 nurses who worked in an inpatient pediatric unit, which admits patients with chronic pain. Qualitative analyses of focus groups were used to extract themes. These themes were examined via a quantitative battery completed by 41 nurses from 2 inpatient pediatric units with youth with chronic pain. The themes were burnout, moral distress, negative beliefs about chronic pain, barriers to pain management, fear of losing compassion, coworker support as a coping method, time worked in the unit, professional self-efficacy, and negative views of the hospital environment. Quantitative results supported most of the qualitative findings, and taken together, the findings supported a model of burnout in nurses working with youth with chronic pain. Conclusions We integrated qualitative and quantitative findings to develop a model of nurse burnout. This model provides a framework for evaluating and targeting burnout in nurses working with pediatric patients with chronic pain.

Quantitative evaluation of dual-flip-angle T1 mapping on DCE-MRI kinetic parameter estimation in head and neck

PubMed Central

Chow, Steven Kwok Keung; Yeung, David Ka Wai; Ahuja, Anil T; King, Ann D

2012-01-01

Purpose To quantitatively evaluate the kinetic parameter estimation for head and neck (HN) dynamic contrast-enhanced (DCE) MRI with dual-flip-angle (DFA) T1 mapping. Materials and methods Clinical DCE-MRI datasets of 23 patients with HN tumors were included in this study. T1 maps were generated based on multiple-flip-angle (MFA) method and different DFA combinations. Tofts model parameter maps of kep, Ktrans and vp based on MFA and DFAs were calculated and compared. Fitted parameter by MFA and DFAs were quantitatively evaluated in primary tumor, salivary gland and muscle. Results T1 mapping deviations by DFAs produced remarkable kinetic parameter estimation deviations in head and neck tissues. In particular, the DFA of [2º, 7º] overestimated, while [7º, 12º] and [7º, 15º] underestimated Ktrans and vp, significantly (P<0.01). [2º, 15º] achieved the smallest but still statistically significant overestimation for Ktrans and vp in primary tumors, 32.1% and 16.2% respectively. kep fitting results by DFAs were relatively close to the MFA reference compared to Ktrans and vp. Conclusions T1 deviations induced by DFA could result in significant errors in kinetic parameter estimation, particularly Ktrans and vp, through Tofts model fitting. MFA method should be more reliable and robust for accurate quantitative pharmacokinetic analysis in head and neck. PMID:23289084

Sample normalization methods in quantitative metabolomics.

PubMed

Wu, Yiman; Li, Liang

2016-01-22

To reveal metabolomic changes caused by a biological event in quantitative metabolomics, it is critical to use an analytical tool that can perform accurate and precise quantification to examine the true concentration differences of individual metabolites found in different samples. A number of steps are involved in metabolomic analysis including pre-analytical work (e.g., sample collection and storage), analytical work (e.g., sample analysis) and data analysis (e.g., feature extraction and quantification). Each one of them can influence the quantitative results significantly and thus should be performed with great care. Among them, the total sample amount or concentration of metabolites can be significantly different from one sample to another. Thus, it is critical to reduce or eliminate the effect of total sample amount variation on quantification of individual metabolites. In this review, we describe the importance of sample normalization in the analytical workflow with a focus on mass spectrometry (MS)-based platforms, discuss a number of methods recently reported in the literature and comment on their applicability in real world metabolomics applications. Sample normalization has been sometimes ignored in metabolomics, partially due to the lack of a convenient means of performing sample normalization. We show that several methods are now available and sample normalization should be performed in quantitative metabolomics where the analyzed samples have significant variations in total sample amounts. Copyright © 2015 Elsevier B.V. All rights reserved.

Quantitative elasticity measurement of urinary bladder wall using laser-induced surface acoustic waves.

PubMed

Li, Chunhui; Guan, Guangying; Zhang, Fan; Song, Shaozhen; Wang, Ruikang K; Huang, Zhihong; Nabi, Ghulam

2014-12-01

The maintenance of urinary bladder elasticity is essential to its functions, including the storage and voiding phases of the micturition cycle. The bladder stiffness can be changed by various pathophysiological conditions. Quantitative measurement of bladder elasticity is an essential step toward understanding various urinary bladder disease processes and improving patient care. As a nondestructive, and noncontact method, laser-induced surface acoustic waves (SAWs) can accurately characterize the elastic properties of different layers of organs such as the urinary bladder. This initial investigation evaluates the feasibility of a noncontact, all-optical method of generating and measuring the elasticity of the urinary bladder. Quantitative elasticity measurements of ex vivo porcine urinary bladder were made using the laser-induced SAW technique. A pulsed laser was used to excite SAWs that propagated on the bladder wall surface. A dedicated phase-sensitive optical coherence tomography (PhS-OCT) system remotely recorded the SAWs, from which the elasticity properties of different layers of the bladder were estimated. During the experiments, series of measurements were performed under five precisely controlled bladder volumes using water to estimate changes in the elasticity in relation to various urinary bladder contents. The results, validated by optical coherence elastography, show that the laser-induced SAW technique combined with PhS-OCT can be a feasible method of quantitative estimation of biomechanical properties.

Twenty-four/seven: a mixed-method systematic review of the off-shift literature

PubMed Central

de Cordova, Pamela B.; Phibbs, Ciaran S.; Bartel, Ann P.; Stone, Patricia W.

2012-01-01

Aim This article is a report of a review that aimed to synthesize qualitative and quantitative evidence of ‘off-shifts’ (nights, weekends and/or holidays) on quality and employee outcomes in hospitals. Background Healthcare workers provide 24-hour-a-day, 7-day-a-week service. Quality and employee outcomes may differ on off-shifts as compared to regular hours. Data sources Searches for studies occurred between the years 1985–2011 using computerized databases including Business Source Complete, EconLit, ProQuest, PubMed and MEDLINE. Review design and methods Design was a mixed-method systematic review with quantitative and qualitative studies. To be included, studies met the following criteria: (1) the independent variable was an off-shift; (2) the article was a research study and peer-reviewed; (3) the article could be obtained in English; and (4) the article pertained to health care. Studies were not excluded on design. Results Sixty studies were included. There were 37 quality outcome, 19 employee outcome and four qualitative studies. In the quality outcome studies, researchers often used quantitative, longitudinal study designs with large sample sizes. Researchers found important differences between patients admitted on weekends and mortality. Important differences were also found between nighttime birth and mortality and rotating night work and fatigue, stress and low mental well-being. Most studies (9 of 12) did not find an important association between patients admitted at night and mortality. Conclusion Patient outcomes on weekends and employee outcomes at night are worse than during the day. It is important to further investigate why care on off-shifts differs from weekly day shifts. PMID:22905343

Multi-spectral digital holographic microscopy for enhanced quantitative phase imaging of living cells

NASA Astrophysics Data System (ADS)

Kemper, Björn; Kastl, Lena; Schnekenburger, Jürgen; Ketelhut, Steffi

2018-02-01

Main restrictions of using laser light in digital holographic microscopy (DHM) are coherence induced noise and parasitic reflections in the experimental setup which limit resolution and measurement accuracy. We explored, if coherence properties of partial coherent light sources can be generated synthetically utilizing spectrally tunable lasers. The concept of the method is demonstrated by label-free quantitative phase imaging of living pancreatic tumor cells and utilizing an experimental configuration including a commercial microscope and a laser source with a broad tunable spectral range of more than 200 nm.

Recent Achievements in Characterizing the Histone Code and Approaches to Integrating Epigenomics and Systems Biology.

PubMed

Janssen, K A; Sidoli, S; Garcia, B A

2017-01-01

Functional epigenetic regulation occurs by dynamic modification of chromatin, including genetic material (i.e., DNA methylation), histone proteins, and other nuclear proteins. Due to the highly complex nature of the histone code, mass spectrometry (MS) has become the leading technique in identification of single and combinatorial histone modifications. MS has now overcome antibody-based strategies due to its automation, high resolution, and accurate quantitation. Moreover, multiple approaches to analysis have been developed for global quantitation of posttranslational modifications (PTMs), including large-scale characterization of modification coexistence (middle-down and top-down proteomics), which is not currently possible with any other biochemical strategy. Recently, our group and others have simplified and increased the effectiveness of analyzing histone PTMs by improving multiple MS methods and data analysis tools. This review provides an overview of the major achievements in the analysis of histone PTMs using MS with a focus on the most recent improvements. We speculate that the workflow for histone analysis at its state of the art is highly reliable in terms of identification and quantitation accuracy, and it has the potential to become a routine method for systems biology thanks to the possibility of integrating histone MS results with genomics and proteomics datasets. © 2017 Elsevier Inc. All rights reserved.

Mechanisms and drivers of social inequality in phase II cardiac rehabilitation attendance: A Convergent Mixed Methods study.

PubMed

Pedersen, Maria; Overgaard, Dorthe; Andersen, Ingelise; Baastrup, Marie; Egerod, Ingrid

2018-05-17

To explore the extent to which the qualitative and quantitative data converge and explain mechanisms and drivers of social inequality in cardiac rehabilitation attendance. Social inequality in cardiac rehabilitation attendance has been a recognized problem for many years. However, to date the mechanisms driving these inequalities are still not fully understood. The study was designed as a convergent mixed methods study. From March 2015 - March 2016, patients hospitalized with acute coronary syndrome to two Danish regional hospitals were included in a quantitative prospective observational study (N=302). Qualitative interview informants (N=24) were sampled from the quantitative study population and half brought a close relative (N=12) for dyadic interviews. Interviews were conducted from August 2015 to February 2016. Integrated analyses were conducted in joint displays by merging the quantitative and qualitative findings. Qualitative and quantitative findings primarily confirmed and expanded each other; however, discordant results were also evident. Integrated analyses identified socially differentiated lifestyles, health beliefs, travel barriers and self-efficacy as potential drivers of social inequality in cardiac rehabilitation. Our study adds empirical evidence regarding how a mixed methods study can be used to obtain an understanding of complex healthcare problems. The study provides new knowledge concerning the mechanisms driving social inequality in cardiac rehabilitation attendance. To prevent social inequality, cardiac rehabilitation should be accommodated to patients with a history of unhealthy behaviour and low self-efficacy. Additionally, the rehabilitation programme should be offered in locations not requiring a long commute. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

CT-SPECT fusion plus conjugate views for determining dosimetry in iodine-131-monoclonal antibody therapy of lymphoma patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koral, K.F.; Zasadny, K.R.; Kessler, M.L.

A method of performing {sup 131}I quantitative SPECT imaging is described which uses the superimposition of markers placed on the skin to accomplish fusion of computed tomography (CT) and SPECT image sets. To calculate mean absorbed dose after administration of one of two {sup 131}I-labeled monoclonal antibodies (Mabs), the shape of the time-activity curve is measured by daily diagnostic conjugate views, the y-axis of that curve is normalized by a quantitative SPECT measurement (usually intra-therapy), and the tumor mass is deduced from a concurrent CT volume measurement. The method is applied to six B-cell non-Hodgkin`s lymphoma patients. For four tumorsmore » in three patients treated with the MB1 Mab, a correlation appears to be present between resulting mean absorbed dose and disease response. Including all dosimetric estimates for both antibodies, the range for the specific absorbed dose is within that found by others in treating B-cell lymphoma patients. Excluding a retreated anti-B1 patient, the tumor-specific absorbed dose during anti-B1 therapy is from 1.4 to 1.7 mGy/MBq. For the one anti-B1 patient, where quantitative SPECT and conjugate-view imaging was carried out back to back , the quantitative SPECT-measured activity was somewhat less for the spleen and much less for the tumor than that from conjugate views. The quantitative SPECT plus conjugate views method may be of general utility for macro-dosimetry of {sup 131}If therapies. 18 refs., 3 figs., 5 tabs.« less

Compilation of a near-infrared library for the construction of quantitative models of amoxicillin and potassium clavulanate oral dosage forms

NASA Astrophysics Data System (ADS)

Zou, Wen-bo; Chong, Xiao-meng; Wang, Yan; Hu, Chang-qin

2018-05-01

The accuracy of NIR quantitative models depends on calibration samples with concentration variability. Conventional sample collecting methods have some shortcomings especially the time-consuming which remains a bottleneck in the application of NIR models for Process Analytical Technology (PAT) control. A study was performed to solve the problem of sample selection collection for construction of NIR quantitative models. Amoxicillin and potassium clavulanate oral dosage forms were used as examples. The aim was to find a normal approach to rapidly construct NIR quantitative models using an NIR spectral library based on the idea of a universal model [2021]. The NIR spectral library of amoxicillin and potassium clavulanate oral dosage forms was defined and consisted of spectra of 377 batches of samples produced by 26 domestic pharmaceutical companies, including tablets, dispersible tablets, chewable tablets, oral suspensions, and granules. The correlation coefficient (rT) was used to indicate the similarities of the spectra. The samples’ calibration sets were selected from a spectral library according to the median rT of the samples to be analyzed. The rT of the samples selected was close to the median rT. The difference in rT of those samples was 1.0% to 1.5%. We concluded that sample selection is not a problem when constructing NIR quantitative models using a spectral library versus conventional methods of determining universal models. The sample spectra with a suitable concentration range in the NIR models were collected quickly. In addition, the models constructed through this method were more easily targeted.

Development of an integrated laboratory system for the monitoring of cyanotoxins in surface and drinking waters.

PubMed

Triantis, Theodoros; Tsimeli, Katerina; Kaloudis, Triantafyllos; Thanassoulias, Nicholas; Lytras, Efthymios; Hiskia, Anastasia

2010-05-01

A system of analytical processes has been developed in order to serve as a cost-effective scheme for the monitoring of cyanobacterial toxins on a quantitative basis, in surface and drinking waters. Five cyclic peptide hepatotoxins, microcystin-LR, -RR, -YR, -LA and nodularin were chosen as the target compounds. Two different enzyme-linked immunosorbent assays (ELISA) were validated in order to serve as primary quantitative screening tools. Validation results showed that the ELISA methods are sufficiently specific and sensitive with limits of detection (LODs) around 0.1 microg/L, however, matrix effects should be considered, especially with surface water samples or bacterial mass methanolic extracts. A colorimetric protein phosphatase inhibition assay (PPIA) utilizing protein phosphatase 2A and p-nitrophenyl phosphate as substrate, was applied in microplate format in order to serve as a quantitative screening method for the detection of the toxic activity associated with cyclic peptide hepatotoxins, at concentration levels >0.2 microg/L of MC-LR equivalents. A fast HPLC/PDA method has been developed for the determination of microcystins, by using a short, 50mm C18 column, with 1.8 microm particle size. Using this method a 10-fold reduction of sample run time was achieved and sufficient separation of microcystins was accomplished in less than 3 min. Finally, the analytical system includes an LC/MS/MS method that was developed for the determination of the 5 target compounds after SPE extraction. The method achieves extremely low limits of detection (<0.02 microg/L), in both surface and drinking waters and it is used for identification and verification purposes as well as for determinations at the ppt level. An analytical protocol that includes the above methods has been designed and validated through the analysis of a number of real samples. Copyright 2009 Elsevier Ltd. All rights reserved.

Chemical Fingerprint and Quantitative Analysis for the Quality Evaluation of Docynia dcne Leaves by High-Performance Liquid Chromatography Coupled with Chemometrics Analysis.

PubMed

Zhang, Xiaoyu; Mei, Xueran; Wang, Zhanguo; Wu, Jing; Liu, Gang; Hu, Huiling; Li, Qijuan

2018-05-24

Docynia dcne leaf from the genus of Docynia Dcne (including three species of Docynia delavayi, Docynia indica and Docynia longiunguis.) is an important raw material of local ethnic minority tea, ethnomedicines and food supplements in southwestern areas of China. However, D. dcne leaves from these three species are usually used confusingly, which could influence the therapeutic effect of it. A rapid and effective method for the chemical fingerprint and quantitative analysis to evaluate the quality of D. dcne leaves was established. The chemometric methods, including similarity analysis, hierarchical cluster analysis and partial least-squares discrimination analysis, were applied to distinguish 30 batches of D. dcne leaf samples from these three species. The above results could validate each other and successfully group these samples into three categories which were closely related to the species of D. dcne leaves. Moreover, isoquercitrin and phlorizin were screened as the chemical markers to evaluate the quality of D. dcne leaves from different species. And the contents of isoquercitrin and phlorizin varied remarkably in these samples, with ranges of 6.41-38.84 and 95.73-217.76 mg/g, respectively. All the results indicated that an integration method of chemical fingerprint couple with chemometrics analysis and quantitative assessment was a powerful and beneficial tool for quality control of D. dcne leaves, and could be applied also for differentiation and quality control of other herbal preparations.

Contributors to Frequent Telehealth Alerts Including False Alerts for Patients with Heart Failure: A Mixed Methods Exploration

PubMed Central

Radhakrishna, K.; Bowles, K.; Zettek-Sumner, A.

2013-01-01

Summary Background Telehealth data overload through high alert generation is a significant barrier to sustained adoption of telehealth for managing HF patients. Objective To explore the factors contributing to frequent telehealth alerts including false alerts for Medicare heart failure (HF) patients admitted to a home health agency. Materials and Methods A mixed methods design that combined quantitative correlation analysis of patient characteristic data with number of telehealth alerts and qualitative analysis of telehealth and visiting nurses’ notes on follow-up actions to patients’ telehealth alerts was employed. All the quantitative and qualitative data was collected through retrospective review of electronic records of the home heath agency. Results Subjects in the study had a mean age of 83 (SD = 7.6); 56% were female. Patient co-morbidities (p<0.05) of renal disorders, anxiety, and cardiac arrhythmias emerged as predictors of telehealth alerts through quantitative analysis (n = 168) using multiple regression. Inappropriate telehealth measurement technique by patients (54%) and home healthcare system inefficiencies (37%) contributed to most telehealth false alerts in the purposive qualitative sub-sample (n = 35) of patients with high telehealth alerts. Conclusion Encouraging patient engagement with the telehealth process, fostering a collaborative approach among all the clinicians involved with the telehealth intervention, tailoring telehealth alert thresholds to patient characteristics along with establishing patient-centered telehealth outcome goals may allow meaningful generation of telehealth alerts. Reducing avoidable telehealth alerts could vastly improve the efficiency and sustainability of telehealth programs for HF management. PMID:24454576

Advances in quantitative UV-visible spectroscopy for clinical and pre-clinical application in cancer.

PubMed

Brown, J Quincy; Vishwanath, Karthik; Palmer, Gregory M; Ramanujam, Nirmala

2009-02-01

Methods of optical spectroscopy that provide quantitative, physically or physiologically meaningful measures of tissue properties are an attractive tool for the study, diagnosis, prognosis, and treatment of various cancers. Recent development of methodologies to convert measured reflectance and fluorescence spectra from tissue to cancer-relevant parameters such as vascular volume, oxygenation, extracellular matrix extent, metabolic redox states, and cellular proliferation have significantly advanced the field of tissue optical spectroscopy. The number of publications reporting quantitative tissue spectroscopy results in the UV-visible wavelength range has increased sharply in the past three years, and includes new and emerging studies that correlate optically measured parameters with independent measures such as immunohistochemistry, which should aid in increased clinical acceptance of these technologies.

Low angle light scattering analysis: a novel quantitative method for functional characterization of human and murine platelet receptors.

PubMed

Mindukshev, Igor; Gambaryan, Stepan; Kehrer, Linda; Schuetz, Claudia; Kobsar, Anna; Rukoyatkina, Natalia; Nikolaev, Viacheslav O; Krivchenko, Alexander; Watson, Steve P; Walter, Ulrich; Geiger, Joerg

2012-07-01

Determinations of platelet receptor functions are indispensable diagnostic indicators of cardiovascular and hemostatic diseases including hereditary and acquired receptor defects and receptor responses to drugs. However, presently available techniques for assessing platelet function have some disadvantages, such as low sensitivity and the requirement of large sample sizes and unphysiologically high agonist concentrations. Our goal was to develop and initially characterize a new technique designed to quantitatively analyze platelet receptor activation and platelet function on the basis of measuring changes in low angle light scattering. We developed a novel technique based on low angle light scattering registering changes in light scattering at a range of different angles in platelet suspensions during activation. The method proved to be highly sensitive for simultaneous real time detection of changes in size and shape of platelets during activation. Unlike commonly-used methods, the light scattering method could detect platelet shape change and aggregation in response to nanomolar concentrations of extracellular nucleotides. Furthermore, our results demonstrate that the advantages of the light scattering method make it a choice method for platelet receptor monitoring and for investigation of both murine and human platelets in disease models. Our data demonstrate the suitability and superiority of this new low angle light scattering method for comprehensive analyses of platelet receptors and functions. This highly sensitive, quantitative, and online detection of essential physiological, pathophysiological and pharmacological-response properties of human and mouse platelets is a significant improvement over conventional techniques.

Quantitative Modeling of Earth Surface Processes

NASA Astrophysics Data System (ADS)

Pelletier, Jon D.

This textbook describes some of the most effective and straightforward quantitative techniques for modeling Earth surface processes. By emphasizing a core set of equations and solution techniques, the book presents state-of-the-art models currently employed in Earth surface process research, as well as a set of simple but practical research tools. Detailed case studies demonstrate application of the methods to a wide variety of processes including hillslope, fluvial, aeolian, glacial, tectonic, and climatic systems. Exercises at the end of each chapter begin with simple calculations and then progress to more sophisticated problems that require computer programming. All the necessary computer codes are available online at www.cambridge.org/9780521855976. Assuming some knowledge of calculus and basic programming experience, this quantitative textbook is designed for advanced geomorphology courses and as a reference book for professional researchers in Earth and planetary science looking for a quantitative approach to Earth surface processes.

Value Tendency Differences between Pre-Service Social Studies Teachers within the Scope of the East and the West

ERIC Educational Resources Information Center

Osmanoglu, Ahmed Emin

2017-01-01

This study aims to comparatively examine the values that the students of the Department of Social Studies in Education Faculty at two universities located in the Eastern and Western parts of Turkey desire to find in people they interact with. Multiple methods, including quantitative and qualitative methods, were used in this study. The research…

Measurement of Walking Ground Reactions in Real-Life Environments: A Systematic Review of Techniques and Technologies.

PubMed

Shahabpoor, Erfan; Pavic, Aleksandar

2017-09-12

Monitoring natural human gait in real-life environments is essential in many applications, including quantification of disease progression, monitoring the effects of treatment, and monitoring alteration of performance biomarkers in professional sports. Nevertheless, developing reliable and practical techniques and technologies necessary for continuous real-life monitoring of gait is still an open challenge. A systematic review of English-language articles from scientific databases including Scopus, ScienceDirect, Pubmed, IEEE Xplore, EBSCO and MEDLINE were carried out to analyse the 'accuracy' and 'practicality' of the current techniques and technologies for quantitative measurement of the tri-axial walking ground reactions outside the laboratory environment, and to highlight their strengths and shortcomings. In total, 679 relevant abstracts were identified, 54 full-text papers were included in the paper and the quantitative results of 17 papers were used for meta-analysis and comparison. Three classes of methods were reviewed: (1) methods based on measured kinematic data; (2) methods based on measured plantar pressure; and (3) methods based on direct measurement of ground reactions. It was found that all three classes of methods have competitive accuracy levels with methods based on direct measurement of the ground reactions showing highest accuracy while being least practical for long-term real-life measurement. On the other hand, methods that estimate ground reactions using measured body kinematics show highest practicality of the three classes of methods reviewed. Among the most prominent technical and technological challenges are: (1) reducing the size and price of tri-axial load-cells; (2) improving the accuracy of orientation measurement using IMUs; (3) minimizing the number and optimizing the location of required IMUs for kinematic measurement; (4) increasing the durability of pressure insole sensors, and (5) enhancing the robustness and versatility of the ground reactions estimation methods to include pathological gaits and natural variability of gait in real-life physical environment.

Measurement of Walking Ground Reactions in Real-Life Environments: A Systematic Review of Techniques and Technologies

PubMed Central

Shahabpoor, Erfan; Pavic, Aleksandar

2017-01-01

Monitoring natural human gait in real-life environments is essential in many applications, including quantification of disease progression, monitoring the effects of treatment, and monitoring alteration of performance biomarkers in professional sports. Nevertheless, developing reliable and practical techniques and technologies necessary for continuous real-life monitoring of gait is still an open challenge. A systematic review of English-language articles from scientific databases including Scopus, ScienceDirect, Pubmed, IEEE Xplore, EBSCO and MEDLINE were carried out to analyse the ‘accuracy’ and ‘practicality’ of the current techniques and technologies for quantitative measurement of the tri-axial walking ground reactions outside the laboratory environment, and to highlight their strengths and shortcomings. In total, 679 relevant abstracts were identified, 54 full-text papers were included in the paper and the quantitative results of 17 papers were used for meta-analysis and comparison. Three classes of methods were reviewed: (1) methods based on measured kinematic data; (2) methods based on measured plantar pressure; and (3) methods based on direct measurement of ground reactions. It was found that all three classes of methods have competitive accuracy levels with methods based on direct measurement of the ground reactions showing highest accuracy while being least practical for long-term real-life measurement. On the other hand, methods that estimate ground reactions using measured body kinematics show highest practicality of the three classes of methods reviewed. Among the most prominent technical and technological challenges are: (1) reducing the size and price of tri-axial load-cells; (2) improving the accuracy of orientation measurement using IMUs; (3) minimizing the number and optimizing the location of required IMUs for kinematic measurement; (4) increasing the durability of pressure insole sensors, and (5) enhancing the robustness and versatility of the ground reactions estimation methods to include pathological gaits and natural variability of gait in real-life physical environment. PMID:28895909

Multiple and mixed methods in formative evaluation: Is more better? Reflections from a South African study.

PubMed

Odendaal, Willem; Atkins, Salla; Lewin, Simon

2016-12-15

Formative programme evaluations assess intervention implementation processes, and are seen widely as a way of unlocking the 'black box' of any programme in order to explore and understand why a programme functions as it does. However, few critical assessments of the methods used in such evaluations are available, and there are especially few that reflect on how well the evaluation achieved its objectives. This paper describes a formative evaluation of a community-based lay health worker programme for TB and HIV/AIDS clients across three low-income communities in South Africa. It assesses each of the methods used in relation to the evaluation objectives, and offers suggestions on ways of optimising the use of multiple, mixed-methods within formative evaluations of complex health system interventions. The evaluation's qualitative methods comprised interviews, focus groups, observations and diary keeping. Quantitative methods included a time-and-motion study of the lay health workers' scope of practice and a client survey. The authors conceptualised and conducted the evaluation, and through iterative discussions, assessed the methods used and their results. Overall, the evaluation highlighted programme issues and insights beyond the reach of traditional single methods evaluations. The strengths of the multiple, mixed-methods in this evaluation included a detailed description and nuanced understanding of the programme and its implementation, and triangulation of the perspectives and experiences of clients, lay health workers, and programme managers. However, the use of multiple methods needs to be carefully planned and implemented as this approach can overstretch the logistic and analytic resources of an evaluation. For complex interventions, formative evaluation designs including multiple qualitative and quantitative methods hold distinct advantages over single method evaluations. However, their value is not in the number of methods used, but in how each method matches the evaluation questions and the scientific integrity with which the methods are selected and implemented.

Relationship between Plaque Echo, Thickness and Neovascularization Assessed by Quantitative and Semi-quantitative Contrast-Enhanced Ultrasonography in Different Stenosis Groups.

PubMed

Song, Yan; Feng, Jun; Dang, Ying; Zhao, Chao; Zheng, Jie; Ruan, Litao

2017-12-01

The aim of this study was to determine the relationship between plaque echo, thickness and neovascularization in different stenosis groups using quantitative and semi-quantitative contrast-enhanced ultrasound (CEUS) in patients with carotid atherosclerosis plaque. A total of 224 plaques were divided into mild stenosis (<50%; 135 plaques, 60.27%), moderate stenosis (50%-69%; 39 plaques, 17.41%) and severe stenosis (70%-99%; 50 plaques, 22.32%) groups. Quantitative and semi-quantitative methods were used to assess plaque neovascularization and determine the relationship between plaque echo, thickness and neovascularization. Correlation analysis revealed no relationship of neovascularization with plaque echo in the groups using either quantitative or semi-quantitative methods. Furthermore, there was no correlation of neovascularization with plaque thickness using the semi-quantitative method. The ratio of areas under the curve (RAUC) was negatively correlated with plaque thickness (r = -0.317, p = 0.001) in the mild stenosis group. With the quartile method, plaque thickness of the mild stenosis group was divided into four groups, with significant differences between the 1.5-2.2 mm and ≥3.5 mm groups (p = 0.002), 2.3-2.8 mm and ≥3.5 mm groups (p <0.001) and 2.9-3.4 mm and ≥3.5 mm groups (p <0.001). Both semi-quantitative and quantitative CEUS methods characterizing neovascularization of plaque are equivalent with respect to assessing relationships between neovascularization, echogenicity and thickness. However, the quantitative method could fail for plaque <3.5 mm because of motion artifacts. Copyright © 2017 World Federation for Ultrasound in Medicine and Biology. Published by Elsevier Inc. All rights reserved.

The effectiveness of knowledge translation interventions for promoting evidence-informed decision-making among nurses in tertiary care: a systematic review and meta-analysis.

PubMed

Yost, Jennifer; Ganann, Rebecca; Thompson, David; Aloweni, Fazila; Newman, Kristine; Hazzan, Afeez; McKibbon, Ann; Dobbins, Maureen; Ciliska, Donna

2015-07-14

Nurses are increasingly expected to engage in evidence-informed decision-making (EIDM) to improve client and system outcomes. Despite an improved awareness about EIDM, there is a lack of use of research evidence and understanding about the effectiveness of interventions to promote EIDM. This project aimed to discover if knowledge translation (KT) interventions directed to nurses in tertiary care are effective for improving EIDM knowledge, skills, behaviours, and, as a result, client outcomes. It also sought to understand contextual factors that affect the impact of such interventions. A systematic review funded by the Canadian Institutes of Health Research (PROSPERO registration: CRD42013003319) was conducted. Included studies examined the implementation of any KT intervention involving nurses in tertiary care to promote EIDM knowledge, skills, behaviours, and client outcomes or studies that examined contextual factors. Study designs included systematic reviews, quantitative, qualitative, and mixed method studies. The search included electronic databases and manual searching of published and unpublished literature to November 2012; key databases included MEDLINE, Cumulative Index to Nursing and Allied Health Literature (CINAHL), and Excerpta Medica (EMBASE). Two reviewers independently performed study selection, risk of bias assessment, and data extraction. Studies with quantitative data determined to be clinically homogeneous were synthesized using meta-analytic methods. Studies with quantitative data not appropriate for meta-analysis were synthesized narratively by outcome. Studies with qualitative data were synthesized by theme. Of the 44,648 citations screened, 30 citations met the inclusion criteria (18 quantitative, 10 qualitative, and 2 mixed methods studies). The quality of studies with quantitative data ranged from very low to high, and quality criteria was generally met for studies with qualitative data. No studies evaluated the impact on knowledge and skills; they primarily investigated the effectiveness of multifaceted KT strategies for promoting EIDM behaviours and improving client outcomes. Almost all studies included an educational component. A meta-analysis of two studies determined that a multifaceted intervention (educational meetings and use of a mentor) did not increase engagement in a range of EIDM behaviours [mean difference 2.7, 95 % CI (-1.7 to 7.1), I (2) = 0 %]. Among the remaining studies, no definitive conclusions could be made about the relative effectiveness of the KT interventions due to variation of interventions and outcomes, as well as study limitations. Findings from studies with qualitative data identified the organizational, individual, and interpersonal factors, as well as characteristics of the innovation, that influence the success of implementation. KT interventions are being implemented and evaluated on nurses' behaviour and client outcomes. This systematic review may inform the selection of KT interventions and outcomes among nurses in tertiary care and decisions about further research.

Structural issues affecting mixed methods studies in health research: a qualitative study.

PubMed

O'Cathain, Alicia; Nicholl, Jon; Murphy, Elizabeth

2009-12-09

Health researchers undertake studies which combine qualitative and quantitative methods. Little attention has been paid to the structural issues affecting this mixed methods approach. We explored the facilitators and barriers to undertaking mixed methods studies in health research. Face-to-face semi-structured interviews with 20 researchers experienced in mixed methods research in health in the United Kingdom. Structural facilitators for undertaking mixed methods studies included a perception that funding bodies promoted this approach, and the multidisciplinary constituency of some university departments. Structural barriers to exploiting the potential of these studies included a lack of education and training in mixed methods research, and a lack of templates for reporting mixed methods articles in peer-reviewed journals. The 'hierarchy of evidence' relating to effectiveness studies in health care research, with the randomised controlled trial as the gold standard, appeared to pervade the health research infrastructure. Thus integration of data and findings from qualitative and quantitative components of mixed methods studies, and dissemination of integrated outputs, tended to occur through serendipity and effort, further highlighting the presence of structural constraints. Researchers are agents who may also support current structures - journal reviewers and editors, and directors of postgraduate training courses - and thus have the ability to improve the structural support for exploiting the potential of mixed methods research. The environment for health research in the UK appears to be conducive to mixed methods research but not to exploiting the potential of this approach. Structural change, as well as change in researcher behaviour, will be necessary if researchers are to fully exploit the potential of using mixed methods research.

Communication: Quantitative Fourier-transform infrared data for competitive loading of small cages during all-vapor instantaneous formation of gas-hydrate aerosols

NASA Astrophysics Data System (ADS)

Uras-Aytemiz, Nevin; Abrrey Monreal, I.; Devlin, J. Paul

2011-10-01

A simple method has been developed for the measurement of high quality FTIR spectra of aerosols of gas-hydrate nanoparticles. The application of this method enables quantitative observation of gas hydrates that form on subsecond timescales using our all-vapor approach that includes an ether catalyst rather than high pressures to promote hydrate formation. The sampling method is versatile allowing routine studies at temperatures ranging from 120 to 210 K of either a single gas or the competitive uptake of different gas molecules in small cages of the hydrates. The present study emphasizes hydrate aerosols formed by pulsing vapor mixtures into a cold chamber held at 160 or 180 K. We emphasize aerosol spectra from 6 scans recorded an average of 8 s after "instantaneous" hydrate formation as well as of the gas hydrates as they evolve with time. Quantitative aerosol data are reported and analyzed for single small-cage guests and for mixed hydrates of CO2, CH4, C2H2, N2O, N2, and air. The approach, combined with the instant formation of gas hydrates from vapors only, offers promise with respect to optimization of methods for the formation and control of gas hydrates.

[Analysis of aromatic hydrocarbons in cracking products of jet fuel by comprehensive two-dimensional gas chromatography-mass spectrometry].

PubMed

Li, Haijing; Zhang, Xiangwen

2017-08-08

As coking precursors, aromatic hydrocarbons have an effect on the cracking stability of fuels. A method for identifying and quantitating aromatics in the supercritical cracking products of jet fuel was established by comprehensive two-dimensional gas chromatography coupled with mass spectrometry (GC×GC-MS). The effects of main chromatographic conditions such as initial oven temperature and modulation period on the separation of supercritical cracking products were studied. The method has good separation ability for polycyclic aromatic hydrocarbons (PAH) isomers. A total of 27 aromatics, including monocyclic aromatic hydrocarbons, bicyclic aromatic hydrocarbons, tricyclic aromatic hydrocarbons, tetracyclic aromatic hydrocarbons, etc., were identified based on standard mass spectra, the retention times of standards and literature reports. Moreover, the corresponding quantitative determination was achieved by external standard method of GC×GC-FID. The results showed that the contents of aromatics increased with the increase of gas yield. When gas yield reached 22%, the bicyclic aromatic hydrocarbons began to produce, and their contents increased exponentially with the increase of gas yield. Compared with the traditional GC-MS, the method has better separation and qualitative ability, and can be applied to the separation of complex samples and qualitative and quantitative analyses of cracking products.

QUANTITATIVE PESTICIDE EXPOSURE ASSESSMENT OF CHILDREN LIVING IN AN AGRICULTURAL COMMUNITY

EPA Science Inventory

In support of planning efforts for the National Children's Study, we conducted a pilot study to test field methods characterizing pesticide exposures to 20 farmworker children aged 6-24 months living in the Salinas Valley, Monterey County, California. Sample collection included d...

Identifying Gifted Students: A Practical Guide

ERIC Educational Resources Information Center

Johnsen, S., Ed.

2004-01-01

This user-friendly guide offers advice and insight on developing defensible identification procedures and services for gifted and talented students. Special attention is given to the use of multiple methods including qualitative and quantitative assessments such as standardized measures (e.g. intelligence, aptitude, and achievement tests),…

77 FR 36489 - Agency Information Collection Activities: Submission for OMB Review; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-19

... collection methods, including interviews and research, to inform the design, development, and implementation.... For example, information collected from consumers will help the CFPB to design model forms... used for quantitative information collections that are designed to yield statistically significant...

Diurnal Motion of the Sun as Seen From Mercury

ERIC Educational Resources Information Center

Turner, Lawrence E., Jr.

1978-01-01

Two methods are described for the quantitative description of the motion of the sun as observed from Mercury. A listing of a computer subroutine is included. The combination of slow rotation and high eccentricity of Mercury's orbit makes this problem an interesting one. (BB)

Challenges and Tensions in Implementing Current Directions for Indigenous Education.

ERIC Educational Resources Information Center

Tripcony, Penny

In 2001-02, the Queensland Indigenous Education Consultative Body conducted seven research projects examining Indigenous educational policies and strategies. Qualitative and quantitative methods included literature reviews; academic data collection; and interviews and focus groups with Indigenous and non-Indigenous educators, parents, community…

Survey: Tribal Colleges Deeply Involved in Research.

ERIC Educational Resources Information Center

Ambler, Marjane; Crazy Bull, Cheryl

1997-01-01

Describes results of survey distributed to the American Indian Higher Education Consortium's 31 colleges. Findings from the 11 who responded indicate that both faculty and students conduct educational, scientific, and cultural (including local tribal communities) research, using a range of qualitative and quantitative methods. (YKH)

Approaches to acceptable risk

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whipple, C

Several alternative approaches to address the question {open_quotes}How safe is safe enough?{close_quotes} are reviewed and an attempt is made to apply the reasoning behind these approaches to the issue of acceptability of radiation exposures received in space. The approaches to the issue of the acceptability of technological risk described here are primarily analytical, and are drawn from examples in the management of environmental health risks. These include risk-based approaches, in which specific quantitative risk targets determine the acceptability of an activity, and cost-benefit and decision analysis, which generally focus on the estimation and evaluation of risks, benefits and costs, inmore » a framework that balances these factors against each other. These analytical methods tend by their quantitative nature to emphasize the magnitude of risks, costs and alternatives, and to downplay other factors, especially those that are not easily expressed in quantitative terms, that affect acceptance or rejection of risk. Such other factors include the issues of risk perceptions and how and by whom risk decisions are made.« less

Quantitative Characterization of Tissue Microstructure with Temporal Diffusion Spectroscopy

PubMed Central

Xu, Junzhong; Does, Mark D.; Gore, John C.

2009-01-01

The signals recorded by diffusion-weighted magnetic resonance imaging (DWI) are dependent on the micro-structural properties of biological tissues, so it is possible to obtain quantitative structural information non-invasively from such measurements. Oscillating gradient spin echo (OGSE) methods have the ability to probe the behavior of water diffusion over different time scales and the potential to detect variations in intracellular structure. To assist in the interpretation of OGSE data, analytical expressions have been derived for diffusion-weighted signals with OGSE methods for restricted diffusion in some typical structures, including parallel planes, cylinders and spheres, using the theory of temporal diffusion spectroscopy. These analytical predictions have been confirmed with computer simulations. These expressions suggest how OGSE signals from biological tissues should be analyzed to characterize tissue microstructure, including how to estimate cell nuclear sizes. This approach provides a model to interpret diffusion data obtained from OGSE measurements that can be used for applications such as monitoring tumor response to treatment in vivo. PMID:19616979

Live-cell confocal microscopy and quantitative 4D image analysis of anchor cell invasion through the basement membrane in C. elegans

PubMed Central

Kelley, Laura C.; Wang, Zheng; Hagedorn, Elliott J.; Wang, Lin; Shen, Wanqing; Lei, Shijun; Johnson, Sam A.; Sherwood, David R.

2018-01-01

Cell invasion through basement membrane (BM) barriers is crucial during development, leukocyte trafficking, and for the spread of cancer. Despite its importance in normal and diseased states, the mechanisms that direct invasion are poorly understood, in large part because of the inability to visualize dynamic cell-basement membrane interactions in vivo. This protocol describes multi-channel time-lapse confocal imaging of anchor cell invasion in live C. elegans. Methods presented include outline slide preparation and worm growth synchronization (15 min), mounting (20 min), image acquisition (20-180 min), image processing (20 min), and quantitative analysis (variable timing). Images acquired enable direct measurement of invasive dynamics including invadopodia formation, cell membrane protrusions, and BM removal. This protocol can be combined with genetic analysis, molecular activity probes, and optogenetic approaches to uncover molecular mechanisms underlying cell invasion. These methods can also be readily adapted for real-time analysis of cell migration, basement membrane turnover, and cell membrane dynamics by any worm laboratory. PMID:28880279

How qualitative research can contribute to research in the intensive care unit.

PubMed

Sinuff, Tasnim; Cook, Deborah J; Giacomini, Mita

2007-06-01

A qualitative research design can provide unique contributions to research in the intensive care unit. Qualitative research includes the entire process of research: the methodology (conceptualization of the research question, choosing the appropriate qualitative strategy, designing the protocol), methods (conducting the research using qualitative methods within the chosen qualitative strategy, analysis of the data, verification of the findings), and writing the narrative. The researcher is the instrument and the data are the participants' words and experiences that are collected and coded to present experiences, discover themes, or build theories. A number of strategies are available to conduct qualitative research and include grounded theory, phenomenology, case study, and ethnography. Qualitative methods can be used to understand complex phenomena that do not lend themselves to quantitative methods of formal hypothesis testing. Qualitative research may be used to gain insights about organizational and cultural issues within the intensive care unit and to improve our understanding of social interaction and processes of health care delivery. In this article, we outline the rationale for, and approaches to, using qualitative research to inform critical care issues. We provide an overview of qualitative methods available and how they can be used alone or in concert with quantitative methods. To illustrate how our understanding of social phenomena such as patient safety and behavior change has been enhanced we use recent qualitative studies in acute care medicine.

78 FR 70059 - Agency Information Collection Activities: Proposed Collection; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2013-11-22

... (as opposed to quantitative statistical methods). In consultation with research experts, we have... qualitative interviews (as opposed to quantitative statistical methods). In consultation with research experts... utilization of qualitative interviews (as opposed to quantitative statistical methods). In consultation with...

Use of local noise power spectrum and wavelet analysis in quantitative image quality assurance for EPIDs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Soyoung

Purpose: To investigate the use of local noise power spectrum (NPS) to characterize image noise and wavelet analysis to isolate defective pixels and inter-subpanel flat-fielding artifacts for quantitative quality assurance (QA) of electronic portal imaging devices (EPIDs). Methods: A total of 93 image sets including custom-made bar-pattern images and open exposure images were collected from four iViewGT a-Si EPID systems over three years. Global quantitative metrics such as modulation transform function (MTF), NPS, and detective quantum efficiency (DQE) were computed for each image set. Local NPS was also calculated for individual subpanels by sampling region of interests within each subpanelmore » of the EPID. The 1D NPS, obtained by radially averaging the 2D NPS, was fitted to a power-law function. The r-square value of the linear regression analysis was used as a singular metric to characterize the noise properties of individual subpanels of the EPID. The sensitivity of the local NPS was first compared with the global quantitative metrics using historical image sets. It was then compared with two commonly used commercial QA systems with images collected after applying two different EPID calibration methods (single-level gain and multilevel gain). To detect isolated defective pixels and inter-subpanel flat-fielding artifacts, Haar wavelet transform was applied on the images. Results: Global quantitative metrics including MTF, NPS, and DQE showed little change over the period of data collection. On the contrary, a strong correlation between the local NPS (r-square values) and the variation of the EPID noise condition was observed. The local NPS analysis indicated image quality improvement with the r-square values increased from 0.80 ± 0.03 (before calibration) to 0.85 ± 0.03 (after single-level gain calibration) and to 0.96 ± 0.03 (after multilevel gain calibration), while the commercial QA systems failed to distinguish the image quality improvement between the two calibration methods. With wavelet analysis, defective pixels and inter-subpanel flat-fielding artifacts were clearly identified as spikes after thresholding the inversely transformed images. Conclusions: The proposed local NPS (r-square values) showed superior sensitivity to the noise level variations of individual subpanels compared with global quantitative metrics such as MTF, NPS, and DQE. Wavelet analysis was effective in detecting isolated defective pixels and inter-subpanel flat-fielding artifacts. The proposed methods are promising for the early detection of imaging artifacts of EPIDs.« less

Integrating Quantitative and Qualitative Results in Health Science Mixed Methods Research Through Joint Displays

PubMed Central

Guetterman, Timothy C.; Fetters, Michael D.; Creswell, John W.

2015-01-01

PURPOSE Mixed methods research is becoming an important methodology to investigate complex health-related topics, yet the meaningful integration of qualitative and quantitative data remains elusive and needs further development. A promising innovation to facilitate integration is the use of visual joint displays that bring data together visually to draw out new insights. The purpose of this study was to identify exemplar joint displays by analyzing the various types of joint displays being used in published articles. METHODS We searched for empirical articles that included joint displays in 3 journals that publish state-of-the-art mixed methods research. We analyzed each of 19 identified joint displays to extract the type of display, mixed methods design, purpose, rationale, qualitative and quantitative data sources, integration approaches, and analytic strategies. Our analysis focused on what each display communicated and its representation of mixed methods analysis. RESULTS The most prevalent types of joint displays were statistics-by-themes and side-by-side comparisons. Innovative joint displays connected findings to theoretical frameworks or recommendations. Researchers used joint displays for convergent, explanatory sequential, exploratory sequential, and intervention designs. We identified exemplars for each of these designs by analyzing the inferences gained through using the joint display. Exemplars represented mixed methods integration, presented integrated results, and yielded new insights. CONCLUSIONS Joint displays appear to provide a structure to discuss the integrated analysis and assist both researchers and readers in understanding how mixed methods provides new insights. We encourage researchers to use joint displays to integrate and represent mixed methods analysis and discuss their value. PMID:26553895

Quantitative cervical vertebral maturation assessment in adolescents with normal occlusion: a mixed longitudinal study.

PubMed

Chen, Li-Li; Xu, Tian-Min; Jiang, Jiu-Hui; Zhang, Xing-Zhong; Lin, Jiu-Xiang

2008-12-01

The purpose of this study was to establish a quantitative cervical vertebral maturation (CVM) system for adolescents with normal occlusion. Mixed longitudinal data were used. The subjects included 87 children and adolescents from 8 to 18 years old with normal occlusion (32 boys, 55 girls) selected from 901 candidates. Sequential lateral cephalograms and hand-wrist films were taken once a year for 6 years. The lateral cephalograms of all subjects were divided into 11 maturation groups according to the Fishman skeletal maturity indicators. The morphologic characteristics of the second, third, and fourth cervical vertebrae at 11 developmental stages were measured and analyzed. Three characteristic parameters (H4/W4, AH3/PH3, @2) were selected to determine the classification of CVM. With 3 morphologic variables, the quantitative CVM system including 4 maturational stages was established. An equation that can accurately estimate the maturation of the cervical vertebrae was established: CVM stage=-4.13+3.57xH4/W4+4.07xAH3/PH3+0.03x@2. The quantitative CVM method is an efficient, objective, and relatively simple approach to assess the level of skeletal maturation during adolescence.

Quantitative assessment of RNA-protein interactions with high-throughput sequencing-RNA affinity profiling.

PubMed

Ozer, Abdullah; Tome, Jacob M; Friedman, Robin C; Gheba, Dan; Schroth, Gary P; Lis, John T

2015-08-01

Because RNA-protein interactions have a central role in a wide array of biological processes, methods that enable a quantitative assessment of these interactions in a high-throughput manner are in great demand. Recently, we developed the high-throughput sequencing-RNA affinity profiling (HiTS-RAP) assay that couples sequencing on an Illumina GAIIx genome analyzer with the quantitative assessment of protein-RNA interactions. This assay is able to analyze interactions between one or possibly several proteins with millions of different RNAs in a single experiment. We have successfully used HiTS-RAP to analyze interactions of the EGFP and negative elongation factor subunit E (NELF-E) proteins with their corresponding canonical and mutant RNA aptamers. Here we provide a detailed protocol for HiTS-RAP that can be completed in about a month (8 d hands-on time). This includes the preparation and testing of recombinant proteins and DNA templates, clustering DNA templates on a flowcell, HiTS and protein binding with a GAIIx instrument, and finally data analysis. We also highlight aspects of HiTS-RAP that can be further improved and points of comparison between HiTS-RAP and two other recently developed methods, quantitative analysis of RNA on a massively parallel array (RNA-MaP) and RNA Bind-n-Seq (RBNS), for quantitative analysis of RNA-protein interactions.

Practical no-gold-standard evaluation framework for quantitative imaging methods: application to lesion segmentation in positron emission tomography

PubMed Central

Jha, Abhinav K.; Mena, Esther; Caffo, Brian; Ashrafinia, Saeed; Rahmim, Arman; Frey, Eric; Subramaniam, Rathan M.

2017-01-01

Abstract. Recently, a class of no-gold-standard (NGS) techniques have been proposed to evaluate quantitative imaging methods using patient data. These techniques provide figures of merit (FoMs) quantifying the precision of the estimated quantitative value without requiring repeated measurements and without requiring a gold standard. However, applying these techniques to patient data presents several practical difficulties including assessing the underlying assumptions, accounting for patient-sampling-related uncertainty, and assessing the reliability of the estimated FoMs. To address these issues, we propose statistical tests that provide confidence in the underlying assumptions and in the reliability of the estimated FoMs. Furthermore, the NGS technique is integrated within a bootstrap-based methodology to account for patient-sampling-related uncertainty. The developed NGS framework was applied to evaluate four methods for segmenting lesions from F-Fluoro-2-deoxyglucose positron emission tomography images of patients with head-and-neck cancer on the task of precisely measuring the metabolic tumor volume. The NGS technique consistently predicted the same segmentation method as the most precise method. The proposed framework provided confidence in these results, even when gold-standard data were not available. The bootstrap-based methodology indicated improved performance of the NGS technique with larger numbers of patient studies, as was expected, and yielded consistent results as long as data from more than 80 lesions were available for the analysis. PMID:28331883

Fast and simultaneous determination of 12 polyphenols in apple peel and pulp by using chemometrics-assisted high-performance liquid chromatography with diode array detection.

PubMed

Wang, Tong; Wu, Hai-Long; Xie, Li-Xia; Zhu, Li; Liu, Zhi; Sun, Xiao-Dong; Xiao, Rong; Yu, Ru-Qin

2017-04-01

In this work, a smart chemometrics-enhanced strategy, high-performance liquid chromatography, and diode array detection coupled with second-order calibration method based on alternating trilinear decomposition algorithm was proposed to simultaneously quantify 12 polyphenols in different kinds of apple peel and pulp samples. The proposed strategy proved to be a powerful tool to solve the problems of coelution, unknown interferences, and chromatographic shifts in the process of high-performance liquid chromatography analysis, making it possible for the determination of 12 polyphenols in complex apple matrices within 10 min under simple conditions of elution. The average recoveries with standard deviations, and figures of merit including sensitivity, selectivity, limit of detection, and limit of quantitation were calculated to validate the accuracy of the proposed method. Compared to the quantitative analysis results from the classic high-performance liquid chromatography method, the statistical and graphical analysis showed that our proposed strategy obtained more reliable results. All results indicated that our proposed method used in the quantitative analysis of apple polyphenols was an accurate, fast, universal, simple, and green one, and it was expected to be developed as an attractive alternative method for simultaneous determination of multitargeted analytes in complex matrices. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Patient's and health care provider's perspectives on music therapy in palliative care - an integrative review.

PubMed

Schmid, W; Rosland, J H; von Hofacker, S; Hunskår, I; Bruvik, F

2018-02-20

The use of music as therapy in multidisciplinary end-of-life care dates back to the 1970s and nowadays music therapy (MT) is one of the most frequently used complementary therapy in in-patient palliative care in the US. However existing research investigated music therapy's potential impact mainly from one perspective, referring to either a quantitative or qualitative paradigm. The aim of this review is to provide an overview of the users' and providers' perspectives on music therapy in palliative care within one research article. A systematic literature search was conducted using several databases supplemented with a hand-search of journals between November 1978 and December 2016. Inclusion criteria were: Music therapy with adults in palliative care conducted by a certified music therapist. Both quantitative and qualitative studies in English, German or a Scandinavian language published in peer reviewed journals were included. We aimed to identify and discuss the perspectives of both patients and health care providers on music therapy's impact in palliative care to forward a comprehensive understanding of it's effectiveness, benefits and limitations. We investigated themes mentioned by patients within qualitative studies, as well as commonly chosen outcome measures in quantitative research. A qualitative approach utilizing inductive content analysis was carried out to analyze and categorize the data. Twelve articles, reporting on nine quantitative and three qualitative research studies were included. Seven out of the nine quantitative studies investigated pain as an outcome. All of the included quantitative studies reported positive effects of the music therapy. Patients themselves associated MT with the expression of positive as well as challenging emotions and increased well-being. An overarching theme in both types of research is a psycho-physiological change through music therapy. Both quantitative as well as qualitative research showed positive changes in psycho-physiological well-being. The integration of the users´ and providers´ perspectives within future research applicable for example in mixed-methods designs is recommended.

A technique for setting analytical thresholds in massively parallel sequencing-based forensic DNA analysis

PubMed Central

2017-01-01

Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described. PMID:28542338

A technique for setting analytical thresholds in massively parallel sequencing-based forensic DNA analysis.

PubMed

Young, Brian; King, Jonathan L; Budowle, Bruce; Armogida, Luigi

2017-01-01

Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described.

Quantitative analysis of fatty-acid-based biofuels produced by wild-type and genetically engineered cyanobacteria by gas chromatography-mass spectrometry.

PubMed

Guan, Wenna; Zhao, Hui; Lu, Xuefeng; Wang, Cong; Yang, Menglong; Bai, Fali

2011-11-11

Simple and rapid quantitative determination of fatty-acid-based biofuels is greatly important for the study of genetic engineering progress for biofuels production by microalgae. Ideal biofuels produced from biological systems should be chemically similar to petroleum, like fatty-acid-based molecules including free fatty acids, fatty acid methyl esters, fatty acid ethyl esters, fatty alcohols and fatty alkanes. This study founded a gas chromatography-mass spectrometry (GC-MS) method for simultaneous quantification of seven free fatty acids, nine fatty acid methyl esters, five fatty acid ethyl esters, five fatty alcohols and three fatty alkanes produced by wild-type Synechocystis PCC 6803 and its genetically engineered strain. Data obtained from GC-MS analyses were quantified using internal standard peak area comparisons. The linearity, limit of detection (LOD) and precision (RSD) of the method were evaluated. The results demonstrated that fatty-acid-based biofuels can be directly determined by GC-MS without derivation. Therefore, rapid and reliable quantitative analysis of fatty-acid-based biofuels produced by wild-type and genetically engineered cyanobacteria can be achieved using the GC-MS method founded in this work. Copyright © 2011 Elsevier B.V. All rights reserved.

Comparative evaluation of two Rickettsia typhi-specific quantitative real-time PCRs for research and diagnostic purposes.

PubMed

Papp, Stefanie; Rauch, Jessica; Kuehl, Svenja; Richardt, Ulricke; Keller, Christian; Osterloh, Anke

2017-02-01

Rickettsioses are caused by intracellular bacteria of the family of Rickettsiaceae. Rickettsia (R.) typhi is the causative agent of endemic typhus. The disease occurs worldwide and is one of the most prevalent rickettsioses. Rickettsial diseases, however, are generally underdiagnosed which is mainly due to the lack of sensitive and specific methods. In addition, methods for quantitative detection of the bacteria for research purposes are rare. We established two qPCRs for the detection of R. typhi by amplification of the outer membrane protein B (ompB) and parvulin-type PPIase (prsA) genes. Both qPCRs are specific and exclusively recognize R. typhi but no other rickettsiae including the closest relative, R. prowazekii. The prsA-based qPCR revealed to be much more sensitive than the amplification of ompB and provided highly reproducible results in the detection of R. typhi in organs of infected mice. Furthermore, as a nested PCR the prsA qPCR was applicable for the detection of R. typhi in human blood samples. Collectively, the prsA-based qPCR represents a reliable method for the quantitative detection of R. typhi for research purposes and is a promising candidate for differential diagnosis.

Developing an Engineering Design Process Assessment using Mixed Methods.

PubMed

Wind, Stefanie A; Alemdar, Meltem; Lingle, Jeremy A; Gale, Jessica D; Moore, Roxanne A

Recent reforms in science education worldwide include an emphasis on engineering design as a key component of student proficiency in the Science, Technology, Engineering, and Mathematics disciplines. However, relatively little attention has been directed to the development of psychometrically sound assessments for engineering. This study demonstrates the use of mixed methods to guide the development and revision of K-12 Engineering Design Process (EDP) assessment items. Using results from a middle-school EDP assessment, this study illustrates the combination of quantitative and qualitative techniques to inform item development and revisions. Overall conclusions suggest that the combination of quantitative and qualitative evidence provides an in-depth picture of item quality that can be used to inform the revision and development of EDP assessment items. Researchers and practitioners can use the methods illustrated here to gather validity evidence to support the interpretation and use of new and existing assessments.

High-Throughput RT-PCR for small-molecule screening assays

PubMed Central

Bittker, Joshua A.

2012-01-01

Quantitative measurement of the levels of mRNA expression using real-time reverse transcription polymerase chain reaction (RT-PCR) has long been used for analyzing expression differences in tissue or cell lines of interest. This method has been used somewhat less frequently to measure the changes in gene expression due to perturbagens such as small molecules or siRNA. The availability of new instrumentation for liquid handling and real-time PCR analysis as well as the commercial availability of start-to-finish kits for RT-PCR has enabled the use of this method for high-throughput small-molecule screening on a scale comparable to traditional high-throughput screening (HTS) assays. This protocol focuses on the special considerations necessary for using quantitative RT-PCR as a primary small-molecule screening assay, including the different methods available for mRNA isolation and analysis. PMID:23487248

Charting organellar importomes by quantitative mass spectrometry

PubMed Central

Peikert, Christian D.; Mani, Jan; Morgenstern, Marcel; Käser, Sandro; Knapp, Bettina; Wenger, Christoph; Harsman, Anke; Oeljeklaus, Silke; Schneider, André; Warscheid, Bettina

2017-01-01

Protein import into organelles is essential for all eukaryotes and facilitated by multi-protein translocation machineries. Analysing whether a protein is transported into an organelle is largely restricted to single constituents. This renders knowledge about imported proteins incomplete, limiting our understanding of organellar biogenesis and function. Here we introduce a method that enables charting an organelle's importome. The approach relies on inducible RNAi-mediated knockdown of an essential subunit of a translocase to impair import and quantitative mass spectrometry. To highlight its potential, we established the mitochondrial importome of Trypanosoma brucei, comprising 1,120 proteins including 331 new candidates. Furthermore, the method allows for the identification of proteins with dual or multiple locations and the substrates of distinct protein import pathways. We demonstrate the specificity and versatility of this ImportOmics method by targeting import factors in mitochondria and glycosomes, which demonstrates its potential for globally studying protein import and inventories of organelles. PMID:28485388

Comparison of 3D quantitative structure-activity relationship methods: Analysis of the in vitro antimalarial activity of 154 artemisinin analogues by hypothetical active-site lattice and comparative molecular field analysis

NASA Astrophysics Data System (ADS)

Woolfrey, John R.; Avery, Mitchell A.; Doweyko, Arthur M.

1998-03-01

Two three-dimensional quantitative structure-activity relationship (3D-QSAR) methods, comparative molecular field analysis (CoMFA) and hypothetical active site lattice (HASL), were compared with respect to the analysis of a training set of 154 artemisinin analogues. Five models were created, including a complete HASL and two trimmed versions, as well as two CoMFA models (leave-one-out standard CoMFA and the guided-region selection protocol). Similar r2 and q2 values were obtained by each method, although some striking differences existed between CoMFA contour maps and the HASL output. Each of the four predictive models exhibited a similar ability to predict the activity of a test set of 23 artemisinin analogues, although some differences were noted as to which compounds were described well by either model.

Ted Hall and the science of biological microprobe X-ray analysis: a historical perspective of methodology and biological dividends.

PubMed

Gupta, B L

1991-06-01

This review surveys the emergence of electron probe X-ray microanalysis as a quantitative method for measuring the chemical elements in situ. The extension of the method to the biological sciences under the influence of Ted Hall is reviewed. Some classical experiments by Hall and his colleagues in Cambridge, UK, previously unpublished, are described; as are some of the earliest quantitative results from the cryo-sections obtained in Cambridge and elsewhere. The progress of the methodology is critically evaluated from the earliest starts to the present state of the art. Particular attention has been focused on the application of the method in providing fresh insights into the role of ions in cell and tissue physiology and pathology. A comprehensive list of references is included for a further pursuit of the topics by the interested reader.

DOE Office of Scientific and Technical Information (OSTI.GOV)

WIELOPOLSKI, L.

In this short report, I reassess the feasibility of measuring iron in vivo in the liver and heart of thalassemia patients undergoing chelation therapy. Despite the multiplicity of analytical methods for analyzing iron, only two, magnetic resonance imaging, and magnetic susceptibility, are suitable for in vivo applications, and these are limited to the liver because of the heart's beat. Previously, a nuclear method, gamma-resonance scattering, offered a quantitative measure of iron in these organs; however, it was abandoned because it necessitated a nuclear reactor to produce the radioactive source. I reviewed and reassessed the status of two alternative nuclear methods,more » based on iron spectroscopy of gamma rays induced by fast neutron inelastic scattering and delayed activation in iron. Both are quantitative methods with high specificity for iron and adequate penetrating power to measure it in organs sited deep within the human body. My experiments demonstrated that both modalities met the stated qualitative objectives to measure iron. However, neutron dosimetry revealed that the intensity of the neutron radiation field was too weak to reliably assess the minimum detection limits, and to allow quantitative extrapolations to measurements in people. A review of the literature, included in this report, showed that these findings agree qualitatively with the published results, although the doses reported were about three orders-of-magnitude higher than those I used. Reviewing the limitations of the present work, steps were outlined for overcoming some of the shortcomings. Due to a dearth of valid quantitative alternatives for determining iron in vivo, I conclude that nuclear methods remain the only viable option. However, from the lessons learned, further systematic work is required before embarking on clinical studies.« less

Measurement issues associated with quantitative molecular biology analysis of complex food matrices for the detection of food fraud.

PubMed

Burns, Malcolm; Wiseman, Gordon; Knight, Angus; Bramley, Peter; Foster, Lucy; Rollinson, Sophie; Damant, Andrew; Primrose, Sandy

2016-01-07

Following a report on a significant amount of horse DNA being detected in a beef burger product on sale to the public at a UK supermarket in early 2013, the Elliott report was published in 2014 and contained a list of recommendations for helping ensure food integrity. One of the recommendations included improving laboratory testing capacity and capability to ensure a harmonised approach for testing for food authenticity. Molecular biologists have developed exquisitely sensitive methods based on the polymerase chain reaction (PCR) or mass spectrometry for detecting the presence of particular nucleic acid or peptide/protein sequences. These methods have been shown to be specific and sensitive in terms of lower limits of applicability, but they are largely qualitative in nature. Historically, the conversion of these qualitative techniques into reliable quantitative methods has been beset with problems even when used on relatively simple sample matrices. When the methods are applied to complex sample matrices, as found in many foods, the problems are magnified resulting in a high measurement uncertainty associated with the result which may mean that the assay is not fit for purpose. However, recent advances in the technology and the understanding of molecular biology approaches have further given rise to the re-assessment of these methods for their quantitative potential. This review focuses on important issues for consideration when validating a molecular biology assay and the various factors that can impact on the measurement uncertainty of a result associated with molecular biology approaches used in detection of food fraud, with a particular focus on quantitative PCR-based and proteomics assays.

Exploitation of the complexation reaction of ortho-dihydroxylated anthocyanins with aluminum(III) for their quantitative spectrophotometric determination in edible sources.

PubMed

Bernal, Freddy A; Orduz-Diaz, Luisa L; Coy-Barrera, Ericsson

2015-10-15

Anthocyanins are natural pigments known for their color and antioxidant activity. These properties allow their use in various fields, including food and pharmaceutical ones. Quantitative determination of anthocyanins had been performed by non-specific methods that limit the accuracy and reliability of the results. Therefore, a novel, simple spectrophotometric method for the anthocyanins quantification based on a formation of blue-colored complexes by the known reaction between catechol- and pyrogallol-containing anthocyanins and aluminum(III) is presented. The method demonstrated to be reproducible, repetitive (RSD<1.5%) and highly sensitive to ortho-dihydroxylated anthocyanins (LOD = 0.186 μg/mL). Compliance with Beer's law was also evident in a range of concentrations (2-16 μg/mL for cyanidin 3-O-glucoside). Good recoveries (98.8-103.3%) were calculated using anthocyanin-rich plant samples. The described method revealed direct correlation to pH differential method results for several common anthocyanin-containing fruits indicating its great analytical potential. The presented method was successfully validated. Copyright © 2015 Elsevier Ltd. All rights reserved.

Advances in multiplexed MRM-based protein biomarker quantitation toward clinical utility.

PubMed

Percy, Andrew J; Chambers, Andrew G; Yang, Juncong; Hardie, Darryl B; Borchers, Christoph H

2014-05-01

Accurate and rapid protein quantitation is essential for screening biomarkers for disease stratification and monitoring, and to validate the hundreds of putative markers in human biofluids, including blood plasma. An analytical method that utilizes stable isotope-labeled standard (SIS) peptides and selected/multiple reaction monitoring-mass spectrometry (SRM/MRM-MS) has emerged as a promising technique for determining protein concentrations. This targeted approach has analytical merit, but its true potential (in terms of sensitivity and multiplexing) has yet to be realized. Described herein is a method that extends the multiplexing ability of the MRM method to enable the quantitation 142 high-to-moderate abundance proteins (from 31mg/mL to 44ng/mL) in undepleted and non-enriched human plasma in a single run. The proteins have been reported to be associated to a wide variety of non-communicable diseases (NCDs), from cardiovascular disease (CVD) to diabetes. The concentrations of these proteins in human plasma are inferred from interference-free peptides functioning as molecular surrogates (2 peptides per protein, on average). A revised data analysis strategy, involving the linear regression equation of normal control plasma, has been instituted to enable the facile application to patient samples, as demonstrated in separate nutrigenomics and CVD studies. The exceptional robustness of the LC/MS platform and the quantitative method, as well as its high throughput, makes the assay suitable for application to patient samples for the verification of a condensed or complete protein panel. This article is part of a Special Issue entitled: Biomarkers: A Proteomic Challenge. © 2013.

A Framework for Mixing Methods in Quantitative Measurement Development, Validation, and Revision: A Case Study

ERIC Educational Resources Information Center

Luyt, Russell

2012-01-01

A framework for quantitative measurement development, validation, and revision that incorporates both qualitative and quantitative methods is introduced. It extends and adapts Adcock and Collier's work, and thus, facilitates understanding of quantitative measurement development, validation, and revision as an integrated and cyclical set of…

Cooperative Learning in Distance Learning: A Mixed Methods Study

ERIC Educational Resources Information Center

Kupczynski, Lori; Mundy, Marie Anne; Goswami, Jaya; Meling, Vanessa

2012-01-01

Distance learning has facilitated innovative means to include Cooperative Learning (CL) in virtual settings. This study, conducted at a Hispanic-Serving Institution, compared the effectiveness of online CL strategies in discussion forums with traditional online forums. Quantitative and qualitative data were collected from 56 graduate student…

Transformative Learning Experiences of International Graduate Students from Asian Countries

ERIC Educational Resources Information Center

Kumi-Yeboah, Alex; James, Waynne

2014-01-01

This article investigates the transformative learning experiences of international graduate students from Asian countries. Data collection consisted of quantitative and qualitative methods. Participants included international graduate students from Asia, in the Colleges of Arts and Sciences and Engineering. Overall, 82.3% of the participants…

QUANTITATIVE IN VITRO MEASUREMENT OF CELLULAR PROCESSES CRITICAL TO THE DEVELOPMENT OF NEURAL CONNECTIVITY USING HCA.

EPA Science Inventory

New methods are needed to screen thousands of environmental chemicals for toxicity, including developmental neurotoxicity. In vitro, cell-based assays that model key cellular events have been proposed for high throughput screening of chemicals for developmental neurotoxicity. Whi...

Quantitative SIMS Imaging of Agar-Based Microbial Communities.

PubMed

Dunham, Sage J B; Ellis, Joseph F; Baig, Nameera F; Morales-Soto, Nydia; Cao, Tianyuan; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V

2018-05-01

After several decades of widespread use for mapping elemental ions and small molecular fragments in surface science, secondary ion mass spectrometry (SIMS) has emerged as a powerful analytical tool for molecular imaging in biology. Biomolecular SIMS imaging has primarily been used as a qualitative technique; although the distribution of a single analyte can be accurately determined, it is difficult to map the absolute quantity of a compound or even to compare the relative abundance of one molecular species to that of another. We describe a method for quantitative SIMS imaging of small molecules in agar-based microbial communities. The microbes are cultivated on a thin film of agar, dried under nitrogen, and imaged directly with SIMS. By use of optical microscopy, we show that the area of the agar is reduced by 26 ± 2% (standard deviation) during dehydration, but the overall biofilm morphology and analyte distribution are largely retained. We detail a quantitative imaging methodology, in which the ion intensity of each analyte is (1) normalized to an external quadratic regression curve, (2) corrected for isomeric interference, and (3) filtered for sample-specific noise and lower and upper limits of quantitation. The end result is a two-dimensional surface density image for each analyte. The sample preparation and quantitation methods are validated by quantitatively imaging four alkyl-quinolone and alkyl-quinoline N-oxide signaling molecules (including Pseudomonas quinolone signal) in Pseudomonas aeruginosa colony biofilms. We show that the relative surface densities of the target biomolecules are substantially different from values inferred through direct intensity comparison and that the developed methodologies can be used to quantitatively compare as many ions as there are available standards.

Advanced imaging of the macrostructure and microstructure of bone

NASA Technical Reports Server (NTRS)

Genant, H. K.; Gordon, C.; Jiang, Y.; Link, T. M.; Hans, D.; Majumdar, S.; Lang, T. F.

2000-01-01

Noninvasive and/or nondestructive techniques are capable of providing more macro- or microstructural information about bone than standard bone densitometry. Although the latter provides important information about osteoporotic fracture risk, numerous studies indicate that bone strength is only partially explained by bone mineral density. Quantitative assessment of macro- and microstructural features may improve our ability to estimate bone strength. The methods available for quantitatively assessing macrostructure include (besides conventional radiographs) quantitative computed tomography (QCT) and volumetric quantitative computed tomography (vQCT). Methods for assessing microstructure of trabecular bone noninvasively and/or nondestructively include high-resolution computed tomography (hrCT), micro-computed tomography (muCT), high-resolution magnetic resonance (hrMR), and micromagnetic resonance (muMR). vQCT, hrCT and hrMR are generally applicable in vivo; muCT and muMR are principally applicable in vitro. Although considerable progress has been made in the noninvasive and/or nondestructive imaging of the macro- and microstructure of bone, considerable challenges and dilemmas remain. From a technical perspective, the balance between spatial resolution versus sampling size, or between signal-to-noise versus radiation dose or acquisition time, needs further consideration, as do the trade-offs between the complexity and expense of equipment and the availability and accessibility of the methods. The relative merits of in vitro imaging and its ultrahigh resolution but invasiveness versus those of in vivo imaging and its modest resolution but noninvasiveness also deserve careful attention. From a clinical perspective, the challenges for bone imaging include balancing the relative advantages of simple bone densitometry against the more complex architectural features of bone or, similarly, the deeper research requirements against the broader clinical needs. The considerable potential biological differences between the peripheral appendicular skeleton and the central axial skeleton have to be addressed further. Finally, the relative merits of these sophisticated imaging techniques have to be weighed with respect to their applications as diagnostic procedures requiring high accuracy or reliability on one hand and their monitoring applications requiring high precision or reproducibility on the other. Copyright 2000 S. Karger AG, Basel.

Integrating Quantitative and Qualitative Results in Health Science Mixed Methods Research Through Joint Displays.

PubMed

Guetterman, Timothy C; Fetters, Michael D; Creswell, John W

2015-11-01

Mixed methods research is becoming an important methodology to investigate complex health-related topics, yet the meaningful integration of qualitative and quantitative data remains elusive and needs further development. A promising innovation to facilitate integration is the use of visual joint displays that bring data together visually to draw out new insights. The purpose of this study was to identify exemplar joint displays by analyzing the various types of joint displays being used in published articles. We searched for empirical articles that included joint displays in 3 journals that publish state-of-the-art mixed methods research. We analyzed each of 19 identified joint displays to extract the type of display, mixed methods design, purpose, rationale, qualitative and quantitative data sources, integration approaches, and analytic strategies. Our analysis focused on what each display communicated and its representation of mixed methods analysis. The most prevalent types of joint displays were statistics-by-themes and side-by-side comparisons. Innovative joint displays connected findings to theoretical frameworks or recommendations. Researchers used joint displays for convergent, explanatory sequential, exploratory sequential, and intervention designs. We identified exemplars for each of these designs by analyzing the inferences gained through using the joint display. Exemplars represented mixed methods integration, presented integrated results, and yielded new insights. Joint displays appear to provide a structure to discuss the integrated analysis and assist both researchers and readers in understanding how mixed methods provides new insights. We encourage researchers to use joint displays to integrate and represent mixed methods analysis and discuss their value. © 2015 Annals of Family Medicine, Inc.

Qualitative research within trials: developing a standard operating procedure for a clinical trials unit

PubMed Central

2013-01-01

Background Qualitative research methods are increasingly used within clinical trials to address broader research questions than can be addressed by quantitative methods alone. These methods enable health professionals, service users, and other stakeholders to contribute their views and experiences to evaluation of healthcare treatments, interventions, or policies, and influence the design of trials. Qualitative data often contribute information that is better able to reform policy or influence design. Methods Health services researchers, including trialists, clinicians, and qualitative researchers, worked collaboratively to develop a comprehensive portfolio of standard operating procedures (SOPs) for the West Wales Organisation for Rigorous Trials in Health (WWORTH), a clinical trials unit (CTU) at Swansea University, which has recently achieved registration with the UK Clinical Research Collaboration (UKCRC). Although the UKCRC requires a total of 25 SOPs from registered CTUs, WWORTH chose to add an additional qualitative-methods SOP (QM-SOP). Results The qualitative methods SOP (QM-SOP) defines good practice in designing and implementing qualitative components of trials, while allowing flexibility of approach and method. Its basic principles are that: qualitative researchers should be contributors from the start of trials with qualitative potential; the qualitative component should have clear aims; and the main study publication should report on the qualitative component. Conclusions We recommend that CTUs consider developing a QM-SOP to enhance the conduct of quantitative trials by adding qualitative data and analysis. We judge that this improves the value of quantitative trials, and contributes to the future development of multi-method trials. PMID:23433341

Occurrence of invertebrates at 38 stream sites in the Mississippi Embayment study unit, 1996-99

USGS Publications Warehouse

Caskey, Brian J.; Justus, B.G.; Zappia, Humbert

2002-01-01

A total of 88 invertebrate species and 178 genera representing 59 families, 8 orders, 6 classes, and 3 phyla was identified at 38 stream sites in the Mississippi Embayment Study Unit from 1996 through 1999 as part of the National Water-Quality Assessment Program. Sites were selected based on land use within the drainage basins and the availability of long-term streamflow data. Invertebrates were sampled as part of an overall sampling design to provide information related to the status and trends in water quality in the Mississippi Embayment Study Unit, which includes parts of Arkansas, Kentucky, Louisiana, Mississippi, Missouri, and Tennessee. Invertebrate sampling and processing was conducted using nationally standardized techniques developed for the National Water-Quality Assessment Program. These techniques included both a semi-quantitative method, which targeted habitats where invertebrate diversity is expected to be highest, and a qualitative multihabitat method, which samples all available habitat types possible within a sampling reach. All invertebrate samples were shipped to the USGS National Water-Quality Laboratory (NWQL) where they were processed. Of the 365 taxa identified, 156 were identified with the semi-quantitative method that involved sampling a known quantity of what was expected to be the richest habitat, woody debris. The qualitative method, which involved sampling all available habitats, identified 345 taxa The number of organisms identified in the semi-quantitative samples ranged from 74 to 3,295, whereas the number of taxa identified ranged from 9 to 54. The number of organisms identified in the qualitative samples ranged from 42 to 29,634, whereas the number of taxa ranged from 18 to 81. From all the organisms identified, chironomid taxa were the most frequently identified, and plecopteran taxa were among the least frequently identified.

Application of the correlation constrained multivariate curve resolution alternating least-squares method for analyte quantitation in the presence of unexpected interferences using first-order instrumental data.

PubMed

Goicoechea, Héctor C; Olivieri, Alejandro C; Tauler, Romà

2010-03-01

Correlation constrained multivariate curve resolution-alternating least-squares is shown to be a feasible method for processing first-order instrumental data and achieve analyte quantitation in the presence of unexpected interferences. Both for simulated and experimental data sets, the proposed method could correctly retrieve the analyte and interference spectral profiles and perform accurate estimations of analyte concentrations in test samples. Since no information concerning the interferences was present in calibration samples, the proposed multivariate calibration approach including the correlation constraint facilitates the achievement of the so-called second-order advantage for the analyte of interest, which is known to be present for more complex higher-order richer instrumental data. The proposed method is tested using a simulated data set and two experimental data systems, one for the determination of ascorbic acid in powder juices using UV-visible absorption spectral data, and another for the determination of tetracycline in serum samples using fluorescence emission spectroscopy.

Recovering the dynamics of root growth and development using novel image acquisition and analysis methods

PubMed Central

Wells, Darren M.; French, Andrew P.; Naeem, Asad; Ishaq, Omer; Traini, Richard; Hijazi, Hussein; Bennett, Malcolm J.; Pridmore, Tony P.

2012-01-01

Roots are highly responsive to environmental signals encountered in the rhizosphere, such as nutrients, mechanical resistance and gravity. As a result, root growth and development is very plastic. If this complex and vital process is to be understood, methods and tools are required to capture the dynamics of root responses. Tools are needed which are high-throughput, supporting large-scale experimental work, and provide accurate, high-resolution, quantitative data. We describe and demonstrate the efficacy of the high-throughput and high-resolution root imaging systems recently developed within the Centre for Plant Integrative Biology (CPIB). This toolset includes (i) robotic imaging hardware to generate time-lapse datasets from standard cameras under infrared illumination and (ii) automated image analysis methods and software to extract quantitative information about root growth and development both from these images and via high-resolution light microscopy. These methods are demonstrated using data gathered during an experimental study of the gravitropic response of Arabidopsis thaliana. PMID:22527394

Recovering the dynamics of root growth and development using novel image acquisition and analysis methods.

PubMed

Wells, Darren M; French, Andrew P; Naeem, Asad; Ishaq, Omer; Traini, Richard; Hijazi, Hussein I; Hijazi, Hussein; Bennett, Malcolm J; Pridmore, Tony P

2012-06-05

Roots are highly responsive to environmental signals encountered in the rhizosphere, such as nutrients, mechanical resistance and gravity. As a result, root growth and development is very plastic. If this complex and vital process is to be understood, methods and tools are required to capture the dynamics of root responses. Tools are needed which are high-throughput, supporting large-scale experimental work, and provide accurate, high-resolution, quantitative data. We describe and demonstrate the efficacy of the high-throughput and high-resolution root imaging systems recently developed within the Centre for Plant Integrative Biology (CPIB). This toolset includes (i) robotic imaging hardware to generate time-lapse datasets from standard cameras under infrared illumination and (ii) automated image analysis methods and software to extract quantitative information about root growth and development both from these images and via high-resolution light microscopy. These methods are demonstrated using data gathered during an experimental study of the gravitropic response of Arabidopsis thaliana.

New Technology-Large-Area Three- Dimensional Surface Profiling Using Only Focused Air-Coupled Ultrasound-Given 1999 R&D 100 Award

NASA Technical Reports Server (NTRS)

Roth, Don J.; Kautz, Harold E.; Abel, Phillip B.; Whalen, Mike F.; Hendricks, J. Lynne; Bodis, James R.

2000-01-01

Surface topography, which significantly affects the performance of many industrial components, is normally measured with diamond-tip profilometry over small areas or with optical scattering methods over larger areas. To develop air-coupled surface profilometry, the NASA Glenn Research Center at Lewis Field initiated a Space Act Agreement with Sonix, Inc., through two Glenn programs, the Advanced High Temperature Engine Materials Program (HITEMP) and COMMTECH. The work resulted in quantitative surface topography profiles obtained using only high-frequency, focused ultrasonic pulses in air. The method is nondestructive, noninvasive, and noncontact, and it does not require light-reflective surfaces. Air surface profiling may be desirable when diamond-tip or laserbased methods are impractical, such as over large areas, when a significant depth range is required, or for curved surfaces. When the configuration is optimized, the method is reasonably rapid and all the quantitative analysis facilities are online, including two- and three-dimensional visualization, extreme value filtering (for faulty data), and leveling.

Projecting technology change to improve space technology planning and systems management

NASA Astrophysics Data System (ADS)

Walk, Steven Robert

2011-04-01

Projecting technology performance evolution has been improving over the years. Reliable quantitative forecasting methods have been developed that project the growth, diffusion, and performance of technology in time, including projecting technology substitutions, saturation levels, and performance improvements. These forecasts can be applied at the early stages of space technology planning to better predict available future technology performance, assure the successful selection of technology, and improve technology systems management strategy. Often what is published as a technology forecast is simply scenario planning, usually made by extrapolating current trends into the future, with perhaps some subjective insight added. Typically, the accuracy of such predictions falls rapidly with distance in time. Quantitative technology forecasting (QTF), on the other hand, includes the study of historic data to identify one of or a combination of several recognized universal technology diffusion or substitution patterns. In the same manner that quantitative models of physical phenomena provide excellent predictions of system behavior, so do QTF models provide reliable technological performance trajectories. In practice, a quantitative technology forecast is completed to ascertain with confidence when the projected performance of a technology or system of technologies will occur. Such projections provide reliable time-referenced information when considering cost and performance trade-offs in maintaining, replacing, or migrating a technology, component, or system. This paper introduces various quantitative technology forecasting techniques and illustrates their practical application in space technology and technology systems management.

77 FR 33133 - Patient Protection and Affordable Care Act; Data Collection To Support Standards Related to...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-05

... includes both quantitative and non-quantitative limits on benefits. Examples of quantitative limits include... duration of treatment. Examples of non-quantitative limits include prior authorization and step therapy... relevant issuers would submit data and descriptive information on the [[Page 33136

A sampling framework for incorporating quantitative mass spectrometry data in protein interaction analysis.

PubMed

Tucker, George; Loh, Po-Ru; Berger, Bonnie

2013-10-04

Comprehensive protein-protein interaction (PPI) maps are a powerful resource for uncovering the molecular basis of genetic interactions and providing mechanistic insights. Over the past decade, high-throughput experimental techniques have been developed to generate PPI maps at proteome scale, first using yeast two-hybrid approaches and more recently via affinity purification combined with mass spectrometry (AP-MS). Unfortunately, data from both protocols are prone to both high false positive and false negative rates. To address these issues, many methods have been developed to post-process raw PPI data. However, with few exceptions, these methods only analyze binary experimental data (in which each potential interaction tested is deemed either observed or unobserved), neglecting quantitative information available from AP-MS such as spectral counts. We propose a novel method for incorporating quantitative information from AP-MS data into existing PPI inference methods that analyze binary interaction data. Our approach introduces a probabilistic framework that models the statistical noise inherent in observations of co-purifications. Using a sampling-based approach, we model the uncertainty of interactions with low spectral counts by generating an ensemble of possible alternative experimental outcomes. We then apply the existing method of choice to each alternative outcome and aggregate results over the ensemble. We validate our approach on three recent AP-MS data sets and demonstrate performance comparable to or better than state-of-the-art methods. Additionally, we provide an in-depth discussion comparing the theoretical bases of existing approaches and identify common aspects that may be key to their performance. Our sampling framework extends the existing body of work on PPI analysis using binary interaction data to apply to the richer quantitative data now commonly available through AP-MS assays. This framework is quite general, and many enhancements are likely possible. Fruitful future directions may include investigating more sophisticated schemes for converting spectral counts to probabilities and applying the framework to direct protein complex prediction methods.

Comparison of culture-based, vital stain and PMA-qPCR methods for the quantitative detection of viable hookworm ova.

PubMed

Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S

2017-06-01

Accurate quantitative measurement of viable hookworm ova from environmental samples is the key to controlling hookworm re-infections in the endemic regions. In this study, the accuracy of three quantitative detection methods [culture-based, vital stain and propidium monoazide-quantitative polymerase chain reaction (PMA-qPCR)] was evaluated by enumerating 1,000 ± 50 Ancylostoma caninum ova in the laboratory. The culture-based method was able to quantify an average of 397 ± 59 viable hookworm ova. Similarly, vital stain and PMA-qPCR methods quantified 644 ± 87 and 587 ± 91 viable ova, respectively. The numbers of viable ova estimated by the culture-based method were significantly (P < 0.05) lower than vital stain and PMA-qPCR methods. Therefore, both PMA-qPCR and vital stain methods appear to be suitable for the quantitative detection of viable hookworm ova. However, PMA-qPCR would be preferable over the vital stain method in scenarios where ova speciation is needed.

Quantitative analysis of γ-oryzanol content in cold pressed rice bran oil by TLC-image analysis method

PubMed Central

Sakunpak, Apirak; Suksaeree, Jirapornchai; Monton, Chaowalit; Pathompak, Pathamaporn; Kraisintu, Krisana

2014-01-01

Objective To develop and validate an image analysis method for quantitative analysis of γ-oryzanol in cold pressed rice bran oil. Methods TLC-densitometric and TLC-image analysis methods were developed, validated, and used for quantitative analysis of γ-oryzanol in cold pressed rice bran oil. The results obtained by these two different quantification methods were compared by paired t-test. Results Both assays provided good linearity, accuracy, reproducibility and selectivity for determination of γ-oryzanol. Conclusions The TLC-densitometric and TLC-image analysis methods provided a similar reproducibility, accuracy and selectivity for the quantitative determination of γ-oryzanol in cold pressed rice bran oil. A statistical comparison of the quantitative determinations of γ-oryzanol in samples did not show any statistically significant difference between TLC-densitometric and TLC-image analysis methods. As both methods were found to be equal, they therefore can be used for the determination of γ-oryzanol in cold pressed rice bran oil. PMID:25182282

Quantitative analysis of crystalline pharmaceuticals in powders and tablets by a pattern-fitting procedure using X-ray powder diffraction data.

PubMed

Yamamura, S; Momose, Y

2001-01-16

A pattern-fitting procedure for quantitative analysis of crystalline pharmaceuticals in solid dosage forms using X-ray powder diffraction data is described. This method is based on a procedure for pattern-fitting in crystal structure refinement, and observed X-ray scattering intensities were fitted to analytical expressions including some fitting parameters, i.e. scale factor, peak positions, peak widths and degree of preferred orientation of the crystallites. All fitting parameters were optimized by the non-linear least-squares procedure. Then the weight fraction of each component was determined from the optimized scale factors. In the present study, well-crystallized binary systems, zinc oxide-zinc sulfide (ZnO-ZnS) and salicylic acid-benzoic acid (SA-BA), were used as the samples. In analysis of the ZnO-ZnS system, the weight fraction of ZnO or ZnS could be determined quantitatively in the range of 5-95% in the case of both powders and tablets. In analysis of the SA-BA systems, the weight fraction of SA or BA could be determined quantitatively in the range of 20-80% in the case of both powders and tablets. Quantitative analysis applying this pattern-fitting procedure showed better reproducibility than other X-ray methods based on the linear or integral intensities of particular diffraction peaks. Analysis using this pattern-fitting procedure also has the advantage that the preferred orientation of the crystallites in solid dosage forms can be also determined in the course of quantitative analysis.

Informatics methods to enable sharing of quantitative imaging research data.

PubMed

Levy, Mia A; Freymann, John B; Kirby, Justin S; Fedorov, Andriy; Fennessy, Fiona M; Eschrich, Steven A; Berglund, Anders E; Fenstermacher, David A; Tan, Yongqiang; Guo, Xiaotao; Casavant, Thomas L; Brown, Bartley J; Braun, Terry A; Dekker, Andre; Roelofs, Erik; Mountz, James M; Boada, Fernando; Laymon, Charles; Oborski, Matt; Rubin, Daniel L

2012-11-01

The National Cancer Institute Quantitative Research Network (QIN) is a collaborative research network whose goal is to share data, algorithms and research tools to accelerate quantitative imaging research. A challenge is the variability in tools and analysis platforms used in quantitative imaging. Our goal was to understand the extent of this variation and to develop an approach to enable sharing data and to promote reuse of quantitative imaging data in the community. We performed a survey of the current tools in use by the QIN member sites for representation and storage of their QIN research data including images, image meta-data and clinical data. We identified existing systems and standards for data sharing and their gaps for the QIN use case. We then proposed a system architecture to enable data sharing and collaborative experimentation within the QIN. There are a variety of tools currently used by each QIN institution. We developed a general information system architecture to support the QIN goals. We also describe the remaining architecture gaps we are developing to enable members to share research images and image meta-data across the network. As a research network, the QIN will stimulate quantitative imaging research by pooling data, algorithms and research tools. However, there are gaps in current functional requirements that will need to be met by future informatics development. Special attention must be given to the technical requirements needed to translate these methods into the clinical research workflow to enable validation and qualification of these novel imaging biomarkers. Copyright © 2012 Elsevier Inc. All rights reserved.

Distance-based microfluidic quantitative detection methods for point-of-care testing.

PubMed

Tian, Tian; Li, Jiuxing; Song, Yanling; Zhou, Leiji; Zhu, Zhi; Yang, Chaoyong James

2016-04-07

Equipment-free devices with quantitative readout are of great significance to point-of-care testing (POCT), which provides real-time readout to users and is especially important in low-resource settings. Among various equipment-free approaches, distance-based visual quantitative detection methods rely on reading the visual signal length for corresponding target concentrations, thus eliminating the need for sophisticated instruments. The distance-based methods are low-cost, user-friendly and can be integrated into portable analytical devices. Moreover, such methods enable quantitative detection of various targets by the naked eye. In this review, we first introduce the concept and history of distance-based visual quantitative detection methods. Then, we summarize the main methods for translation of molecular signals to distance-based readout and discuss different microfluidic platforms (glass, PDMS, paper and thread) in terms of applications in biomedical diagnostics, food safety monitoring, and environmental analysis. Finally, the potential and future perspectives are discussed.

[Simultaneous quantitative analysis of five alkaloids in Sophora flavescens by multi-components assay by single marker].

PubMed

Chen, Jing; Wang, Shu-Mei; Meng, Jiang; Sun, Fei; Liang, Sheng-Wang

2013-05-01

To establish a new method for quality evaluation and validate its feasibilities by simultaneous quantitative assay of five alkaloids in Sophora flavescens. The new quality evaluation method, quantitative analysis of multi-components by single marker (QAMS), was established and validated with S. flavescens. Five main alkaloids, oxymatrine, sophocarpine, matrine, oxysophocarpine and sophoridine, were selected as analytes to evaluate the quality of rhizome of S. flavescens, and the relative correction factor has good repeatibility. Their contents in 21 batches of samples, collected from different areas, were determined by both external standard method and QAMS. The method was evaluated by comparison of the quantitative results between external standard method and QAMS. No significant differences were found in the quantitative results of five alkaloids in 21 batches of S. flavescens determined by external standard method and QAMS. It is feasible and suitable to evaluate the quality of rhizome of S. flavescens by QAMS.

HIFI-C: a robust and fast method for determining NMR couplings from adaptive 3D to 2D projections.

PubMed

Cornilescu, Gabriel; Bahrami, Arash; Tonelli, Marco; Markley, John L; Eghbalnia, Hamid R

2007-08-01

We describe a novel method for the robust, rapid, and reliable determination of J couplings in multi-dimensional NMR coupling data, including small couplings from larger proteins. The method, "High-resolution Iterative Frequency Identification of Couplings" (HIFI-C) is an extension of the adaptive and intelligent data collection approach introduced earlier in HIFI-NMR. HIFI-C collects one or more optimally tilted two-dimensional (2D) planes of a 3D experiment, identifies peaks, and determines couplings with high resolution and precision. The HIFI-C approach, demonstrated here for the 3D quantitative J method, offers vital features that advance the goal of rapid and robust collection of NMR coupling data. (1) Tilted plane residual dipolar couplings (RDC) data are collected adaptively in order to offer an intelligent trade off between data collection time and accuracy. (2) Data from independent planes can provide a statistical measure of reliability for each measured coupling. (3) Fast data collection enables measurements in cases where sample stability is a limiting factor (for example in the presence of an orienting medium required for residual dipolar coupling measurements). (4) For samples that are stable, or in experiments involving relatively stronger couplings, robust data collection enables more reliable determinations of couplings in shorter time, particularly for larger biomolecules. As a proof of principle, we have applied the HIFI-C approach to the 3D quantitative J experiment to determine N-C' RDC values for three proteins ranging from 56 to 159 residues (including a homodimer with 111 residues in each subunit). A number of factors influence the robustness and speed of data collection. These factors include the size of the protein, the experimental set up, and the coupling being measured, among others. To exhibit a lower bound on robustness and the potential for time saving, the measurement of dipolar couplings for the N-C' vector represents a realistic "worst case analysis". These couplings are among the smallest currently measured, and their determination in both isotropic and anisotropic media demands the highest measurement precision. The new approach yielded excellent quantitative agreement with values determined independently by the conventional 3D quantitative J NMR method (in cases where sample stability in oriented media permitted these measurements) but with a factor of 2-5 in time savings. The statistical measure of reliability, measuring the quality of each RDC value, offers valuable adjunct information even in cases where modest time savings may be realized.

[Evaluation on methodological problems in reports concerning quantitative analysis of syndrome differentiation of diabetes mellitus].

PubMed

Chen, Bi-Cang; Wu, Qiu-Ying; Xiang, Cheng-Bin; Zhou, Yi; Guo, Ling-Xiang; Zhao, Neng-Jiang; Yang, Shu-Yu

2006-01-01

To evaluate the quality of reports published in recent 10 years in China about quantitative analysis of syndrome differentiation for diabetes mellitus (DM) in order to explore the methodological problems in these reports and find possible solutions. The main medical literature databases in China were searched. Thirty-one articles were included and evaluated by the principles of clinical epidemiology. There were many mistakes and deficiencies in these articles, such as clinical trial designs, diagnosis criteria for DM, standards of syndrome differentiation of DM, case inclusive and exclusive criteria, sample size and estimation, data comparability and statistical methods. It is necessary and important to improve the quality of reports concerning quantitative analysis of syndrome differentiation of DM in light of the principles of clinical epidemiology.

Quantitative somatosensory testing of the penis: optimizing the clinical neurological examination.

PubMed

Bleustein, Clifford B; Eckholdt, Haftan; Arezzo, Joseph C; Melman, Arnold

2003-06-01

Quantitative somatosensory testing, including vibration, pressure, spatial perception and thermal thresholds of the penis, has demonstrated neuropathy in patients with a history of erectile dysfunction of all etiologies. We evaluated which measurement of neurological function of the penis was best at predicting erectile dysfunction and examined the impact of location on the penis for quantitative somatosensory testing measurements. A total of 107 patients were evaluated. All patients were required to complete the erectile function domain of the International Index of Erectile Function (IIEF) questionnaire, of whom 24 had no complaints of erectile dysfunction and scored within the "normal" range on the IIEF. Patients were subsequently tested on ventral middle penile shaft, proximal dorsal midline penile shaft and glans penis (with foreskin retracted) for vibration, pressure, spatial perception, and warm and cold thermal thresholds. Mixed models repeated measures analysis of variance controlling for age, diabetes and hypertension revealed that method of measurement (quantitative somatosensory testing) was predictive of IIEF score (F = 209, df = 4,1315, p <0.001), while site of measurement on the penis was not. To determine the best method of measurement, we used hierarchical regression, which revealed that warm temperature was the best predictor of erectile dysfunction with pseudo R(2) = 0.19, p <0.0007. There was no significant improvement in predicting erectile dysfunction when another test was added. Using 37C and greater as the warm thermal threshold yielded a sensitivity of 88.5%, specificity 70.0% and positive predictive value 85.5%. Quantitative somatosensory testing using warm thermal threshold measurements taken at the glans penis can be used alone to assess the neurological status of the penis. Warm thermal thresholds alone offer a quick, noninvasive accurate method of evaluating penile neuropathy in an office setting.

Medical Student Research: An Integrated Mixed-Methods Systematic Review and Meta-Analysis

PubMed Central

Amgad, Mohamed; Man Kin Tsui, Marco; Liptrott, Sarah J.; Shash, Emad

2015-01-01

Importance Despite the rapidly declining number of physician-investigators, there is no consistent structure within medical education so far for involving medical students in research. Objective To conduct an integrated mixed-methods systematic review and meta-analysis of published studies about medical students' participation in research, and to evaluate the evidence in order to guide policy decision-making regarding this issue. Evidence Review We followed the PRISMA statement guidelines during the preparation of this review and meta-analysis. We searched various databases as well as the bibliographies of the included studies between March 2012 and September 2013. We identified all relevant quantitative and qualitative studies assessing the effect of medical student participation in research, without restrictions regarding study design or publication date. Prespecified outcome-specific quality criteria were used to judge the admission of each quantitative outcome into the meta-analysis. Initial screening of titles and abstracts resulted in the retrieval of 256 articles for full-text assessment. Eventually, 79 articles were included in our study, including eight qualitative studies. An integrated approach was used to combine quantitative and qualitative studies into a single synthesis. Once all included studies were identified, a data-driven thematic analysis was performed. Findings and Conclusions Medical student participation in research is associated with improved short- and long- term scientific productivity, more informed career choices and improved knowledge about-, interest in- and attitudes towards research. Financial worries, gender, having a higher degree (MSc or PhD) before matriculation and perceived competitiveness of the residency of choice are among the factors that affect the engagement of medical students in research and/or their scientific productivity. Intercalated BSc degrees, mandatory graduation theses and curricular research components may help in standardizing research education during medical school. PMID:26086391

Structural issues affecting mixed methods studies in health research: a qualitative study

PubMed Central

2009-01-01

Background Health researchers undertake studies which combine qualitative and quantitative methods. Little attention has been paid to the structural issues affecting this mixed methods approach. We explored the facilitators and barriers to undertaking mixed methods studies in health research. Methods Face-to-face semi-structured interviews with 20 researchers experienced in mixed methods research in health in the United Kingdom. Results Structural facilitators for undertaking mixed methods studies included a perception that funding bodies promoted this approach, and the multidisciplinary constituency of some university departments. Structural barriers to exploiting the potential of these studies included a lack of education and training in mixed methods research, and a lack of templates for reporting mixed methods articles in peer-reviewed journals. The 'hierarchy of evidence' relating to effectiveness studies in health care research, with the randomised controlled trial as the gold standard, appeared to pervade the health research infrastructure. Thus integration of data and findings from qualitative and quantitative components of mixed methods studies, and dissemination of integrated outputs, tended to occur through serendipity and effort, further highlighting the presence of structural constraints. Researchers are agents who may also support current structures - journal reviewers and editors, and directors of postgraduate training courses - and thus have the ability to improve the structural support for exploiting the potential of mixed methods research. Conclusion The environment for health research in the UK appears to be conducive to mixed methods research but not to exploiting the potential of this approach. Structural change, as well as change in researcher behaviour, will be necessary if researchers are to fully exploit the potential of using mixed methods research. PMID:20003210

Reasons for Vocabulary Attrition: Revisiting the State of the Art

ERIC Educational Resources Information Center

Alharthi, Thamer

2015-01-01

This paper reports on a one year, mixed-methods longitudinal case study investigating the neglected area of the perceived reasons why participants forget vocabulary knowledge. The participants were 43 fourth year male Saudi EFL majors at King Abdulaziz University KAU, Saudi Arabia. Quantitative and qualitative data including self-reported…

Enrollment Trends at University of Alaska Community Campuses

ERIC Educational Resources Information Center

Goldsmith, Scott; Hill, Alexandra; Killorin, Mary

2005-01-01

In this report, Institute of Social and Economic Research, University of Alaska Anchorage, investigated the factors that explain change over time in enrollments and credit hours (participation) at the community campuses of the University of Alaska using both quantitative and qualitative methods. Sections include: (1) Background; (2) Factors…

A Graphical Approach to Quantitative Structural Geology.

ERIC Educational Resources Information Center

De Paor, Declan G.

1986-01-01

Describes how computer graphic methods can be used in teaching structural geology. Describes the design of a graphics workstation for the Apple microcomputer. Includes a listing of commands used with software to plot structures in a digitized form. Argues for the establishment of computer laboratories for structural geology classes. (TW)

Calibrated Peer Review for Computer-Assisted Learning of Biological Research Competencies

ERIC Educational Resources Information Center

Clase, Kari L.; Gundlach, Ellen; Pelaez, Nancy J.

2010-01-01

Recently, both science and technology faculty have been recognizing biological research competencies that are valued but rarely assessed. Some of these valued learning outcomes include scientific methods and thinking, critical assessment of primary papers, quantitative reasoning, communication, and putting biological research into a historical and…

The Role of Emotional Intelligence in Community College Leadership

ERIC Educational Resources Information Center

Freed, Curt Alan

2016-01-01

The study explores the role of emotional intelligence in community college leaders using a case study design with mixed-methods, including quantitative and qualitative data. Twenty-one leaders among three cases participated in the study, each completing the Mayer-Salovey-Caruso Emotional Intelligence Test (MSCEIT) and participating in…

Factors That Influence Organization Learning Sustainability in Non-Profit Organizations

ERIC Educational Resources Information Center

Prugsamatz, Raphaella

2010-01-01

Purpose: The purpose of this paper is to broaden previous work on organizational learning and the factors that influence learning in organizational settings. Design/methodology/approach: Qualitative and quantitative research methods that included in-depth interviews and questionnaire distribution were used. Data gathered were analyzed using…

Components That Affect the Personal Motivation to Implement Campus Safety Protocols

ERIC Educational Resources Information Center

Burt, Ernest, III

2013-01-01

This study examined components that have an effect on crisis response team members' personal motivation to perform campus safety protocols. The research method for this study was a quantitative design. The variables measured were compensation, experience, training, and communication. The motivation sources for this study included instrumental…

Graphic Representation of Carbon Dioxide Equilibria in Biological Systems.

ERIC Educational Resources Information Center

Kindig, Neal B.; Filley, Giles F.

1983-01-01

The log C-pH diagram is a useful means of displaying quantitatively the many variables (including temperature) that determine acid-base equilibria in biological systems. Presents the diagram as extended to open/closed biological systems and derives a new water-ion balance method for determining equilibrium pH. (JN)

Teacher Perceptions and Individual Differences: How They Influence Rural Teachers' Motivating Strategies

ERIC Educational Resources Information Center

Hardre, Patricia L.; Sullivan, David W.

2008-01-01

This study examined the influence of high school teachers' perceptions and individual difference characteristics on teachers' use of motivating strategies in their classrooms. Participants were 75 teachers in 19 rural, public high schools. A mixed method approach was used. Quantitative measures included demographics, individual differences,…

Urban Men's Knowledge and Perceptions regarding Sexually Transmitted Infections in Pakistan

ERIC Educational Resources Information Center

Mohammad Mir, Ali; Reichenbach, Laura; Wajid, Abdul

2009-01-01

In a pioneering study undertaken in Pakistan, urban men's sexual behaviors, perceptions and knowledge regarding sexually transmitted infections including HIV/AIDS were determined by employing both qualitative and quantitative research methods. Focus group discussions were carried out initially and followed by a structured cross sectional survey…

Quantitative Assessment of Interutterance Stability: Application to Dysarthria

ERIC Educational Resources Information Center

Cummins, Fred; Lowit, Anja; van Brenk, Frits

2014-01-01

Purpose: Following recent attempts to quantify articulatory impairment in speech, the present study evaluates the usefulness of a novel measure of motor stability to characterize dysarthria. Method: The study included 8 speakers with ataxic dysarthria (AD), 16 speakers with hypokinetic dysarthria (HD) as a result of Parkinson's disease, and…

Research Methods Tutorial

NASA Technical Reports Server (NTRS)

Aguilera, Frank J.

2015-01-01

A guiding principle for conducting research in technology, science, and engineering, leading to innovation is based on our use of research methodology (both qualitative and quantitative). A brief review of research methodology will be presented with an overview of NASA process in developing aeronautics technologies and other things to consider in research including what is innovation.

QUANTITATIVE MEASUREMENT OF STACHYBOTRYS CHARTARUM CONIDIA USING REAL TIME DETECTION OF PCR PRODUCTS WITH THE TAQMAN TM FLUOROGENIC PROBE SYSTEM

EPA Science Inventory

The occurence of Stachybotrys chartarum in indoor environments has been associated with a number of human health concerns, including fatal pulmonary haemosiderosis in infants. Currently used culture-based and microscopic methods of fungal species identification are poorly suited ...

Science Education in the Boy Scouts of America

ERIC Educational Resources Information Center

Hintz, Rachel Sterneman

2009-01-01

This study of science education in the Boy Scouts of America focused on males with Boy Scout experience. The mixed-methods study topics included: merit badge standards compared with National Science Education Standards, Scout responses to open-ended survey questions, the learning styles of Scouts, a quantitative assessment of science content…

Qualitative Approaches to Evaluating Education.

ERIC Educational Resources Information Center

Fetterman, David M.

This paper explores the variety of qualitative methods available, in the context of a larger quantitative-qualitative debate in the field of educational evaluation. Each approach is reviewed in terms of the work of its major proponents. The dominant forms of qualitative evaluation include: (1) ethnography; (2) naturalistic inquiry; (3) generic…

Comparison of Methods for miRNA Extraction from Plasma and Quantitative Recovery of RNA from Cerebrospinal Fluid

PubMed Central

McAlexander, Melissa A.; Phillips, Maggie J.; Witwer, Kenneth W.

2013-01-01

Interest in extracellular RNA (exRNA) has intensified as evidence accumulates that these molecules may be useful as indicators of a wide variety of biological conditions. To establish specific exRNA molecules as clinically relevant biomarkers, reproducible recovery from biological samples and reliable measurements of the isolated RNA are paramount. Toward these ends, careful and rigorous comparisons of technical procedures are needed at all steps from sample handling to RNA isolation to RNA measurement protocols. In the investigations described in this methods paper, RT-qPCR was used to examine the apparent recovery of specific endogenous miRNAs and a spiked-in synthetic RNA from blood plasma samples. RNA was isolated using several widely used RNA isolation kits, with or without the addition of glycogen as a carrier. Kits examined included total RNA isolation systems that have been commercially available for several years and commonly adapted for extraction of biofluid RNA, as well as more recently introduced biofluids-specific RNA methods. Our conclusions include the following: some RNA isolation methods appear to be superior to others for the recovery of RNA from biological fluids; addition of a carrier molecule seems to be beneficial for some but not all isolation methods; and quantitative recovery of RNA is observed from increasing volumes of cerebrospinal fluid. PMID:23720669

Development and Validation of an Inductively Coupled Plasma Mass Spectrometry (ICP-MS) Method for Quantitative Analysis of Platinum in Plasma, Urine, and Tissues.

PubMed

Zhang, Ti; Cai, Shuang; Forrest, Wai Chee; Mohr, Eva; Yang, Qiuhong; Forrest, M Laird

2016-09-01

Cisplatin, a platinum chemotherapeutic, is one of the most commonly used chemotherapeutic agents for many solid tumors. In this work, we developed and validated an inductively coupled plasma mass spectrometry (ICP-MS) method for quantitative determination of platinum levels in rat urine, plasma, and tissue matrices including liver, brain, lungs, kidney, muscle, heart, spleen, bladder, and lymph nodes. The tissues were processed using a microwave accelerated reaction system (MARS) system prior to analysis on an Agilent 7500 ICP-MS. According to the Food and Drug Administration guidance for industry, bioanalytical validation parameters of the method, such as selectivity, accuracy, precision, recovery, and stability were evaluated in rat biological samples. Our data suggested that the method was selective for platinum without interferences caused by other presenting elements, and the lower limit of quantification was 0.5 ppb. The accuracy and precision of the method were within 15% variation and the recoveries of platinum for all tissue matrices examined were determined to be 85-115% of the theoretical values. The stability of the platinum-containing solutions, including calibration standards, stock solutions, and processed samples in rat biological matrices was investigated. Results indicated that the samples were stable after three cycles of freeze-thaw and for up to three months. © The Author(s) 2016.

Development and Validation of an Inductively Coupled Plasma Mass Spectrometry (ICP-MS) Method for Quantitative Analysis of Platinum in Plasma, Urine, and Tissues

PubMed Central

Zhang, Ti; Cai, Shuang; Forrest, Wai Chee; Mohr, Eva; Yang, Qiuhong; Forrest, M. Laird

2016-01-01

Cisplatin, a platinum chemotherapeutic, is one of the most commonly used chemotherapeutic agents for many solid tumors. In this work, we developed and validated an inductively coupled plasma mass spectrometry (ICP-MS) method for quantitative determination of platinum levels in rat urine, plasma, and tissue matrices including liver, brain, lungs, kidney, muscle, heart, spleen, bladder, and lymph nodes. The tissues were processed using a microwave accelerated reaction system (MARS) system prior to analysis on an Agilent 7500 ICP-MS. According to the Food and Drug Administration guidance for industry, bioanalytical validation parameters of the method, such as selectivity, accuracy, precision, recovery, and stability were evaluated in rat biological samples. Our data suggested that the method was selective for platinum without interferences caused by other presenting elements, and the lower limit of quantification was 0.5 ppb. The accuracy and precision of the method were within 15% variation and the recoveries of platinum for all tissue matrices examined were determined to be 85–115% of the theoretical values. The stability of the platinum-containing solutions, including calibration standards, stock solutions, and processed samples in rat biological matrices was investigated. Results indicated that the samples were stable after three cycles of freeze–thaw and for up to three months. PMID:27527103

Validation of PCR methods for quantitation of genetically modified plants in food.

PubMed

Hübner, P; Waiblinger, H U; Pietsch, K; Brodmann, P

2001-01-01

For enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients, quantitative detection methods such as quantitative competitive (QC-PCR) and real-time PCR are applied by official food control laboratories. The experiences of 3 European food control laboratories in validating such methods were compared to describe realistic performance characteristics of quantitative PCR detection methods. The limit of quantitation (LOQ) of GMO-specific, real-time PCR was experimentally determined to reach 30-50 target molecules, which is close to theoretical prediction. Starting PCR with 200 ng genomic plant DNA, the LOQ depends primarily on the genome size of the target plant and ranges from 0.02% for rice to 0.7% for wheat. The precision of quantitative PCR detection methods, expressed as relative standard deviation (RSD), varied from 10 to 30%. Using Bt176 corn containing test samples and applying Bt176 specific QC-PCR, mean values deviated from true values by -7to 18%, with an average of 2+/-10%. Ruggedness of real-time PCR detection methods was assessed in an interlaboratory study analyzing commercial, homogeneous food samples. Roundup Ready soybean DNA contents were determined in the range of 0.3 to 36%, relative to soybean DNA, with RSDs of about 25%. Taking the precision of quantitative PCR detection methods into account, suitable sample plans and sample sizes for GMO analysis are suggested. Because quantitative GMO detection methods measure GMO contents of samples in relation to reference material (calibrants), high priority must be given to international agreements and standardization on certified reference materials.

Non-animal approaches for toxicokinetics in risk evaluations of food chemicals.

PubMed

Punt, Ans; Peijnenburg, Ad A C M; Hoogenboom, Ron L A P; Bouwmeester, Hans

2017-01-01

The objective of the present work was to review the availability and predictive value of non-animal toxicokinetic approaches and to evaluate their current use in European risk evaluations of food contaminants, additives and food contact materials, as well as pesticides and medicines. Results revealed little use of quantitative animal or human kinetic data in risk evaluations of food chemicals, compared with pesticides and medicines. Risk evaluations of medicines provided sufficient in vivo kinetic data from different species to evaluate the predictive value of animal kinetic data for humans. These data showed a relatively poor correlation between the in vivo bioavailability in rats and dogs versus that in humans. In contrast, in vitro (human) kinetic data have been demonstrated to provide adequate predictions of the fate of compounds in humans, using appropriate in vitro-in vivo scalers and by integration of in vitro kinetic data with in silico kinetic modelling. Even though in vitro kinetic data were found to be occasionally included within risk evaluations of food chemicals, particularly results from Caco-2 absorption experiments and in vitro data on gut-microbial conversions, only minor use of in vitro methods for metabolism and quantitative in vitro-in vivo extrapolation methods was identified. Yet, such quantitative predictions are essential in the development of alternatives to animal testing as well as to increase human relevance of toxicological risk evaluations. Future research should aim at further improving and validating quantitative alternative methods for kinetics, thereby increasing regulatory acceptance of non-animal kinetic data.

Development and application of absolute quantitative detection by duplex chamber-based digital PCR of genetically modified maize events without pretreatment steps.

PubMed

Zhu, Pengyu; Fu, Wei; Wang, Chenguang; Du, Zhixin; Huang, Kunlun; Zhu, Shuifang; Xu, Wentao

2016-04-15

The possibility of the absolute quantitation of GMO events by digital PCR was recently reported. However, most absolute quantitation methods based on the digital PCR required pretreatment steps. Meanwhile, singleplex detection could not meet the demand of the absolute quantitation of GMO events that is based on the ratio of foreign fragments and reference genes. Thus, to promote the absolute quantitative detection of different GMO events by digital PCR, we developed a quantitative detection method based on duplex digital PCR without pretreatment. Moreover, we tested 7 GMO events in our study to evaluate the fitness of our method. The optimized combination of foreign and reference primers, limit of quantitation (LOQ), limit of detection (LOD) and specificity were validated. The results showed that the LOQ of our method for different GMO events was 0.5%, while the LOD is 0.1%. Additionally, we found that duplex digital PCR could achieve the detection results with lower RSD compared with singleplex digital PCR. In summary, the duplex digital PCR detection system is a simple and stable way to achieve the absolute quantitation of different GMO events. Moreover, the LOQ and LOD indicated that this method is suitable for the daily detection and quantitation of GMO events. Copyright © 2016 Elsevier B.V. All rights reserved.

A minimalist biosensor: Quantitation of cyclic di-GMP using the conformational change of a riboswitch aptamer.

PubMed

Kellenberger, Colleen A; Sales-Lee, Jade; Pan, Yuchen; Gassaway, Madalee M; Herr, Amy E; Hammond, Ming C

2015-01-01

Cyclic di-GMP (c-di-GMP) is a second messenger that is important in regulating bacterial physiology and behavior, including motility and virulence. Many questions remain about the role and regulation of this signaling molecule, but current methods of detection are limited by either modest sensitivity or requirements for extensive sample purification. We have taken advantage of a natural, high affinity receptor of c-di-GMP, the Vc2 riboswitch aptamer, to develop a sensitive and rapid electrophoretic mobility shift assay (EMSA) for c-di-GMP quantitation that required minimal engineering of the RNA.

Multispectral analysis of ocean dumped materials

NASA Technical Reports Server (NTRS)

Johnson, R. W.

1977-01-01

Remotely sensed data were collected in conjunction with sea-truth measurements in three experiments in the New York Bight. Pollution features of primary interest were ocean dumped materials, such as sewage sludge and acid waste. Sewage-sludge and acid-waste plumes, including plumes from sewage sludge dumped by the 'line-dump' and 'spot-dump' methods, were located, identified, and mapped. Previously developed quantitative analysis techniques for determining quantitative distributions of materials in sewage sludge dumps were evaluated, along with multispectral analysis techniques developed to identify ocean dumped materials. Results of these experiments and the associated data analysis investigations are presented and discussed.

A Mixed Methods Approach to Equity and Justice Research: Insights from Research on Children's Reasoning About Economic Inequality.

PubMed

Mistry, Rashmita S; White, Elizabeth S; Chow, Kirby A; Griffin, Katherine M; Nenadal, Lindsey

2016-01-01

Mixed methods research approaches are gaining traction across various social science disciplines, including among developmental scientists. In this chapter, we discuss the utility of a mixed methods research approach in examining issues related to equity and justice. We incorporate a brief overview of quantitative and qualitative monomethod research approaches in our larger discussion of the advantages, procedures, and considerations of employing a mixed methods design to advance developmental science from an equity and justice perspective. To better illustrate the theoretical and practical significance of a mixed methods research approach, we include examples of research conducted on children and adolescents' conceptions of economic inequality as one example of developmental science research with an equity and justice frame. © 2016 Elsevier Inc. All rights reserved.

Embedding Quantitative Methods by Stealth in Political Science: Developing a Pedagogy for Psephology

ERIC Educational Resources Information Center

Gunn, Andrew

2017-01-01

Student evaluations of quantitative methods courses in political science often reveal they are characterised by aversion, alienation and anxiety. As a solution to this problem, this paper describes a pedagogic research project with the aim of embedding quantitative methods by stealth into the first-year undergraduate curriculum. This paper…

The Use of Quantitative and Qualitative Methods in the Analysis of Academic Achievement among Undergraduates in Jamaica

ERIC Educational Resources Information Center

McLaren, Ingrid Ann Marie

2012-01-01

This paper describes a study which uses quantitative and qualitative methods in determining the relationship between academic, institutional and psychological variables and degree performance for a sample of Jamaican undergraduate students. Quantitative methods, traditionally associated with the positivist paradigm, and involving the counting and…

Analytical validation of quantitative immunohistochemical assays of tumor infiltrating lymphocyte biomarkers.

PubMed

Singh, U; Cui, Y; Dimaano, N; Mehta, S; Pruitt, S K; Yearley, J; Laterza, O F; Juco, J W; Dogdas, B

2018-06-04

Tumor infiltrating lymphocytes (TIL), especially T-cells, have both prognostic and therapeutic applications. The presence of CD8+ effector T-cells and the ratio of CD8+ cells to FOXP3+ regulatory T-cells have been used as biomarkers of disease prognosis to predict response to various immunotherapies. Blocking the interaction between inhibitory receptors on T-cells and their ligands with therapeutic antibodies including atezolizumab, nivolumab, pembrolizumab and tremelimumab increases the immune response against cancer cells and has shown significant improvement in clinical benefits and survival in several different tumor types. The improved clinical outcome is presumed to be associated with a higher tumor infiltration; therefore, it is thought that more accurate methods for measuring the amount of TIL could assist prognosis and predict treatment response. We have developed and validated quantitative immunohistochemistry (IHC) assays for CD3, CD8 and FOXP3 for immunophenotyping T-lymphocytes in tumor tissue. Various types of formalin fixed, paraffin embedded (FFPE) tumor tissues were immunolabeled with anti-CD3, anti-CD8 and anti-FOXP3 antibodies using an IHC autostainer. The tumor area of stained tissues, including the invasive margin of the tumor, was scored by a pathologist (visual scoring) and by computer-based quantitative image analysis. Two image analysis scores were obtained for the staining of each biomarker: the percent positive cells in the tumor area and positive cells/mm 2 tumor area. Comparison of visual vs. image analysis scoring methods using regression analysis showed high correlation and indicated that quantitative image analysis can be used to score the number of positive cells in IHC stained slides. To demonstrate that the IHC assays produce consistent results in normal daily testing, we evaluated the specificity, sensitivity and reproducibility of the IHC assays using both visual and image analysis scoring methods. We found that CD3, CD8 and FOXP3 IHC assays met the fit-for-purpose analytical acceptance validation criteria and that they can be used to support clinical studies.

Evaluation of a quantitative H2S MPN test for fecal microbes analysis of water using biochemical and molecular identification.

PubMed

McMahan, Lanakila; Grunden, Amy M; Devine, Anthony A; Sobsey, Mark D

2012-04-15

The sensitivity and specificity of the H(2)S test to detect fecal bacteria in water has been variable and uncertain in previous studies, partly due to its presence-absence results. Furthermore, in groundwater samples false-positive results have been reported, with H(2)S-positive samples containing no fecal coliforms or Escherichia coli. False-negative results also have been reported in other studies, with H(2)S-negative samples found to contain E. coli. Using biochemical and molecular methods and a novel quantitative test format, this research identified the types and numbers of microbial community members present in natural water samples, including fecal indicators and pathogens as well as other bacteria. Representative water sources tested in this study included cistern rainwater, a protected lake, and wells in agricultural and forest settings. Samples from quantitative H(2)S tests of water were further cultured for fecal bacteria by spread plating onto the selective media for detection and isolation of Aeromonas spp., E. coli, Clostridium spp., H(2)S-producers, and species of Salmonella and Shigella. Isolates were then tested for H(2)S production, and identified to the genus and species level using biochemical methods. Terminal Restriction Fragment Length Polymorphisms (TRFLP) was the molecular method employed to quantitatively characterize microbial community diversity. Overall, it was shown that water samples testing positive for H(2)S bacteria also had bacteria of likely fecal origin and waters containing fecal pathogens also were positive for H(2)S bacteria. Of the microorganisms isolated from natural water, greater than 70 percent were identified using TRFLP analysis to reveal a relatively stable group of organisms whose community composition differed with water source and over time. These results further document the validity of the H(2)S test for detecting and quantifying fecal contamination of water. Copyright © 2011 Elsevier Ltd. All rights reserved.

Apparatus and method for quantitative assay of generic transuranic wastes from nuclear reactors

DOEpatents

Caldwell, J.T.; Kunz, W.E.; Atencio, J.D.

1982-03-31

A combination of passive and active neutron measurements which yields quantitative information about the isotopic composition of transuranic wastes from nuclear power or weapons material manufacture reactors is described. From the measurement of prompt and delayed neutron emission and the incidence of two coincidentally emitted neutrons from induced fission of fissile material in the sample, one can quantify /sup 233/U, /sup 235/U and /sup 239/Pu isotopes in waste samples. Passive coincidence counting, including neutron multiplicity measurement and determination of the overall passive neutron flux additionally enables the separate quantitative evaluation of spontaneous fission isotopes such as /sup 240/Pu, /sup 244/Cm and /sup 252/Cf, and the spontaneous alpha particle emitter /sup 241/Am. These seven isotopes are the most important constituents of wastes from nuclear power reactors and once the mass of each isotope present is determined by the apparatus and method of the instant invention, the overall alpha particle activity can be determined to better than 1 nCi/g from known radioactivity data. Therefore, in addition to the quantitative analysis of the waste sample useful for later reclamation purposes, the alpha particle activity can be determined to decide whether permanent low-level burial is appropriate for the waste sample.

Apparatus and method for quantitative assay of generic transuranic wastes from nuclear reactors

DOEpatents

Caldwell, John T.; Kunz, Walter E.; Atencio, James D.

1984-01-01

A combination of passive and active neutron measurements which yields quantitative information about the isotopic composition of transuranic wastes from nuclear power or weapons material manufacture reactors is described. From the measurement of prompt and delayed neutron emission and the incidence of two coincidentally emitted neutrons from induced fission of fissile material in the sample, one can quantify .sup.233 U, .sup.235 U and .sup.239 Pu isotopes in waste samples. Passive coincidence counting, including neutron multiplicity measurement and determination of the overall passive neutron flux additionally enables the separate quantitative evaluation of spontaneous fission isotopes such as .sup.240 Pu, .sup.244 Cm and .sup.252 Cf, and the spontaneous alpha particle emitter .sup.241 Am. These seven isotopes are the most important constituents of wastes from nuclear power reactors and once the mass of each isotope present is determined by the apparatus and method of the instant invention, the overall alpha particle activity can be determined to better than 1 nCi/g from known radioactivity data. Therefore, in addition to the quantitative analysis of the waste sample useful for later reclamation purposes, the alpha particle activity can be determined to decide whether "permanent" low-level burial is appropriate for the waste sample.

QDMR: a quantitative method for identification of differentially methylated regions by entropy

PubMed Central

Zhang, Yan; Liu, Hongbo; Lv, Jie; Xiao, Xue; Zhu, Jiang; Liu, Xiaojuan; Su, Jianzhong; Li, Xia; Wu, Qiong; Wang, Fang; Cui, Ying

2011-01-01

DNA methylation plays critical roles in transcriptional regulation and chromatin remodeling. Differentially methylated regions (DMRs) have important implications for development, aging and diseases. Therefore, genome-wide mapping of DMRs across various temporal and spatial methylomes is important in revealing the impact of epigenetic modifications on heritable phenotypic variation. We present a quantitative approach, quantitative differentially methylated regions (QDMRs), to quantify methylation difference and identify DMRs from genome-wide methylation profiles by adapting Shannon entropy. QDMR was applied to synthetic methylation patterns and methylation profiles detected by methylated DNA immunoprecipitation microarray (MeDIP-chip) in human tissues/cells. This approach can give a reasonable quantitative measure of methylation difference across multiple samples. Then DMR threshold was determined from methylation probability model. Using this threshold, QDMR identified 10 651 tissue DMRs which are related to the genes enriched for cell differentiation, including 4740 DMRs not identified by the method developed by Rakyan et al. QDMR can also measure the sample specificity of each DMR. Finally, the application to methylation profiles detected by reduced representation bisulphite sequencing (RRBS) in mouse showed the platform-free and species-free nature of QDMR. This approach provides an effective tool for the high-throughput identification of potential functional regions involved in epigenetic regulation. PMID:21306990

An Quantitative Analysis Method Of Trabecular Pattern In A Bone

NASA Astrophysics Data System (ADS)

Idesawa, Masanor; Yatagai, Toyohiko

1982-11-01

Orientation and density of trabecular pattern observed in a bone is closely related to its mechanical properties and deseases of a bone are appeared as changes of orientation and/or density distrbution of its trabecular patterns. They have been treated from a qualitative point of view so far because quantitative analysis method has not be established. In this paper, the authors proposed and investigated some quantitative analysis methods of density and orientation of trabecular patterns observed in a bone. These methods can give an index for evaluating orientation of trabecular pattern quantitatively and have been applied to analyze trabecular pattern observed in a head of femur and their availabilities are confirmed. Key Words: Index of pattern orientation, Trabecular pattern, Pattern density, Quantitative analysis

Visual Search with Image Modification in Age-Related Macular Degeneration

PubMed Central

Wiecek, Emily; Jackson, Mary Lou; Dakin, Steven C.; Bex, Peter

2012-01-01

Purpose. AMD results in loss of central vision and a dependence on low-resolution peripheral vision. While many image enhancement techniques have been proposed, there is a lack of quantitative comparison of the effectiveness of enhancement. We developed a natural visual search task that uses patients' eye movements as a quantitative and functional measure of the efficacy of image modification. Methods. Eye movements of 17 patients (mean age = 77 years) with AMD were recorded while they searched for target objects in natural images. Eight different image modification methods were implemented and included manipulations of local image or edge contrast, color, and crowding. In a subsequent task, patients ranked their preference of the image modifications. Results. Within individual participants, there was no significant difference in search duration or accuracy across eight different image manipulations. When data were collapsed across all image modifications, a multivariate model identified six significant predictors for normalized search duration including scotoma size and acuity, as well as interactions among scotoma size, age, acuity, and contrast (P < 0.05). Additionally, an analysis of image statistics showed no correlation with search performance across all image modifications. Rank ordering of enhancement methods based on participants' preference revealed a trend that participants preferred the least modified images (P < 0.05). Conclusions. There was no quantitative effect of image modification on search performance. A better understanding of low- and high-level components of visual search in natural scenes is necessary to improve future attempts at image enhancement for low vision patients. Different search tasks may require alternative image modifications to improve patient functioning and performance. PMID:22930725

Methods to estimate the transfer of contaminants into recycling products - A case study from Austria.

PubMed

Knapp, Julika; Allesch, Astrid; Müller, Wolfgang; Bockreis, Anke

2017-11-01

Recycling of waste materials is desirable to reduce the consumption of limited primary resources, but also includes the risk of recycling unwanted, hazardous substances. In Austria, the legal framework demands secondary products must not present a higher risk than comparable products derived from primary resources. However, the act provides no definition on how to assess this risk potential. This paper describes the development of different quantitative and qualitative methods to estimate the transfer of contaminants in recycling processes. The quantitative methods comprise the comparison of concentrations of harmful substances in recycling products to corresponding primary products and to existing limit values. The developed evaluation matrix, which considers further aspects, allows for the assessment of the qualitative risk potential. The results show that, depending on the assessed waste fraction, particular contaminants can be critical. Their concentrations were higher than in comparable primary materials and did not comply with existing limit values. On the other hand, the results show that a long-term, well-established quality control system can assure compliance with the limit values. The results of the qualitative assessment obtained with the evaluation matrix support the results of the quantitative assessment. Therefore, the evaluation matrix can be suitable to quickly screen waste streams used for recycling to estimate their potential environmental and health risks. To prevent the transfer of contaminants into product cycles, improved data of relevant substances in secondary resources are necessary. In addition, regulations for material recycling are required to assure adequate quality control measures, including limit values. Copyright © 2017 Elsevier Ltd. All rights reserved.

A new dimethyl labeling-based SID-MRM-MS method and its application to three proteases involved in insulin maturation.

PubMed

Cheng, Dongwan; Zheng, Li; Hou, Junjie; Wang, Jifeng; Xue, Peng; Yang, Fuquan; Xu, Tao

2015-01-01

The absolute quantification of target proteins in proteomics involves stable isotope dilution coupled with multiple reactions monitoring mass spectrometry (SID-MRM-MS). The successful preparation of stable isotope-labeled internal standard peptides is an important prerequisite for the SID-MRM absolute quantification methods. Dimethyl labeling has been widely used in relative quantitative proteomics and it is fast, simple, reliable, cost-effective, and applicable to any protein sample, making it an ideal candidate method for the preparation of stable isotope-labeled internal standards. MRM mass spectrometry is of high sensitivity, specificity, and throughput characteristics and can quantify multiple proteins simultaneously, including low-abundance proteins in precious samples such as pancreatic islets. In this study, a new method for the absolute quantification of three proteases involved in insulin maturation, namely PC1/3, PC2 and CPE, was developed by coupling a stable isotope dimethyl labeling strategy for internal standard peptide preparation with SID-MRM-MS quantitative technology. This method offers a new and effective approach for deep understanding of the functional status of pancreatic β cells and pathogenesis in diabetes.

Quantitative Determination of Cannabinoids in Cannabis and Cannabis Products Using Ultra-High-Performance Supercritical Fluid Chromatography and Diode Array/Mass Spectrometric Detection.

PubMed

Wang, Mei; Wang, Yan-Hong; Avula, Bharathi; Radwan, Mohamed M; Wanas, Amira S; Mehmedic, Zlatko; van Antwerp, John; ElSohly, Mahmoud A; Khan, Ikhlas A

2017-05-01

Ultra-high-performance supercritical fluid chromatography (UHPSFC) is an efficient analytical technique and has not been fully employed for the analysis of cannabis. Here, a novel method was developed for the analysis of 30 cannabis plant extracts and preparations using UHPSFC/PDA-MS. Nine of the most abundant cannabinoids, viz. CBD, ∆ 8 -THC, THCV, ∆ 9 -THC, CBN, CBG, THCA-A, CBDA, and CBGA, were quantitatively determined (RSDs < 6.9%). Unlike GC methods, no derivatization or decarboxylation was required prior to UHPSFC analysis. The UHPSFC chromatographic separation of cannabinoids displayed an inverse elution order compared to UHPLC. Combining with PDA-MS, this orthogonality is valuable for discrimination of cannabinoids in complex matrices. The developed method was validated, and the quantification results were compared with a standard UHPLC method. The RSDs of these two methods were within ±13.0%. Finally, chemometric analysis including principal component analysis (PCA) and partial least squares-discriminant analysis (PLS-DA) were used to differentiate between cannabis samples. © 2016 American Academy of Forensic Sciences.

Importance of mixed methods in pragmatic trials and dissemination and implementation research.

PubMed

Albright, Karen; Gechter, Katherine; Kempe, Allison

2013-01-01

With increased attention to the importance of translating research to clinical practice and policy, recent years have seen a proliferation of particular types of research, including pragmatic trials and dissemination and implementation research. Such research seeks to understand how and why interventions function in real-world settings, as opposed to highly controlled settings involving conditions not likely to be repeated outside the research study. Because understanding the context in which interventions are implemented is imperative for effective pragmatic trials and dissemination and implementation research, the use of mixed methods is critical to understanding trial results and the success or failure of implementation efforts. This article discusses a number of dimensions of mixed methods research, utilizing at least one qualitative method and at least one quantitative method, that may be helpful when designing projects or preparing grant proposals. Although the strengths and emphases of qualitative and quantitative approaches differ substantially, methods may be combined in a variety of ways to achieve a deeper level of understanding than can be achieved by one method alone. However, researchers must understand when and how to integrate the data as well as the appropriate order, priority, and purpose of each method. The ability to demonstrate an understanding of the rationale for and benefits of mixed methods research is increasingly important in today's competitive funding environment, and many funding agencies now expect applicants to include mixed methods in proposals. The increasing demand for mixed methods research necessitates broader methodological training and deepened collaboration between medical, clinical, and social scientists. Although a number of challenges to conducting and disseminating mixed methods research remain, the potential for insight generated by such work is substantial. Copyright © 2013 Academic Pediatric Association. Published by Elsevier Inc. All rights reserved.

A liquid chromatography–tandem mass spectrometric method for quantitative determination of native 5-methyltetrahydrofolate and its polyglutamyl derivatives in raw vegetables

PubMed Central

Wang, Chao; Riedl, Ken M.; Schwartz, Steven J.

2013-01-01

Folate deficiency is a prevalent phenomenon worldwide especially in underprivileged countries. Polyglutamyl 5-methyltetrahydrofolate (5MTHF) species are the naturally occurring principle folate in store-bought vegetables. Here we report a simple and complete extraction method for the determination of native polyglutamyl 5-methyltetrahydrofolate in vegetables using high performance liquid chromatography with tandem mass spectrometric detection (HPLC–MS/MS). Coarsely chopped samples (18 different vegetables) were steamed to inactivate glutamylase enzymes and liberate folate from binding proteins and extracted in a reducing buffer with 13C5 5MTHF stable isotope added as internal standard. The polyglutamyl 5-methyltetrahydrofolate species were separated in 9 min on a C18 column using a reversed phase system. HPLC eluate was interfaced with a triple quadrupole mass spectrometer operated in electrospray positive mode. The respective pseudomolecular cation of each polyglutamyl 5-methyltetrahydrofolate species was selected for fragmentation to a common daughter ion for detection. We quantitated polyglutamyl 5-methyltetrahydrofolate in store-bought vegetables from families Brassicaceae, Asteraceae and Amaranthaceae (including mustard greens, romaine lettuce and Swiss chard) of which most have not been quantitated previously. Most vegetables from Asteraceae and those from Amaranthaceae contained similar amounts of monoglutamyl 5MTHF and polyglutamyl 5MTHF while Brassicaceae were dominated by polyglutamyls and endive species (Asteraceae) contained mainly monoglutamyl 5MTHF. The precision of the method for the various polyglutamyl 5-methyltetrahydrofolate forms was 1–9% RSD, recovery 84–91%, limit of detection 64–658 fmol and limit of quantitation 193–1994 fmol. Herein we describe a rapid, sensitive and selective HPLC–MS/MS technique to quantitate polyglutamyl 5-methyltetrahydrofolate species. This method may be suitable for analyzing the polyglutamyl 5-methyltetrahydrofolate profile of inherent folates in a wide range of leafy green vegetables. PMID:20888309

On-line miniaturized asymmetrical flow field-flow fractionation-electrospray ionization-tandem mass spectrometry with selected reaction monitoring for quantitative analysis of phospholipids in plasma lipoproteins.

PubMed

Yang, Iseul; Kim, Ki Hun; Lee, Ju Yong; Moon, Myeong Hee

2014-01-10

A direct analytical method for high speed quantitative analysis of lipids in human blood plasma using on-line chip-type asymmetrical flow field-flow fractionation-electrospray ionization-tandem mass spectrometry (cAF4-ESI-MS/MS) with selected reaction monitoring (SRM) is described in this study. Utilizing a miniaturized cAF4 channel, high speed size separation of high density lipoproteins (HDL) and low density lipoproteins (LDL) from plasma samples can be accomplished at a microflow rate along with simultaneous desalting of lipoproteins, both of which are conducive to direct ESI of lipids in lipoproteins. This study demonstrates that the SRM method to monitor phospholipids during cAF4-ESI-MS/MS can be successfully applied to the quantitation of lipid molecules in plasma lipoproteins without the need of a separate lipid extraction process. For quantitation of lipids in HDL and LDL during cAF4-ESI-MS/MS runs, a protein standard (carbonic anhydrase, 29 kDa) was added to each plasma sample as an internal standard such that a peak intensity of y67(+5) ions, which are high abundant SRM product ions of CA, could be utilized to calculate the relative intensity of each lipid molecule. The developed method was applied to plasma samples from 10 patients with coronary artery disease (CAD) and 10 healthy control samples, and quantitative analysis of 39 lipid molecules including phosphatidylcholines, phosphatidylethanolamines, sphingomyelins, phosphatidylglycerols, and phosphatidylinositols, resulted in the selection of 13 PL species showing more than 2.5 fold difference in relative abundance (p<0.01) between the groups. The present study demonstrates a high speed analytical method for determining plasma lipid content and distribution without an organic solvent extraction of lipids from plasma. Copyright © 2013 Elsevier B.V. All rights reserved.

Quantitative analysis of γ-oryzanol content in cold pressed rice bran oil by TLC-image analysis method.

PubMed

Sakunpak, Apirak; Suksaeree, Jirapornchai; Monton, Chaowalit; Pathompak, Pathamaporn; Kraisintu, Krisana

2014-02-01

To develop and validate an image analysis method for quantitative analysis of γ-oryzanol in cold pressed rice bran oil. TLC-densitometric and TLC-image analysis methods were developed, validated, and used for quantitative analysis of γ-oryzanol in cold pressed rice bran oil. The results obtained by these two different quantification methods were compared by paired t-test. Both assays provided good linearity, accuracy, reproducibility and selectivity for determination of γ-oryzanol. The TLC-densitometric and TLC-image analysis methods provided a similar reproducibility, accuracy and selectivity for the quantitative determination of γ-oryzanol in cold pressed rice bran oil. A statistical comparison of the quantitative determinations of γ-oryzanol in samples did not show any statistically significant difference between TLC-densitometric and TLC-image analysis methods. As both methods were found to be equal, they therefore can be used for the determination of γ-oryzanol in cold pressed rice bran oil.

Detection of genetically modified organisms in foods by DNA amplification techniques.

PubMed

García-Cañas, Virginia; Cifuentes, Alejandro; González, Ramón

2004-01-01

In this article, the different DNA amplification techniques that are being used for detecting genetically modified organisms (GMOs) in foods are examined. This study intends to provide an updated overview (including works published till June 2002) on the principal applications of such techniques together with their main advantages and drawbacks in GMO detection in foods. Some relevant facts on sampling, DNA isolation, and DNA amplification methods are discussed. Moreover; these analytical protocols are discuissed from a quantitative point of view, including the newest investigations on multiplex detection of GMOs in foods and validation of methods.

A community-based, mixed-methods study of the attitudes and behaviors of men regarding modern family planning in Nigeria.

PubMed

Akaba, Godwin; Ketare, Nathaniel; Tile, Wilfred

2016-10-01

To investigate the knowledge, attitudes, and extent of involvement of men in family planning in Nigeria, and to evaluate spousal communication regarding family planning. A community-based, mixed-methods study enrolled participants in Gwagwalada, Abuja, Nigeria between January 11 and June 30, 2012. Quantitative surveys including semi-structured interviews were used to collect information from married men regarding their knowledge and attitudes to modern family planning. The qualitative components constituted focus group discussion sessions and in-depth interviews that included married men, married women, religious leaders, community leaders, and family-planning providers. Quantitative surveys were completed by 152 men; 99 (65.1%) reported that they would accompany their wives to family-planning clinics in the future, 116 (76.3%) reported approving of the use of modern contraception by their wives, and 132 (86.8%) reported wanting to know more about family planning. Both quantitative and qualitative aspects of the study indicated that husbands were the major decision makers regarding family size, choice of contraceptive, and pregnancy timing. In terms of fertility goals and family planning, men were the primary decision makers; consequently, obtaining their support and commitment to family planning is of crucial importance in Nigeria. Copyright © 2016 International Federation of Gynecology and Obstetrics. Published by Elsevier Ireland Ltd. All rights reserved.

Characterization of Cerebral White Matter Properties Using Quantitative Magnetic Resonance Imaging Stains

PubMed Central

Hurley, Samuel A.; Samsonov, Alexey A.; Adluru, Nagesh; Hosseinbor, Ameer Pasha; Mossahebi, Pouria; Tromp, Do P.M.; Zakszewski, Elizabeth; Field, Aaron S.

2011-01-01

Abstract The image contrast in magnetic resonance imaging (MRI) is highly sensitive to several mechanisms that are modulated by the properties of the tissue environment. The degree and type of contrast weighting may be viewed as image filters that accentuate specific tissue properties. Maps of quantitative measures of these mechanisms, akin to microstructural/environmental-specific tissue stains, may be generated to characterize the MRI and physiological properties of biological tissues. In this article, three quantitative MRI (qMRI) methods for characterizing white matter (WM) microstructural properties are reviewed. All of these measures measure complementary aspects of how water interacts with the tissue environment. Diffusion MRI, including diffusion tensor imaging, characterizes the diffusion of water in the tissues and is sensitive to the microstructural density, spacing, and orientational organization of tissue membranes, including myelin. Magnetization transfer imaging characterizes the amount and degree of magnetization exchange between free water and macromolecules like proteins found in the myelin bilayers. Relaxometry measures the MRI relaxation constants T1 and T2, which in WM have a component associated with the water trapped in the myelin bilayers. The conduction of signals between distant brain regions occurs primarily through myelinated WM tracts; thus, these methods are potential indicators of pathology and structural connectivity in the brain. This article provides an overview of the qMRI stain mechanisms, acquisition and analysis strategies, and applications for these qMRI stains. PMID:22432902

Commutability of the First World Health Organization International Standard for Human Cytomegalovirus

PubMed Central

Preiksaitis, J.; Tong, Y.; Pang, X.; Sun, Y.; Tang, L.; Cook, L.; Pounds, S.; Fryer, J.; Caliendo, A. M.

2015-01-01

Quantitative detection of cytomegalovirus (CMV) DNA has become a standard part of care for many groups of immunocompromised patients; recent development of the first WHO international standard for human CMV DNA has raised hopes of reducing interlaboratory variability of results. Commutability of reference material has been shown to be necessary if such material is to reduce variability among laboratories. Here we evaluated the commutability of the WHO standard using 10 different real-time quantitative CMV PCR assays run by eight different laboratories. Test panels, including aliquots of 50 patient samples (40 positive samples and 10 negative samples) and lyophilized CMV standard, were run, with each testing center using its own quantitative calibrators, reagents, and nucleic acid extraction methods. Commutability was assessed both on a pairwise basis and over the entire group of assays, using linear regression and correspondence analyses. Commutability of the WHO material differed among the tests that were evaluated, and these differences appeared to vary depending on the method of statistical analysis used and the cohort of assays included in the analysis. Depending on the methodology used, the WHO material showed poor or absent commutability with up to 50% of assays. Determination of commutability may require a multifaceted approach; the lack of commutability seen when using the WHO standard with several of the assays here suggests that further work is needed to bring us toward true consensus. PMID:26269622

Indigenous health program evaluation design and methods in Australia: a systematic review of the evidence.

PubMed

Lokuge, Kamalini; Thurber, Katherine; Calabria, Bianca; Davis, Meg; McMahon, Kathryn; Sartor, Lauren; Lovett, Raymond; Guthrie, Jill; Banks, Emily

2017-10-01

Indigenous Australians experience a disproportionately higher burden of disease compared to non-Indigenous Australians. High-quality evaluation of Indigenous health programs is required to inform health and health services improvement. We aimed to quantify methodological and other characteristics of Australian Indigenous health program evaluations published in the peer-reviewed literature. Systematic review of peer-reviewed literature (November 2009-2014) on Indigenous health program evaluation. We identified 118 papers describing evaluations of 109 interventions; 72.0% were university/research institution-led. 82.2% of evaluations included a quantitative component; 49.2% utilised quantitative data only and 33.1% used both quantitative and qualitative data. The most common design was a before/after comparison (30.5%, n=36/118). 7.6% of studies (n=9/118) used an experimental design: six individual-level and three cluster-randomised controlled trials. 56.8% (67/118) reported on service delivery/process outcomes (versus health or health risk factor outcomes) only. Given the number of Indigenous health programs that are implemented, few evaluations overall are published in the peer-reviewed literature and, of these, few use optimal methodologies such as mixed methods and experimental design. Implications for public health: Multiple strategies are required to increase high-quality, accessible evaluation in Indigenous health, including supporting stronger research-policy-practice partnerships and capacity building for evaluation by health services and government. © 2017 The Authors.

LC/MS/MS Bioanalysis of Protein-Drug Conjugates-The Importance of Incorporating Succinimide Hydrolysis Products.

PubMed

Shi, Chuan; Goldberg, Shalom; Lin, Tricia; Dudkin, Vadim; Widdison, Wayne; Harris, Luke; Wilhelm, Sharon; Jmeian, Yazen; Davis, Darryl; O'Neil, Karyn; Weng, Naidong; Jian, Wenying

2018-04-17

Bioanalysis of antibody-drug conjugates (ADCs) is challenging due to the complex, heterogeneous nature of their structures and their complicated catabolism. To fully describe the pharmacokinetics (PK) of an ADC, several analytes are commonly quantified, including total antibody, conjugate, and payload. Among them, conjugate is the most challenging to measure, because it requires detection of both small and large molecules as one entity. Existing approaches to quantify the conjugated species of ADCs involve a ligand binding assay (LBA) for conjugated antibody or hybrid LBA/liquid chromatography/tandem mass spectrometry (LC/MS/MS) for quantitation of conjugated drug. In our current work for a protein-drug conjugate (PDC) using the Centyrin scaffold, a similar concept to ADCs but with smaller protein size, an alternative method to quantify the conjugate by using a surrogate peptide approach, was utilized. The His-tagged proteins were isolated from biological samples using immobilized metal affinity chromatography (IMAC), followed by trypsin digestion. The tryptic peptide containing the linker attached to the payload was used as a surrogate of the conjugate and monitored by LC/MS/MS analysis. During method development and its application, we found that hydrolysis of the succinimide ring of the linker was ubiquitous, taking place at many stages during the lifetime of the PDC including in the initial drug product, in vivo in circulation in the animals, and ex vivo during the trypsin digestion step of the sample preparation. We have shown that hydrolysis during trypsin digestion is concentration-independent and consistent during the work flow-therefore, having no impact on assay performance. However, for samples that have undergone extensive hydrolysis prior to trypsin digestion, significant bias could be introduced if only the non-hydrolyzed form is considered in the quantitation. Therefore, it is important to incorporate succinimide hydrolysis products in the quantitation method in order to provide an accurate estimation of the total conjugate level. More importantly, the LC/MS/MS-based method described here provides a useful tool to quantitatively evaluate succinimide hydrolysis of ADCs in vivo, which has been previously reported to have significant impact on their stability, exposure, and efficacy.

Measuring past glacier fluctuations from historic photographs geolocated using Structure from Motion

NASA Astrophysics Data System (ADS)

Vargo, L.; Anderson, B.; Horgan, H. J.; Mackintosh, A.; Lorrey, A.; Thornton, M.

2017-12-01

Quantifying glacier fluctuations is important for understanding how the cryosphere responds to climate variability and change. Photographs of past ice extents have become iconic images of climate change, but until now incorporating these images into quantitative estimates of glacier change has been problematic. We present a new method to quantitatively measure past glacier fluctuations from historic images. The method uses a large set of modern geolocated photographs and Structure from Motion (SfM) to calculate the camera parameters for the historic images, including the location from which they were taken. We initially apply this method to a small maritime New Zealand glacier (Brewster Glacier, 44°S, 2 km2), and quantify annual equilibrium line altitudes (ELAs) and length changes from historic oblique aerial photographs (1981 - 2017). Results show that Brewster has retreated 364 ± 12 m since 1981 and, using independent field measurements of terminus positions (2005 - 2014), we show that this SfM-derived length record accurately captures glacier change. We calculate the uncertainties associated with this method using known coordinates of bedrock features surrounding the glacier. Mean uncertainties in the ELA and length records are 7 m and 11 m, respectively. In addition to Brewster, 49 other New Zealand glaciers have been monitored by aerial photographs since 1978. However, the length records for these glaciers only include years of relative advance or retreat, and no length changes have been quantified. We will ultimately apply this method to all 50 glaciers, expanding the database of New Zealand glacier fluctuations that until now included only a few glaciers. This method can be further applied to any glacier with historic images, and can be used to measure past changes in glacier width, area, and surface elevation in addition to ELA and length.

Contextualizing and assessing the social capital of seniors in congregate housing residences: study design and methods

PubMed Central

Moore, Spencer; Shiell, Alan; Haines, Valerie; Riley, Therese; Collier, Carrie

2005-01-01

Background This article discusses the study design and methods used to contextualize and assess the social capital of seniors living in congregate housing residences in Calgary, Alberta. The project is being funded as a pilot project under the Institute of Aging, Canadian Institutes for Health Research. Design/Methods Working with seniors living in 5 congregate housing residencies in Calgary, the project uses a mixed method approach to develop grounded measures of the social capital of seniors. The project integrates both qualitative and quantitative methods in a 3-phase research design: 1) qualitative, 2) quantitative, and 3) qualitative. Phase 1 uses gender-specific focus groups; phase 2 involves the administration of individual surveys that include a social network module; and phase 3 uses anamolous-case interviews. Not only does the study design allow us to develop grounded measures of social capital but it also permits us to test how well the three methods work separately, and how well they fit together to achieve project goals. This article describes the selection of the study population, the multiple methods used in the research and a brief discussion of our conceptualization and measurement of social capital. PMID:15836784

The Specificity of Observational Studies in Physical Activity and Sports Sciences: Moving Forward in Mixed Methods Research and Proposals for Achieving Quantitative and Qualitative Symmetry.

PubMed

Anguera, M Teresa; Camerino, Oleguer; Castañer, Marta; Sánchez-Algarra, Pedro; Onwuegbuzie, Anthony J

2017-01-01

Mixed methods studies are been increasingly applied to a diversity of fields. In this paper, we discuss the growing use-and enormous potential-of mixed methods research in the field of sport and physical activity. A second aim is to contribute to strengthening the characteristics of mixed methods research by showing how systematic observation offers rigor within a flexible framework that can be applied to a wide range of situations. Observational methodology is characterized by high scientific rigor and flexibility throughout its different stages and allows the objective study of spontaneous behavior in natural settings, with no external influence. Mixed methods researchers need to take bold yet thoughtful decisions regarding both substantive and procedural issues. We present three fundamental and complementary ideas to guide researchers in this respect: we show why studies of sport and physical activity that use a mixed methods research approach should be included in the field of mixed methods research, we highlight the numerous possibilities offered by observational methodology in this field through the transformation of descriptive data into quantifiable code matrices, and we discuss possible solutions for achieving true integration of qualitative and quantitative findings.

Towards standardized assessment of endoscope optical performance: geometric distortion

NASA Astrophysics Data System (ADS)

Wang, Quanzeng; Desai, Viraj N.; Ngo, Ying Z.; Cheng, Wei-Chung; Pfefer, Joshua

2013-12-01

Technological advances in endoscopes, such as capsule, ultrathin and disposable devices, promise significant improvements in safety, clinical effectiveness and patient acceptance. Unfortunately, the industry lacks test methods for preclinical evaluation of key optical performance characteristics (OPCs) of endoscopic devices that are quantitative, objective and well-validated. As a result, it is difficult for researchers and developers to compare image quality and evaluate equivalence to, or improvement upon, prior technologies. While endoscope OPCs include resolution, field of view, and depth of field, among others, our focus in this paper is geometric image distortion. We reviewed specific test methods for distortion and then developed an objective, quantitative test method based on well-defined experimental and data processing steps to evaluate radial distortion in the full field of view of an endoscopic imaging system. Our measurements and analyses showed that a second-degree polynomial equation could well describe the radial distortion curve of a traditional endoscope. The distortion evaluation method was effective for correcting the image and can be used to explain other widely accepted evaluation methods such as picture height distortion. Development of consensus standards based on promising test methods for image quality assessment, such as the method studied here, will facilitate clinical implementation of innovative endoscopic devices.

SERS quantitative urine creatinine measurement of human subject

NASA Astrophysics Data System (ADS)

Wang, Tsuei Lian; Chiang, Hui-hua K.; Lu, Hui-hsin; Hung, Yung-da

2005-03-01

SERS method for biomolecular analysis has several potentials and advantages over traditional biochemical approaches, including less specimen contact, non-destructive to specimen, and multiple components analysis. Urine is an easily available body fluid for monitoring the metabolites and renal function of human body. We developed surface-enhanced Raman scattering (SERS) technique using 50nm size gold colloidal particles for quantitative human urine creatinine measurements. This paper shows that SERS shifts of creatinine (104mg/dl) in artificial urine is from 1400cm-1 to 1500cm-1 which was analyzed for quantitative creatinine measurement. Ten human urine samples were obtained from ten healthy persons and analyzed by the SERS technique. Partial least square cross-validation (PLSCV) method was utilized to obtain the estimated creatinine concentration in clinically relevant (55.9mg/dl to 208mg/dl) concentration range. The root-mean square error of cross validation (RMSECV) is 26.1mg/dl. This research demonstrates the feasibility of using SERS for human subject urine creatinine detection, and establishes the SERS platform technique for bodily fluids measurement.

freeQuant: A Mass Spectrometry Label-Free Quantification Software Tool for Complex Proteome Analysis.

PubMed

Deng, Ning; Li, Zhenye; Pan, Chao; Duan, Huilong

2015-01-01

Study of complex proteome brings forward higher request for the quantification method using mass spectrometry technology. In this paper, we present a mass spectrometry label-free quantification tool for complex proteomes, called freeQuant, which integrated quantification with functional analysis effectively. freeQuant consists of two well-integrated modules: label-free quantification and functional analysis with biomedical knowledge. freeQuant supports label-free quantitative analysis which makes full use of tandem mass spectrometry (MS/MS) spectral count, protein sequence length, shared peptides, and ion intensity. It adopts spectral count for quantitative analysis and builds a new method for shared peptides to accurately evaluate abundance of isoforms. For proteins with low abundance, MS/MS total ion count coupled with spectral count is included to ensure accurate protein quantification. Furthermore, freeQuant supports the large-scale functional annotations for complex proteomes. Mitochondrial proteomes from the mouse heart, the mouse liver, and the human heart were used to evaluate the usability and performance of freeQuant. The evaluation showed that the quantitative algorithms implemented in freeQuant can improve accuracy of quantification with better dynamic range.

Quantitative imaging biomarkers: a review of statistical methods for computer algorithm comparisons.

PubMed

Obuchowski, Nancy A; Reeves, Anthony P; Huang, Erich P; Wang, Xiao-Feng; Buckler, Andrew J; Kim, Hyun J Grace; Barnhart, Huiman X; Jackson, Edward F; Giger, Maryellen L; Pennello, Gene; Toledano, Alicia Y; Kalpathy-Cramer, Jayashree; Apanasovich, Tatiyana V; Kinahan, Paul E; Myers, Kyle J; Goldgof, Dmitry B; Barboriak, Daniel P; Gillies, Robert J; Schwartz, Lawrence H; Sullivan, Daniel C

2015-02-01

Quantitative biomarkers from medical images are becoming important tools for clinical diagnosis, staging, monitoring, treatment planning, and development of new therapies. While there is a rich history of the development of quantitative imaging biomarker (QIB) techniques, little attention has been paid to the validation and comparison of the computer algorithms that implement the QIB measurements. In this paper we provide a framework for QIB algorithm comparisons. We first review and compare various study designs, including designs with the true value (e.g. phantoms, digital reference images, and zero-change studies), designs with a reference standard (e.g. studies testing equivalence with a reference standard), and designs without a reference standard (e.g. agreement studies and studies of algorithm precision). The statistical methods for comparing QIB algorithms are then presented for various study types using both aggregate and disaggregate approaches. We propose a series of steps for establishing the performance of a QIB algorithm, identify limitations in the current statistical literature, and suggest future directions for research. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Anthropometric and quantitative EMG status of femoral quadriceps before and after conventional kinesitherapy with and without magnetotherapy.

PubMed

Graberski Matasović, M; Matasović, T; Markovac, Z

1997-06-01

The frequency of femoral quadriceps muscle hypotrophy has become a significant therapeutic problem. Efforts are being made to improve the standard scheme of kinesitherapeutic treatment by using additional more effective therapeutic methods. Beside kinesitherapy, the authors have used magnetotherapy in 30 of the 60 patients. The total of 60 patients, both sexes, similar age groups and intensity of hypotrophy, were included in the study. They were divided into groups A and B, the experimental and the control one (30 patients each). The treatment was scheduled for the usual 5-6 weeks. Electromyographic quantitative analysis was used to check-up the treatment results achieved after 5 and 6 weeks of treatment period. Analysis of results has confirmed the assumption that magnetotherapy may yield better and faster treatment results, disappearance of pain and decreased risk of complications. The same results were obtained in the experimental group, only one week earlier than in the control group. The EMG quantitative analysis has not proved sufficiently reliable and objective method in the assessment of real condition of the muscle and effects of treatment.

A double-label time-resolved fluorescent strip for rapidly quantitative detection of carbofuran residues in agro-products.

PubMed

Zhang, Qi; Qu, Qiaoyu; Chen, Shanshan; Liu, Xiaowei; Li, Peiwu

2017-09-15

A rapid and quantitative time-resolved fluorescent immunochromatographic assay (TRFICA) for detecting carbofuran residues in agro-products was reported in this paper. This assay was developed based on double-label immunoprobes, one of which was a carbofuran-specific antibody coupled with europium microbeads for the test (T) line signal while the other was mouse IgG coupled with europium microbeads for the control (C) line signal. Quantitative relationships between carbofuran concentrations and T/C ratios were established to determine the analyte concentration. To increase assay accuracy, four standard curves were established for the agro-products (green bean, cabbage, apple, and pear). The limits of detection (LODs) ranged from 0.04 to 0.76mgL -1 . The spiked recoveries of carbofuran in the agro-products were in the range of 81-103%, which was in good agreement with a standard HPLC method. Therefore, we provided a new and reliable method for determination of N-methylcarbamate pesticide carbofuran residues in agro-products including vegetables and fruits. Copyright © 2017. Published by Elsevier Ltd.

Barriers to GPs' use of evidence-based medicine: a systematic review

PubMed Central

Zwolsman, Sandra; te Pas, Ellen; Hooft, Lotty; Waard, Margreet Wieringa-de; van Dijk, Nynke

2012-01-01

Background GPs report various barriers to the use and practice of evidence-based medicine (EBM). A review of research on these barriers may help solve problems regarding the uptake of evidence in clinical outpatient practice. Aim To determine the barriers encountered by GPs in the practice of EBM and to come up with solutions to the barriers identified. Design A systematic review of the literature. Method The following databases were searched: MEDLINE® (PubMed®), Embase, CINAHL®, ERIC, and the Cochrane Library, until February 2011. Primary studies (all methods, all languages) that explore the barriers that GPs encounter in the practice of EBM were included. Results A total of 14 700 articles were identified, of which 22 fulfilled all inclusion criteria. Of the latter, nine concerned qualitative, 12 concerned quantitative, and one concerned both qualitative and quantitative research methods. The barriers described in the articles cover the categories: evidence (including the accompanying EBM steps), the GP’s preferences (experience, expertise, education), and the patient’s preferences. The particular GP setting also has important barriers to the use of EBM. Barriers found in this review, among others, include lack of time, EBM skills, and available evidence; patient-related factors; and the attitude of the GP. Conclusion Various barriers are encountered when using EBM in GP practice. Interventions that help GPs to overcome these barriers are needed, both within EBM education and in clinical practice. PMID:22781999