A PCR primer bank for quantitative gene expression analysis.
Wang, Xiaowei; Seed, Brian
2003-12-15
Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.
Design of primers and probes for quantitative real-time PCR methods.
Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J
2015-01-01
Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.
A tool for design of primers for microRNA-specific quantitative RT-qPCR.
Busk, Peter K
2014-01-28
MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Sato, Naoki; Seo, Genichiro; Benno, Yoshimi
2014-01-01
Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859
Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias
2016-01-01
Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.
Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias
2016-01-01
Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543
Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel
2011-01-01
Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659
Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm
2012-01-01
We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644
CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design
Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven
2003-01-01
We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413
Hepatitis C Virus RNA Real-Time Quantitative RT-PCR Method Based on a New Primer Design Strategy.
Chen, Lida; Li, Wenli; Zhang, Kuo; Zhang, Rui; Lu, Tian; Hao, Mingju; Jia, Tingting; Sun, Yu; Lin, Guigao; Wang, Lunan; Li, Jinming
2016-01-01
Viral nucleic acids are unstable when improperly collected, handled, and stored, resulting in decreased sensitivity of currently available commercial quantitative nucleic acid testing kits. Using known unstable hepatitis C virus RNA, we developed a quantitative RT-PCR method based on a new primer design strategy to reduce the impact of nucleic acid instability on nucleic acid testing. The performance of the method was evaluated for linearity, limit of detection, precision, specificity, and agreement with commercial hepatitis C virus assays. Its clinical application was compared to that of two commercial kits--Cobas AmpliPrep/Cobas TaqMan (CAP/CTM) and Kehua. The quantitative RT-PCR method delivered a good performance, with a linearity of R(2) = 0.99, a total limit of detection (genotypes 1 to 6) of 42.6 IU/mL (95% CI, 32.84 to 67.76 IU/mL), a CV of 1.06% to 3.34%, a specificity of 100%, and a high concordance with the CAP/CTM assay (R(2) = 0.97), with a means ± SD value of -0.06 ± 1.96 log IU/mL (range, -0.38 to 0.25 log IU/mL). The method was superior to commercial assays in detecting unstable hepatitis C virus RNA (P < 0.05). This quantitative RT-PCR method can effectively eliminate the influence of RNA instability on nucleic acid testing. The principle of primer design strategy may be applied to the detection of other RNA or DNA viruses. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Byoun, Mun Sub; Yoo, Changhoon; Sim, Sang Jun; Lim, Chae Seung; Kim, Sung Woo
2018-01-01
Real-time PCR, also called quantitative PCR (qPCR), has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR) where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN). One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction. PMID:29293604
Mesarch, Matthew B.; Nakatsu, Cindy H.; Nies, Loring
2000-01-01
Benzene, toluene, xylenes, phenol, naphthalene, and biphenyl are among a group of compounds that have at least one reported pathway for biodegradation involving catechol 2,3-dioxygenase enzymes. Thus, detection of the corresponding catechol 2,3-dioxygenase genes can serve as a basis for identifying and quantifying bacteria that have these catabolic abilities. Primers that can successfully amplify a 238-bp catechol 2,3-dioxygenase gene fragment from eight different bacteria are described. The identities of the amplicons were confirmed by hybridization with a 238-bp catechol 2,3-dioxygenase probe. The detection limit was 102 to 103 gene copies, which was lowered to 100 to 101 gene copies by hybridization. Using the dioxygenase-specific primers, an increase in catechol 2,3-dioxygenase genes was detected in petroleum-amended soils. The dioxygenase genes were enumerated by competitive quantitative PCR with a 163-bp competitor that was amplified using the same primers. Target and competitor sequences had identical amplification kinetics. Potential PCR inhibitors that could coextract with DNA, nonamplifying DNA, soil factors (humics), and soil pollutants (toluene) did not impact enumeration. Therefore, this technique can be used to accurately and reproducibly quantify catechol 2,3-dioxygenase genes in complex environments such as petroleum-contaminated soil. Direct, non-cultivation-based molecular techniques for detecting and enumerating microbial pollutant-biodegrading genes in environmental samples are powerful tools for monitoring bioremediation and developing field evidence in support of natural attenuation. PMID:10653735
Mesarch, M B; Nakatsu, C H; Nies, L
2000-02-01
Benzene, toluene, xylenes, phenol, naphthalene, and biphenyl are among a group of compounds that have at least one reported pathway for biodegradation involving catechol 2,3-dioxygenase enzymes. Thus, detection of the corresponding catechol 2,3-dioxygenase genes can serve as a basis for identifying and quantifying bacteria that have these catabolic abilities. Primers that can successfully amplify a 238-bp catechol 2,3-dioxygenase gene fragment from eight different bacteria are described. The identities of the amplicons were confirmed by hybridization with a 238-bp catechol 2,3-dioxygenase probe. The detection limit was 10(2) to 10(3) gene copies, which was lowered to 10(0) to 10(1) gene copies by hybridization. Using the dioxygenase-specific primers, an increase in catechol 2, 3-dioxygenase genes was detected in petroleum-amended soils. The dioxygenase genes were enumerated by competitive quantitative PCR with a 163-bp competitor that was amplified using the same primers. Target and competitor sequences had identical amplification kinetics. Potential PCR inhibitors that could coextract with DNA, nonamplifying DNA, soil factors (humics), and soil pollutants (toluene) did not impact enumeration. Therefore, this technique can be used to accurately and reproducibly quantify catechol 2, 3-dioxygenase genes in complex environments such as petroleum-contaminated soil. Direct, non-cultivation-based molecular techniques for detecting and enumerating microbial pollutant-biodegrading genes in environmental samples are powerful tools for monitoring bioremediation and developing field evidence in support of natural attenuation.
Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis
Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.
2005-01-01
Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538
PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection
O’Halloran, Damien M.
2016-01-01
Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558
PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.
Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt
2017-01-24
The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-01-01
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350
PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome
Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi
2006-01-01
PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094
Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers
Levin, Joshua D.; Fiala, Dean; Samala, Meinrado F.; Kahn, Jason D.; Peterson, Raymond J.
2006-01-01
Genomes are becoming heavily annotated with important features. Analysis of these features often employs oligonucleotides that hybridize at defined locations. When the defined location lies in a poor sequence context, traditional design strategies may fail. Locked Nucleic Acid (LNA) can enhance oligonucleotide affinity and specificity. Though LNA has been used in many applications, formal design rules are still being defined. To further this effort we have investigated the effect of LNA on the performance of sequencing and PCR primers in AT-rich regions, where short primers yield poor sequencing reads or PCR yields. LNA was used in three positional patterns: near the 5′ end (LNA-5′), near the 3′ end (LNA-3′) and distributed throughout (LNA-Even). Quantitative measures of sequencing read length (Phred Q30 count) and real-time PCR signal (cycle threshold, CT) were characterized using two-way ANOVA. LNA-5′ increased the average Phred Q30 score by 60% and it was never observed to decrease performance. LNA-5′ generated cycle thresholds in quantitative PCR that were comparable to high-yielding conventional primers. In contrast, LNA-3′ and LNA-Even did not improve read lengths or CT. ANOVA demonstrated the statistical significance of these results and identified significant interaction between the positional design rule and primer sequence. PMID:17071964
Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay
Ogrean, Christy; Jackson, Ben; Covino, James
2010-01-01
The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-11-16
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
USDA-ARS?s Scientific Manuscript database
The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...
2009-01-01
Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully
miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA
Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming
2018-01-01
MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
One step screening of retroviral producer clones by real time quantitative PCR.
Towers, G J; Stockholm, D; Labrousse-Najburg, V; Carlier, F; Danos, O; Pagès, J C
1999-01-01
Recombinant retroviruses are obtained from either stably or transiently transfected retrovirus producer cells. In the case of stably producing lines, a large number of clones must be screened in order to select the one with the highest titre. The multi-step selection of high titre producing clones is time consuming and expensive. We have taken advantage of retroviral endogenous reverse transcription to develop a quantitative PCR assay on crude supernatant from producing clones. We used Taqman PCR technology, which, by using fluorescence measurement at each cycle of amplification, allows PCR product quantification. Fluorescence results from specific degradation of a probe oligonucleotide by the Taq polymerase 3'-5' exonuclease activity. Primers and probe sequences were chosen to anneal to the viral strong stop species, which is the first DNA molecule synthesised during reverse transcription. The protocol consists of a single real time PCR, using as template filtered viral supernatant without any other pre-treatment. We show that the primers and probe described allow quantitation of serially diluted plasmid to as few as 15 plasmid molecules. We then test 200 GFP-expressing retroviral-producing clones either by FACS analysis of infected cells or by using the quantitative PCR. We confirm that the Taqman protocol allows the detection of virus in supernatant and selection of high titre clones. Furthermore, we can determine infectious titre by quantitative PCR on genomic DNA from infected cells, using an additional set of primers and probe to albumin to normalise for the genomic copy number. We demonstrate that real time quantitative PCR can be used as a powerful and reliable single step, high throughput screen for high titre retroviral producer clones.
Quantitative phenotyping of X-disease resistance in chokecherry using real-time PCR.
Huang, Danqiong; Walla, James A; Dai, Wenhao
2014-03-01
A quantitative real-time SYBR Green PCR (qPCR) assay has been developed to detect and quantify X-disease phytoplasmas in chokecherry. An X-disease phytoplasma-specific and high sensitivity primer pair was designed based on the 16S rRNA gene sequence of X-disease phytoplasmas. This primer pair was specific to the 16SrIII group (X-disease) phytoplasmas. The qPCR method can quantify phytoplasmas from a DNA mix (a mix of both chokecherry and X-disease phytoplasma DNA) at as low as 0.001 ng, 10-fold lower than conventional PCR using the same primer pair. A significant correlation between the copy number of phytoplasmas and visual phenotypic rating scores of X-disease resistance in chokecherry plants was observed. Disease resistant chokecherries had a significantly lower titer of X-disease phytoplasmas than susceptible plants. This suggests that the qPCR assay provides a more objective tool to phenotype phytoplasma disease severity, particularly for early evaluation of host resistance; therefore, this method will facilitate quantitative phenotyping of disease resistance and has great potential in enhancing plant breeding. Copyright © 2013 Elsevier B.V. All rights reserved.
PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.
Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I
2016-09-01
The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.
Restrepo-Ortiz, Claudia X; Casamayor, Emilio O
2013-12-01
Quantitative environmental distribution of two widely distributed uncultured freshwater Euryarchaeota with unknown functional role was explored by newly designed quantitative PCR primers targeting the 16S rRNA gene of clades Miscellaneous Euryarchaeota Group (MEG, containing the groups pMC2A384 and VALII/Eury4) and Deep-Sea Euryarchaeotal Groups (DSEG, targeting the cluster named VALIII containing the DHVE-3/DSEG, BC07-2A-27/DSEG-3 and DSEG-2 groups), respectively. The summer surface plankton of 28 lakes was analysed, and one additional dimictic deep alpine lake, Lake Redon, was temporally and vertically surveyed covering seasonal limnological variability. A trophic range between 0.2 and 5.2 μg l(-1) Chl a, and pH span from 3.8 to 9.5 was explored at altitudes between 632 and 2590 m above sea level. The primers showed to be highly selective with c. 85% coverage and 100% specificity. Only pH significantly explained the changes observed in gene abundances and environment. In Lake Redon, DSEG bloomed in deep stratified waters both in summer and early spring, and MEG at intermediate depths during the ice-cover period. Overall, MEG and DSEG showed a differential ecological distribution although correlational analyses indicated lack of coupling of both Euryarchaeota with phytoplankton (chlorophyll a). However, an intriguing positive and significant relationship was found between DSEG and putative ammonia oxidizing thaumarchaeota. © 2013 John Wiley & Sons Ltd and Society for Applied Microbiology.
2016-01-01
Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Microfluidics-based digital quantitative PCR for single-cell small RNA quantification.
Yu, Tian; Tang, Chong; Zhang, Ying; Zhang, Ruirui; Yan, Wei
2017-09-01
Quantitative analyses of small RNAs at the single-cell level have been challenging because of limited sensitivity and specificity of conventional real-time quantitative PCR methods. A digital quantitative PCR (dqPCR) method for miRNA quantification has been developed, but it requires the use of proprietary stem-loop primers and only applies to miRNA quantification. Here, we report a microfluidics-based dqPCR (mdqPCR) method, which takes advantage of the Fluidigm BioMark HD system for both template partition and the subsequent high-throughput dqPCR. Our mdqPCR method demonstrated excellent sensitivity and reproducibility suitable for quantitative analyses of not only miRNAs but also all other small RNA species at the single-cell level. Using this method, we discovered that each sperm has a unique miRNA profile. © The Authors 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
High-throughput real-time quantitative reverse transcription PCR.
Bookout, Angie L; Cummins, Carolyn L; Mangelsdorf, David J; Pesola, Jean M; Kramer, Martha F
2006-02-01
Extensive detail on the application of the real-time quantitative polymerase chain reaction (QPCR) for the analysis of gene expression is provided in this unit. The protocols are designed for high-throughput, 384-well-format instruments, such as the Applied Biosystems 7900HT, but may be modified to suit any real-time PCR instrument. QPCR primer and probe design and validation are discussed, and three relative quantitation methods are described: the standard curve method, the efficiency-corrected DeltaCt method, and the comparative cycle time, or DeltaDeltaCt method. In addition, a method is provided for absolute quantification of RNA in unknown samples. RNA standards are subjected to RT-PCR in the same manner as the experimental samples, thus accounting for the reaction efficiencies of both procedures. This protocol describes the production and quantitation of synthetic RNA molecules for real-time and non-real-time RT-PCR applications.
STITCHER 2.0: primer design for overlapping PCR applications.
O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-03-30
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.
MRPrimerV: a database of PCR primers for RNA virus detection
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo
2017-01-01
Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620
Gemi: PCR Primers Prediction from Multiple Alignments
Sobhy, Haitham; Colson, Philippe
2012-01-01
Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117
Bokulich, Nicholas A.
2013-01-01
Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949
A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis
Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo
2012-01-01
In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223
Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.
Robertson, Amber L; Phillips, Allison R
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.
STITCHER 2.0: primer design for overlapping PCR applications
O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-01-01
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011
PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S. N.
2013-08-08
Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.
RUCS: rapid identification of PCR primers for unique core sequences.
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole
2017-12-15
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.
Campos, Maria Jorge; Quesada, Alberto
2017-01-01
PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.
There are numerous quantitative real-time PCR (qPCR) assays available to detect and enumerate fecal pollution in ambient waters. Each assay employs distinct primers and probes that target different rRNA genes and microorganisms leading to potential variations in concentration es...
Pauthenier, Cyrille; Faulon, Jean-Loup
2014-07-01
PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí
2005-01-01
Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific
Long, Ju
2016-05-01
In China, -(SEA), -α(3.7) and -α(4.2) are common deletional α-thalassemia alleles. Gap-PCR is the currently used detection method for these alleles, whose disadvantages include time-consuming procedure and increased potential for PCR product contamination. Therefore, this detection method needs to be improved. Based on identical-primer homologous fragments, a qPCR system was developed for deletional α-thalassemia genotyping, which was composed of a group of quantitatively-related primers and their corresponding probes plus two groups of qualitatively-related primers and their corresponding probes. In order to verify the accuracy of the qPCR system, known genotype samples and random samples are employed. The standard curve result demonstrated that designed primers and probes all yielded good amplification efficiency. In the tests of known genotype samples and random samples, sample detection results were consistent with verification results. In detecting αα, -(SEA), -α(3.7) and -α(4.2) alleles, deletional α-thalassemia alleles are accurately detected by this method. In addition, this method is provided with a wider detection range, greater speed and reduced PCR product contamination risk when compared with current common gap-PCR detection reagents. Copyright © 2016 Elsevier B.V. All rights reserved.
[Quantitative PCR in the diagnosis of Leishmania].
Mortarino, M; Franceschi, A; Mancianti, F; Bazzocchi, C; Genchi, C; Bandi, C
2004-06-01
Polymerase chain reaction (PCR) is a sensitive and rapid method for the diagnosis of canine Leishmania infection and can be performed on a variety of biological samples, including peripheral blood, lymph node, bone marrow and skin. Standard PCR requires electrophoretic analysis of the amplification products and is usually not suitable for quantification of the template DNA (unless competitor-based or other methods are developed), being of reduced usefulness when accurate monitoring of target DNA is required. Quantitative real-time PCR allows the continuous monitoring of the accumulation of PCR products during the amplification reaction. This allows the identification of the cycle of near-logarithmic PCR product generation (threshold cycle) and, by inference, the relative quantification of the template DNA present at the start of the reaction. Since the amplification product are monitored in "real-time" as they form cycle-by-cycle, no post-amplification handling is required. The absolute quantification is performed according either to an internal standard co-amplified with the sample DNA, or to an external standard curve obtained by parallel amplification of serial known concentrations of a reference DNA sequence. From the quantification of the template DNA, an estimation of the relative load of parasites in the different samples can be obtained. The advantages compared to standard and semi-quantitative PCR techniques are reduction of the assay's time and contamination risks, and improved sensitivity. As for standard PCR, the minimal components of the quantitative PCR reaction mixture are the DNA target of the amplification, an oligonucleotide primer pair flanking the target sequence, a suitable DNA polymerase, deoxynucleotides, buffer and salts. Different technologies have been set up for the monitoring of amplification products, generally based on the use of fluorescent probes. For instance, SYBR Green technology is a non-specific detection system based on a
Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.
Roque, H D; Vieira, R; Rato, S; Luz-Martins, M
2006-12-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.
Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William
2011-12-01
Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.
USDA-ARS?s Scientific Manuscript database
Quantitative PCR (Q-PCR) utilizing specific primer sequences and a fluorogenic, 5’-exonuclease linear hydrolysis probe is well established as a detection and identification method for Phakopsora pachyrhizi, the soybean rust pathogen. Because of the extreme sensitivity of Q-PCR, the DNA of a single u...
Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿
Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.
2006-01-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755
There are numerous quantitative real-time PCR (qPCR) methods available to detect and enumerate human fecal pollution in ambient waters. Each assay employs distinct primers and/or probes and many target different genes and microorganisms leading to potential variations in method ...
Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water
Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.
2007-01-01
The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.
Sensitive, microliter PCR with consensus degenerate primers for Epstein Barr virus amplification
Oh, Kyudam; Pak, Nikita; Saunders, D. Curtis; Conrardy, Christina; Landers, James P.; Tong, Suxiang; Forest, Craig R.
2016-01-01
Sensitive identification of the etiology of viral diseases is key to implementing appropriate prevention and treatment. The gold standard for virus identification is the polymerase chain reaction (PCR), a technique that allows for highly specific and sensitive detection of pathogens by exponentially amplifying a specific region of DNA from as little as a single copy through thermocycling a biochemical cocktail. Today, molecular biology laboratories use commercial instruments that operate in 0.5–2 h/analysis using reaction volumes of 5–50 μL contained within polymer tubes or chambers. Towards reducing this volume and maintaining performance, we present a semi-quantitative, systematic experimental study of how PCR yield is affected by tube/chamber substrate, surface-area-to-volume ratio (SA:V), and passivation methods. We perform PCR experiments using traditional PCR tubes as well as using disposable polymer microchips with 1 μL reaction volumes thermocycled using water baths. We report the first oil encapsulation microfluidic PCR method without fluid flow and its application to the first microfluidic amplification of Epstein Barr virus using consensus degenerate primers, a powerful and broad PCR method to screen for both known and novel members of a viral family. The limit of detection is measured as 140 starting copies of DNA from a starting concentration of 3×105 copies/mL, regarded as an accepted sensitivity threshold for diagnostic purposes, and reaction specificity was improved as compared to conventional methods. Also notable, these experiments were conducted with conventional reagent concentrations, rather than commonly spiked enzyme and/or template mixtures. This experimental study of the effects of substrate, SA:V, and passivation, together with sensitive and specific microfluidic PCR with consensus degenerate primers represent advances towards lower cost and higher throughput pathogen screening. PMID:23080522
Quantitative competitive (QC) PCR for quantification of porcine DNA.
Wolf, C; Lüthy, J
2001-02-01
Many meat products nowadays may contain several species in different proportions. To protect consumers from fraud and misdeclarations, not only a qualitative but also a quantitative monitoring of ingredients of complex food products is necessary. DNA based techniques like the polymerase chain reaction (PCR) are widely used for identification of species but no answer to the proportional amount of a certain species could be given using current techniques. In this study we report the development and evaluation of a quantitative competitive polymerase chain reaction (QC-PCR) for detection and quantification of porcine DNA using a new porcine specific PCR system based on the growth hormone gene of sus scrofa. A DNA competitor differing by 30 bp in length from the porcine target sequence was constructed and used for PCR together with the target DNA. Specificity of the new primers was evaluated with DNA from cattle, sheep, chicken and turkey. The competitor concentration was adjusted to porcine DNA contents of 2 or 20% by coamplification of mixtures containing porcine and corresponding amounts of bovine DNA in defined ratios.
NASA Astrophysics Data System (ADS)
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
Quantitative PCR for human herpesviruses 6 and 7.
Secchiero, P; Zella, D; Crowley, R W; Gallo, R C; Lusso, P
1995-01-01
A quantitative PCR assay for the detection of human herpesvirus 6 (HHV-6) (variants A and B) and HHV-7 DNAs in clinical samples was developed. The assay uses a nonhomologous internal standard (IS) for each virus that is coamplified with the wild-type target sequence in the same vial and with the same pair of primers. This method allows for a correction of the variability of efficiency of the PCR technique. A standard curve is constructed for each experiment by coamplification of known quantities of the cloned HHV-6 or HHV-7 target templates with the respective IS. Absolute quantitation of the test samples is then achieved by determining the viral target/IS ratio of the hybridization signals of the amplification products and plotting this value against the standard curve. Using this assay, we quantitated the amount of HHV-6 or HHV-7 DNA in infected cell cultures and demonstrated an inhibitory effect of phosphonoformic acid on the replication of HHV-6 and HHV-7 in vitro. As the first clinical application of this procedure, we performed preliminary measurements of the loads of HHV-6 and HHV-7 in lymph nodes from patients with Hodgkin's disease and AIDS. Application of this quantitative PCR method should be helpful for elucidating the pathogenic roles of HHV-6 and HHV-7. PMID:7559960
There are numerous quantitative real-time PCR (qPCR) methods available to detect and enumerate human fecal pollution in ambient waters. Each assay employs distinct primers and/or probes and many target different genes and microorganisms leading to potential variations in method p...
PRISE2: software for designing sequence-selective PCR primers and probes.
Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James
2014-09-25
PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
Shang, Ying; Xu, Wentao; Wang, Yong; Xu, Yuancong; Huang, Kunlun
2017-12-15
This study described a novel multiplex qualitative detection method using pyrosequencing. Based on the principle of the universal primer-multiplex-PCR, only one sequencing primer was employed to realize the detection of the multiple targets. Samples containing three genetically modified (GM) crops in different proportions were used to validate the method. The dNTP dispensing order was designed based on the product sequences. Only 12 rounds (ATCTGATCGACT) of dNTPs addition and, often, as few as three rounds (CAT) under ideal conditions, were required to detect the GM events qualitatively, and sensitivity was as low as 1% of a mixture. However, when considering a mixture, calculating signal values allowed the proportion of each GM to be estimated. Based on these results, we concluded that our novel method not only realized detection but also allowed semi-quantitative detection of individual events. Copyright © 2017. Published by Elsevier Ltd.
Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V
2016-01-01
Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.
Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.
2016-01-01
Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839
Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond
2018-01-01
Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.
Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg
2018-01-01
Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium “Candidatus Liberibacter asiaticus” (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer. PMID:29772016
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource
Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR
Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209
Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.
Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.
2011-01-01
Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809
Banting, Graham S.; Braithwaite, Shannon; Scott, Candis; Kim, Jinyong; Jeon, Byeonghwa; Ashbolt, Nicholas; Ruecker, Norma; Tymensen, Lisa; Charest, Jollin; Pintar, Katarina; Checkley, Sylvia
2016-01-01
ABSTRACT Campylobacter spp. are the leading cause of bacterial gastroenteritis worldwide, and water is increasingly seen as a risk factor in transmission. Here we describe a most-probable-number (MPN)–quantitative PCR (qPCR) assay in which water samples are centrifuged and aliquoted into microtiter plates and the bacteria are enumerated by qPCR. We observed that commonly used Campylobacter molecular assays produced vastly different detection rates. In irrigation water samples, detection rates varied depending upon the PCR assay and culture method used, as follows: 0% by the de Boer Lv1-16S qPCR assay, 2.5% by the Van Dyke 16S and Jensen glyA qPCR assays, and 75% by the Linton 16S endpoint PCR when cultured at 37°C. Primer/probe specificity was the major confounder, with Arcobacter spp. routinely yielding false-positive results. The primers and PCR conditions described by Van Dyke et al. (M. I. Van Dyke, V. K. Morton, N. L. McLellan, and P. M. Huck, J Appl Microbiol 109:1053–1066, 2010, http://dx.doi.org/10.1111/j.1365-2672.2010.04730.x) proved to be the most sensitive and specific for Campylobacter detection in water. Campylobacter occurrence in irrigation water was found to be very low (<2 MPN/300 ml) when this Campylobacter-specific qPCR was used, with the most commonly detected species being C. jejuni, C. coli, and C. lari. Campylobacters in raw sewage were present at ∼102/100 ml, with incubation at 42°C required for reducing microbial growth competition from arcobacters. Overall, when Campylobacter prevalence and/or concentration in water is reported using molecular methods, considerable validation is recommended when adapting methods largely developed for clinical applications. Furthermore, combining MPN methods with molecular biology-based detection algorithms allows for the detection and quantification of Campylobacter spp. in environmental samples and is potentially suited to quantitative microbial risk assessment for improved public health disease
Jin, Yang Oh; Mattes, Timothy E
2010-12-01
Vinyl chloride (VC) is a known human carcinogen that is primarily formed in groundwater via incomplete anaerobic dechlorination of chloroethenes. Aerobic, ethene-degrading bacteria (etheneotrophs), which are capable of both fortuitous and growth-linked VC oxidation, could be important in natural attenuation of VC plumes that escape anaerobic treatment. In this work, we developed a quantitative, real-time PCR (qPCR) assay for etheneotrophs in groundwater. We designed and tested degenerate qPCR primers for two functional genes involved in aerobic, growth-coupled VC- and ethene-oxidation (etnC and etnE). Primer specificity to these target genes was tested by comparison to nucleotide sequence databases, PCR analysis of template DNA extracted from isolates and environmental samples, and sequencing of qPCR products obtained from VC-contaminated groundwater. The assay was made quantitative by constructing standard curves (threshold cycle vs log gene copy number) with DNA amplified from Mycobacterium strain JS60, an etheneotrophic isolate. Analysis of groundwater samples from three different VC-contaminated sites revealed that etnC abundance ranged from 1.6 × 10(3) - 1.0 × 10(5) copies/L groundwater while etnE abundance ranged from 4.3 × 10(3) - 6.3 × 10(5) copies/L groundwater. Our data suggest this novel environmental measurement method will be useful for supporting VC bioremediation strategies, assisting in site closure, and conducting microbial ecology studies involving etheneotrophs.
Steps to achieve quantitative measurements of microRNA using two step droplet digital PCR.
Stein, Erica V; Duewer, David L; Farkas, Natalia; Romsos, Erica L; Wang, Lili; Cole, Kenneth D
2017-01-01
Droplet digital PCR (ddPCR) is being advocated as a reference method to measure rare genomic targets. It has consistently been proven to be more sensitive and direct at discerning copy numbers of DNA than other quantitative methods. However, one of the largest obstacles to measuring microRNA (miRNA) using ddPCR is that reverse transcription efficiency depends upon the target, meaning small RNA nucleotide composition directly effects primer specificity in a manner that prevents traditional quantitation optimization strategies. Additionally, the use of reagents that are optimized for miRNA measurements using quantitative real-time PCR (qRT-PCR) appear to either cause false positive or false negative detection of certain targets when used with traditional ddPCR quantification methods. False readings are often related to using inadequate enzymes, primers and probes. Given that two-step miRNA quantification using ddPCR relies solely on reverse transcription and uses proprietary reagents previously optimized only for qRT-PCR, these barriers are substantial. Therefore, here we outline essential controls, optimization techniques, and an efficacy model to improve the quality of ddPCR miRNA measurements. We have applied two-step principles used for miRNA qRT-PCR measurements and leveraged the use of synthetic miRNA targets to evaluate ddPCR following cDNA synthesis with four different commercial kits. We have identified inefficiencies and limitations as well as proposed ways to circumvent identified obstacles. Lastly, we show that we can apply these criteria to a model system to confidently quantify miRNA copy number. Our measurement technique is a novel way to quantify specific miRNA copy number in a single sample, without using standard curves for individual experiments. Our methodology can be used for validation and control measurements, as well as a diagnostic technique that allows scientists, technicians, clinicians, and regulators to base miRNA measures on a single
Steps to achieve quantitative measurements of microRNA using two step droplet digital PCR
Duewer, David L.; Farkas, Natalia; Romsos, Erica L.; Wang, Lili; Cole, Kenneth D.
2017-01-01
Droplet digital PCR (ddPCR) is being advocated as a reference method to measure rare genomic targets. It has consistently been proven to be more sensitive and direct at discerning copy numbers of DNA than other quantitative methods. However, one of the largest obstacles to measuring microRNA (miRNA) using ddPCR is that reverse transcription efficiency depends upon the target, meaning small RNA nucleotide composition directly effects primer specificity in a manner that prevents traditional quantitation optimization strategies. Additionally, the use of reagents that are optimized for miRNA measurements using quantitative real-time PCR (qRT-PCR) appear to either cause false positive or false negative detection of certain targets when used with traditional ddPCR quantification methods. False readings are often related to using inadequate enzymes, primers and probes. Given that two-step miRNA quantification using ddPCR relies solely on reverse transcription and uses proprietary reagents previously optimized only for qRT-PCR, these barriers are substantial. Therefore, here we outline essential controls, optimization techniques, and an efficacy model to improve the quality of ddPCR miRNA measurements. We have applied two-step principles used for miRNA qRT-PCR measurements and leveraged the use of synthetic miRNA targets to evaluate ddPCR following cDNA synthesis with four different commercial kits. We have identified inefficiencies and limitations as well as proposed ways to circumvent identified obstacles. Lastly, we show that we can apply these criteria to a model system to confidently quantify miRNA copy number. Our measurement technique is a novel way to quantify specific miRNA copy number in a single sample, without using standard curves for individual experiments. Our methodology can be used for validation and control measurements, as well as a diagnostic technique that allows scientists, technicians, clinicians, and regulators to base miRNA measures on a single
Han, Joan C.; Elsea, Sarah H.; Pena, Heloísa B.; Pena, Sérgio Danilo Junho
2013-01-01
Detection of human microdeletion and microduplication syndromes poses significant burden on public healthcare systems in developing countries. With genome-wide diagnostic assays frequently inaccessible, targeted low-cost PCR-based approaches are preferred. However, their reproducibility depends on equally efficient amplification using a number of target and control primers. To address this, the recently described technique called Microdeletion/Microduplication Quantitative Fluorescent PCR (MQF-PCR) was shown to reliably detect four human syndromes by quantifying DNA amplification in an internally controlled PCR reaction. Here, we confirm its utility in the detection of eight human microdeletion syndromes, including the more common WAGR, Smith-Magenis, and Potocki-Lupski syndromes with 100% sensitivity and 100% specificity. We present selection, design, and performance evaluation of detection primers using variety of approaches. We conclude that MQF-PCR is an easily adaptable method for detection of human pathological chromosomal aberrations. PMID:24288428
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
ERIC Educational Resources Information Center
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
Real-Time PCR (qPCR) Primer Design Using Free Online Software
ERIC Educational Resources Information Center
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…
Sorensen, Darwin L.; Dupont, R. Ryan
2016-01-01
ABSTRACT The extent of arsenic contamination in drinking water and its potential threat to human health have resulted in considerable research interest in the microbial species responsible for arsenic reduction. The arsenate reductase gene (arrA), an important component of the microbial arsenate reduction system, has been widely used as a biomarker to study arsenate-reducing microorganisms. A new primer pair was designed and evaluated for quantitative PCR (qPCR) and high-throughput sequencing of the arrA gene, because currently available PCR primers are not suitable for these applications. The primers were evaluated in silico and empirically tested for amplification of arrA genes in clones and for amplification and high-throughput sequencing of arrA genes from soil and groundwater samples. In silico, this primer pair matched (≥90% DNA identity) 86% of arrA gene sequences from GenBank. Empirical evaluation showed successful amplification of arrA gene clones of diverse phylogenetic groups, as well as amplification and high-throughput sequencing of independent soil and groundwater samples without preenrichment, suggesting that these primers are highly specific and can amplify a broad diversity of arrA genes. The arrA gene diversity from soil and groundwater samples from the Cache Valley Basin (CVB) in Utah was greater than anticipated. We observed a significant correlation between arrA gene abundance, quantified through qPCR, and reduced arsenic (AsIII) concentrations in the groundwater samples. Furthermore, we demonstrated that these primers can be useful for studying the diversity of arsenate-reducing microbial communities and the ways in which their relative abundance in groundwater may be associated with different groundwater quality parameters. IMPORTANCE Arsenic is a major drinking water contaminant that threatens the health of millions of people worldwide. The extent of arsenic contamination and its potential threat to human health have resulted in
Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR
2010-01-01
Background Human papillomaviruses (HPVs) remain a serious world health problem due to their association with anogenital/oral cancers and warts. While over 100 HPV types have been identified, a subset is associated with malignancy. HPV16 and 18 are the most prevalent oncogenic types, while HPV6 and 11 are most commonly responsible for anogenital warts. While other quantitative PCR (qPCR) assays detect oncogenic HPV, there is no single tube assay distinguishing the most frequent oncogenic types and the most common types found in warts. Results A Sybr Green-based qPCR assay was developed utilizing degenerate primers to the highly conserved HPV E1 theoretically detecting any HPV type. A single tube multiplex qPCR assay was also developed using type-specific primer pairs and TaqMan probes that allowed for detection and quantitation of HPV6,11,16,18. Each HPV type was detected over a range from 2 × 101 to 2 × 106copies/reaction providing a reliable method of quantitating type-specific HPV in 140 anogenital/cutaneous/oral benign and malignant specimens. 35 oncogenic and low risk alpha genus HPV types were detected. Concordance was detected in previously typed specimens. Comparisons to the gold standard detected an overall sensitivity of 89% (95% CI: 77% - 96%) and specificity of 90% (95%CI: 52% - 98%). Conclusion There was good agreement between the ability of the qPCR assays described here to identify HPV types in malignancies previously typed using standard methods. These novel qPCR assays will allow rapid detection and quantitation of HPVs to assess their role in viral pathogenesis. PMID:20723234
Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing
2010-02-01
To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
Mathematics of quantitative kinetic PCR and the application of standard curves.
Rutledge, R G; Côté, C
2003-08-15
Fluorescent monitoring of DNA amplification is the basis of real-time PCR, from which target DNA concentration can be determined from the fractional cycle at which a threshold amount of amplicon DNA is produced. Absolute quantification can be achieved using a standard curve constructed by amplifying known amounts of target DNA. In this study, the mathematics of quantitative PCR are examined in detail, from which several fundamental aspects of the threshold method and the application of standard curves are illustrated. The construction of five replicate standard curves for two pairs of nested primers was used to examine the reproducibility and degree of quantitative variation using SYBER Green I fluorescence. Based upon this analysis the application of a single, well- constructed standard curve could provide an estimated precision of +/-6-21%, depending on the number of cycles required to reach threshold. A simplified method for absolute quantification is also proposed, in which quantitative scale is determined by DNA mass at threshold.
2013-01-01
Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to < two hours. Analysis of the PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
ERIC Educational Resources Information Center
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.
Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl
2017-01-01
The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.
O'Halloran, Damien M
2015-06-01
Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.
2014-01-01
Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511
Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang
2017-04-01
Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for
Kim, Tae Gwan; Jeong, So-Yeon; Cho, Kyung-Suk
2014-07-01
The newly developed droplet digital PCR (DD-PCR) has shown promise as a DNA quantification technology in medical diagnostic fields. This study evaluated the applicability of DD-PCR as a quantitative tool for soil DNA using quantitative real-time PCR (qRT-PCR) as a reference technology. Cupriavidus sp. MBT14 and Sphingopyxis sp. MD2 were used, and a primer/TaqMan probe set was designed for each (CupMBT and SphMD2, respectively). Standard curve analyses on tenfold dilution series showed that both qRT-PCR and DD-PCR exhibited excellent linearity (R (2) = 1.00) and PCR efficiency (≥92 %) across their detectable ranges. However, DD-PCR showed a tenfold greater sensitivity than qRT-PCR. MBT14 and MD2 were added to non-sterile soil at 0 ~ 5 × 10(8) and 0 ~ 5 × 10(7) cells per gram of soil, respectively (n = 5). This bacterial load test indicated that DD-PCR was more sensitive and discriminating than qRT-PCR. For instance, DD-PCR showed a gradual DNA increase from 14 to 141,160 MBT14 rDNA copies μL DNA extract(-1) as the bacterial load increased, while qRT-PCR could quantify the DNA (6,432 copies μL DNA(-1)) at ≥5 × 10(5) MBT14 per gram of soil. When temporal DNA changes were monitored for 3 weeks in the amended soils, the two technologies exhibited nearly identical changes over time. Linearity tests (y = a · x) revealed excellent quantitative agreement between the two technologies (a = 0.98, R (2) = 0.97 in the CupMBT set and a = 0.90, R (2) = 0.94 in the SphMD2 set). These results suggest that DD-PCR is a promising tool to examine temporal dynamics of microorganisms in complex environments.
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-01-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.
Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C
1996-01-01
In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291
Mehndiratta, Mohit; Palanichamy, Jayanth Kumar; Ramalingam, Pradeep; Pal, Arnab; Das, Prerna; Sinha, Subrata; Chattopadhyay, Parthaprasad
2008-12-01
Quantitative real-time PCR (qPCR) is a standard method used for quantification of specific gene expression. This utilizes either dsDNA binding dyes or probe based chemistry. While dsDNA binding dyes have the advantage of low cost and flexibility, fluorescence due to primer dimers also interferes with the fluorescence of the specific product. Sometimes it is difficult, if not impossible, to standardize conditions and redesign primers in such a way that only specific fluorescence of the products of test and reference genes are acquired. Normally, the fluorescence acquisition in qPCR using dsDNA binding dyes is done during the melting phase of the PCR at a temperature between the melting points of primer dimers and the specific product. We have modified the protocol to acquire fluorescence during the hybridization phase. This significantly increased the signal-to-noise ratio and enabled the use of dsDNA binding dyes for mRNA quantification in situations where it was not possible when measurement was done in the melting phase. We have demonstrated it for three mRNAs, E6, E7, and DNMT1 with beta-actin as the reference gene, and for two miRNAs. This modification broadens the scope of qPCR using dsDNA binding dyes.
Te, Shu Harn; Chen, Enid Yingru
2015-01-01
The increasing occurrence of harmful cyanobacterial blooms, often linked to deteriorated water quality and adverse public health effects, has become a worldwide concern in recent decades. The use of molecular techniques such as real-time quantitative PCR (qPCR) has become increasingly popular in the detection and monitoring of harmful cyanobacterial species. Multiplex qPCR assays that quantify several toxigenic cyanobacterial species have been established previously; however, there is no molecular assay that detects several bloom-forming species simultaneously. Microcystis and Cylindrospermopsis are the two most commonly found genera and are known to be able to produce microcystin and cylindrospermopsin hepatotoxins. In this study, we designed primers and probes which enable quantification of these genera based on the RNA polymerase C1 gene for Cylindrospermopsis species and the c-phycocyanin beta subunit-like gene for Microcystis species. Duplex assays were developed for two molecular techniques—qPCR and droplet digital PCR (ddPCR). After optimization, both qPCR and ddPCR assays have high linearity and quantitative correlations for standards. Comparisons of the two techniques showed that qPCR has higher sensitivity, a wider linear dynamic range, and shorter analysis time and that it was more cost-effective, making it a suitable method for initial screening. However, the ddPCR approach has lower variability and was able to handle the PCR inhibition and competitive effects found in duplex assays, thus providing more precise and accurate analysis for bloom samples. PMID:26025892
Winn-Deen
1998-12-01
Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.
Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena
2009-08-01
Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.
Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded
2009-12-01
To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.
Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik
2007-08-31
Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.
Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.
Lee, Jaikoo; Lee, Sangsun; Young, J Peter W
2008-08-01
A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.
Quantitative Microbial Risk Assessment Tutorial - Primer
This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...
Technique for quantitative RT-PCR analysis directly from single muscle fibers.
Wacker, Michael J; Tehel, Michelle M; Gallagher, Philip M
2008-07-01
The use of single-cell quantitative RT-PCR has greatly aided the study of gene expression in fields such as muscle physiology. For this study, we hypothesized that single muscle fibers from a biopsy can be placed directly into the reverse transcription buffer and that gene expression data can be obtained without having to first extract the RNA. To test this hypothesis, biopsies were taken from the vastus lateralis of five male subjects. Single muscle fibers were isolated and underwent RNA isolation (technique 1) or placed directly into reverse transcription buffer (technique 2). After cDNA conversion, individual fiber cDNA was pooled and quantitative PCR was performed using primer-probes for beta(2)-microglobulin, glyceraldehyde-3-phosphate dehydrogenase, insulin-like growth factor I receptor, and glucose transporter subtype 4. The no RNA extraction method provided similar quantitative PCR data as that of the RNA extraction method. A third technique was also tested in which we used one-quarter of an individual fiber's cDNA for PCR (not pooled) and the average coefficient of variation between fibers was <8% (cycle threshold value) for all genes studied. The no RNA extraction technique was tested on isolated muscle fibers using a gene known to increase after exercise (pyruvate dehydrogenase kinase 4). We observed a 13.9-fold change in expression after resistance exercise, which is consistent with what has been previously observed. These results demonstrate a successful method for gene expression analysis directly from single muscle fibers.
Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J
1994-01-01
Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912
Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi
2011-01-01
A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.
Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.
2013-01-01
We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367
Te, Shu Harn; Chen, Enid Yingru; Gin, Karina Yew-Hoong
2015-08-01
The increasing occurrence of harmful cyanobacterial blooms, often linked to deteriorated water quality and adverse public health effects, has become a worldwide concern in recent decades. The use of molecular techniques such as real-time quantitative PCR (qPCR) has become increasingly popular in the detection and monitoring of harmful cyanobacterial species. Multiplex qPCR assays that quantify several toxigenic cyanobacterial species have been established previously; however, there is no molecular assay that detects several bloom-forming species simultaneously. Microcystis and Cylindrospermopsis are the two most commonly found genera and are known to be able to produce microcystin and cylindrospermopsin hepatotoxins. In this study, we designed primers and probes which enable quantification of these genera based on the RNA polymerase C1 gene for Cylindrospermopsis species and the c-phycocyanin beta subunit-like gene for Microcystis species. Duplex assays were developed for two molecular techniques-qPCR and droplet digital PCR (ddPCR). After optimization, both qPCR and ddPCR assays have high linearity and quantitative correlations for standards. Comparisons of the two techniques showed that qPCR has higher sensitivity, a wider linear dynamic range, and shorter analysis time and that it was more cost-effective, making it a suitable method for initial screening. However, the ddPCR approach has lower variability and was able to handle the PCR inhibition and competitive effects found in duplex assays, thus providing more precise and accurate analysis for bloom samples. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Cho, Gyu-Sung; Krauss, Sabrina; Huch, Melanie; Du Toit, Maret; Franz, Charles M A P
2011-12-01
A quantitative, real-time PCR method was developed to enumerate Lactobacillus plantarum IWBT B 188 during the malolactic fermentation (MLF) in Grauburgunder wine. The qRT-PCR was strain-specific, as it was based on primers targeting a plasmid DNA sequence, or it was L. plantarum-specific, as it targeted a chromosomally located plantaricin gene sequence. Two 50 l wine fermentations were prepared. One was inoculated with 15 g/hl Saccharomyces cerevisiae, followed by L. plantarum IWBT B 188 at 3.6 × 10(6) CFU/ml, whereas the other was not inoculated (control). Viable cell counts were performed for up to 25 days on MRS agar, and the same cells were enumerated by qRT-PCR with both the plasmid or chromosomally encoded gene primers. The L. plantarum strain survived under the harsh conditions in the wine fermentation at levels above 10(5)/ml for approx. 10 days, after which cell numbers decreased to levels of 10(3) CFU/ml at day 25, and to below the detection limit after day 25. In the control, no lactic acid bacteria could be detected throughout the fermentation, with the exception of two sampling points where ca. 1 × 10(2) CFU/ml was detected. The minimum detection level for quantitative PCR in this study was 1 × 10(2) to 1 × 10(3) CFU/ml. The qRT-PCR results determined generally overestimated the plate count results by about 1 log unit, probably as a result of the presence of DNA from dead cells. Overall, qRT-PCR appeared to be well suited for specifically enumerating Lactobacillus plantarum starter cultures in the MLF in wine.
Development of a real-time quantitative PCR assay to enumerate Yersinia pestis in fleas.
Gabitzsch, Elizabeth S; Vera-Tudela, Rommelle; Eisen, Rebecca J; Bearden, Scott W; Gage, Kenneth L; Zeidner, Nordin S
2008-07-01
A real-time quantitative polymerase chain reaction (qPCR) assay was developed for Yersina pestis. The qPCR assay was developed utilizing a conserved region of the Y. pestis ferric iron uptake regulator gene (fur) to design primers and a fluorescent (FAM-labeled) TaqMan probe. The assay was optimized using cultured Y. pestis (UG05-0454) and was confirmed to work with strains from 3 Y. pestis biovars. The optimized assay was capable of detecting a single organism of cultured Y. pestis and as little as 300 bacteria in infected flea triturates. This qPCR assay enables rapid enumeration of Y. pestis bacterium in laboratory-infected fleas when compared with conventional serial dilution plating.
Ahlawat, Sonika; Sharma, Rekha; Maitra, A.; Roy, Manoranjan; Tantia, M.S.
2014-01-01
New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP) genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15). Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes. PMID:25606428
Zhu, Pengyu; Fu, Wei; Wang, Chenguang; Du, Zhixin; Huang, Kunlun; Zhu, Shuifang; Xu, Wentao
2016-04-15
The possibility of the absolute quantitation of GMO events by digital PCR was recently reported. However, most absolute quantitation methods based on the digital PCR required pretreatment steps. Meanwhile, singleplex detection could not meet the demand of the absolute quantitation of GMO events that is based on the ratio of foreign fragments and reference genes. Thus, to promote the absolute quantitative detection of different GMO events by digital PCR, we developed a quantitative detection method based on duplex digital PCR without pretreatment. Moreover, we tested 7 GMO events in our study to evaluate the fitness of our method. The optimized combination of foreign and reference primers, limit of quantitation (LOQ), limit of detection (LOD) and specificity were validated. The results showed that the LOQ of our method for different GMO events was 0.5%, while the LOD is 0.1%. Additionally, we found that duplex digital PCR could achieve the detection results with lower RSD compared with singleplex digital PCR. In summary, the duplex digital PCR detection system is a simple and stable way to achieve the absolute quantitation of different GMO events. Moreover, the LOQ and LOD indicated that this method is suitable for the daily detection and quantitation of GMO events. Copyright © 2016 Elsevier B.V. All rights reserved.
Panicker, Gitika; Bej, Asim K
2005-10-01
We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.
USDA-ARS?s Scientific Manuscript database
The present study describes the development of a real time Taqman polymerase chain reaction (PCR) assay using a fluorescent labeled probe for the detection and quantitation of chicken parvovirus (ChPV) in feces. The primers and probes were designed based on the nucleotide sequence of the non struct...
Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.
Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun
2007-10-01
Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.
Quantification of Endospore-Forming Firmicutes by Quantitative PCR with the Functional Gene spo0A
Bueche, Matthieu; Wunderlin, Tina; Roussel-Delif, Ludovic; Junier, Thomas; Sauvain, Loic; Jeanneret, Nicole
2013-01-01
Bacterial endospores are highly specialized cellular forms that allow endospore-forming Firmicutes (EFF) to tolerate harsh environmental conditions. EFF are considered ubiquitous in natural environments, in particular, those subjected to stress conditions. In addition to natural habitats, EFF are often the cause of contamination problems in anthropogenic environments, such as industrial production plants or hospitals. It is therefore desirable to assess their prevalence in environmental and industrial fields. To this end, a high-sensitivity detection method is still needed. The aim of this study was to develop and evaluate an approach based on quantitative PCR (qPCR). For this, the suitability of functional genes specific for and common to all EFF were evaluated. Seven genes were considered, but only spo0A was retained to identify conserved regions for qPCR primer design. An approach based on multivariate analysis was developed for primer design. Two primer sets were obtained and evaluated with 16 pure cultures, including representatives of the genera Bacillus, Paenibacillus, Brevibacillus, Geobacillus, Alicyclobacillus, Sulfobacillus, Clostridium, and Desulfotomaculum, as well as with environmental samples. The primer sets developed gave a reliable quantification when tested on laboratory strains, with the exception of Sulfobacillus and Desulfotomaculum. A test using sediment samples with a diverse EFF community also gave a reliable quantification compared to 16S rRNA gene pyrosequencing. A detection limit of about 104 cells (or spores) per gram of initial material was calculated, indicating this method has a promising potential for the detection of EFF over a wide range of applications. PMID:23811505
[Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].
Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu
2005-07-01
To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.
Böttcher, S; Ritgen, M; Pott, C; Brüggemann, M; Raff, T; Stilgenbauer, S; Döhner, H; Dreger, P; Kneba, M
2004-10-01
The clinically most suitable method for minimal residual disease (MRD) detection in chronic lymphocytic leukemia is still controversial. We prospectively compared MRD assessment in 158 blood samples of 74 patients with CLL after stem cell transplantation (SCT) using four-color flow cytometry (MRD flow) in parallel with consensus IgH-PCR and ASO IgH real-time PCR (ASO IgH RQ-PCR). In 25 out of 106 samples (23.6%) with a polyclonal consensus IgH-PCR pattern, MRD flow still detected CLL cells, proving higher sensitivity of flow cytometry over PCR-genescanning with consensus IgH-primers. Of 92 samples, 14 (15.2%) analyzed in parallel by MRD flow and by ASO IgH RQ-PCR were negative by our flow cytometric assay but positive by PCR, thus demonstrating superior sensitivity of RQ-PCR with ASO primers. Quantitative MRD levels measured by both methods correlated well (r=0.93). MRD detection by flow and ASO IgH RQ-PCR were equally suitable to monitor MRD kinetics after allogeneic SCT, but the PCR method detected impending relapses after autologous SCT earlier. An analysis of factors that influence sensitivity and specificity of flow cytometry for MRD detection allowed to devise further improvements of this technique.
Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C
2004-11-01
To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.
Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu
2015-01-01
The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410
A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR
Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven
2016-01-01
Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and
Willenburg, Elize; Divol, Benoit
2012-11-15
Quantitative PCR as a tool has been used to detect Brettanomyces bruxellensis directly from wine samples. Accurate and timely detection of this yeast is important to prevent unwanted spoilage of wines and beverages. The aim of this study was to distinguish differences between DNA and mRNA as template for the detection of this yeast. The study was also used to determine if it is possible to accurately detect cells in the viable but not culturable (VBNC) state of B. bruxellensis by qPCR. Several methods including traditional plating, epifluorescence counts and qPCR were used to amplify DNA and mRNA. It was observed that mRNA was a better template for the detection in terms of standard curve analysis and qPCR efficiencies. Various primers previously published were tested for their specificity, qPCR efficiency and accuracy of enumeration. A single primer set was selected which amplified a region of the actin-encoding gene. The detection limit for this assay was 10cellsmL(-1). B. bruxellensis could also be quantified in naturally contaminated wines with this assay. The mRNA gave a better indication of the viability of the cells which compared favourably to fluorescent microscopy and traditional cell counts. The ability of the assay to accurately estimate the number of cells in the VBNC state was also demonstrated. Copyright © 2012 Elsevier B.V. All rights reserved.
Kurakawa, Takashi; Ogata, Kiyohito; Tsuji, Hirokazu; Kado, Yukiko; Takahashi, Takuya; Kida, Yumi; Ito, Masahiro; Okada, Nobuhiko; Nomoto, Koji
2015-04-01
Ten specific primer sets, for Lactobacillus gasseri, Lactobacillus crispatus, Atopobium vaginae, Gardnerella vaginalis, Mobiluncus curtisii, Chlamydia trachomatis/muridarum, Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, Bifidobacterium adolescentis, and Bifidobacterium angulatum, were developed for quantitative analysis of vaginal microbiota. rRNA-targeted reverse transcription-quantitative PCR (RT-qPCR) analysis of the vaginal samples from 12 healthy Japanese volunteers using the new primer sets together with 25 existing primer sets revealed the diversity of their vaginal microbiota: Lactobacilli such as L. crispatus, L. gasseri, Lactobacillus jensenii, Lactobacillus iners, and Lactobacillus vaginalis, as the major populations at 10(7) cells/ml vaginal fluid, were followed by facultative anaerobes such as Streptococcus and strict anaerobes at lower population levels of 10(4) cells/ml or less. Certain bacterial vaginosis (BV)-related bacteria, such as G. vaginalis, A. vaginae, M. curtisii, and Prevotella, were also detected in some subjects. Especially in one subject, both G. vaginalis and A. vaginae were detected at high population levels of 10(8.8) and 10(8.9) cells/ml vaginal fluid, suggesting that she is an asymptomatic BV patient. These results suggest that the RT-qPCR system is effective for accurate analysis of major vaginal commensals and diagnosis of several vaginal infections. Copyright © 2015 Elsevier B.V. All rights reserved.
FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS
Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...
Hata, S; Hata, H; Miyasawa-Hori, H; Kudo, A; Mayanagi, H
2006-02-01
To detect quantitatively the total bacteria and Streptococcus mutans in dental plaque by real-time PCR with prbac, Sm and GTF-B primers, and to compare their presence with the prevalence of dental caries in Japanese preschool children. Human dental plaque samples were collected from the labial surfaces of the upper primary central incisors of 107 children. The dental status was recorded as dft by WHO caries diagnostic criteria. Positive dt and dft scores by the Sm or GTF-B primer were significantly higher than negative scores (P < 0.01). The proportions of Strep. mutans to the total bacteria from sound, and sound and/or filled upper primary incisors were significantly lower than those from decayed or filled, and decayed incisors, respectively (P < 0.01). The ratios of Strep. mutans to total bacteria in plaque detected by real-time PCR with Sm and GTF-B primers were closely associated with the prevalence of dental caries in Japanese preschool children. These assays may be useful for the assessment of an individual's risk of dental caries.
Mahmood, Shahid; Freitag, Thomas E; Prosser, James I
2006-06-01
PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.
Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.
2003-01-01
Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643
Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J
2006-01-01
important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H
2012-04-27
To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.
Wensing, Annette; Zimmermann, Stefan; Geider, Klaus
2010-01-01
Pantoea stewartii subsp. stewartii is the causative agent of Stewart's wilt, a bacterial disease transmitted by the corn flea beetle mainly to sweet corn (Zea mays). In many countries, it is classified as a quarantine organism and must be differentiated from other yellow enteric bacteria frequently occurring with corn. We have created novel primers from the pstS-glmS region of P. stewartii for use in conventional PCR (cPCR) and quantitative PCR (qPCR). To facilitate rapid diagnosis, we applied matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS) analysis. Using whole-cell protein extracts, profiles were generated with a Bruker microflex machine, and the bacteria classified. P. stewartii strains were clearly distinguished from strains of Pantoea agglomerans, Pantoea dispersa, and Pantoea ananatis. Dendrogram analysis of the protein profiles confirmed the score values and showed the formation of separate clades for each species. The identification achieved by MALDI-TOF MS analysis agrees with the diagnosis by specific PCR primers. The combination of both methods allows a rapid and simple identification of the corn pathogen. P. stewartii subsp. stewartii and P. stewartii subsp. indologenes are highly related and can be distinguished not only by virulence assays and indole tests but also by a characteristic pattern in the nucleotide sequence of recA. PMID:20656863
Kim, Jaai; Lim, Juntaek; Lee, Changsoo
2013-12-01
Quantitative real-time PCR (qPCR) has been widely used in recent environmental microbial ecology studies as a tool for detecting and quantifying microorganisms of interest, which aids in better understandings of the complexity of wastewater microbial communities. Although qPCR can be used to provide more specific and accurate quantification than other molecular techniques, it does have limitations that must be considered when applying it in practice. This article reviews the principle of qPCR quantification and its applications to microbial ecology studies in various wastewater treatment environments. Here we also address several limitations of qPCR-based approaches that can affect the validity of quantification data: template nucleic acid quality, nucleic acid extraction efficiency, specificity of group-specific primers and probes, amplification of nonviable DNA, gene copy number variation, and limited number of sequences in the database. Even with such limitations, qPCR is reportedly among the best methods for quantitatively investigating environmental microbial communities. The application of qPCR is and will continue to be increasingly common in studies of wastewater treatment systems. To obtain reliable analyses, however, the limitations that have often been overlooked must be carefully considered when interpreting the results. Copyright © 2013 Elsevier Inc. All rights reserved.
Buh Gasparic, Meti; Tengs, Torstein; La Paz, Jose Luis; Holst-Jensen, Arne; Pla, Maria; Esteve, Teresa; Zel, Jana; Gruden, Kristina
2010-03-01
Several techniques have been developed for detection and quantification of genetically modified organisms, but quantitative real-time PCR is by far the most popular approach. Among the most commonly used real-time PCR chemistries are TaqMan probes and SYBR green, but many other detection chemistries have also been developed. Because their performance has never been compared systematically, here we present an extensive evaluation of some promising chemistries: sequence-unspecific DNA labeling dyes (SYBR green), primer-based technologies (AmpliFluor, Plexor, Lux primers), and techniques involving double-labeled probes, comprising hybridization (molecular beacon) and hydrolysis (TaqMan, CPT, LNA, and MGB) probes, based on recently published experimental data. For each of the detection chemistries assays were included targeting selected loci. Real-time PCR chemistries were subsequently compared for their efficiency in PCR amplification and limits of detection and quantification. The overall applicability of the chemistries was evaluated, adding practicability and cost issues to the performance characteristics. None of the chemistries seemed to be significantly better than any other, but certain features favor LNA and MGB technology as good alternatives to TaqMan in quantification assays. SYBR green and molecular beacon assays can perform equally well but may need more optimization prior to use.
Arancia, Silvia; Sandini, Silvia; De Carolis, Elena; Vella, Antonietta; Sanguinetti, Maurizio; Norelli, Sandro; De Bernardis, Flavia
2016-10-01
Aspergillus species are the cause of invasive mold infections in immunocompromised patients: Aspergillus fumigatus, A. flavus and A. terreus account for most cases of invasive aspergillosis (IA). As certain species are associated with higher mortality and vary in their resistance to antifungal therapy, diagnosis requires increasingly rapid molecular methods that enable sensitive detection and species discrimination. We have developed PCR and Multiplex PCR assays for the detection of six medically important Aspergillus spp. species DNA in bronchoalveolar lavage (BAL) specimens from hematology and intensive care unit (ICU) patients at risk of IA, using different species and genus-specific PCR primers, selected within the SCW4 gene, encoding a cell wall glucanase of A. fumigatus, similar to mannoprotein Mp65 of Candida albicans. The genus-specific PCR primers were able to amplify only Aspergillus DNAs but not that belonging to other fungal genera tested. The species-specific PCR primers allowed differentiation of each Aspergillus species by the amplicon length produced. The methods described in this study are rapid (less than 4 h), reproducible, simple and specific and demonstrate potential application in the clinical laboratory.
PALATAL DYSMORPHOGENESIS: QUANTITATIVE RT-PCR
ABSTRACT
Palatal Dysmorphogenesis : Quantitative RT-PCR
Gary A. Held and Barbara D. Abbott
Reverse transcription PCR (RT-PCR) is a very sensitive method for detecting mRNA in tissue samples. However, as it is usually performed it is does not yield quantitativ...
Jia, Peng; Purcell, Maureen; Pan, Guang; Wang, Jinjin; Kan, Shifu; Liu, Yin; Zheng, Xiaocong; SHi, Xiujie; He, Junqiang; Yu, Li; Hua, Qunyi; Lu, Tikang; Lan, Wensheng; Winton, James; Jin, Ningyi; Liu, Hong
2017-01-01
Infectious hematopoietic necrosis virus (IHNV) is an important pathogen of salmonid fishes. A validated universal reverse transcriptase quantitative PCR (RT-qPCR) assay that can quantify levels of IHNV in fish tissues has been previously reported. In the present study, we adapted the published set of IHNV primers and probe for use in a reverse-transcriptase droplet digital PCR (RT-ddPCR) assay for quantification of the virus in fish tissue samples. The RT-ddPCR and RT-qPCR assays detected 13 phylogenetically diverse IHNV strains, but neither assay produced detectable amplification when RNA from other fish viruses was used. The RT-ddPCR assay had a limit of detection (LOD) equating to 2.2 plaque forming units (PFU)/μl while the LOD for the RT-qPCR was 0.2 PFU/μl. Good agreement (69.4–100%) between assays was observed when used to detect IHNV RNA in cell culture supernatant and tissues from IHNV infected rainbow trout (Oncorhynchus mykiss) and arctic char (Salvelinus alpinus). Estimates of RNA copy number produced by the two assays were significantly correlated but the RT-qPCR consistently produced higher estimates than the RT-ddPCR. The analytical properties of the N gene RT-ddPCR test indicated that this method may be useful to assess IHNV RNA copy number for research and diagnostic purposes. Future work is needed to establish the within and between laboratory diagnostic performance of the RT-ddPCR assay.
Wang, Jianchang; Li, Rui; Hu, Lianxia; Sun, Xiaoxia; Wang, Jinfeng; Li, Jing
2016-02-16
Food-borne disease caused by Salmonella has long been, and continues to be, an important global public health problem, necessitating rapid and accurate detection of Salmonella in food. Real time PCR is the most recently developed approach for Salmonella detection. Single primer isothermal amplification (SPIA), a novel gene amplification technique, has emerged as an attractive microbiological testing method. SPIA is performed under a constant temperature, eliminating the need for an expensive thermo-cycler. In addition, SPIA reactions can be accomplished in 30 min, faster than real time PCR that usually takes over 2h. We developed a quantitative fluorescence SPIA-based method for the detection of Salmonella. Using Salmonella Typhimurium genomic DNA as template and a primer targeting Salmonella invA gene, we showed the detection limit of SPIA was 2.0 × 10(1)fg DNA. Its successful amplification of different serotypic Salmonella genomic DNA but not non-Salmonella bacterial DNA demonstrated the specificity of SPIA. Furthermore, this method was validated with artificially contaminated beef. In conclusion, we showed high sensitivity and specificity of SPIA in the detection of Salmonella, comparable to real time PCR. In addition, SPIA is faster and more cost-effective (non-use of expensive cyclers), making it a potential alternative for field detection of Salmonella in resource-limited settings that are commonly encountered in developing countries. Copyright © 2015 Elsevier B.V. All rights reserved.
Quantitative PCR measurement of tRNA 2-methylthio modification for assessing type 2 diabetes risk.
Xie, Peiyu; Wei, Fan-Yan; Hirata, Shoji; Kaitsuka, Taku; Suzuki, Tsutomu; Suzuki, Takeo; Tomizawa, Kazuhito
2013-11-01
Genetic variants in the human CDKAL1 (CDK5 regulatory subunit associated protein 1-like 1) gene have been associated with reduced insulin secretion and type 2 diabetes (T2D). CDKAL1 is a methylthiotransferase that catalyzes 2-methylthio (ms(2)) modification of the adenine at position 37 (A37) of cytoplasmic tRNA(Lys)(UUU). We investigated the ms(2)-modification level of tRNA(Lys)(UUU) as a direct readout of CDKAL1 enzyme activity in human samples. We developed a quantitative PCR (qPCR)-based method to measure ms(2) modification. tRNA(Lys)(UUU) was reverse-transcribed with 2 unique primers: Reverse primer r1 was designed to anneal to the middle of this tRNA, including the nucleotide at A37, and reverse primer r2 was designed to anneal to the region downstream (3') of A37. Subsequent qPCR was performed to detect the corresponding transcribed cDNAs. The efficiency of reverse transcription of tRNA(Lys)(UUU) was ms(2)-modification dependent. The relative difference in threshold cycle number obtained with the r1 or r2 primer yielded the ms(2)-modification level in tRNA(Lys)(UUU) precisely as predicted by an original mathematical model. The method was capable of measuring ms(2)-modification levels in tRNA(Lys)(UUU) in total RNA isolated from human peripheral blood samples, revealing that the ms(2)-modification rate in tRNA(Lys)(UUU) was decreased in individuals carrying the CDKAL1 genotype associated with T2D. In addition, the ms(2)-modification level was correlated with insulin secretion. The results point to the critical role of ms(2) modification in T2D and to a potential clinical use of a simple and high-throughput method for assessing T2D risk.
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur
2009-01-01
* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.
Mitchell, Andrew
2015-09-01
Natural history museums are vastly underutilized as a source of material for DNA analysis because of perceptions about the limitations of DNA degradation in older specimens. Despite very few exceptions, most DNA barcoding projects, which aim to obtain sequence data from all species, generally use specimens collected specifically for that purpose, instead of the wealth of identified material in museums, constrained by the lack of suitable PCR methods. Any techniques that extend the utility of museum specimens for DNA analysis therefore are highly valuable. This study first tested the effects of specimen age and PCR amplicon size on PCR success rates in pinned insect specimens, then developed a PCR primer set and amplification strategy allowing greatly increased utilization of older museum specimens for DNA barcoding. PCR success rates compare favourably with the few published studies utilizing similar aged specimens, and this new strategy has the advantage of being easily automated for high-throughput laboratory workflows. The strategy uses hemi-nested, degenerate, M13-tailed PCR primers to amplify two overlapping amplicons, using two PCRs per amplicon (i.e. four PCRs per DNA sample). Initial PCR products are reamplified using an internal primer and a M13 primer. Together the two PCR amplicons yield 559 bp of the COI gene from Coleoptera, Lepidoptera, Diptera, Hemiptera, Odonata and presumably also other insects. BARCODE standard-compliant data were recovered from 67% (56 of 84) of specimens up to 25 years old, and 51% (102 of 197) of specimens up to 55 years old. Given the time, cost and specialist expertise required for fieldwork and identification, 'collecting in collections' is a viable alternative allowing researchers to capitalize on the knowledge captured by curation work in decades past. © 2015 John Wiley & Sons Ltd.
Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu
2015-08-01
Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Söderlund-Strand, Anna; Carlson, Joyce; Dillner, Joakim
2009-03-01
Human papillomavirus (HPV) infection is a necessary cause of cervical cancer and cervical dysplasia. Accurate and sensitive genotyping of multiple oncogenic HPVs is essential for a multitude of both clinical and research uses. We developed a modified general primer (MGP) PCR system with five forward and five reverse consensus primers. The MGP system was compared to the classical HPV general primer system GP5+/6+ using a proficiency panel with HPV plasmid dilutions as well as cervical samples from 592 women with low-grade cytological abnormalities. The reference method (GP5+/6+) had the desirable high sensitivity (five copies/PCR) for five oncogenic HPV types (HPV type 16 [HPV-16], HPV-18, HPV-56, HPV-59, and HPV-66). The MGP system was able to detect all 14 oncogenic HPV types at five copies/PCR. In the clinical samples, the MGP system detected a significantly higher proportion of women with more than two concomitant HPV infections than did the GP5+/6+ system (102/592 women compared to 42/592 women). MGP detected a significantly greater number of infections with HPV-16, -18, -31, -33, -35, -39, -42, -43, -45, -51, -52, -56, -58, and -70 than did GP5+/6+. In summary, the MGP system primers allow a more sensitive amplification of most of the HPV types that are established as oncogenic and had an improved ability to detect multiple concomitant HPV infections.
Randhawa, Parmjeet S; Farasati, Noush A; Huang, Yuchen; Mapara, Markus Y; Shapiro, Ron
2010-12-01
Our objective was to determine whether quantitative polymerase chain reaction (PCR) can be used to measure the effect of tyrosine kinase (TK) inhibition on polyomavirus BK (BKV) replication. The BKV was grown in a cell culture system. The rate of viral replication in the presence or absence of the drug being tested was assessed by amplifying the viral genome using primers directed against the viral capsid 1 protein. Dasatinib, erlotinib, gefitinib, imatinib, sunitinib, and sorafenib all showed antiviral activity at micromolar concentrations. The 50% effective concentration for erlotinib and sorafenib was within blood concentrations readily achieved in human subjects. Quantitative PCR is a convenient method for viral drug sensitivity testing for slow-growing viruses that do not readily produce cytopathic effect. TK inhibitors deserve further consideration as a potential therapeutic option for BKV-associated nephropathy and hemorrhagic cystitis.
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-01-01
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272
Seo, Jung Soo; Jeon, Eun Ji; Kim, Moo Sang; Woo, Sung Ho; Kim, Jin Do; Jung, Sung Hee; Park, Myoung Ae; Jee, Bo Young; Kim, Jin Woo; Kim, Yi-Cheong; Lee, Eun Hye
2012-06-01
Intestinal giant-cystic disease (IGCD) of the Israel carp (Cyprinus carpio nudus) has been recognized as one of the most serious diseases afflicting inland farmed fish in the Republic of Korea, and Thelohanellus kitauei has been identified as the causative agent of the disease. Until now, studies concerning IGCD caused by T. kitauei in the Israel carp have been limited to morphological and histopathological examinations. However, these types of diagnostic examinations are relatively time-consuming, and the infection frequently cannot be detected in its early stages. In this study, we cloned the full-length 18S rRNA gene of T. kitauei isolated from diseased Israel carps, and carried out molecular identification by comparing the sequence with those of other myxosporeans. Moreover, conventional PCR and real-time quantitative PCR (qPCR) using oligonucleotide primers for the amplification of 18S rRNA gene fragment were established for further use as methods for rapid diagnosis of IGCD. Our results demonstrated that both the conventional PCR and real-time quantitative PCR systems applied herein are effective for rapid detection of T. kitauei spores in fish tissues and environmental water.
Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.
Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D
2002-12-20
A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.
Pooler, M R; Ritchie, D F; Hartung, J S
1996-01-01
Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198
NASA Astrophysics Data System (ADS)
Yi, Xiaoyan; Zhang, Huan; Liu, Guangxing
2014-05-01
Pelagic copepods play an important role in the marine food web. However, a full understanding of the ecological status of this zooplankton group depends on the careful study of their natural diets. In previous PCR-based copepod diet studies, we found many apostome ciliates that live symbiotically under the exoskeleton of the copepods, and their sequences were often over-represented in the 18S rRNA gene (18S rDNA) libraries. As a first step to address this issue, we designed three apostome ciliate 18S rDNA blocking primers, and tested their blocking efficiency against apostome ciliate 18s rDNA under various PCR conditions. Using a semi-quantitative PCR method, we optimized the conditions to efficiently amplify the 18S rDNA of the prey while simultaneously excluding the symbiotic apostome ciliates. This technique will facilitate PCR-based diet studies of copepods and other zooplankton in their natural environments.
Dolan, Anthony; Burgess, Catherine M; Barry, Thomas B; Fanning, Seamus; Duffy, Geraldine
2009-04-01
A sensitive quantitative reverse-transcription PCR (qRT-PCR) method was developed for enumeration of total bacteria. Using two sets of primers separately to target the ribonuclease-P (RNase P) RNA transcripts of gram positive and gram negative bacteria. Standard curves were generated using SYBR Green I kits for the LightCycler 2.0 instrument (Roche Diagnostics) to allow quantification of mixed microflora in liquid media. RNA standards were used and extracted from known cell equivalents and subsequently converted to cDNA for the construction of standard curves. The number of mixed bacteria in culture was determined by qRT-PCR, and the results correlated (r(2)=0.88, rsd=0.466) with the total viable count over the range from approx. Log(10) 3 to approx. Log(10) 7 CFU ml(-1). The rapid nature of this assay (8 h) and its potential as an alternative method to the standard plate count method to predict total viable counts and shelf life are discussed.
Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur
2015-01-01
The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-07-08
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc
2009-10-28
GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.
[A new method of processing quantitative PCR data].
Ke, Bing-Shen; Li, Guang-Yun; Chen, Shi-Min; Huang, Xiang-Yan; Chen, Ying-Jian; Xu, Jun
2003-05-01
Today standard PCR can't satisfy the need of biotechnique development and clinical research any more. After numerous dynamic research, PE company found there is a linear relation between initial template number and cycling time when the accumulating fluorescent product is detectable.Therefore,they developed a quantitative PCR technique to be used in PE7700 and PE5700. But the error of this technique is too great to satisfy the need of biotechnique development and clinical research. A better quantitative PCR technique is needed. The mathematical model submitted here is combined with the achievement of relative science,and based on the PCR principle and careful analysis of molecular relationship of main members in PCR reaction system. This model describes the function relation between product quantity or fluorescence intensity and initial template number and other reaction conditions, and can reflect the accumulating rule of PCR product molecule accurately. Accurate quantitative PCR analysis can be made use this function relation. Accumulated PCR product quantity can be obtained from initial template number. Using this model to do quantitative PCR analysis,result error is only related to the accuracy of fluorescence intensity or the instrument used. For an example, when the fluorescence intensity is accurate to 6 digits and the template size is between 100 to 1,000,000, the quantitative result accuracy will be more than 99%. The difference of result error is distinct using same condition,same instrument but different analysis method. Moreover,if the PCR quantitative analysis system is used to process data, it will get result 80 times of accuracy than using CT method.
A quantitative TaqMan PCR assay for the detection of Ureaplasma diversum.
Marques, Lucas M; Amorim, Aline T; Martins, Hellen Braga; Rezende, Izadora Souza; Barbosa, Maysa Santos; Lobão, Tassia Neves; Campos, Guilherme B; Timenetsky, Jorge
2013-12-27
Ureaplasma diversum in veterinary studies is an undesirable microbe, which may cause infection in bulls and may result in seminal vesiculitis, balanopostitis, and alterations in spermatozoids, whereas in cows, it may cause placentitis, fetal alveolitis, abortion, and birth of weak calves. U. diversum is released through organic secretions, especially semen, preputial and vaginal mucus, conjunctival secretion, and milk. The aim of the present study was to develop a TaqMan probe, highly sensitive and specific quantitative PCR (qPCR) assay for the detection and quantification of U. diversum from genital swabs of bovines. Primers and probes specific to U. diversum 16S rRNA gene were designed. The specificity, detection limit, intra- and inter-assay variability of qPCR to detect this ureaplasma was compared with the results of the conventional PCR assay (cPCR). Swabs of vaginal mucus from 169 cows were tested. The qPCR assay detected as few as 10 copies of U. diversum and was 100-fold more sensitive than the cPCR. No cross-reactivity with other Mollicutes or eubacteria was observed. U. diversum was detected in 79 swabs (46.42%) by qPCR, while using cPCR it was detected in 42 (25%) samples. The difference in cPCR and qPCR ureaplasma detection between healthy and sick animals was not statistically significant. But the U. diversum load in samples from animals with genital disorders was higher than in healthy animals. The qPCR assay developed herein is highly sensitive and specific for the detection and quantification of U. diversum in vaginal bovine samples. Copyright © 2013. Published by Elsevier B.V.
Huang, Xunbing; Wu, Huihui; McNeill, Mark Richard; Qin, Xinghu; Ma, Jingchuan; Tu, Xiongbing; Cao, Guangchun; Wang, Guangjun; Nong, Xiangqun; Zhang, Zehua
2016-01-01
Studies on grasshopper diets have historically employed a range of methodologies, each with certain advantages and disadvantages. For example, some methodologies are qualitative instead of quantitative. Others require long experimental periods or examine population-level effects, only. In this study, we used real-time PCR to examine diets of individual grasshoppers. The method has the advantage of being both fast and quantitative. Using two grasshopper species, Oedaleus asiaticus and Dasyhippus barbipes, we designed ITS primer sequences for their three main host plants, Stipa krylovii, Leymus chinensis and Cleistogenes squarrosa and used real-time PCR method to test diet structure both qualitatively and quantitatively. The lowest detection efficiency of the three grass species was ~80% with a strong correlation between actual and PCR-measured food intake. We found that Oedaleus asiaticus maintained an unchanged diet structure across grasslands with different grass communities. By comparison, Dasyhippus barbipes changed its diet structure. These results revealed why O. asiaticus distribution is mainly confined to Stipa-dominated grassland, and D. barbipes is more widely distributed across Inner Mongolia. Overall, real-time PCR was shown to be a useful tool for investigating grasshopper diets, which in turn offers some insight into grasshopper distributions and improved pest management. PMID:27562455
Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles
2008-01-01
So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.
Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y
2010-08-01
To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.
[Development of a universal primers PCR-coupled liquid bead array to detect biothreat bacteria].
Wen, Hai-yan; Wang, Jing; Liu, Heng-chuan; Sun, Xiao-hong; Yang, Yu; Hu, Kong-xin; Shan, Lin-jun
2009-10-01
To develop a fast, high-throughput screening method with suspension array technique for simultaneous detection of biothreat bacteria. 16 S rDNA universal primers for Bacillus anthracis, Francisella tularensis, Yersinia pestis, Brucella spp.and Burkholderia pseudomallei were selected to amplify corresponding regions and the genus-specific or species-specific probes were designed. After amplification of chromosomal DNA by 16 S rDNA primers 341A and 519B, the PCR products were detected by suspension array technique. The sensitivity, specificity, reproducibility and detection power were also analyzed. After PCR amplification by 16 S rDNA primers and specific probe hybridization, the target microorganisms could be identified at genus level, cross reaction was recognized in the same genus. The detection sensitivity of the assay was 1.5 pg/microl (Burkholderia pseudomallei), 20 pg/microl (Brucella spp.), 7 pg/microl (Bacillus anthracis), 0.1 pg/microl (Francisella tularensis), and 1.1 pg/microl (Yersinia pestis), respectively. The coefficient of variation for 15 test of different probes was ranged from 5.18% to 17.88%, it showed good reproducibility. The assay could correctly identify Bacillus anthracis and Yersinia pestis strains in simulated white powder samples. The suspension array technique could be served as an opening screening method for biothreat bacteria rapid detection.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
An Alu-based, MGB Eclipse real-time PCR method for quantitation of human DNA in forensic samples.
Nicklas, Janice A; Buel, Eric
2005-09-01
The forensic community needs quick, reliable methods to quantitate human DNA in crime scene samples to replace the laborious and imprecise slot blot method. A real-time PCR based method has the possibility of allowing development of a faster and more quantitative assay. Alu sequences are primate-specific and are found in many copies in the human genome, making these sequences an excellent target or marker for human DNA. This paper describes the development of a real-time Alu sequence-based assay using MGB Eclipse primers and probes. The advantages of this assay are simplicity, speed, less hands-on-time and automated quantitation, as well as a large dynamic range (128 ng/microL to 0.5 pg/microL).
Miller, D M; Dudley, E G; Roberts, R F
2012-09-01
Yogurt starter cultures may consist of multiple strains of Lactobacillus delbrueckii ssp. bulgaricus (LB) and Streptococcus thermophilus (ST). Conventional plating methods for monitoring LB and ST levels during yogurt manufacture do not allow for quantification of individual strains. The objective of the present work was to develop a quantitative PCR method for quantification of individual strains in a commercial yogurt starter culture. Strain-specific primers were designed for 2 ST strains (ST DGCC7796 and ST DGCC7710), 1 LB strain (DGCC4078), and 1 Lactobacillus delbrueckii ssp. lactis strain (LL; DGCC4550). Primers for the individual ST and LB strains were designed to target unique DNA sequences in clustered regularly interspersed short palindromic repeats. Primers for LL were designed to target a putative mannitol-specific IIbC component of the phosphotransferase system. Following evaluation of primer specificity, standard curves relating cell number to cycle threshold were prepared for each strain individually and in combination in yogurt mix, and no significant differences in the slopes were observed. Strain balance data was collected for yogurt prepared at 41 and 43°C to demonstrate the potential application of this method. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
M. T. Mmbaga; N. B. Klopfenstein; M. -S. Kim; N. C. Mmbaga
2004-01-01
The internal transcribed spacer (ITS) regions of rDNA and the intervening 5.8S rRNA gene for the powdery mildew fungi Erysiphe (sect. Microsphaera) pulchra and Phyllactinia guttata were amplified using standard polymerase chain reaction (PCR) protocols and the universal primer pairs, ITS1 and ITS4. PCR products for ITS were analysed by electrophoresis in a 1.5% agarose...
Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk
2012-06-01
The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.
2014-01-01
Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675
Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann
2016-08-01
A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.
Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann
2016-01-01
A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201
Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Yarimizu, Tohru; Iwakiri, Ryo; Hoshida, Hisashi; Akada, Rinji
2015-08-01
Escherichia coli plasmids are commonly used for gene expression experiments in mammalian cells, while PCR-amplified DNAs are rarely used even though PCR is a much faster and easier method to construct recombinant DNAs. One difficulty may be the limited amount of DNA produced by PCR. For direct utilization of PCR-amplified DNA in transfection experiments, efficient transfection with a smaller amount of DNA should be attained. For this purpose, we investigated two enhancer reagents, polyethylene glycol and tRNA, for a chemical transfection method. The addition of the enhancers to a commercial transfection reagent individually and synergistically exhibited higher transfection efficiency applicable for several mammalian cell culture lines in a 96-well plate. By taking advantage of a simple transfection procedure using PCR-amplified DNA, SV40 and rabbit β-globin terminator lengths were minimized. The terminator length is short enough to design in oligonucleotides; thus, terminator primers can be used for the construction and analysis of numerous mutations, deletions, insertions, and tag-fusions at the 3'-terminus of any gene. The PCR-mediated gene manipulation with the terminator primers will transform gene expression by allowing for extremely simple and high-throughput experiments with small-scale, multi-well, and mammalian cell cultures.
Cerón, J; Ortíz, A; Quintero, R; Güereca, L; Bravo, A
1995-01-01
In this paper we describe a PCR strategy that can be used to rapidly identify Bacillus thuringiensis strains that harbor any of the known cryI or cryIII genes. Four general PCR primers which amplify DNA fragments from the known cryI or cryIII genes were selected from conserved regions. Once a strain was identified as an organism that contains a particular type of cry gene, it could be easily characterized by performing additional PCR with specific cryI and cryIII primers selected from variable regions. The method described in this paper can be used to identify the 10 different cryI genes and the five different cryIII genes. One feature of this screening method is that each cry gene is expected to produce a PCR product having a precise molecular weight. The genes which produce PCR products having different sizes probably represent strains that harbor a potentially novel cry gene. Finally, we present evidence that novel crystal genes can be identified by the method described in this paper. PMID:8526493
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
Su, Y-L; Feng, J; Li, Y-W; Bai, J-S; Li, A-X
2016-02-01
Streptococcus agalactiae has become one of the most important emerging pathogens in the aquaculture industry and has resulted in large economic losses for tilapia farms in China. In this study, three pairs of specific primers were designed and tested for their specificities and sensitivities in quantitative real-time polymerase chain reactions (qPCRs) after optimization of the annealing temperature. The primer pair IGS-s/IGS-a, which targets the 16S-23S rRNA intergenic spacer region, was finally chosen, having a detection limit of 8.6 copies of S. agalactiae DNA in a 20 μL reaction mixture. Bacterial tissue tropism was demonstrated by qPCR in Oreochromis niloticus 5 days post-injection with a virulent S. agalactiae strain. Bacterial loads were detected at the highest level in brain, followed by moderately high levels in kidney, heart, spleen, intestines, and eye. Significantly lower bacterial loads were observed in muscle, gill and liver. In addition, significantly lower bacterial loads were observed in the brain of convalescent O. niloticus 14 days post-injection with several different S. agalactiae strains. The qPCR for the detection of S. agalactiae developed in this study provides a quantitative tool for investigating bacterial tissue tropism in infected fish, as well as for monitoring bacterial colonization in convalescent fish. © 2015 John Wiley & Sons Ltd.
Altınel, Ahmet
2017-01-01
Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256
Sulzinski, Michael A; Wasilewski, Melissa A; Farrell, James C; Glick, David L
2009-07-01
It is an extraordinary challenge to offer an undergraduate laboratory course in virology that teaches hands-on, relevant molecular biology techniques using nonpathogenic models of human virus detection. To our knowledge, there exists no inexpensive kits or reagent sets that are appropriate for demonstrating real-time PCR (RT-PCR) in an undergraduate laboratory course in virology. Here we describe simple procedures for student exercises that demonstrate the PCR detection of an HIV target nucleic acid. Our procedures combine a commercially available kit for conventional PCR with a modification for RT-PCR using the same reagents in the kit, making it possible for an instructor with access to a LightCycler® instrument to implement a relevant student exercise on RT-PCR detection of HIV nucleic acid targets. This combination of techniques is useful for demonstrating and comparing conventional PCR amplification and detection with agarose gel electrophoresis, with real-time PCR over a series of three laboratory periods. The series of laboratory periods also is used to provide the foundation for teaching the concept of PCR primer design, optimization of PCR detection systems, and introduction to nucleic acid queries using NCBI-BLAST to find and identify primers, amplicons, and other potential amplification targets within the HIV viral genome. The techniques were successfully implemented at the Biology 364 undergraduate virology course at the University of Scranton during the Fall 2008 semester. The techniques are particularly targeted to students who intend to pursue either postgraduate technical employment or graduate studies in the molecular life sciences. Copyright © 2009 International Union of Biochemistry and Molecular Biology, Inc.
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
URPD: a specific product primer design tool.
Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong
2012-06-19
Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.
Wang, Zi-nian; Cai, Han-fang; Li, Ming-xun; Cao, Xiu-kai; Lan, Xian-yong; Lei, Chu-zhao; Chen, Hong
2016-01-10
Patatin-like phospholipase domain-containing protein 3 (PNPLA3), a member of the patatin like phospholipase domain-containing (PNPLA) family, plays an important role in energy balance, fat metabolism regulation, glucose metabolism and fatty liver disease. Tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) is a new method offering fast detection and extreme simplicity at a negligible cost for SNP genotyping. In this paper, we investigated the genetic variations at different ages of 660 Chinese indigenous cattle belonging to three breeds (QC, NY, JX) and applied T-ARMS-PCR and PCR-RFLP methods to genotype four SNPs, SNP1: g.A2980G, SNP2: g.A2996T, SNP3: g.A36718G, SNP4: g.G36850A. The statistical analyses indicated that these 4 SNPs affected growth traits markedly (P<0.05) in QC population, whereas combined haplotypes were not (P>0.05). The qPCR (quantitative PCR) indicated that bovine PNPLA3 gene was exclusively expressed in fat tissues. Besides, the analysis between SNP and mRNA expression revealed that, in SNP1, the expression of AG was much higher than AA and GG (P<0.05), which was in accordance with the results of growth traits association analysis, while the results of SNP4 was not. These results supported high potential that SNPs of bovine PNPLA3 gene might be utilized as genetic markers in marker-assisted selection (MAS) for Chinese cattle breeding programs. Copyright © 2015 Elsevier B.V. All rights reserved.
PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences
Machida, Ryuji J.; Knowlton, Nancy
2012-01-01
Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets
URPD: a specific product primer design tool
2012-01-01
Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312
NASA Astrophysics Data System (ADS)
Carrion, C. N.; Slesinger, E.; Marinovic, B.
2016-02-01
Euphausiids, otherwise known as krill, are an important link between primary producers and higher trophic levels within the central California current upwelling system. Euphausia pacifica and Thysanoessa spinifera, two of the most common euphausiid species along the central California coast, are both broadcast spawners and have some overlap in habitat, e.g. near marine life hotspots like the Monterey Bay and Gulf of Farallones. Species composition of euphausiid egg population within these regions is currently unknown. Distinct morphological differences between their eggs are lost once the egg dies or is preserved via formalin, alcohol, or freezing. In this project we designed genus specific DNA primers (mtCOI) for use in a multiplex PCR to distinguish among spawned euphausiid eggs of Euphausia spp. and Thysanoessa spp. in central California current surface waters. Effective and ineffective application of primers in a multiplex versus single-plex PCR is discussed, with an emphasis on primer design limitations in reference to the available barcoded regions of mitochondrial cytochrome oxidase subunit I (mtCOI) for each species in GenBank. This new protocol expands current monitoring efforts into sampling a non-swimming portion of the population which has the potential to improve euphausiid biomass estimates.
Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize
USDA-ARS?s Scientific Manuscript database
Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...
Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K
2015-02-01
A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.
Azzi, Salah; Steunou, Virginie; Rousseau, Alexandra; Rossignol, Sylvie; Thibaud, Nathalie; Danton, Fabienne; Le Jule, Marilyne; Gicquel, Christine; Le Bouc, Yves; Netchine, Irène
2011-02-01
Many human syndromes involve a loss of imprinting (LOI) due to a loss (LOM) or a gain of DNA methylation (GOM). Most LOI occur as mosaics and can therefore be difficult to detect with conventional methods. The human imprinted 11p15 region is crucial for the control of fetal growth, and LOI at this locus is associated with two clinical disorders with opposite phenotypes: Beckwith-Wiedemann syndrome (BWS), characterized by fetal overgrowth and a high risk of tumors, and Russell-Silver syndrome (RSS), characterized by intrauterine and postnatal growth restriction. Until recently, we have been using Southern blotting for the diagnosis of RSS and BWS. We describe here a powerful quantitative technique, allele-specific methylated multiplex real-time quantitative PCR (ASMM RTQ-PCR), for the diagnosis of these two complex disorders. We first checked the specificity of the probes and primers used for ASMM RTQ-PCR. We then carried out statistical validation for this method, on both retrospective and prospective populations of patients. This analysis demonstrated that ASMM RTQ-PCR is more sensitive than Southern blotting for detecting low degree of LOI. Moreover, ASMM RTQ-PCR is a very rapid, reliable, simple, safe, and cost effective method. © 2011 Wiley-Liss, Inc.
Hatta, Takeshi; Matsubayashi, Makoto; Miyoshi, Takeharu; Islam, Khyrul; Alim, M Abdul; Anisuzzaman; Yamaji, Kayoko; Fujisaki, Kozo; Tsuji, Naotoshi
2013-01-31
Most causative agents of babesiosis, Babesia parasites, are transmitted transovarially in ixodid ticks. In this study, B. gibsoni, the causative agent of canine babesiosis which has transovarial transmission, was detected in tissues of the vector tick, Haemaphysalis longicornis using a modified quantitative PCR assay. Conventional PCR results showed that the newly designed primer set, which amplifies a 143-bp fragment of rhoptry-associated protein-1 (BgRAP-1) gene in B. gibsoni, was 100 times more sensitive than primers targeting P18 gene encoding 18 kDa protein of B. gibsoni, which was recently renamed as thrombospondin related adhesive protein (BgTRAP) gene, in an artificially generated sample solution containing metagenomic DNA (B. gibsoni DNA extracted from infected dog blood mixed with tick DNA). The TaqMan probe-based quantitative PCR (qPCR) for BgRAP-1 could also detect infected RBCs (iRBCs) at levels of 3.5 × 10(5) to 3.5 × 10(1)/μl, a range that is broader than that of a past SYBR Green-based qPCR method for P18/BgTRAP, which had a detection limit of 3.5 × 10(3) iRBCs/μl. Using this qPCR assay, we attempted to quantify the B. gibsoni burden in tick ovaries and embryonated eggs. Levels of infection were normalized to the copy number of tick's genomic DNA fragment of ribosomal DNA internal transcribed spacer region 2 (ITS2) for the standardization. According to this, low levels of parasite burden were quantified in ovaries and eggs. This detection system is sensitive and is recommended as a tool for elucidating the biological interactions between the vector tick H. longicornis and the parasite, B. gibsoni.
Duan, Chuanren; Cui, Yamin; Zhao, Yi; Zhai, Jun; Zhang, Baoyun; Zhang, Kun; Sun, Da; Chen, Hang
2016-10-01
A genetic marker within the 16S rRNA gene of Faecalibacterium was identified for use in a quantitative PCR (qPCR) assay to detect swine faecal contamination in water. A total of 146,038 bacterial sequences were obtained using 454 pyrosequencing. By comparative bioinformatics analysis of Faecalibacterium sequences with those of numerous swine and other animal species, swine-specific Faecalibacterium 16S rRNA gene sequences were identified and Polymerase Chain Okabe (PCR) primer sets designed and tested against faecal DNA samples from swine and non-swine sources. Two PCR primer sets, PFB-1 and PFB-2, showed the highest specificity to swine faecal waste and had no cross-reaction with other animal samples. PFB-1 and PFB-2 amplified 16S rRNA gene sequences from 50 samples of swine with positive ratios of 86 and 90%, respectively. We compared swine-specific Faecalibacterium qPCR assays for the purpose of quantifying the newly identified markers. The quantification limits (LOQs) of PFB-1 and PFB-2 markers in environmental water were 6.5 and 2.9 copies per 100 ml, respectively. Of the swine-associated assays tested, PFB-2 was more sensitive in detecting the swine faecal waste and quantifying the microbial load. Furthermore, the microbial abundance and diversity of the microbiomes of swine and other animal faeces were estimated using operational taxonomic units (OTUs). The species specificity was demonstrated for the microbial populations present in various animal faeces. Copyright © 2016 Elsevier Ltd. All rights reserved.
O'Mahony, Jim; Hill, Colin
2004-01-01
Using fluorescence resonance energy transfer technology and Lightcycler analysis, we developed a real-time PCR assay with primers and probes designed by using IS900 which allowed rapid detection of Mycobacterium avium subsp. paratuberculosis DNA in artificially contaminated milk. Initially, the PCR parameters (including primer and probe levels, assay volume, Mg2+ concentration, and annealing temperature) were optimized. Subsequently, the quantitative ability of the assay was tested and was found to be accurate over a broad linear range (3 × 106 to 3 × 101 copies). The assay sensitivity when purified DNA was used was determined to be as low as five copies, with excellent reproducibility. A range of DNA isolation strategies was developed for isolating M. avium subsp. paratuberculosis DNA from spiked milk, the most effective of which involved the use of 50 mM Tris HCl, 10 mM EDTA, 2% Triton X-100, 4 M guanidinium isothiocyante, and 0.3 M sodium acetate combined with boiling, physical grinding, and nucleic acid spin columns. When this technique was used in conjunction with the real-time PCR assay, it was possible to consistently detect <100 organisms per ml of milk (equivalent to 2,000 organisms per 25 ml). Furthermore, the entire procedure (extraction and PCR) was performed in less than 3 h and was successfully adapted to quantify M. avium subsp. paratuberculosis in spiked milk from heavily and mildly contaminated samples. PMID:15294786
Competitor internal standards for quantitative detection of mycoplasma DNA.
Sidhu, M K; Rashidbaigi, A; Testa, D; Liao, M J
1995-05-01
Homologous internal controls were used as competitor DNA in the polymerase chain reaction for the quantitative detection of mycoplasma DNA. PCR primer sets were designed on the basis of the most conserved nucleotide sequences of the 16S rRNA gene of mycoplasma species. Amplification of this gene was examined in five different mycoplasma species: Mycoplasma orale, M. hyorhinus, M. synoviae, M. gallisepticum and M. pneumoniae. To evaluate the primers, a number of different cell lines were assayed for the detection of mycoplasma infections. All positive cell lines showed a distinct product on agarose gels while uninfected cells showed no DNA amplification. Neither bacterial nor eukaryotic DNA produced any cross-reaction with the primers used, thus confirming their specificity. Internal control DNA to be used for quantitation was constructed by modifying the sizes of the wild-type amplified products and cloning them in plasmid vectors. These controls used the same primer binding sites as the wild-type and the amplified products were differentiated by a size difference. The detection limits for all the mycoplasma species by competitive quantitative PCR were estimated to range from 4 to 60 genome copies per assay as determined by ethidium bromide-stained agarose gels. These internal standards also serve as positive controls in PCR-based detection of mycoplasma DNA, and therefore accidental contamination of test samples with wild-type positive controls can be eliminated. The quantitative PCR method developed will be useful in monitoring the progression and significance of mycoplasma in the disease process.
Qualitative PCR method for Roundup Ready soybean: interlaboratory study.
Kodama, Takashi; Kasahara, Masaki; Minegishi, Yasutaka; Futo, Satoshi; Sawada, Chihiro; Watai, Masatoshi; Akiyama, Hiroshi; Teshima, Reiko; Kurosawa, Yasunori; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi
2011-01-01
Quantitative and qualitative methods based on PCR have been developed for genetically modified organisms (GMO). Interlaboratory studies were previously conducted for GMO quantitative methods; in this study, an interlaboratory study was conducted for a qualitative method for a GM soybean, Roundup Ready soy (RR soy), with primer pairs designed for the quantitative method of RR soy studied previously. Fourteen laboratories in Japan participated. Each participant extracted DNA from 1.0 g each of the soy samples containing 0, 0.05, and 0.10% of RR soy, and performed PCR with primer pairs for an internal control gene (Le1) and RR soy followed by agarose gel electrophoresis. The PCR product amplified in this PCR system for Le1 was detected from all samples. The sensitivity, specificity, and false-negative and false-positive rates of the method were obtained from the results of RR soy detection. False-negative rates at the level of 0.05 and 0.10% of the RR soy samples were 6.0 and 2.3%, respectively, revealing that the LOD of the method was somewhat below 0.10%. The current study demonstrated that the qualitative method would be practical for monitoring the labeling system of GM soy in kernel lots.
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske
2007-02-14
The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses
Multiplexing Short Primers for Viral Family PCR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S N; Hiddessen, A L; Hara, C A
We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less
Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.
2013-01-01
The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746
Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris
2017-08-01
The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms
David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart
2017-01-01
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161
Shibuta, K; Abe, M; Suzuki, T
1994-01-01
The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197
Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W
2014-09-01
Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We
Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.
2003-01-01
A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936
Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.
Kalendar, Ruslan; Lee, David; Schulman, Alan H
2011-08-01
The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.
Ciulli, Sara; Pinheiro, Ana Cristina de Aguiar Saldana; Volpe, Enrico; Moscato, Michele; Jung, Tae Sung; Galeotti, Marco; Stellino, Sabrina; Farneti, Riccardo; Prosperi, Santino
2015-03-01
Lymphocystis disease virus (LCDV) is responsible for a chronic self-limiting disease that affects more than 125 teleosts. Viral isolation of LCDV is difficult, time-consuming and often ineffective; the development of a rapid and specific tool to detect and quantify LCDV is desirable for both diagnosis and pathogenic studies. In this study, a quantitative real-time PCR (qPCR) assay was developed using a Sybr-Green-based assay targeting a highly conserved region of the MCP gene. Primers were designed on a multiple alignment that included all known LCDV genotypes. The viral DNA segment was cloned within a plasmid to generate a standard curve. The limit of detection was as low as 2.6DNA copies/μl of plasmid and the qPCR was able to detect viral DNA from cell culture lysates and tissues at levels ten-times lower than conventional PCR. Both gilthead seabream and olive flounder LCDV has been amplified, and an in silico assay showed that LCDV of all genotypes can be amplified. LCDV was detected in target and non-target tissues of both diseased and asymptomatic fish. The LCDV qPCR assay developed in this study is highly sensitive, specific, reproducible and versatile for the detection and quantitation of Lymphocystivirus, and may also be used for asymptomatic carrier detection or pathogenesis studies of different LCDV strains. Copyright © 2014 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Identification of populations of Aspergillus section Nigri species in environmental samples using traditional methods is laborious and impractical for large numbers of samples. We developed species-specific primers and probes for quantitative droplet digital PCR (ddPCR) to improve sample throughput ...
Maruyama, N; Mori, A; Shono, S; Oda, H; Sako, T
2018-03-01
Porphyromonas gulae, Tannerella forsythia and Campylobacter rectus are considered dominant periodontal pathogens in dogs. Recently, quantitative real-time PCR (qRT-PCR) methods have been used for absolute quantitative determination of oral bacterial counts. The purpose of the present study was to establish a standardized qRT-PCR procedure to quantify bacterial counts of the three target periodontal bacteria (P. gulae, T. forsythia and C. rectus). Copy numbers of the three target periodontal bacteria were evaluated in 26 healthy dogs. Then, changes in bacterial counts of the three target periodontal bacteria were evaluated for 24 weeks in 7 healthy dogs after periodontal scaling. Analytical evaluation of each self-designed primer indicated acceptable analytical imprecision. All 26 healthy dogs were found to be positive for P. gulae, T. forsythia and C. rectus. Median total bacterial counts (copies/ng) of each target genes were 385.612 for P. gulae, 25.109 for T. forsythia and 5.771 for C. rectus. Significant differences were observed between the copy numbers of the three target periodontal bacteria. Periodontal scaling reduced median copy numbers of the three target periodontal bacteria in 7 healthy dogs. However, after periodontal scaling, copy numbers of all three periodontal bacteria significantly increased over time (p<0.05, Kruskal-Wallis test) (24 weeks). In conclusion, our results demonstrated that qRT-PCR can accurately measure periodontal bacteria in dogs. Furthermore, the present study has revealed that qRT-PCR method can be considered as a new objective evaluation system for canine periodontal disease. Copyright© by the Polish Academy of Sciences.
Nielsen, Martin K; Peterson, David S; Monrad, Jesper; Thamsborg, Stig M; Olsen, Susanne N; Kaplan, Ray M
2008-03-01
Strongylus vulgaris is an important strongyle nematode with high pathogenic potential infecting horses world-wide. Several decades of intensive anthelmintic use has virtually eliminated clinical disease caused by S. vulgaris, but has also caused high levels of anthelmintic resistance in equine small strongyle (cyathostomin) nematodes. Recommendations aimed at limiting the development of anthelmintic resistance by reducing treatment intensity raises a simultaneous demand for reliable and accurate diagnostic tools for detecting important parasitic pathogens. Presently, the only means available to differentiate among strongyle species in a faecal sample is by identifying individual L3 larvae following a two week coproculture procedure. The aim of the present study is to overcome this diagnostic obstacle by developing a fluorescence-based quantitative PCR assay capable of identifying S. vulgaris eggs in faecal samples from horses. Species-specific primers and a TaqMan probe were designed by alignment of published ribosomal DNA sequences of the second internal transcribed spacer of cyathostomin and Strongylus spp. nematodes. The assay was tested for specificity and optimized using genomic DNA extracted from identified male worms of Strongylus and cyathostomin species. In addition, eggs were collected from adult female worms and used to evaluate the quantitative potential of the assay. Statistically significant linear relationships were found between egg numbers and cycle of threshold (Ct) values. PCR results were unaffected by the presence of cyathostomin DNA in the sample and there was no indication of PCR inhibition by faecal sources. A field evaluation on faecal samples obtained from four Danish horse farms revealed a good agreement with the traditional larval culture (kappa-value=0.78), but with a significantly higher performance of the PCR assay. An association between Ct values and S. vulgaris larval counts was statistically significant. The present assay can
De Luca, Eliana; Crisi, Paolo Emidio; Di Domenico, Marco; Malatesta, Daniela; Vincifori, Giacomo; Di Tommaso, Morena; Di Guardo, Giovanni; Di Francesco, Gabriella; Petrini, Antonio; Savini, Giovanni; Boari, Andrea; Lorusso, Alessio
2018-05-03
The aim of this study was to develop a real-time RT-PCR to detect and quantitate feline morbillivirus (FeMV) RNA in biological samples. Primers and probe were targeted on a conserved region of FeMV P/V/C gene. To validate the assay with field samples, a total number of specimens of cats have been recruited including 264 urine and blood samples and compared with a generic RT-PCR targeting the L protein encoding gene of morbilliviruses. In addition, 385 tissue samples from 35 carcasses of cats have been also employed. RNA titres were low in all tested samples. Results also indicated the absence of cross-reaction with related morbilliviruses and existing pathogens of cats. In tissues with low levels of FeMV RNA, the presence of viral antigen was also evidenced by immunohistochemistry targeting the N viral protein. This newly described assay allows for a rapid, accurate and reliable quantitative detection of FeMV RNA that can be applied for diagnostics and research studies. Copyright © 2018 Elsevier B.V. All rights reserved.
Wang, Fei; Tian, Yin; Yang, Jing; Sun, Fu-Jun; Sun, Ning; Liu, Bi-Yong; Tian, Rui; Ge, Guang-Lu; Zou, Ming-qiang; Deng, Cong-liang; Liu, Yi
2014-10-01
To establish a magnetic nanoparticles separation-based quantitative real-time PCR (RT-PCR) assay for fast and accurate detection of Plasmodium falciparum and providing a technical support for improving the control and prevention of imported malaria. According to the conserved sequences of the P. falciparum genome 18SrRNA, the species-specific primers and probe were designed and synthetized. The RT-PCR was established by constructing the plasmid standard, fitting the standard curve and using magnetic nanoparticles separation. The sensitivity and specificity of the assay were evaluated. The relationship between the threshold cycle (Ct) and logarithm of initial templates copies was linear over a range of 2.5 x 10(1) to 2.5 x 10(8) copies/μl (R2 = 0.999). Among 13 subjects of entry frontier, a P. falciparum carrier with low load was detected by using the assay and none was detected with the conventional examinations (microscopic examinations and rapid tests). This assay shows a high sensitivity in detection of P. falciparum, with rapid and accurate characteristics, and is especially useful in diagnosis of P. falciparum infectors with low parasitaemia at entry-exit frontier ports.
Evaluation of primer and probe mismatches in sensitivity of select RRT-PCR tests for avian influenza
USDA-ARS?s Scientific Manuscript database
The recent outbreak of pH1N1 in animals highlighted an imperfection of the matrix real-time reverse transcriptase-polymerase chain reaction (RRT-PCR) that has become the primary screening test for avian and swine influenza viruses. Four mismatches in one primer resulted in an important loss of sens...
[Multiplex real-time PCR method for rapid detection of Marburg virus and Ebola virus].
Yang, Yu; Bai, Lin; Hu, Kong-Xin; Yang, Zhi-Hong; Hu, Jian-Ping; Wang, Jing
2012-08-01
Marburg virus and Ebola virus are acute infections with high case fatality rates. A rapid, sensitive detection method was established to detect Marburg virus and Ebola virus by multiplex real-time fluorescence quantitative PCR. Designing primers and Taqman probes from highly conserved sequences of Marburg virus and Ebola virus through whole genome sequences alignment, Taqman probes labeled by FAM and Texas Red, the sensitivity of the multiplex real-time quantitative PCR assay was optimized by evaluating the different concentrations of primers and Probes. We have developed a real-time PCR method with the sensitivity of 30.5 copies/microl for Marburg virus positive plasmid and 28.6 copies/microl for Ebola virus positive plasmids, Japanese encephalitis virus, Yellow fever virus, Dengue virus were using to examine the specificity. The Multiplex real-time PCR assays provide a sensitive, reliable and efficient method to detect Marburg virus and Ebola virus simultaneously.
Kim, Miju; Yoo, Insuk; Lee, Shin-Young; Hong, Yeun; Kim, Hae-Yeong
2016-11-01
The TaqMan® real-time PCR assay using the mitochondrial D-loop region was developed for the quantitative detection of pork in processed meat products. The newly designed primers and probe specifically amplified pork without any cross-reactivity with non-target animal species. The limit of detection of the real-time PCR assay was 0.1pg of heat-treated pork meat and 0.1% (w/w) pork meat in beef and chicken meat mixtures. The quantitative real-time PCR assay was applied to analyze the pork meat content in 22 commercial processed meat products including jerkies, press hams, sausages, hamburger patties and steaks, grilled short rib patties, and nuggets. The developed real-time PCR method was able to detect pork meat in various types of processed meat products that declared the use of pork meat on their label. All processed meat products that declared no use of pork meat showed a negative result in the assay. The method developed in this study showed sensitivity and specificity in the quantification of pork meat in commercial processed meat products. Copyright © 2016 Elsevier Ltd. All rights reserved.
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms.
David, Fabrice P A; Rougemont, Jacques; Deplancke, Bart
2017-01-04
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Hierro, Núria; Esteve-Zarzoso, Braulio; González, Ángel; Mas, Albert; Guillamón, Jose M.
2006-01-01
Real-time PCR, or quantitative PCR (QPCR), has been developed to rapidly detect and quantify the total number of yeasts in wine without culturing. Universal yeast primers were designed from the variable D1/D2 domains of the 26S rRNA gene. These primers showed good specificity with all the wine yeasts tested, and they did not amplify the most representative wine species of acetic acid bacteria and lactic acid bacteria. Numerous standard curves were constructed with different strains and species grown in yeast extract-peptone-dextrose medium or incubated in wine. The small standard errors with these replicas proved that the assay is reproducible and highly robust. This technique was validated with artificially contaminated and natural wine samples. We also performed a reverse transcription-QPCR (RT-QPCR) assay from rRNA for total viable yeast quantification. This technique had a low detection limit and was more accurate than QPCR because the dead cells were not quantified. As far as we know, this is the first time that RT-QPCR has been performed to quantify viable yeasts from rRNA. RT-QPCR is a rapid and accurate technique for enumerating yeasts during industrial wine fermentation and controlling the risk of wine spoilage. PMID:17088381
Landa, B B; López-Díaz, C; Jiménez-Fernández, D; Montes-Borrego, M; Muñoz-Ledesma, F J; Ortiz-Urquiza, A; Quesada-Moraga, E
2013-10-01
Beauveria bassiana strain 04/01-Tip obtained from larvae of the opium poppy stem gall Iraella luteipes endophytically colonizes opium poppy plants and protect it against this pest. Development of a specific, rapid and sensitive technique that allows accurately determining the process and factors leading to the establishment of this strain in opium poppy plants would be essential to achieve its efficient control in a large field scale. For that purpose in the present study, species-specific primers that can be used in conventional or quantitative PCR protocols were developed for specifically identification and detection of B. bassiana in plant tissues. The combination of the designed BB.fw/BB.rv primer set with the universal ITS1-F/ITS4 primer set in a two-step nested-PCR approach, has allowed the amplification of up to 10fg of B. bassiana. This represented an increase in sensitivity of 10000- and 1000-fold of detection than when using the BB.fw/BB.rv primers in a single or single-tube semi-nested PCR approaches, respectively. The BB.fw and BB.rv primer set were subsequently optimized to be used in real time quantitative PCR assays and allowed to accurately quantify B. bassiana DNA in different plant DNA backgrounds (leaves and seeds) without losing accuracy and efficiency. The qPCR protocol was used to monitor the endophytic colonization of opium poppy leaves byB. bassiana after inoculation with the strain EABb 04/01-Tip, detecting as low as 26fg of target DNA in leaves and a decrease in fungal biomass over time. PCR quantification data were supported in parallel with CLMS by the monitoring of spatial and temporal patterns of leaf and stem colonization using a GFP-tagged transformant of the B. bassiana EABb 04/01-Tip strain, which enabled to demonstrate that B. bassiana effectively colonizes aerial tissues of opium poppy plants mainly through intercellular spaces and even leaf trichomes. A decline in endophytic colonization was also observed by the last sampling
Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers
Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie
2013-01-01
The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915
Validation of PCR methods for quantitation of genetically modified plants in food.
Hübner, P; Waiblinger, H U; Pietsch, K; Brodmann, P
2001-01-01
For enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients, quantitative detection methods such as quantitative competitive (QC-PCR) and real-time PCR are applied by official food control laboratories. The experiences of 3 European food control laboratories in validating such methods were compared to describe realistic performance characteristics of quantitative PCR detection methods. The limit of quantitation (LOQ) of GMO-specific, real-time PCR was experimentally determined to reach 30-50 target molecules, which is close to theoretical prediction. Starting PCR with 200 ng genomic plant DNA, the LOQ depends primarily on the genome size of the target plant and ranges from 0.02% for rice to 0.7% for wheat. The precision of quantitative PCR detection methods, expressed as relative standard deviation (RSD), varied from 10 to 30%. Using Bt176 corn containing test samples and applying Bt176 specific QC-PCR, mean values deviated from true values by -7to 18%, with an average of 2+/-10%. Ruggedness of real-time PCR detection methods was assessed in an interlaboratory study analyzing commercial, homogeneous food samples. Roundup Ready soybean DNA contents were determined in the range of 0.3 to 36%, relative to soybean DNA, with RSDs of about 25%. Taking the precision of quantitative PCR detection methods into account, suitable sample plans and sample sizes for GMO analysis are suggested. Because quantitative GMO detection methods measure GMO contents of samples in relation to reference material (calibrants), high priority must be given to international agreements and standardization on certified reference materials.
Kim, Jeong-Soon; Wang, Nian
2009-03-06
Citrus Huanglongbing (HLB) is one of the most devastating diseases on citrus and is associated with Candidatus Liberibacter spp.. The pathogens are phloem limited and have not been cultured in vitro. The current management strategy of HLB is to remove infected citrus trees and reduce psyllid populations with insecticides to prevent the spreading. This strategy requires sensitive and reliable diagnostic methods for early detection. We investigated the copy numbers of the 16S rDNA and 16S rRNA of the HLB pathogen and the implication of improving the diagnosis of HLB for early detection using Quantitative PCR. We compared the detection of HLB with different Quantitative PCR based methods with primers/probe targeting either 16S rDNA, beta-operon DNA, 16S rRNA, or beta-operon RNA. The 16S rDNA copy number of Ca. Liberibacter asiaticus was estimated to be three times of that of the beta-operon region, thus allowing detection of lower titer of Ca. L. asiaticus. Quantitative reverse transcriptional PCR (QRT-PCR) indicated that the 16S rRNA averaged 7.83 times more than that of 16S rDNA for the same samples. Dilution analysis also indicates that QRT-PCR targeting 16S rRNA is 10 time more sensitive than QPCR targeting 16S rDNA. Thus QRT-PCR was able to increase the sensitivity of detection by targeting 16S rRNA. Our result indicates that Candidatus Liberibacter asiaticus contains three copies of 16S rDNA. The copy number of 16S rRNA of Ca. L. asiaticus in planta averaged about 7.8 times of 16S rDNA for the same set of samples tested in this study. Detection sensitivity of HLB could be improved through the following approaches: using 16S rDNA based primers/probe in the QPCR assays; and using QRT-PCR assays targeting 16S rRNA.
Stets, Maria Isabel; Alqueres, Sylvia Maria Campbell; Souza, Emanuel Maltempi; Pedrosa, Fábio de Oliveira; Schmid, Michael; Hartmann, Anton; Cruz, Leonardo Magalhães
2015-10-01
Azospirillum is a rhizobacterial genus containing plant growth-promoting species associated with different crops worldwide. Azospirillum brasilense strains exhibit a growth-promoting effect by means of phytohormone production and possibly by N2 fixation. However, one of the most important factors for achieving an increase in crop yield by plant growth-promoting rhizobacteria is the survival of the inoculant in the rhizosphere, which is not always achieved. The objective of this study was to develop quantitative PCR protocols for the strain-specific quantification of A. brasilense FP2. A novel approach was applied to identify strain-specific DNA sequences based on a comparison of the genomic sequences within the same species. The draft genome sequences of A. brasilense FP2 and Sp245 were aligned, and FP2-specific regions were filtered and checked for other possible matches in public databases. Strain-specific regions were then selected to design and evaluate strain-specific primer pairs. The primer pairs AzoR2.1, AzoR2.2, AzoR5.1, AzoR5.2, and AzoR5.3 were specific for the A. brasilense FP2 strain. These primer pairs were used to monitor quantitatively the population of A. brasilense in wheat roots under sterile and nonsterile growth conditions. In addition, coinoculations with other plant growth-promoting bacteria in wheat were performed under nonsterile conditions. The results showed that A. brasilense FP2 inoculated into wheat roots is highly competitive and achieves high cell numbers (∼10(7) CFU/g [fresh weight] of root) in the rhizosphere even under nonsterile conditions and when coinoculated with other rhizobacteria, maintaining the population at rather stable levels for at least up to 13 days after inoculation. The strategy used here can be applied to other organisms whose genome sequences are available. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Stets, Maria Isabel; Alqueres, Sylvia Maria Campbell; Souza, Emanuel Maltempi; Pedrosa, Fábio de Oliveira; Schmid, Michael
2015-01-01
Azospirillum is a rhizobacterial genus containing plant growth-promoting species associated with different crops worldwide. Azospirillum brasilense strains exhibit a growth-promoting effect by means of phytohormone production and possibly by N2 fixation. However, one of the most important factors for achieving an increase in crop yield by plant growth-promoting rhizobacteria is the survival of the inoculant in the rhizosphere, which is not always achieved. The objective of this study was to develop quantitative PCR protocols for the strain-specific quantification of A. brasilense FP2. A novel approach was applied to identify strain-specific DNA sequences based on a comparison of the genomic sequences within the same species. The draft genome sequences of A. brasilense FP2 and Sp245 were aligned, and FP2-specific regions were filtered and checked for other possible matches in public databases. Strain-specific regions were then selected to design and evaluate strain-specific primer pairs. The primer pairs AzoR2.1, AzoR2.2, AzoR5.1, AzoR5.2, and AzoR5.3 were specific for the A. brasilense FP2 strain. These primer pairs were used to monitor quantitatively the population of A. brasilense in wheat roots under sterile and nonsterile growth conditions. In addition, coinoculations with other plant growth-promoting bacteria in wheat were performed under nonsterile conditions. The results showed that A. brasilense FP2 inoculated into wheat roots is highly competitive and achieves high cell numbers (∼107 CFU/g [fresh weight] of root) in the rhizosphere even under nonsterile conditions and when coinoculated with other rhizobacteria, maintaining the population at rather stable levels for at least up to 13 days after inoculation. The strategy used here can be applied to other organisms whose genome sequences are available. PMID:26187960
Randhawa, Rohit; Duseja, Ajay; Changotra, Harish
2017-02-01
Various case-control studies have shown association of single nucleotide polymorphism rs12303764(G/T) in ULK1 with crohn's disease. The techniques used in these studies were time consuming, complicated and require sophisticated/expensive instruments. Therefore, in order to overcome these problems, we have developed a new, rapid and cost effective Tetra-primer ARMS-PCR assay to genotype single nucleotide polymorphism rs12303764(G/T) of ULK1 gene. We manually designed allele specific primers. DNA fragment amplified using outer primers was sequenced to obtain samples with known genotypes (GG, GT and TT) for further use in the development of T-ARMS-PCR assay. Amplification conditions were optimized for parameters; annealing temperature, Taq DNA polymerase and primers. The developed T-ARMS-PCR assay was applied to genotype one hundred samples from healthy individuals. Genotyping results of 10 DNA samples from healthy individuals for rs12303764(G/T) by T-ARMS-PCR assay and sequencing were concordant. The newly developed assay was further applied to genotype samples from 100 healthy individuals of North Indian origin. Genotype frequencies were 9, 34 and 57 % for GG, GT and TT, respectively. Allele frequencies were 0.26 and 0.74 for G and T, respectively. The allele frequencies were in Hardy-Weinberg's equilibrium (p = 0.2443). T-ARMS-PCR assay developed in our laboratory for genotyping rs12303764 (G/T) of ULK1 gene is time saving and cost-effective as compared to the available methods. Furthermore, this is the first study reporting allelic and genotype frequencies of ULK1 rs12303764 (G/T) variants in North Indian population.
Barber, L; Egan, J J; Lomax, J; Haider, Y; Yonan, N; Woodcock, A A; Turner, A J; Fox, A J
2000-08-01
Qualitative polymerase chain reaction (PCR) for the identification of cytomegalovirus (CMV) infection has a low predictive value for the identification of CMV pneumonia. This study prospectively evaluated the application of a quantitative PCR Enzyme-Linked Immuno-Sorbent Assay (ELISA) assay in 9 lung- and 18 heart-transplant recipients who did not receive ganciclovir prophylaxis. DNA was collected from peripheral blood polymorphonuclear leucocytes (PMNL) posttransplantation. Oligonucleotide primers for the glycoprotein B gene (149 bp) were used in a PCR ELISA assay using an internal standard for quantitation. CMV disease was defined as histological evidence of end organ damage. The median level CMV genome equivalents in patients with CMV disease was 2665/2 x 10(5) PMNL (range 1,200 to 61,606) compared to 100 x 10(5) PMNL (range 20 to 855) with infection but no CMV disease (p = 0.036). All patients with CMV disease had genome equivalents levels of >1200/2 x 10(5) PMNL. A cut-off level of 1,200 PMNL had a positive predictive value for CMV disease of 100% and a negative predictive value of 100%. The first detection of levels of CMV genome equivalents above a level of 1200/2 x 10(5) PMNL was at a median of 58 days (range 47 to 147) posttransplant. Quantitative PCR assays for the diagnosis of CMV infection may predict patients at risk of CMV disease and thereby direct preemptive treatment to high-risk patients.
Identification of Erwinia species isolated from apples and pears by differential PCR.
Gehring, I; Geider, K
2012-04-01
Many pathogenic and epiphytic bacteria isolated from apples and pears belong to the genus Erwinia; these include the species E. amylovora, E. pyrifoliae, E. billingiae, E. persicina, E. rhapontici and E. tasmaniensis. Identification and classification of freshly isolated bacterial species often requires tedious taxonomic procedures. To facilitate routine identification of Erwinia species, we have developed a PCR method based on species-specific oligonucleotides (SSOs) from the sequences of the housekeeping genes recA and gpd. Using species-specific primers that we report here, differentiation was done with conventional PCR (cPCR) and quantitative PCR (qPCR) applying two consecutive primer annealing temperatures. The specificity of the primers depends on terminal Single Nucleotide Polymorphisms (SNPs) that are characteristic for the target species. These PCR assays enabled us to distinguish eight Erwinia species, as well as to identify new Erwinia isolates from plant surfaces. When performed with mixed bacterial cultures, they only detected a single target species. This method is a novel approach to classify strains within the genus Erwinia by PCR and it can be used to confirm other diagnostic data, especially when specific PCR detection methods are not already available. The method may be applied to classify species within other bacterial genera. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Huang, Su-Hua; Yang, Tsuey-Ching; Tsai, Ming-Hong; Tsai, I.-Shou; Lu, Huang-Chih; Chuang, Pei-Hsin; Wan, Lei; Lin, Ying-Ju; Lai, Chih-Ho; Lin, Cheng-Wen
2008-10-01
Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples.
Taylor, Sean C; Mrkusich, Eli M
2014-01-01
In the past decade, the techniques of quantitative PCR (qPCR) and reverse transcription (RT)-qPCR have become accessible to virtually all research labs, producing valuable data for peer-reviewed publications and supporting exciting research conclusions. However, the experimental design and validation processes applied to the associated projects are the result of historical biases adopted by individual labs that have evolved and changed since the inception of the techniques and associated technologies. This has resulted in wide variability in the quality, reproducibility and interpretability of published data as a direct result of how each lab has designed their RT-qPCR experiments. The 'minimum information for the publication of quantitative real-time PCR experiments' (MIQE) was published to provide the scientific community with a consistent workflow and key considerations to perform qPCR experiments. We use specific examples to highlight the serious negative ramifications for data quality when the MIQE guidelines are not applied and include a summary of good and poor practices for RT-qPCR. © 2013 S. Karger AG, Basel.
Fredriksson, Nils Johan; Hermansson, Malte; Wilén, Britt-Marie
2013-01-01
Assessments of bacterial community diversity and dynamics are fundamental for the understanding of microbial ecology as well as biotechnological applications. We show that the choice of PCR primers has great impact on the results of analyses of diversity and dynamics using gene libraries and DNA fingerprinting. Two universal primer pairs targeting the 16S rRNA gene, 27F&1492R and 63F&M1387R, were compared and evaluated by analyzing the bacterial community in the activated sludge of a large-scale wastewater treatment plant. The two primer pairs targeted distinct parts of the bacterial community, none encompassing the other, both with similar richness. Had only one primer pair been used, very different conclusions had been drawn regarding dominant phylogenetic and putative functional groups. With 27F&1492R, Betaproteobacteria would have been determined to be the dominating taxa while 63F&M1387R would have described Alphaproteobacteria as the most common taxa. Microscopy and fluorescence in situ hybridization analysis showed that both Alphaproteobacteria and Betaproteobacteria were abundant in the activated sludge, confirming that the two primer pairs target two different fractions of the bacterial community. Furthermore, terminal restriction fragment polymorphism analyses of a series of four activated sludge samples showed that the two primer pairs would have resulted in different conclusions about community stability and the factors contributing to changes in community composition. In conclusion, different PCR primer pairs, although considered universal, target different ranges of bacteria and will thus show the diversity and dynamics of different fractions of the bacterial community in the analyzed sample. We also show that while a database search can serve as an indicator of how universal a primer pair is, an experimental assessment is necessary to evaluate the suitability for a specific environmental sample. PMID:24098498
Quantitative Analysis of Food and Feed Samples with Droplet Digital PCR
Morisset, Dany; Štebih, Dejan; Milavec, Mojca; Gruden, Kristina; Žel, Jana
2013-01-01
In this study, the applicability of droplet digital PCR (ddPCR) for routine analysis in food and feed samples was demonstrated with the quantification of genetically modified organisms (GMOs). Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of GMOs in products. However, its use is limited for detecting and quantifying very small numbers of DNA targets, as in some complex food and feed matrices. Using ddPCR duplex assay, we have measured the absolute numbers of MON810 transgene and hmg maize reference gene copies in DNA samples. Key performance parameters of the assay were determined. The ddPCR system is shown to offer precise absolute and relative quantification of targets, without the need for calibration curves. The sensitivity (five target DNA copies) of the ddPCR assay compares well with those of individual qPCR assays and of the chamber digital PCR (cdPCR) approach. It offers a dynamic range over four orders of magnitude, greater than that of cdPCR. Moreover, when compared to qPCR, the ddPCR assay showed better repeatability at low target concentrations and a greater tolerance to inhibitors. Finally, ddPCR throughput and cost are advantageous relative to those of qPCR for routine GMO quantification. It is thus concluded that ddPCR technology can be applied for routine quantification of GMOs, or any other domain where quantitative analysis of food and feed samples is needed. PMID:23658750
Samson, Maria Cristina; Gullì, Mariolina; Marmiroli, Nelson
2010-07-01
Methodologies that enable the detection of genetically modified organisms (GMOs) (authorized and non-authorized) in food and feed strongly influence the potential for adequate updating and implementation of legislation together with labeling requirements. Quantitative polymerase chain reaction (qPCR) systems were designed to boost the sensitivity and specificity on the identification of GMOs in highly degraded DNA samples; however, such testing will become economically difficult to cope with due to increasing numbers of approved genetically modified (GM) lines. Multiplexing approaches are therefore in development to provide cost-efficient solution. Construct-specific primers and probe were developed for quantitative analysis of Roundup Ready soybean (RRS) event glyphosate-tolerant soybean (GTS) 40-3-2. The lectin gene (Le1) was used as a reference gene, and its specificity was verified. RRS- and Le1-specific quantitative real-time PCR (qRTPCR) were optimized in a duplex platform that has been validated with respect to limit of detection (LOD) and limit of quantification (LOQ), as well as accuracy. The analysis of model processed food samples showed that the degradation of DNA has no adverse or little effects on the performance of quantification assay. In this study, a duplex qRTPCR using TaqMan minor groove binder-non-fluorescent quencher (MGB-NFQ) chemistry was developed for specific detection and quantification of RRS event GTS 40-3-2 that can be used for practical monitoring in processed food products.
Rapid Quantitative Detection of Lactobacillus sakei in Meat and Fermented Sausages by Real-Time PCR
Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa
2006-01-01
A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages. PMID:16957227
Rapid quantitative detection of Lactobacillus sakei in meat and fermented sausages by real-time PCR.
Martín, Belén; Jofré, Anna; Garriga, Margarita; Pla, Maria; Aymerich, Teresa
2006-09-01
A quick and simple method for quantitative detection of Lactobacillus sakei in fermented sausages was successfully developed. It is based on Chelex-100-based DNA purification and real-time PCR enumeration using a TaqMan fluorescence probe. Primers and probes were designed in the L. sakei 16S-23S rRNA intergenic transcribed spacer region, and the assay was evaluated using L. sakei genomic DNA and an artificially inoculated sausage model. The detection limit of this technique was approximately 3 cells per reaction mixture using both purified DNA and the inoculated sausage model. The quantification limit was established at 30 cells per reaction mixture in both models. The assay was then applied to enumerate L. sakei in real samples, and the results were compared to the MRS agar count method followed by confirmation of the percentage of L. sakei colonies. The results obtained by real-time PCR were not statistically significantly different than those obtained by plate count on MRS agar (P > 0.05), showing a satisfactory agreement between both methods. Therefore, the real-time PCR assay developed can be considered a promising rapid alternative method for the quantification of L. sakei and evaluation of the implantation of starter strains of L. sakei in fermented sausages.
Zhou, Zhichao; Chen, Jing; Meng, Han; Dvornyk, Volodymyr; Gu, Ji-Dong
2017-02-01
PCR primers targeting genes encoding the two proteins of anammox bacteria, hydrazine synthase and cytochrome c biogenesis protein, were designed and tested in this study. Three different ecotypes of samples, namely ocean sediments, coastal wetland sediments, and wastewater treatment plant (WWTP) samples, were used to assess the primer efficiency and the community structures of anammox bacteria retrieved by 16S ribosomal RNA (rRNA) and the functional genes. Abundances of hzsB gene of anammox bacteria in South China Sea (SCS) samples were significantly correlated with 16S rRNA gene by qPCR method. And hzsB and hzsC gene primer pair hzsB364f-hzsB640r and hzsC745f-hzsC862r in combination with anammox bacterial 16S rRNA gene primers were recommended for quantifying anammox bacteria. Congruent with 16S rRNA gene-based community study, functional gene hzsB could also delineate the coastal-ocean distributing pattern, and seawater depth was positively associated with the diversity and abundance of anammox bacteria from shallow- to deep-sea. Both hzsC and ccsA genes could differentiate marine samples between deep and shallow groups of the Scalindua sp. clades. As for WWTP samples, non-Scalindua anammox bacteria reflected by hzsB, hzsC, ccsA, and ccsB gene-based libraries showed a similar distribution pattern with that by 16S rRNA gene. NH 4 + and NH 4 + /Σ(NO 3 - + NO 2 - ) positively correlated with anammox bacteria gene diversity, but organic matter contents correlated negatively with anammox bacteria gene diversity in SCS. Salinity was positively associated with diversity indices of hzsC and ccsB gene-harboring anammox bacteria communities and could potentially differentiate the distribution patterns between shallow- and deep-sea sediment samples. SCS surface sediments harbored considerably diverse community of Scalindua. A new Mai Po clade representing coastal estuary wetland anammox bacteria group based on 16S rRNA gene phylogeny is proposed. Existence of anammox
Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.
Smith, Cindy J; Osborn, A Mark
2009-01-01
Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.
Rapid Detection of Ceratocystis platani Inoculum by Quantitative Real-Time PCR Assay
Ghelardini, Luisa; Belbahri, Lassaâd; Quartier, Marion; Santini, Alberto
2013-01-01
Ceratocystis platani is the causal agent of canker stain of plane trees, a lethal disease able to kill mature trees in one or two successive growing seasons. The pathogen is a quarantine organism and has a negative impact on anthropogenic and natural populations of plane trees. Contaminated sawdust produced during pruning and sanitation fellings can contribute to disease spread. The goal of this study was to design a rapid, real-time quantitative PCR assay to detect a C. platani airborne inoculum. Airborne inoculum traps (AITs) were placed in an urban setting in the city of Florence, Italy, where the disease was present. Primers and TaqMan minor groove binder (MGB) probes were designed to target cerato-platanin (CP) and internal transcribed spacer 2 (ITS2) genes. The detection limits of the assay were 0.05 pg/μl and 2 fg/μl of fungal DNA for CP and ITS, respectively. Pathogen detection directly from AITs demonstrated specificity and high sensitivity for C. platani, detecting DNA concentrations as low as 1.2 × 10−2 to 1.4 × 10−2 pg/μl, corresponding to ∼10 conidia per ml. Airborne inoculum traps were able to detect the C. platani inoculum within 200 m of the closest symptomatic infected plane tree. The combination of airborne trapping and real-time quantitative PCR assay provides a rapid and sensitive method for the specific detection of a C. platani inoculum. This technique may be used to identify the period of highest risk of pathogen spread in a site, thus helping disease management. PMID:23811499
PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.
Prevost, S; Andre, S; Remize, F
2010-12-01
Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores.
Lefevre, Jonas; Hankins, Catherine; Pourreaux, Karina; Voyer, Hélène; Coutlée, François
2003-12-01
High-risk human papillomavirus 16 (HPV-16) DNA viral load has been measured with real-time PCR assays by amplifying HPV-16 and a human gene. However, these assays have not used internal controls (ICs) to screen for the presence of inhibitors contained in samples. To quantitate HPV-16 DNA and cell content with real-time PCR, ICs for HPV-16 DNA and beta-globin were synthesised and used to control for inhibition. The assays were sensitive and linear over 5 logs. Good reproducibility was achieved with inter-run coefficients of variation of 23% (10(2) HPV-16 copies), 12% (10(4) HPV-16 copies), 17% (274 beta-globin DNA copies) and 7% (27,400 beta-globin DNA copies). Samples containing 56,800,000, 306,000, 18,000, and 4,070 HPV-16 copies/microg of cellular DNA were tested blindly and estimated to contain 48,800,000, 479,000, 20,300, and 6,620 HPV-16 copies/microg of DNA (mean ratio of measured to expected viral load of 1.27+/-0.32). Inhibition of amplification of HPV-16 and beta-globin ICs by six samples known to contain PCR inhibitors was variable: four inhibited both ICs while two inhibited only the HPV-16 IC. The use of internal controls with real-time PCR for HPV-16 quantitation allows to screen for the presence of inhibitors that do not affect equally primer-driven genomic amplification.
Xu, Xiaoli; Peng, Cheng; Wang, Xiaofu; Chen, Xiaoyun; Wang, Qiang; Xu, Junfeng
2016-12-01
This study evaluated the applicability of droplet digital PCR (ddPCR) as a tool for maize zygosity determination using quantitative real-time PCR (qPCR) as a reference technology. Quantitative real-time PCR is commonly used to determine transgene copy number or GMO zygosity characterization. However, its effectiveness is based on identical reaction efficiencies for the transgene and the endogenous reference gene. Additionally, a calibrator sample should be utilized for accuracy. Droplet digital PCR is a DNA molecule counting technique that directly counts the absolute number of target and reference DNA molecules in a sample, independent of assay efficiency or external calibrators. The zygosity of the transgene can be easily determined using the ratio of the quantity of the target gene to the reference single copy endogenous gene. In this study, both the qPCR and ddPCR methods were used to determine insect-resistant transgenic maize IE034 zygosity. Both methods performed well, but the ddPCR method was more convenient because of its absolute quantification property.
Human fecal source identification with real-time quantitative PCR
Waterborne diseases represent a significant public health risk worldwide, and can originate from contact with water contaminated with human fecal material. We describe a real-time quantitative PCR (qPCR) method that targets a Bacteroides dori human-associated genetic marker for...
Doyle, Jacqueline M; McCormick, Cory R; DeWoody, J Andrew
2011-01-01
Many animals, such as crustaceans, insects, and salamanders, package their sperm into spermatophores, and the number of spermatozoa contained in a spermatophore is relevant to studies of sexual selection and sperm competition. We used two molecular methods, real-time quantitative polymerase chain reaction (RT-qPCR) and spectrophotometry, to estimate sperm numbers from spermatophores. First, we designed gene-specific primers that produced a single amplicon in four species of ambystomatid salamanders. A standard curve generated from cloned amplicons revealed a strong positive relationship between template DNA quantity and cycle threshold, suggesting that RT-qPCR could be used to quantify sperm in a given sample. We then extracted DNA from multiple Ambystoma maculatum spermatophores, performed RT-qPCR on each sample, and estimated template copy numbers (i.e. sperm number) using the standard curve. Second, we used spectrophotometry to determine the number of sperm per spermatophore by measuring DNA concentration relative to the genome size. We documented a significant positive relationship between the estimates of sperm number based on RT-qPCR and those based on spectrophotometry. When these molecular estimates were compared to spermatophore cap size, which in principle could predict the number of sperm contained in the spermatophore, we also found a significant positive relationship between sperm number and spermatophore cap size. This linear model allows estimates of sperm number strictly from cap size, an approach which could greatly simplify the estimation of sperm number in future studies. These methods may help explain variation in fertilization success where sperm competition is mediated by sperm quantity. © 2010 Blackwell Publishing Ltd.
Interlaboratory Comparison of Quantitative PCR Test Results for Dehalococcoides
Quantitative PCR (qPCR) techniques have been widely used to measure Dehalococcoides (Dhc) DNA in the groundwater at field sites for several years. Interpretation of these data may be complicated when different laboratories using alternate methods conduct the analysis. An...
Wu, Da-lin; Ling, Han-xin; Tang, Hao
2004-11-01
To evaluate the accuracy of PCR with sequence-specific primers (PCR-SSP) for HLA-I genotyping and analyze the causes of the errors occurring in the genotyping. DNA samples and were obtained from 34 clinical patients, and serological typing with monoclonal antibody (mAb) and HLA-A and, B antigen genotyping with PCR-SSP were performed. HLA-A and, B alleles were successfully typed in 34 clinical samples by mAb and PCR-SSP. No false positive or false negative results were found, and the erroneous and missed diagnosis rates were obviously higher in serological detection, being 23.5% for HLA-A and 26.5% for HLA-B. Error or confusion was more likely to occur in the antigens of A2 and A68, A32 and A33, B5, B60 and B61. DNA typing for HLA-I class (A, B antigens) by PCR-SSP has high resolution, high specificity, and good reproducibility, which is more suitable for clinical application than serological typing. PCR-SSP may accurately detect the alleles that are easily missed or mistaken in serological typing.
Cheng, Wenyu; He, Xiaobing; Jia, Huaijie; Chen, Guohua; Wang, Cong; Zhang, Jun; Jing, Zhizhong
2018-04-01
Ectromelia virus (ECTV) is the causative agent of mousepox, which has devastating effects in laboratory-mouse colonies and causes economic loss in biomedical research. More importantly, ECTV has been extensively used as an excellent model for studies of the pathogenesis and immunobiology of human smallpox. A rapid and sensitive SYBR Green I-based real-time PCR assay was developed and used for the detection and quantitation of orthopoxvirus by using ECTV in this study. Primers targeted to the highly conserved region of major core protein P4b gene of orthopoxvirus were designed and the standard plasmid was constructed. This assay was able to detect a minimum of 10 copies of standard DNA and 5 TCID 50 units of ECTV. In addition, no cross-reactions were observed with two DNA viruses, such as herpes simplex virus and swine pseudorabies virus, and one RNA virus, vesicular stomatitis virus. Furthermore, intra- and inter-assay variability data showed that this method had a highly reproducibility and reliability. Moreover, the current assay was faster and had a higher sensitivity for detection of ECTV genomic DNA in cell cultured and clinical test samples. Therefore, the high sensitivity and reproducibility of this SYBR Green real-time PCR approach is a more effective method than the conventional PCR for ECTV diagnosis and quantitation. Copyright © 2017. Published by Elsevier Ltd.
Dwivedi, Bhakti; Schmieder, Robert; Goldsmith, Dawn B; Edwards, Robert A; Breitbart, Mya
2012-03-04
Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution.
Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction
2012-01-01
Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool
Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia
2014-01-01
Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the
Mekonnen, Solomon A; Beissner, Marcus; Saar, Malkin; Ali, Solomon; Zeynudin, Ahmed; Tesfaye, Kassahun; Adbaru, Mulatu G; Battke, Florian; Poppert, Sven; Hoelscher, Michael; Löscher, Thomas; Bretzel, Gisela; Herbinger, Karl-Heinz
2017-10-02
Onchocerciasis is a parasitic disease caused by the filarial nematode Onchocerca volvulus. In endemic areas, the diagnosis is commonly confirmed by microscopic examination of skin snip samples, though this technique is considered to have low sensitivity. The available melting-curve based quantitative real-time PCR (qPCR) using degenerated primers targeting the O-150 repeat of O. volvulus was considered insufficient for confirming the individual diagnosis, especially in elimination studies. This study aimed to improve detection of O. volvulus DNA in clinical samples through the development of a highly sensitive qPCR assay. A novel hydrolysis probe based qPCR assay was designed targeting the specific sequence of the O. volvulus O-5S rRNA gene. A total of 200 clinically suspected onchocerciasis cases were included from Goma district in South-west Ethiopia, from October 2012 through May 2013. Skin snip samples were collected and subjected to microscopy, O-150 qPCR, and the novel O-5S qPCR. Among the 200 individuals, 133 patients tested positive (positivity rate of 66.5%) and 67 negative by O-5S qPCR, 74 tested positive by microscopy (37.0%) and 78 tested positive by O-150 qPCR (39.0%). Among the 133 O-5S qPCR positive individuals, microscopy and O-150 qPCR detected 55.6 and 59.4% patients, respectively, implying a higher sensitivity of O-5S qPCR than microscopy and O-150 qPCR. None of the 67 individuals who tested negative by O-5S qPCR tested positive by microscopy or O-150 qPCR, implying 100% specificity of the newly designed O-5S qPCR assay. The novel O-5S qPCR assay is more sensitive than both microscopic examination and the existing O-150 qPCR for the detection of O. volvulus from skin snip samples. The newly designed assay is an important step towards appropriate individual diagnosis and control of onchocerciasis.
Kane, Lauren P; Bunick, David; Abd-Eldaim, Mohamed; Dzhaman, Elena; Allender, Matthew C
2016-06-01
Diseases that affect the upper respiratory tract (URT) in chelonians have been well described as a significant contributor of morbidity and mortality. Specifically, herpesviruses are common pathogens in captive chelonians worldwide, but their importance on free-ranging populations is less well known. Historical methods for the diagnosis of herpesvirus infections include virus isolation and conventional PCR. Real-time PCR has become an essential tool for detection and quantitation of many pathogens, but has not yet been developed for herpesviruses in box turtles. Two quantitative real-time TaqMan PCR assays, TerHV58 and TerHV64, were developed targeting the DNA polymerase gene of Terrapene herpesvirus 1 (TerHV1). The assay detected a viral DNA segment cloned within a plasmid with 10-fold serial dilutions from 1.04 × 10(7) to 1.04 × 10(1) viral copies per reaction. Even though both primers had acceptable levels of efficiency and variation, TerHV58 was utilized to test clinical samples based on less variation and increased efficiency. This assay detected as few as 10 viral copies per reaction and should be utilized in free-ranging and captive box turtles to aid in the characterization of the epidemiology of this disease. Copyright © 2016 Elsevier B.V. All rights reserved.
PrimerZ: streamlined primer design for promoters, exons and human SNPs.
Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam
2007-07-01
PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.
Badri, Amine; Stefani, Franck O P; Lachance, Geneviève; Roy-Arcand, Line; Beaudet, Denis; Vialle, Agathe; Hijri, Mohamed
2016-10-01
Rhizophagus irregularis (previously named Glomus irregulare) is one of the most widespread and common arbuscular mycorrhizal fungal (AMF) species. It has been recovered worldwide in agricultural and natural soils, and the isolate DAOM-197198 has been utilized as a commercial inoculant for two decades. Despite the ecological and economical importance of this taxon, specific markers for quantification of propagules by quantitative real-time PCR (qPCR) are extremely limited and none have been rigorously validated for quality control of manufactured products such as biofertilizers. From the sequencing of 14 complete AMF mitochondrial (mt) genomes, a qPCR assay using a hydrolysis probe designed in the single copy cox3-rnl intergenic region was tested and validated to specifically and accurately quantify the spores of R. irregularis isolate DAOM-197198. Specificity tests were performed using standard PCR and qPCR, and results clearly showed that the primers specifically amplified the isolate DAOM-197198, yielding a PCR product of 106 bp. According to the qPCR analyses on spores produced in vitro, the average copy number of mt genomes per spore was 3172 ± 304 SE (n = 6). Quantification assays were successfully undertaken on known and unknown samples in liquid suspensions and commercial dry formulations to show the accuracy, precision, robustness, and reproducibility of the qPCR assay. This study provides a powerful molecular toolkit specifically designed to quantify spores of the model AMF isolate DAOM-197198. The approach of molecular toolkit used in our study could be applied to other AMF taxa and will be useful to research institutions and governmental and industrial laboratories running routine quality control of AMF-based products.
Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo
2007-10-01
Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.
Development and evaluation of a quantitative PCR assay for detection of Hepatozoon sp.
Criado-Fornelio, A; Buling, A; Cunha-Filho, N A; Ruas, J L; Farias, N A R; Rey-Valeiron, C; Pingret, J L; Etievant, M; Barba-Carretero, J C
2007-12-25
With the aim to improve current molecular diagnostic techniques of Hepatozoon sp. in carnivore mammals, we developed a quantitative PCR (qPCR) assay with SYBR Green I((R)). The method, consisting of amplification of a 235bp fragment of the 18S rRNA gene, is able to detect at least 0.1fg of parasite DNA. Reproducible quantitative results were obtained over a range of 0.1ng-0.1fg of Hepatozoon sp. DNA. To assess the performance of the qPCR assay, DNA samples from dogs (140) and cats (50) were tested with either standard PCR or qPCR. Positive samples were always confirmed by partial sequencing of the 18S rRNA gene. Quantitative PCR was 15.8% more sensitive than standard PCR to detect H. canis in dogs. In cats, no infections were detected by standard PCR, compared to two positives by qPCR (which were infected by H. canis as shown by sequencing).
Quantitative Detection of Streptococcus pneumoniae in Nasopharyngeal Secretions by Real-Time PCR
Greiner, Oliver; Day, Philip J. R.; Bosshard, Philipp P.; Imeri, Fatime; Altwegg, Martin; Nadal, David
2001-01-01
Streptococcus pneumoniae is an important cause of community-acquired pneumonia. However, in this setting the diagnostic sensitivity of blood cultures is below 30%. Since during such infections changes in the amounts of S. pneumoniae may also occur in the upper respiratory tract, quantification of these bacteria in nasopharnygeal secretions (NPSs) may offer a suitable diagnostic approach. Real-time PCR offers a sensitive, efficient, and routinely reproducible approach to quantification. Using primers and a fluorescent probe specific for the pneumolysin gene, we were able to detect DNA from serial dilutions of S. pneumoniae cells in which the quantities of DNA ranged from the amounts extracted from 1 to 106 cells. No difference was noted when the same DNA was mixed with DNA extracted from NPSs shown to be deficient of S. pneumoniae following culture, suggesting that this bacterium can be detected and accurately quantitated in clinical samples. DNAs from Haemophilus influenzae, Moraxella catarrhalis, or alpha-hemolytic streptococci other than S. pneumoniae were not amplified or were only weakly amplified when there were ≥106 cells per reaction mixture. When the assay was applied to NPSs from patients with respiratory tract infections, the assay performed with a sensitivity of 100% and a specificity of up to 96% compared to the culture results. The numbers of S. pneumoniae organisms detected by real-time PCR correlated with the numbers detected by semiquantitative cultures. A real-time PCR that targeted the pneumolysin gene provided a sensitive and reliable means for routine rapid detection and quantification of S. pneumoniae present in NPSs. This assay may serve as a tool to study changes in the amounts of S. pneumoniae during lower respiratory tract infections. PMID:11526140
Kelm-Nelson, Cynthia A; Stevenson, Sharon A; Ciucci, Michelle R
2016-09-01
Datasets provided in this article represent the Rattus norvegicus primer design and verification used in Pink1 -/- and wildtype Long Evans brain tissue. Accessible tables include relevant information, accession numbers, sequences, temperatures and product length, describing primer design specific to the transcript amplification use. Additionally, results of Sanger sequencing of qPCR reaction products (FASTA aligned sequences) are presented for genes of interest. Results and further interpretation and discussion can be found in the original research article "Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease" [1].
2012-01-01
Background Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Results Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. Conclusions PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution. PMID:22385976
Dalla Valle, L; Toffolo, V; Lamprecht, M; Maltese, C; Bovo, G; Belvedere, P; Colombo, L
2005-10-31
The aim of the present work was to develop two new independent SYBR Green I-based real-time PCR assays for both detection and quantification of betanodavirus, an RNA virus that infects several species of marine teleost fish causing massive mortalities in larvae and juveniles. The assays utilized two pairs of primers targeting highly conserved regions of both the RNA molecules forming the betanodavirus genome: RNA1 encoding the RNA-dependent RNA polymerase (RdRP) and RNA2 encoding the coat protein (CP). The specificity of amplifications was monitored by the melting analysis and agarose gel electrophoresis of the amplified products. The applicability of these assays was confirmed with 21 betanodavirus strains, covering all the four main clades. In addition, a BLAST (NCBI) search with the primer sequences showed no genomic cross-reactivity with other viruses. The new assays were able to quantify concentrations of betanodavirus genes ranging from 10(1) to 10(8) copies per reaction. The intra-assay coefficients of variation (CV) of threshold cycle (Ct) values of the assays were 1.5% and 1.4% for CP and RdRP RNAs, respectively. The inter-assay CVs of Ct values were 2.3% and 2.4% for CP and RdRP RNAs, respectively. Moreover, regression analysis showed a significant correlation (R2>0.97) between genome number, as determined by real-time PCR assays and the corresponding virus titer expressed as TCID50/ml of two different betanodavirus strains propagated in cell culture. The two assays were compared with a previously established one-step RT-PCR assay and with the classical virus isolation test and found to be more sensitive. In conclusion, the developed real-time RT-PCR assays are a reliable, specific and sensitive tool for the quantitative diagnosis of betanodavirus.
Zongze, Zhang; Xin, Yang; Awais, Ali Ahmad; Weiqiang, Lei; Chunqun, Wang; Di, Wenda; Yanqin, Zhou; Junlong, Zhao; Rui, Fang; Min, Hu
2018-03-15
The tetra-primer ARMS-PCR is a rapid, simple and low cost method for single nucleotide polymorphism (SNP) genotyping and has been used to detect SNPs associated with diseases and drug resistance. E198A in the isotype-1 β-tubulin gene is one of the three SNPs associated with benzimidazole resistance in parasitic nematode Haemonchus contortus. However, up to now, only PCR-RFLP method was used to test E198A in H. contortus. In the present study, we developed a tetra-primer ARMS-PCR to detect E198A in H. contortus and the accuracy of the results was compared with that of PCR-coupled sequencing. The results showed that optimization of PCR reaction system, especially the proportion of the amount of inner and outer primers, could achieve desirable amplification effect. Three different profiles displaying three distinct genotypes could be identified clearly and intuitively on the agarose gel where the samples with amplified PCR products containing two bands of 433 bp and 200 bp in size indicated susceptible homozygous (SS), those with PCR products containing two bands of 433 bp and 284 bp in length indicated resistant homozygous (RR) and the samples with amplified PCR products containing three bands of 433 bp, 284 bp and 200 bp in size indicated heterozygous (RS). The results showed that the established method can be successfully applied to the detection of E198A in H. contortus, which has high accuracy and is easy to perform. Copyright © 2018 Elsevier B.V. All rights reserved.
Real-time quantitative PCR of Staphylococcus aureus and application in restaurant meals.
Berrada, H; Soriano, J M; Mañes, J; Picó, Y
2006-01-01
Staphylococcus aureus is considered the second most common pathogen to cause outbreaks of food poisoning, exceeded only by Campylobacter. Consumption of foods containing this microorganism is often identified as the cause of illness. In this study, a rapid, reliable, and sensitive real-time quantitative PCR was developed and compared with conventional culture methods. Real-time quantitative PCR was carried out by purifying DNA extracts of S. aureus with a Staphylococcus sample preparation kit and quantifying it in the LightCycler system with hybridization probes. The assay was linear from a range of 10 to 10(6) S. aureus cells (r2 > 0.997). The PCR reaction presented an efficiency of >85%. Accuracy of the PCR-based assay, expressed as percent bias, was around 13%, and the precision, expressed as a percentage of the coefficient of variation, was 7 to 10%. Intraday and interday variability were studied at 10(2) CFU/g and was 12 and 14%, respectively. The proposed method was applied to the analysis of 77 samples of restaurant meals in Valencia (Spain). In 11.6% of samples S. aureus was detected by real-time quantitative PCR, as well as by the conventional microbiological method. An excellent correspondence between real-time quantitative PCR and microbiological numbers (CFU/g) was observed with deviations of < 28%.
Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas
2013-05-21
Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.
2013-01-01
Background Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. Findings We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. Conclusions These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects. PMID:23693071
Clifton, D.R.; Rodriguez, R.J.
1997-01-01
A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.
Clifton, D.R.; Rodriguez, R.J.
1997-01-01
A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.
Quantitative analysis of pork and chicken products by droplet digital PCR.
Cai, Yicun; Li, Xiang; Lv, Rong; Yang, Jielin; Li, Jian; He, Yuping; Pan, Liangwen
2014-01-01
In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises.
Whale, Alexandra S; Huggett, Jim F; Cowen, Simon; Speirs, Valerie; Shaw, Jacqui; Ellison, Stephen; Foy, Carole A; Scott, Daniel J
2012-06-01
One of the benefits of Digital PCR (dPCR) is the potential for unparalleled precision enabling smaller fold change measurements. An example of an assessment that could benefit from such improved precision is the measurement of tumour-associated copy number variation (CNV) in the cell free DNA (cfDNA) fraction of patient blood plasma. To investigate the potential precision of dPCR and compare it with the established technique of quantitative PCR (qPCR), we used breast cancer cell lines to investigate HER2 gene amplification and modelled a range of different CNVs. We showed that, with equal experimental replication, dPCR could measure a smaller CNV than qPCR. As dPCR precision is directly dependent upon both the number of replicate measurements and the template concentration, we also developed a method to assist the design of dPCR experiments for measuring CNV. Using an existing model (based on Poisson and binomial distributions) to derive an expression for the variance inherent in dPCR, we produced a power calculation to define the experimental size required to reliably detect a given fold change at a given template concentration. This work will facilitate any future translation of dPCR to key diagnostic applications, such as cancer diagnostics and analysis of cfDNA.
NASA Astrophysics Data System (ADS)
Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.
2015-12-01
Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.
Ferreira-Gonzalez, A; Yanovich, S; Langley, M R; Weymouth, L A; Wilkinson, D S; Garrett, C T
2000-01-01
Accurate and rapid diagnosis of CMV disease in immunocompromised individuals remains a challenge. Quantitative polymerase chain reaction (QPCR) methods for detection of CMV in peripheral blood mononuclear cells (PBMC) have improved the positive and negative predictive value of PCR for diagnosis of CMV disease. However, detection of CMV in plasma has demonstrated a lower negative predictive value for plasma as compared with PBMC. To enhance the sensitivity of the QPCR assay for plasma specimens, plasma samples were centrifuged before nucleic-acid extraction and the extracted DNA resolubilized in reduced volume. Optimization of the nucleic-acid extraction focused on decreasing or eliminating the presence of inhibitors in the pelleted plasma. Quantitation was achieved by co-amplifying an internal quantitative standard (IS) with the same primer sequences as CMV. PCR products were detected by hybridization in a 96-well microtiter plate coated with a CMV or IS specific probe. The precision of the QPCR assay for samples prepared from untreated and from pelleted plasma was then assessed. The coefficient of variation for both types of samples was almost identical and the magnitude of the coefficient of variations was reduced by a factor of ten if the data were log transformed. Linearity of the QPCR assay extended over a 3.3-log range for both types of samples but the range of linearity for pelleted plasma was 20 to 40,000 viral copies/ml (vc/ml) in contrast to 300 to 400,000 vc/ml for plasma. Thus, centrifugation of plasma before nucleic-acid extraction and resuspension of extracted CMV DNA in reduced volume enhanced the analytical sensitivity approximately tenfold over the dynamic range of the assay. Copyright 2000 Wiley-Liss, Inc.
Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel
2013-01-01
A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets. PMID:24312333
Ouyang, Ping; Arif, Mohammad; Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel
2013-01-01
A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets.
Molaee, Neda; Abtahi, Hamid; Ghannadzadeh, Mohammad Javad; Karimi, Masoude; Ghaznavi-Rad, Ehsanollah
2015-01-01
Polymerase chain reaction (PCR) is preferred to other methods for detecting Escherichia coli (E. coli) in water in terms of speed, accuracy and efficiency. False positive result is considered as the major disadvantages of PCR. For this reason, reverse transcriptase-polymerase chain reaction (RT-PCR) can be used to solve this problem. The aim of present study was to determine the efficiency of RT-PCR for rapid detection of viable Escherichia coli in drinking water samples and enhance its sensitivity through application of different filter membranes. Specific primers were designed for 16S rRNA and elongation Factor II genes. Different concentrations of bacteria were passed through FHLP and HAWP filters. Then, RT-PCR was performed using 16srRNA and EF -Tu primers. Contamination of 10 wells was determined by RT-PCR in Arak city. To evaluate RT-PCR efficiency, the results were compared with most probable number (MPN) method. RT-PCR is able to detect bacteria in different concentrations. Application of EF II primers reduced false positive results compared to 16S rRNA primers. The FHLP hydrophobic filters have higher ability to absorb bacteria compared with HAWB hydrophilic filters. So the use of hydrophobic filters will increase the sensitivity of RT-PCR. RT-PCR shows a higher sensitivity compared to conventional water contamination detection method. Unlike PCR, RT-PCR does not lead to false positive results. The use of EF-Tu primers can reduce the incidence of false positive results. Furthermore, hydrophobic filters have a higher ability to absorb bacteria compared to hydrophilic filters.
Rolland-Turner, Magali; Farré, Guillaume; Boué, Franck
2006-04-15
The immune response in the fox (Vulpes vulpes), despite the success of the oral rabies vaccine is not well characterised, and specific immunological tools are needed. A quantitative RT-PCR using SyBR Green to investigate fox cytokine expression after antigen PBMC in vitro re-stimulation is presented here. First, we cloned by homology with dog cytokine sequences the fox IL2, IL6, IL10, IFNgamma and a partial 18S sequence. Fox specific primers were then defined and used to set up a species-specific quantitative RT-PCR assay using SyBR Green and 18S housekeeping gene as internal standard. The technique was validated using total RNA from fox PBMC stimulated with a polyclonal activator, Concanavaline A.
A TaqMan real-time PCR-based assay for the identification of Fasciola spp.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-30
Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.
Rouleau, Etienne; Lefol, Cédrick; Bourdon, Violaine; Coulet, Florence; Noguchi, Tetsuro; Soubrier, Florent; Bièche, Ivan; Olschwang, Sylviane; Sobol, Hagay; Lidereau, Rosette
2009-06-01
Several techniques have been developed to screen mismatch repair (MMR) genes for deleterious mutations. Until now, two different techniques were required to screen for both point mutations and large rearrangements. For the first time, we propose a new approach, called "quantitative PCR (qPCR) high-resolution melting (HRM) curve analysis (qPCR-HRM)," which combines qPCR and HRM to obtain a rapid and cost-effective method suitable for testing a large series of samples. We designed PCR amplicons to scan the MLH1 gene using qPCR HRM. Seventy-six patients were fully scanned in replicate, including 14 wild-type patients and 62 patients with known mutations (57 point mutations and five rearrangements). To validate the detected mutations, we used sequencing and/or hybridization on a dedicated MLH1 array-comparative genomic hybridization (array-CGH). All point mutations and rearrangements detected by denaturing high-performance liquid chromatography (dHPLC)+multiplex ligation-dependent probe amplification (MLPA) were successfully detected by qPCR HRM. Three large rearrangements were characterized with the dedicated MLH1 array-CGH. One variant was detected with qPCR HRM in a wild-type patient and was located within the reverse primer. One variant was not detected with qPCR HRM or with dHPLC due to its proximity to a T-stretch. With qPCR HRM, prescreening for point mutations and large rearrangements are performed in one tube and in one step with a single machine, without the need for any automated sequencer in the prescreening process. In replicate, its reagent cost, sensitivity, and specificity are comparable to those of dHPLC+MLPA techniques. However, qPCR HRM outperformed the other techniques in terms of its rapidity and amount of data provided.
Purified oocysts of Cryptosporidium parvum were used to evaluate applicability of two quantitative PCR (qPCR) viability detection methods in raw surface water and disinfection treated water. Propidium monoazide-qPCR targeting hsp70 gene was compared to reverse transcription (RT)-...
Fujimoto, Junji
2013-01-01
We developed a PCR-based method to detect and quantify viable Bifidobacterium bifidum BF-1 cells in human feces. This method (PMA-qPCR) uses propidium monoazide (PMA) to distinguish viable from dead cells and quantitative PCR using a BF-1-specific primer set designed from the results of randomly amplified polymorphic DNA analysis. During long-term culture (10 days), the number of viable BF-1 cells detected by counting the number of CFU on modified MRS agar, by measuring the ATP contents converted to CFU, and by using PMA-qPCR decreased from about 1010 to 106 cells/ml; in contrast, the total number of (viable and dead) BF-1 cells detected by counting 4′,6-diamidino-2-phenylindolee (DAPI)-stained cells and by using qPCR without PMA and reverse transcription-qPCR remained constant. The number of viable BF-1 cells in fecal samples detected by using PMA-qPCR was highly and significantly correlated with the number of viable BF-1 cells added to the fecal samples, within the range of 105.3 to 1010.3 cells/g feces (wet weight) (r > 0.99, P < 0.001). After 12 healthy subjects ingested 1010.3 to 1011.0 CFU of BF-1 in a fermented milk product daily for 28 days, 104.5 ± 1.5 (mean ± standard deviation [SD]) BF-1 CFU/g was detected in fecal samples by using strain-specific selective agar; in contrast, 106.2 ± 0.4 viable BF-1 cells/g were detected by using PMA-qPCR, and a total of 107.6 ± 0.7 BF-1 cells/g were detected by using qPCR without PMA. Thus, the number of viable BF-1 cells detected by PMA-qPCR was about 50 times higher (P < 0.01) than that detected by the culture-dependent method. We conclude that strain-specific PMA-qPCR can be used to quickly and accurately evaluate viable BF-1 in feces. PMID:23354719
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi
2005-01-01
Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428
Vitali, Beatrice; Pugliese, Ciro; Biagi, Elena; Candela, Marco; Turroni, Silvia; Bellen, Gert; Donders, Gilbert G G; Brigidi, Patrizia
2007-09-01
The microbial flora of the vagina plays a major role in preventing genital infections, including bacterial vaginosis (BV) and candidiasis (CA). An integrated approach based on PCR-denaturing gradient gel electrophoresis (PCR-DGGE) and real-time PCR was used to study the structure and dynamics of bacterial communities in vaginal fluids of healthy women and patients developing BV and CA. Universal eubacterial primers and Lactobacillus genus-specific primers, both targeted at 16S rRNA genes, were used in DGGE and real-time PCR analysis, respectively. The DGGE profiles revealed that the vaginal flora was dominated by Lactobacillus species under healthy conditions, whereas several potentially pathogenic bacteria were present in the flora of women with BV. Lactobacilli were the predominant bacterial population in the vagina for patients affected by CA, but changes in the composition of Lactobacillus species were observed. Real-time PCR analysis allowed the quantitative estimation of variations in lactobacilli associated with BV and CA diseases. A statistically significant decrease in the relative abundance of lactobacilli was found in vaginal fluids of patients with BV compared to the relative abundance of lactobacilli in the vaginal fluids of healthy women and patients with CA.
Specific and quantitative detection of human polyomaviruses BKV, JCV, and SV40 by real time PCR.
McNees, Adrienne L; White, Zoe S; Zanwar, Preeti; Vilchez, Regis A; Butel, Janet S
2005-09-01
The polyomaviruses that infect humans, BK virus (BKV), JC virus (JCV), and simian virus 40 (SV40), typically establish subclinical persistent infections. However, reactivation of these viruses in immunocompromised hosts is associated with renal nephropathy and hemorrhagic cystitis (HC) caused by BKV and with progressive multifocal leukoencephalopathy (PML) caused by JCV. Additionally, SV40 is associated with several types of human cancers including primary brain and bone cancers, mesotheliomas, and non-Hodgkin's lymphoma. Advancements in detection of these viruses may contribute to improved diagnosis and treatment of affected patients. To develop sensitive and specific real time quantitative polymerase chain reaction (RQ-PCR) assays for the detection of T-antigen DNA sequences of the human polyomaviruses BKV, JCV, and SV40 using the ABI Prism 7000 Sequence Detection System. Assays for absolute quantification of the viral T-ag sequences were designed and the sensitivity and specificity were evaluated. A quantitative assay to measure the single copy human RNAse P gene was also developed and evaluated in order to normalize viral gene copy numbers to cell numbers. Quantification of the target genes is sensitive and specific over a 7 log dynamic range. Ten copies each of the viral and cellular genes are reproducibly and accurately detected. The sensitivity of detection of the RQ-PCR assays is increased 10- to 100-fold compared to conventional PCR and agarose gel protocols. The primers and probes used to detect the viral genes are specific for each virus and there is no cross reactivity within the dynamic range of the standard dilutions. The sensitivity of detection for these assays is not reduced in human cellular extracts; however, different DNA extraction protocols may affect quantification. These assays provide a technique for rapid and specific quantification of polyomavirus genomes per cell in human samples.
Expósito-Rodríguez, Marino; Borges, Andrés A; Borges-Pérez, Andrés; Pérez, José A
2008-01-01
Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC), SGN-U321250 (TIP41), SGN-U346908 ("Expressed") and SGN-U316474 (SAND) genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real-time RT-PCR studies of gene
Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt
2017-03-22
Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.
Comparative diagnostics of allergy using quantitative immuno-PCR and ELISA.
Simonova, Maria A; Pivovarov, Victor D; Ryazantsev, Dmitry Y; Dolgova, Anna S; Berzhets, Valentina M; Zavriev, Sergei K; Svirshchevskaya, Elena V
2018-05-01
Estimation of specific IgE is essential for the prevention of allergy progression. Quantitative immuno-PCR (qiPCR) can increase the sensitivity of IgE detection. We aimed to develop qiPCR and compare it to the conventional ELISA in identification of IgE to Alt a 1 and Fel d 1 allergens. Single stranded 60-mer DNA conjugated to streptavidin was used to detect antigen-IgE-biotin complex by qiPCR. In semi-logarithmic scale qiPCR data were linear in a full range of serum dilutions resulting in three- to ten-times higher sensitivity of qiPCR in comparison with ELISA in IgE estimation in low titer sera. Higher sensitivity of qiPCR in identification of low titer IgE is a result of a higher linearity of qiPCR data.
Sun, Bing; Zheng, Yun-Ling
2018-01-01
Currently there is no sensitive, precise, and reproducible method to quantitate alternative splicing of mRNA transcripts. Droplet digital™ PCR (ddPCR™) analysis allows for accurate digital counting for quantification of gene expression. Human telomerase reverse transcriptase (hTERT) is one of the essential components required for telomerase activity and for the maintenance of telomeres. Several alternatively spliced forms of hTERT mRNA in human primary and tumor cells have been reported in the literature. Using one pair of primers and two probes for hTERT, four alternatively spliced forms of hTERT (α-/β+, α+/β- single deletions, α-/β- double deletion, and nondeletion α+/β+) were accurately quantified through a novel analysis method via data collected from a single ddPCR reaction. In this chapter, we describe this ddPCR method that enables direct quantitative comparison of four alternatively spliced forms of the hTERT messenger RNA without the need for internal standards or multiple pairs of primers specific for each variant, eliminating the technical variation due to differential PCR amplification efficiency for different amplicons and the challenges of quantification using standard curves. This simple and straightforward method should have general utility for quantifying alternatively spliced gene transcripts.
Evaluation of quantitative PCR measurement of bacterial colonization of epithelial cells.
Schmidt, Marcin T; Olejnik-Schmidt, Agnieszka K; Myszka, Kamila; Borkowska, Monika; Grajek, Włodzimierz
2010-01-01
Microbial colonization is an important step in establishing pathogenic or probiotic relations to host cells and in biofilm formation on industrial or medical devices. The aim of this work was to verify the applicability of quantitative PCR (Real-Time PCR) to measure bacterial colonization of epithelial cells. Salmonella enterica and Caco-2 intestinal epithelial cell line was used as a model. To verify sensitivity of the assay a competition of the pathogen cells to probiotic microorganism was tested. The qPCR method was compared to plate count and radiolabel approach, which are well established techniques in this area of research. The three methods returned similar results. The best quantification accuracy had radiolabel method, followed by qPCR. The plate count results showed coefficient of variation two-times higher than this of qPCR. The quantitative PCR proved to be a reliable method for enumeration of microbes in colonization assay. It has several advantages that make it very useful in case of analyzing mixed populations, where several different species or even strains can be monitored at the same time.
Kato, Junki; Masaki, Ayako; Fujii, Keiichiro; Takino, Hisashi; Murase, Takayuki; Yonekura, Kentaro; Utsunomiya, Atae; Ishida, Takashi; Iida, Shinsuke; Inagaki, Hiroshi
2016-11-01
Detection of HTLV-1 provirus using paraffin tumor sections may assist the diagnosis of adult T-cell leukemia/lymphoma (ATLL). For the detection, non-quantitative PCR assay has been reported, but its usefulness and limitations remain unclear. To our knowledge, quantitative PCR assay using paraffin tumor sections has not been reported. Using paraffin sections from ATLLs and non-ATLL T-cell lymphomas, we first performed non-quantitative PCR for HTLV-1 provirus. Next, we determined tumor ratios and carried out quantitative PCR to obtain provirus copy numbers. The results were analyzed with a simple regression model and a novel criterion, cut-off using 95 % rejection limits. Our quantitative PCR assay showed an excellent association between tumor ratios and the copy numbers (r = 0.89, P < 0.0001). The 95 % rejection limits provided a statistical basis for the range for the determination of HTLV-1 involvement. Its application suggested that results of non-quantitative PCR assay should be interpreted very carefully and that our quantitative PCR assay is useful to estimate the status of HTLV-1 involvement in the tumor cases. In conclusion, our quantitative PCR assay using paraffin tumor sections may be useful for the screening of ATLL cases, especially in HTLV-1 non-endemic areas where easy access to serological testing for HTLV-1 infection is limited. © 2016 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Malik, Afshan N., E-mail: afshan.malik@kcl.ac.uk; Shahni, Rojeen; Rodriguez-de-Ledesma, Ana
2011-08-19
Highlights: {yields} Mitochondrial dysfunction is central to many diseases of oxidative stress. {yields} 95% of the mitochondrial genome is duplicated in the nuclear genome. {yields} Dilution of untreated genomic DNA leads to dilution bias. {yields} Unique primers and template pretreatment are needed to accurately measure mitochondrial DNA content. -- Abstract: Circulating mitochondrial DNA (MtDNA) is a potential non-invasive biomarker of cellular mitochondrial dysfunction, the latter known to be central to a wide range of human diseases. Changes in MtDNA are usually determined by quantification of MtDNA relative to nuclear DNA (Mt/N) using real time quantitative PCR. We propose that themore » methodology for measuring Mt/N needs to be improved and we have identified that current methods have at least one of the following three problems: (1) As much of the mitochondrial genome is duplicated in the nuclear genome, many commonly used MtDNA primers co-amplify homologous pseudogenes found in the nuclear genome; (2) use of regions from genes such as {beta}-actin and 18S rRNA which are repetitive and/or highly variable for qPCR of the nuclear genome leads to errors; and (3) the size difference of mitochondrial and nuclear genomes cause a 'dilution bias' when template DNA is diluted. We describe a PCR-based method using unique regions in the human mitochondrial genome not duplicated in the nuclear genome; unique single copy region in the nuclear genome and template treatment to remove dilution bias, to accurately quantify MtDNA from human samples.« less
Quantitative CrAssphage PCR Assays for Human Fecal ...
Environmental waters are monitored for fecal pollution to protect public health and water resources. Traditionally, general fecal indicator bacteria are used; however, they cannot distinguish human fecal waste from pollution from other animals. Recently, a novel bacteriophage, crAssphage, was discovered by metagenomic data mining and reported to be abundant in and closely associated with human fecal waste. To confirm bioinformatic predictions, 384 primer sets were designed along the length of the crAssphage genome. Based upon initial screening, two novel crAssphage qPCR assays (CPQ_056 and CPQ_064) were designed and evaluated in reference fecal samples and water matrices. The assays exhibited high specificities (98.6%) when tested against a large animal fecal reference library and were highly abundant in raw sewage and sewage impacted water samples. In addition, CPQ_056 and CPQ_064 assay performance was compared to HF183/BacR287 and HumM2 methods in paired experiments. Findings confirm viral crAssphage qPCR assays perform at a similar level to well established bacterial human-associated fecal source identification technologies. These new viral based assays could become important water quality management and research tools. To inform the public.
Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li
2017-08-16
Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and
Complementary techniques: validation of gene expression data by quantitative real time PCR.
Provenzano, Maurizio; Mocellin, Simone
2007-01-01
Microarray technology can be considered the most powerful tool for screening gene expression profiles of biological samples. After data mining, results need to be validated with highly reliable biotechniques allowing for precise quantitation of transcriptional abundance of identified genes. Quantitative real time PCR (qrt-PCR) technology has recently reached a level of sensitivity, accuracy and practical ease that support its use as a routine bioinstrumentation for gene level measurement. Currently, qrt-PCR is considered by most experts the most appropriate method to confirm or confute microarray-generated data. The knowledge of the biochemical principles underlying qrt-PCR as well as some related technical issues must be beard in mind when using this biotechnology.
Ballard, S A; Grabsch, E A; Johnson, P D R; Grayson, M L
2005-01-01
We assessed the sensitivities and specificities of three previously described PCR primers on enrichment broth cultures of feces for the accurate detection of fecal carriage of vancomycin-resistant enterococci (VRE). In addition, we investigated specimens that were vanB PCR positive but VRE culture negative for the presence of other vanB-containing pathogens. Feces from 59 patients (12 patients carrying vanB Enterococcus faecium strains and 47 patients negative for VRE carriage) were cultured for 36 h in aerobic brain heart infusion (BHI) broth, anaerobic BHI (AnO(2)BHI) broth, or aerobic Enterococcosel (EC) broth. DNA was extracted from the cultures and tested for the presence of vanB by using the PCR primers of Dutka-Malen et al. (S. Dutka-Malen, S. Evers, and P. Courvalin, J. Clin. Microbiol. 33:24-27, 1995), Bell et al. (J. M. Bell, J. C. Paton, and J. Turnidge, J. Clin. Microbiol. 36:2187-2190, 1998), and Stinear et al. (T. P. Stinear, D. C. Olden, P. D. R. Johnson, J. K. Davies, and M. L. Grayson, Lancet 357:855-856, 2001). The sensitivity (specificity) of PCR compared with the results of culture on BHI, AnO(2)BHI, and EC broths were 67% (96%), 50% (94%), and 17% (100%), respectively, with the primers of Dutka-Malen et al.; 92% (60%), 92% (45%), and 92% (83%), respectively, with the primers of Bell et al.; and 92% (49%), 92% (43%), and 100% (51%) respectively, with the primers of Stinear et al. The primers of both Bell et al. and Stinear et al. were significantly more sensitive than those of Dutka-Malen et al. in EC broth (P = 0.001 and P < 0.001, respectively). The poor specificities for all primer pairs were due in part to the isolation and identification of six anaerobic gram-positive bacilli, Clostridium hathewayi (n = 3), a Clostridium innocuum-like organism (n = 1), Clostridium bolteae (n = 1), and Ruminococcus lactaris-like (n = 1), from five fecal specimens that were vanB positive but VRE culture negative. All six organisms were demonstrated to contain
Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing
2014-01-01
A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973
Asvapathanagul, P; Olson, B H
2017-01-01
To develop qPCR broad-spectrum primers combined with a Nocardia genus-specific probe for the identification of a broad spectrum of Nocardia spp. and to analyse the effects of using this developed primer and probe set on the ability to quantify Nocardia spp. in mixed DNA. The consequences of using a degenerative primer set and species-specific probe for the genus Nocardia on qPCR assays were examined using DNA extracts of pure cultures and activated sludge. The mixed DNA extracts where the target organism Nocardia flavorosea concentration ranged from 5 × 10 2 to 5 × 10 6 copies per reaction, while the background organism's DNA (Mycobacterium bovis) concentration was held at 5 × 10 6 copies per reaction, only produced comparable cycle threshold florescence levels when N. flavorosea concentration was greater than or equal to the background organism concentration. When concentrations of N. flavorosea were lowered in increments of 1 log, while holding M. bovis concentrations constant at 5 × 10 6 copies per reaction, all assays demonstrated delayed cycle threshold values with a maximum 34·6-fold decrease in cycle threshold at a ratio of 10 6 M. bovis: 10 2 N. flavorosea copies per reaction. The data presented in this study indicated that increasing the ability of a primer set to capture a broad group of organisms can affect the accuracy of quantification even when a highly specific probe is used. This study examined several applications of molecular tools in complex communities such as evaluating the effect of mispriming vs interference. It also elucidates the importance of understanding the community genetic make-up on primer design. Degenerative primers are very useful in amplifying bacterial DNA across genera, but reduce the efficiency of qPCR reactions. Therefore, standards that address closely related background species must be used to obtain accurate qPCR results. © 2016 The Society for Applied Microbiology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Castro Gonzalez, Hector F; Classen, Aimee T; Austin, Emily E
2012-01-01
Molecular innovations in microbial ecology are allowing scientists to correlate microbial community characteristics to a variety of ecosystem functions. However, to date the majority of soil microbial ecology studies target phylogenetic rRNA markers, while a smaller number target functional markers linked to soil processes. We validated a new primer set targeting citrate synthase (gtlA), a central enzyme in the citric acid cycle linked to aerobic respiration. Primers for a 225 bp fragment suitable for qPCR were tested for specificity and assay performance verified on multiple soils. Clone libraries of the PCR-amplified gtlA gene exhibited high diversity and recovered most majormore » groups identified in a previous 16S rRNA gene study. Comparisons among bacterial communities based on gtlA sequencing using UniFrac revealed differences among the experimental soils studied. Conditions for gtlA qPCR were optimized and calibration curves were highly linear (R2 > 0.99) over six orders of magnitude (4.56 10^5 to 4.56 10^11 copies), with high amplification efficiencies (>1.7). We examined the performance of the gtlA qPCR across a variety of soils and ecosystems, spanning forests, old fields and agricultural areas. We were able to amplify gtlA genes in all tested soils, and detected differences in gtlA abundance within and among environments. These results indicate that a fully developed gtlA-targeted qPCR approach may have potential to link microbial community characteristics with changes in soil respiration.« less
Blanchard, Philippe; Regnault, Julie; Schurr, Frank; Dubois, Eric; Ribière, Magali
2012-03-01
Chronic bee paralysis virus (CBPV) is responsible for chronic bee paralysis, an infectious and contagious disease in adult honey bees (Apis mellifera L.). A real-time RT-PCR assay to quantitate the CBPV load is now available. To propose this assay as a reference method, it was characterised further in an intra-laboratory study during which the reliability and the repeatability of results and the performance of the assay were confirmed. The qPCR assay alone and the whole quantitation method (from sample RNA extraction to analysis) were both assessed following the ISO/IEC 17025 standard and the recent XP U47-600 standard issued by the French Standards Institute. The performance of the qPCR assay and of the overall CBPV quantitation method were validated over a 6 log range from 10(2) to 10(8) with a detection limit of 50 and 100 CBPV RNA copies, respectively, and the protocol of the real-time RT-qPCR assay for CBPV quantitation was approved by the French Accreditation Committee. Copyright © 2011 Elsevier B.V. All rights reserved.
Identification of Mycobacterium bovis in bovine clinical samples by PCR species-specific primers.
Romero, R E; Garzón, D L; Mejía, G A; Monroy, W; Patarroyo, M E; Murillo, L A
1999-01-01
Tuberculosis, caused by Mycobacterium bovis is emerging as the most important disease affecting cattle. Furthermore, it results in a major public health problem when transmitted to humans. Due to its difficult and non-specific diagnosis, M. bovis has been declared to be one of the etiologic agents causing significant economic loss in the cattle industry. Our group evaluated a more rapid and specific method, based on a new polymerase chain reaction species-specific primers, which amplifies a 470-base pair fragment of the M. bovis genome. A total of 275 milk-producing cows were studied by intradermal tuberculin test (ITT) which gave 184 positive and 91 negative cases. From them, 50 animals were taken from a cattle ranch free of tuberculosis. Three different samples were collected from each animal (blood, nasal mucus, and milk). Positive results were obtained from 26 animals by PCR (11.4%), 1 by bacteriological culturing (0.4%) and 1 by bacilloscopy (0.4%). This finding suggests, as in previous reports, that ITT, normally used for bovine tuberculosis detection, has the inconvenience of having a broad range of specificity and sensitivity, and the PCR technique is a more specific and sensitive test to detect infection associated with M. bovis. Therefore, we propose this PCR assay as a useful tool in the epidemiological characterization of infected animals in areas considered to be at high risk of transmission. Images Figure 1. PMID:10369566
Gu, Z.; Sam, S. S.; Sun, Y.; Tang, L.; Pounds, S.; Caliendo, A. M.
2016-01-01
A potential benefit of digital PCR is a reduction in result variability across assays and platforms. Three sets of PCR reagents were tested on two digital PCR systems (Bio-Rad and RainDance), using three different sets of PCR reagents for quantitation of cytomegalovirus (CMV). Both commercial quantitative viral standards and 16 patient samples (n = 16) were tested. Quantitative accuracy (compared to nominal values) and variability were determined based on viral standard testing results. Quantitative correlation and variability were assessed with pairwise comparisons across all reagent-platform combinations for clinical plasma sample results. The three reagent sets, when used to assay quantitative standards on the Bio-Rad system, all showed a high degree of accuracy, low variability, and close agreement with one another. When used on the RainDance system, one of the three reagent sets appeared to have a much better correlation to nominal values than did the other two. Quantitative results for patient samples showed good correlation in most pairwise comparisons, with some showing poorer correlations when testing samples with low viral loads. Digital PCR is a robust method for measuring CMV viral load. Some degree of result variation may be seen, depending on platform and reagents used; this variation appears to be greater in samples with low viral load values. PMID:27535685
Development of a duplex ddPCR assay for detection of “Candidatus Liberibacter asiaticus”
USDA-ARS?s Scientific Manuscript database
Huanglongbing (HLB) (aka citrus greening) is a devastating citrus disease associated with “Candidatus Liberibacter asiaticus” (CLas). Currently, diagnosis of CLas in regulatory samples is based on a real-time quantitative polymerase chain reaction (qPCR) assay using 16S rRNA gene specific primers/pr...
Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W
1998-08-01
The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.
Rodríguez, Alicia; Werning, María L; Rodríguez, Mar; Bermúdez, Elena; Córdoba, Juan J
2012-12-01
A quantitative TaqMan real-time PCR (qPCR) method that includes an internal amplification control (IAC) to quantify cyclopiazonic acid (CPA)-producing molds in foods has been developed. A specific primer pair (dmaTF/dmaTR) and a TaqMan probe (dmaTp) were designed on the basis of dmaT gene which encodes the enzyme dimethylallyl tryptophan synthase involved in the biosynthesis of CPA. The IAC consisted of a 105 bp chimeric DNA fragment containing a region of the hly gene of Listeria monocytogenes. Thirty-two mold reference strains representing CPA producers and non-producers of different mold species were used in this study. All strains were tested for CPA production by high-performance liquid chromatography-mass spectrometry (HPLC-MS). The functionality of the designed qPCR method was demonstrated by the high linear relationship of the standard curves relating to the dmaT gene copy numbers and the Ct values obtained from the different CPA producers tested. The ability of the qPCR protocol to quantify CPA-producing molds was evaluated in different artificially inoculated foods. A good linear correlation was obtained over the range 1-4 log cfu/g in the different food matrices. The detection limit in all inoculated foods ranged from 1 to 2 log cfu/g. This qPCR protocol including an IAC showed good efficiency to quantify CPA-producing molds in naturally contaminated foods avoiding false negative results. This method could be used to monitor the CPA producers in the HACCP programs to prevent the risk of CPA formation throughout the food chain. Copyright © 2012 Elsevier Ltd. All rights reserved.
Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C
2009-06-01
Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P < 0.01). In contrast, PGR expression was significantly down-regulated in the cancer group (P < 0.05). There were no significant differences in AR, ERalpha or PSA expression between the groups. This study represents the first to show an upregulation of ERbeta gene expression in laser microdissected prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.
Primer and platform effects on 16S rRNA tag sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tremblay, Julien; Singh, Kanwar; Fern, Alison
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
Primer and platform effects on 16S rRNA tag sequencing
Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...
2015-08-04
Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less
NASA Astrophysics Data System (ADS)
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
Multiplex digital PCR: breaking the one target per color barrier of quantitative PCR.
Zhong, Qun; Bhattacharya, Smiti; Kotsopoulos, Steven; Olson, Jeff; Taly, Valérie; Griffiths, Andrew D; Link, Darren R; Larson, Jonathan W
2011-07-07
Quantitative polymerase chain reactions (qPCR) based on real-time PCR constitute a powerful and sensitive method for the analysis of nucleic acids. However, in qPCR, the ability to multiplex targets using differently colored fluorescent probes is typically limited to 4-fold by the spectral overlap of the fluorophores. Furthermore, multiplexing qPCR assays requires expensive instrumentation and most often lengthy assay development cycles. Digital PCR (dPCR), which is based on the amplification of single target DNA molecules in many separate reactions, is an attractive alternative to qPCR. Here we report a novel and easy method for multiplexing dPCR in picolitre droplets within emulsions-generated and read out in microfluidic devices-that takes advantage of both the very high numbers of reactions possible within emulsions (>10(6)) as well as the high likelihood that the amplification of only a single target DNA molecule will initiate within each droplet. By varying the concentration of different fluorogenic probes of the same color, it is possible to identify the different probes on the basis of fluorescence intensity. Adding multiple colors increases the number of possible reactions geometrically, rather than linearly as with qPCR. Accurate and precise copy numbers of up to sixteen per cell were measured using a model system. A 5-plex assay for spinal muscular atrophy was demonstrated with just two fluorophores to simultaneously measure the copy number of two genes (SMN1 and SMN2) and to genotype a single nucleotide polymorphism (c.815A>G, SMN1). Results of a pilot study with SMA patients are presented. This journal is © The Royal Society of Chemistry 2011
A survey of tools for the analysis of quantitative PCR (qPCR) data.
Pabinger, Stephan; Rödiger, Stefan; Kriegner, Albert; Vierlinger, Klemens; Weinhäusel, Andreas
2014-09-01
Real-time quantitative polymerase-chain-reaction (qPCR) is a standard technique in most laboratories used for various applications in basic research. Analysis of qPCR data is a crucial part of the entire experiment, which has led to the development of a plethora of methods. The released tools either cover specific parts of the workflow or provide complete analysis solutions. Here, we surveyed 27 open-access software packages and tools for the analysis of qPCR data. The survey includes 8 Microsoft Windows, 5 web-based, 9 R-based and 5 tools from other platforms. Reviewed packages and tools support the analysis of different qPCR applications, such as RNA quantification, DNA methylation, genotyping, identification of copy number variations, and digital PCR. We report an overview of the functionality, features and specific requirements of the individual software tools, such as data exchange formats, availability of a graphical user interface, included procedures for graphical data presentation, and offered statistical methods. In addition, we provide an overview about quantification strategies, and report various applications of qPCR. Our comprehensive survey showed that most tools use their own file format and only a fraction of the currently existing tools support the standardized data exchange format RDML. To allow a more streamlined and comparable analysis of qPCR data, more vendors and tools need to adapt the standardized format to encourage the exchange of data between instrument software, analysis tools, and researchers.
Ambient stable quantitative PCR reagents for the detection of Yersinia pestis.
Qu, Shi; Shi, Qinghai; Zhou, Lei; Guo, Zhaobiao; Zhou, Dongsheng; Zhai, Junhui; Yang, Ruifu
2010-03-09
Although assays for detecting Yersinia pestis using TaqMan probe-based real-time PCR have been developed for years, little is reported on room-temperature-stable PCR reagents, which will be invaluable for field epidemic surveillance, immediate response to public health emergencies, counter-bioterrorism investigation, etc. In this work, a set of real-time PCR reagents for rapid detection of Y. pestis was developed with extraordinary stability at 37 degrees C. TaqMan-based real-time PCR assays were developed using the primers and probes targeting the 3a sequence in the chromosome and the F1 antigen gene caf1 in the plasmid pMT1of Y. pestis, respectively. Then, carbohydrate mixtures were added to the PCR reagents, which were later vacuum-dried for stability evaluation. The vacuum-dried reagents were stable at 37 degrees C for at least 49 days for a lower concentration of template DNA (10 copies/microl), and up to 79 days for higher concentrations (> or =10(2) copies/microl). The reagents were used subsequently to detect soil samples spiked with Y. pestis vaccine strain EV76, and 5x10(4) CFU per gram of soil could be detected by both 3a- and caf1-based PCR reagents. In addition, a simple and efficient method for soil sample processing is presented here. The vacuum-dried reagents for real-time PCR maintain accuracy and reproducibility for at least 49 days at 37 degrees C, indicating that they can be easily transported at room temperature for field application if the machine for performing real-time PCR is available. This dry reagent is of great significance for routine plague surveillance.
Johansson, Anna H; Bejai, Sarosh; Niazi, Adnan; Manzoor, Shahid; Bongcam-Rudloff, Erik; Meijer, Johan
2014-12-01
Certain strains of Bacillus amyloliquefaciens can colonize plants and improve growth and stress management. In order to study these effects, bacterial growth dynamics on plants and in the rhizosphere are of interest calling for specific analytical tools. For that purpose, quantitative real-time PCR (qPCR) assays were developed in order to differentiate among three closely related B. amyloliquefaciens subsp. plantarum strains (UCMB5033, UCMB5036, UCMB5113) and to determine their levels with high accuracy. Oligonucleotide primers were designed for strain unique gene sequences and used for SYBR green based qPCR analysis. Standard curves covered a wide linear range (10(6)) of DNA amounts with the lowest detection level at 50 fg. Post-reaction melting curve analysis showed only a single product. Accurate threshold cycles were obtained, even in the presence of high excess of related Bacillus strains and total bacterial DNA from soil. Analysis of Bacillus colonisation after seed treatment of two oilseed rape cultivars (Oase and Ritz) grown on agar support showed a time dependent effect but that the bacteria mostly were found on root tissues and little on green tissues. The colonisation on plants grown in soil varied among the Bacillus strains where Oase seemed to house more bacteria than Ritz. Applied as a mixture, all three Bacillus strains co-existed on the roots of plants grown in soil. The qPCR assay in combination with other techniques will be a powerful tool to study plant interactions of these B. amyloliquefaciens biocontrol agents to further understand the requirements for successful interactions and improvement of plant properties.
Optimization of Diamond Nucleic Acid Dye for quantitative PCR.
Haines, Alicia M; Tobe, Shanan S; Linacre, Adrian
2016-10-01
Here, we evaluate Diamond Nucleic Acid Dye (DD) for use in quantitative PCR (qPCR) applications. Although DD is a commercially available stain for detection of DNA separated by gel electrophoresis, its use as a detection dye in qPCR has yet to be described. To determine if DD can be used in qPCR, we investigated its inhibitory effects on qPCR at concentrations ranging 0.1-2.5×. Serial dilution of DNA was used to determine the efficiency, sensitivity, and linearity of DD-generated qPCR data in comparison to other commonly used fluorescent dyes such as SYBR Green (SG), EvaGreen (EG), and BRYT Green (BG). DD was found to be comparable with other dyes for qPCR applications, with an R2 value >0.9 and an efficiency of 0.83. Mitochondrial DNA (mtDNA) target signals were successfully produced by DD over a DNA dilution range of ~28 ng- 0.28 pg, demonstrating comparable sensitivity to the other dyes investigated. Cq values obtained using DD were lower than those using EG by almost 7 cycles. We conclude that Diamond Nucleic Acid Dye is a cheaper, less toxic alternative for qPCR applications.
Ito, Takao; Suzaki, Koichi
2017-01-01
Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.
Suzaki, Koichi
2017-01-01
Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays. PMID:28957362
Begum, Sharmin; Uddin, Md Jashim; Platts-Mills, James A.; Liu, Jie; Kirkpatrick, Beth D.; Chowdhury, Anwarul H.; Jamil, Khondoker M.; Haque, Rashidul; Petri, William A.; Houpt, Eric R.
2014-01-01
Amid polio eradication efforts, detection of oral polio vaccine (OPV) virus in stool samples can provide information about rates of mucosal immunity and allow estimation of the poliovirus reservoir. We developed a multiplex one-step quantitative reverse transcription-PCR (qRT-PCR) assay for detection of OPV Sabin strains 1, 2, and 3 directly in stool samples with an external control to normalize samples for viral quantity and compared its performance with that of viral culture. We applied the assay to samples from infants in Dhaka, Bangladesh, after the administration of trivalent OPV (tOPV) at weeks 14 and 52 of life (on days 0 [pre-OPV], +4, +11, +18, and +25 relative to vaccination). When 1,350 stool samples were tested, the sensitivity and specificity of the quantitative PCR (qPCR) assay were 89 and 91% compared with culture. A quantitative relationship between culture+/qPCR+ and culture−/qPCR+ stool samples was observed. The kinetics of shedding revealed by qPCR and culture were similar. qPCR quantitative cutoffs based on the day +11 or +18 stool samples could be used to identify the culture-positive shedders, as well as the long-duration or high-frequency shedders. Interestingly, qPCR revealed that a small minority (7%) of infants contributed the vast majority (93 to 100%) of the total estimated viral excretion across all subtypes at each time point. This qPCR assay for OPV can simply and quantitatively detect all three Sabin strains directly in stool samples to approximate shedding both qualitatively and quantitatively. PMID:25378579
Comparison of droplet digital PCR and conventional quantitative PCR for measuring EGFR gene mutation
ZHANG, BO; XU, CHUN-WEI; SHAO, YUN; WANG, HUAI-TAO; WU, YONG-FANG; SONG, YE-YING; LI, XIAO-BING; ZHANG, ZHE; WANG, WEN-JING; LI, LI-QIONG; CAI, CONG-LI
2015-01-01
Early detection of epidermal growth factor receptor (EGFR) mutation, particularly EGFR T790M mutation, is of clinical significance. The aim of the present study was to compare the performances of amplification refractory mutation system-based quantitative polymerase chain reaction (ARMS-qPCR) and droplet digital polymerase chain reaction (ddPCR) approaches in the detection of EGFR mutation and explore the feasibility of using ddPCR in the detection of samples with low mutation rates. EGFR gene mutations in plasmid samples with different T790M mutation rates (0.1–5%) and 10 clinical samples were detected using the ARMS-qPCR and ddPCR approaches. The results demonstrated that the ARMS-qPCR method stably detected the plasmid samples (6,000 copies) with 5 and 1% mutation rates, while the ddPCR approach reliably detected those with 5% (398 copies), 1% (57 copies), 0.5% (24 copies) and 0.1% (average 6 copies) mutation rates. For the 10 clinical samples, the results for nine samples by the ARMS-qPCR and ddPCR methods were consistent; however, the sample N006, indicated to be EGFR wild-type by ARMS-qPCR, was revealed to have a clear EGFR T790M mutation with seven copies of mutant alleles in a background of 6,000 wild-type copies using ddPCR technology. This study demonstrates the feasibility of applying the ddPCR system to detect EGFR mutation and identified the advantage of ddPCR in the detection of samples with a low EGFR mutation abundance, particularly the secondary EGFR T790M resistance mutation, which enables early diagnosis before acquired resistance to tyrosine kinase inhibitors becomes clinically detectable. PMID:25780439
Fan, Lihua; Shuai, Jiangbing; Zeng, Ruoxue; Mo, Hongfei; Wang, Suhua; Zhang, Xiaofeng; He, Yongqiang
2017-12-01
Genome fragment enrichment (GFE) method was applied to identify host-specific bacterial genetic markers that differ among different fecal metagenomes. To enrich for swine-specific DNA fragments, swine fecal DNA composite (n = 34) was challenged against a DNA composite consisting of cow, human, goat, sheep, chicken, duck and goose fecal DNA extracts (n = 83). Bioinformatic analyses of 384 non-redundant swine enriched metagenomic sequences indicated a preponderance of Bacteroidales-like regions predicted to encode metabolism-associated, cellular processes and information storage and processing. After challenged against fecal DNA extracted from different animal sources, four sequences from the clone libraries targeting two Bacteroidales- (genes 1-38 and 3-53), a Clostridia- (gene 2-109) as well as a Bacilli-like sequence (gene 2-95), respectively, showed high specificity to swine feces based on PCR analysis. Host-specificity and host-sensitivity analysis confirmed that oligonucleotide primers and probes capable of annealing to select Bacteroidales-like sequences (1-38 and 3-53) exhibited high specificity (>90%) in quantitative PCR assays with 71 fecal DNAs from non-target animal sources. The two assays also demonstrated broad distributions of corresponding genetic markers (>94% positive) among 72 swine feces. After evaluation with environmental water samples from different areas, swine-targeted assays based on two Bacteroidales-like GFE sequences appear to be suitable quantitative tracing tools for swine fecal pollution. Copyright © 2017 Elsevier Ltd. All rights reserved.
Walter, J.; Tannock, G. W.; Tilsala-Timisjarvi, A.; Rodtong, S.; Loach, D. M.; Munro, K.; Alatossava, T.
2000-01-01
Denaturing gradient gel electrophoresis (DGGE) of DNA fragments obtained by PCR amplification of the V2-V3 region of the 16S rRNA gene was used to detect the presence of Lactobacillus species in the stomach contents of mice. Lactobacillus isolates cultured from human and porcine gastrointestinal samples were identified to the species level by using a combination of DGGE and species-specific PCR primers that targeted 16S-23S rRNA intergenic spacer region or 16S rRNA gene sequences. The identifications obtained by this approach were confirmed by sequencing the V2-V3 region of the 16S rRNA gene and by a BLAST search of the GenBank database. PMID:10618239
Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao
2016-09-29
The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
Quantitative PCR and Digital PCR for Detection of Ascaris lumbricoides Eggs in Reclaimed Water
Santísima-Trinidad, Ana Belén; Bornay-Llinares, Fernando Jorge; Martín González, Marcos; Pascual Valero, José Antonio; Ros Muñoz, Margarita
2017-01-01
The reuse of reclaimed water from wastewater depuration is a widespread and necessary practice in many areas around the world and must be accompanied by adequate and continuous quality control. Ascaris lumbricoides is one of the soil-transmitted helminths (STH) with risk for humans due to its high infectivity and an important determinant of transmission is the inadequacy of water supplies and sanitation. The World Health Organization (WHO) recommends a limit equal to or lower than one parasitic helminth egg per liter, to reuse reclaimed water for unrestricted irrigation. We present two new protocols of DNA extraction from large volumes of reclaimed water. Quantitative PCR (qPCR) and digital PCR (dPCR) were able to detect low amounts of A. lumbricoides eggs. By using the first extraction protocol, which processes 500 mL of reclaimed water, qPCR can detect DNA concentrations as low as one A. lumbricoides egg equivalent, while dPCR can detect DNA concentrations as low as five A. lumbricoides egg equivalents. By using the second protocol, which processes 10 L of reclaimed water, qPCR was able to detect DNA concentrations equivalent to 20 A. lumbricoides eggs. This fact indicated the importance of developing new methodologies to detect helminth eggs with higher sensitivity and precision avoiding possible human infection risks. PMID:28377928
Quantitative Real-Time Legionella PCR for Environmental Water Samples: Data Interpretation
Joly, Philippe; Falconnet, Pierre-Alain; André, Janine; Weill, Nicole; Reyrolle, Monique; Vandenesch, François; Maurin, Max; Etienne, Jerome; Jarraud, Sophie
2006-01-01
Quantitative Legionella PCRs targeting the 16S rRNA gene (specific for the genus Legionella) and the mip gene (specific for the species Legionella pneumophila) were applied to a total of 223 hot water system samples (131 in one laboratory and 92 in another laboratory) and 37 cooling tower samples (all in the same laboratory). The PCR results were compared with those of conventional culture. 16S rRNA gene PCR results were nonquantifiable for 2.8% of cooling tower samples and up to 39.1% of hot water system samples, and this was highly predictive of Legionella CFU counts below 250/liter. PCR cutoff values for identifying hot water system samples containing >103 CFU/liter legionellae were determined separately in each laboratory. The cutoffs differed widely between the laboratories and had sensitivities from 87.7 to 92.9% and specificities from 77.3 to 96.5%. The best specificity was obtained with mip PCR. PCR cutoffs could not be determined for cooling tower samples, as the results were highly variable and often high for culture-negative samples. Thus, quantitative Legionella PCR appears to be applicable to samples from hot water systems, but the positivity cutoff has to be determined in each laboratory. PMID:16597985
Rasmussen, Ulla; Svenning, Mette M.
1998-01-01
The presence of repeated DNA (short tandemly repeated repetitive [STRR] and long tandemly repeated repetitive [LTRR]) sequences in the genome of cyanobacteria was used to generate a fingerprint method for symbiotic and free-living isolates. Primers corresponding to the STRR and LTRR sequences were used in the PCR, resulting in a method which generate specific fingerprints for individual isolates. The method was useful both with purified DNA and with intact cyanobacterial filaments or cells as templates for the PCR. Twenty-three Nostoc isolates from a total of 35 were symbiotic isolates from the angiosperm Gunnera species, including isolates from the same Gunnera species as well as from different species. The results show a genetic similarity among isolates from different Gunnera species as well as a genetic heterogeneity among isolates from the same Gunnera species. Isolates which have been postulated to be closely related or identical revealed similar results by the PCR method, indicating that the technique is useful for clustering of even closely related strains. The method was applied to nonheterocystus cyanobacteria from which a fingerprint pattern was obtained. PMID:16349487
Quantitative PCR for Genetic Markers of Human Fecal Pollution
Assessment of health risk and fecal bacteria loads associated with human fecal pollution requires reliable host-specific analytical methods and a rapid quantificationapproach. We report the development of quantitative PCR assays for quantification of two recently described human-...
Arif, M.; Aguilar-Moreno, G. S.; Wayadande, A.; Fletcher, J.
2014-01-01
A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods—real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)—for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5′ terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574
Ambient Stable Quantitative PCR Reagents for the Detection of Yersinia pestis
Zhou, Lei; Guo, Zhaobiao; Zhou, Dongsheng; Zhai, Junhui; Yang, Ruifu
2010-01-01
Background Although assays for detecting Yersinia pestis using TaqMan probe-based real-time PCR have been developed for years, little is reported on room-temperature-stable PCR reagents, which will be invaluable for field epidemic surveillance, immediate response to public health emergencies, counter-bioterrorism investigation, etc. In this work, a set of real-time PCR reagents for rapid detection of Y. pestis was developed with extraordinary stability at 37°C. Methods/Principal Findings TaqMan-based real-time PCR assays were developed using the primers and probes targeting the 3a sequence in the chromosome and the F1 antigen gene caf1 in the plasmid pMT1of Y. pestis, respectively. Then, carbohydrate mixtures were added to the PCR reagents, which were later vacuum-dried for stability evaluation. The vacuum-dried reagents were stable at 37°C for at least 49 days for a lower concentration of template DNA (10 copies/µl), and up to 79 days for higher concentrations (≥102 copies/µl). The reagents were used subsequently to detect soil samples spiked with Y. pestis vaccine strain EV76, and 5×104 CFU per gram of soil could be detected by both 3a- and caf1-based PCR reagents. In addition, a simple and efficient method for soil sample processing is presented here. Conclusions/Significance The vacuum-dried reagents for real-time PCR maintain accuracy and reproducibility for at least 49 days at 37°C, indicating that they can be easily transported at room temperature for field application if the machine for performing real-time PCR is available. This dry reagent is of great significance for routine plague surveillance. PMID:20231881
This describes fluorogenic 5' nuclease PCR assays suitable for rapid, sensitive, quantitative, high-throughput detection of the human-pathogenic microsporidial species Encephalitozoon hellem, E. cunicli and E. intestinalis. The assays utilize species-specific primer sets and a g...
Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou
2016-11-01
It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.
Quantitative PCR for genetic markers of human fecal pollution
Assessment of health risk and fecal bacteria loads associated with human fecal pollution requires reliable host-specific analytical methods and a rapid quantification approach. We report the development of quantitative PCR assays for enumeration of two recently described hum...
Quality control for quantitative PCR based on amplification compatibility test.
Tichopad, Ales; Bar, Tzachi; Pecen, Ladislav; Kitchen, Robert R; Kubista, Mikael; Pfaffl, Michael W
2010-04-01
Quantitative qPCR is a routinely used method for the accurate quantification of nucleic acids. Yet it may generate erroneous results if the amplification process is obscured by inhibition or generation of aberrant side-products such as primer dimers. Several methods have been established to control for pre-processing performance that rely on the introduction of a co-amplified reference sequence, however there is currently no method to allow for reliable control of the amplification process without directly modifying the sample mix. Herein we present a statistical approach based on multivariate analysis of the amplification response data generated in real-time. The amplification trajectory in its most resolved and dynamic phase is fitted with a suitable model. Two parameters of this model, related to amplification efficiency, are then used for calculation of the Z-score statistics. Each studied sample is compared to a predefined reference set of reactions, typically calibration reactions. A probabilistic decision for each individual Z-score is then used to identify the majority of inhibited reactions in our experiments. We compare this approach to univariate methods using only the sample specific amplification efficiency as reporter of the compatibility. We demonstrate improved identification performance using the multivariate approach compared to the univariate approach. Finally we stress that the performance of the amplification compatibility test as a quality control procedure depends on the quality of the reference set. Copyright 2010 Elsevier Inc. All rights reserved.
Croville, Guillaume; Foret, Charlotte; Heuillard, Pauline; Senet, Alexis; Delpont, Mattias; Mouahid, Mohammed; Ducatez, Mariette F; Kichou, Faouzi; Guerin, Jean-Luc
2018-06-01
Respiratory syndromes (RS) are among the most significant pathological conditions in edible birds and are caused by complex coactions of pathogens and environmental factors. In poultry, low pathogenic avian influenza A viruses, metapneumoviruses, infectious bronchitis virus, infectious laryngotracheitis virus, Mycoplasma spp. Escherichia coli and/or Ornithobacterium rhinotracheale in turkeys are considered as key co-infectious agents of RS. Aspergillus sp., Pasteurella multocida, Avibacterium paragallinarum or Chlamydia psittaci may also be involved in respiratory outbreaks. An innovative quantitative PCR method, based on a nanofluidic technology, has the ability to screen up to 96 samples with 96 pathogen-specific PCR primers, at the same time, in one run of real-time quantitative PCR. This platform was used for the screening of avian respiratory pathogens: 15 respiratory agents, including viruses, bacteria and fungi potentially associated with respiratory infections of poultry, were targeted. Primers were designed and validated for SYBR green real-time quantitative PCR and subsequently validated on the Biomark high throughput PCR nanofluidic platform (Fluidigm©, San Francisco, CA, USA). As a clinical assessment, tracheal swabs were sampled from turkeys showing RS and submitted to this panel assay. Beside systematic detection of E. coli, avian metapneumovirus, Mycoplasma gallisepticum and Mycoplasma synoviae were frequently detected, with distinctive co-infection patterns between French and Moroccan flocks. This proof-of-concept study illustrates the potential of such panel assays for unveiling respiratory co-infection profiles in poultry.
Quantification Bias Caused by Plasmid DNA Conformation in Quantitative Real-Time PCR Assay
Lin, Chih-Hui; Chen, Yu-Chieh; Pan, Tzu-Ming
2011-01-01
Quantitative real-time PCR (qPCR) is the gold standard for the quantification of specific nucleic acid sequences. However, a serious concern has been revealed in a recent report: supercoiled plasmid standards cause significant over-estimation in qPCR quantification. In this study, we investigated the effect of plasmid DNA conformation on the quantification of DNA and the efficiency of qPCR. Our results suggest that plasmid DNA conformation has significant impact on the accuracy of absolute quantification by qPCR. DNA standard curves shifted significantly among plasmid standards with different DNA conformations. Moreover, the choice of DNA measurement method and plasmid DNA conformation may also contribute to the measurement error of DNA standard curves. Due to the multiple effects of plasmid DNA conformation on the accuracy of qPCR, efforts should be made to assure the highest consistency of plasmid standards for qPCR. Thus, we suggest that the conformation, preparation, quantification, purification, handling, and storage of standard plasmid DNA should be described and defined in the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) to assure the reproducibility and accuracy of qPCR absolute quantification. PMID:22194997
Villard, Pierre; Malausa, Thibaut
2013-07-01
SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.
Quantitative detection method of Enterocytozoon hepatopenaei using TaqMan probe real-time PCR.
Liu, Ya-Mei; Qiu, Liang; Sheng, An-Zhi; Wan, Xiao-Yuan; Cheng, Dong-Yuan; Huang, Jie
2018-01-01
A TaqMan probe and a pair of specific primers were selected from the small subunit ribosomal DNA (SSU rDNA) sequence of Enterocytozoon hepatopenaei (EHP); this real-time PCR assay was developed and optimized. It showed a good linearity in detecting standards of EHP SSU rDNA fragments from 4 × 10 2 to 4 × 10 8 copies/reaction using the established method. The detection limit of the qPCR method was as low as 4 × 10 1 copies per reaction, which was higher than the conventional PCR and SYBR Green I-based EHP qPCR reported. Using the qPCR assay, EHP was detected in four batches of slow-growing Penaeus vannamei specimens collected from Tianjin and Zhejiang Province in China was detected using qPCR. The results showed that all the hepatopancreas from the slow-growing P. vannamei specimens were detected as EHP-positive. EHP copies of hepatopancreas in some batches had a negative correlation with the body mass index (BMI) of shrimps; however, not all batches of specimens had this negative correlation between EHP copies of hepatopancreas and BMI. This qPCR technique is sensitive, specific and easy to perform (96 tests in <3 h), which provides technical support for the detection and prevention of EHP. Copyright © 2017 Elsevier Inc. All rights reserved.
On-chip quantitative detection of pathogen genes by autonomous microfluidic PCR platform.
Tachibana, Hiroaki; Saito, Masato; Shibuya, Shogo; Tsuji, Koji; Miyagawa, Nobuyuki; Yamanaka, Keiichiro; Tamiya, Eiichi
2015-12-15
Polymerase chain reaction (PCR)-based genetic testing has become a routine part of clinical diagnoses and food testing. In these fields, rapid, easy-to-use, and cost-efficient PCR chips are expected to be appeared for providing such testing on-site. In this study, a new autonomous disposable plastic microfluidic PCR chip was created, and was utilized for quantitative detection of pathogenic microorganisms. To control the capillary flow of the following solution in the PCR microchannel, a driving microchannel was newly designed behind the PCR microchannel. This allowed the effective PCR by simply dropping the PCR solution onto the inlet without any external pumps. In order to achieve disposability, injection-molded cyclo-olefin polymer (COP) of a cost-competitive plastic was used for the PCR chip. We discovered that coating the microchannel walls with non-ionic surfactant produced a suitable hydrophilic surface for driving the capillary flow through the 1250-mm long microchannel. As a result, quantitative real-time PCR with the lowest initial concentration of human, Escherichia coli (E. coli), and pathogenic E. coli O157 genomic DNA of 4, 0.0019, 0.031 pg/μl, respectively, was successfully achieved in less than 18 min. Our results indicate that the platform presented in this study provided a rapid, easy-to-use, and low-cost real-time PCR system that could be potentially used for on-site gene testing. Copyright © 2015 Elsevier B.V. All rights reserved.
Design and Validation of Real-Time PCR: Quantitative Diagnosis of Common Leishmania Species in Iran.
Fekri Soofi Abadi, Maryam; Dabiri, Shahriar; Fotouhi Ardakani, Reza; Fani Malaki, Lina; Amirpoor Rostami, Sahar; Ziasistani, Mahsa; Dabiri, Donya
2016-07-01
Design and validation of Real-time PCR on the protected gene region ITS2 to quantify the parasite load in common leishmania (L) species. Probe and primer were designed from the ITS2 region between the rRNA genes with minimum gene variation in three common leishmania species followed by a Real-time PCR using the Taq man probe method in the form of absolute quantification. A series of different concentrations of leishmania were analyzed. After the purified PCR product was successfully placed in a PTG19-T plasmid vector, specialized ITS2 region was cloned in this plasmid. In the last phase, the cloned gene was transferred to the Ecoli.Top10F bacteria. The standard plasmid was provided in 10(7) to 10(1) copies/rxn concentrations. The specification and clinical sensitivity of the data was analyzed using inter and intra scales. The probe and primer were designed using three species, including L. infantum, L. major, and L.tropica. Seven concentrations of purified parasite in culture media showed that the selected region for quantifying the parasite is suitable. Clinical and analytical specificity and sensitivity were both 100%, respectively. The Taq man method for the ITS2 region in leishmania is one the most sensitive diagnostic test for identifying the parasite load and is suggested as a tool for fast identification and quantification of species.
Ott, Stephan J; Musfeldt, Meike; Ullmann, Uwe; Hampe, Jochen; Schreiber, Stefan
2004-06-01
The composition of the human intestinal flora is important for the health status of the host. The global composition and the presence of specific pathogens are relevant to the effects of the flora. Therefore, accurate quantification of all major bacterial populations of the enteric flora is needed. A TaqMan real-time PCR-based method for the quantification of 20 dominant bacterial species and groups of the intestinal flora has been established on the basis of 16S ribosomal DNA taxonomy. A PCR with conserved primers was used for all reactions. In each real-time PCR, a universal probe for quantification of total bacteria and a specific probe for the species in question were included. PCR with conserved primers and the universal probe for total bacteria allowed relative and absolute quantification. Minor groove binder probes increased the sensitivity of the assays 10- to 100-fold. The method was evaluated by cross-reaction experiments and quantification of bacteria in complex clinical samples from healthy patients. A sensitivity of 10(1) to 10(3) bacterial cells per sample was achieved. No significant cross-reaction was observed. The real-time PCR assays presented may facilitate understanding of the intestinal bacterial flora through a normalized global estimation of the major contributing species.
Detection and Analysis of Circular RNAs by RT-PCR.
Panda, Amaresh C; Gorospe, Myriam
2018-03-20
Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.
A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.
Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh
2015-06-01
Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.
USDA-ARS?s Scientific Manuscript database
In this study, an ultra sensitive and quantitative diagnostic system for “Candidatus Liberibacter asiaticus” was developed. This system adapts a nested PCR and Taq-Man PCR in a single closed tube. The procedure involves two steps of PCR using the species specific outer and inner primer pairs. Differ...
Implementation of Novel Design Features for qPCR-Based eDNA Assessment
Veldhoen, Nik; Hobbs, Jared; Ikonomou, Georgios; Hii, Michael; Lesperance, Mary; Helbing, Caren C.
2016-01-01
Environmental stewardship requires timely, accurate information related to the status of a given ecosystem and the species that occupy it. Recent advances in the application of the highly sensitive real-time quantitative polymerase chain reaction (qPCR) towards identification of constituents within environmental DNA (eDNA) now allow targeted detection of the presence of species-specific biological material within a localized geographic region. However, as with all molecular techniques predicated on the specificity and sensitivity of the PCR assay, careful validation of each eDNA qPCR assay in development must be performed both under controlled laboratory conditions and when challenged with field-derived eDNA samples. Such a step-wise approach forms the basis for incorporation of innovative qPCR design features that strengthen the implementation and interpretation of the eDNA assay. This includes empirical determination that the qPCR assay is refractory to the presence of human DNA and the use of a tripartite assay approach comprised of 1) a primer set targeting plant chloroplast that evaluates the presence of amplifiable DNA from field samples to increase confidence in a negative result, 2) an animal group primer set to increase confidence in the assay result, and 3) a species-specific primer set to assess presence of DNA from the target species. To demonstrate this methodology, we generated eDNA assays specific for the North American bullfrog (Lithobates (Rana) catesbeiana) and the Rocky Mountain tailed frog (Ascaphus montanus) and characterized each with respect to detection sensitivity and specificity with demonstrated performance in a field survey scenario. The qPCR design features presented herein address specific challenges of eDNA assays thereby increasing their interpretative power. PMID:27802293
ERIC Educational Resources Information Center
Elkins, Kelly M.; Kadunc, Raelynn E.
2012-01-01
In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…
A simple PCR-based strategy for estimating species-specific contributions in chimeras and xenografts
Ealba, Erin L.; Schneider, Richard A.
2013-01-01
Many tissue-engineering approaches for repair and regeneration involve transplants between species. Yet a challenge is distinguishing donor versus host effects on gene expression. This study provides a simple molecular strategy to quantify species-specific contributions in chimeras and xenografts. Species-specific primers for reverse transcription quantitative real-time PCR (RT-qPCR) were designed by identifying silent mutations in quail, duck, chicken, mouse and human ribosomal protein L19 (RPL19). cDNA from different pairs of species was mixed in a dilution series and species-specific RPL19 primers were used to generate standard curves. Then quail cells were transplanted into transgenic-GFP chick and resulting chimeras were analyzed with species-specific primers. Fluorescence-activated cell sorting (FACS) confirmed that donor- and host-specific levels of RPL19 expression represent actual proportions of cells. To apply the RPL19 strategy, we measured Runx2 expression in quail-duck chimeras. Elevated Runx2 levels correlated with higher percentages of donor cells. Finally, RPL19 primers also discriminated mouse from human and chick. Thus, this strategy enables chimeras and/or xenografts to be screened rapidly at the molecular level. PMID:23785056
DOE Office of Scientific and Technical Information (OSTI.GOV)
Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.
Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less
Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.; ...
2016-07-15
Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less
Shuga, Joe; Zeng, Yong; Novak, Richard; Lan, Qing; Tang, Xiaojiang; Rothman, Nathaniel; Vermeulen, Roel; Li, Laiyu; Hubbard, Alan; Zhang, Luoping; Mathies, Richard A; Smith, Martyn T
2013-09-01
Cancers are heterogeneous and genetically unstable. New methods are needed that provide the sensitivity and specificity to query single cells at the genetic loci that drive cancer progression, thereby enabling researchers to study the progression of individual tumors. Here, we report the development and application of a bead-based hemi-nested microfluidic droplet digital PCR (dPCR) technology to achieve 'quantitative' measurement and single-molecule sequencing of somatically acquired carcinogenic translocations at extremely low levels (<10(-6)) in healthy subjects. We use this technique in our healthy study population to determine the overall concentration of the t(14;18) translocation, which is strongly associated with follicular lymphoma. The nested dPCR approach improves the detection limit to 1×10(-7) or lower while maintaining the analysis efficiency and specificity. Further, the bead-based dPCR enabled us to isolate and quantify the relative amounts of the various clonal forms of t(14;18) translocation in these subjects, and the single-molecule sensitivity and resolution of dPCR led to the discovery of new clonal forms of t(14;18) that were otherwise masked by the conventional quantitative PCR measurements. In this manner, we created a quantitative map for this carcinogenic mutation in this healthy population and identified the positions on chromosomes 14 and 18 where the vast majority of these t(14;18) events occur.
QUANTITATIVE PCR OF SELECTED ASPERGILLUS, PENICILLIUM AND PAECILOMYCES SPECIES
A total of 65 quantitative PCR (QPCR) assays, incorporating fluorigenic 5' nuclease (TaqMan®) chemistry and directed at the nuclear ribosomal RNA operon, internal transcribed spacer regions (ITS1 or ITS2) was developed and tested for the detection of Aspergillus, Penicillium and ...
Hasan, Mohammad R; Tan, Rusung; Al-Rawahi, Ghada; Thomas, Eva; Tilley, Peter
2016-08-01
Quantitative, viral load monitoring for BK virus (BKV) by real-time PCR is an important tool in the management of polyomavirus associated nephropathy in renal transplant patients. However, variability in PCR results has been reported because of polymorphisms in viral genes among different subtypes of BKV, and lack of standardization of the PCR assays among different laboratories. In this study we have compared the performance of several laboratory developed PCR assays that target highly conserved regions of BKV genome with a commercially available, RealStar(®) BKV PCR Kit. Three real-time PCR assays (i) VP1 assay: selected from the literature that targets the major capsid protein (VP1) gene (ii) VP1MOD assay: VP1 assay with a modified probe, and (iii) BKLTA assay: newly designed assay that targets the large T antigen gene were assessed in parallel, using controls and clinical specimens that were previously tested using RealStar(®) BKV PCR Kit (Altona Diagnostics GmbH, Hamburg, Germany). Nucleic acid from all samples were extracted using the QIA symphony virus/bacteria kit on an automated DNA extraction platform QIA symphony SP (Qiagen). Primer and probe concentration, and reaction conditions for laboratory developed assays were optimized and the limit of detection of different assays was determined. Positive control for laboratory developed BK assays was prepared through construction of a plasmid carrying respective amplicon sequences. The 95% detection limit of VP1, VP1MOD and BKLTA assays were 1.8×10(2), 3×10(3) and 3.5×10(2) genomic copies/ml, respectively, as determined by Probit regression analysis of data obtained by testing a dilution series of a titered patient specimen, using RealStar(®) BKV PCR Kit. The inter-assay and intra-assay, coefficient of variations of these assays using calibrated, plasmid standards were <1%. All assays, including the RealStar(®) BKV PCR assay, were highly specific when tested against a panel of external proficiency
Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR.
Kim, Y H; Cho, K W; Youn, H Y; Yoo, H S; Han, H R
2001-04-01
A one step reverse transcription PCR (RT-PCR) combined nested PCR was set up to increase efficiency in the diagnosis of canine distemper virus (CDV) infection after developement of nested PCR. Two PCR primer sets were designed based on the sequence of nucleocapsid gene of CDV Onderstepoort strain. One-step RT-PCR with the outer primer pair was revealed to detect 10(2) PFU/ml. The sensitivity was increased hundredfold using the one-step RT-PCR combined with the nested PCR. Specificity of the PCR was also confirmed using other related canine virus and peripheral blood mononuclear cells (PBMC) and body secretes of healthy dogs. Of the 51 blood samples from dogs clinically suspected of CD, 45 samples were revealed as positive by one-step RT-PCR combined with nested PCR. However, only 15 samples were identified as positive with a single one step RT-PCR. Therefore approximately 60% increase in the efficiency of the diagnosis was observed by the combined method. These results suggested that one step RT-PCR combined with nested PCR could be a sensitive, specific, and practical method for diagnosis of CDV infection.
Muneta, Yoshihiro; Minagawa, Yu; Kusumoto, Masahiro; Shinkai, Hiroki; Uenishi, Hirohide; Splichal, Igor
2012-05-01
In the present study, we have developed an allele-specific primer-polymerase chain reaction (ASP-PCR) for genotyping a single nucleotide polymorphism (SNP) of swine Toll-like receptor 2 (TLR2) (C406G), which is related to the prevalence of pneumonia caused by Mycoplasma hyopneumoniae. We also compared the allele frequency among several pig breeds of Japan and the Czech Republic. Allele-specific primers were constructed by introducing 1-base mismatch sequence before the SNP site. The swine TLR2 C406G mutation was successfully determined by the ASP-PCR using genomic DNA samples in Japan as previously genotyped by a sequencing method. Using the PCR condition determined, genomic DNA samples from pig blood obtained from 110 pigs from 7 different breeds in the Czech Republic were genotyped by the ASP-PCR. The genotyping results from the ASP-PCR were completely matched with the results from the sequencing method. The allele frequency of the swine TLR2 C406G mutation was 27.5% in the Czech Republic and 3.6% in Japan. The C406G mutation was only found in the Landrace breed in Japan, and was almost exclusively found in the Landrace breed in the Czech Republic as well. These results indicated the usefulness of ASP-PCR for detecting a specific SNP for swine TLR2.
Malandraki, Ioanna; Varveri, Christina; Olmos, Antonio; Vassilakos, Nikon
2015-03-01
A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys. Copyright © 2014 Elsevier B.V. All rights reserved.
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bulat, S.A.; Mironenko, N.V.; Zholkevich, Yu.G.
1995-07-01
The genetic structure of three soil populations of fungus Fusarium oxysporum was analyzed using polymerase chain reaction with universal primers (UP-PCR). Distinct UP-PCR variants revealed by means of cross-dot hybridization of amplified DNA and restriction analysis of nuclear ribosomal DNA represent subspecies or sibling species of F. oxysporum. The remaining isolates of F. oxysporum showed moderate UP-PCR polymorphism characterized by numerous types, whose relatedness was analyzed by computer treatment of the UP-PCR patterns. The genetic distance trees based on the UP-PCR patterns, which were obtained with different universal primers, demonstrated similar topology. This suggests that evolutionarily important genome rearrangements correlativelymore » occur within the entire genome. Isolates representing different UP-PCR polymorphisms were encountered in all populations, being distributed asymmetrically in two of these. In general, soil populations of F. oxysporum were represented by numerous genetically isolated groups with a similar genome structure. The genetic heterogeneity of the isolates within these groups is likely to be caused by the parasexual process. The usefulness of the UP-PCR technique for population studies of F. oxysporum was demonstrated. 39 refs., 7 figs., 2 tabs.« less
NASA Astrophysics Data System (ADS)
Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong
2017-02-01
There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.
Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong
2014-06-01
To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.
Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K
2000-06-15
Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.
Nagy, Balint; Nagy, Richard Gyula; Lazar, Levente; Schonleber, Julianna; Papp, Csaba; Rigo, Janos
2015-05-20
Aneuploidies are the most frequent chromosomal abnormalities at birth. Autosomal aneuploidies cause serious malformations like trisomy 21, trisomy 18 and trisomy 13. However sex chromosome aneuploidies are causing less severe syndromes. For the detection of these aneuploidies, the "gold standard" method is the cytogenetic analysis of fetal cells, karyograms show all numerical and structural abnormalities, but it takes 2-4 weeks to get the reports. Molecular biological methods were developed to overcome the long culture time, thus, FISH and quantitative fluorescent PCR were introduced. In this work we show our experience with a commercial kit for the detection of sex chromosome aneuploidies. We analyzed 20.173 amniotic fluid samples for the period of 2006-2013 in our department. A conventional cytogenetic analysis was performed on the samples. We checked the reliability of quantitative fluorescent PCR and DNA fragment analysis on those samples where sex chromosomal aneuploidy was diagnosed. From the 20.173 amniotic fluid samples we found 50 samples with sex chromosome aneuploidy. There were 19 samples showing 46, XO, 17 samples with 46, XXY, 9 samples with 47, XXX and 5 samples with 47, XYY karyotypes. The applied quantitative fluorescent PCR and DNA fragment analyses method are suitable to detect all abnormal sex chromosome aneuploidies. Quantitative fluorescent PCR is a fast and reliable method for detection of sex chromosome aneuploidies. Copyright © 2015. Published by Elsevier B.V.
Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C.; Chorianopoulos, Nikos
2015-01-01
Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry. PMID:26506345
Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos
2015-10-22
Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.
Cho, Min Seok; Joh, Kiseong; Ahn, Tae-Young; Park, Dong Suk
2014-09-01
Escherichia coli serotype O157 is still a major global healthcare problem. However, only limited information is now available on the molecular and serological detection of pathogenic bacteria. Therefore, the development of appropriate strategies for their rapid identification and monitoring is still needed. In general, the sequence analysis based on stx, slt, eae, hlyA, rfb, and fliCh7 genes is widely employed for the identification of E. coli serotype O157; but there have been critical defects in the diagnosis and identification of E. coli serotype O157, in that they are also present in other E. coli serogroups. In this study, NCBI-BLAST searches using the nucleotide sequences of the putative regulatory protein gene from E. coli O157:H7 str. Sakai found sequence difference at the serotype level. The specific primers from the putative regulatory protein gene were designed and investigated for their sensitivity and specificity for detecting the pathogen in environment water samples. The specificity of the primer set was evaluated using genomic DNA from 8 isolates of E. coli serotype O157 and 32 other reference strains. In addition, the sensitivity and specificity of this assay were confirmed by successful identification of E. coli serotype O157 in environmental water samples. In conclusion, this study showed that the newly developed quantitative serotype-specific PCR method is a highly specific and efficient tool for the surveillance and rapid detection of high-risk E. coli serotype O157.
KHATAMI, Mehri; HEIDARI, Mohammad Mehdi; HADADZADEH, Mehdi; SCHEIBER-MOJDEHKAR, Barbara; BITARAF SANI, Morteza; HOUSHMAND, Massoud
2017-01-01
Background: A significant role of Renin-angiotensin system (RAS) genetic variants in the pathogenesis of essential hypertension and cardiovascular diseases has been proved. This study aimed to develop a new, fast and cheap method for the simultaneous detection of two missense single nucleotide polymorphisms (T207M or rs4762 and M268T orrs699) of angiotensinogen (AGT) in single-step Multiplex Hexa-Primer Amplification Refractory Mutation System - polymerase chain reaction (H-ARMS-PCR). Methods: In this case-control study, 148 patients with coronary artery disease (CAD) and 135 controls were included. The patients were referred to cardiac centers in Afshar Hospital (Yazd, Iran) from 2012 to 2015. Two sets of inner primer (for each SNP) and one set outer primer pairs were designed for genotyping of rs4762 and rs699 in single tube H-ARMS-PCR. Direct sequencing of all samples was also performed to assess the accuracy of this method. DNA sequencing method validated the results of single tube H-ARMS-PCR. Results: We found full accordance for genotype adscription by sequencing method. The frequency of the AGT T521 and C702 alleles was significantly higher in CAD patients than in the control group (OR: 0.551, 95% CI: 0.359–0.846, P=0.008 and OR: 0.629, 95% CI: 0.422–0.936, P=0.028, respectively). Conclusion: This is the first work describing a rapid, low-cost, high-throughput simultaneous detection of rs4762 and rs699 polymorphisms in AGT gene, used in large clinical studies. PMID:28828324
Vargas, Diana Y.; Kramer, Fred Russell; Tyagi, Sanjay; Marras, Salvatore A. E.
2016-01-01
We describe the use of “SuperSelective” primers that enable the detection and quantitation of somatic mutations whose presence relates to cancer diagnosis, prognosis, and therapy, in real-time PCR assays that can potentially analyze rare DNA fragments present in blood samples (liquid biopsies). The design of these deoxyribonucleotide primers incorporates both a relatively long “5' anchor sequence” that hybridizes strongly to target DNA fragments, and a very short, physically and functionally separate, “3' foot sequence” that is perfectly complementary to the mutant target sequence, but mismatches the wild-type sequence. As few as ten mutant fragments can reliably be detected in the presence of 1,000,000 wild-type fragments, even when the difference between the mutant and the wild type is only a single nucleotide polymorphism. Multiplex PCR assays employing a set of SuperSelective primers, and a corresponding set of differently colored molecular beacon probes, can be used in situations where the different mutations, though occurring in different cells, are located in the same codon. These non-symmetric real-time multiplex PCR assays contain limited concentrations of each SuperSelective primer, thereby enabling the simultaneous determination of each mutation’s abundance by comparing its threshold value to the threshold value of a reference gene present in the sample. PMID:27244445
Nucleic acid amplification using modular branched primers
Ulanovsky, Levy; Raja, Mugasimangalam C.
2001-01-01
Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Curreli, Francesca; Robles, Monica A; Friedman-Kien, Alvin E; Flore, Ornella
2003-02-01
Kaposi's sarcoma-associated herpesvirus is a novel herpesvirus linked to AIDS-related neoplasms. Currently it is difficult to evaluate the number of virions in viral preparation or in samples obtained from patients with Kaposi's sarcoma (KS), since no protocol for determining the plaque forming units of KSHV exists. We constructed a fragment of a different size than the target viral DNA to carry out a competitive-quantitative PCR. Both fragment and viral DNA were added to a single PCR reaction to compete for the same set of primers. By knowing the amount of the competitor added to the reaction, we could determine the number of viral DNA molecules. We used this assay successfully to detect and quantify KSHV genomes from KS skin biopsies and pleural effusion lymphoma, and from different viral preparations. To date, this is the most convenient and economic method that allows an accurate and fast viral detection/quantitation with a single PCR.
Patel, Pranav; Landt, Olfert; Kaiser, Marco; Faye, Oumar; Koppe, Tanja; Lass, Ulrich; Sall, Amadou A; Niedrig, Matthias
2013-02-14
The genus Flavivirus includes several pathogenic agents that cause severe illness in humans. Re-emergence of West Nile virus in Europe and continuous spread of certain flaviviruses such as dengue, yellow fever and Japanese encephalitis viruses represent a global danger to public health. Therefore, a rapid and accurate molecular method is required for diagnostics and epidemiological surveillance of flaviviruses. A Pan-Flavi quantitative RT-PCR assay using a Locked-Nucleic Acid probe targeting the flavivirus NS5 gene was developed and optimized to detect a wide range of flaviviruses simultaneously. The specificity and sensitivity of the Pan-Flavi assay were tested using RNA of different flaviviruses and non-flaviviruses. Furthermore, the assay was compared directly to flavivirus species-specific assays for the ability to detect flaviviruses sensitively. Two degenerate primers and one Locked-Nucleic Acids probe were designed to amplify most of the flaviviruses. To increase the specificity and fluorescence signal of the Pan-Flavi assay for detection of yellow fever virus and dengue virus 4, additional primers and probes were included. Viral RNA of thirty different flaviviruses was detected, verifying the broad range specificity. The testing of this assay was successful, using standard plasmid and RNA dilutions of yellow fever virus vaccine strain, dengue virus 1 and tick-borne encephalitis virus, with a sensitivity limit of 10-100 genome copies/reaction. Also comparatively good results were achieved for detecting different flaviviruses by the Pan-Flavi assay when compared to the flavivirus species-specific assays. The assay is rapid, broad-range flavivirus-specific and highly sensitive making it a valuable tool for rapid detection of flaviviruses in livestock samples, epidemiological studies or as useful complement to single flavivirus-specific assays for clinical diagnosis.
Ahberg, Christian D.; Manz, Andreas; Neuzil, Pavel
2015-01-01
Since its invention in 1985 the polymerase chain reaction (PCR) has become a well-established method for amplification and detection of segments of double-stranded DNA. Incorporation of fluorogenic probe or DNA intercalating dyes (such as SYBR Green) into the PCR mixture allowed real-time reaction monitoring and extraction of quantitative information (qPCR). Probes with different excitation spectra enable multiplex qPCR of several DNA segments using multi-channel optical detection systems. Here we show multiplex qPCR using an economical EvaGreen-based system with single optical channel detection. Previously reported non quantitative multiplex real-time PCR techniques based on intercalating dyes were conducted once the PCR is completed by performing melting curve analysis (MCA). The technique presented in this paper is both qualitative and quantitative as it provides information about the presence of multiple DNA strands as well as the number of starting copies in the tested sample. Besides important internal control, multiplex qPCR also allows detecting concentrations of more than one DNA strand within the same sample. Detection of the avian influenza virus H7N9 by PCR is a well established method. Multiplex qPCR greatly enhances its specificity as it is capable of distinguishing both haemagglutinin (HA) and neuraminidase (NA) genes as well as their ratio. PMID:26088868
Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao
2016-01-01
The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711
Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.
Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo
2017-05-28
Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.
Comparison of nested PCR and qPCR for the detection and quantitation of BoHV6 DNA.
Kubiś, Piotr; Materniak, Magdalena; Kuźmak, Jacek
2013-12-01
Nested PCR and qPCR (quantitative PCR) tests based on glycoprotein B (gB) gene were designed for detecting Bovine herpesvirus 6 (BoHV6) in bovine whole blood samples and wild ruminant blood clots (deer and roe-deer). This virus, commonly known as BLHV (bovine lymphotropic herpesvirus) belongs to the Herpesviridae family, subfamily Gammaherpesvirinae and Macavirus genus. DNA isolated from 92 dairy cow blood samples and 69 wild ruminant clots were examined for the presence of BoHV6 using nested PCR and qPCR tests. Viral DNA was detected by using nested PCR in 59 out of 92 bovine blood samples (64.1%), and by qPCR in 68 out of 92 bovine blood samples (73.9%), but none out of 69 DNA samples isolated from wild ruminant blood clots, was positive in both assays. The specificity of nested PCR and qPCR was confirmed by using BoHV1, BoHV4, BoHV6, BFV, BIV, and BLV DNA. The sensitivity of nested PCR and qPCR was determined using a serially 10-fold diluted vector pCR2.1HgB (2 × 10(0)-2 × 10(6)copies/reaction). In this testing, qPCR was more sensitive than the nested PCR, detecting two copies of BoHV6 whilst the limit of detection for nested PCR was 20 copies. In all qPCR assays, the coefficients of determination (R(2)) ranged between 0.990 and 0.999, and the calculated amplification efficiencies (Eff%) within the range of 89.7-106.9. The intra- and inter-assay CV (coefficient of variation) values did not exceed 4%. Copyright © 2013 Elsevier B.V. All rights reserved.
Sekhavati, Mohammad H; Mesgaran, Mohsen Danesh; Nassiri, Mohammad R; Mohammadabadi, Tahereh; Rezaii, Farkhondeh; Fani Maleki, Adham
2009-10-01
This paper describes the use of a quantitative competitive polymerase chain reaction (QC-PCR) assay; using PCR primers to the rRNA locus of rumen fungi and a standard-control DNA including design and validation. In order to test the efficiency of this method for quantifying anaerobic rumen fungi, it has been attempted to evaluate this method in in vitro conditions by comparing with an assay based on measuring cell wall chitin. The changes in fungal growth have been studied when they are grown in in vitro on either untreated (US) or sodium hydroxide treated wheat straw (TS). Results showed that rumen fungi growth was significantly higher in treated samples compared with untreated during the 12d incubation (P<0.05) and plotting the chitin assay's results against the competitive PCR's showed high positive correlation (R(2)> or =0.87). The low mean values of the coefficients of variance in repeatability in the QC-PCR method against the chitin assay demonstrated more reliability of this new approach. And finally, the efficiency of this method was investigated in in vivo conditions. Samples of rumen fluid were collected from four fistulated Holstein steers which were fed four different diets (basal diet, high starch, high sucrose and starch plus sucrose) in rotation. The results of QC-PCR showed that addition of these non-structural carbohydrates to the basal diets caused a significant decrease in rumen anaerobic fungi biomass. The QC-PCR method appears to be a reliable and can be used for rumen samples.
Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M
2016-06-01
Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.
Real-time PCR for rapidly detecting aniline-degrading bacteria in activated sludge.
Kayashima, Takakazu; Suzuki, Hisako; Maeda, Toshinari; Ogawa, Hiroaki I
2013-05-01
We developed a detection method that uses quantitative real-time PCR (qPCR) and the TaqMan system to easily and rapidly assess the population of aniline-degrading bacteria in activated sludge prior to conducting a biodegradability test on a chemical compound. A primer and probe set for qPCR was designed by a multiple alignment of conserved amino acid sequences encoding the large (α) subunit of aniline dioxygenase. PCR amplification tests showed that the designed primer and probe set targeted aniline-degrading strains such as Acidovorax sp., Gordonia sp., Rhodococcus sp., and Pseudomonas putida, thereby suggesting that the developed method can detect a wide variety of aniline-degrading bacteria. There was a strong correlation between the relative copy number of the α-aniline dioxygenase gene in activated sludge obtained with the developed qPCR method and the number of aniline-degrading bacteria measured by the Most Probable Number method, which is the conventional method, and a good correlation with the lag time of the BOD curve for aniline degradation produced by the biodegradability test in activated sludge samples collected from eight different wastewater treatment plants in Japan. The developed method will be valuable for the rapid and accurate evaluation of the activity of inocula prior to conducting a ready biodegradability test. Copyright © 2013 Elsevier Ltd. All rights reserved.
Design and optimization of reverse-transcription quantitative PCR experiments.
Tichopad, Ales; Kitchen, Rob; Riedmaier, Irmgard; Becker, Christiane; Ståhlberg, Anders; Kubista, Mikael
2009-10-01
Quantitative PCR (qPCR) is a valuable technique for accurately and reliably profiling and quantifying gene expression. Typically, samples obtained from the organism of study have to be processed via several preparative steps before qPCR. We estimated the errors of sample withdrawal and extraction, reverse transcription (RT), and qPCR that are introduced into measurements of mRNA concentrations. We performed hierarchically arranged experiments with 3 animals, 3 samples, 3 RT reactions, and 3 qPCRs and quantified the expression of several genes in solid tissue, blood, cell culture, and single cells. A nested ANOVA design was used to model the experiments, and relative and absolute errors were calculated with this model for each processing level in the hierarchical design. We found that intersubject differences became easily confounded by sample heterogeneity for single cells and solid tissue. In cell cultures and blood, the noise from the RT and qPCR steps contributed substantially to the overall error because the sampling noise was less pronounced. We recommend the use of sample replicates preferentially to any other replicates when working with solid tissue, cell cultures, and single cells, and we recommend the use of RT replicates when working with blood. We show how an optimal sampling plan can be calculated for a limited budget. .
Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing
2018-05-12
Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.
Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Uehara, Masayuki; Sugano, Mitsutoshi; Okumura, Nobuo; Honda, Takayuki
2015-05-20
Chimerism analysis is important for the evaluation of engraftment and predicting relapse following hematopoietic stem cell transplantation (HSCT). We developed a chimerism analysis for single nucleotide polymorphisms (SNPs), including rapid screening of the discriminable donor/recipient alleles using droplet allele-specific PCR (droplet-AS-PCR) pre-HSCT and quantitation of recipient DNA using AS-quantitative PCR (AS-qPCR) following HSCT. SNP genotyping of 20 donor/recipient pairs via droplet-AS-PCR and the evaluation of the informativity of 5 SNP markers for chimerism analysis were performed. Samples from six follow-up patients were analyzed to assess the chimerism via AS-qPCR. These results were compared with that determined by short tandem repeat PCR (STR-PCR). Droplet-AS-PCR could determine genotypes within 8min. The total informativity using all 5 loci was 95% (19/20). AS-qPCR provided the percentage of recipient DNA in all 6 follow-up patients without influence of the stutter peak or the amplification efficacy, which affected the STR-PCR results. The droplet-AS-PCR had an advantage over STR-PCR in terms of rapidity and simplicity for screening before HSCT. Furthermore, AS-qPCR had better accuracy than STR-PCR for quantification of recipient DNA following HSCT. The present chimerism assay compensates for the disadvantages of STR-PCR and is readily performable in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.
A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.
Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu
2013-03-11
Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.
Abdeldaim, G; Herrmann, B; Korsgaard, J; Olcén, P; Blomberg, J; Strålin, K
2009-06-01
The pneumolysin (ply) gene is widely used as a target in PCR assays for Streptococcus pneumoniae in respiratory secretions. However, false-positive results with conventional ply-based PCR have been reported. The aim here was to study the performance of a quantitative ply-based PCR for the identification of pneumococcal lower respiratory tract infection (LRTI). In a prospective study, fibreoptic bronchoscopy was performed in 156 hospitalized adult patients with LRTI and 31 controls who underwent bronchoscopy because of suspicion of malignancy. Among the LRTI patients and controls, the quantitative ply-based PCR applied to bronchoalveolar lavage (BAL) fluid was positive at >or=10(3) genome copies/mL in 61% and 71% of the subjects, at >or=10(5) genome copies/mL in 40% and 58% of the subjects, and at >or=10(7) genome copies/mL in 15% and 3.2% of the subjects, respectively. Using BAL fluid culture, blood culture, and/or a urinary antigen test, S. pneumoniae was identified in 19 LRTI patients. As compared with these diagnostic methods used in combination, quantitative ply-based PCR showed sensitivities and specificities of 89% and 43% at a cut-off of 10(3) genome copies/mL, of 84% and 66% at a cut-off of 10(5) genome copies/mL, and of 53% and 90% at a cut-off of 10(7) genome copies/mL, respectively. In conclusion, a high cut-off with the quantitative ply-based PCR was required to reach acceptable specificity. However, as a high cut-off resulted in low sensitivity, quantitative ply-based PCR does not appear to be clinically useful. Quantitative PCR methods for S. pneumoniae using alternative gene targets should be evaluated.
Szatmari, I; Tókés, S; Dunn, C B; Bardos, T J; Aradi, J
2000-06-15
A polymerase chain reaction (PCR)-based radioactive telomerase assay was developed in our laboratory which is quantitative and does not require electrophoretic evaluation (designated as TP-TRAP; it utilizes two reverse primers). The main steps of the assay include (1) extension of a 20-mer oligonucleotide substrate (MTS) by telomerase, (2) amplification of the telomerase products in the presence of [(3)H]dTTP using the substrate oligonucleotide and two reverse primers (RPC3, 38 mer; RP, 20 mer), (3) isolation of the amplified radioactive dsDNA by precipitation and filtration, (4) determination of the radioactivity of the acid-insoluble DNA. The length of the telomerase products does not increase on amplification. This valuable feature of the assay is achieved by utilization of the two reverse primers and a highly specific PCR protocol. The assay is linear, accurate, and suitable for cell-biological studies where slight quantitative differences in telomerase activity must be detected. The assay is also suitable for screening and characterization of telomerase inhibitors, as shown with a chemically modified oligonucleotide reverse transcriptase inhibitor [(s(4)dU)(35)]. Copyright 2000 Academic Press.
NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs.
Morisset, Dany; Dobnik, David; Hamels, Sandrine; Zel, Jana; Gruden, Kristina
2008-10-01
We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1-25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification.
NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs
Morisset, Dany; Dobnik, David; Hamels, Sandrine; Žel, Jana; Gruden, Kristina
2008-01-01
We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1–25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification. PMID:18710880
Zhang, Haibo; Yang, Litao; Guo, Jinchao; Li, Xiang; Jiang, Lingxi; Zhang, Dabing
2008-07-23
To enforce the labeling regulations of genetically modified organisms (GMOs), the application of reference molecules as calibrators is becoming essential for practical quantification of GMOs. However, the reported reference molecules with tandem marker multiple targets have been proved not suitable for duplex PCR analysis. In this study, we developed one unique plasmid molecule based on one pMD-18T vector with three exogenous target DNA fragments of Roundup Ready soybean GTS 40-3-2 (RRS), that is, CaMV35S, NOS, and RRS event fragments, plus one fragment of soybean endogenous Lectin gene. This Lectin gene fragment was separated from the three exogenous target DNA fragments of RRS by inserting one 2.6 kb DNA fragment with no relatedness to RRS detection targets in this resultant plasmid. Then, we proved that this design allows the quantification of RRS using the three duplex real-time PCR assays targeting CaMV35S, NOS, and RRS events employing this reference molecule as the calibrator. In these duplex PCR assays, the limits of detection (LOD) and quantification (LOQ) were 10 and 50 copies, respectively. For the quantitative analysis of practical RRS samples, the results of accuracy and precision were similar to those of simplex PCR assays, for instance, the quantitative results were at the 1% level, the mean bias of the simplex and duplex PCR were 4.0% and 4.6%, respectively, and the statistic analysis ( t-test) showed that the quantitative data from duplex and simplex PCR had no significant discrepancy for each soybean sample. Obviously, duplex PCR analysis has the advantages of saving the costs of PCR reaction and reducing the experimental errors in simplex PCR testing. The strategy reported in the present study will be helpful for the development of new reference molecules suitable for duplex PCR quantitative assays of GMOs.
NASA Astrophysics Data System (ADS)
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Enumeration of verocytotoxigenic Escherichia coli (VTEC) O157 and O26 in milk by quantitative PCR.
Mancusi, Rocco; Trevisani, Marcello
2014-08-01
Quantitative real-time polymerase chain reaction (qPCR) can be a convenient alternative to the Most Probable Number (MPN) methods to count VTEC in milk. The number of VTEC is normally very low in milk; therefore with the aim of increasing the method sensitivity a qPCR protocol that relies on preliminary enrichment was developed. The growth pattern of six VTEC strains (serogroups O157 and O26) was studied using enrichment in Buffered Peptone Water (BPW) with or without acriflavine for 4-24h. Milk samples were inoculated with these strains over a five Log concentration range between 0.24-0.50 and 4.24-4.50 Log CFU/ml. DNA was extracted from the enriched samples in duplicate and each extract was analysed in duplicate by qPCR using pairs of primers specific for the serogroups O157 and O26. When samples were pre-enriched in BPW at 37°C for 8h, the relationship between threshold cycles (CT values) and VTEC Log numbers was linear over a five Log concentration range. The regression of PCR threshold cycle numbers on VTEC Log CFU/ml had a slope coefficient equal to -3.10 (R(2)=0.96) which is indicative of a 10-fold difference of the gene copy numbers between samples (with a 100 ± 10% PCR efficiency). The same 10-fold proportion used for inoculating the milk samples with VTEC was observed, therefore, also in the enriched samples at 8h. A comparison of the CT values of milk samples and controls revealed that the strains inoculated in milk grew with 3 Log increments in the 8h enrichment period. Regression lines that fitted the qPCR and MPN data revealed that the error of the qPCR estimates is lower than the error of the estimated MPN (r=0.982, R(2)=0.965 vs. r=0.967, R(2)=0.935). The growth rates of VTEC strains isolated from milk should be comparatively assessed before qPCR estimates based on the regression model are considered valid. Comparative assessment of the growth rates can be done using spectrophotometric measurements of standardized cultures of isolates and
Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies
Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.
2014-01-01
Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
NASA Astrophysics Data System (ADS)
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
[A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].
Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan
2015-04-01
To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.
Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A
2016-10-01
Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent
MOLD SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS
Today I will talk about the use of quantitative or Real time PCR for the standardized identification and quantification of molds. There are probably at least 100,000 species of molds or fungi. But there are actually about 100 typically found indoors. Some pose a threat to human...
Devonshire, Alison S; O'Sullivan, Denise M; Honeyborne, Isobella; Jones, Gerwyn; Karczmarczyk, Maria; Pavšič, Jernej; Gutteridge, Alice; Milavec, Mojca; Mendoza, Pablo; Schimmel, Heinz; Van Heuverswyn, Fran; Gorton, Rebecca; Cirillo, Daniela Maria; Borroni, Emanuele; Harris, Kathryn; Barnard, Marinus; Heydenrych, Anthenette; Ndusilo, Norah; Wallis, Carole L; Pillay, Keshree; Barry, Thomas; Reddington, Kate; Richter, Elvira; Mozioğlu, Erkan; Akyürek, Sema; Yalçınkaya, Burhanettin; Akgoz, Muslum; Žel, Jana; Foy, Carole A; McHugh, Timothy D; Huggett, Jim F
2016-08-03
Real-time PCR (qPCR) based methods, such as the Xpert MTB/RIF, are increasingly being used to diagnose tuberculosis (TB). While qualitative methods are adequate for diagnosis, the therapeutic monitoring of TB patients requires quantitative methods currently performed using smear microscopy. The potential use of quantitative molecular measurements for therapeutic monitoring has been investigated but findings have been variable and inconclusive. The lack of an adequate reference method and reference materials is a barrier to understanding the source of such disagreement. Digital PCR (dPCR) offers the potential for an accurate method for quantification of specific DNA sequences in reference materials which can be used to evaluate quantitative molecular methods for TB treatment monitoring. To assess a novel approach for the development of quality assurance materials we used dPCR to quantify specific DNA sequences in a range of prototype reference materials and evaluated accuracy between different laboratories and instruments. The materials were then also used to evaluate the quantitative performance of qPCR and Xpert MTB/RIF in eight clinical testing laboratories. dPCR was found to provide results in good agreement with the other methods tested and to be highly reproducible between laboratories without calibration even when using different instruments. When the reference materials were analysed with qPCR and Xpert MTB/RIF by clinical laboratories, all laboratories were able to correctly rank the reference materials according to concentration, however there was a marked difference in the measured magnitude. TB is a disease where the quantification of the pathogen could lead to better patient management and qPCR methods offer the potential to rapidly perform such analysis. However, our findings suggest that when precisely characterised materials are used to evaluate qPCR methods, the measurement result variation is too high to determine whether molecular quantification
Detection of group a streptococcal pharyngitis by quantitative PCR.
Dunne, Eileen M; Marshall, Julia L; Baker, Ciara A; Manning, Jayne; Gonis, Gena; Danchin, Margaret H; Smeesters, Pierre R; Satzke, Catherine; Steer, Andrew C
2013-07-11
Group A streptococcus (GAS) is the most common bacterial cause of sore throat. School-age children bear the highest burden of GAS pharyngitis. Accurate diagnosis is difficult: the majority of sore throats are viral in origin, culture-based identification of GAS requires 24-48 hours, and up to 15% of children are asymptomatic throat carriers of GAS. The aim of this study was to develop a quantitative polymerase chain reaction (qPCR) assay for detecting GAS pharyngitis and assess its suitability for clinical diagnosis. Pharyngeal swabs were collected from children aged 3-18 years (n = 91) and adults (n = 36) located in the Melbourne area who presented with sore throat. Six candidate PCR assays were screened using a panel of reference isolates, and two of these assays, targeting speB and spy1258, were developed into qPCR assays. The qPCR assays were compared to standard culture-based methods for their ability to detect GAS pharyngitis. GAS isolates from culture positive swabs underwent emm-typing. Clinical data were used to calculate McIsaac scores as an indicator of disease severity. Twenty-four of the 127 samples (18.9%) were culture-positive for GAS, and all were in children (26%). The speB qPCR had 100% sensitivity and 100% specificity compared with gold-standard culture, whereas the spy1258 qPCR had 87% sensitivity and 100% specificity. Nine different emm types were found, of which emm 89, 3, and 28 were most common. Bacterial load as measured by qPCR correlated with culture load. There were no associations between symptom severity as indicated by McIsaac scores and GAS bacterial load. The speB qPCR displayed high sensitivity and specificity and may be a useful tool for GAS pharyngitis diagnosis and research.
Detection of Bacillus spores using PCR and FTA filters.
Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A
2004-05-01
Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.
Ohtsubo, Ken'ichi; Suzuki, Keitaro; Haraguchi, Kazutomo; Nakamura, Sumiko
2008-04-24
As many rice wine brewers label the name of the cultivar of the material rice, authentication technology is necessary. The problems are (1) decomposition of DNAs during the fermentation, (2) contamination of DNAs from microorganisms, (3) co-existence of PCR inhibitors, such as polyphenols. The present authors improved the PCR method by (1) lyophilizing and pulverizing the rice wine to concentrate DNAs, (2) decomposition of starches and proteins so as not to inhibit DNA extraction by the use of heat-resistant amylase and proteinase K, (3) purification of the template DNA by the combination of CTAB method and fractional precipitation by 70% EtOH. To prevent the amplification of microorganism's DNAs during PCR, the present authors selected the suitable plant-specific primers. It became possible to prepare the template DNAs for PCR from the rice wine. The sequences of the amplified DNAs by PCR were ascertained to be same with those of material rice. Mislabeling of material rice cultivar was detected by PCR using the commercial rice wine. It became possible to extract and purify the template DNAs for PCR from the rice wine and to differentiate the material rice cultivars by the PCR using the rice wine as a sample.
Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko
2005-01-01
PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.
Quantitation of Porcine Cytomegalovirus in Pig Tissues by PCR
Fryer, Jacqueline F. L.; Griffiths, Paul D.; Fishman, Jay A.; Emery, Vincent C.; Clark, Duncan A.
2001-01-01
A quantitative-competitive PCR for the quantification of porcine cytomegalovirus (PCMV) was developed. The virus was detected in a variety of pig organs (including potential xenotransplant donations), with viral loads ranging from <10 to 97 genome copies/μg of DNA. This assay will have significant utility for studying the activation and replication of PCMV and in swine models for allo- and xenotransplantation. PMID:11230447
Carrillo-Casas, Erika Margarita; Hernández-Castro, Rigoberto; Suárez-Güemes, Francisco; de la Peña-Moctezuma, Alejandro
2008-06-01
Analysis of gene expression requires sensitive, precise, and reproducible measurements for specific mRNA sequences. To avoid bias, real-time RT-PCR is referred to one or several internal control genes. Here, we sought to identify a gene to be used as normalizer by analyzing three functional distinct housekeeping genes (lipL41, flaB, and 16S rRNA) for their expression level and stability in temperature treated Leptospira cultures. Leptospira interrogans serovar Hardjo subtype Hardjoprajitno was cultured at 30 degrees C for 7 days until a density of 10(6) cells/ml was reached and then shifted to physiological temperatures (37 degrees C and 42 degrees C) and to environmental temperatures (25 degrees C and 30 degrees C) during a 24 h period. cDNA was amplified by quantitative PCR using SYBR Green I technology and gene-specific primers for lipL41, flaB, and 16S rRNA. Expression stability (M) was assessed by geNorm and Normfinder v.18. 16S rRNA registered an average expression stability of M = 1.1816, followed by flaB (M = 1.682) and lipL41 (M = 1.763). 16S rRNA was identified as the most stable gene and can be used as a normalizer, as it showed greater expression stability than lipL41 and flaB in the four temperature treatments. Hence, comparisons of gene expression will have a higher sensitivity and specificity.
A Versatile Panel of Reference Gene Assays for the Measurement of Chicken mRNA by Quantitative PCR
Maier, Helena J.; Van Borm, Steven; Young, John R.; Fife, Mark
2016-01-01
Quantitative real-time PCR assays are widely used for the quantification of mRNA within avian experimental samples. Multiple stably-expressed reference genes, selected for the lowest variation in representative samples, can be used to control random technical variation. Reference gene assays must be reliable, have high amplification specificity and efficiency, and not produce signals from contaminating DNA. Whilst recent research papers identify specific genes that are stable in particular tissues and experimental treatments, here we describe a panel of ten avian gene primer and probe sets that can be used to identify suitable reference genes in many experimental contexts. The panel was tested with TaqMan and SYBR Green systems in two experimental scenarios: a tissue collection and virus infection of cultured fibroblasts. GeNorm and NormFinder algorithms were able to select appropriate reference gene sets in each case. We show the effects of using the selected genes on the detection of statistically significant differences in expression. The results are compared with those obtained using 28s ribosomal RNA, the present most widely accepted reference gene in chicken work, identifying circumstances where its use might provide misleading results. Methods for eliminating DNA contamination of RNA reduced, but did not completely remove, detectable DNA. We therefore attached special importance to testing each qPCR assay for absence of signal using DNA template. The assays and analyses developed here provide a useful resource for selecting reference genes for investigations of avian biology. PMID:27537060
Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.
Pegels, N; González, I; Fernández, S; García, T; Martín, R
2012-01-01
A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.
MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool
Zhou, Quan
2017-01-01
An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876
A multiple-alignment based primer design algorithm for genetically highly variable DNA targets
2013-01-01
Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160
Human papillomavirus detection and typing using a nested-PCR-RFLP assay.
Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo
2011-01-01
It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.
Quantification of hookworm ova from wastewater matrices using quantitative PCR.
Gyawali, Pradip; Ahmed, Warish; Sidhu, Jatinder P; Jagals, Paul; Toze, Simon
2017-07-01
A quantitative PCR (qPCR) assay was used to quantify Ancylostoma caninum ova in wastewater and sludge samples. We estimated the average gene copy numbers for a single ovum using a mixed population of ova. The average gene copy numbers derived from the mixed population were used to estimate numbers of hookworm ova in A. caninum seeded and unseeded wastewater and sludge samples. The newly developed qPCR assay estimated an average of 3.7×10 3 gene copies per ovum, which was then validated by seeding known numbers of hookworm ova into treated wastewater. The qPCR estimated an average of (1.1±0.1), (8.6±2.9) and (67.3±10.4) ova for treated wastewater that was seeded with (1±0), (10±2) and (100±21) ova, respectively. The further application of the qPCR assay for the quantification of A. caninum ova was determined by seeding a known numbers of ova into the wastewater matrices. The qPCR results indicated that 50%, 90% and 67% of treated wastewater (1L), raw wastewater (1L) and sludge (~4g) samples had variable numbers of A. caninum gene copies. After conversion of the qPCR estimated gene copy numbers to ova for treated wastewater, raw wastewater, and sludge samples, had an average of 0.02, 1.24 and 67 ova, respectively. The result of this study indicated that qPCR can be used for the quantification of hookworm ova from wastewater and sludge samples; however, caution is advised in interpreting qPCR generated data for health risk assessment. Copyright © 2017. Published by Elsevier B.V.
Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M
2017-01-01
This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .
A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...
Moriyama, Moriyama; Taira, Masaaki; Matsumura, Hiroshi; Aoki, Hiroshi; Mikuni, Morio; Kaneko, Miki; Shioda, Atsuo; Iwaguchi, Kayo; Arai, Shinobu; Ichijima, Sagiri; Iwasaki, Hiroko; Tanaka, Naohide; Abe, Kenji; Arakawa, Yasuyuki
2003-01-01
The aims of this study were to determine the hepatitis B virus (HBV) genotypes in hepatitis delta virus (HDV) RNA-positive patients and to characterize the HBV nucleotide sequences that may be found on a distant island of Japan. This study included three patients with chronic hepatitis who were positive for hepatitis B surface antigen (enzyme-linked immunosorbent assay; ELISA), HDV antibody (ELISA) and HDV RNA by polymerase chain reaction (PCR). The HBV genotype was determined by nested PCR using type-specific primers. The first-round PCR products from two patients were sequenced, followed by an investigation of nucleotide homology. Viruses from all three patients in this study were classified as HBV genotype B. Comparison with HBV isolates from geographically neighboring regions revealed that the two HBV isolates had 97.9-98.6% identity at the nucleotide level to a Chinese isolate, 98.3-98.6% identity to the Okinawa isolate and 98.6-98.8% identity to a Japanese isolate of genotype B. On phylogenetic analysis, the HBV isolates from the two patients were classified as HBV genotype B. The HBV isolates of cases 1 and 3 clustered in the same group as isolates from the Chinese mainland and Japanese mainland, which are geographically near Miyako Island. The HBV isolates coinfected with HDV found on Miyako Island were of genotype B. The PCR method based on genotype-specific primers was useful in determining HBV genotypes. Copyright 2003 S. Karger AG, Basel
Gonzales, J L; Loza, A; Chacon, E
2006-03-15
There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.
2009-09-01
Legionella Pneumophila (ATCC 33152) were acquired from the American Type Culture Collection (ATCC; Manassas, VA, USA). Conventional PCR testing The primers... Legionella Pneumophila – One nanogram of genomic DNA was used as a DNA template in each assay. Assays were performed in triplicate. Samples were negative at
Evaluation of PCR methods for detection of Brucella strains from culture and tissues.
Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar
2017-04-01
The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Lina
2013-02-01
Cronobacter sakazakii and its phylogenetically closest species are considered to be an opportunistic pathogens associated with food-borne disease in neonates and infants. Neither phenotypic nor genotypic (16S ribosomal DNA sequence analysis) techniques can provide sufficient resolutions for accurately and rapidly identification of these species. The objective of this study was to develop species-specific PCR based on the gyrB gene sequence for direct species identification of the C. sakazakii and Cronobacter dublinensis within the C. sakazakii group. Two pair of species-specific primers were designed and used to specifically identify C. sakazakii and C. dublinensis, but none of the other C. sakazakii group strains. Our data indicate that the novel species-specific primers could be used to rapidly and accurately identify the species of C. sakazakii and C. dublinensis from C. sakazakii group by the PCR based assays. Copyright © 2012 Elsevier Ltd. All rights reserved.
Identification of root rot fungi in nursery seedlings by nested multiplex PCR.
Hamelin, R C; Bérubé, P; Gignac, M; Bourassa, M
1996-01-01
The internal transcribed spacer (ITS) of the ribosomal DNA (rDNA) subunit repeat was sequenced in 12 isolates of Cylindrocladium floridanum and 11 isolates of Cylindrocarpon destructans. Sequences were aligned and compared with ITS sequences of other fungi in GenBank. Some intraspecific variability was present within our collections of C. destructans but not in C. floridanum. Three ITS variants were identified within C. destructans, but there was no apparent association between ITS variants and host or geographic origin. Two internal primers were synthesized for the specific amplification of portions of the ITS for C. floridanum, and two primers were designed to amplify all three variants of C. destructans. The species-specific primers amplified PCR products of the expected length when tested with cultures of C, destructans and C. floridanum from white spruce, black spruce, Norway spruce, red spruce, jack pine, red pine, and black walnut from eight nurseries and three plantations in Quebec. No amplification resulted from PCR reactions on fungal DNA from 26 common contaminants of conifer roots. For amplifications directly from infected tissues, a nested primer PCR using two rounds of amplification was combined with multiplex PCR approach resulting in the amplification of two different species-specific PCR fragments in the same reaction. First, the entire ITS was amplified with one universal primer and a second primer specific to fungi; a second round of amplification was carried out with species-specific primers that amplified a 400-bp PCR product from C. destructans and a 328-bp product from C. floridanum. The species-specific fragments were amplified directly from infected roots from which one or the two fungi had been isolated. PMID:8899993
Aims: To determine the performance of a rapid, real time polymerase chain reaction (PCR) method for the detection and quantitative analysis Helicobacter pylori at low concentrations in drinking water.
Methods and Results: A rapid DNA extraction and quantitative PCR (QPCR)...
Plastid primers for angiosperm phylogenetics and phylogeography.
Prince, Linda M
2015-06-01
PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.
Analysis of artifacts suggests DGGE should not be used for quantitative diversity analysis.
Neilson, Julia W; Jordan, Fiona L; Maier, Raina M
2013-03-01
PCR-denaturing gradient gel electrophoresis (PCR-DGGE) is widely used in microbial ecology for the analysis of comparative community structure. However, artifacts generated during PCR-DGGE of mixed template communities impede the application of this technique to quantitative analysis of community diversity. The objective of the current study was to employ an artificial bacterial community to document and analyze artifacts associated with multiband signatures and preferential template amplification and to highlight their impacts on the use of this technique for quantitative diversity analysis. Six bacterial species (three Betaproteobacteria, two Alphaproteobacteria, and one Firmicutes) were amplified individually and in combinations with primers targeting the V7/V8 region of the 16S rRNA gene. Two of the six isolates produced multiband profiles demonstrating that band number does not correlate directly with α-diversity. Analysis of the multiple bands from one of these isolates confirmed that both bands had identical sequences which lead to the hypothesis that the multiband pattern resulted from two distinct structural conformations of the same amplicon. In addition, consistent preferential amplification was demonstrated following pairwise amplifications of the six isolates. DGGE and real time PCR analysis identified primer mismatch and PCR inhibition due to 16S rDNA secondary structure as the most probable causes of preferential amplification patterns. Reproducible DGGE community profiles generated in this study confirm that PCR-DGGE provides an excellent high-throughput tool for comparative community structure analysis, but that method-specific artifacts preclude its use for accurate comparative diversity analysis. Copyright © 2013 Elsevier B.V. All rights reserved.
TipMT: Identification of PCR-based taxon-specific markers.
Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C
2017-02-11
Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .
HSV2 acute retinal necrosis: diagnosis and monitoring with quantitative polymerase chain reaction.
Cottet, L; Kaiser, L; Hirsch, H H; Baglivo, E
2009-06-01
To describe a case of HSV2 acute retinal necrosis (ARN) diagnosed and monitored with quantitative polymerase chain reaction (PCR) in ocular fluids. Case report. Quantitative PCR was performed in the aqueous humor (AH) and vitreous using primers specific for herpes virus. A positive PCR was found for HSV2 in the AH (>100,000,000 viral copies - 8.00 log/ml). After therapy, another anterior chamber tap showed a reduction of the viral load at 4.28 log/ml (19205 copies), confirming the efficacy of the treatment. After six months, PCR on the vitreous still showed the presence of HSV2 viral particles in the eye (3.14 log DNA copies/ml, 1379 copies) although the lesion was healed. This case demonstrates that PCR is useful to detect viral DNA in AH and vitreous and to monitor viral activity and therapeutic response. Viral DNA persists in ocular fluids for months in the presence of a healed infection.
Wang, Xiaoyu; Seo, Dong Joo; Lee, Min Hwa
2014-01-01
This study aimed to develop a loop-mediated isothermal amplification (LAMP) method for the rapid detection of Arcobacter species. Specific primers targeting the 23S ribosomal RNA gene were used to detect Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii. The specificity of the LAMP primer set was assessed using DNA samples from a panel of Arcobacter and Campylobacter species, and the sensitivity was determined using serial dilutions of Arcobacter species cultures. LAMP showed a 10- to 1,000-fold-higher sensitivity than multiplex PCR, with a detection limit of 2 to 20 CFU per reaction in vitro. Whereas multiplex PCR showed cross-reactivity with Campylobacter species, the LAMP method developed in this study was more sensitive and reliable than conventional PCR or multiplex PCR for the detection of Arcobacter species. PMID:24478488
A real-time quantitative PCR (qPCR) method and a modification of this method incorporating pretreatment of samples with propidium monoazide (PMA) were evaluated for respective analyses of total and presumptively viable Enterococcus and Bacteroidales fecal indicator bacteria. Thes...
García, Margarita; Esteve-Zarzoso, Braulio; Crespo, Julia; Cabellos, Juan M; Arroyo, Teresa
2017-01-01
There is an increasing trend toward understanding the impact of non- Saccharomyces yeasts on the winemaking process. Although Saccharomyces cerevisiae is the predominant species at the end of fermentation, it has been recognized that the presence of non- Saccharomyces species during alcoholic fermentation can produce an improvement in the quality and complexity of the final wines. A previous work was developed for selecting the best combinations between S. cerevisiae and five non- Saccharomyces ( Torulaspora delbrueckii, Schizosaccharomyces pombe, Candida stellata, Metschnikowia pulcherrima , and Lachancea thermotolorans ) native yeast strains from D.O. "Vinos de Madrid" at the laboratory scale. The best inoculation strategies between S. cerevisiae and non- Saccharomyces strains were chosen to analyze, by real-time quantitative PCR (qPCR) combined with the use of specific primers, the dynamics of inoculated populations throughout the fermentation process at the pilot scale using the Malvar white grape variety. The efficiency of the qPCR system was verified independently of the samples matrix, founding the inoculated yeast species throughout alcoholic fermentation. Finally, we can validate the positive effect of selected co-cultures in the Malvar wine quality, highlighting the sequential cultures of T. delbrueckii CLI 918/ S. cerevisiae CLI 889 and C. stellata CLI 920/ S. cerevisiae CLI 889 and, mixed and sequential cultures of L. thermotolerans 9-6C combined with S. cerevisiae CLI 889.
Bruckert, G; Vivien, D; Docagne, F; Roussel, B D
2016-04-01
Reverse transcription quantitative-polymerase chain reaction (RT-qPCR) has become a routine method in many laboratories. Normalization of data from experimental conditions is critical for data processing and is usually achieved by the use of a single reference gene. Nevertheless, as pointed by the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines, several reference genes should be used for reliable normalization. Ageing is a physiological process that results in a decline of many expressed genes. Reliable normalization of RT-qPCR data becomes crucial when studying ageing. Here, we propose a RT-qPCR study from four mouse brain regions (cortex, hippocampus, striatum and cerebellum) at different ages (from 8 weeks to 22 months) in which we studied the expression of nine commonly used reference genes. With the use of two different algorithms, we found that all brain structures need at least two genes for a good normalization step. We propose specific pairs of gene for efficient data normalization in the four brain regions studied. These results underline the importance of reliable reference genes for specific brain regions in ageing.
Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S
2017-06-01
Accurate quantitative measurement of viable hookworm ova from environmental samples is the key to controlling hookworm re-infections in the endemic regions. In this study, the accuracy of three quantitative detection methods [culture-based, vital stain and propidium monoazide-quantitative polymerase chain reaction (PMA-qPCR)] was evaluated by enumerating 1,000 ± 50 Ancylostoma caninum ova in the laboratory. The culture-based method was able to quantify an average of 397 ± 59 viable hookworm ova. Similarly, vital stain and PMA-qPCR methods quantified 644 ± 87 and 587 ± 91 viable ova, respectively. The numbers of viable ova estimated by the culture-based method were significantly (P < 0.05) lower than vital stain and PMA-qPCR methods. Therefore, both PMA-qPCR and vital stain methods appear to be suitable for the quantitative detection of viable hookworm ova. However, PMA-qPCR would be preferable over the vital stain method in scenarios where ova speciation is needed.
Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR
Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo
2005-01-01
A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001
Benga, Laurentiu; Benten, W Peter M; Engelhardt, Eva; Gougoula, Christina; Sager, Martin
2013-08-01
[Actinobacillus] muris represents along with [Pasteurella] pneumotropica the most prevalent Pasteurellaceae species isolated from the laboratory mouse. Despite the biological and economic importance of Pasteurellaceae in relation to experimental animals, no molecular based methods for the identification of [A.] muris are available. The aim of the present investigation was to develop a PCR method allowing detection and identification of [A.] muris. In this assay, a Pasteurellaceae common forward primer based on a conserved region of the 16S rRNA gene was used in conjunction with two different reverse primers specific for [A.] muris, targeting the 16S-23S internal transcribed spacer sequences. The specificity of the assay was tested against 78 reference and clinical isolates of Pasteurellaceae, including 37 strains of [A.] muris. In addition, eight other mice associated bacterial species which could pose a diagnostic problem were included. The assay showed 100% sensitivity and 97.95% specificity. Identification of the clinical isolates was validated by ITS profiling and when necessary by 16S rRNA sequencing. This multiplex PCR represents the first molecular tool able to detect [A.] muris and may become a reliable alternative to the present diagnostic methods. Copyright © 2013 Elsevier B.V. All rights reserved.
QUANTITATIVE PCR ANALYSIS OF HOUSE DUST CAN REVEAL ABNORMAL MOLD CONDITIONS
Indoor mold populations were measured in the dust of homes in Cleveland and Cincinnati, OH, by quantitative PCR (QPCR) and, in Cincinnati, also by culturing. QPCR assays for 82 species (or groups of species) were used to identify and quantify indoor mold populations in moldy home...
Li, Wenli; Drake, Mary Anne
2001-01-01
A quantitative competitive PCR (QC-PCR) assay was developed to detect and quantify Escherichia coli O157:H7 cells. From 103 to 108 CFU of E. coli O157:H7 cells/ml was quantified in broth or skim milk, and cell densities predicted by QC-PCR were highly related to viable cell counts (r2 = 0.99 and 0.93, respectively). QC-PCR has potential for quantitative detection of pathogenic bacteria in foods. PMID:11425755
Yang, Rongchang; Jacobson, Caroline; Gardner, Graham; Carmichael, Ian; Campbell, Angus J D; Ryan, Una
2014-02-01
A novel quantitative PCR (qPCR) for Giardia at the glutamate dehydrogenase (gdh) locus was developed and validated. The qPCR was used to screen a total of 3412 lamb faecal samples collected from approximately 1189 lambs at three sampling periods (weaning, post-weaning and pre-slaughter) from eight farms across South Australia (SA), New South Wales (NSW), Victoria (Vic) and Western Australia (WA). The overall prevalence was 20.2% (95% CI 18.9-21.6) and of the 690 positives, 473 were successfully typed. In general, the prevalence of Giardia varied widely across the different farms with the highest prevalence in one WA farm (42.1%) at pre-slaughter sampling and the lowest prevalence in one Victorian farm (7.2%) at weaning. The range of cyst shedding at weaning, post-weaning and pre-slaughter overall across all states was 63-1.3×10(9) cysts g(-1) (median=1.7×10(4)), 63-1.1×10(9) cysts g(-1) (median=9.6×10(3)), 63-4.7×10(9) cysts g(-1) (median=8.1×10(4)) respectively. Assemblage specific primers at the triose phosphate isomerase (tpi) locus identified assemblage A in 22.4% (106/473) of positive samples typed, assemblage E in 75.9% (359/473) and mixed A and E assemblages in 1.7% (8/473) of samples. A subset of representative samples from the 8 farms (n=32) were typed at both the gdh and beta-giardin loci and confirmed these results and identified sub-assemblage AII in 16 representative assemblage A isolates across the 8 farms. This demonstrates a prevalence of Giardia previously not recognised in Australian sheep, highlighting a need for further research to quantify the production impacts of this protozoan parasite. Copyright © 2013 Elsevier Inc. All rights reserved.
Lai, Chieh-Hsien; Wu, Sih-Rong; Pang, Jen-Chieh; Ramireddy, Latha; Chiang, Yu-Cheng; Lin, Chien-Ku; Tsen, Hau-Yang
2017-07-01
The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA) real-time quantitative polymerase chain reaction (qPCR) to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4-5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable. Copyright © 2016. Published by Elsevier B.V.
A semi-nested PCR assay for molecular detection of Paracoccidioides brasiliensis in tissue samples.
Koishi, Andrea Cristine; Vituri, Débora Fonseca; Dionízio Filho, Pedro Sebastião Raimundo; Sasaki, Alexandre Augusto; Felipe, Maria Sueli Soares; Venancio, Emerson José
2010-01-01
Paracoccidioidomycosis is a systemic infection caused by Paracoccidioides brasiliensis. In this study, a semi-nested PCR for paracoccidioidomycosis diagnosis was developed. The primers ITS1 and ITS4 were used in the first reaction, while the primers MJ03 and ITS1 primer were used in the second reaction. The semi-nested PCR was used to investigate biopsies of five patients with oral lesions that resembled paracoccidioidomycosis. The semi-nested PCR was positive for four samples and negative for a sample from a patient later diagnosed with leishmaniasis. The new semi-nested PCR describe is useful for paracoccidioidomycosis diagnosis.
Error minimization algorithm for comparative quantitative PCR analysis: Q-Anal.
OConnor, William; Runquist, Elizabeth A
2008-07-01
Current methods for comparative quantitative polymerase chain reaction (qPCR) analysis, the threshold and extrapolation methods, either make assumptions about PCR efficiency that require an arbitrary threshold selection process or extrapolate to estimate relative levels of messenger RNA (mRNA) transcripts. Here we describe an algorithm, Q-Anal, that blends elements from current methods to by-pass assumptions regarding PCR efficiency and improve the threshold selection process to minimize error in comparative qPCR analysis. This algorithm uses iterative linear regression to identify the exponential phase for both target and reference amplicons and then selects, by minimizing linear regression error, a fluorescence threshold where efficiencies for both amplicons have been defined. From this defined fluorescence threshold, cycle time (Ct) and the error for both amplicons are calculated and used to determine the expression ratio. Ratios in complementary DNA (cDNA) dilution assays from qPCR data were analyzed by the Q-Anal method and compared with the threshold method and an extrapolation method. Dilution ratios determined by the Q-Anal and threshold methods were 86 to 118% of the expected cDNA ratios, but relative errors for the Q-Anal method were 4 to 10% in comparison with 4 to 34% for the threshold method. In contrast, ratios determined by an extrapolation method were 32 to 242% of the expected cDNA ratios, with relative errors of 67 to 193%. Q-Anal will be a valuable and quick method for minimizing error in comparative qPCR analysis.
There is a growing interest in the application of human-associated fecal sourceidentification quantitative real-time PCR (qPCR) technologies for water quality management. The transition from a research tool to a standardized protocol requires a high degree of confidence in data q...
USDA-ARS?s Scientific Manuscript database
Vibrio parahaemolyticus is a significant human pathogen capable of causing foodborne gastroenteritis associated with the consumption of contaminated raw or undercooked seafood. Quantitative RT-PCR (qRT-PCR) is a useful tool for studying gene expression in V. parahaemolyticus to characterize the viru...
Yip, Cyril C Y; Sridhar, Siddharth; Cheng, Andrew K W; Fung, Ami M Y; Cheng, Vincent C C; Chan, Kwok-Hung; Yuen, Kwok-Yung
2017-08-01
HHV-6 reactivation in immunocompromised patients is common and may be associated with serious morbidity and mortality; therefore, early detection and initiation of therapy might be of benefit. Real-time PCR assays allow for early identification of HHV-6 reactivation to assist in providing a timely response. Thus, we compared the performance of an in-house developed HHV-6 quantitative PCR assay with a commercially available kit, the RealStar ® HHV-6 PCR Kit. The analytical sensitivity, analytical specificity, linearity, precision and accuracy of the in-house developed HHV-6 qPCR assay were evaluated. The diagnostic performance of the in-house HHV-6 qPCR assay was compared with the RealStar ® HHV-6 PCR Kit, using 72 clinical specimens and 17 proficiency testing samples. Linear regression analysis of the quantitative results showed a dynamic range from 2 to 10 log 10 copies/ml and a coefficient of determination (R 2 ) of 0.999 for the in-house assay. A dilution series demonstrated a limit of detection and a limit of quantification of 1.7 log 10 and 2 log 10 copies/ml, respectively. The precision of the assay was highly reproducible among runs with coefficients of variance (CV) ranging from 0.27% to 4.37%. A comparison of 27 matched samples showed an excellent correlation between the quantitative viral loads measured by the in-house HHV-6 qPCR assay and the RealStar ® HHV-6 PCR Kit (R 2 =0.926; P<0.0001), with an average bias of -0.24 log 10 copies/ml. The in-house developed HHV-6 qPCR method is a sensitive and reliable assay with lower cost for the detection and quantification of HHV-6 DNA when compared to the RealStar ® HHV-6 PCR Kit. Copyright © 2017 Elsevier B.V. All rights reserved.
Shewale, Jaiprakash G; Schneida, Elaine; Wilson, Jonathan; Walker, Jerilyn A; Batzer, Mark A; Sinha, Sudhir K
2007-03-01
The human DNA quantification (H-Quant) system, developed for use in human identification, enables quantitation of human genomic DNA in biological samples. The assay is based on real-time amplification of AluYb8 insertions in hominoid primates. The relatively high copy number of subfamily-specific Alu repeats in the human genome enables quantification of very small amounts of human DNA. The oligonucleotide primers present in H-Quant are specific for human DNA and closely related great apes. During the real-time PCR, the SYBR Green I dye binds to the DNA that is synthesized by the human-specific AluYb8 oligonucleotide primers. The fluorescence of the bound SYBR Green I dye is measured at the end of each PCR cycle. The cycle at which the fluorescence crosses the chosen threshold correlates to the quantity of amplifiable DNA in that sample. The minimal sensitivity of the H-Quant system is 7.6 pg/microL of human DNA. The amplicon generated in the H-Quant assay is 216 bp, which is within the same range of the common amplifiable short tandem repeat (STR) amplicons. This size amplicon enables quantitation of amplifiable DNA as opposed to a quantitation of degraded or nonamplifiable DNA of smaller sizes. Development and validation studies were performed on the 7500 real-time PCR system following the Quality Assurance Standards for Forensic DNA Testing Laboratories.
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially
Jarausch, W; Saillard, C; Dosba, F; Bové, J M
1994-01-01
A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180
Chen, Yue-yue; Peng, Zhi-lan; Liu, Shan-ling; He, Bing; Hu, Min
2007-06-01
To establish a method of using real-time fluorescence quantitative PCR and RT-PCR to detect the E6 and E7 genes of human papillomavirus type 16 (HPV-16). Plasmids containing HPV-16 E6 or E7 were used to generate absolute standard curves. Three cervical carcinoma cell lines CaSki, SiHa and HeLa were tested by real-time fluorescence quantitative PCR and RT-PCR analyses for the expressions of HPV-16 E6 and E7. The correlation coefficients of standard curves were larger than 0. 99, and the PCR efficiency was more than 90%. The relative levels of HPV-16 E6 and E7 DNA and RNA were CaSki>SiHa>HeLa cell. HPV-16 E6 and E7 quantum by real-time fluorescence quantitative PCR and RT-PCR analyses may serve as a reliable and sensitive tool. This study provides the possibility of further researches on the relationship between HPV-16 E6 or E7 copy number and cervical carcinoma.
USDA-ARS?s Scientific Manuscript database
Quantitative PCR (qPCR) can be used to detect and monitor pathogen colonization, but early attempts to apply the technology to quiescent Botrytis cinerea infections of grape berries identified some specific limitations. In this study, four DNA extraction methods, two tissue-grinding methods, two gra...
Aims: Compare specificity and sensitivity of quantitative PCR (qPCR) assays targeting single and multi-copy gene regions of Escherichia coli. Methods and Results: A previously reported assay targeting the uidA gene (uidA405) was used as the basis for comparing the taxono...
Tian, Hui; Sun, Yuanyuan; Liu, Chenghui; Duan, Xinrui; Tang, Wei; Li, Zhengping
2016-12-06
MicroRNA (miRNA) analysis in a single cell is extremely important because it allows deep understanding of the exact correlation between the miRNAs and cell functions. Herein, we wish to report a highly sensitive and precisely quantitative assay for miRNA detection based on ligation-based droplet digital polymerase chain reaction (ddPCR), which permits the quantitation of miRNA in a single cell. In this ligation-based ddPCR assay, two target-specific oligonucleotide probes can be simply designed to be complementary to the half-sequence of the target miRNA, respectively, which avoids the sophisticated design of reverse transcription and provides high specificity to discriminate a single-base difference among miRNAs with simple operations. After the miRNA-templated ligation, the ddPCR partitions individual ligated products into a water-in-oil droplet and digitally counts the fluorescence-positive and negative droplets after PCR amplification for quantification of the target molecules, which possesses the power of precise quantitation and robustness to variation in PCR efficiency. By integrating the advantages of the precise quantification of ddPCR and the simplicity of the ligation-based PCR, the proposed method can sensitively measure let-7a miRNA with a detection limit of 20 aM (12 copies per microliter), and even a single-base difference can be discriminated in let-7 family members. More importantly, due to its high selectivity and sensitivity, the proposed method can achieve precise quantitation of miRNAs in single-cell lysate. Therefore, the ligation-based ddPCR assay may serve as a useful tool to exactly reveal the miRNAs' actions in a single cell, which is of great importance for the study of miRNAs' biofunction as well as for the related biomedical studies.
Woo, Hye In; Joo, Eun Yeon; Lee, Kyung Wha
2012-01-01
Background Narcolepsy is a neurologic disorder characterized by excessive daytime sleepiness, symptoms of abnormal rapid eye movement (REM) sleep, and a strong association with HLA-DRB1*1501, -DQA1*0102, and -DQB1*0602. Here, we investigated the clinico-physical characteristics of Korean patients with narcolepsy, their HLA types, and the clinical utility of high-resolution PCR with sequence-specific primers (PCR-SSP) as a simple typing method for identifying DRB1*15/16, DQA1, and DQB1 alleles. Methods The study population consisted of 67 consecutively enrolled patients having unexplained daytime sleepiness and diagnosed narcolepsy based on clinical and neurological findings. Clinical data and the results of the multiple sleep latency test and polysomnography were reviewed, and HLA typing was performed using both high-resolution PCR-SSP and sequence-based typing (SBT). Results The 44 narcolepsy patients with cataplexy displayed significantly higher frequencies of DRB1*1501 (Pc= 0.003), DQA1*0102 (Pc=0.001), and DQB1*0602 (Pc=0.014) than the patients without cataplexy. Among patients carrying DRB1*1501-DQB1*0602 or DQA1*0102, the frequencies of a mean REM sleep latency of less than 20 min in nocturnal polysomnography and clinical findings, including sleep paralysis and hypnagogic hallucination were significantly higher. SBT and PCR-SSP showed 100% concordance for high-resolution typing of DRB1*15/16 alleles and DQA1 and DQB1 loci. Conclusions The clinical characteristics and somnographic findings of narcolepsy patients were associated with specific HLA alleles, including DRB1*1501, DQA1*0102, and DQB1*0602. Application of high-resolution PCR-SSP, a reliable and simple method, for both allele- and locus-specific HLA typing of DRB1*15/16, DQA1, and DQB1 would be useful for characterizing clinical status among subjects with narcolepsy. PMID:22259780
Acharya, Kamal R.; Dhand, Navneet K.; Whittington, Richard J.; Plain, Karren M.
2017-01-01
Molecular tests such as polymerase chain reaction (PCR) are increasingly being applied for the diagnosis of Johne’s disease, a chronic intestinal infection of ruminants caused by Mycobacterium avium subspecies paratuberculosis (MAP). Feces, as the primary test sample, presents challenges in terms of effective DNA isolation, with potential for PCR inhibition and ultimately for reduced analytical and diagnostic sensitivity. However, limited evidence is available regarding the magnitude and diagnostic implications of PCR inhibition for the detection of MAP in feces. This study aimed to investigate the presence and diagnostic implications of PCR inhibition in a quantitative PCR assay for MAP (High-throughput Johne’s test) to investigate the characteristics of samples prone to inhibition and to identify measures that can be taken to overcome this. In a study of fecal samples derived from a high prevalence, endemically infected cattle herd, 19.94% of fecal DNA extracts showed some evidence of inhibition. Relief of inhibition by a five-fold dilution of the DNA extract led to an average increase in quantification of DNA by 3.3-fold that consequently increased test sensitivity of the qPCR from 55 to 80% compared to fecal culture. DNA extracts with higher DNA and protein content had 19.33 and 10.94 times higher odds of showing inhibition, respectively. The results suggest that the current test protocol is sensitive for herd level diagnosis of Johne’s disease but that test sensitivity and individual level diagnosis could be enhanced by relief of PCR inhibition, achieved by five-fold dilution of the DNA extract. Furthermore, qualitative and quantitative parameters derived from absorbance measures of DNA extracts could be useful for prediction of inhibitory fecal samples. PMID:28210245
Yuan, Yahong; Liu, Bin; Wang, Ling; Yue, Tianli
2015-01-01
An approach based on immunomagnetic separation (IMS) and SYBR Green I real-time PCR (real-time PCR) with species-specific primers and melting curve analysis was proposed as a rapid and effective method for detecting Alicyclobacillus spp. in fruit juices. Specific primers targeting the 16S rDNA sequences of Alicyclobacillus spp. were designed and then confirmed by the amplification of DNA extracted from standard strains and isolates. Spiked samples containing known amounts of target bacteria were used to obtain standard curves; the correlation coefficient was greater than 0.986 and the real-time PCR amplification efficiencies were 98.9%- 101.8%. The detection limit of the testing system was 2.8×101 CFU/mL. The coefficient of variation for intra-assay and inter-assay variability were all within the acceptable limit of 5%. Besides, the performance of the IMS-real-time PCR assay was further investigated by detecting naturally contaminated kiwi fruit juice; the sensitivity, specificity and accuracy were 91.7%, 95.9% and 95.3%, respectively. The established IMS-real-time PCR procedure provides a new method for identification and quantitative detection of Alicyclobacillus spp. in fruit juice. PMID:26488469
García, Margarita; Esteve-Zarzoso, Braulio; Crespo, Julia; Cabellos, Juan M.; Arroyo, Teresa
2017-01-01
There is an increasing trend toward understanding the impact of non-Saccharomyces yeasts on the winemaking process. Although Saccharomyces cerevisiae is the predominant species at the end of fermentation, it has been recognized that the presence of non-Saccharomyces species during alcoholic fermentation can produce an improvement in the quality and complexity of the final wines. A previous work was developed for selecting the best combinations between S. cerevisiae and five non-Saccharomyces (Torulaspora delbrueckii, Schizosaccharomyces pombe, Candida stellata, Metschnikowia pulcherrima, and Lachancea thermotolorans) native yeast strains from D.O. “Vinos de Madrid” at the laboratory scale. The best inoculation strategies between S. cerevisiae and non-Saccharomyces strains were chosen to analyze, by real-time quantitative PCR (qPCR) combined with the use of specific primers, the dynamics of inoculated populations throughout the fermentation process at the pilot scale using the Malvar white grape variety. The efficiency of the qPCR system was verified independently of the samples matrix, founding the inoculated yeast species throughout alcoholic fermentation. Finally, we can validate the positive effect of selected co-cultures in the Malvar wine quality, highlighting the sequential cultures of T. delbrueckii CLI 918/S. cerevisiae CLI 889 and C. stellata CLI 920/S. cerevisiae CLI 889 and, mixed and sequential cultures of L. thermotolerans 9-6C combined with S. cerevisiae CLI 889. PMID:29326669
Ludlow, Andrew T.; Robin, Jerome D.; Sayed, Mohammed; Litterst, Claudia M.; Shelton, Dawne N.; Shay, Jerry W.; Wright, Woodring E.
2014-01-01
The telomere repeat amplification protocol (TRAP) for the human reverse transcriptase, telomerase, is a PCR-based assay developed two decades ago and is still used for routine determination of telomerase activity. The TRAP assay can only reproducibly detect ∼2-fold differences and is only quantitative when compared to internal standards and reference cell lines. The method generally involves laborious radioactive gel electrophoresis and is not conducive to high-throughput analyzes. Recently droplet digital PCR (ddPCR) technologies have become available that allow for absolute quantification of input deoxyribonucleic acid molecules following PCR. We describe the reproducibility and provide several examples of a droplet digital TRAP (ddTRAP) assay for telomerase activity, including quantitation of telomerase activity in single cells, telomerase activity across several common telomerase positive cancer cells lines and in human primary peripheral blood mononuclear cells following mitogen stimulation. Adaptation of the TRAP assay to digital format allows accurate and reproducible quantification of the number of telomerase-extended products (i.e. telomerase activity; 57.8 ± 7.5) in a single HeLa cell. The tools developed in this study allow changes in telomerase enzyme activity to be monitored on a single cell basis and may have utility in designing novel therapeutic approaches that target telomerase. PMID:24861623
Nimesh, Manoj; Joon, Deepali; Pathak, Anil Kumar; Saluja, Daman
2013-11-01
Indian contribution to global burden of tuberculosis is about 26%. In the present study we have developed an in-house PCR assay using primers for sdaA gene of Mycobacterium tuberculosis and evaluated against already established primers devR, IS6110, MPB64, rpoB primers for diagnosis of pulmonary tuberculosis. Using universal sample preparation (USP) method, DNA was extracted from sputum specimens of 412 symptomatic patients from Delhi, India. The DNA so extracted was used as template for PCR amplification using primers targeting sdaA, devR, IS6110, MPB64 and rpoB genes. Out of 412, 149 specimens were considered positive based on composite reference standard (CRS) criteria. The in-house designed sdaA PCR showed high specificity (96.5%), the high positive likelihood ratio (28), the high sensitivity (95.9%), and the very low negative likelihood ratio (0.04) in comparison to CRS. Based on our results, the sdaA PCR assay can be considered as one of the most reliable diagnostic tests in comparison to other PCR based detection methods. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
Qiu, Fang-Zhou; Shen, Xin-Xin; Zhao, Meng-Chuan; Zhao, Li; Duan, Su-Xia; Chen, Chen; Qi, Ju-Ju; Li, Gui-Xia; Wang, Le; Feng, Zhi-Shan; Ma, Xue-Jun
2018-05-02
Human adenovirus (HAdV) serotypes 2, 3 and 7 are more prevalent than other serotypes and have been associated with severe pneumonia in pediatric children. Molecular typing of HAdV is not routinely performed in clinical diagnostic laboratories as it is time-consuming and labor-intensive. In the present study, we developed a triplex quantitative real-time PCR assay (tq-PCR) in a single closed tube for differential detection and quantitative analysis of HAdV serotypes 2, 3 and 7. The sensitivity, specificity, reproducibility and clinical performance of tq-PCR were evaluated. The analytical sensitivity of the tq-PCR was 100 copies/reaction for each of HAdV serotypes 2, 3 and 7, and no cross-reaction with other common respiratory viruses or HAdV serotypes 1,4,5,6,31,55 and 57 was observed. The coefficients of variation (CV) of intra-assay and inter-assay were between 0.6% to 3.6%. Of 138 previously-defined HAdV-positive nasopharyngeal aspirates samples tested, the detection agreement between tq-PCR and nested PCR was 96.38% (133/138). The proposed tq-PCR assay is a sensitive, specific and reproducible method and has the potential for clinical use in the rapid and differential detection and quantitation of HAdV serotypes 2, 3 and 7.
Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan (trademark)) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glab...
Fuller, Nicholas J.; Wilson, William H.; Joint, Ian R.; Mann, Nicholas H.
1998-01-01
Viruses are ubiquitous components of marine ecosystems and are known to infect unicellular phycoerythrin-containing cyanobacteria belonging to the genus Synechococcus. A conserved region from the cyanophage genome was identified in three genetically distinct cyanomyoviruses, and a sequence analysis revealed that this region exhibited significant similarity to a gene encoding a capsid assembly protein (gp20) from the enteric coliphage T4. The results of a comparison of gene 20 sequences from three cyanomyoviruses and T4 allowed us to design two degenerate PCR primers, CPS1 and CPS2, which specifically amplified a 165-bp region from the majority of cyanomyoviruses tested. A competitive PCR (cPCR) analysis revealed that cyanomyovirus strains could be accurately enumerated, and it was demonstrated that quantification was log-linear over ca. 3 orders of magnitude. Different calibration curves were obtained for each of the three cyanomyovirus strains tested; consequently, cPCR performed with primers CPS1 and CPS2 could lead to substantial inaccuracies in estimates of phage abundance in natural assemblages. Further sequence analysis of cyanomyovirus gene 20 homologs would be necessary in order to design primers which do not exhibit phage-to-phage variability in priming efficiency. It was demonstrated that PCR products of the correct size could be amplified from seawater samples following 100× concentration and even directly without any prior concentration. Hence, the use of degenerate primers in PCR analyses of cyanophage populations should provide valuable data on the diversity of cyanophages in natural assemblages. Further optimization of procedures may ultimately lead to a sensitive assay which can be used to analyze natural cyanophage populations both quantitatively (by cPCR) and qualitatively following phylogenetic analysis of amplified products. PMID:9603813
Mano, Junichi; Masubuchi, Tomoko; Hatano, Shuko; Futo, Satoshi; Koiwa, Tomohiro; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Takabatake, Reona; Kitta, Kazumi
2013-01-01
In this article, we report a novel real-time PCR-based analytical method for quantitation of the GM maize event LY038. We designed LY038-specific and maize endogenous reference DNA-specific PCR amplifications. After confirming the specificity and linearity of the LY038-specific PCR amplification, we determined the conversion factor required to calculate the weight-based content of GM organism (GMO) in a multilaboratory evaluation. Finally, in order to validate the developed method, an interlaboratory collaborative trial according to the internationally harmonized guidelines was performed with blind DNA samples containing LY038 at the mixing levels of 0, 0.5, 1.0, 5.0 and 10.0%. The precision of the method was evaluated as the RSD of reproducibility (RSDR), and the values obtained were all less than 25%. The limit of quantitation of the method was judged to be 0.5% based on the definition of ISO 24276 guideline. The results from the collaborative trial suggested that the developed quantitative method would be suitable for practical testing of LY038 maize.
Long distance PCR in detection of inversion mutations of F8C gene in hemophilia A patients.
Poláková, H; Zmetáková, I; Kádasi, L'
2003-06-01
In the present paper, the experience with detection of intron 22 inversion of F8C gene in severe hemophilia A patients using a recently described long-distance PCR (LD-PCR) method was reported. To test the sensitivity and the specifity of the LD-PCR, analysis of 46 DNA samples of patients and their family members, previously tested by Southern hybridization, was performed. In addition, 16 DNA samples of severe hemophilia A patients in which causative mutation was unknown, were included in analysis. Four-primers, P, Q, A&B, which are able to differentiate between the affected males with or without the inversion, and in female carriers, were used in LD-PCR. Two primers, P&Q, are located within the F8C gene flanking int22h1. Two further primers, A&B, flank int22h2 and int22h3, extragene homologs of int22h1. Nine combinations of four primers were used to identify the optimal one. Four-primers (P, Q, A&B), three-primers (P,Q & B;P, A & B; A, B & Q;P, Q & A) and two-primers (A & B; P & Q; A & Q; P & B) PCR amplifications were performed in the hemophilia A patients as well as in obligate carriers DNA samples. Successful amplification required introduction of some modifications of the original protocol. The most reproducible and uniform results were obtained using two-primers PCR, performed in four single reactions. Thus, a total of 46 DNA samples, 22 were hemizygous for inversion, 6 without the inversion, 14 carriers and 4 non-carriers of inversion. Perfect correlation between genotypes determined using Southern hybridization and LD-PCR was achieved. The optimalized two-primers LD-PCR protocol was used for analysis of 16 DNA samples of severe hemophilia A patients with unknown mutation. Ten cases of inversions and six cases without them were detected. Thus in additional 10 severe hemophilic patients DNA diagnosis was completed. The most successful and reproducible results were obtained performing four single LD-PCR reactions with combinations of two-primers A & B; P & Q
Cho, Min Seok; Ahn, Tae-Young; Joh, Kiseong; Lee, Eui Seok; Park, Dong Suk
2015-11-01
Legionellosis outbreak is a major global health care problem. However, current Legionella risk assessments may be compromised by uncertainties in Legionella detection methods, infectious dose, and strain infectivity. These limitations may place public health at significant risk, leading to significant monetary losses in health care. However, there are still unmet needs for its rapid identification and monitoring of legionellae in water systems. Therefore, in the present study, a primer set was designed based on a LysR-type transcriptional regulator (LTTR) family protein gene of Legionella pneumophila subsp. pneumophila str. Philadelphia 1 because it was found that this gene is structurally diverse among species through BLAST searches. The specificity of the primer set was evaluated using genomic DNA from 6 strains of L. pneumophila, 5 type strains of other related Legionella species, and other 29 reference pathogenic bacteria. The primer set used in the PCR assay amplified a 264-bp product for only targeted six strains of L. pneumophila. The assay was also able to detect at least 1.39 × 10(3) copies/μl of cloned amplified target DNA using purified DNA or 7.4 × 10(0) colony-forming unit per reaction when using calibrated cell suspension. In addition, the sensitivity and specificity of this assay were confirmed by successful detection of Legionella pneumophila in environmental water samples.
Wen, Shuxiang; Chen, Xiaoling; Xu, Fuzhou; Sun, Huiling
2016-01-01
Real-time quantitative reverse transcription PCR (qRT-PCR) offers a robust method for measurement of gene expression levels. Selection of reliable reference gene(s) for gene expression study is conducive to reduce variations derived from different amounts of RNA and cDNA, the efficiency of the reverse transcriptase or polymerase enzymes. Until now reference genes identified for other members of the family Pasteurellaceae have not been validated for Avibacterium paragallinarum. The aim of this study was to validate nine reference genes of serovars A, B, and C strains of A. paragallinarum in different growth phase by qRT-PCR. Three of the most widely used statistical algorithms, geNorm, NormFinder and ΔCT method were used to evaluate the expression stability of reference genes. Data analyzed by overall rankings showed that in exponential and stationary phase of serovar A, the most stable reference genes were gyrA and atpD respectively; in exponential and stationary phase of serovar B, the most stable reference genes were atpD and recN respectively; in exponential and stationary phase of serovar C, the most stable reference genes were rpoB and recN respectively. This study provides recommendations for stable endogenous control genes for use in further studies involving measurement of gene expression levels.
Evaluation of the PCR method for identification of Bifidobacterium species.
Youn, S Y; Seo, J M; Ji, G E
2008-01-01
Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.
Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A; Zhang, Dabing
2008-06-04
Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. We describe a real-time PCR technique employing attached universal duplex probes (AUDP), which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP) and a complementary quenching probe (QP) lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT) and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO) quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost.
Demeke, Tigst; Ratnayaka, Indira; Phan, Anh
2009-01-01
The quality of DNA affects the accuracy and repeatability of quantitative PCR results. Different DNA extraction and purification methods were compared for quantification of Roundup Ready (RR) soybean (event 40-3-2) by real-time PCR. DNA was extracted using cetylmethylammonium bromide (CTAB), DNeasy Plant Mini Kit, and Wizard Magnetic DNA purification system for food. CTAB-extracted DNA was also purified using the Zymo (DNA Clean & Concentrator 25 kit), Qtip 100 (Qiagen Genomic-Tip 100/G), and QIAEX II Gel Extraction Kit. The CTAB extraction method provided the largest amount of DNA, and the Zymo purification kit resulted in the highest percentage of DNA recovery. The Abs260/280 and Abs260/230 ratios were less than the expected values for some of the DNA extraction and purification methods used, indicating the presence of substances that could inhibit PCR reactions. Real-time quantitative PCR results were affected by the DNA extraction and purification methods used. Further purification or dilution of the CTAB DNA was required for successful quantification of RR soybean. Less variability of quantitative PCR results was observed among experiments and replications for DNA extracted and/or purified by CTAB, CTAB+Zymo, CTAB+Qtip 100, and DNeasy methods. Correct and repeatable results for real-time PCR quantification of RR soybean were achieved using CTAB DNA purified with Zymo and Qtip 100 methods.
Genetic linkage analysis using pooled DNA and infrared detection of tailed STRP primer patterns
NASA Astrophysics Data System (ADS)
Oetting, William S.; Wildenberg, Scott C.; King, Richard A.
1996-04-01
The mapping of a disease locus to a specific chromosomal region is an important step in the eventual isolation and analysis of a disease causing gene. Conventional mapping methods analyze large multiplex families and/or smaller nuclear families to find linkage between the disease and a chromosome marker that maps to a known chromosomal region. This analysis is time consuming and tedious, typically requiring the determination of 30,000 genotypes or more. For appropriate populations, we have instead utilized pooled DNA samples for gene mapping which greatly reduces the amount of time necessary for an initial chromosomal screen. This technique assumes a common founder for the disease locus of interest and searches for a region of a chromosome shared between affected individuals. Our analysis involves the PCR amplification of short tandem repeat polymorphisms (STRP) to detect these shared regions. In order to reduce the cost of genotyping, we have designed unlabeled tailed PCR primers which, when combined with a labeled universal primer, provides for an alternative to synthesizing custom labeled primers. The STRP pattern is visualized with an infrared fluorescence based automated DNA sequencer and the patterns quantitated by densitometric analysis of the allele pattern. Differences in the distribution of alleles between pools of affected and unaffected individuals, including a reduction in the number of alleles in the affected pool, indicate the sharing of a region of a chromosome. We have found this method effective for markers 10 - 15 cM away from the disease locus for a recessive genetic disease.
Zhu, Ying; Zhang, Yun-Xia; Liu, Wen-Wen; Ma, Yan; Fang, Qun; Yao, Bo
2015-04-01
This paper describes a nanoliter droplet array-based single-cell reverse transcription quantitative PCR (RT-qPCR) assay method for quantifying gene expression in individual cells. By sequentially printing nanoliter-scale droplets on microchip using a microfluidic robot, all liquid-handling operations including cell encapsulation, lysis, reverse transcription, and quantitative PCR with real-time fluorescence detection, can be automatically achieved. The inhibition effect of cell suspension buffer on RT-PCR assay was comprehensively studied to achieve high-sensitivity gene quantification. The present system was applied in the quantitative measurement of expression level of mir-122 in single Huh-7 cells. A wide distribution of mir-122 expression in single cells from 3061 copies/cell to 79998 copies/cell was observed, showing a high level of cell heterogeneity. With the advantages of full-automation in liquid-handling, simple system structure, and flexibility in achieving multi-step operations, the present method provides a novel liquid-handling mode for single cell gene expression analysis, and has significant potentials in transcriptional identification and rare cell analysis.
Zhu, Ying; Zhang, Yun-Xia; Liu, Wen-Wen; Ma, Yan; Fang, Qun; Yao, Bo
2015-01-01
This paper describes a nanoliter droplet array-based single-cell reverse transcription quantitative PCR (RT-qPCR) assay method for quantifying gene expression in individual cells. By sequentially printing nanoliter-scale droplets on microchip using a microfluidic robot, all liquid-handling operations including cell encapsulation, lysis, reverse transcription, and quantitative PCR with real-time fluorescence detection, can be automatically achieved. The inhibition effect of cell suspension buffer on RT-PCR assay was comprehensively studied to achieve high-sensitivity gene quantification. The present system was applied in the quantitative measurement of expression level of mir-122 in single Huh-7 cells. A wide distribution of mir-122 expression in single cells from 3061 copies/cell to 79998 copies/cell was observed, showing a high level of cell heterogeneity. With the advantages of full-automation in liquid-handling, simple system structure, and flexibility in achieving multi-step operations, the present method provides a novel liquid-handling mode for single cell gene expression analysis, and has significant potentials in transcriptional identification and rare cell analysis. PMID:25828383
PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples.
Wang, R F; Cao, W W; Cerniglia, C E
1996-01-01
PCR procedures based on 16S rRNA gene sequences specific for 12 anaerobic bacteria that predominate in the human intestinal tract were developed and used for quantitative detection of these species in human (adult and baby) feces and animal (rat, mouse, cat, dog, monkey, and rabbit) feces. Fusobacterium prausnitzii, Peptostreptococcus productus, and Clostridium clostridiiforme had high PCR titers (the maximum dilutions for positive PCR results ranged from 10(-3) to 10(-8)) in all of the human and animal fecal samples tested. Bacteroides thetaiotaomicron, Bacteroides vulgatus, and Eubacterium limosum also showed higher PCR titers (10(-2) to 10(-6)) in adult human feces. The other bacteria tested, including Escherichia coli, Bifidobacterium adolescentis, Bifidobacterium longum, Lactobacillus acidophilus, Eubacterium biforme, and Bacteroides distasonis, were either at low PCR titers (less than 10(-2)) or not detected by PCR. The reported PCR procedure including the fecal sample preparation method is simplified and rapid and eliminates the DNA isolation steps. PMID:8919784
Pan, Xiaoming; Zhang, Yanfang; Sha, Xuejiao; Wang, Jing; Li, Jing; Dong, Ping; Liang, Xingguo
2017-03-28
White spot syndrome virus (WSSV) is a major threat to the shrimp farming industry and so far there is no effective therapy for it, and thus early diagnostic of WSSV is of great importance. However, at the early stage of infection, the extremely low-abundance of WSSV DNA challenges the detection sensitivity and accuracy of PCR. To effectively detect low-abundance WSSV, here we developed a pre-amplification PCR (pre-amp PCR) method to amplify trace amounts of WSSV DNA from massive background genomic DNA. Combining with normal specific PCR, 10 copies of target WSSV genes were detected from ~10 10 magnitude of backgrounds. In particular, multiple target genes were able to be balanced amplified with similar efficiency due to the usage of the universal primer. The efficiency of the pre-amp PCR was validated by nested-PCR and quantitative PCR, and pre-amp PCR showed higher efficiency than nested-PCR when multiple targets were detected. The developed method is particularly suitable for the super early diagnosis of WSSV, and has potential to be applied in other low-abundance sample detection cases.
Hu, Hui; Jung, Kwonil; Wang, Qiuhong; Saif, Linda J; Vlasova, Anastasia N
2018-06-01
Coronaviruses (CoVs) are critical human and animal pathogens because of their potential to cause severe epidemics of respiratory or enteric diseases. In pigs, the newly emerged porcine deltacoronavirus (PDCoV) and re-emerged porcine epidemic diarrhea virus (PEDV) reported in the US and Asia, as well as the discovery of novel CoVs in wild bats or birds, has necessitated development of improved detection and control measures for these CoVs. Because the previous pancoronavirus (panCoV) RT-PCR established in our laboratory in 2007-2011 did not detect deltacoronaviruses (δ-CoVs) in swine fecal and serum samples, our goal was to develop a new panCoV RT-PCR assay to detect known human and animal CoVs, including δ-CoVs. In this study, we designed a new primer set to amplify a 668 bp-region within the RNA-dependent RNA polymerase (RdRP) gene that encodes the most conserved protein domain of α-, β-, γ-, and δ-CoVs. We established a one-step panCoV RT-PCR assay and standardized the assay conditions. The newly established panCoV RT-PCR assay was demonstrated to have a high sensitivity and specificity. Using a panel of 60 swine biological samples (feces, intestinal contents, and sera) characterized by PEDV, PDCoV and transmissible gastroenteritis virus-specific RT-PCR assays, we demonstrated that sensitivity and specificity of the newly established panCoV RT-PCR assay were 100%. 400 avian fecal (RNA) samples were further tested simultaneously for CoV by the new panCoV RT-PCR and a one-step RT-PCR assay with the δ-CoV nucleocapsid-specific universal primers. Four of 400 avian samples were positive for CoV, three of which were positive for δ-CoV by the conventional RT-PCR. PanCoV RT-PCR fragments for 3 of the 4 CoVs were sequenced. Phylogenetic analysis revealed the presence of one γ-CoV and two δ-CoV in the sequenced samples. The newly designed panCoV RT-PCR assay should be useful for the detection of currently known CoVs in animal biological samples. Copyright © 2018
Real-time PCR detection chemistry.
Navarro, E; Serrano-Heras, G; Castaño, M J; Solera, J
2015-01-15
Real-time PCR is the method of choice in many laboratories for diagnostic and food applications. This technology merges the polymerase chain reaction chemistry with the use of fluorescent reporter molecules in order to monitor the production of amplification products during each cycle of the PCR reaction. Thus, the combination of excellent sensitivity and specificity, reproducible data, low contamination risk and reduced hand-on time, which make it a post-PCR analysis unnecessary, has made real-time PCR technology an appealing alternative to conventional PCR. The present paper attempts to provide a rigorous overview of fluorescent-based methods for nucleic acid analysis in real-time PCR described in the literature so far. Herein, different real-time PCR chemistries have been classified into two main groups; the first group comprises double-stranded DNA intercalating molecules, such as SYBR Green I and EvaGreen, whereas the second includes fluorophore-labeled oligonucleotides. The latter, in turn, has been divided into three subgroups according to the type of fluorescent molecules used in the PCR reaction: (i) primer-probes (Scorpions, Amplifluor, LUX, Cyclicons, Angler); (ii) probes; hydrolysis (TaqMan, MGB-TaqMan, Snake assay) and hybridization (Hybprobe or FRET, Molecular Beacons, HyBeacon, MGB-Pleiades, MGB-Eclipse, ResonSense, Yin-Yang or displacing); and (iii) analogues of nucleic acids (PNA, LNA, ZNA, non-natural bases: Plexor primer, Tiny-Molecular Beacon). In addition, structures, mechanisms of action, advantages and applications of such real-time PCR probes and analogues are depicted in this review. Copyright © 2014 Elsevier B.V. All rights reserved.
Ludlow, Andrew T; Robin, Jerome D; Sayed, Mohammed; Litterst, Claudia M; Shelton, Dawne N; Shay, Jerry W; Wright, Woodring E
2014-07-01
The telomere repeat amplification protocol (TRAP) for the human reverse transcriptase, telomerase, is a PCR-based assay developed two decades ago and is still used for routine determination of telomerase activity. The TRAP assay can only reproducibly detect ∼ 2-fold differences and is only quantitative when compared to internal standards and reference cell lines. The method generally involves laborious radioactive gel electrophoresis and is not conducive to high-throughput analyzes. Recently droplet digital PCR (ddPCR) technologies have become available that allow for absolute quantification of input deoxyribonucleic acid molecules following PCR. We describe the reproducibility and provide several examples of a droplet digital TRAP (ddTRAP) assay for telomerase activity, including quantitation of telomerase activity in single cells, telomerase activity across several common telomerase positive cancer cells lines and in human primary peripheral blood mononuclear cells following mitogen stimulation. Adaptation of the TRAP assay to digital format allows accurate and reproducible quantification of the number of telomerase-extended products (i.e. telomerase activity; 57.8 ± 7.5) in a single HeLa cell. The tools developed in this study allow changes in telomerase enzyme activity to be monitored on a single cell basis and may have utility in designing novel therapeutic approaches that target telomerase. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Joshi, Molishree; Keith Pittman, H; Haisch, Carl; Verbanac, Kathryn
2008-09-01
Quantitative real-time PCR (qPCR) is a sensitive technique for the detection and quantitation of specific DNA sequences. Here we describe a Taqman qPCR assay for quantification of tissue-localized, adoptively transferred enhanced green fluorescent protein (EGFP)-transgenic cells. A standard curve constructed from serial dilutions of a plasmid containing the EGFP transgene was (i) highly reproducible, (ii) detected as few as two copies, and (iii) was included in each qPCR assay. qPCR analysis of genomic DNA was used to determine transgene copy number in several mouse strains. Fluorescent microscopy of tissue sections showed that adoptively transferred vascular endothelial cells (VEC) from EGFP-transgenic mice specifically localized to tissue with metastatic tumors in syngeneic recipients. VEC microscopic enumeration of liver metastases strongly correlated with qPCR analysis of identical sections (Pearson correlation 0.81). EGFP was undetectable in tissue from control mice by qPCR. In another study using intra-tumor EGFP-VEC delivery to subcutaneous tumors, manual cell count and qPCR analysis of alternating sections also strongly correlated (Pearson correlation 0.82). Confocal microscopy of the subcutaneous tumor sections determined that visual fluorescent signals were frequently tissue artifacts. This qPCR methodology offers specific, objective, and rapid quantitation, uncomplicated by tissue autofluorescence, and should be readily transferable to other in vivo models to quantitate the biolocalization of transplanted cells.
Pan, Xiao-Ben; Wei, Lai; Han, Jin-Chao; Gao, Yan
2008-01-01
Fluorescence quantitative real-time PCR (FQ-PCR) is a recently developed technique increasingly used for clinical diagnosis by detection of hepatitis B virus (HBV) DNA in serum. FQ-PCR is also used in scientific research for detection of HBV DNA in cell culture. Understanding potential FQ-PCR interference factors can improve the accuracy of HBV DNA quantification in cell culture medium. HBV positive serum was diluted with culture medium to produce three test groups with HBV DNA levels of 5 x 10(7) copies/ml (high), 5 x 10(5) copies/ml (medium), and 5 x 10(3) copies/ml (low). Chromosome DNA was extracted from HepG2 cells and then added to high, medium, and low group samples at final concentrations of 0, 12.5, 25, 50, and 100 microg/ml. The samples were quantified by FQ-PCR and data were evaluated using statistical software. No marked changes were seen in the quantitative curves for high level HBV DNA samples when the samples were supplemented with 0-100 microg/ml of chromosome DNA. Interference was observed in medium level samples when 50 and 100 microg/ml of chromosome DNA was added. Interference was also observed in low level HBV DNA samples when the concentration of added chromosome DNA was greater than 25 microg/ml. The interference was eliminated when samples were digested by DNase I prior to PCR detection. In Conclusions, the presence of cellular chromosome DNA can interfere with the detection of HBV DNA by FQ-PCR. Removal of cellular chromosome DNA from culture media prior to FQ-PCR is necessary for reliable HBV DNA quantitative detection. (c) 2007 Wiley-Liss, Inc.
Chouhy, Diego; Kocjan, Boštjan J; Staheli, Jeannette P; Bolatti, Elisa M; Hošnjak, Lea; Sagadin, Martin; Giri, Adriana A; Rose, Timothy M; Poljak, Mario
2018-01-01
A modified pan-PV consensus-degenerate hybrid oligonucleotide primer (CODEHOP) PCR was developed for generic and sensitive detection of a broad-spectrum of human papillomaviruses (HPVs) infecting the cutaneous epithelium. To test the analytical sensitivity of the assay we examined 149 eyebrow hair follicle specimens from immunocompetent male patients. HPV DNA was detected in 60 % (89/149) of analysed eyebrow samples with a total of 48 different HPV sequences, representing 21 previously described HPVs and 27 putative novel HPV types. Evidence for ten novel HPV subtypes and seven viral variants, clustering to three out of five genera containing cutaneous HPVs, was also obtained. Thus, we have shown that the modified pan-PV CODEHOP PCR assay is able to identify multiple HPV types, even from different genera, in the same clinical sample. Overall, these results demonstrate that the pan-PV CODEHOP PCR is an excellent tool for screening and identification of novel cutaneous HPVs, even in samples with low viral loads.
Jean, Audrey; Tardy, Florence; Allatif, Omran; Grosjean, Isabelle; Blanquier, Bariza
2017-01-01
Mycoplasmas (a generic name for Mollicutes) are a predominant bacterial contaminant of cell culture and cell derived products including viruses. This prokaryote class is characterized by very small size and lack of a cell wall. Consequently, mycoplasmas escape ultrafiltration and visualization under routine microscopic examination, hence the ease with which cells in culture can be contaminated, with routinely more than 10% of cell lines being contaminated. Mycoplasma are a formidable threat both in fundamental research by perverting a whole range of cell properties and functions and in the pharmacological use of cells and cell derived products. Although many methods have been developed, there is still a need for a sensitive, universal assay. Here is reported the development and validation of a quantitative polymerase chain reaction (qPCR) based on the amplification of a 1.5 kb fragment covering the 16S rDNA of the Mollicute class by real-time PCR using universal U1 and U8 degenerate primers. The method includes the addition of a DNA loading probe to each sample to monitor DNA extraction and the absence of PCR inhibitors in the extracted DNA, a positive mycoplasma 16S rDNA traceable reference sample to exclude any accidental contamination of an unknown sample with this reference DNA, an analysis procedure based on the examination of the melting curve and the size of the PCR amplicon, followed by quantification of the number of 16S rDNA copies (with a lower limit of 19 copies) when relevant, and, if useful, the identification of the contaminating prokaryote by sequencing. The method was validated on a collection of mycoplasma strains and by testing over 100 samples of unknown contamination status including stocks of viruses requiring biosafety level 2, 3 or 4 containments. When compared to four established methods, the m16S_qPCR technique exhibits the highest sensitivity in detecting mycoplasma contamination. PMID:28225826
Microsatellite primers for red drum (Sciaenops ocellatus)
USDA-ARS?s Scientific Manuscript database
In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...
A Multiplexed, Probe-Based Quantitative PCR Assay for DNA of Phytophthora sojae
USDA-ARS?s Scientific Manuscript database
Phytophthora sojae (Kaufm. & Gerd.) causes seed rot, pre- and post-emergence damping off, and sometimes foliar blight in soybean (Glycine max). Crop loss may approach 100% with susceptible cultivars. We report here the development of a unique quantitative PCR assay specific to DNA of P. sojae, and a...
Kim, Choon-Mee; Cho, Min Keun; Yun, Na-Ra; Kim, Seok Won; Jang, Sook Jin; Ahn, Young-Joon; Lim, Donghoon
2015-01-01
We retrospectively evaluated the accuracy of conventional PCR targeting the 16S rRNA gene (16S C-PCR) using the Ot-16sRF1/Ot-16sRR1 primers for diagnosing scrub typhus. The diagnosis of Orientia tsutsugamushi infection by 16S C-PCR presented an increased sensitivity of 87.0% and specificity of 100% compared with those obtained with other targets and is thus a simple and clinically useful method with good diagnostic accuracy. PMID:26491185
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Haudenshield, James S.; Song, Jeong Y.; Hartman, Glen L.
2017-01-01
Phytophthora root rot of soybean [Glycine max (L.) Merr.] is caused by the oomycete Phytophthora sojae (Kaufm. & Gerd.). P. sojae has a narrow host range, consisting primarily of soybean, and it is a serious pathogen worldwide. It exists in root and stem tissues as mycelium, wherein it can form oospores which subsequently germinate to release motile, infectious zoospores. Molecular assays detecting DNA of P. sojae are useful in disease diagnostics, and for determining the presence of the organism in host tissues, soils, and runoff or ponded water from potentially infested fields. Such assays as published have utilized ITS sequences from the nuclear ribosomal RNA genes in conventional PCR or dye-binding quantitative PCR (Q-PCR) but are not amenable to multiplexing, and some of these assays did not utilize control strategies for type I or type II errors. In this study, we describe primers and a bifunctional probe with specificity to a gypsy-like retroelement in the P. sojae genome to create a fluorogenic 5’-exonuclease linear hydrolysis assay, with a multiplexed internal control reaction detecting an exogenous target to validate negative calls, and with uracil-deglycosylase-mediated protection against carryover contamination. The assay specifically detected 13 different P. sojae isolates, and excluded 17 other Phytophthora species along with 20 non-Phytophthora fungal and oomycete species pathogenic on soybean. A diagnostic limit of detection of 34 fg total P. sojae DNA was observed in serial dilutions, equivalent to 0.3 genome, and a practical detection sensitivity of four zoospores per sample was achieved, despite losses during DNA extraction. PMID:28441441
Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D
2009-12-01
The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.
Bomfim, Maria Rosa Quaresma; Koury, Matilde Cota
2006-12-20
We evaluated the use of low-stringency single specific primer PCR (LSSP-PCR) for genetically typing Leptospira directly from urine samples of cattle with clinical suspicion of leptospirosis. Urine samples obtained from 40 cattle with clinical suspicion of leptospirosis were amplified by specific PCR using the following primers: Internal 1/Internal 2 and G1/G2. The internal primers were designed from the gene sequence of the outer membrane lipoprotein Lip32 from Leptospira kirschneri, strain RM52. The PCR products were amplified with these two pairs of primers, which had approximately 497 and 285bp, respectively, and were subsequently used as a template for LSSP-PCR analysis. The genetic signatures from the leptospires which were present in the urine samples allowed us to make a preliminary identification of the leptospires by comparing the LSSP-PCR profiles obtained directly from urine samples with those from reference leptospires. The LSSP-PCR profiles obtained with the Internal 1 primer or with the G1 primer allowed the grouping of the leptospires into serogroups. LSSP-PCR was found to be a useful and sensitive approach capable of identifying leptospires directly from biological samples without the need for prior bacterial isolation. In conclusion, the LSSP-PCR technique may still be helpful in discriminating serogroups of Leptospira from different animal reservoirs, since the early identification of carrier animals and information on the shedding state are crucial to prevent the spread of leptospiral infection to other animals and humans.
2015-01-01
Here, we present a universal, simple, efficient, and reliable way to add small BioBrick parts to any BioBrick via PCR that is compatible with BioBrick assembly standard 10. As a proof of principle, we have designed a universal primer, rbs_B0034, that contains a ribosomal binding site (RBS; BBa_B0034) and that can be used in PCR to amplify any coding BioBrick that starts with ATG. We performed test PCRs with rbs_B0034 on 31 different targets and found it to be 93.6% efficient. Moreover, when supplemented with a complementary primer, addition of RBS can be accomplished via whole plasmid site-directed mutagenesis, thus reducing the time required for further assembly of composite parts. The described method brings simplicity to the addition of small parts, such as regulatory elements to existing BioBricks. The final product of the PCR assembly is indistinguishable from the standard or 3A BioBrick assembly. PMID:25524097
Kamau, Everlyn; Agoti, Charles N; Lewa, Clement S; Oketch, John; Owor, Betty E; Otieno, Grieven P; Bett, Anne; Cane, Patricia A; Nokes, D James
2017-03-01
Direct immuno-fluorescence test (IFAT) and multiplex real-time RT-PCR have been central to RSV diagnosis in Kilifi, Kenya. Recently, these two methods showed discrepancies with an increasing number of PCR undetectable RSV-B viruses. Establish if mismatches in the primer and probe binding sites could have reduced real-time RT-PCR sensitivity. Nucleoprotein (N) and glycoprotein (G) genes were sequenced for real-time RT-PCR positive and negative samples. Primer and probe binding regions in N gene were checked for mismatches and phylogenetic analyses done to determine molecular epidemiology of these viruses. New primers and probe were designed and tested on the previously real-time RT-PCR negative samples. N gene sequences revealed 3 different mismatches in the probe target site of PCR negative, IFAT positive viruses. The primers target sites had no mismatches. Phylogenetic analysis of N and G genes showed that real-time RT-PCR positive and negative samples fell into distinct clades. Newly designed primers-probe pair improved detection and recovered previous PCR undetectable viruses. An emerging RSV-B variant is undetectable by a quite widely used real-time RT-PCR assay due to polymorphisms that influence probe hybridization affecting PCR accuracy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Fazelahi, Mansoureh; Kia, Vahid; Kaghazian, Hooman; Paryan, Mahdi
2017-11-26
Recombinant streptokinase is a biopharmaceutical which is usually produced in E. coli. Residual DNA as a contamination and risk factor may remain in the product. It is necessary to control the production procedure to exclude any possible contamination. The aim of the present study was to develop a highly specific and sensitive quantitative real-time PCR-based method to determine the amount of E. coli DNA in recombinant streptokinase. A specific primers and a probe was designed to detect all strains of E. coli. To determine the specificity, in addition to using NCBI BLASTn, 28 samples including human, bacterial, and viral genomes were used. The results confirmed that the assay detects no genomic DNA but E. coli's and the specificity was determined to be 100%. To determine the sensitivity and limit of detection of the assay, a 10-fold serial dilution (10 1 to 10 7 copies/µL) was tested in triplicate. The sensitivity of the test was determined to be 101 copies/µL or 35 fg/µL. Inter-assay and intra-assay were determined to be 0.86 and 1.69%, respectively. Based on the results, this assay can be used as an accurate method to evaluate the contamination of recombinant streptokinase in E. coli.
Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg
2002-12-01
The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.
Quantitative PCR for Detection and Enumeration of Genetic Markers of Bovine Fecal Pollution
Accurate assessment of health risks associated with bovine (cattle) fecal pollution requires a reliable host-specific genetic marker and a rapid quantification method. We report the development of quantitative PCR assays for the detection of two recently described cow feces-spec...
This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria (FIB), and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manure-amended agricultural soils. Known concentrations of transformed green...
This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria, and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manre-amended agricultural soils. Known concentrations of transformed green fluore...
Nie, Hui; Evans, Alison A.; London, W. Thomas; Block, Timothy M.; Ren, Xiangdong David
2011-01-01
Hepatitis B virus (HBV) carrying the A1762T/G1764A double mutation in the basal core promoter (BCP) region is associated with HBe antigen seroconversion and increased risk of liver cirrhosis and hepatocellular carcinoma (HCC). Quantification of the mutant viruses may help in predicting the risk of HCC. However, the viral genome tends to have nucleotide polymorphism, which makes it difficult to design hybridization-based assays including real-time PCR. Ultrasensitive quantification of the mutant viruses at the early developmental stage is even more challenging, as the mutant is masked by excessive amounts of the wild-type (WT) viruses. In this study, we developed a selective inhibitory PCR (siPCR) using a locked nucleic acid-based PCR blocker to selectively inhibit the amplification of the WT viral DNA but not the mutant DNA. At the end of siPCR, the proportion of the mutant could be increased by about 10,000-fold, making the mutant more readily detectable by downstream applications such as real-time PCR and DNA sequencing. We also describe a primer-probe partial overlap approach which significantly simplified the melting curve patterns and minimized the influence of viral genome polymorphism on assay accuracy. Analysis of 62 patient samples showed a complete match of the melting curve patterns with the sequencing results. More than 97% of HBV BCP sequences in the GenBank database can be correctly identified by the melting curve analysis. The combination of siPCR and the SimpleProbe real-time PCR enabled mutant quantification in the presence of a 100,000-fold excess of the WT DNA. PMID:21562108
Klosterman, Steven J.; Anchieta, Amy; McRoberts, Neil; Koike, Steven T.; Subbarao, Krishna V.; Voglmayr, Hermann; Choi, Young-Joon; Thines, Marco; Martin, Frank N.
2016-01-01
Downy mildew of spinach (Spinacia oleracea), caused by Peronospora effusa, is a production constraint on production worldwide, including in California, where the majority of U.S. spinach is grown. The aim of this study was to develop a real-time quantitative polymerase chain reaction (qPCR) assay for detection of airborne inoculum of P. effusa in California. Among oomycete ribosomal DNA (rDNA) sequences examined for assay development, the highest nucleotide sequence identity was observed between rDNA sequences of P. effusa and P. schachtii, the cause of downy mildew on sugar beet and Swiss chard in the leaf beet group (Beta vulgaris subsp. vulgaris). Single-nucleotide polymorphisms were detected between P. effusa and P. schachtii in the 18S rDNA regions for design of P. effusa- and P. schachtii-specific TaqMan probes and reverse primers. An allele-specific probe and primer amplification method was applied to determine the frequency of both P. effusa and P. schachtii rDNA target sequences in pooled DNA samples, enabling quantification of rDNA of P. effusa from impaction spore trap samples collected from spinach production fields. The rDNA copy numbers of P. effusa were, on average, ≈3,300-fold higher from trap samples collected near an infected field compared with those levels recorded at a site without a nearby spinach field. In combination with disease-conducive weather forecasting, application of the assays may be helpful to time fungicide applications for disease management. PMID:24964150
Yang, Litao; Liang, Wanqi; Jiang, Lingxi; Li, Wenquan; Cao, Wei; Wilson, Zoe A; Zhang, Dabing
2008-01-01
Background Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. Results We describe a real-time PCR technique employing attached universal duplex probes (AUDP), which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP) and a complementary quenching probe (QP) lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT) and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO) quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. Conclusion The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost. PMID:18522756
Monochloramine disinfection kinetics were determined for the pure culture ammonia-oxidizing bacterium Nitrosomonas europaea (ATCC 19718) by two culture independent methods: (1) LIVE/DEAD® BacLight™ (LD) and (2) propidium monoazide quantitative PCR (PMA-qPCR). Both methods were f...
Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....
Tomasello, Salvatore; Heubl, Günther
2017-07-01
The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.
Quantitative polymerase chain reaction (qPCR) is increasingly being used for the quantitative detection of fecal indicator bacteria in beach water. QPCR allows for same-day health warnings, and its application is being considered as an optionn for recreational water quality testi...
Pau, Chou-Pong; Wells, Susan K; Granade, Timothy C
2012-01-01
This chapter describes a real-time PCR method for the detection of HIV-1 proviral DNA in whole blood samples using a novel double-stranded primer system. The assay utilizes a simple commercially available DNA extraction method and a rapid and easy-to-perform real-time PCR protocol to consistently detect a minimum of four copies of HIV-1 group M proviral DNA in as little as 90 min after sample (whole blood) collection. Co-amplification of the human RNase P gene serves as an internal control to monitor the efficiency of both the DNA extraction and amplification. Once the assay is validated properly, it may be suitable as an alternative confirmation test for HIV-1 infections in a variety of HIV testing venues including the mother-to-child transmission testing sites, clinics, and diagnostic testing centers.
NASA Technical Reports Server (NTRS)
Newcombe, David; Stuecker, Tara; La Duc, Myron; Venkateswaran, Kasthuri
2005-01-01
Previous studies indicated evidence of opportunistic pathogens samples obtained during missions to the International Space Station (ISS). This study utilized TaqMan quantitative PCR to determine specific gene abundance in potable and non-potable ISS waters. Probe and primer sets specific to the small subunit rRNA genes were used to elucidate overall bacterial rRNA gene numbers. while those specific for Burkholderia cepacia and Stenotrophomonas maltophilia were optimized and used to probe for the presence of these two opportunistic pathogens. This research builds upon previous microbial diversity studies of ISS water and demonstrates the utility of Q-PCR tool to examine water quality.
Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing
2005-11-30
Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.
Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Luo, Yunbo; Xu, Wentao
2016-03-18
Digital polymerase chain reaction (PCR) has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ), sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP) sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO) genome samples using commercial digital PCR detection systems.
Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Luo, Yunbo; Xu, Wentao
2016-01-01
Digital polymerase chain reaction (PCR) has developed rapidly since it was first reported in the 1990s. However, pretreatments are often required during preparation for digital PCR, which can increase operation error. The single-plex amplification of both the target and reference genes may cause uncertainties due to the different reaction volumes and the matrix effect. In the current study, a quantitative detection system based on the pretreatment-free duplex chamber digital PCR was developed. The dynamic range, limit of quantitation (LOQ), sensitivity and specificity were evaluated taking the GA21 event as the experimental object. Moreover, to determine the factors that may influence the stability of the duplex system, we evaluated whether the pretreatments, the primary and secondary structures of the probes and the SNP effect influence the detection. The results showed that the LOQ was 0.5% and the sensitivity was 0.1%. We also found that genome digestion and single nucleotide polymorphism (SNP) sites affect the detection results, whereas the unspecific hybridization within different probes had little side effect. This indicated that the detection system was suited for both chamber-based and droplet-based digital PCR. In conclusion, we have provided a simple and flexible way of achieving absolute quantitation for genetically modified organism (GMO) genome samples using commercial digital PCR detection systems. PMID:26999129
Xu, Man; Arku, Benedict; Jartti, Tuomas; Koskinen, Janne; Peltola, Ville; Hedman, Klaus; Söderlund-Venermo, Maria
2017-05-15
Human bocavirus (HBoV) 1 can cause life-threatening respiratory tract infection in children. Diagnosing acute HBoV1 infection is challenging owing to long-term airway persistence. We assessed whether messenger RNA (mRNA) detection would correlate better than DNA detection with acute HBoV1 infection. Paired serum samples from 121 children with acute wheezing were analyzed by means of serology. Quantitative polymerase chain reaction (PCR) and reverse-transcription (RT) PCR were applied to nasopharyngeal swab (NPS) samples from all acutely HBoV1-infected children and from controls with nonacute infection. By serology, 16 of 121 children (13.2%) had acute HBoV1 infection, all of whom had HBoV1 DNA in NPS samples, and 12 of 16 (75%) had HBoV1 mRNA. Among 25 children with nondiagnostic results, 6 had HBoV1 DNA in NPS samples, and 1 had mRNA. All 13 mRNA-positive samples exhibited high DNA loads (≥106 copies/mL). No mRNA persisted for 2 weeks, whereas HBoV1 DNA persisted for 2 months in 4 children; 1 year later all 15 samples were DNA negative. Compared with serology, DNA PCR had high clinical sensitivity (100%) but, because of viral persistence, low specificity (76%). In contrast, mRNA RT-PCR had low clinical sensitivity (75%) but high specificity (96%). A combination of HBoV1 serology and nasopharyngeal DNA quantitative PCR and mRNA RT-PCR should be used for accurate diagnosis of HBoV1 infection. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Identification of Staphylococcus spp. using (GTG)₅-PCR fingerprinting.
Svec, Pavel; Pantůček, Roman; Petráš, Petr; Sedláček, Ivo; Nováková, Dana
2010-12-01
A group of 212 type and reference strains deposited in the Czech Collection of Microorganisms (Brno, Czech Republic) and covering 41 Staphylococcus species comprising 21 subspecies was characterised using rep-PCR fingerprinting with the (GTG)₅ primer in order to evaluate this method for identification of staphylococci. All strains were typeable using the (GTG)₅ primer and generated PCR products ranging from 200 to 4500 bp. Numerical analysis of the obtained fingerprints revealed (sub)species-specific clustering corresponding with the taxonomic position of analysed strains. Taxonomic position of selected strains representing the (sub)species that were distributed over multiple rep-PCR clusters was verified and confirmed by the partial rpoB gene sequencing. Staphylococcus caprae, Staphylococcus equorum, Staphylococcus sciuri, Staphylococcus piscifermentans, Staphylococcus xylosus, and Staphylococcus saprophyticus revealed heterogeneous fingerprints and each (sub)species was distributed over several clusters. However, representatives of the remaining Staphylococcus spp. were clearly separated in single (sub)species-specific clusters. These results showed rep-PCR with the (GTG)₅ primer as a fast and reliable method applicable for differentiation and straightforward identification of majority of Staphylococcus spp. Copyright © 2010 Elsevier GmbH. All rights reserved.
mcrA-Targeted Real-Time Quantitative PCR Method To Examine Methanogen Communities▿
Steinberg, Lisa M.; Regan, John M.
2009-01-01
Methanogens are of great importance in carbon cycling and alternative energy production, but quantitation with culture-based methods is time-consuming and biased against methanogen groups that are difficult to cultivate in a laboratory. For these reasons, methanogens are typically studied through culture-independent molecular techniques. We developed a SYBR green I quantitative PCR (qPCR) assay to quantify total numbers of methyl coenzyme M reductase α-subunit (mcrA) genes. TaqMan probes were also designed to target nine different phylogenetic groups of methanogens in qPCR assays. Total mcrA and mcrA levels of different methanogen phylogenetic groups were determined from six samples: four samples from anaerobic digesters used to treat either primarily cow or pig manure and two aliquots from an acidic peat sample stored at 4°C or 20°C. Only members of the Methanosaetaceae, Methanosarcina, Methanobacteriaceae, and Methanocorpusculaceae and Fen cluster were detected in the environmental samples. The three samples obtained from cow manure digesters were dominated by members of the genus Methanosarcina, whereas the sample from the pig manure digester contained detectable levels of only members of the Methanobacteriaceae. The acidic peat samples were dominated by both Methanosarcina spp. and members of the Fen cluster. In two of the manure digester samples only one methanogen group was detected, but in both of the acidic peat samples and two of the manure digester samples, multiple methanogen groups were detected. The TaqMan qPCR assays were successfully able to determine the environmental abundance of different phylogenetic groups of methanogens, including several groups with few or no cultivated members. PMID:19447957
Vitali, Beatrice; Pugliese, Ciro; Biagi, Elena; Candela, Marco; Turroni, Silvia; Bellen, Gert; Donders, Gilbert G. G.; Brigidi, Patrizia
2007-01-01
The microbial flora of the vagina plays a major role in preventing genital infections, including bacterial vaginosis (BV) and candidiasis (CA). An integrated approach based on PCR-denaturing gradient gel electrophoresis (PCR-DGGE) and real-time PCR was used to study the structure and dynamics of bacterial communities in vaginal fluids of healthy women and patients developing BV and CA. Universal eubacterial primers and Lactobacillus genus-specific primers, both targeted at 16S rRNA genes, were used in DGGE and real-time PCR analysis, respectively. The DGGE profiles revealed that the vaginal flora was dominated by Lactobacillus species under healthy conditions, whereas several potentially pathogenic bacteria were present in the flora of women with BV. Lactobacilli were the predominant bacterial population in the vagina for patients affected by CA, but changes in the composition of Lactobacillus species were observed. Real-time PCR analysis allowed the quantitative estimation of variations in lactobacilli associated with BV and CA diseases. A statistically significant decrease in the relative abundance of lactobacilli was found in vaginal fluids of patients with BV compared to the relative abundance of lactobacilli in the vaginal fluids of healthy women and patients with CA. PMID:17644631
A multiplex PCR for detection of six viruses in ducks.
Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong
2017-10-01
In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059
Torriani, S; Zapparoli, G; Dellaglio, F
1999-10-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.
Le Bourhis, Anne-Gaëlle; Saunier, Katiana; Doré, Joël; Carlier, Jean-Philippe; Chamba, Jean-François; Popoff, Michel-Robert; Tholozan, Jean-Luc
2005-01-01
A nested-PCR temporal temperature gradient gel electrophoresis (TTGE) approach was developed for the detection of bacteria belonging to phylogenetic cluster I of the genus Clostridium (the largest clostridial group, which represents 25% of the currently cultured clostridial species) in cheese suspected of late blowing. Primers were designed based on the 16S rRNA gene sequence, and the specificity was confirmed in PCRs performed with DNAs from cluster I and non-cluster I species as the templates. TTGE profiles of the PCR products, comprising the V5-V6 region of the 16S rRNA gene, allowed us to distinguish the majority of cluster I species. PCR-TTGE was applied to analyze commercial cheeses with defects. All cheeses gave a signal after nested PCR, and on the basis of band comigration with TTGE profiles of reference strains, all the bands could be assigned to a clostridial species. The direct identification of Clostridium spp. was confirmed by sequencing of excised bands. C. tyrobutyricum and C. beijerinckii contaminated 15 and 14 of the 20 cheese samples tested, respectively, and C. butyricum and C. sporogenes were detected in one cheese sample. Most-probable-number counts and volatile fatty acid were determined for comparison purposes. Results obtained were in agreement, but only two species, C. tyrobutyricum and C. sporogenes, could be isolated by the plating method. In all cheeses with a high amount of butyric acid (>100 mg/100 g), the presence of C. tyrobutyricum DNA was confirmed by PCR-TTGE, suggesting the involvement of this species in butyric acid fermentation. These results demonstrated the efficacy of the PCR-TTGE method to identify Clostridium in cheeses. The sensitivity of the method was estimated to be 100 CFU/g. PMID:15640166
Geng, J; Liu, C; Zhou, X C; Ma, J; Du, L; Lu, J; Zhou, W N; Hu, T T; Lyu, L J; Yin, A H
2017-02-25
Objective: To develop a new method based on droplet digital PCR (DD-PCR) for detection and quantification of maternal cell contamination in prenatal diagnosis. Methods: Invasive prenatal samples from 40 couples of β(IVS-Ⅱ-654)/β(N) thalassemia gene carriers who accepted prenatal diagnosis in Affiliated Women and Children's Hospital of Guangzhou Medical University from October 2015 to December 2016 were analyzed retrospectively. Specific primers and probes were designed. The concentration gradient were 50%, 25%, 12.5%, 6.25%, 3.125%, 1.562 5%. There were 40 groups of prenatal diagnostic samples. Comparing DD-PCR with quantitative fluorescent-PCR (QF-PCR) based on the short tandem repeats for assement of the sensitivity and accuracy of maternal cell contamination, respectively. Results: DD-PCR could quantify the maternal cell contamination as low as 1.562 5%. The result was proportional to the dilution titers. In the 40 prenatal samples, 6 cases (15%, 6/40) of maternal cell contamination were detected by DD-PCR, while the QF-PCR based on short tandem repeat showed 3 cases (7.5%, 3/40) with maternal cell contamination, DD-PCR was more accurate ( P= 0.002) . Conclusion: DD-PCR is a precise and sensitive method in the detection of maternal cell contamintation. It could be useful in clinical application.
Noorbazargan, Hassan; Nadji, Seyed Alireza; Samiee, Siamak Mirab; Paryan, Mahdi; Mohammadi-Yeganeh, Samira
2018-04-01
Background Viral load measurement is commonly applicable to monitor HIV infection in patients to determine the number of HIV-RNA in serum samples of individuals. The aim of the present study was to set up a highly specific, sensitive, and reproducible home-brewed Real-time PCR assay based on TaqMan chemistry to quantify HIV-1 RNA genome. Methods In this study, three sets of primer pairs and a TaqMan probe were designed for HIV subtypes conserved sequences. An internal control was included in this assay to evaluate the presence of inhibition. Standard curve and threshold cycle values were determined using in vitro transcribed RNA from int region of HIV-1. A serial dilution of RNA standards was generated by in vitro transcription, from 10 to 10 9 copies/ml to find the sensitivity and the limit of detection (LOD) of the assay and to evaluate its performance in a quantitative RT-PCR assay. Results The assay has a low LOD equivalent to 33.13 copies/ml of HIV-1 RNA and a linear range of detection from 10 to 10 9 copies/ml. The coefficient of variation (CV) for Inter and Intra-assay precision of this in-house HIV Real-time RT-PCR ranged from 0.28 to 2.49% and 0.72 to 4.47%, respectively. The analytical and clinical specificity was 100%. Conclusions The results indicate that the developed method has a suitable specificity and sensitivity and is highly reproducible and cost-benefit. Therefore, it will be useful to monitor HIV infection in plasma samples of individuals.
Real-Time PCR Quantification Using A Variable Reaction Efficiency Model
Platts, Adrian E.; Johnson, Graham D.; Linnemann, Amelia K.; Krawetz, Stephen A.
2008-01-01
Quantitative real-time PCR remains a cornerstone technique in gene expression analysis and sequence characterization. Despite the importance of the approach to experimental biology the confident assignment of reaction efficiency to the early cycles of real-time PCR reactions remains problematic. Considerable noise may be generated where few cycles in the amplification are available to estimate peak efficiency. An alternate approach that uses data from beyond the log-linear amplification phase is explored with the aim of reducing noise and adding confidence to efficiency estimates. PCR reaction efficiency is regressed to estimate the per-cycle profile of an asymptotically departed peak efficiency, even when this is not closely approximated in the measurable cycles. The process can be repeated over replicates to develop a robust estimate of peak reaction efficiency. This leads to an estimate of the maximum reaction efficiency that may be considered primer-design specific. Using a series of biological scenarios we demonstrate that this approach can provide an accurate estimate of initial template concentration. PMID:18570886
Lee, Hong Kai; Lee, Chun Kiat; Loh, Tze Ping; Tang, Julian Wei-Tze; Chiu, Lily; Tambyah, Paul A; Sethi, Sunil K; Koay, Evelyn Siew-Chuan
2010-09-01
With the relative global lack of immunity to the pandemic influenza A/H1N1/2009 virus that emerged in April 2009 as well as the sustained susceptibility to infection, rapid and accurate diagnostic assays are essential to detect this novel influenza A variant. Among the molecular diagnostic methods that have been developed to date, most are in tandem monoplex assays targeting either different regions of a single viral gene segment or different viral gene segments. We describe a dual-gene (duplex) quantitative real-time RT-PCR method selectively targeting pandemic influenza A/H1N1/2009. The assay design includes a primer-probe set specific to only the hemagglutinin (HA) gene of this novel influenza A variant and a second set capable of detecting the nucleoprotein (NP) gene of all swine-origin influenza A virus. In silico analysis of the specific HA oligonucleotide sequence used in the assay showed that it targeted only the swine-origin pandemic strain; there was also no cross-reactivity against a wide spectrum of noninfluenza respiratory viruses. The assay has a diagnostic sensitivity and specificity of 97.7% and 100%, respectively, a lower detection limit of 50 viral gene copies/PCR, and can be adapted to either a qualitative or quantitative mode. It was first applied to 3512 patients with influenza-like illnesses at a tertiary hospital in Singapore, during the containment phase of the pandemic (May to July 2009).
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.