Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...
Polymerase chain displacement reaction.
Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang
2013-02-01
Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.
Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas
2010-01-01
Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158
Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine
2007-02-01
In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.
HSV2 acute retinal necrosis: diagnosis and monitoring with quantitative polymerase chain reaction.
Cottet, L; Kaiser, L; Hirsch, H H; Baglivo, E
2009-06-01
To describe a case of HSV2 acute retinal necrosis (ARN) diagnosed and monitored with quantitative polymerase chain reaction (PCR) in ocular fluids. Case report. Quantitative PCR was performed in the aqueous humor (AH) and vitreous using primers specific for herpes virus. A positive PCR was found for HSV2 in the AH (>100,000,000 viral copies - 8.00 log/ml). After therapy, another anterior chamber tap showed a reduction of the viral load at 4.28 log/ml (19205 copies), confirming the efficacy of the treatment. After six months, PCR on the vitreous still showed the presence of HSV2 viral particles in the eye (3.14 log DNA copies/ml, 1379 copies) although the lesion was healed. This case demonstrates that PCR is useful to detect viral DNA in AH and vitreous and to monitor viral activity and therapeutic response. Viral DNA persists in ocular fluids for months in the presence of a healed infection.
Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.
Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava
2018-05-01
Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.
Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong
2015-01-01
The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.
Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.
Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z
2017-03-01
The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.
Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu
2011-09-01
To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.
Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu
2014-04-01
The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.
Lo, Yat-Tung; Shaw, Pang-Chui
2017-10-25
Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.
Quantitative analysis of periodontal pathogens by ELISA and real-time polymerase chain reaction.
Hamlet, Stephen M
2010-01-01
The development of analytical methods enabling the accurate identification and enumeration of bacterial species colonizing the oral cavity has led to the identification of a small number of bacterial pathogens that are major factors in the etiology of periodontal disease. Further, these methods also underpin more recent epidemiological analyses of the impact of periodontal disease on general health. Given the complex milieu of over 700 species of microorganisms known to exist within the complex biofilms found in the oral cavity, the identification and enumeration of oral periodontopathogens has not been an easy task. In recent years however, some of the intrinsic limitations of the more traditional microbiological analyses previously used have been overcome with the advent of immunological and molecular analytical methods. Of the plethora of methodologies reported in the literature, the enzyme-linked immunosorbent assay (ELISA), which combines the specificity of antibody with the sensitivity of simple enzyme assays and the polymerase chain reaction (PCR), has been widely utilized in both laboratory and clinical applications. Although conventional PCR does not allow quantitation of the target organism, real-time PCR (rtPCR) has the ability to detect amplicons as they accumulate in "real time" allowing subsequent quantitation. These methods enable the accurate quantitation of as few as 10(2) (using rtPCR) to 10(4) (using ELISA) periodontopathogens in dental plaque samples.
Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.
2011-01-01
Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.
Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre
2002-01-01
Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.
Basic quantitative polymerase chain reaction using real-time fluorescence measurements.
Ares, Manuel
2014-10-01
This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.
Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A
2008-12-01
One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov
2014-01-01
A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.
Polymerase chain reaction system
Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.
2004-03-02
A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.
Bridge, Julia A
2017-01-01
The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.
Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn
2013-06-01
A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.
Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...
Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei
2018-06-01
The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8 copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4 copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1 copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.
The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...
Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur
2017-05-17
Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.
Kwok, Lai-yu; Zhang, Jiachao; Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping
2014-01-01
The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.
Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping
2014-01-01
The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota. PMID:24699404
Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi
2013-01-01
A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nasarabadi, Shanavaz
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less
Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi
2008-07-23
A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.
Olivero, S; Maroc, C; Beillard, E; Gabert, J; Nietfeld, W; Chabannon, C; Tonnelle, C
2000-09-01
The Ikaros gene is an essential regulator in development and haematopoiesis. Dysregulated Ikaros gene expression participates in leukaemic processes, as evidenced in animal models, and by analyses of blast-cell populations from leukaemic patients. We used real-time quantitative polymerase chain reaction (PCR) to evaluate the relative abundance of several Ikaros transcript isoforms in a variety of leukaemic-cell samples. Total RNA was isolated from bone-marrow or blood-cell samples collected at diagnosis in children or adult patients, 18 of whom had acute myeloblastic leukaemia (AML), 61 of whom had acute lymphoblastic leukaemia (ALL) and 11 of whom had chronic myeloid leukaemia (CML). The ratio (Ik1 + Ik2)/(Ik1 + Ik2 + Ik4 + Ik7 + Ik8) ranged from 13.5% to 85% and was lower (P < 0. 05) in samples from patients with m-bcr-abl ALL. An alternative splicing resulting in the deletion of 30 nucleotides at the end of exon 6 was observed in leukaemic samples, and in normal thymus and bone marrow. Our results are consistent with previous reports and suggest that the pattern of expression of the different human Ikaros isoforms are not homogeneous among different subsets of leukaemias.
Scherrer, Simone; Frei, Daniel; Wittenbrink, Max Michael
2016-12-01
Progressive atrophic rhinitis (PAR) in pigs is caused by toxigenic Pasteurella multocida. In Switzerland, PAR is monitored by selective culture of nasal swabs and subsequent polymerase chain reaction (PCR) screening of bacterial colonies for the P. multocida toxA gene. A panel of 203 nasal swabs from a recent PAR outbreak were used to evaluate a novel quantitative real-time PCR for toxigenic P. multocida in porcine nasal swabs. In comparison to the conventional PCR with a limit of detection of 100 genome equivalents per PCR reaction, the real-time PCR had a limit of detection of 10 genome equivalents. The real-time PCR detected toxA-positive P. multocida in 101 samples (49.8%), whereas the conventional PCR was less sensitive with 90 toxA-positive samples (44.3%). In comparison to the real-time PCR, 5.4% of the toxA-positive samples revealed unevaluable results by conventional PCR. The approach of culture-coupled toxA PCR for the monitoring of PAR in pigs is substantially improved by a novel quantitative real-time PCR.
Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori
2016-08-01
On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.
USDA-ARS?s Scientific Manuscript database
A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...
Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E
2017-08-01
The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.
Problem-Solving Test: Real-Time Polymerase Chain Reaction
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2009-01-01
Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…
NASA Astrophysics Data System (ADS)
Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.
1992-04-01
Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.
Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn
2009-08-01
A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.
Marconcini, Simone; Covani, Ugo; Barone, Antonio; Vittorio, Orazio; Curcio, Michele; Barbuti, Serena; Scatena, Fabrizio; Felli, Lamberto; Nicolini, Claudio
2011-07-01
Periodontitis is a complex multifactorial disease and is typically polygenic in origin. Genes play a fundamental part in each biologic process forming complex networks of interactions. However, only some genes have a high number of interactions with other genes in the network and may, therefore, be considered to play an important role. In a preliminary bioinformatic analysis, five genes that showed a higher number of interactions were identified and termed leader genes. In the present study, we use real-time quantitative polymerase chain reaction (PCR) technology to evaluate the expression levels of leader genes in the leukocytes of 10 patients with refractory chronic periodontitis and compare the expression levels with those of the same genes in 24 healthy patients. Blood was collected from 24 healthy human subjects and 10 patients with refractory chronic periodontitis and placed into heparinized blood collection tubes by personnel trained in phlebotomy using a sterile technique. Blood leukocyte cells were immediately lysed by using a kit for total RNA purification from human whole blood. Complementary DNA (cDNA) synthesis was obtained from total RNA and then real-time quantitative PCR was performed. PCR efficiencies were calculated with a relative standard curve derived from a five cDNA dilution series in triplicate that gave regression coefficients >0.98 and efficiencies >96%. The standard curves were obtained using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and growth factor receptor binding protein 2 (GRB2), casitas B-lineage lymphoma (CBL), nuclear factor-KB1 (NFKB1), and REL-A (gene for transcription factor p65) gene primers and amplified with 1.6, 8, 40, 200, and 1,000 ng/μL total cDNA. Curves obtained for each sample showed a linear relationship between RNA concentrations and the cycle threshold value of real-time quantitative PCR for all genes. Data were expressed as mean ± SE (SEM). The groups were compared to the analysis of variance. A
Yang, Jin-Long; Cheng, An-Chun; Wang, Ming-Shu; Pan, Kang-Cheng; Li, Min; Guo, Yu-Fei; Li, Chuan-Feng; Zhu, De-Kang; Chen, Xiao-Yue
2009-01-01
Background Goose parvovirus (GPV) is a Dependovirus associated with latent infection and mortality in geese. Currently, it severely affects geese production worldwide. The objective of this study was to develop a fluorescent quantitative real-time polymerase chain reaction (PCR) (FQ-PCR) assay for fast and accurate quantification of GPV DNA in infected goslings, which can aid in the understanding of the regular distribution pattern and the nosogenesis of GPV in vivo. Results The detection limit of the assay was 2.8 × 101 standard DNA copies, with a sensitivity of 3 logs higher than that of the conventional gel-based PCR assay targeting the same gene. The real-time PCR was reproducible, as shown by satisfactory low intraassay and interassay coefficients of variation. Conclusion The high sensitivity, specificity, simplicity, and reproducibility of the GPV fluorogenic PCR assay, combined with a high throughput, make this method suitable for a broad spectrum of GPV etiology-related applications. PMID:19754946
Lund, Vidar; Fonahn, Wenche; Pettersen, Jens Erik; Caugant, Dominique A; Ask, Eirik; Nysaeter, Ase
2014-09-01
Cases of Legionnaires' disease associated with biological treatment plants (BTPs) have been reported in six countries between 1997 and 2010. However, knowledge about the occurrence of Legionella in BTPs is scarce. Hence, we undertook a qualitative and quantitative screening for Legionella in BTPs treating waste water from municipalities and industries in Norway, to assess the transmission potential of Legionella from these installations. Thirty-three plants from different industries were sampled four times within 1 year. By cultivation, 21 (16%) of 130 analyses were positive for Legionella species and 12 (9%) of 130 analyses were positive for Legionella pneumophila. By quantitative real-time polymerase chain reaction (PCR), 433 (99%) of 437 analyses were positive for Legionella species and 218 (46%) of 470 analyses were positive for L. pneumophila. This survey indicates that PCR could be the preferable method for detection of Legionella in samples from BTPs. Sequence types of L. pneumophila associated with outbreaks in Norway were not identified from the BTPs. We showed that a waste water treatment plant with an aeration basin can produce high concentrations of Legionella. Therefore, these plants should be considered as a possible source of community-acquired Legionella infections.
Chase, D.M.; Elliott, D.G.; Pascho, R.J.
2006-01-01
Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.
Tricarico, Carmela; Pinzani, Pamela; Bianchi, Simonetta; Paglierani, Milena; Distante, Vito; Pazzagli, Mario; Bustin, Stephen A; Orlando, Claudio
2002-10-15
Careful normalization is essential when using quantitative reverse transcription polymerase chain reaction assays to compare mRNA levels between biopsies from different individuals or cells undergoing different treatment. Generally this involves the use of internal controls, such as mRNA specified by a housekeeping gene, ribosomal RNA (rRNA), or accurately quantitated total RNA. The aim of this study was to compare these methods and determine which one can provide the most accurate and biologically relevant quantitative results. Our results show significant variation in the expression levels of 10 commonly used housekeeping genes and 18S rRNA, both between individuals and between biopsies taken from the same patient. Furthermore, in 23 breast cancers samples mRNA and protein levels of a regulated gene, vascular endothelial growth factor (VEGF), correlated only when normalized to total RNA, as did microvessel density. Finally, mRNA levels of VEGF and the most popular housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were significantly correlated in the colon. Our results suggest that the use of internal standards comprising single housekeeping genes or rRNA is inappropriate for studies involving tissue biopsies.
Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F
2015-10-01
We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco
2015-05-27
This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.
Code of Federal Regulations, 2010 CFR
2010-01-01
... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...
Code of Federal Regulations, 2011 CFR
2011-01-01
... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...
A polymerase chain reaction strategy for the diagnosis of camelpox.
Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar
2009-03-01
Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.
Harms, Craig A.; Ottinger, Christopher A.; Blazer, Vicki S.; Densmore, Christine L.; Pieper, L.H.; Kennedy-Stoskopf, S.
2000-01-01
Fish morbidity and mortality events in Chesapeake Bay tributaries have aroused concern over the health of this important aquatic ecosystem. We applied a recently described method for quantifying mRNA of an immunosuppressive cytokine, transforming growth factor-β (TGF-β), by reverse transcription quantitative-competitive polymerase chain reaction to a field study of fish health in the Chesapeake Basin, and compared the results to those of a traditional cellular immunoassay macrophage bactericidal activity. We selected the white perch (Morone americana) as the sentinel fish species because of its abundance at all of the collection sites. White perch were sampled from Chesapeake Bay tributaries in June, August, and October 1998. Splenic mononuclear cell TGF-β mRNA levels increased and anterior kidney macrophage bactericidal activity decreased, particularly in eastern shore tributaries, from June to August and October. The results of the two assays correlated inversely (Kendall's τ b = -0.600; p = 0.0102). The results indicated both temporal and spatial modulation of white perch immune systems in the Chesapeake Basin, and demonstrated the utility of quantitative PCR for TGF-β as a molecular biomarker for field assessment of teleost fish immune status.
Determining Annealing Temperatures for Polymerase Chain Reaction
ERIC Educational Resources Information Center
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
Zhao, Lihong; Li, Ruiying; Liu, Aihua; Zhao, Shuping
2015-07-01
The objective of this study was to build and apply a duplex real time quantitative reverse transcription-polymerase chain reaction (RT-PCR) for rubella virus. Firstly, a 60-bp-long armored RV RNA was constructed in the laboratory. Secondly, a duplex real time RT-PCR assay was established. Thirdly, the 60-bp-long armored RV RNA was used as an internal positive control (IPC) for the duplex real time RT-PCR. And finally the duplex real time RT-PCR assay was applied to detect RV RNA in clinical specimens. The in-house assay has a high amplification efficiency (0.99), a high analytical sensitivity (200 copies/mL), and a good reproducibility. The diagnostic specificity and sensitivity of the in-house assay were both 100%, due to the monitoring of the armored RV RNA IPC. Therefore, the in-house duplex real time quantitative RT-PCR assay is a specific, sensitive, reproducible and accurate assay for quantitation of RV RNA in clinical specimens. And noncompetitive armored RV RNA IPC can monitor RT-PCR inhibition and prevent false-negative and inaccurate results in the real time detection system. Copyright © 2015 Elsevier B.V. All rights reserved.
Barakat, Fareed H; Luthra, Rajyalakshmi; Yin, C Cameron; Barkoh, Bedia A; Hai, Seema; Jamil, Waqar; Bhakta, Yaminiben I; Chen, Su; Medeiros, L Jeffrey; Zuo, Zhuang
2011-08-01
Nucleophosmin 1 (NPM1) is the most commonly mutated gene in acute myeloid leukemia. Detection of NPM1 mutations is useful for stratifying patients for therapy, predicting prognosis, and assessing for minimal residual disease. Several methods have been developed to rapidly detect NPM1 mutations in genomic DNA and/or messenger RNA specimens. To directly compare a quantitative real-time polymerase chain reaction (qPCR) assay with a widely used capillary electrophoresis assay for detecting NPM1 mutations. We adopted and modified a qPCR assay designed to detect the 6 most common NPM1 mutations and performed the assay in parallel with capillary electrophoresis assay in 207 bone marrow aspirate or peripheral blood samples from patients with a range of hematolymphoid neoplasms. The qPCR assay demonstrated a higher analytical sensitivity than the capillary electrophoresis 1/1000 versus 1/40, respectively. The capillary electrophoresis assay generated 10 equivocal results that needed to be repeated, whereas the qPCR assay generated only 1 equivocal result. After test conditions were optimized, the qPCR and capillary electrophoresis methods produced 100% concordant results, 85 positive and 122 negative. Given the higher analytical sensitivity and specificity of the qPCR assay, that assay is less likely to generate equivocal results than the capillary electrophoresis assay. Moreover, the qPCR assay is quantitative, faster, cheaper, less prone to contamination, and well suited for monitoring minimal residual disease.
Romand, Stéphane; Chosson, Muriel; Franck, Jacqueline; Wallon, Martine; Kieffer, François; Kaiser, Karine; Dumon, Henri; Peyron, François; Thulliez, Philippe; Picot, Stéphane
2004-03-01
Our purpose was to evaluate Toxoplasma gondii concentration in amniotic fluid (AF) samples as a prognostic marker of congenital toxoplasmosis. A retrospective study was carried out in 88 consecutive AF samples from 86 pregnant women, which were found positive by prospective polymerase chain reaction (PCR) testing. Parasite AF concentrations were estimated by real-time quantitative PCR and analyzed in relation to the clinical outcome of infected fetuses during pregnancy and at birth, taking into account the gestational age at maternal infection. A significant negative linear regression was observed between gestational age at maternal infection and T gondii DNA loads in AF. After adjusting for time at maternal seroconversion by multivariate analysis, higher parasite concentrations were significantly associated with a severe outcome of congenital infection (odds ratio [OR]=15.38/log (parasites/mL AF) [95% CI=2.45-97.7]). PCR quantification of T gondii in AF can be highly contributive for early prognosis of congenital toxoplasmosis. Maternal infections acquired before 20 weeks with a parasite load greater than 100/mL of AF have the highest risk of severe fetal outcome.
Jiang, Xin; Xue, Yang; Zhou, Hongzhi; Li, Shouhong; Zhang, Zongmin; Hou, Rui; Ding, Yuxiang; Hu, Kaijin
2015-10-01
Reference genes are commonly used as a reliable approach to normalize the results of quantitative polymerase chain reaction (qPCR), and to reduce errors in the relative quantification of gene expression. Suitable reference genes belonging to numerous functional classes have been identified for various types of species and tissue. However, little is currently known regarding the most suitable reference genes for bone, specifically for the sheep mandibular condyle. Sheep are important for the study of human bone diseases, particularly for temporomandibular diseases. The present study aimed to identify a set of reference genes suitable for the normalization of qPCR data from the mandibular condyle of sheep. A total of 12 reference genes belonging to various functional classes were selected, and the expression stability of the reference genes was determined in both the normal and fractured area of the sheep mandibular condyle. RefFinder, which integrates the following currently available computational algorithms: geNorm, NormFinder, BestKeeper, and the comparative ΔCt method, was used to compare and rank the candidate reference genes. The results obtained from the four methods demonstrated a similar trend: RPL19, ACTB, and PGK1 were the most stably expressed reference genes in the sheep mandibular condyle. As determined by RefFinder comprehensive analysis, the results of the present study suggested that RPL19 is the most suitable reference gene for studies associated with the sheep mandibular condyle. In addition, ACTB and PGK1 may be considered suitable alternatives.
Kidd, I M; Clark, D A; Emery, V C
2000-06-01
Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.
Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M
2014-12-10
A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.
Millon, Laurence; Larosa, Fabrice; Lepiller, Quentin; Legrand, Faezeh; Rocchi, Steffi; Daguindau, Etienne; Scherer, Emeline; Bellanger, Anne-Pauline; Leroy, Joel; Grenouillet, Frederic
2013-05-01
The aim of our study was to assess the detection of circulating DNA from the most common species of Mucorales for early diagnosis of mucormycosis in at-risk patients. We retrospectively evaluated a combination of 3 quantitative polymerase chain reaction (qPCR) assays using hydrolysis probes targeting Mucor/Rhizopus, Lichtheimia (formerly Absidia), and Rhizomucor for circulating Mucorales detection. Serial serum samples from 10 patients diagnosed with proven mucormycosis (2-9 samples per patient) were analyzed. No cross-reactivity was detected in the 3 qPCR assays using 19 reference strains of opportunistic fungi, and the limit of detection ranged from 3.7 to 15 femtograms/10 µL, depending on the species. DNA from Mucorales was detected in the serum of 9 of 10 patients between 68 and 3 days before mucormycosis diagnosis was confirmed by histopathological examination and/or positive culture. All the qPCR results were concordant with culture and/or PCR-based identification of the causing agents in tissue (Lichtheimia species, Rhizomucor species, and Mucor/Rhizopus species in 4, 3, and 2 patients, respectively). Quantitative PCR was negative in only 1 patient with proven disseminated mucormycosis caused by Lichtheimia species. Our study suggests that using specific qPCR targeting several species of Mucorales according to local ecology to screen at-risk patients could be useful in a clinical setting. The cost and efficacy of this strategy should be evaluated. However, given the human and economic cost of mucormycosis and the need for rapid diagnosis to initiate prompt directed antifungal therapy, this strategy could be highly attractive.
Peters, Iain R; Helps, Chris R; Calvert, Emma L; Hall, Edward J; Day, Michael J
2005-01-01
To examine the difference in expression of messenger RNA (mRNA) transcripts for polymeric immunoglobulin receptor (plgR), alpha-chain, and J-chain determined by use of quantitative real-time reverse transcription-polymerase chain reaction (QRT-PCR) assays in duodenal biopsy specimens obtained from dogs with and without chronic diarrhea. Biopsy specimens of the proximal portion of the duodenum were obtained endoscopically from 39 dogs evaluated because of chronic diarrhea (12 German Shepherd Dogs and 27 non-German Shepherd Dog breeds); specimens were also obtained from a control group of 7 dogs evaluated because of other gastrointestinal tract diseases and 2 dogs that were euthanatized as a result of nongastrointestinal tract disease. Dogs were anesthetized, and multiple mucosal biopsy specimens were obtained endoscopically at the level of the caudal duodenal flexure by use of biopsy forceps; in 2 control dogs, samples were obtained from the descending duodenum within 5 minutes of euthanasia. One-step QRT-PCR was used to quantify the level of expression of transcripts for the housekeeper gene glyceraldehyde-3-phosphate dehydrogenase, plgR, alpha-chain, and J-chain in duodenal mucosal tissue. There was no significant difference in the level of expression of any transcript among non-German Shepherd Dog breeds without diarrhea (control group), non-German Shepherd Dog breeds with chronic diarrhea, and German Shepherd Dogs with chronic diarrhea. Conclusions and Clinical Relevance-Results indicated that the susceptibility of German Shepherd Dogs to chronic diarrhea is not a result of simple failure of transcription of the key genes that encode molecules involved in mucosal IgA secretion.
Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A
2012-08-15
Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.
Garg, Pankaj
2017-07-01
Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.
Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.
Chen, Y T; Mercer, G O; Chen, Y
1993-11-01
Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.
Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves
2008-05-15
Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.
Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.
Makeyev, E V; Bamford, D H
2001-05-01
Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.
Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui
2016-05-01
In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.
Treff, Nathan R; Scott, Richard T
2013-03-15
Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...
Polymerase Chain Reaction for Detection of Systemic Plant Pathogens
USDA-ARS?s Scientific Manuscript database
This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...
Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.
Igarashi, T; Yamamoto, A; Goto, N
1996-10-01
Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.
Bowley, Lucas A; Alam, Farhana; Marentette, Julie R; Balshine, Sigal; Wilson, Joanna Y
2010-12-01
A growing concern over endocrine disruption in aquatic species has prompted the development of molecular assays to monitor environmental impacts. This study describes the development of quantitative polymerase chain reaction (qPCR) assays to characterize the expression of two vitellogenin (Vtg) genes in the invasive round goby (Neogobius melanostomus). Fragments from the 18SrRNA (housekeeping gene), Vtg II, and Vtg III genes were cloned and sequenced. The qPCR assays were developed to detect hepatic Vtg expression in goby. The assays detected induction of both Vtg genes in nonreproductive males following a two-week laboratory exposure to 17β-estradiol (≥1 mg/kg i.p. injection). The assays were applied to goby from Hamilton Harbour, Lake Ontario (Canada), including those from sites where feminization and intersex of goby has been documented. Both Vtg genes had significantly higher expression in females compared to males. Male reproductive goby adopt either parental or sneaker tactics; Vtg II expression was higher in sneaker than in parental males but parental and nonreproductive males did not differ from each other. The Vtg III expression was significantly higher in sneaker males followed by parental males and nonreproductive males, respectively. The Vtg II and III expression in nonreproductive males was elevated in the contaminated site with documented intersex. This assay provides an important tool for the use of an invasive species in monitoring endocrine disruption in the Great Lakes region. Copyright © 2010 SETAC.
Torr, Peter; Spiridonov, Sergei E; Heritage, Stuart; Wilson, Michael J
2007-03-01
1. Despite nematodes being the most abundant animals on earth, very few animal ecologists study them, probably because of the difficulties of identifying them to species by morphological methods. 2. A group of nematodes that are important both ecologically and economically is the entomopathogenic nematodes, which play a key role in regulating soil food webs and are sold throughout the world as biological insecticides, yet for which very little is known of their population ecology. 3. A novel detection and quantification method was developed for soil nematodes using real-time polymerase chain reaction (PCR), and the technique was used to estimate numbers of two closely related species of entomopathogenic nematodes, Steinernema kraussei and S. affine in 50 soil samples from 10 sites in Scotland representing two distinct habitats (woodland and grassland). 4. There was a high degree of correlation between our molecular and traditional morphological estimates of population size and our data clearly showed that Steinernema affine occurred only in grassland areas, whereas S. kraussei was found in grassland and woodland samples to a similar degree. 5. Real-time PCR offers a rapid and accurate method of detecting individual nematode species from soil samples without the need for a specialist taxonomist, and has much potential for use in studies of nematode population ecology.
Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo
2018-06-01
Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.
Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.
Ragheb, Suzan Mohammed; Jimenez, Luis
Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.
Richter, C.A.; Wright-Osment, Maureen K.; Zajicek, J.L.; Honeyfield, D.C.; Tillitt, D.E.
2009-01-01
The thiaminase I enzyme produced by the gram-positive bacterium Paenibacillus thiaminolyticus isolated from the viscera of Lake Michigan alewives Alosa pseudoharengus is currently the only defined source of the thiaminase activity linked to thiamine (vitamin B1) deficiency in early mortality syndrome (EMS) in the larvae of Great Lakes salmonines. Diets of alewife or isolated strains of P. thiaminolyticus mixed in a semipurified diet and fed to lake trout Salvelinus namaycush have been shown to produce EMS in fry. We utilized quantitative polymerase chain reaction (Q-PCR) to aid in studies of the sources of P. thiaminolyticus and thiaminase I. Quantitative PCR assays were established to detect the thiaminase I gene of P. thiaminolyticus, the 16S rRNA gene from most species of bacteria, and the 16S rRNA gene specifically from P. thiaminolyticus and a few closely related taxa. The Q-PCR assays are linear over at least six orders of magnitude and can detect the thiaminase I gene of P. thiaminolyticus from as few as 1,000 P. thiaminolyticus cells/g of sample or the Paenibacillus 16S rRNA gene from as few as 100 P. thiaminolyticus cells/g of sample. The initial results from alewife viscera samples with high thiaminase activity yielded unexpectedly low densities of P. thiaminolyticus cells; Paenibacillus thiaminolyticus was detectable in 2 of 6 alewife viscera tested at densities on the order of 100 cells/g out of 100,000,000 total bacterial cells/g. The low numbers of P. thiaminolyticus detected suggest that alewives contain additional non-P. thiaminolyticus sources of thiaminase activity.
Yin, Hua; Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Zhao, Junfeng; Dong, Jianjun; Yu, Junhong; Chang, Zongming
2016-08-01
Genome shuffling is an efficient and promising approach for the rapid improvement of microbial phenotypes. In this study, genome shuffling was applied to enhance the yield of glutathione produced by Saccharomyces cerevisiae YS86. Six isolates with subtle improvements in glutathione yield were obtained from populations generated by ultraviolet (UV) irradiation and nitrosoguanidine (NTG) mutagenesis. These yeast strains were then subjected to recursive pool-wise protoplast fusion. A strain library that was likely to yield positive colonies was created by fusing the lethal protoplasts obtained from both UV irradiation and heat treatments. After two rounds of genome shuffling, a high-yield recombinant YSF2-19 strain that exhibited 3.2- and 3.3-fold increases in glutathione production in shake flask and fermenter respectively was obtained. Comparative analysis of synthetase gene expression was conducted between the initial and shuffled strains using FQ (fluorescent quantitation) RT-PCR (reverse transcription polymerase chain reaction). Delta CT (threshold cycle) relative quantitation analysis revealed that glutathione synthetase gene (GSH-I) expression at the transcriptional level in the YSF2-19 strain was 9.9-fold greater than in the initial YS86. The shuffled yeast strain has a potential application in brewing, other food, and pharmaceutical industries. Simultaneously, the analysis of improved phenotypes will provide more valuable data for inverse metabolic engineering. Copyright © 2016 Elsevier B.V. All rights reserved.
The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.
Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W
2006-07-01
We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.
Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy
2015-01-01
Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier
Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R
2007-09-01
To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.
Code of Federal Regulations, 2014 CFR
2014-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Code of Federal Regulations, 2013 CFR
2013-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Code of Federal Regulations, 2012 CFR
2012-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Bédard, Emilie; Laferrière, Céline; Charron, Dominique; Lalancette, Cindy; Renaud, Christian; Desmarais, Nadia; Déziel, Eric; Prévost, Michèle
2015-11-01
To perform a post-outbreak prospective study of the Pseudomonas aeruginosa contamination at the faucets (water, aerator and drain) by culture and quantitative polymerase chain reaction (qPCR) and to assess environmental factors influencing occurrence A 450-bed pediatric university hospital in Montreal, Canada Water, aerator swab, and drain swab samples were collected from faucets and analyzed by culture and qPCR for the post-outbreak investigation. Water microbial and physicochemical parameters were measured, and a detailed characterization of the sink environmental and design parameters was performed. The outbreak genotyping investigation identified drains and aerators as the source of infection. The implementation of corrective measures was effective, but post-outbreak sampling using qPCR revealed 50% positivity for P. aeruginosa remaining in the water compared with 7% by culture. P. aeruginosa was recovered in the water, the aerator, and the drain in 21% of sinks. Drain alignment vs the faucet and water microbial quality were significant factors associated with water positivity, whereas P. aeruginosa load in the water was an average of 2 log higher for faucets with a positive aerator. P. aeruginosa contamination in various components of sink environments was still detected several years after the resolution of an outbreak in a pediatric university hospital. Although contamination is often not detectable in water samples by culture, P. aeruginosa is present and can recover its culturability under favorable conditions. The importance of having clear maintenance protocols for water systems, including the drainage components, is highlighted.
Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard
2013-05-30
Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.
Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.
Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng
2017-04-15
Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.
Krøjgaard, Louise H; Krogfelt, Karen A; Albrechtsen, Hans-Jørgen; Uldum, Søren A
2011-11-21
Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool for risk assessment. In water collected from the apartments Legionella spp were detected by qPCR in the concentration range from LOQ to 9.6*105GU/L while L. pneumophila were detected in a range from LOQ to 6.8*105 GU/L. By culturing, the legionellae were detected in the range from below detection limit (> 10 CFU/L) to 1.6*106 CFU/L. In circulating water and in first flush water from shower hoses, culture and qPCR showed the same tendencies. The overall correlation between the bacteria number detected by culture and the two developed qPCR assays (L. spp and L. pneumophila) was relatively poor (r2 = 0.31 for culture and Legionella spp. assay, r2 = 0.20 for culture and L. pneumophila assay). Detection by qPCR was suitable for monitoring changes in the concentration of Legionella but the precise determination of bacteria is difficult. Risk assessment by qPCR only on samples without any background information regarding treatment, timing, etc is dubious. However, the rapid detection by qPCR of high concentrations of Legionella - especially Legionella pneumophila - is valuable as an indicator of risk, although it may be false positive compared to culture results. On the other hand, the detection of a low number of bacteria by qPCR is a strong indication for the absence of risk.
Code of Federal Regulations, 2010 CFR
2010-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...
Code of Federal Regulations, 2011 CFR
2011-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...
Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A
2015-12-01
Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.
Kaliyaperumal, Subadra; Sankarapandian, Sathasivasubramanian
2016-01-01
The aim of this study was to quantitatively investigate the hypermethylation of p16 gene in buccal cells and saliva of oral submucous fibrosis (OSMF) patients using real-time quantitative methylation-specific polymerase chain reaction (PCR) and to compare the values of two methods. A total of 120 samples were taken from 60 subjects selected for this study, of which 30 were controls and 30 patients were clinically and histopathologically diagnosed with OSMF. In both groups, two sets of samples were collected, one directly from the buccal cells through cytobrush technique and the other through salivary rinse. We analyzed the samples for the presence of p16 hypermethylation using quantitative real-time PCR. In OSMF, the hypermethylation status of p16 in buccal cells was very high (93.3%) and in salivary samples, it was partially methylated (50%). However, no hypermethylation was found in controls suggesting that significant quantity of p16 hypermethylation was present in buccal cells and saliva in OSMF. This study indicates that buccal cell sampling may be a better method for evaluation than the salivary samples. It signifies that hypermethylation of p16 is an important factor to be considered in epigenetic alterations of normal cells to oral precancer, i.e. OSMF.
Bentley-Hewitt, Kerry L; Hedderley, Duncan I; Monro, John; Martell, Sheridan; Smith, Hannah; Mishra, Suman
2016-05-25
Experimental methods are constantly being improved by new technology. Recently a new technology, NanoString®, has been introduced to the market for the analysis of gene expression. Our experiments used adipose and liver samples collected from a rat feeding trial to explore gene expression changes resulting from a diet of 7.5% seaweed. Both quantitative real-time polymerase chain reaction (qPCR) and NanoString methods were employed to look at expression of genes related to fat and glucose metabolism and this paper compares results from both methods. We conclude that NanoString offers a valuable alternative to qPCR and our data suggest that results are more accurate because of the reduced sample handling and direct quantification of gene copy number without the need for enzymatic amplification. However, we have highlighted a potential challenge for both methods, which needs to be addressed when designing primers or probes. We suggest a literature search for known splice variants of a particular gene to be completed so that primers or probes can be designed that do not span exons which may be affected by alternative gene sequences. Copyright © 2016 Elsevier B.V. All rights reserved.
Identification of Brucella spp. by using the polymerase chain reaction.
Herman, L; De Ridder, H
1992-01-01
The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903
Detection of Listeria monocytogenes by using the polymerase chain reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bessesen, M.T.; Luo, Q.; Blaser, M.J.
1990-09-01
A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.
Mitran, Catherine J; Mbonye, Anthony K; Hawkes, Michael; Yanow, Stephanie K
2018-06-04
Malaria rapid diagnostic tests (RDTs) are widely used in clinical and surveillance settings. However, the performance of most RDTs has not been characterized at parasite densities below detection by microscopy. We present findings from Uganda, where RDT results from 491 participants with suspected malaria were correlated with quantitative polymerase chain reaction (qPCR)-defined parasitemia. Compared with qPCR, the sensitivity and specificity of the RDT for Plasmodium falciparum mono-infections were 76% (95% confidence interval [CI]: 68-83%) and 95% (95% CI: 92-97%), respectively. The sensitivity of the RDT at parasite densities between 0.2 and 200 parasites/μL was surprisingly high (87%, 95% CI: 74-94%). The high sensitivity of the RDT is likely because of histidine-rich protein 2 from submicroscopic infections, gametocytes, or sequestered parasites. These findings underscore the importance of evaluating different RDTs in field studies against qPCR reference testing to better define the sensitivity and specificity, particularly at low parasite densities.
Peng, Cheng; Wang, Hua; Xu, Xiaoli; Wang, Xiaofu; Chen, Xiaoyun; Wei, Wei; Lai, Yongmin; Liu, Guoquan; Godwin, Ian Douglas; Li, Jieqin; Zhang, Ling; Xu, Junfeng
2018-05-15
Gene editing techniques are becoming powerful tools for modifying target genes in organisms. Although several methods have been developed to detect gene-edited organisms, these techniques are time and labour intensive. Meanwhile, few studies have investigated high-throughput detection and screening strategies for plants modified by gene editing. In this study, we developed a simple, sensitive and high-throughput quantitative real-time (qPCR)-based method. The qPCR-based method exploits two differently labelled probes that are placed within one amplicon at the gene editing target site to simultaneously detect the wild-type and a gene-edited mutant. We showed that the qPCR-based method can accurately distinguish CRISPR/Cas9-induced mutants from the wild-type in several different plant species, such as Oryza sativa, Arabidopsis thaliana, Sorghum bicolor, and Zea mays. Moreover, the method can subsequently determine the mutation type by direct sequencing of the qPCR products of mutations due to gene editing. The qPCR-based method is also sufficiently sensitive to distinguish between heterozygous and homozygous mutations in T 0 transgenic plants. In a 384-well plate format, the method enabled the simultaneous analysis of up to 128 samples in three replicates without handling the post-polymerase chain reaction (PCR) products. Thus, we propose that our method is an ideal choice for screening plants modified by gene editing from many candidates in T 0 transgenic plants, which will be widely used in the area of plant gene editing. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.
Yamamura, Kensuke; Baba, Yoshifumi; Miyake, Keisuke; Nakamura, Kenichi; Shigaki, Hironobu; Mima, Kosuke; Kurashige, Junji; Ishimoto, Takatsugu; Iwatsuki, Masaaki; Sakamoto, Yasuo; Yamashita, Yoichi; Yoshida, Naoya; Watanabe, Masayuki; Baba, Hideo
2017-12-01
The human microbiome Fusobacterium nucleatum , which primarily inhabits the oral cavity, causes periodontal disease and has also been implicated in the development of colorectal cancer. However, whether F. nucleatum is present in other gastroenterological cancer tissues remains to be elucidated. The present study evaluated whether quantitative polymerase chain reaction (qPCR) assays were able to detect F. nucleatum DNA and measure the quantity of F. nucleatum DNA in esophageal, gastric, pancreatic and liver cancer tissues. The accuracy of the qPCR assay was determined from a calibration curve using DNA extracted from cells from the oral cavity. Formalin-fixed paraffin-embedded (FFPE) tumor tissues from 20 patients with gastroenterological [esophageal (squamous cell carcinoma), gastric, colorectal, pancreatic and liver] cancer and 20 matched normal tissues were evaluated for F. nucleatum DNA content. The cycle threshold values in the qPCR assay for F. nucleatum and solute carrier organic anion transporter family member 2A1 (reference sample) decreased linearly with the quantity of input DNA ( r 2 >0.99). The F. nucleatum detection rate in esophageal, gastric and colorectal cancer tissues were 20% (4/20), 10% (2/20) and 45% (9/20), respectively. F. nucleatum was not detected in liver and pancreatic cancer tissues. The qPCR results from the frozen and FFPE tissues were consistent. Notably, F. nucleatum was detected at a higher level in superficial areas compared with the invasive areas. F. nucleatum in esophageal, gastric and colorectal cancer tissues was evaluated by qPCR using FFPE tissues. F. nucleatum may be involved in the development of esophageal, gastric and colorectal cancer.
Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A
2015-04-01
Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D
2009-12-01
The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.
Principles and applications of polymerase chain reaction in medical diagnostic fields: a review
Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio
2009-01-01
Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310
Detection of Trypanosoma cruzi by Polymerase Chain Reaction.
Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz
2016-01-01
American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
ERIC Educational Resources Information Center
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Choi, Eun-Jung; Lee, Sung-Hoon; Kim, Young-Jae
2009-03-01
Streptococcus mutans and Streptococcus sobrinus are closely associated with the development of early childhood caries (ECC). Recently, quantitative real-time polymerase chain reaction (qRT-PCR) has been used for rapid and accurate quantification of these bacterial species. This study aims to detect quantitatively the levels of S. mutans and S. sobrinus in plaque samples by qRT-PCR, and to assess their association with the prevalence of ECC in Korean preschool children. One hundred and five children (71 months old or younger) were examined and classified into three groups (caries-free, ECC, severe ECC). Dental plaque samples were collected and qRT-PCR was conducted using oligonucleotide primers specific for glucosyltransferase gene (S. mutans-gtfB, S. sobrinus-gtfU) and universal primer. Pearson's correlation test was conducted to evaluate the relationship between the dmfs (decayed, missing, or filled surfaces primary teeth) scores and the microbiological findings. There was a significant difference between the levels of S. mutans and S. sobrinus in the plaque samples of the three groups (P < 0.05). The proportion of S. sobrinus to S. mutans showed strong correlation to the dmfs scores (r = 0.748, P < 0.05). The qRT-PCR results of this study showed that children with ECC had higher level of S. mutans and S. sobrinus in their dental plaque samples. The children with higher ratio of S. sobrinus to S. mutans in their dental plaque showed higher incidence of ECC.
Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K
2014-01-01
Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.
Tattiyapong, P; Sirikanchana, K; Surachetpong, W
2018-02-01
Tilapia lake virus (TiLV) is an emerging pathogen associated with high mortalities of wild and farm-raised tilapia in different countries. In this study, a SYBR green-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay targeting segment three of the virus was developed to detect and quantify TiLV in clinical samples and experimentally challenged fish. All 30 field samples with clinical signs and history consistent with TiLV infection were positive for TiLV as detected by the developed RT-qPCR method. The RT-qPCR technique provided 100 and 10,000 times more sensitive for virus detection than those offered by the RT-PCR and virus isolation in cell culture methods, respectively. The detection limit of the RT-qPCR method was as low as two viral copies/μl. Moreover, the RT-qPCR technique could be applied for TiLV detection in various fish tissues including gills, liver, brain, heart, anterior kidney and spleen. Significantly, this study delivered an accurate and reliable method for rapid detection of TiLV viruses that facilitates active surveillance programme and disease containment. © 2017 John Wiley & Sons Ltd.
Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase
McInerney, Peter; Adams, Paul; Hadi, Masood Z.
2014-01-01
As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less
Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar
An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less
Yang, Yang; Wong, Gary; Ye, Baoguo; Li, Shihua; Li, Shanqin; Zheng, Haixia; Wang, Qiang; Liang, Mifang; Gao, George F; Liu, Lei; Liu, Yingxia; Bi, Yuhai
2017-06-01
The Zika virus (ZIKV) is an arbovirus that has spread rapidly worldwide within recent times. There is accumulating evidence that associates ZIKV infections with Guillain-Barré Syndrome (GBS) and microcephaly in humans. The ZIKV is genetically diverse and can be separated into Asian and African lineages. A rapid, sensitive, and specific assay is needed for the detection of ZIKV across various pandemic regions. So far, the available primers and probes do not cover the genetic diversity and geographic distribution of all ZIKV strains. To this end, we have developed a one-step quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay based on conserved sequences in the ZIKV envelope (E) gene. The detection limit of the assay was determined to be five RNA transcript copies and 2.94 × 10 -3 50% tissue culture infectious doses (TCID 50 ) of live ZIKV per reaction. The assay was highly specific and able to detect five different ZIKV strains covering the Asian and African lineages without nonspecific amplification, when tested against other flaviviruses. The assay was also successful in testing for ZIKV in clinical samples. Our assay represents an improvement over the current methods available for the detection ZIKV and would be valuable as a diagnostic tool in various pandemic regions.
Barletta, Francesca; Mercado, Erik; Ruiz, Joaquim; Ecker, Lucie; Lopez, Giovanni; Mispireta, Monica; Gil, Ana I.; Lanata, Claudio F.; Cleary, Thomas G.
2011-01-01
Background. Enteropathogenic Escherichia coli (EPEC) strains are pediatric pathogens commonly isolated from both healthy and sick children with diarrhea in areas of endemicity. The aim of this study was to compare the bacterial load of EPEC isolated from stool samples from children with and without diarrhea to determine whether bacterial load might be a useful tool for further study of this phenomenon. Methods. EPEC was detected by polymerase chain reaction (PCR) of colonies isolated on MacConkey plates from 53 diarrheal and 90 healthy children aged <2 years. DNA was isolated from stool samples by cetyltrimethylammonium bromide extraction. To standardize quantification by quantitative real-time PCR (qRT-PCR), the correlation between fluorescence threshold cycle and copy number of the intimin gene of EPEC E2348/69 was determined. Results. The detection limit of qRT-PCR was 5 bacteria/mg stool. The geometric mean load in diarrhea was 299 bacteria/mg (95% confidence interval [CI], 77–1164 bacteria/mg), compared with 29 bacteria/mg (95% CI, 10–87 bacteria/mg) in control subjects (P = .016). Bacterial load was significantly higher in children with diarrhea than in control subjects among children <12 months of age (178 vs 5 bacteria/mg; P = .006) and among children with EPEC as the sole pathogen (463 vs 24 bacteria/mg; P = .006). Conclusions. EPEC load measured by qRT-PCR is higher in diarrheal than in healthy children. qRT-PCR may be useful to study the relationship between disease and colonization in settings of endemicity. PMID:22028433
Pan, Min; Han, Jin; Zhen, Li; Yang, Xin; Li, Ru; Liao, Can; Li, Dong-Zhi
2016-02-01
To assess the clinical value of prenatal diagnosis of fetuses with increased nuchal translucency (NT) using an approach based on quantitative fluorescent polymerase chain reaction (QF-PCR) and chromosomal microarray (CMA). From January 2013 to October 2014, we included 175 pregnancies with fetal NT ≥ 3.5mm at 11-13 weeks' gestation who received chorionic villus sampling. QF-PCR was first used to rapidly detect common aneuploidies. The cases with a normal QF-PCR result were analyzed by CMA. Of the 175 cases, common aneuploidies were detected by QF-PCR in 53 (30.2%) cases (30 cases of trisomy 21, 12 cases of monosomy X, 7 cases of trisomy 18, 3 cases of trisomy 13 and 1 case of 47, XXY). Among the 122 cases with a normal QF-PCR result, microarray detected additional pathogenic copy number variants (CNVs) in 5.7% (7/122) of cases. Four cases would have expected to be detectable by conventional karyotyping because of large deletions/duplications (>10 Mb), leaving three cases (2.5%; 3/118) with pathogenic CNVs only detectable by CMA. It is rational to use a diagnostic strategy in which CMA is preceded by the less expensive, rapid, QF-PCR to detect common aneuploidies. CMA allows detection of a number of pathogenic chromosomal aberrations in fetuses with a high NT. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Chern, Eunice C; King, Dawn; Haugland, Richard; Pfaller, Stacy
2015-03-01
Mycobacterium avium (MA), Mycobacterium intracellulare (MI), and Mycobacterium avium subsp. paratuberculosis (MAP) are difficult to culture due to their slow growing nature. A quantitative polymerase chain reaction (qPCR) method for the rapid detection of MA, MI, and MAP can be used to provide data supporting drinking water biofilms as potential sources of human exposure. The aim of this study was to characterize two qPCR assays targeting partial 16S rRNA gene sequences of MA and MI and use these assays, along with two previously reported MAP qPCR assays (IS900 and Target 251), to investigate Mycobacterium occurrence in kitchen faucet biofilms. MA and MI qPCR assays demonstrated 100% specificity and sensitivity when evaluated against 18 non-MA complex, 76 MA, and 17 MI isolates. Both assays detected approximately 1,000 cells from a diluted cell stock inoculated on a sampling swab 100% of the time. DNA analysis by qPCR indicated that 35.3, 56.9 and 11.8% of the 51 kitchen faucet biofilm samples collected contained MA, MI, and MAP, respectively. This study introduces novel qPCR assays designed to specifically detect MA and MI in biofilm. Results support the use of qPCR as an alternative to culture for detection and enumeration of MA, MI, and MAP in microbiologically complex samples.
Adewale, B; Mafe, M A; Oyerinde, J P O
2005-01-01
Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.
Highly Reproducible Label Free Quantitative Proteomic Analysis of RNA Polymerase Complexes*
Mosley, Amber L.; Sardiu, Mihaela E.; Pattenden, Samantha G.; Workman, Jerry L.; Florens, Laurence; Washburn, Michael P.
2011-01-01
The use of quantitative proteomics methods to study protein complexes has the potential to provide in-depth information on the abundance of different protein components as well as their modification state in various cellular conditions. To interrogate protein complex quantitation using shotgun proteomic methods, we have focused on the analysis of protein complexes using label-free multidimensional protein identification technology and studied the reproducibility of biological replicates. For these studies, we focused on three highly related and essential multi-protein enzymes, RNA polymerase I, II, and III from Saccharomyces cerevisiae. We found that label-free quantitation using spectral counting is highly reproducible at the protein and peptide level when analyzing RNA polymerase I, II, and III. In addition, we show that peptide sampling does not follow a random sampling model, and we show the need for advanced computational models to predict peptide detection probabilities. In order to address these issues, we used the APEX protocol to model the expected peptide detectability based on whole cell lysate acquired using the same multidimensional protein identification technology analysis used for the protein complexes. Neither method was able to predict the peptide sampling levels that we observed using replicate multidimensional protein identification technology analyses. In addition to the analysis of the RNA polymerase complexes, our analysis provides quantitative information about several RNAP associated proteins including the RNAPII elongation factor complexes DSIF and TFIIF. Our data shows that DSIF and TFIIF are the most highly enriched RNAP accessory factors in Rpb3-TAP purifications and demonstrate our ability to measure low level associated protein abundance across biological replicates. In addition, our quantitative data supports a model in which DSIF and TFIIF interact with RNAPII in a dynamic fashion in agreement with previously published reports. PMID
Sarris, Andreas H; Jiang, Yunfang; Tsimberidou, Apostolia M; Thomaides, Athanasios; Rassidakis, George Z; Ford, Richard J; Medeiros, L Jeffrey; Cabanillas, Fernando; McLaughlin, Peter
2002-02-01
Fludarabine and rituximab (Rituxan; Genentech, Inc, South San Francisco, CA, and IDEC Pharmaceuticals, San Diego, CA) are active against indolent lymphomas. We have previously shown the safety and efficacy of the combination of FND (fludarabine/mitoxantrone/dexamethasone) in relapsed and subsequently untreated patients with stage IV indolent lymphomas. Currently, we treat patients with stage IV indolent lymphomas who are previously untreated, younger than 60 years, human immunodeficiency virus-negative, and have adequate organ and marrow function with FND and random assignment to concurrent or delayed administration of rituximab. We have developed a quantitative real-time polymerase chain reaction assay for t(14;18). With 1 μg of DNA, this assay detects 0.6 copies in 55% of reactions, as expected for the Poisson distribution. When 1μg of DNA was analyzed in duplicate, cells with the t(14;18) were detected in peripheral blood of 22% of 152 volunteer blood donors. Quantitation showed that numbers of t(14;18) cells were higher than the statistical upper normal limit (mean of all volunteer values plus standard deviations) in 2% of volunteer blood donors. By contrast, 36% of blood or marrow specimens from follicular lymphoma patients were positive, and the number of cells with t(14;18) was higher than the normal upper limit in 26%. The presence of cells with t(14;18) and their numbers are prospectively quantitated in blood and marrow of patients treated with FND plus rituximab to determine their clinical significance both at presentation and during therapy. Semin Oncol 29 (suppl 2):48-55. Copyright © 2002 by W.B. Saunders Company. Copyright © 2002 W.B. Saunders Company. All rights reserved.
Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai
2014-10-29
Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.
NASA Astrophysics Data System (ADS)
Pérez Urquiza, M.; Acatzi Silva, A. I.
2014-02-01
Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.
Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing
2005-11-30
Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.
Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.
Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T
1997-09-01
In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.
Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves
2009-01-01
Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390
Dual phase multiplex polymerase chain reaction
Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL
2008-10-07
Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.
Wang, F; Zhang, Y Q; Ding, J; Yu, L X
2017-10-18
To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions
Quantification of Wilms' tumor 1 mRNA by digital polymerase chain reaction.
Koizumi, Yuki; Furuya, Daisuke; Endo, Teruo; Asanuma, Kouichi; Yanagihara, Nozomi; Takahashi, Satoshi
2018-02-01
Wilms' tumor 1 (WT1) is overexpressed in various hematopoietic tumors and widely used as a marker of minimal residual disease. WT1 mRNA has been analyzed using quantitative real-time polymerase chain reaction (real-time PCR). In the present study, we analyzed 40 peripheral blood and bone marrow samples obtained from cases of acute myeloid leukemia, acute lymphoblastic leukemia, and myelodysplastic syndrome at Sapporo Medical University Hospital from April 2012 to January 2015. We performed quantification of WT1 was performed using QuantStudio 3D Digital PCR System (Thermo Fisher Scientific) and compared the results between digital PCR and real-time PCR technology. The correlation between digital PCR and real-time PCR was very strong (R = 0.99), and the detection limits of the two methods were equivalent. Digital PCR was able to accurately detect lower WT levels compared with real-time PCR. Digital PCR technology can thus be utilized to predict WT1/ABL1 expression level accurately and should thus be useful for diagnosis or the evaluation of drug efficiency in patients with leukemia.
Building block synthesis using the polymerase chain assembly method.
Marchand, Julie A; Peccoud, Jean
2012-01-01
De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).
Operario, Darwin J; Platts-Mills, James A; Nadan, Sandrama; Page, Nicola; Seheri, Mapaseka; Mphahlele, Jeffrey; Praharaj, Ira; Kang, Gagandeep; Araujo, Irene T; Leite, Jose Paulo G; Cowley, Daniel; Thomas, Sarah; Kirkwood, Carl D; Dennis, Francis; Armah, George; Mwenda, Jason M; Wijesinghe, Pushpa Ranjan; Rey, Gloria; Grabovac, Varja; Berejena, Chipo; Simwaka, Chibumbya J; Uwimana, Jeannine; Sherchand, Jeevan B; Thu, Hlaing Myat; Galagoda, Geethani; Bonkoungou, Isidore J O; Jagne, Sheriffo; Tsolenyanu, Enyonam; Diop, Amadou; Enweronu-Laryea, Christabel; Borbor, Sam-Aliyah; Liu, Jie; McMurry, Timothy; Lopman, Benjamin; Parashar, Umesh; Gentsch, John; Steele, A Duncan; Cohen, Adam; Serhan, Fatima; Houpt, Eric R
2017-01-01
Abstract Background The etiology of acute watery diarrhea remains poorly characterized, particularly after rotavirus vaccine introduction. Methods We performed quantitative polymerase chain reaction for multiple enteropathogens on 878 acute watery diarrheal stools sampled from 14643 episodes captured by surveillance of children <5 years of age during 2013–2014 from 16 countries. We used previously developed models of the association between pathogen quantity and diarrhea to calculate pathogen-specific weighted attributable fractions (AFs). Results Rotavirus remained the leading etiology (overall weighted AF, 40.3% [95% confidence interval {CI}, 37.6%–44.3%]), though the AF was substantially lower in the Americas (AF, 12.2 [95% CI, 8.9–15.6]), based on samples from a country with universal rotavirus vaccination. Norovirus GII (AF, 6.2 [95% CI, 2.8–9.2]), Cryptosporidium (AF, 5.8 [95% CI, 4.0–7.6]), Shigella (AF, 4.7 [95% CI, 2.8–6.9]), heat-stable enterotoxin-producing Escherichia coli (ST-ETEC) (AF, 4.2 [95% CI, 2.0–6.1]), and adenovirus 40/41 (AF, 4.2 [95% CI, 2.9–5.5]) were also important. In the Africa Region, the rotavirus AF declined from 54.8% (95% CI, 48.3%–61.5%) in rotavirus vaccine age-ineligible children to 20.0% (95% CI, 12.4%–30.4%) in age-eligible children. Conclusions Rotavirus remained the leading etiology of acute watery diarrhea despite a clear impact of rotavirus vaccine introduction. Norovirus GII, Cryptosporidium, Shigella, ST-ETEC, and adenovirus 40/41 were also important. Prospective surveillance can help identify priorities for further reducing the burden of diarrhea. PMID:28838152
Shin, Yun-Kyung; Nam, Ki-Woong; Park, Kwan Ha; Yoon, Jong-Man; Park, Kyung-Il
2014-11-26
The kinetoplastid parasite, Azumiobodo hoyamushi, is the causative agent of soft tunic syndrome (STS) in ascidians and leads to their mass mortality in Korean waters. This study was conducted to quantify A. hoyamushi density during the development of STS in the tunics of ascidians (Halocynthia roretzi) using real-time polymerase chain reaction (qPCR). The infection intensity of A. hoyamushi, as measured by qPCR, varied depending on the part of the tunic analyzed, as well as the stage of STS development. The highest infection intensity was recorded in the tunics of the siphons. The infection intensity of A. hoyamushi in the siphons was only 2.9 cell/tunic (area, 0.25 cm(2)) or 106.0 cell/gram tunic (GT) in the early phase of STS, but this value increased dramatically to 16,066 cells/tunic (0.25 cm(2)) or 617,004 cell/GT at the time of death. The number of A. hoyamushi parasites increased gradually and their distribution spread from the siphons to the other parts of the tunics. qPCR enabled the quantitation of A. hoyamushi and the results revealed that parasite density increased as STS progressed. In addition, our results suggested that the siphons might function as the portal of entry for A. hoyamushi during infection.
2017-01-01
We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring. PMID:28541661
Abramovici, Adi; Lobashevsky, Elena; Cliver, Suzanne P; Edwards, Rodney K; Hauth, John C; Biggio, Joseph R
2015-10-01
The aim of this study was to determine whether quantitative polymerase chain reaction (qPCR) bacterial load measurement is a valid method to assess response to treatment of bacterial vaginosis and risk of preterm birth in pregnant women. Secondary analysis by utilizing stored vaginal samples obtained during a previous randomized controlled trial studying the effect of antibiotics on preterm birth (PTB). All women had risk factors for PTB: (1) positive fetal fibronectin (n=146), (2) bacterial vaginosis (BV) and a prior PTB (n=43), or (3) BV and a prepregnancy weight<50 kg (n=54). Total and several individual BV-related bacteria loads were measured using qPCR for 16S rRNA. Loads were correlated with Nugent scores (Spearman correlation coefficients). Loads were compared pre- and posttreatment with Wilcoxon rank-sum test. Individual patient differences were examined with Wilcoxon signed-rank test. A total of 243 paired vaginal samples were available for analysis: 123 antibiotics and 120 placebo. Groups did not differ by risk factors for PTB. For all samples, bacterial loads were correlated with Nugent score and each of its specific bacterial components (all p<0.01). Baseline total bacterial load did not differ by treatment group (p=0.87). Posttreatment total bacterial load was significantly lower in the antibiotics group than the placebo group (p<0.01). Individual patient total bacterial load decreased significantly posttreatment in the antibiotics group (p<0.01), but not in the placebo group (p=0.12). The rate of PTB did not differ between groups (p=0.24). PTB relative risks calculated for BV positive versus BV negative women and women with the highest quartile total and individual bacterial loads were not statistically significant. qPCR correlates with Nugent score and demonstrates decreased bacterial load after antibiotic treatment. Therefore, it is a valid method of vaginal flora assessment in pregnant women who are at high risk for PTB. Thieme Medical Publishers
Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.
2012-01-01
The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694
Xu, Man; Arku, Benedict; Jartti, Tuomas; Koskinen, Janne; Peltola, Ville; Hedman, Klaus; Söderlund-Venermo, Maria
2017-05-15
Human bocavirus (HBoV) 1 can cause life-threatening respiratory tract infection in children. Diagnosing acute HBoV1 infection is challenging owing to long-term airway persistence. We assessed whether messenger RNA (mRNA) detection would correlate better than DNA detection with acute HBoV1 infection. Paired serum samples from 121 children with acute wheezing were analyzed by means of serology. Quantitative polymerase chain reaction (PCR) and reverse-transcription (RT) PCR were applied to nasopharyngeal swab (NPS) samples from all acutely HBoV1-infected children and from controls with nonacute infection. By serology, 16 of 121 children (13.2%) had acute HBoV1 infection, all of whom had HBoV1 DNA in NPS samples, and 12 of 16 (75%) had HBoV1 mRNA. Among 25 children with nondiagnostic results, 6 had HBoV1 DNA in NPS samples, and 1 had mRNA. All 13 mRNA-positive samples exhibited high DNA loads (≥106 copies/mL). No mRNA persisted for 2 weeks, whereas HBoV1 DNA persisted for 2 months in 4 children; 1 year later all 15 samples were DNA negative. Compared with serology, DNA PCR had high clinical sensitivity (100%) but, because of viral persistence, low specificity (76%). In contrast, mRNA RT-PCR had low clinical sensitivity (75%) but high specificity (96%). A combination of HBoV1 serology and nasopharyngeal DNA quantitative PCR and mRNA RT-PCR should be used for accurate diagnosis of HBoV1 infection. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Nishiura, T; Abe, K
1999-01-01
The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.
Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."
ERIC Educational Resources Information Center
Phelps, Tara L.; And Others
1996-01-01
Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…
Kölbl, Alexandra C; Hiller, Roman A; Ilmer, Mathias; Liesche, Friederike; Heublein, Sabine; Schröder, Lennard; Hutter, Stefan; Friese, Klaus; Jeschke, Udo; Andergassen, Ulrich
2015-08-01
Altered glycosylation is a predominant feature of tumour cells; it serves for cell adhesion and detachment, respectively, and facilitates the immune escape of these cells. Therefore changes in the expression of glycosyltransferase genes could help to identify circulating tumour cells (CTCs) in the blood samples of cancer patients using a quantitative polymerase chain reaction (PCR) approach. Blood samples of healthy donors were inoculated with certain numbers of established breast cancer cell line cells, thus creating a model system. These samples were analysed by quantitative PCR for the expression of six different glycosyltransferase genes. The three genes with the best results in the model system were consecutively applied to samples from adjuvant breast cancer patients and of healthy donors. FUT3 and GALNT6 showed the highest increase in relative expression, while GALNT6 and ST3GAL3 were the first to reach statistically significant different ∆CT-values comparing the sample with and without addition of tumour cells. These three genes were applied to patient samples, but did not show any significant results that may suggest the presence of CTCs in the blood. Although the relative expression of some of the glycosyltransferase genes exhibited reasonable results in the model system, their application to breast cancer patient samples will have to be further improved, e.g. by co-analysis of patient blood samples by gold-standard methods.
Lu, Jingrang; Gerke, Tammie L; Buse, Helen Y; Ashbolt, Nicholas J
2014-12-01
A quantitative polymerase chain reaction assay (115 bp amplicon) specific to Escherichia coli K12 with an ABI(TM) internal control was developed based on sequence data encoding the rfb gene cluster. Assay specificity was evaluated using three E. coli K12 strains (ATCC W3110, MG1655 & DH1), 24 non-K12 E. coli and 23 bacterial genera. The biofilm detection limit was 10(3) colony-forming units (CFU) E. coli K12 mL(-1), but required a modified protocol, which included a bio-blocker Pseudomonas aeruginosa with ethylenediaminetetraacetic acid buffered to pH 5 prior to cell lysis/DNA extraction. The novel protocol yielded the same sensitivity for drinking water biofilms associated with Fe3O4 (magnetite)-coated SiO2 (quartz) grains and biofilm-surface iron corrosion products from a drinking water distribution system. The novel DNA extraction protocol and specific E. coli K12 assay are sensitive and robust enough for detection and quantification within iron drinking water pipe biofilms, and are particularly well suited for studying enteric bacterial interactions within biofilms.
Cimino, Rubén O; Jeun, Rebecca; Juarez, Marisa; Cajal, Pamela S; Vargas, Paola; Echazú, Adriana; Bryan, Patricia E; Nasser, Julio; Krolewiecki, Alejandro; Mejia, Rojelio
2015-07-17
In resource-limited countries, stool microscopy is the diagnostic test of choice for intestinal parasites (soil-transmitted helminths and/or intestinal protozoa). However, sensitivity and specificity is low. Improved diagnosis of intestinal parasites is especially important for accurate measurements of prevalence and intensity of infections in endemic areas. The study was carried out in Orán, Argentina. A total of 99 stool samples from a local surveillance campaign were analyzed by concentration microscopy and McMaster egg counting technique compared to the analysis by multi-parallel quantitative real-time polymerase chain reaction (qPCR). This study compared the performance of qPCR assay and stool microscopy for 8 common intestinal parasites that infect humans including the helminths Ascaris lumbricoides, Ancylostoma duodenale, Necator americanus, Strongyloides stercoralis, Trichuris trichiura, and the protozoa Giardia lamblia, Cryptosporidium parvum/hominis, and Entamoeba histolytica, and investigated the prevalence of polyparasitism in an endemic area. qPCR showed higher detection rates for all parasites as compared to stool microscopy except T. trichiura. Species-specific primers and probes were able to distinguish between A. duodenale (19.1%) and N. americanus (36.4%) infections. There were 48.6% of subjects co-infected with both hookworms, and a significant increase in hookworm DNA for A. duodenale versus N. americanus (119.6 fg/μL: 0.63 fg/μL, P < 0.001) respectively. qPCR outperformed microscopy by the largest margin in G. lamblia infections (63.6% versus 8.1%, P < 0.05). Polyparasitism was detected more often by qPCR compared to microscopy (64.7% versus 24.2%, P < 0.05). Multi-parallel qPCR is a quantitative molecular diagnostic method for common intestinal parasites in an endemic area that has improved diagnostic accuracy compared to stool microscopy. This first time use of multi-parallel qPCR in Argentina has demonstrated the high
Stelzer, Erin A.; Strickler, Kriston M.; Schill, William B.
2012-01-01
During summer and early fall 2010, 15 river samples and 6 fecal-source samples were collected in West Virginia. These samples were analyzed by three laboratories for three microbial source tracking (MST) markers: AllBac, a general fecal indicator; BacHum, a human-associated fecal indicator; and BoBac, a ruminant-associated fecal indicator. MST markers were analyzed by means of the quantitative polymerase chain reaction (qPCR) method. The aim was to assess interlaboratory precision when the three laboratories used the same MST marker and shared deoxyribonucleic acid (DNA) extracts of the samples, but different equipment, reagents, and analyst experience levels. The term assay refers to both the markers and the procedure differences listed above. Interlaboratory precision was best for all three MST assays when using the geometric mean absolute relative percent difference (ARPD) and Friedman's statistical test as a measure of interlaboratory precision. Adjustment factors (one for each MST assay) were calculated using results from fecal-source samples analyzed by all three laboratories and applied retrospectively to sample concentrations to account for differences in qPCR results among labs using different standards and procedures. Following the application of adjustment factors to qPCR results, ARPDs were lower; however, statistically significant differences between labs were still observed for the BacHum and BoBac assays. This was a small study and two of the MST assays had 52 percent of samples with concentrations at or below the limit of accurate quantification; hence, more testing could be done to determine if the adjustment factors would work better if the majority of sample concentrations were above the quantification limit.
Shin, You Jung; Kim, Do Jin; Ryu, Hyun Mee; Kim, Moon Young; Han, Jung Yeol; Choi, June Seek
2016-01-01
Objective To validate quantitative fluorescent polymerase chain reaction (QF-PCR) via chorionic villus sampling (CVS) for the diagnosis of fetal aneuploidies. Methods We retrospectively reviewed the medical records of consecutive pregnant women who had undergone CVS at Cheil General Hospital between December 2009 and June 2014. Only cases with reported QF-PCR before long-term culture (LTC) for conventional cytogenetic analysis were included, and the results of these two methods were compared. Results A total of 383 pregnant women underwent QF-PCR and LTC via CVS during the study period and 403 CVS specimens were collected. The indications of CVS were as follows: abnormal first-trimester ultrasonographic findings, including increased fetal nuchal translucency (85.1%), advanced maternal age (6.8%), previous history of fetal anomalies (4.2%), and positive dual test results for trisomy 21 (3.9%). The results of QF-PCR via CVS were as follows: 76 (18.9%) cases were identified as trisomy 21 (36 cases), 18 (33 cases), or 13 (seven cases), and 4 (1.0%) cases were suspected to be mosaicism. All results of common autosomal trisomies by QF-PCR were consistent with those of LTC and there were no false-positive findings. Four cases suspected as mosaicism in QF-PCR were confirmed as non-mosaic trisomies of trisomy 21 (one case) or trisomy 18 (three cases) in LTC. Conclusion QF-PCR via CVS has the advantage of rapid prenatal screening at an earlier stage of pregnancy for common chromosomal trisomies and thus can reduce the anxiety of parents. In particular, it can be helpful for pregnant women with increased fetal nuchal translucency or abnormal first-trimester ultrasonographic findings. PMID:27896246
Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten
2005-03-01
We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.
Wang, Mei-Rong; Qiu, Ning; Lu, Shi-Chun; Xiu, Dian-Rong; Yu, Jian-Guo; Li, Tong; Liu, Xue-En; Zhuang, Hui
2011-05-01
To establish and optimize a sensitive and specific quantitative real-time polymerase chain reaction (PCR) method for detection of hepatitis B virus covalently closed circular DNA (HBV cccDNA) in liver tissue. Specific primers and probes were designed to detect HBV DNA (tDNA) and cccDNA. A series of plasmids (3.44 × 10(0) - 3.44 × 10(9) copies/µl) containing a full double-stranded copies of HBV genome (genotype C) were used to establish the standard curve of real-time PCR. Liver samples of 33 patients with HBV related hepatocellular carcinoma (HCC), 13 Chronic hepatitis B patients (CHB) and 10 non-HBV patients were collected to verify the sensitivity and specificity of the assay. A fraction of extracted DNA was digested with a Plasmid-Safe ATP-dependent Dnase (PSAD) for HBV cccDNA detection and the remaining was used for tDNA and β-globin detection. The amount (copies/cell) of HBV cccDNA and tDNA were measured by a real-time PCR, using β-globin housekeeping gene as a quantitation standard. The standard curves of real-time PCR with a linear range of 3.44 × 10(0) to 3.44 × 10(9) copies/µl were established for detecting HBV cccDNA and tDNA, and both of the lowest detection limits of HBV cccDNA and tDNA were 3.44 × 10(0) copies/µl. The lowest quantitation levels of HBV cccDNA in liver tissues tested in 33 HBV related HCC patients and 13 CHB patients were 0.003 copies/cell and 0.031 copies/cell, respectively. HBV cccDNA and tDNA in liver tissue of 10 non-HBV patient appeared to be negative. The true positive rate was increasing through the digestion of HBV DNA by PSAD, and the analytic specificity of cccDNA detection improved by 7.24 × 10(2) times. Liver tissues of 2 patients were retested 5 times in the PCR for detecting cccDNA and the coefficient of variations on cycle threshold (Ct) were between 0.224% - 0.609%. A highly sensitive and specific quantitative real time PCR method for the detection of HBV cccDNA in liver tissue was established and could be used
deWit, D; Wootton, M; Allan, B; Steyn, L
1993-01-01
A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752
Yang, Jie; Lin, Qi; Lin, Juan; Ye, Xiuyun
2016-01-01
With its ability to produce ligninolytic enzymes such as laccases, white-rot basidiomycete Cerrena unicolor, a medicinal mushroom, has great potential in biotechnology. Elucidation of the expression profiles of genes encoding ligninolytic enzymes are important for increasing their production. Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool to study transcriptional regulation of genes of interest. To ensure accuracy and reliability of qPCR analysis of C. unicolor, expression levels of seven candidate reference genes were studied at different growth phases, under various induction conditions, and with a range of carbon/nitrogen ratios and carbon and nitrogen sources. The stability of the genes were analyzed with five statistical approaches, namely geNorm, NormFinder, BestKeeper, the ΔCt method, and RefFinder. Our results indicated that the selection of reference genes varied with sample sets. A combination of four reference genes (Cyt-c, ATP6, TEF1, and β-tubulin) were recommended for normalizing gene expression at different growth phases. GAPDH and Cyt-c were the appropriate reference genes under different induction conditions. ATP6 and TEF1 were most stable in fermentation media with various carbon/nitrogen ratios. In the fermentation media with various carbon or nitrogen sources, 18S rRNA and GAPDH were the references of choice. The present study represents the first validation analysis of reference genes in C. unicolor and serves as a foundation for its qPCR analysis.
Dobrowsky, Penelope H; Khan, Sehaam; Khan, Wesaal
2017-10-01
Legionella and Acanthamoeba spp. persist in harvested rainwater pasteurized at high temperatures (> 72°C) and the interaction mechanisms exhibited between these organisms need to be elucidated. The resistance of two Legionella reference strains (Legionella pneumophila ATCC 33152 and Legionella longbeachae ATCC 33462), three environmental strains [Legionella longbeachae (env.), Legionella norrlandica (env.) and Legionella rowbothamii (env.)] and Acanthamoeba mauritaniensis ATCC 50676 to heat treatment (50-90°C) was determined by monitoring culturability and viability [ethidium monoazide quantitative polymerase chain reaction (EMA-qPCR)]. The expression of metabolic and virulence genes of L. pneumophila ATCC 33152 (lolA, sidF, csrA) and L. longbeachae (env.) (lolA) in co-culture with A. mauritaniensis ATCC 50676 during heat treatment (50-90°C) was monitored using relative qPCR. While the culturability (CFU/mL) and viability (gene copies/mL) of the Legionella strains reduced significantly (p < 0.05) following heat treatment (60-90°C), L. longbeachae (env.) and L. pneumophila ATCC 33152 were culturable following heat treatment at 50-60°C. Metabolically active trophozoites and dormant cysts of A. mauritaniensis ATCC 50676 were detected at 50°C and 60-90°C, respectively. For L. pneumophila ATCC 33152, lolA expression remained constant, sidF expression increased and the expression of csrA decreased during co-culture with A. mauritaniensis ATCC 50676. For L. longbeachae (env.), while lolA was up-regulated at 50-70°C, expression was not detected at 80-90°C and in co-culture. In conclusion, while heat treatment may reduce the number of viable Legionella spp. in monoculture, results indicate that the presence of A. mauritaniensis increases the virulence of L. pneumophila during heat treatment. The virulence of Legionella spp. in co-culture with Acanthamoeba spp. should thus be monitored in water distribution systems where temperature (heat) is utilized for treatment
Single cell digital polymerase chain reaction on self-priming compartmentalization chip.
Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying
2017-01-01
Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.
Single cell digital polymerase chain reaction on self-priming compartmentalization chip
Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying
2017-01-01
Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267
Park, Sang-Je; Huh, Jae-Won; Kim, Young-Hyun; Lee, Sang-Rae; Kim, Sang-Hyun; Kim, Sun-Uk; Kim, Heui-Soo; Kim, Min Kyu; Chang, Kyu-Tae
2013-05-01
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a specific and sensitive technique for quantifying gene expression. To analyze qRT-PCR data accurately, suitable reference genes that show consistent expression patterns across different tissues and experimental conditions should be selected. The objective of this study was to obtain the most stable reference genes in dogs, using samples from 13 different brain tissues and 10 other organs. 16 well-known candidate reference genes were analyzed by the geNorm, NormFinder, and BestKeeper programs. Brain tissues were derived from several different anatomical regions, including the forebrain, cerebrum, diencephalon, hindbrain, and metencephalon, and grouped accordingly. Combination of the three different analyses clearly indicated that the ideal reference genes are ribosomal protien S5 (RPS5) in whole brain, RPL8 and RPS5 in whole body tissues, RPS5 and RPS19 in the forebrain and cerebrum, RPL32 and RPS19 in the diencephalon, GAPDH and RPS19 in the hindbrain, and MRPS7 and RPL13A in the metencephalon. These genes were identified as ideal for the normalization of qRT-PCR results in the respective tissues. These findings indicate more suitable and stable reference genes for future studies of canine gene expression.
Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
Hyeon, Jiyeon; Cho, Soo Youn; Hong, Min Eui; Kang, So Young; Do, Ingu; Im, Young Hyuck; Cho, Eun Yoon
2017-09-01
Accurate testing for estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) is essential for breast cancer treatment. At present, immunohistochemistry (IHC)/florescence in situ hybridization (FISH) are widely accepted as the standard testing methods. To investigate the value of NanoString nCounter®, we performed its comparative analysis with IHC/FISH and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) for the assessment of ER, PR, and HER2. Data on IHC/FISH results for ER, PR, and HER2 in 240 patients from a single tertiary hospital in Korea were collected and compared with NanoString nCounter® and qRT-PCR results at a single institution. Expression levels for each gene using NanoString nCounter® showed good correlation with the corresponding data for protein expression by IHC ( p <0.001) and gene amplification status for HER2 ( p <0.001). Comparisons between gene expression and IHC data showed good overall agreement with a high area under the curve (AUC) for ESR1 /ER (AUC=0.939), PgR /PR (AUC=0.796), and HER2 /HER2 (AUC=0.989) ( p <0.001). The quantification of ER , PgR , and HER2 mRNA expression with NanoString nCounter® may be a viable alternative to conventional IHC/FISH methods.
Nested methylation-specific polymerase chain reaction cancer detection method
Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM
2007-05-08
A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.
Polymerase chain reaction with phase change as intrinsic thermal control
NASA Astrophysics Data System (ADS)
Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei
2013-04-01
This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.
Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M
1998-11-23
Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.
Sakai, Fuminori; Sonaty, Griffin; Watson, David; Klugman, Keith P; Vidal, Jorge E
2017-09-15
Identification of Streptococcus pneumoniae and its more than 90 serotypes is routinely conducted by culture and Quellung reactions. Quantitative polymerase chain reactions (qPCRs) have been developed for molecular detection, including a pan-pneumococcus lytA assay, and assays targeting 79 serotypes. Reactions require genomic DNA from every target to prepare standards, which can be time consuming. In this study, we have developed a synthetic DNA molecule as a surrogate for genomic DNA and present new single-plex qPCR reactions to increase molecular detection to 94 pneumococcal serotypes. Specificity of these new reactions was confirmed with a limit of detection between 2 and 20 genome equivalents/reaction. A synthetic DNA (NUversa, ∼8.2 kb) was then engineered to contain all available qPCR targets for serotyping and lytA. NUversa was cloned into pUC57-Amp-modified to generate pNUversa (∼10.2 kb). Standards prepared from pNUversa and NUversa were compared against standards made out of genomic DNA. Linearity [NUversa (R2 > 0.982); pNUversa (R2 > 0.991)] and efficiency of qPCR reactions were similar to those utilizing chromosomal DNA (R2 > 0.981). Quantification with plasmid pNUversa was affected, however, whereas quantification with synthetic NUversa was comparable to that of genomic DNA. Therefore, NUversa may be utilized as DNA standard in single-plex assays of the currently known 94 pneumococcal serotypes. © FEMS 2017.
Trends and advances in food analysis by real-time polymerase chain reaction.
Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin
2016-05-01
Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.
Dai, Lin; Huang, Juan; Tang, Yuan; Liao, Dian-ying; Dong, Dan-dan; Xu, Gang; Li, Gan-di
2010-06-01
To study the roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis (TL). Forty-six archival cases of histologically diagnosed TL, encountered during the period from April, 1999 to September, 2009 and with the paraffin-embedded lymph node tissue blocks available, were enrolled into the study. The presence of genome fragments of Toxoplasma gondii (T. gondii) was analyzed using semi-nested polymerase chain reaction (PCR). Thirty cases of one or two histopathologic triad of TL as the controls. The positive rate of PCR in TL group was 76.1% (35/46), as compared to 10.0% (3/30) in the control group. The difference was of statistical significance. The sensitivity and specificity of the histologic triad in diagnosing TL was 92.1% (35/38) and 71.1% (27/38), respectively. The predictive value of positive and negative PCR results was 76.1% (35/46) and 90.0% (27/30). respectively. The high specificity but low sensitivity of applying the histologic triad in diagnosing TL cases may be due to the occurrence of atypical histologic pattern. The sensitivity is improved with the use of semi-nested PCR in detecting T. gondii DNA.
Jung, Woo-Sun; Yang, Il-Hyung; Lim, Won Hee; Baek, Seung-Hak; Kim, Tae-Woo; Ahn, Sug-Joon
2015-12-01
To analyze in vivo mutans streptococci (MS) adhesion to self-ligating ceramic brackets [Clarity-SL (CSL) and Clippy-C (CC)] and the relationships between bacterial adhesion and oral hygiene indices. Four central incisor brackets from the maxilla and mandible were collected from 40 patients (20 patients per each bracket type) at debonding immediately after plaque and gingival indices were measured. Adhesions of Streptococcus mutans, S. sobrinus, and total bacteria were quantitatively determined using real-time polymerase chain reaction after genomic DNA was extracted. Factorial analysis of variance was used to analyze bacterial adhesion to the brackets with respect to the bracket type and jaw position. Correlation coefficients were calculated to determine the relationships of bacterial adhesion to oral hygiene indices. Adhesion of total bacteria and S. mutans to CSL was higher than that to CC (P < 0.001). Adhesion of total bacteria to the mandibular brackets was higher than that to the maxillary ones (P < 0.001), while adhesion of S. mutans to the maxillary brackets were higher than that in the mandibular ones (P < 0.001). In particular, the proportion of S. mutans to total bacteria in CSL was higher than CC (P < 0.05) in the maxillary anterior teeth (P < 0.001). There were no significant differences in adhesion of S. sobrinus between the brackets and jaw positions. Interestingly, no significant relationships were found between bacterial adhesions and oral hygiene indices. Complex bracket configurations may significantly influence bacterial adhesion to orthodontic brackets. Further in vivo study using bracket raw materials will help to define the relationships between bacteria adhesion and enamel demineralization. Because oral hygiene indices were not significantly correlated with adhesions of MS to self-ligating ceramic brackets, careful examinations around the brackets should be needed to prevent enamel demineralization, regardless of oral hygiene status. © The
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei
2008-12-01
We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection ofmore » target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.« less
Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun
2015-09-15
During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus. Copyright © 2015 Elsevier B.V. All rights reserved.
Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung
2012-08-01
Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; p<.001), and appropriate antibiotic usage was an independent predictor for more rapid bacterial clearance (coefficient, -0.995; p<.001). Patients with a slower rate of bacterial clearance experienced higher in-hospital mortality (odds ratio, 2.323; p=.04) Immunosuppression and appropriate antibiotic usage were independent factors affecting the rate of clearance of A. baumannii bacteremia in critical patients. These findings highlight the importance of appropriate antibiotic usage and
Theory and applications of the polymerase chain reaction.
Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A
1990-04-01
The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.
Integrated polymerase chain reaction/electrophoresis instrument
Andresen, Brian D.
2000-01-01
A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.
Senoo, M; Matsubara, Y; Fujii, K; Nagasaki, Y; Hiratsuka, M; Kure, S; Uehara, S; Okamura, K; Yajima, A; Narisawa, K
2000-04-01
Fetal somatic cell gene therapy could become an attractive solution for some congenital genetic diseases or the disorders which manifest themselves during the fetal period. We performed adenovirus-mediated gene transfer to mice and guinea pig fetuses in utero and evaluated the efficiency of gene transfer by histochemical analysis and a quantitative TaqMan-polymerase chain reaction (TaqMan-PCR) assay. We first injected a replication-deficient recombinant adenovirus containing the Escherichia coli LacZ gene driven by a CAG promoter (AxCALacZ) into pregnant mice through the amniotic space, placenta, or intraperitoneal space of the fetus. Histochemical analysis showed limited transgene expression in fetal tissues. We then administered AxCALacZ to guinea pig fetuses in the late stage of pregnancy through the umbilical vein. The highest beta-galactosidase expression was observed in liver followed by moderate expression in heart, spleen, and adrenal gland. The transgene expression was also present in kidney, intestine, and placenta to a lesser degree. No positively stained cells were observed in lung, muscle, or pancreas except in the vascular endothelium of these organs. Quantitative measurement of recombinant adenoviral DNA by the TaqMan-PCR assay showed that the vast majority of the injected viruses was present in liver. The current study indicated that adenovirus-mediated gene transfer into guinea pig fetus through the umbilical vein is feasible and results in efficient transgene expression in fetal tissues. The experimental procedures using pregnant guinea pigs might serve as a good experimental model for in utero gene transfer. Since our TaqMan-PCR assay detects the LacZ gene, one of the most widely used reporter genes, it may be generally applicable to adenovirus quantification in various gene transfer experiments.
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Piller, Nicolas; Decosterd, Isabelle; Suter, Marc R
2013-07-10
The reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a widely used, highly sensitive laboratory technique to rapidly and easily detect, identify and quantify gene expression. Reliable RT-qPCR data necessitates accurate normalization with validated control genes (reference genes) whose expression is constant in all studied conditions. This stability has to be demonstrated.We performed a literature search for studies using quantitative or semi-quantitative PCR in the rat spared nerve injury (SNI) model of neuropathic pain to verify whether any reference genes had previously been validated. We then analyzed the stability over time of 7 commonly used reference genes in the nervous system - specifically in the spinal cord dorsal horn and the dorsal root ganglion (DRG). These were: Actin beta (Actb), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal proteins 18S (18S), L13a (RPL13a) and L29 (RPL29), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and hydroxymethylbilane synthase (HMBS). We compared the candidate genes and established a stability ranking using the geNorm algorithm. Finally, we assessed the number of reference genes necessary for accurate normalization in this neuropathic pain model. We found GAPDH, HMBS, Actb, HPRT1 and 18S cited as reference genes in literature on studies using the SNI model. Only HPRT1 and 18S had been once previously demonstrated as stable in RT-qPCR arrays. All the genes tested in this study, using the geNorm algorithm, presented gene stability values (M-value) acceptable enough for them to qualify as potential reference genes in both DRG and spinal cord. Using the coefficient of variation, 18S failed the 50% cut-off with a value of 61% in the DRG. The two most stable genes in the dorsal horn were RPL29 and RPL13a; in the DRG they were HPRT1 and Actb. Using a 0.15 cut-off for pairwise variations we found that any pair of stable reference gene was sufficient for the normalization process
Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H
2002-07-01
Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.
Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao
2013-11-27
The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.
Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.
2008-01-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880
Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M
2008-09-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.
Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee
2012-07-09
Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Auvré, Frédéric; Coutier, Julien; Martin, Michèle T; Fortunel, Nicolas O
2018-05-08
Genetic and epigenetic characterization of the large cellular diversity observed within tissues is essential to understanding the molecular networks that ensure the regulation of homeostasis, repair, and regeneration, but also pathophysiological processes. Skin is composed of multiple cell lineages and is therefore fully concerned by this complexity. Even within one particular lineage, such as epidermal keratinocytes, different immaturity statuses or differentiation stages are represented, which are still incompletely characterized. Accordingly, there is presently great demand for methods and technologies enabling molecular investigation at single-cell level. Also, most current methods used to analyze gene expression at RNA level, such as RT-qPCR, do not directly provide quantitative data, but rather comparative ratios between two conditions. A second important need in skin biology is thus to determine the number of RNA molecules in a given cell sample. Here, we describe a workflow that we have set up to meet these specific needs, by means of transcript quantification in cellular micro-samples using flow cytometry sorting and reverse transcription-digital droplet polymerase chain reaction. As a proof-of-principle, the workflow was tested for the detection of transcription factor transcripts expressed at low levels in keratinocyte precursor cells. A linear correlation was found between quantification values and keratinocyte input numbers in a low quantity range from 40 cells to 1 cell. Interpretable signals were repeatedly obtained from single-cell samples corresponding to estimated expression levels as low as 10-20 transcript copies per keratinocyte or less. The present workflow may have broad applications for the detection and quantification of low-abundance nucleic acid species in single cells, opening up perspectives for the study of cell-to-cell genetic and molecular heterogeneity. Interestingly, the process described here does not require internal references
USDA-ARS?s Scientific Manuscript database
Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...
le Roux, Marie Cecilia; Hoosen, Anwar Ahmed
2017-01-01
This study was done to diagnose Mycoplasma genitalium infection based on bacterial load in urine specimens from symptomatic and asymptomatic men. Urine specimens from 94 men with visible urethral discharge, 206 with burning on micturition and 75 without symptoms presenting to a family practitioner were tested for M. genitalium as well as Neisseria gonorrhoeae, Chlamydia trachomatis, Trichomonas vaginalis by transcription-mediated amplification assays. A quantitative polymerase chain reaction assay was used to determine the bacterial load for all specimens in which M. genitalium was the only organism detected. Among the 375 specimens collected, M. genitalium was detected in 59 (15.7%) men (both symptomatic and asymptomatic) using the transcription-mediated amplification assay, and in 45 (12.0%) of the total population, it was the only pathogen detected. One or more pathogens were detected in 129 (43%) of the symptomatic men, with N. gonorrhoeae in 50 (16.7%); C. trachomatis in 37 (12.3%) and T. vaginalis present in 24 (8.0%) patients. Among the 17 patients where mixed infections were detected, M. genitalium with N. gonorrhoeae was the most common (11/17; 64.7%). Patients with visible urethral discharge had significantly higher M. genitalium concentrations than those with burning on micturition. The median M. genitalium load in symptomatic men was significantly higher than that in asymptomatic men. This study confirms the high prevalence of M. genitalium among men with urethritis in South Africa and demonstrates that there is a strong association with M. genitalium bacterial load and clinical urethritis. As the number of organisms increased, the severity of the symptoms increased, an indication of the role that the organism plays in disease progression.
Cornwell, Emily R.; Eckerlin, Geofrey E.; Getchell, Rodman G.; Groocock, Geoffrey H.; Thompson, Tarin M.; Batts, William N.; Casey, Rufina N.; Kurath, Gael; Winton, James R.; Bowser, Paul R.; Bain, Mark B.; Casey, James W.
2011-01-01
Viral hemorrhagic septicemia virus (VHSV) was first detected in the Laurentian Great Lakes in 2005 during a mortality event in the Bay of Quinte, Lake Ontario. Subsequent analysis of archived samples determined that the first known isolation of VHSV in the Laurentian Great Lakes was from a muskellunge Esox masquinongy collected in Lake St. Clair in 2003. By the end of 2008, mortality events and viral isolations had occurred in all of the Laurentian Great Lakes except Lake Superior. In 2009, a focused disease surveillance program was designed to determine whether VHSV was also present in Lake Superior. In this survey, 874 fish from 7 sites along the U.S. shoreline of Lake Superior were collected during June 2009. Collections were focused on nearshore species known to be susceptible to VHSV. All fish were dissected individually by using aseptic techniques and were tested for the presence of VHSV genetic material by use of a quantitative reverse transcription (qRT) polymerase chain reaction (PCR) targeting the viral nucleoprotein gene. Seventeen fish from two host species at two different sites tested positive at low levels for VHSV. All attempts to isolate virus in cell culture were unsuccessful. However, the presence of viral RNA was confirmed independently in five fish by using a nested PCR that targeted the glycoprotein (G) gene. Partial G gene sequences obtained from three fish were identical to the corresponding sequence from the original 2003 VHSV isolate (MI03) from muskellunge. These detections represent the earliest evidence for the presence of VHSV in Lake Superior and illustrate the utility of the highly sensitive qRT-PCR assay for disease surveillance in aquatic animals.
Polymerase chain reaction: A molecular diagnostic tool in periodontology
Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam
2016-01-01
This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822
Polymerase chain reaction: A molecular diagnostic tool in periodontology.
Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam
2016-01-01
This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.
Stepwise kinetic equilibrium models of quantitative polymerase chain reaction.
Cobbs, Gary
2012-08-16
Numerous models for use in interpreting quantitative PCR (qPCR) data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the literature. They also give better estimates of
DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.
Guthrie, J N; Moriarty, D J; Blackall, L L
2000-12-15
A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.
Quantification of Xylella fastidiosa from Citrus Trees by Real-Time Polymerase Chain Reaction Assay.
Oliveira, Antonio C; Vallim, Marcelo A; Semighini, Camile P; Araújo, Welington L; Goldman, Gustavo H; Machado, Marcos A
2002-10-01
ABSTRACT Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease of sweet orange cultivars in Brazil. Polymerase chain reaction (PCR)-based assays constitute the principal diagnostic method for detection of these bacteria. In this work, we established a real-time quantitative PCR (QPCR) assay to quantify X. fastidiosa in naturally and artificially infected citrus. The X. fastidiosa cell number detected in the leaves increased according to the age of the leaf, and bacteria were not detected in the upper midrib section in young leaves, indicating temporal and spatial distribution patterns of bacteria, respectively. In addition, the X. fastidiosa cell number quantified in leaves of 'Pera' orange and 'Murcott' tangor reflected the susceptible and resistant status of these citrus cultivars. None of the 12 endophytic citrus bacteria or the four strains of X. fastidiosa nonpathogenic to citrus that were tested showed an increase in the fluorescence signal during QPCR. In contrast, all 10 CVC-causing strains exhibited an increase in fluorescence signal, thus indicating the specificity of this QPCR assay. Our QPCR provides a powerful tool for studies of different aspects of the Xylella-citrus interactions, and can be incorporated into breeding programs in order to select CVC-resistant plants more quickly.
Identification of duck plague virus by polymerase chain reaction.
Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L
1999-01-01
A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
NASA Astrophysics Data System (ADS)
Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel
2010-12-01
Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.
Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R
2001-03-01
A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.
Paganin, Maddalena; Fabbri, Giulia; Conter, Valentino; Barisone, Elena; Polato, Katia; Cazzaniga, Giovanni; Giraldi, Eugenia; Fagioli, Franca; Aricò, Maurizio; Valsecchi, Maria Grazia; Basso, Giuseppe
2014-11-01
Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer. Monitoring minimal residual disease (MRD) by using real-time quantitative polymerase chain reaction (RQ-PCR) provides information for patient stratification and individual risk-directed treatment. Cooperative studies have documented that measurement of blast clearance from the bone marrow during and after induction therapy identifies patient populations with different risk of relapse. We explored the possible contribution of measurements of MRD during the course of treatment. We used RQ-PCR to detect MRD in 110 unselected patients treated in Italy in the International Collaborative Treatment Protocol for Children and Adolescents With Acute Lymphoblastic Leukemia (AIEOP-BFM ALL 2000). The trial took place in AIEOP centers during postinduction chemotherapy. Results were categorized as negative, low positive (below the quantitative range [< 5 × 10(-4)]), or high positive (≥ 5 × 10(-4)). Patients with at least one low-positive or high-positive result were assigned to the corresponding subgroup. Patients who tested high positive, low positive, or negative had significantly different cumulative incidences of leukemia relapse: 83.3%, 34.8%, and 8.6%, respectively (P < .001). Two thirds of positive cases were identified within 4 months after induction-consolidation therapy, suggesting that this time frame may be most suitable for cost-effective MRD monitoring, particularly in patients who did not clear their disease at the end of consolidation. These findings provide further insights into the dynamic of MRD and the ongoing effort to define molecular relapse in childhood ALL. © 2014 by American Society of Clinical Oncology.
The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...
ERIC Educational Resources Information Center
Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary
2006-01-01
We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…
Detection of human Pneumocystis carinii by the polymerase chain reaction.
Becker-Hapak, M; Liberator, P; Graves, D
1991-01-01
Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.
Development of the polymerase chain reaction for diagnosis of chancroid.
Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R
1993-01-01
The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959
Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus
Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.
2004-01-01
A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703
Use of polymerase chain reaction (PCR) in the diagnosis of congenital toxoplasmosis.
Loveridge-Easther, Cam; Yardley, Anne-Marie; Breidenstein, Brenda
2018-06-01
Congenital toxoplasmosis (CT) is a parasitic disease that causes serious fetal and neonatal harm or death. In countries that do not have antenatal screening programs, the initiation of CT treatment relies on a postnatal diagnosis. Until recently, diagnosis was based on clinical signs and immunoglobulin seropositivity, which is fraught with difficulty. In these cases, diagnosis was often delayed or treatment, which carries risk, started empirically. We highlight the use of polymerase chain reaction to diagnose a case of congenital toxoplasmosis, allowing early treatment and justifying the treatment burden. Copyright © 2018 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.
Xu, Qing; Zhu, Yazhen; Bai, Yali; Wei, Xiumin; Zheng, Xirun; Mao, Mao; Zheng, Guangjuan
2015-01-01
Background Two types of epidermal growth factor receptor (EGFR) mutations in exon 19 and exon 21 (ex19del and L858R) are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M) has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR)-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR) method in detecting the three EGFR mutations in patients with lung cancer. Methods Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR. Results The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect patient samples that the qPCR method failed to detect. About 49% of this patient cohort had EGFR mutations (L858R, 15.4%; ex19del, 29.5%; T790M, 6.4%). Two patients with the ex19del mutation also had a naïve T790M mutation. Conclusion These data suggest that the ddPCR method could be useful in the personalized treatment of patients with lung cancer. PMID:26124670
Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton
2017-01-01
Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691
Ksouri, H; Eljed, H; Greco, A; Lakhal, A; Torjman, L; Abdelkefi, A; Ben Othmen, T; Ladeb, S; Slim, A; Zouari, B; Abdeladhim, A; Ben Hassen, A
2007-03-01
A pp65 antigenemia assay for polymorphonuclear leukocytes (PMNLs) (CINAkit Rapid Antigenemia), and a qualitative polymerase chain reaction (PCR) test for plasma 'PCR-P qual' (Amplicor cytomegalovirus [CMV] test) were performed for 126 samples (blood and plasma) obtained from 18 bone marrow transplant patients, over a 9-month surveillance period. Among those samples, 92 were assayed with a semi-quantitative PCR test for PMNLs 'PCR-L quant.' The number of samples with a positive CMV test for antigenemia and PCR-P qual assays was 20.63% and 12.7%, respectively, whereas the PCR-L quant assay was positive in 48 of the 92 samples assayed (52.17%). The rates of concordance of the results of PCR-P qual and antigenemia, PCR-P qual and PCR-L quant, antigenemia and PCR-L quant were 92%, 65.2% and 66.8%, respectively. The analysis of the results for the 92 specimens tested by all 3 methods showed a rate of concordance of 63% among all methods. Good agreement (kappa=0.72) was found only between pp65 Ag and PCR-P qual assays. Clinical disease correlates with an antigenemia high viral load. Three patients had CMV disease despite preemptive therapy, and all of them had graft-versus-host-disease (GVHD). PMNLs-based assays are more efficient in monitoring CMV reactivation, but for high-risk patients with GVHD, more sensitive assays (real-time PCR) must be done.
Kristof, Jessica; Sakrison, Kellen; Jin, Xiaoping; Nakamaru, Kenji; Schneider, Matthias; Beckman, Robert A; Freeman, Daniel; Spittle, Cindy; Feng, Wenqin
2017-01-01
In preclinical studies, heregulin ( HRG ) expression was shown to be the most relevant predictive biomarker for response to patritumab, a fully human anti-epidermal growth factor receptor 3 monoclonal antibody. In support of a phase 2 study of erlotinib ± patritumab in non-small cell lung cancer (NSCLC), a reverse-transcription quantitative polymerase chain reaction (RT-qPCR) assay for relative quantification of HRG expression from formalin-fixed paraffin-embedded (FFPE) NSCLC tissue samples was developed and validated and described herein. Test specimens included matched FFPE normal lung and NSCLC and frozen NSCLC tissue, and HRG -positive and HRG -negative cell lines. Formalin-fixed paraffin-embedded tissue was examined for functional performance. Heregulin distribution was also analyzed across 200 NSCLC commercial samples. Applied Biosystems TaqMan Gene Expression Assays were run on the Bio-Rad CFX96 real-time PCR platform. Heregulin RT-qPCR assay specificity, PCR efficiency, PCR linearity, and reproducibility were demonstrated. The final assay parameters included the Qiagen FFPE RNA Extraction Kit for RNA extraction from FFPE NSCLC tissue, 50 ng of RNA input, and 3 reference (housekeeping) genes ( HMBS, IPO8 , and EIF2B1 ), which had expression levels similar to HRG expression levels and were stable among FFPE NSCLC samples. Using the validated assay, unimodal HRG distribution was confirmed across 185 evaluable FFPE NSCLC commercial samples. Feasibility of an RT-qPCR assay for the quantification of HRG expression in FFPE NSCLC specimens was demonstrated.
Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh
2016-01-01
This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834
Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo
2005-01-01
Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159
Quantitative polymerase chain reaction (qPCR) is increasingly being used for the quantitative detection of fecal indicator bacteria in beach water. QPCR allows for same-day health warnings, and its application is being considered as an optionn for recreational water quality testi...
Polymerase chain reaction technology as analytical tool in agricultural biotechnology.
Lipp, Markus; Shillito, Raymond; Giroux, Randal; Spiegelhalter, Frank; Charlton, Stacy; Pinero, David; Song, Ping
2005-01-01
The agricultural biotechnology industry applies polymerase chain reaction (PCR) technology at numerous points in product development. Commodity and food companies as well as third-party diagnostic testing companies also rely on PCR technology for a number of purposes. The primary use of the technology is to verify the presence or absence of genetically modified (GM) material in a product or to quantify the amount of GM material present in a product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains. The document highlights the many areas to which attention must be paid in order to produce reliable test results. These include sample preparation, method validation, choice of appropriate reference materials, and biological and instrumental sources of error. The article also discusses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
Szuhai, Károly; Sandhaus, Emily; Kolkman-Uljee, Sandra M.; Lemaître, Marc; Truffert, Jean-Christophe; Dirks, Roeland W.; Tanke, Hans J.; Fleuren, Gert Jan; Schuuring, Ed; Raap, Anton K.
2001-01-01
Human papillomaviruses (HPVs) play an important role in the pathogenesis of cervical cancer. For identification of the large number of different HPV types found in (pre)malignant lesions, a robust methodology is needed that combines general HPV detection with HPV genotyping. We have developed for formaldehyde-fixed samples a strategy that, in a homogenous, real-time fluorescence polymerase chain reaction (PCR)-based assay, accomplishes general HPV detection by SybrGreen reporting of HPV-DNA amplicons, and genotyping of seven prevalent HPV types (HPV-6, -11, -16, -18, -31, -33, -45) by real-time molecular beacon PCR. The false-positive rate of the HPV SybrGreen-PCR was 4%, making it well suited as a prescreening, general HPV detection technology. The type specificity of the seven selected HPV molecular beacons was 100% and double infections were readily identified. The multiplexing capacity of the HPV molecular beacon PCR was analyzed and up to three differently labeled molecular beacons could be used in one PCR reaction without observing cross talk. The inherent quantitation capacities of real-time fluorescence PCR allowed the determination of average HPV copy number per cell. We conclude that the HPV SybrGreen-PCR in combination with the HPV molecular beacon PCR provides a robust, sensitive, and quantitative general HPV detection and genotyping methodology. PMID:11696426
A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...
Hsu, Chao-Yu; Hsu, Bing-Mu; Chang, Tien-Yu; Hsu, Tsui-Kang; Shen, Shu-Min; Chiu, Yi-Chou; Wang, Hung-Jen; Ji, Wen-Tsai; Fan, Cheng-Wei; Chen, Jyh-Larng
2014-09-19
Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR) allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS) theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS) for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection.
Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N
2009-01-01
A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.
Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E
2013-08-01
Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.
Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh
2016-01-01
This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.
Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung
2017-01-01
Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.
Li, Tianhong; Maus, Martin K H; Desai, Sonal J; Beckett, Laurel A; Stephens, Craig; Huang, Eric; Hsiang, Jack; Zeger, Gary; Danenberg, Kathleen D; Astrow, Stephanie H; Gandara, David R
2014-01-01
The objective of this study was to identify and characterize echinoderm microtubule-associated protein-like 4 anaplastic lymphoma kinase fusion (EML4-ALK+) cancers by variant-specific, quantitative reverse transcription polymerase chain reaction (RT-PCR) assays in a large cohort of North American non-small-cell lung cancer (NSCLC) patients. We developed a panel of single and multiplex RT-PCR assays suitable for rapid and accurate detection of the eight most common EML4-ALK+ variants and ALK gene expression in archival formalin-fixed, paraffin-embedded NSCLC specimens. EGFR and KRAS genotyping and thymidylate synthase RNA level by RT-PCR assays were available in a subset of patients. Between December 2009 and September 2012, 7344 NSCLC specimens were tested. An EML4-ALK+ transcript was detected in 200 cases (2.7%), including 109 V1 (54.5%), 20 V2 (10.0%), 68 V3 (34.0%), and three V5a (1.5%) variants. Median age was 54.5 years (range, 23-89), and 104 patients (52.0%) were women. The great majority (n=188, 94.0%) of EML4-ALK+ NSCLC tumors had adenocarcinoma histology. ALK expression level varied significantly among different EML4-ALK+ variants and individual tumors. Only one case each of concurrent EGFR or KRAS mutation was detected. The median thymidylate synthase RNA level from 85 EML4-ALK+ cancers was significantly lower compared with that of EML4-ALK-negative lung adenocarcinomas (2.02 versus 3.29, respectively, p<0.001). This panel of variant-specific, quantitative RT-PCR assays detects common EML4-ALK+ variants as well as ALK gene expression level in archival formalin-fixed paraffin-embedded NSCLC specimens. These RT-PCR assays may be useful as an adjunct to the standard fluorescence in situ hybridization assay to better understand biologic variability and response patterns to anaplastic lymphoma kinase inhibitors.
de Almeida, Márcia R; Ruedell, Carolina M; Ricachenevsky, Felipe K; Sperotto, Raul A; Pasquali, Giancarlo; Fett-Neto, Arthur G
2010-09-20
Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs identified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression
2010-01-01
Background Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. Results By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs indentified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Conclusion Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based
Evidence of simian retrovirus type D by polymerase chain reaction.
Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A
2017-06-01
Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.
Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry
2012-11-16
The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.
Review of Detection of Brucella sp. by Polymerase Chain Reaction
Yu, Wei Ling; Nielsen, Klaus
2010-01-01
Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083
Roura, X; Santamarina, G; Tabar, M-D; Francino, O; Altet, L
2018-05-25
The presence of Bartonella spp. was detected by polymerase chain reaction (PCR) in dogs from Spain with blood culture-negative endocarditis. The aim of this study is to add information about canine infectious endocarditis in Europe. Thirty dogs with naturally occurring blood culture-negative endocarditis were examined from 2010 to 2017 at three veterinary referral hospitals, located in northwest, northeast, and southeast of Spain. It is a retrospective study. Medical records were reviewed to extract relevant data. Frozen or paraffin-embedded cardiac valve tissue and/or ethylenediamine tetraacetic acid blood samples were evaluated by PCR for the presence of Bartonella DNA. Positive results were sequenced to confirm the species. Polymerase chain reaction was positive for eight out of 30 dogs included (26.6%). Bartonella rochalimae, Bartonella vinsonii subsp. berkhoffii, and Bartonella koehlerae were detected in valve tissue or blood. Bartonella could be an important cause of blood culture-negative infectious endocarditis in dogs from Spain. The outcome for those dogs affected with Bartonella spp. was grave. Prompt empirical treatment with amoxicillin-clavulanate plus fluoroquinolones could be of value in cases of blood culture-negative endocarditis. Copyright © 2018 Elsevier B.V. All rights reserved.
Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.
Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan
2017-10-01
Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Aims: To determine the performance of a rapid, real time polymerase chain reaction (PCR) method for the detection and quantitative analysis Helicobacter pylori at low concentrations in drinking water.
Methods and Results: A rapid DNA extraction and quantitative PCR (QPCR)...
Quantitative analysis of pork and chicken products by droplet digital PCR.
Cai, Yicun; Li, Xiang; Lv, Rong; Yang, Jielin; Li, Jian; He, Yuping; Pan, Liangwen
2014-01-01
In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises.
Pittet, Laure F.; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M.
2014-01-01
Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001−, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested. PMID:24586447
Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M
2014-01-01
Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.
Kutyavin, Igor V.
2013-01-01
Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564
Rollín, R; Alvarez-Lafuente, R; Marco, F; Jover, J A; Hernández-García, C; Rodríguez-Navas, C; López-Durán, L; Fernández-Gutiérrez, B
2007-04-01
To investigate whether there is a possible viral transmission using mesenchymal stem cells (MSCs) in autologous or allogeneic transplantation in the context of osteoarthritis (OA) patients. The presence of parvovirus B19 (B19), varicella zoster virus (VZV), and human herpesvirus-6 (HHV-6) was studied in MSCs from bone marrow of patients with OA and healthy controls. MSCs were prepared from bone marrow aspirates obtained from 18 patients undergoing joint replacement as a result of OA and from 10 healthy controls. DNA was extracted from primary MSCs' culture established from these cells and quantitative real-time polymerase chain reaction was performed to analyse the prevalence and viral load of B19, VZV and HHV-6. The prevalence of total viral DNA among patients with OA was 16.7% (3/18), with a mean viral load of 29.7 copies/microg of DNA. One out of 18 was positive for B19 (viral load, 61.2 copies/microg of DNA), two for VZV (mean viral load, 14.4 copies/microg of DNA), and none for HHV-6. The prevalence of total viral DNA in the control group was 20% (2/10), with a mean viral load of 13.4 copies/microg of DNA. Both positive results were of B19 parvoviruses. There were no statistically significant differences among patients and controls. This first approach to the viral prevalence in MSCs of bone marrow in OA patients and healthy controls seems to show a very low risk of viral transmission or reactivation in a possible MSCs' transplantation.
Nadin-Davis, Susan; Knowles, Margaret K; Burke, Teresa; Böse, Reinhard; Devenish, John
2015-07-01
A quantitative real-time polymerase chain reaction method (qPCR) was developed and tested for the detection of Taylorella equigenitalis. It was shown to have an analytical sensitivity of 5 colony-forming units (CFU) of T. equigenitalis when applied to the testing of culture swabs that mimicked field samples, and a high analytical specificity in not reacting to 8 other commensal bacterial species associated with horses. As designed, it could also differentiate specifically between T. equigenitalis and T. asinigenitalis. The qPCR was compared to standard culture in a study that included 45 swab samples from 6 horses (1 stallion, 5 mares) naturally infected with T. equigenitalis in Canada, 39 swab samples from 5 naturally infected stallions in Germany, and 311 swab samples from 87 culture negative horses in Canada. When the comparison was conducted on an individual sample swab basis, the qPCR had a statistical sensitivity and specificity of 100% and 96.4%, respectively, and 100% and 99.1% when the comparison was conducted on a sample set basis. A comparison was also made on 203 sample swabs from the 5 German stallions taken over a span of 4 to 9 mo following antibiotic treatment. The qPCR was found to be highly sensitive and at least as good as culture in detecting the presence of T. equigenitalis in post-treatment samples. The work demonstrates that the qPCR assay described here can potentially be used to detect the presence of T. equigenitalis directly from submitted sample swabs taken from infected horses and also for determining T. equigenitalis freedom following treatment.
Role of disulfide bridges in archaeal family-B DNA polymerases.
Killelea, Tom; Connolly, Bernard A
2011-06-14
The family-B DNA polymerases obtained from the order Thermococcales, for example, Pyrococcus furiosus (Pfu-Pol) are commonly used in the polymerase chain reaction (PCR) because of their high thermostability and low error rates. Most of these polymerases contain four cysteines, arranged as two disulfide bridges. With Pfu-Pol C429-C443 forms one of the disulfides (DB1) and C507-C510 (DB2) the other. Although the disulfides are well conserved in the enzymes from the hyperthermophilic Thermococcales, they are less prevalent in euryarchaeal polymerases from other orders, and tend to be only found in other hyperthermophiles. Here, we report on the effects of deleting the disulfide bridges by mutating the relevant cysteines to serines. A variety of techniques, including differential scanning calorimetry and differential scanning fluorimetry, have shown that both disulfides make a contribution to thermostability, with DB1 being more important than DB2. However, even when both disulfides are removed, sufficient thermostability remains for normal (identical to the wild type) performance in PCR and quantitative (real-time) PCR. Therefore, polymerases totally lacking cysteine are fully compatible with most PCR-based applications. This observation opens the way to further engineering of polymerases by introduction of a single cysteine followed by appropriate chemical modification. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lung, Jrhau; Lin, Yu-Ching; Hung, Ming-Szu; Jiang, Yuan Yuan; Lee, Kuan-Der; Lin, Paul Yann; Tsai, Ying Huang
2016-04-01
ALK fusion gene is an oncogenic driver in lung cancer with low prevalence, which can be ameliorated by crizotinib. Currently, ALK fusion gene can be diagnosed by fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC), but inconstistnt results between the two methods are encountered regularly. To make the ALK fusion gene screening more efficient and to provide a simple solution to clarify the discrepancy between FISH and IHC results, a sensitive TaqMan-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay was established. The 3-plex TaqMan-based RT-qPCR assay was established and performed on 102 archived formalin-fixed, paraffin-embedded (FFPE) NSCLC samples to detect ALK rearrangement and overexpression. Break-apart FISH and automatic immunohistochemistry based ALK assays were performed side by side using tissue microarray. The RT-qPCR was performed successfully for 80 samples and 10 of them showed positive signals. Three out of the 10 qPCR positive cases were further confirmed by FISH and IHC test. Two others were IHC positive and FISH negative, and expressed full-length ALK transcript. The rest were neither FISH nor IHC positive and their ALK expression level was significantly lower than those FISH or IHC positive cases. Our RT-qPCR assay demonstrates that the capability and reliability of ALK detection is comparable to FISH and IHC, but it is more effective at discriminating ALK rearrangement from overexpression. The RT-qPCR assay easily clarifies the discrepancy between FISH and IHC, and can be incorporated into routine ALK screening for lung cancer. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Gruber, Kim; Horn, Heike; Kalla, Jörg; Fritz, Peter; Rosenwald, Andreas; Kohlhäufl, Martin; Friedel, Godehard; Schwab, Matthias; Ott, German; Kalla, Claudia
2014-03-01
The approved dual-color fluorescence in situ hybridization (FISH) test for the detection of anaplastic lymphoma receptor tyrosine kinase (ALK) gene rearrangements in non-small-cell lung cancer (NSCLC) is complex and represents a low-throughput assay difficult to use in daily diagnostic practice. We devised a sensitive and robust routine diagnostic test for the detection of rearrangements and transcriptional up-regulation of ALK. We developed a quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay adapted to RNA isolated from routine formalin-fixed, paraffin-embedded material and applied it to 652 NSCLC specimens. The reliability of this technique to detect ALK dysregulation was shown by comparison with FISH and immunohistochemistry. qRT-PCR analysis detected unbalanced ALK expression indicative of a gene rearrangement in 24 (4.6%) and full-length ALK transcript expression in six (1.1%) of 523 interpretable tumors. Among 182 tumors simultaneously analyzed by FISH and qRT-PCR, the latter accurately typed 97% of 19 rearranged and 158 nonrearranged tumors and identified ALK deregulation in two cases with insufficient FISH. Six tumors expressing full-length ALK transcripts did not show rearrangements of the gene. Immunohistochemistry detected ALK protein overexpression in tumors with gene fusions and transcriptional up-regulation, but did not distinguish between the two. One case with full-length ALK expression carried a heterozygous point mutation (S1220Y) within the kinase domain potentially interfering with kinase activity and/or inhibitor binding. Our qRT-PCR assay reliably identifies and distinguishes ALK rearrangements and full-length transcript expression in formalin-fixed, paraffin-embedded material. It is an easy-to-perform, cost-effective, and high-throughput tool for the diagnosis of ALK activation. The expression of full-length ALK transcripts may be relevant for ALK inhibitor therapy in NSCLC.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Srienc, Friedrich; Jackson, John K.; Somers, David A.
A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.
Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo
2018-04-01
Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.
Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.
Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C
2012-09-27
We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.
Siqueira, José F; Rôças, Isabela N
2003-08-01
Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and
Identifying of meat species using polymerase chain reaction (PCR)
NASA Astrophysics Data System (ADS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-11-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
A primer on on-demand polymerase chain reaction technology.
Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise
2015-10-01
Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Binary sensitivity and specificity metrics are not adequate to describe the performance of quantitative microbial source tracking methods because the estimates depend on the amount of material tested and limit of detection. We introduce a new framework to compare the performance ...
Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P
2012-12-01
Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D
2011-11-01
The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.
Pavlov, K A; Shkoporov, A N; Khokhlova, E V; Korchagina, A A; Sidorenkov, A V; Grigor'ev, M É; Pushkar', D Iu; Chekhonin, V P
2013-01-01
The wide introduction of prostatic specific antigen (PSA) determination into clinical practice has resulted in a larger number of prostate biopsies, while the lower age threshold for PSA has led to a larger number of unnecessary prostate biopsies. Hence, there is a need for new biomarkers that can detect prostate cancer. PCA3 is a noncoding messenger ribonucleic acid (mRNA) that is expressed exclusively in prostate cells. The aim of the study has been to develop a diagnostic test system for early non-invasive detection of prostate cancer based on PCA3 mRNA levels in urine sediment using quantitative reverse transcription polymerase chain reaction (qRT-PCR). As part of the study, a laboratory diagnostic test system prototype has been designed, an application methodology has been developed and specificity and sensitivity data of the method has been assessed. The diagnostic system has demonstrated its ability to detect significantly elevated levels of PCA 3/KLK 3 in samples from prostate cancer (PCa) patients compared with those from healthy men. The findings have shown relatively high diagnostic sensitivity, specificity and negative-predictive values for an early non-invasive screening of prostate cancer
Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana
2015-08-18
Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain.
[Applying competitive polymerase chain reaction to the detection of hepatitis B virus DNA].
Wang, Ling; Yang, Peng; Li, Shuang-qing; Xu, Shu-hui; Cao, Gui-qun; Zhang, Fa-qiang; Zhang, Mei-xia; Chen, Qing-ying; Xia, Qing-jie; Liu, Kai; Tang, Fang; Zhang, Yuan-zheng
2004-11-01
To reduce the rate of accidental false negative result in the HBV DNA PCR test on clinical serum samples. A competitive polymerase chain reaction (C-PCR) was used to decrease the false negative ratio. In the C-PCR, a constructed inner control DNA was added for co-amplification with the HBV target DNA. In a 20 microl C-PCR system, about 60 to 200 copies of inner control DNA could give apparent co-amplification signal band after electrophoresis on a 2% agarose gel. Five of 120 samples of clinical serum (4.2%) could not be amplified. C-PCR has the advantage of yielding information on false negative in the HBV DNA PCR assay of clinical serum samples.
Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats
Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.
2010-01-01
A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.
Curreli, Francesca; Robles, Monica A; Friedman-Kien, Alvin E; Flore, Ornella
2003-02-01
Kaposi's sarcoma-associated herpesvirus is a novel herpesvirus linked to AIDS-related neoplasms. Currently it is difficult to evaluate the number of virions in viral preparation or in samples obtained from patients with Kaposi's sarcoma (KS), since no protocol for determining the plaque forming units of KSHV exists. We constructed a fragment of a different size than the target viral DNA to carry out a competitive-quantitative PCR. Both fragment and viral DNA were added to a single PCR reaction to compete for the same set of primers. By knowing the amount of the competitor added to the reaction, we could determine the number of viral DNA molecules. We used this assay successfully to detect and quantify KSHV genomes from KS skin biopsies and pleural effusion lymphoma, and from different viral preparations. To date, this is the most convenient and economic method that allows an accurate and fast viral detection/quantitation with a single PCR.
Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...
Quantitative competitive (QC) PCR for quantification of porcine DNA.
Wolf, C; Lüthy, J
2001-02-01
Many meat products nowadays may contain several species in different proportions. To protect consumers from fraud and misdeclarations, not only a qualitative but also a quantitative monitoring of ingredients of complex food products is necessary. DNA based techniques like the polymerase chain reaction (PCR) are widely used for identification of species but no answer to the proportional amount of a certain species could be given using current techniques. In this study we report the development and evaluation of a quantitative competitive polymerase chain reaction (QC-PCR) for detection and quantification of porcine DNA using a new porcine specific PCR system based on the growth hormone gene of sus scrofa. A DNA competitor differing by 30 bp in length from the porcine target sequence was constructed and used for PCR together with the target DNA. Specificity of the new primers was evaluated with DNA from cattle, sheep, chicken and turkey. The competitor concentration was adjusted to porcine DNA contents of 2 or 20% by coamplification of mixtures containing porcine and corresponding amounts of bovine DNA in defined ratios.
Electrochemical product detection of an asymmetric convective polymerase chain reaction.
Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe
2009-10-15
For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.
Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki
2018-05-15
A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.
Nadin-Davis, Susan; Knowles, Margaret K.; Burke, Teresa; Böse, Reinhard; Devenish, John
2015-01-01
A quantitative real-time polymerase chain reaction method (qPCR) was developed and tested for the detection of Taylorella equigenitalis. It was shown to have an analytical sensitivity of 5 colony-forming units (CFU) of T. equigenitalis when applied to the testing of culture swabs that mimicked field samples, and a high analytical specificity in not reacting to 8 other commensal bacterial species associated with horses. As designed, it could also differentiate specifically between T. equigenitalis and T. asinigenitalis. The qPCR was compared to standard culture in a study that included 45 swab samples from 6 horses (1 stallion, 5 mares) naturally infected with T. equigenitalis in Canada, 39 swab samples from 5 naturally infected stallions in Germany, and 311 swab samples from 87 culture negative horses in Canada. When the comparison was conducted on an individual sample swab basis, the qPCR had a statistical sensitivity and specificity of 100% and 96.4%, respectively, and 100% and 99.1% when the comparison was conducted on a sample set basis. A comparison was also made on 203 sample swabs from the 5 German stallions taken over a span of 4 to 9 mo following antibiotic treatment. The qPCR was found to be highly sensitive and at least as good as culture in detecting the presence of T. equigenitalis in post-treatment samples. The work demonstrates that the qPCR assay described here can potentially be used to detect the presence of T. equigenitalis directly from submitted sample swabs taken from infected horses and also for determining T. equigenitalis freedom following treatment. PMID:26130847
Richards-Kortum, Rebecca
2015-01-01
It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to quantify DNA sample concentration using a standard curve. In this manuscript, a detailed protocol for developing and implementing a real-time quantitative recombinase polymerase amplification assay (qRPA assay) is provided. Using HIV-1 DNA quantification as an example, the assembly of real-time RPA reactions, the design of an internal positive control (IPC) sequence, and co-amplification of the IPC and target of interest are all described. Instructions and data processing scripts for the construction of a standard curve using data from multiple experiments are provided, which may be used to predict the concentration of unknown samples or assess the performance of the assay. Finally, an alternative method for collecting real-time fluorescence data with a microscope and a stage heater as a step towards developing a point-of-care qRPA assay is described. The protocol and scripts provided may be used for the development of a qRPA assay for any DNA target of interest. PMID:25867513
Crannell, Zachary A; Rohrman, Brittany; Richards-Kortum, Rebecca
2015-03-30
It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to quantify DNA sample concentration using a standard curve. In this manuscript, a detailed protocol for developing and implementing a real-time quantitative recombinase polymerase amplification assay (qRPA assay) is provided. Using HIV-1 DNA quantification as an example, the assembly of real-time RPA reactions, the design of an internal positive control (IPC) sequence, and co-amplification of the IPC and target of interest are all described. Instructions and data processing scripts for the construction of a standard curve using data from multiple experiments are provided, which may be used to predict the concentration of unknown samples or assess the performance of the assay. Finally, an alternative method for collecting real-time fluorescence data with a microscope and a stage heater as a step towards developing a point-of-care qRPA assay is described. The protocol and scripts provided may be used for the development of a qRPA assay for any DNA target of interest.
Griffin, Dale W.
2011-01-01
Epifluorescent microscopy and quantitative polymerase chain reaction (qPCR) were utilized to determine the presence, concentration and identification of bacteria, and more specifically sulfate reducing bacteria (SRB) in subsamples of Chinese and North American wallboard, and wallboard-mine rock. Bacteria were visible in most subsamples, which included wallboard-lining paper from each side of the wallboard, wallboard filler, wallboard tape and fragments of mined wallboard rock via microscopy. Observed bacteria occurred as single or small clusters of cells and no mass aggregates indicating colonization were noted. Universal 16S qPCR was utilized to directly examine samples and detected bacteria at concentrations ranging from 1.4 x 103 to 6.4 x 104 genomic equivalents per mm2 of paper or per gram of wallboard filler or mined rock, in 12 of 41 subsamples. Subsamples were incubated in sulfate reducing broth for ~30 to 60 days (enrichment assay) and then analyzed by universal 16S and SRB qPCR. Enrichment universal 16S qPCR detected bacteria in 32 of 41 subsamples at concentrations ranging from 1.5 x 104 to 4.2 x 107 genomic equivalents per ml of culture broth. Evaluation of enriched subsamples by SRB qPCR demonstrated that SRB were not detectable in most of the samples and if they were detected, detection was not reproducible (an indication of low concentrations, if present). Enrichment universal 16S and SRB qPCR demonstrated that viable bacteria were present in subsamples (as expected given exposure of the samples following manufacture, transport and use) but that SRB were either not present or present at very low numbers. Further, no differences in trends were noted between the various Chinese and North American wallboard samples. In all, the microscopy and qPCR data indicated that the suspected ‘sulfur emissions’ emanating from suspect wallboard samples is not due to microbial activity.
Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Frank F. Roberto
2008-08-01
Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means ofmore » rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.« less
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions
NASA Astrophysics Data System (ADS)
Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory
1989-04-01
The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
Polymerase chain reaction for detection of Leptospira spp. in clinical samples.
Mérien, F; Amouriaux, P; Perolat, P; Baranton, G; Saint Girons, I
1992-01-01
A sensitive assay for Leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (PCR). A 331-bp sequence from the Leptospira interrogans serovar canicola rrs (16S) gene was amplified, and the PCR products were analyzed by DNA-DNA hybridization by using a 289-bp fragment internal to the amplified DNA. Specific PCR products also were obtained with DNA from the closely related nonpathogenic Leptospira biflexa but not with DNA from other spirochetes, such as Borrelia burgdorferi, Borrelia hermsii, Treponema denticola, Treponema pallidum, Spirochaeta aurantia, or more distant organisms such as Escherichia coli, Staphylococcus aureus, Mycobacterium tuberculosis, and Proteus mirabilis. The assay was able to detect as few as 10 bacteria. Leptospira DNA was detected in urine from experimentally infected mice. In addition, the test was found to be suitable for diagnosing leptospirosis in humans. Cerebrospinal fluid and urine from patients with leptospirosis were positive, whereas samples from control uninfected patients were negative. Images PMID:1400983
Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.
Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P
2000-01-01
Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].
[Polymerase chain reaction applied for detection of Toxoplasma gondii in lymph nodes].
Liu, C; Ouyang, K; Tan, D
1998-01-01
In order to investigate the morbidity of toxoplasmic lymphadenitis, polymerase chain reaction (PCR) was used to detect DNA of Toxoplasma gondii within lymph nodes in 3 groups of 120 patients with different diseases. After extracting the DNA of each sample, PCR was employed to amplify toxoplasma DNA. The results showed that the amplification product of 210 bp was confirmed in 7 patients: 3 cases of Hodgkin's disease (HD), 2 cases of non-Hodgkin's lymphoma (NHL) and 2 cases of chronic lymphadenitis (CL). Each PCR product was then subjected to Southern blot hybridization. Besides the 7 cases proved by PCR, 1 case of CL was found positive. The positive percentages of HD, NHL and CL were 9.38% (3/32), 4.88% (2/41), and 6.38% (3/47), respectively. The total positive rate was 6.67% (8/120).
Marzipan: polymerase chain reaction-driven methods for authenticity control.
Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus
2011-11-23
According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.
Identifying of meat species using polymerase chain reaction (PCR)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Foong, Chow Ming; Sani, Norrakiah Abdullah
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less
Blome, B; Braun, A; Sobarzo, V; Jepsen, S
2008-10-01
It was the aim of the present study to evaluate root canal samples for the presence and numbers of specific species as well as for total bacterial load in teeth with chronic apical periodontitis using quantitative real-time polymerase chain reaction (PCR). Forty adult patients with one radiographically documented periapical lesion were included. Twenty teeth presented with primary infections and 20 with secondary infections, requiring retreatment. After removal of necrotic pulp tissue or root canal filling, a first bacterial sample was obtained. Following chemo-mechanical root canal preparation a second sample was taken and a third sample was obtained after 14 days of intracanal dressing with calcium hydroxide. Analysis by real-time PCR enabled the quantification of total bacterial counts and of nine selected species. Root canals with primary infections harbored significantly more bacteria (by total bacterial count) than teeth with secondary infections (P < 0.05). Mean total bacterial count in the retreatment group was 2.1 x 10(6) and was significantly reduced following root canal preparation (3.6 x 10(4)) and intracanal dressing (1.4 x 10(5)). Corresponding values for primary infections were: 4.6 x 10(7), 3.6 x 10(4), and 6.9 x 10(4). The numbers of the selected bacteria and their detection frequency were also significantly reduced. Root canals with primary infections contained a higher bacterial load. Chemo-mechanical root canal preparation reduced bacterial counts by at least 95%.
One-Step Reverse Transcription-Polymerase Chain Reaction for Ebola and Marburg Viruses.
Park, Sun-Whan; Lee, Ye-Ji; Lee, Won-Ja; Jee, Youngmee; Choi, WooYoung
2016-06-01
Ebola and Marburg viruses (EBOVs and MARVs, respectively) are causative agents of severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. In 2014, there was a major Ebola outbreak in various countries in West Africa, including Guinea, Liberia, Republic of Sierra Leone, and Nigeria. EBOV and MARV are clinically difficult to diagnose and distinguish from other African epidemic diseases. Therefore, in this study, we aimed to develop a method for rapid identification of the virus to prevent the spread of infection. We established a conventional one-step reverse transcription-polymerase chain reaction (RT-PCR) assay for these pathogens based on the Superscript Reverse Transcriptase-Platinum Taq polymerase enzyme mixture. All assays were thoroughly optimized using in vitro-transcribed RNA. We designed seven primer sets of nucleocapsid protein (NP) genes based on sequences from seven filoviruses, including five EBOVs and two MARVs. To evaluate the sensitivity of the RT-PCR assay for each filovirus, 10-fold serial dilutions of synthetic viral RNA transcripts of EBOV or MARV NP genes were used to assess detection limits of viral RNA copies. The potential for these primers to cross react with other filoviruses was also examined. The results showed that the primers were specific for individual genotype detection in the examined filoviruses. The assay established in this study may facilitate rapid, reliable laboratory diagnosis in suspected cases of Ebola and Marburg hemorrhagic fevers.
Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A
2010-10-01
The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT
Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).
Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli
2018-02-26
Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.
Bjourson, A J; Stone, C E; Cooper, J E
1992-01-01
A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166
Noscomial fungal infections represent a persistent threat in hospitals. One of the major issues in fungal control has been monitoring these fungi in a timely manner. Quantitative polymerase chain reaction (QPCR) allows for the rapid (2 to 4 h), sensitive (often down to a single...
Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H
2015-11-01
Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.
On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)
NASA Astrophysics Data System (ADS)
Persat, Alexandre; Santiago, Juan
2008-11-01
We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.
Diagnosis of duck plague in waterfowl by polymerase chain reaction
Hansen, W.R.; Nashold, S.W.; Docherty, D.E.; Brown, S.E.; Knudson, D.L.
2000-01-01
A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.
Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.
Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David
2014-02-20
Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.
Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics
Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David
2014-01-01
Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas. PMID:24553130
Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics
NASA Astrophysics Data System (ADS)
Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David
2014-02-01
Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.
Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction
Chen, Xian; Gupta, Goutam; Bradbury, E. Morton
2001-01-01
Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.
Lee, Ai-Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe
2008-12-15
We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcripts in the population of messenger ribonucleic acid (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify the target signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-naphthyl phosphate. The voltammetric characteristics of substrate and enzymatic product as well as the parameters of SWV analysis were systematically optimized. A detection limit of 1 fM (1 x 10(-19) mol of target transcripts in 100 microL) and a 3-order-wide dynamic range of target concentration were achieved by the electrochemical bDNA assay. Such limit corresponded to approximately 17 fg of the p185 BCR-ABL fusion transcripts. The specificity and sensitivity of assay enabled direct detection of target transcripts in as little as 4.6 ng of mRNA population without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcripts in mRNA population. A mean transcript copy number of 62,900/ng of mRNA was determined, which was at least 50-fold higher than that of real-time quantitative PCR (qPCR). The finding was consistent with the underestimation of targets by qPCR reported earlier. In addition, the unique design based on bDNA technology increases the assay specificity as only the p185 BCR-ABL fusion transcripts will respond to the detection. The approach thus provides a simple, sensitive, accurate, and quantitative tool alternative to the qPCR for early disease diagnosis.
Siala, Mariam; Rihl, Markus; Sellami, Hanen; Znazen, Abir; Sassi, Nadia; Laadhar, Lilia; Gdoura, Radhouane; Belghuith, Imen; Mrabet, Dalila; Baklouti, Sofien; Sellami, Slaheddine; Sibilia, Jean; Fourati, Hela; Hammami, Adnene; Cheour, Ilhem
2018-06-01
Enterobacterial components in the joints of patients are believed to contribute to a perpetuating inflammation leading to a reactive arthritis (ReA), a condition in which microbial agents cannot be recovered from the joint. At present, it is unclear whether nucleic acids from Shigella spp. are playing a pathogenic role in causing not only ReA but also other forms of arthritis. Quantitative real-time polymerase chain reaction assay (qPCR) is the method of choice for the identification of bacteria within the synovium. The aim of our study was to detect the presence of Shigella spp. nucleic acids in the synovial tissue (ST) of Tunisian arthritis patients. We investigated 57 ST samples from rheumatoid arthritis (RA) n = 38, undifferentiated oligoarthritis (UOA) n = 12, and spondyloarthritis (SpA) n = 7 patients; 5 ST samples from healthy individuals were used as controls. Shigella spp. DNA and mRNA transcripts encoding the virulence gene A (VirA) were examined using an optimized qPCR with newly designed primers and probes. Using qPCR, Shigella spp. DNA was found in 37/57 (65%) ST samples (24/38, i.e., 63.2% of RA, 8/12, i.e., 67% of UOA, and 5/7, i.e., 71.4% of SpA patients). Paired DNA and mRNA were extracted from 39 ST samples, whose VirA cDNA was found in 29/39 (74.4%) patients. qPCR did not yield any nucleic acids in the five healthy control ST samples. The qPCR assay was sensitive and showed a good intra- and inter-run reproducibility. These preliminary findings generated by an optimized, highly sensitive PCR assay underline a potential role of past gastrointestinal infections. In Tunisian patients, a bacterial etiology involving Shigella spp. in the manifestation of arthritic disorders including RA might be more common than expected.
Trombley, Adrienne R.; Wachter, Leslie; Garrison, Jeffrey; Buckley-Beason, Valerie A.; Jahrling, Jordan; Hensley, Lisa E.; Schoepp, Randal J.; Norwood, David A.; Goba, Augustine; Fair, Joseph N.; Kulesh, David A.
2010-01-01
Viral hemorrhagic fever is caused by a diverse group of single-stranded, negative-sense or positive-sense RNA viruses belonging to the families Filoviridae (Ebola and Marburg), Arenaviridae (Lassa, Junin, Machupo, Sabia, and Guanarito), and Bunyaviridae (hantavirus). Disease characteristics in these families mark each with the potential to be used as a biological threat agent. Because other diseases have similar clinical symptoms, specific laboratory diagnostic tests are necessary to provide the differential diagnosis during outbreaks and for instituting acceptable quarantine procedures. We designed 48 TaqMan™-based polymerase chain reaction (PCR) assays for specific and absolute quantitative detection of multiple hemorrhagic fever viruses. Forty-six assays were determined to be virus-specific, and two were designated as pan assays for Marburg virus. The limit of detection for the assays ranged from 10 to 0.001 plaque-forming units (PFU)/PCR. Although these real-time hemorrhagic fever virus assays are qualitative (presence of target), they are also quantitative (measure a single DNA/RNA target sequence in an unknown sample and express the final results as an absolute value (e.g., viral load, PFUs, or copies/mL) on the basis of concentration of standard samples and can be used in viral load, vaccine, and antiviral drug studies. PMID:20439981
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cao Hongbin; Banh, Alice; Kwok, Shirley
Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed bymore » p16{sup INK4a} staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using {sup 18}F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.« less
Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H
2018-04-25
In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.
[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].
Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A
2015-01-01
Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.
van Rijn, Piet A; Heutink, René G; Boonstra, Jan; Kramps, Hans A; van Gennip, René G P
2012-05-01
A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic double-stranded RNA, reverse transcription polymerase chain reaction (RT-PCR), and real-time detection and analysis. Reference strains of the 24 recognized BTV serotypes, isolates from different years, and geographic origins were detected. Other orbiviruses such as African horse sickness virus, Epizootic hemorrhagic disease virus, and Equine encephalosis virus were not detected. Experimentally infected animals were PCR positive from 2 days postinoculation, which was earlier than fever, other clinical signs, or seroconversion. The diagnostic sensitivity and specificity were very close to or even 100%. The PCR test played a key role in the detection of BTV serotype 8 in August 2006 in The Netherlands. The outbreak in a completely naive ruminant population allowed for further evaluation of the PCR test with field samples. In 2006, the correlation between enzyme-linked immunosorbent assay and PCR results was estimated to be 95%. In the following years, the PCR test was used for diagnosis of diseased animals, for testing of healthy animals for trade purposes, and for detection of BTV RNA in different species of the insect vector, Culicoides. In the autumn of 2008, BTV serotype 6 unexpectedly emerged in northwest Europe and was also detected with the PCR test developed in the current study. The performance in routine use over 5 years has been recorded and evaluated.
Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom
2015-01-01
This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449
Marois-Créhan, Corinne; Lacouture, Sonia; Jacques, Mario; Fittipaldi, Nahuel; Kobisch, Marylène; Gottschalk, Marcelo
2014-01-01
Two real-time, or quantitative, polymerase chain reaction (qPCR) assays were developed to detect Actinobacillus pleuropneumoniae serovars 1-9-11 (highly related serovars with similar virulence potential) and serovar 2, respectively. The specificity of these assays was verified on a collection of 294 strains, which included all 16 reference A. pleuropneumoniae strains (including serovars 5a and 5b), 263 A. pleuropneumoniae field strains isolated between 1992 and 2009 in different countries, and 15 bacterial strains other than A. pleuropneumoniae. The detection levels of both qPCR tests were evaluated using 10-fold dilutions of chromosomal DNA from reference strains of A. pleuropneumoniae serovars 1 and 2, and the detection limit for both assays was 50 fg per assay. The analytical sensitivities of the qPCR tests were also estimated by using pure cultures and tonsils experimentally spiked with A. pleuropneumoniae. The detection threshold was 2.5 × 10(4) colony forming units (CFU)/ml and 2.9 × 10(5) CFU/0.1 g of tonsil, respectively, for both assays. These specific and sensitive tests can be used for the serotyping of A. pleuropneumoniae in diagnostic laboratories to control porcine pleuropneumonia.
Kaigala, Govind V; Hoang, Viet N; Backhouse, Christopher J
2008-07-01
Microvalves are key in realizing portable miniaturized diagnostic platforms. We present a scalable microvalve that integrates well with standard lab on a chip (LOC) implementations, yet which requires essentially no external infrastructure for its operation. This electrically controlled, phase-change microvalve is used to integrate genetic amplification and analysis via capillary electrophoresis--the basis of many diagnostics. The microvalve is actuated using a polymer (polyethylene glycol, PEG) that exhibits a large volumetric change between its solid and liquid phases. Both the phase change of the PEG and the genetic amplification via polymerase chain reaction (PCR) are thermally controlled using thin film resistive elements that are patterned using standard microfabrication methods. By contrast with many other valve technologies, these microvalves and their control interface scale down in size readily. The novelty here lies in the use of fully integrated microvalves that require only electrical connections to realize a portable and inexpensive genetic analysis platform.
The actin multigene family and livestock speciation using the polymerase chain reaction.
Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G
1998-01-01
Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.
Identification of 29 Rat Genetic Markers by Arbitrarily Primed Polymerase Chain Reaction
Canzian, Federico; Toyota, Minoru; Hosoya, Yoko; Sugimura, Takashi; Nagao, Minako
1996-01-01
The number of genetic markers for the rat is still limited, in spite of its wide use in cancer research. To facilitate accurate mapping of both established and novel rat genetic markers, we constructed a linkage map by genotyping 105 F2 rats from ACI/N (ACI) and BUF/Nac (BUF) crosses. This map consists of 120 genetic markers that had been previously reported, mainly by two research groups, but had not been integrated. To find new genetic markers, the arbitrarily primed polymerase chain reaction (AP‐PCR) was applied to detect polymorphic bands between ACI and BUF rats. After testing 56 single primers and 12 combinations of primers, we found 36 bands produced by 16 single primers and two combinations to be reliably polymorphic between ACI and BUF rats. The 36 bands were typed in the 105 F2 rats, and 29 of them could be linkage‐mapped. AP‐PCR is thus useful to detect new genetic markers in laboratory strains of rats. PMID:8698613
Amebic Liver Abscess Diagnosed by Polymerase Chain Reaction in 14 Returning Travelers
Vallois, Dorothée; Epelboin, Loïc; Touafek, Feriel; Magne, Denis; Thellier, Marc; Bricaire, François; Caumes, Eric
2012-01-01
Amebic liver abscesses (ALA) are not commonly described in travelers. The ALA diagnosis is usually based on serology and Entamoeba histolytica polymerase chain reaction (PCR) is a new tool. We retrospectively reviewed all ALA cases diagnosed by PCR on the liver abscess pus aspirate of patients admitted in French hospitals between 2007 and 2011. Fourteen cases (10 male, median age 48 years) were included. The median lag time between return and onset of symptoms was 23 days (interquartile range [IQ] 18–24). All patients had an elevated cardiopulmonary resuscitation level, and 11 had leukocytosis. The ALA was multiple in five patients, localized in the right lobe in 12, and higher than 5 cm in 11. Serology was initially negative in one patient, whereas PCR was positive. There was bacterial co-infection in one patient. The outcome was good. Liver puncture allows a rapid diagnosis of ALA with PCR and helps identify the association with a bacterial dual infection. PMID:23033402
Inkjet Printing Based Droplet Generation for Integrated Online Digital Polymerase Chain Reaction.
Zhang, Weifei; Li, Nan; Koga, Daisuke; Zhang, Yong; Zeng, Hulie; Nakajima, Hizuru; Lin, Jin-Ming; Uchiyama, Katsumi
2018-04-17
We report on the development of a novel and flexible online digital polymerase chain reaction (dPCR) system. The system was composed of three parts: an inkjet for generating the droplets, a coiled fused-silica capillary for thermal cycling, and a laser-induced fluorescence detector (LIFD) for positive droplet counting. Upon inkjet printing, monodisperse droplets were continuously generated in the oil phase and then introduced into the capillary in the form of a stable dispersion. The droplets containing one or zero molecules of target DNA passed through the helical capillary that was attached to a cylindrical thermal cycler for PCR amplification, resulting in the generation of fluorescence for the DNA-positive droplet. After 36 PCR cycles, the fluorescence signal intensity was detected by laser-induced fluorescence located at the downstream of the capillary, followed by a positive/negative counting. The present system was successfully applied to the absolute quantification of the HPV sequence in Caski cells with dynamic ranges spanning 4 orders of magnitude.
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...
Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo
2014-03-01
The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.
Ordureau, Alban; Sarraf, Shireen A; Duda, David M; Heo, Jin-Mi; Jedrychowski, Mark P; Sviderskiy, Vladislav O; Olszewski, Jennifer L; Koerber, James T; Xie, Tiao; Beausoleil, Sean A; Wells, James A; Gygi, Steven P; Schulman, Brenda A; Harper, J Wade
2014-11-06
Phosphorylation is often used to promote protein ubiquitylation, yet we rarely understand quantitatively how ligase activation and ubiquitin (UB) chain assembly are integrated with phosphoregulation. Here we employ quantitative proteomics and live-cell imaging to dissect individual steps in the PINK1 kinase-PARKIN UB ligase mitochondrial control pathway disrupted in Parkinson's disease. PINK1 plays a dual role by phosphorylating PARKIN on its UB-like domain and poly-UB chains on mitochondria. PARKIN activation by PINK1 produces canonical and noncanonical UB chains on mitochondria, and PARKIN-dependent chain assembly is required for accumulation of poly-phospho-UB (poly-p-UB) on mitochondria. In vitro, PINK1 directly activates PARKIN's ability to assemble canonical and noncanonical UB chains and promotes association of PARKIN with both p-UB and poly-p-UB. Our data reveal a feedforward mechanism that explains how PINK1 phosphorylation of both PARKIN and poly-UB chains synthesized by PARKIN drives a program of PARKIN recruitment and mitochondrial ubiquitylation in response to mitochondrial damage. Copyright © 2014 Elsevier Inc. All rights reserved.
Typing of mutans streptococci by arbitrarily primed polymerase chain reaction.
Saarela, M; Hannula, J; Mättö, J; Asikainen, S; Alaluusua, S
1996-01-01
The discriminative power of the arbitrarily primed polymerase chain reaction (AP-PCR) in differentiating between Streptococcus mutans and Strep. sobrinus species, serotypes and clones was investigated. Mutans streptococcal isolates (12(7)) obtained from 65 individuals (1-10 isolates per individual) were AP-PCR typed separately with two random primers, OPA-05 and OPA-13. Bacterial cell lysates were used as a template in PCR reactions, which made AP-PCR easy and fast to perform. Eighty-one isolates from 19 individuals were also ribotyped to compare the discriminative ability of ribotyping and AP-PCR techniques. AP-PCR performed with the two primers differentiated between Strep. mutans and Strep. sobrinus isolates, but neither primer detected serotype-specific amplification products. OPA-05 distinguished two main AP-PCR patterns among Strep. mutans isolates and one main pattern among Strep. sobrinus isolates, whereas OPA-13 found one main AP-PCR pattern among Strep. mutans isolates and two main patterns among Strep. sobrinus isolates. Ribotyping and AP-PCR revealed 40 and 33 different types among 81 selected isolates, respectively. Both techniques detected intra-individual heterogeneity in 16 out of 19 participants. The results indicate that AP-PCR has good discriminative ability in differentiating between mutans streptococcal clones and that the technique is suitable for epidemiological studies on mutans streptococci.
Badve, Sunil S; Baehner, Frederick L; Gray, Robert P; Childs, Barrett H; Maddala, Tara; Liu, Mei-Lan; Rowley, Steve C; Shak, Steven; Perez, Edith A; Perez, Edith D; Shulman, Lawrence J; Martino, Silvana; Davidson, Nancy E; Sledge, George W; Goldstein, Lori J; Sparano, Joseph A
2008-05-20
Central and local laboratory concordance for hormone receptor measurement is therapeutically important. This study compares estrogen receptor (ER) and progesterone receptor (PR) measured by local laboratory immunohistochemistry (IHC), central IHC, and central reverse-transcriptase polymerase chain reaction (RT-PCR) using a proprietary 21-gene assay. A case-control sample of 776 breast cancer patients from Eastern Cooperative Oncology Group (ECOG) study E2197 was evaluated. Central IHC Allred score for ER and PR was obtained using tissue microarrays and 1D5 ER antibody and 636 PR antibody. Quantitative RT-PCR for ER and PR in whole sections was performed using the 21-gene assay. For ER, the concordance between local and central IHC was 90% (95% CI, 88% to 92%), between local IHC and central RT-PCR was 91% (95% CI, 89% to 93%), and between central IHC and central RT-PCR was 93% (95% CI, 91% to 95%). For PR, the concordance between local IHC and central IHC was 84% (95% CI, 82% to 87%), between local IHC and central RT-PCR was 88% (95% CI, 85% to 90%), and between central IHC and central RT-PCR was 90% (95% CI, 88% to 92%). Although concordance was high, IHC ER-negative cases that were RT-PCR positive were more common than IHC ER-positive cases that were RT-PCR negative. In ER-positive patients, ER expression by central IHC Allred score was marginally associated with recurrence (P = .091), and ER expression by central RT-PCR was significantly associated with recurrence (P = .014). However, recurrence score, which incorporates additional genes/pathways, was a highly significant predictor of recurrence (P < .0001). There is a high degree of concordance among local IHC, central IHC, and central RT-PCR by the proprietary gene assay for ER and PR status. Although ER expression is marginally associated with relapse in ER-positive patients treated with chemohormonal therapy, recurrence score is a highly significant predictor of recurrence.
Jungkind, D
2001-01-01
While it is an extremely powerful and versatile assay method, polymerase chain reaction (PCR) can be a labor-intensive process. Since the advent of commercial test kits from Roche and the semi-automated microwell Amplicor system, PCR has become an increasingly useful and widespread clinical tool. However, more widespread acceptance of molecular testing will depend upon automation that allows molecular assays to enter the routine clinical laboratory. The forces driving the need for automated PCR are the requirements for diagnosis and treatment of chronic viral diseases, economic pressures to develop more automated and less expensive test procedures similar to those in the clinical chemistry laboratories, and a shortage in many areas of qualified laboratory personnel trained in the types of manual procedures used in past decades. The automated Roche COBAS AMPLICOR system has automated the amplification and detection process. Specimen preparation remains the most labor-intensive part of the PCR testing process, accounting for the majority of the hands-on-time in most of the assays. A new automated specimen preparation system, the COBAS AmpliPrep, was evaluated. The system automatically releases the target nucleic acid, captures the target with specific oligonucleotide probes, which become attached to magnetic beads via a biotin-streptavidin binding reaction. Once attached to the beads, the target is purified and concentrated automatically. Results of 298 qualitative and 57 quantitative samples representing a wide range of virus concentrations analyzed after the COBAS AmpliPrep and manual specimen preparation methods, showed that there was no significant difference in qualitative or quantitative hepatitis C virus (HCV) assay performance, respectively. The AmpliPrep instrument decreased the time required to prepare serum or plasma samples for HCV PCR to under 1 min per sample. This was a decrease of 76% compared to the manual specimen preparation method. Systems that
Circulating polymerase chain reaction chips utilizing multiple-membrane activation
NASA Astrophysics Data System (ADS)
Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin
2007-02-01
This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.
Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko
2013-05-01
Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.
Ririe, K M; Rasmussen, R P; Wittwer, C T
1997-02-15
A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.
Pine, Sharon R; Yin, Changhong; Matloub, Yousif H; Sabaawy, Hatem E; Sandoval, Claudio; Levendoglu-Tugal, Oya; Ozkaynak, M Fevzi; Jayabose, Somasundaram
2005-02-01
Accurate detection of central nervous system (CNS) involvement in children with newly diagnosed acute lymphoblastic leukemia (ALL) could have profound prognostic and therapeutic implications. We examined various cerebrospinal fluid (CSF) preservation methods to yield adequate DNA stability for polymerase chain reaction (PCR) analysis and developed a quantitative real-time PCR assay to detect occult CNS leukemia. Sixty CSF specimens were maintained in several storage conditions for varying amounts of time, and we found that preserving CSF in 1:1 serum-free RPMI tissue culture medium offers the best stability of DNA for PCR analysis. Sixty CSF samples (30 at diagnosis and 30 at the end of induction therapy) from 30 children with ALL were tested for CNS leukemic involvement by real-time PCR using patient-specific antigen receptor gene rearrangement primers. Six of thirty patient diagnosis samples were PCR-positive at levels ranging from 0.5 to 66% leukemic blasts in the CSF. Four of these patients had no clinical or cytomorphological evidence of CNS leukemia involvement at that time. All 30 CSF samples drawn at the end of induction therapy were PCR-negative. The data indicate that real-time PCR analysis of CSF is an excellent tool to assess occult CNS leukemia involvement in patients with ALL and can possibly be used to refine CNS status classification.
Pine, Sharon R.; Yin, Changhong; Matloub, Yousif H.; Sabaawy, Hatem E.; Sandoval, Claudio; Levendoglu-Tugal, Oya; Ozkaynak, M. Fevzi; Jayabose, Somasundaram
2005-01-01
Accurate detection of central nervous system (CNS) involvement in children with newly diagnosed acute lymphoblastic leukemia (ALL) could have profound prognostic and therapeutic implications. We examined various cerebrospinal fluid (CSF) preservation methods to yield adequate DNA stability for polymerase chain reaction (PCR) analysis and developed a quantitative real-time PCR assay to detect occult CNS leukemia. Sixty CSF specimens were maintained in several storage conditions for varying amounts of time, and we found that preserving CSF in 1:1 serum-free RPMI tissue culture medium offers the best stability of DNA for PCR analysis. Sixty CSF samples (30 at diagnosis and 30 at the end of induction therapy) from 30 children with ALL were tested for CNS leukemic involvement by real-time PCR using patient-specific antigen receptor gene rearrangement primers. Six of thirty patient diagnosis samples were PCR-positive at levels ranging from 0.5 to 66% leukemic blasts in the CSF. Four of these patients had no clinical or cytomorphological evidence of CNS leukemia involvement at that time. All 30 CSF samples drawn at the end of induction therapy were PCR-negative. The data indicate that real-time PCR analysis of CSF is an excellent tool to assess occult CNS leukemia involvement in patients with ALL and can possibly be used to refine CNS status classification. PMID:15681484
Cruz, Patricia; Mehretu, Arthuro M; Buttner, Mark P; Trice, Theresa; Howard, Katherine M
2015-08-14
In recent studies, periodontal health has been linked to being overweight and/or obese. Among common oral bacteria, Selenomonas noxia has been implicated in converting periodontal health to disease, and Selenomonas species have also been found in gastric ulcers. The objective of this study was to develop and validate a quantitative polymerase chain reaction (qPCR) assay for the specific and rapid detection of S. noxia. Two oligonucleotide primer pairs and one probe were designed and tested to determine optimal amplification signal with three strains of S. noxia. The PCR assay was tested against fourteen non-target organisms, including closely related oral Selenomonads, one phylogenetically closely related bacterium, and two commonly isolated oral bacteria. One of the primer sets was more sensitive at detecting the target organism and was selected for optimization and validation experiments. The designed primers and probe amplified the target organism with 100% specificity. PCR inhibition was observed with an internal positive control, and inhibition was resolved by diluting the DNA extract. The qPCR assay designed in this study can be used to specifically detect S. noxia in the clinical setting and in future research involving the enhanced detection of S. noxia. The assay can also be used in epidemiological studies for understanding the role of S. noxia in disease processes including, but not limited to, oral health and obesity of infectious origin.
Sensitive detection of Treponema pallidum by using the polymerase chain reaction.
Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D
1991-01-01
We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis.
Reverse transcription and polymerase chain reaction: principles and applications in dentistry.
Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth
2004-03-01
Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.
Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis.
Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B
2003-01-01
To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive.
Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis
Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B
2003-01-01
Aim: To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. Methods: The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Results: Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. Conclusions: PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive. PMID:12488268
Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.
2006-01-01
Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978
Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing
2009-11-25
Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.
Kernif, Tahar; Aissi, Meriem; Doumandji, Salah-Eddine; Chomel, Bruno B.; Raoult, Didier; Bitam, Idir
2010-01-01
Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae were detected infecting Algerian dogs. To our knowledge, this study is the first report of detection by PCR amplification of Bartonella in dogs in North Africa. PMID:20682871
Modern techniques for tracking fecal pollution in environmental waters require investing in DNA-based methods to determine the presence of specific fecal sources. To help water quality managers decide whether to employ routine polymerase chain reaction (PCR) or quantitative PC...
Lai, Chieh-Hsien; Wu, Sih-Rong; Pang, Jen-Chieh; Ramireddy, Latha; Chiang, Yu-Cheng; Lin, Chien-Ku; Tsen, Hau-Yang
2017-07-01
The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA) real-time quantitative polymerase chain reaction (qPCR) to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4-5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable. Copyright © 2016. Published by Elsevier B.V.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Cnops, Lieselotte; Van den Eede, Peter; Pettitt, James; Heyndrickx, Leo; De Smet, Birgit; Coppens, Sandra; Andries, Ilse; Pattery, Theresa; Van Hove, Luc; Meersseman, Geert; Van Den Herrewegen, Sari; Vergauwe, Nicolas; Thijs, Rein; Jahrling, Peter B.; Nauwelaers, David; Ariën, Kevin K.
2016-01-01
Background. The 2013–2016 Ebola epidemic in West Africa resulted in accelerated development of rapid diagnostic tests for emergency outbreak preparedness. We describe the development and evaluation of the Idylla™ prototype Ebola virus test, a fully automated sample-to-result molecular diagnostic test for rapid detection of Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV). Methods. The Idylla™ prototype Ebola virus test can simultaneously detect EBOV and SUDV in 200 µL of whole blood. The sample is directly added to a disposable cartridge containing all reagents for sample preparation, RNA extraction, and amplification by reverse-transcription polymerase chain reaction analysis. The performance was evaluated with a variety of sample types, including synthetic constructs and whole blood samples from healthy volunteers spiked with viral RNA, inactivated virus, and infectious virus. Results. The 95% limits of detection for EBOV and SUDV were 465 plaque-forming units (PFU)/mL (1010 copies/mL) and 324 PFU/mL (8204 copies/mL), respectively. In silico and in vitro analyses demonstrated 100% correct reactivity for EBOV and SUDV and no cross-reactivity with relevant pathogens. The diagnostic sensitivity was 97.4% (for EBOV) and 91.7% (for SUDV), the specificity was 100%, and the diagnostic accuracy was 95.9%. Conclusions. The Idylla™ prototype Ebola virus test is a fast, safe, easy-to-use, and near-patient test that meets the performance criteria to detect EBOV in patients with suspected Ebola. PMID:27247341
David-Neto, Elias; Triboni, Ana H K; Paula, Flavio J; Vilas Boas, Lucy S; Machado, Clarisse M; Agena, Fabiana; Latif, Acram Z A; Alencar, Cecília S; Pierrotti, Ligia C; Nahas, William C; Caiaffa-Filho, Helio H; Pannuti, Claudio S
2014-11-27
Cytomegalovirus (CMV) disease occurs in 16% to 20% of low-risk, CMV-positive renal transplant recipients. The cutoffs for quantitative real-time polymerase chain reaction (qPCR) or phosphoprotein (pp65) antigenemia (pp65emia) for starting preemptive therapy have not been well established. We measured qPCR and pp65emia weekly from day 7 to day 120 after transplantation, in anti-CMV immunoglobulin G–positive donor and recipient pairs. Patients and physicians were blinded to the test results. Suspicion of CMV disease led to the order of new tests. In asymptomatic viremic patients, the highest pp65emia and qPCR values were used, whereas we considered the last value before diagnosis in those with CMV disease. We collected a total of 1,481 blood samples from 102 adult patients. Seventeen patients developed CMV disease, 54 presented at least one episode of viremia that cleared spontaneously, and 31 never presented viremia. Five patients developed CMV disease after the end of the study period. The median (95% confidence interval) pp65emia and qPCR values were higher before CMV disease than during asymptomatic viremia (6 [9–82] vs. 3 [1–14] cells/10(6) cells; P<0.001 and 3,080 [1,263–15,605] vs. 258 [258–1,679] copies/mL; P=0.008, respectively). The receiver operating characteristic curve showed that pp65emia 4 cells/10(6) cells or greater showed a sensitivity and specificity to predict CMV disease of 69% and 81%, respectively (area, 0.769; P=0.001), with a positive predictive value of 37% and a negative predictive value of 93%. For qPCR 2,000 copies/mL or higher, the positive predictive value and negative predictive value were 57% and 91%, respectively (receiver operating characteristic area, 0.782; P=0.000). With these cutoffs, both methods are appropriate for detecting CMV disease.
Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.
Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam
2017-01-01
Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.
Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-07-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-01-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
Several studies have examined how fecal indicator bacteria (FIB) measurements compare between quantitative polymerase chain reaction (QPCR) and the culture methods it is intended to replace. Here we extend those studies by examining the stability of that relationship within a be...
D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I
1993-01-01
The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.
High-throughput microfluidic single-cell digital polymerase chain reaction.
White, A K; Heyries, K A; Doolin, C; Vaninsberghe, M; Hansen, C L
2013-08-06
Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118,900 chambers/cm(2)) allows the analysis of 200 single cells per run, for a total of 204,000 PCR reactions using a device footprint of 10 cm(2). Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10(4). We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing.
The goal of this research was to compare the populations of 81 mold species in homes in USA and UK using mould specific quantitative polymerase chain reaction (MSQPCR) technology. Dust samples were obtained from randomly selected homes in Great Britain (n=11). The mould populat...
Yamaguchi, Akemi; Matsuda, Kazuyuki; Sueki, Akane; Taira, Chiaki; Uehara, Masayuki; Saito, Yasunori; Honda, Takayuki
2015-08-25
Reverse transcription (RT)-nested polymerase chain reaction (PCR) is a time-consuming procedure because it has several handling steps and is associated with the risk of cross-contamination during each step. Therefore, a rapid and sensitive one-step RT-nested PCR was developed that could be performed in a single tube using a droplet-PCR machine. The K562 BCR-ABL mRNA-positive cell line as well as bone marrow aspirates from 5 patients with chronic myelogenous leukemia (CML) and 5 controls without CML were used. We evaluated one-step RT-nested PCR using the droplet-PCR machine. One-step RT-nested PCR performed in a single tube using the droplet-PCR machine enabled the detection of BCR-ABL mRNA within 40min, which was 10(3)-fold superior to conventional RT nested PCR using three steps in separate tubes. The sensitivity of the one-step RT-nested PCR was 0.001%, with sample reactivity comparable to that of the conventional assay. One-step RT-nested PCR was developed using the droplet-PCR machine, which enabled all reactions to be performed in a single tube accurately and rapidly and with high sensitivity. This one-step RT-nested PCR may be applicable to a wide spectrum of genetic tests in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.
Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R
1993-11-01
To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.
Aziah, Ismail; Ravichandran, Manickam; Ismail, Asma
2007-12-01
Conventional polymerase chain reaction (PCR) testing requires many pipetting steps and has to be transported and stored in cold chain. To overcome these limitations, we designed a ready-to-use PCR test for Salmonella typhi using PCR reagents, primers against the ST50 gene of S. typhi, a built-in internal amplification control (IAC), and gel loading dye mixed and freeze-dried in a single tube. The 2-step dry-reagent-based assay was used to amplify a 1238-bp target gene and an 810-bp IAC gene from 73 BACTEC blood culture broths (33 true positives for S. typhi and 40 true negatives for non-S. typhi). The sensitivity, specificity, positive predictive value, and negative predictive value of the PCR assay were 87.9%, 100%, 100%, and 90.9%, respectively. We suggest that this rapid 2-step PCR test could be used for the rapid diagnosis of typhoid fever.
Identification of four squid species by quantitative real-time polymerase chain reaction.
Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan
2016-02-01
Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. Copyright © 2016 Elsevier Ltd. All rights reserved.
Quantitative risk stratification in Markov chains with limiting conditional distributions.
Chan, David C; Pollett, Philip K; Weinstein, Milton C
2009-01-01
Many clinical decisions require patient risk stratification. The authors introduce the concept of limiting conditional distributions, which describe the equilibrium proportion of surviving patients occupying each disease state in a Markov chain with death. Such distributions can quantitatively describe risk stratification. The authors first establish conditions for the existence of a positive limiting conditional distribution in a general Markov chain and describe a framework for risk stratification using the limiting conditional distribution. They then apply their framework to a clinical example of a treatment indicated for high-risk patients, first to infer the risk of patients selected for treatment in clinical trials and then to predict the outcomes of expanding treatment to other populations of risk. For the general chain, a positive limiting conditional distribution exists only if patients in the earliest state have the lowest combined risk of progression or death. The authors show that in their general framework, outcomes and population risk are interchangeable. For the clinical example, they estimate that previous clinical trials have selected the upper quintile of patient risk for this treatment, but they also show that expanded treatment would weakly dominate this degree of targeted treatment, and universal treatment may be cost-effective. Limiting conditional distributions exist in most Markov models of progressive diseases and are well suited to represent risk stratification quantitatively. This framework can characterize patient risk in clinical trials and predict outcomes for other populations of risk.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest
Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required formore » PCR.« less
Teixeira, M M; Campaner, M; Camargo, E P
1994-01-01
To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.
Hong, Yan; Zhao, Xiaosu; Qin, Yazhen; Zhou, Songhai; Chang, Yingjun; Wang, Yu; Zhang, Xiaohui; Xu, Lanping; Huang, Xiaojun
2018-04-28
The E2A-PBX1 rearrangement is common in B cell acute lymphoblastic leukemia (B-ALL). However, whether this fusion gene can be used as a reliable marker for minimal residual disease (MRD) following allogeneic hematopoietic stem cell transplantation (allo-HSCT) remains unknown. In this study, clinical data were collected from 28 consecutive B-ALL patients who received allo-HSCT. Their MRD was evaluated by E2A-PBX1 and leukemia-associated immunophenotype (LAIP). The median follow-up was 374 days (55-2342 days). Of the enrolled patients, seven (25%) patients died of leukemia relapse. A total of nine (32.1%) patients experienced relapse at a median of 164 days (75-559 days) after transplantation. The median expression level in the first positive sample was 0.14% (0.0071-902.4%). The duration from E2A-PBX1-positive results to hematological relapse was 74 days (30-469 days). E2A-PBX1 expression generally became positive prior to flow cytometry. Patients with positive E2A-PBX1 gene expression pre-transplantation were more likely to have positive E2A-PBX1 expression after transplantation. Taken all together, E2A-PBX1 expression determined by real-time quantitative reverse transcriptase polymerase chain reaction (RQ-PCR) could be used to evaluate MRD status after allo-HSCT. Patients with positive E2A-PBX1 expression after transplant will have a poor prognosis.
USDA-ARS?s Scientific Manuscript database
Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...
Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma
2015-03-01
Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.
USDA-ARS?s Scientific Manuscript database
The present study describes the development of a real time Taqman polymerase chain reaction (PCR) assay using a fluorescent labeled probe for the detection and quantitation of chicken parvovirus (ChPV) in feces. The primers and probes were designed based on the nucleotide sequence of the non struct...
Sensitive detection of Treponema pallidum by using the polymerase chain reaction.
Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D
1991-01-01
We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis. Images PMID:1993770
Concordance of polymerase chain reaction with human immunodeficiency virus antibody detection.
Horsburgh, C R; Ou, C Y; Jason, J; Holmberg, S D; Lifson, A R; Moore, J L; Ward, J W; Seage, G R; Mayer, K H; Evatt, B L
1990-08-01
To evaluate the correlation of detection of human immunodeficiency virus (HIV) by polymerase chain reaction (PCR) with detection of HIV antibody, 271 simultaneous serum and peripheral blood mononuclear cell samples were examined from 242 persons whose activities placed them at increased risk for HIV infection: 142 from homosexual men, 86 from hemophilic men, and 43 from heterosexual partners of HIV-infected persons. PCR was performed using the gag region primer pair SK38/39 and the env region primer pairs SK68/69 and CO71/72. Amplified HIV DNA was detected using specific oligomer probes. Of 63 HIV antibody-positive samples, 58 (92%) had HIV DNA by PCR. Of 208 HIV antibody-negative samples, 7 (3.4%) had HIV DNA by PCR. On follow-up, 4 of the latter persons were seropositive when next tested; 2 were well and antibody- and PCR-negative; 1 had died of a stroke before retesting. Thus, PCR detects HIV in most antibody-positive persons; detection is increased by use of multiple primer pairs. PCR-positive antibody-negative specimens may indicate HIV infection in which antibody has not yet developed or may be false-positive PCR results. When PCR is discordant with HIV antibody, testing of additional specimens and clinical follow-up are necessary to assess HIV infection status.
A Continuous-Flow Polymerase Chain Reaction Microchip With Regional Velocity Control
Li, Shifeng; Fozdar, David Y.; Ali, Mehnaaz F.; Li, Hao; Shao, Dongbing; Vykoukal, Daynene M.; Vykoukal, Jody; Floriano, Pierre N.; Olsen, Michael; McDevitt, John T.; Gascoyne, Peter R.C.; Chen, Shaochen
2009-01-01
This paper presents a continuous-flow polymerase chain reaction (PCR) microchip with a serpentine microchannel of varying width for “regional velocity control.” Varying the channel width by incorporating expanding and contracting conduits made it possible to control DNA sample velocities for the optimization of the exposure times of the sample to each temperature phase while minimizing the transitional periods during temperature transitions. A finite element analysis (FEA) and semi-analytical heat transfer model was used to determine the distances between the three heating assemblies that are responsible for creating the denaturation (96 °C), hybridization (60 °C), and extension (72 °C) temperature zones within the microchip. Predictions from the thermal FEA and semi-analytical model were compared with temperature measurements obtained from an infrared (IR) camera. Flow-field FEAs were also performed to predict the velocity distributions in the regions of the expanding and contracting conduits to study the effects of the microchannel geometry on flow recirculation and bubble nucleation. The flow fields were empirically studied using micro particle image velocimetry (μ-PIV) to validate the flow-field FEA’s and to determine experimental velocities in each of the regions of different width. Successful amplification of a 90 base pair (bp) bacillus anthracis DNA fragment was achieved. PMID:19829760
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-06-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.
Law, Dennis K S; Tsang, Raymond S W
2013-05-01
A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.
Bullard, K M; Hietpas, P B; Ewing, A G
1998-01-01
Polymerase chain reaction (PCR) amplified short tandem repeat (STR) samples from the HUMVWF locus have been analyzed using a unique sample introduction and separation technique. A single capillary is used to transfer samples onto an ultrathin slab gel (57 microm thin). This ultrathin nondenaturing polyacrylamide gel is used to separate the amplified fragments, and laser-induced fluorescence with ethidium bromide is used for detection. The feasibility of performing STR analysis using this system has been investigated by examining the reproducibility for repeated samples. Reproducibility is examined by comparing the migration of the 14 and 17 HUMVWF alleles on three consecutive separations on the ultrathin slab gel. Using one locus, separations match in migration time with the two alleles 42 s apart for each of the three consecutive separations. This technique shows potential to increase sample throughput in STR analysis techniques although separation resolution still needs to be improved.
Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H
2007-03-01
A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.
Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen
2007-06-01
Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.
A multisite assessment of the quantitative capabilities of the Xpert MTB/RIF assay.
Blakemore, Robert; Nabeta, Pamela; Davidow, Amy L; Vadwai, Viral; Tahirli, Rasim; Munsamy, Vanisha; Nicol, Mark; Jones, Martin; Persing, David H; Hillemann, Doris; Ruesch-Gerdes, Sabine; Leisegang, Felicity; Zamudio, Carlos; Rodrigues, Camilla; Boehme, Catharina C; Perkins, Mark D; Alland, David
2011-11-01
The Xpert MTB/RIF is an automated molecular test for Mycobacterium tuberculosis that estimates bacterial burden by measuring the threshold-cycle (Ct) of its M. tuberculosis-specific real-time polymerase chain reaction. Bacterial burden is an important biomarker for disease severity, infection control risk, and response to therapy. Evaluate bacterial load quantitation by Xpert MTB/RIF compared with conventional quantitative methods. Xpert MTB/RIF results were compared with smear-microscopy, semiquantiative solid culture, and time-to-detection in liquid culture for 741 patients and 2,008 samples tested in a multisite clinical trial. An internal control real-time polymerase chain reaction was evaluated for its ability to identify inaccurate quantitative Xpert MTB/RIF results. Assays with an internal control Ct greater than 34 were likely to be inaccurately quantitated; this represented 15% of M. tuberculosis-positive tests. Excluding these, decreasing M. tuberculosis Ct was associated with increasing smear microscopy grade for smears of concentrated sputum pellets (r(s) = -0.77) and directly from sputum (r(s) =-0.71). A Ct cutoff of approximately 27.7 best predicted smear-positive status. The association between M. tuberculosis Ct and time-to-detection in liquid culture (r(s) = 0.68) and semiquantitative colony counts (r(s) = -0.56) was weaker than smear. Tests of paired same-patient sputum showed that high viscosity sputum samples contained ×32 more M. tuberculosis than nonviscous samples. Comparisons between the grade of the acid-fast bacilli smear and Xpert MTB/RIF quantitative data across study sites enabled us to identify a site outlier in microscopy. Xpert MTB/RIF quantitation offers a new, standardized approach to measuring bacterial burden in the sputum of patients with tuberculosis.
DNA Polymerase III Star Requires ATP to Start Synthesis on a Primed DNA†
Wickner, William; Kornberg, Arthur
1973-01-01
DNA polymerase III star replicates a ϕX174 single-stranded, circular DNA primed with a fragment of RNA. This reaction proceeds in two stages. In stage I, a complex is formed requiring DNA polymerase III star, ATP, spermidine, copolymerase III*, and RNA-primed ϕX174 single-stranded, circular DNA. The complex, isolated by gel filtration, contains ADP and inorganic phosphate (the products of a specific ATP cleavage) as well as spermidine, polymerase III star, and copolymerase III star. In stage II, the chain grows upon addition of deoxynucleoside triphosphates; ADP and inorganic phosphate are discharged and chain elongation is resistant to antibody to copolymerase III star. Thus ATP and copolymerase III star are required to initiate chain growth but not to sustain it. Images PMID:4519657
Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C
2002-01-01
Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.
Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources
Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam
2017-01-01
Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources. PMID:29142893
Quantitative Profiling of Feruloylated Arabinoxylan Side-Chains from Graminaceous Cell Walls
Schendel, Rachel R.; Meyer, Marleen R.; Bunzel, Mirko
2016-01-01
Graminaceous arabinoxylans are distinguished by decoration with feruloylated monosaccharidic and oligosaccharidic side-chains. Although it is hypothesized that structural complexity and abundance of these feruloylated arabinoxylan side-chains may contribute, among other factors, to resistance of plant cell walls to enzymatic degradation, quantitative profiling approaches for these structural units in plant cell wall materials have not been described yet. Here we report the development and application of a rapid and robust method enabling the quantitative comparison of feruloylated side-chain profiles in cell wall materials following mildly acidic hydrolysis, C18-solid phase extraction (SPE), reduction under aprotic conditions, and liquid chromatography with diode-array detection/mass spectrometry (LC-DAD/MS) separation and detection. The method was applied to the insoluble fiber/cell wall materials isolated from 12 whole grains: wild rice (Zizania aquatica L.), long-grain brown rice (Oryza sativa L.), rye (Secale cereale L.), kamut (Triticum turanicum Jakubz.), wheat (Triticum aestivum L.), spelt (Triticum spelta L.), intermediate wheatgrass (Thinopyrum intermedium), maize (Zea mays L.), popcorn (Zea mays L. var. everta), oat (Avena sativa L.) (dehulled), barley (Hordeum vulgare L.) (dehulled), and proso millet (Panicum miliaceum L.). Between 51 and 96% of the total esterified monomeric ferulates were represented in the quantified compounds captured in the feruloylated side-chain profiles, which confirms the significance of these structures to the global arabinoxylan structure in terms of quantity. The method provided new structural insights into cereal grain arabinoxylans, in particular, that the structural moiety α-l-galactopyranosyl-(1→2)-β-d-xylopyranosyl-(1→2)-5-O-trans-feruloyl-l-arabinofuranose (FAXG), which had previously only been described in maize, is ubiquitous to cereal grains. PMID:26834763
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
Plague in a Pediatric Patient: Case Report and Use of Polymerase Chain Reaction as a Diagnostic Aid.
Drummond, Wendi K; Nelson, Christina A; Fowler, Joe; Epson, Erin E; Mead, Paul S; Lawaczeck, Elisabeth W
2014-12-01
We report a case of bubonic plaque in a 7-year-old patient who presented with a core temperature of 107°F, seizures, vomiting, altered mental status, and septic shock. This case highlights the utility of polymerase chain reaction (PCR) as a diagnostic aid for rapid presumptive identification of Yersinia pestis as well as the importance of correlating PCR results with clinical data. We discuss the various manifestations of plague as they relate to infection control, postexposure prophylaxis, antimicrobial therapy, and treatment duration. © The Author 2014. Published by Oxford University Press on behalf of the Pediatric Infectious Diseases Society. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
He, Rong-Quan; Yang, Xia; Liang, Liang; Chen, Gang; Ma, Jie
2018-04-01
The present study aimed to explore the potential clinical significance of microRNA (miR)-124-3p expression in the hepatocarcinogenesis and development of hepatocellular carcinoma (HCC), as well as the potential target genes of functional HCC pathways. Reverse transcription-quantitative polymerase chain reaction was performed to evaluate the expression of miR-124-3p in 101 HCC and adjacent non-cancerous tissue samples. Additionally, the association between miR-124-3p expression and clinical parameters was also analyzed. Differentially expressed genes identified following miR-124-3p transfection, the prospective target genes predicted in silico and the key genes of HCC obtained from Natural Language Processing (NLP) were integrated to obtain potential target genes of miR-124-3p in HCC. Relevant signaling pathways were assessed with protein-protein interaction (PPI) networks, Gene Ontology (GO) enrichment analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) and Protein Annotation Through Evolutionary Relationships (PANTHER) pathway enrichment analysis. miR-124-3p expression was significantly reduced in HCC tissues compared with expression in adjacent non-cancerous liver tissues. In HCC, miR-124-3p was demonstrated to be associated with clinical stage. The mean survival time of the low miR-124-3p expression group was reduced compared with that of the high expression group. A total of 132 genes overlapped from differentially expressed genes, miR-124-3p predicted target genes and NLP identified genes. PPI network construction revealed a total of 109 nodes and 386 edges, and 20 key genes were identified. The major enriched terms of three GO categories included regulation of cell proliferation, positive regulation of cellular biosynthetic processes, cell leading edge, cytosol and cell projection, protein kinase activity, transcription activator activity and enzyme binding. KEGG analysis revealed pancreatic cancer, prostate cancer and non-small cell lung cancer as the
Ibrahim, Eslam S; Kashef, Mona T; Essam, Tamer M; Ramadan, Mohammed A
2017-12-01
A clean way to overcome environmental pollution is biodegradation. In this perspective, at the intersection of biodegradation and metagenomics, the degradome is defined as the totality of genes related to the biodegradation of a certain compound. It includes the genetic elements from both culturable and uncultured microorganisms. The possibility of assessing the biodegradation potential of an environmental samples, using a degradome-based polymerase chain reaction, was explored. 2,4-Dichlorophenol (2,4-DCP) was chosen as a model and the use of tfdB gene as a biodegradation marker was confirmed by bioinformatics study of TfdB protein. Five primer pairs were designed for the detection of different tfdB gene families. A total of 16 environmental samples were collected from Egyptian agricultural soils and wastewaters and tested for the presence of 2,4-DCP. The biodegradation capacity of 2,4-DCP was determined, for all isolated consortia, to reach up to 350 mg/l. Metagenomic DNA was extracted directly from the soil samples while successive 2,4-DCP-degrading microbial communities were enriched, with increasing concentrations of 2,4-DCP, then their DNA was extracted. The extracted DNA was tested for the distribution of the tfdB gene using a degradome-based polymerase chain reaction. tfdB-1 and tfdB-2 were detected in 5 and 9 samples, respectively. However, the co-existence of both genes was detected only in five samples. All tfdB positive samples were capable of 2,4-DCP degradation. The developed approach of assessing the potential of different environments for degrading 2,4-DCP was successfully measured in terms of accuracy (81.25%) and specificity (100%).
Valverde, Estefania J; Cano, Irene; Labella, Alejandro; Borrego, Juan J; Castro, Dolores
2016-04-06
Lymphocystis disease (LCD) is the main viral infection reported to affect cultured gilthead seabream (Sparus aurata) in Europe. The existence of subclinical Lymphocystis disease virus (LCDV) infection in this fish species has been recognised by using polymerase chain reaction (PCR)-based methods. Nevertheless, these methods do not provide quantitative results that can be useful in epidemiological and pathological studies. Moreover, carrier fish have been involved in viral transmission, therefore the use of specific and sensitive diagnostic methods to detect LCDV will be relevant for LCD prevention. We have developed a real-time PCR (qPCR) assay to detect and quantify LCDV. The assay was evaluated for viral diagnosis in surveillance studies in gilthead seabream farms, and also to identify viral reservoirs in a hatchery. The prevalence of LCDV infection in the asymptomatic gilthead seabream populations tested varied from 30 to 100 %, including data from one farm without previous records of LCD. Estimated viral load in caudal fin of subclinically infected fish was two to five orders of magnitude lower than in diseased fish. The qPCR assay allowed the detection of carrier fish in broodstock from a farm with a history of clinical LCD in juvenile fish. In addition, the quantitative detection of LCDV was achieved in all samples collected in the hatchery, including fertilized eggs, larvae and fingerlings, and also rotifer cultures and artemia metanauplii and cysts used for larval rearing. The qPCR assay developed in this study has proved to be a rapid, sensitive, and reliable method for LCDV diagnosis, which could be valuable to identify LCDV reservoirs or to study viral replication in gilthead seabream.
Cheng, Y Ky; Lin, C Sw; Kwok, Y Ky; Chan, Y M; Lau, T K; Leung, T Y; Choy, K W
2017-04-01
There is significant morbidity associated with fragile X syndrome. Unfortunately, most maternal carriers are clinically silent during their reproductive years. Because of this, many experts have put forward the notion of preconception or prenatal fragile X carrier screening for females. This study aimed to determine the prevalence of fragile X syndrome pre-mutation and asymptomatic full-mutation carriers in a Chinese pregnant population, and the distribution of cytosine-guanine-guanine (CGG) repeat numbers using a robust fragile X mental retardation 1 (FMR1) polymerase chain reaction assay. This was a cross-sectional survey in prospectively recruited pregnant women from a university hospital in Hong Kong. Chinese pregnant women without a family history of fragile X syndrome were recruited between April 2013 and May 2015. A specific FMR1 polymerase chain reaction assay was performed on peripheral blood to determine the CGG repeat number of the FMR1 gene. Prenatal counselling was offered to full-mutation and pre-mutation carriers. In 2650 Chinese pregnant women, two individuals with pre-mutation alleles (0.08%, one in 1325) and one asymptomatic woman with full-mutation (0.04%, one in 2650) alleles were identified. The overall prevalence of pre-mutation and full-mutation alleles was 0.11% (1 in 883). Furthermore, 30 (1.1%) individuals with intermediate alleles were detected. In the 2617 women with normal CGG repeats, the most common CGG repeat allele was 30. The overall prevalence of pre-mutation and asymptomatic full-mutation carriers in the Chinese pregnant population was one in 883, detected by a new FMR1 polymerase chain reaction assay.
Zhao, Xiaowen; Bailey, Mark R; Emery, Warren R; Lambooy, Peter K; Chen, Dayue
2007-06-01
Nanofiltration is commonly introduced into purification processes of biologics produced in mammalian cells to serve as a designated step for removal of potential exogenous viral contaminants and endogenous retrovirus-like particles. The LRV (log reduction value) achieved by nanofiltration is often determined by cell-based infectivity assay, which is time-consuming and labour-intensive. We have explored the possibility of employing QPCR (quantitative PCR) to evaluate LRV achieved by nanofiltration in scaled-down studies using two model viruses, namely xenotropic murine leukemia virus and murine minute virus. We report here the successful development of a QPCR-based method suitable for quantification of virus removal by nanofiltration. The method includes a nuclease treatment step to remove free viral nucleic acids, while viral genome associated with intact virus particles is shielded from the nuclease. In addition, HIV Armored RNA was included as an internal control to ensure the accuracy and reliability of the method. The QPCRbased method described here provides several advantages such as better sensitivity, faster turnaround time, reduced cost and higher throughput over the traditional cell-based infectivity assays.
Zeman, David; Kušnierová, Pavlína; Švagera, Zdeněk; Všianský, František; Byrtusová, Monika; Hradílek, Pavel; Kurková, Barbora; Zapletalová, Olga; Bartoš, Vladimír
2016-01-01
We aimed to compare various methods for free light chain (fLC) quantitation in cerebrospinal fluid (CSF) and serum and to determine whether quantitative CSF measurements could reliably predict intrathecal fLC synthesis. In addition, we wished to determine the relationship between free kappa and free lambda light chain concentrations in CSF and serum in various disease groups. We analysed 166 paired CSF and serum samples by at least one of the following methods: turbidimetry (Freelite™, SPAPLUS), nephelometry (N Latex FLC™, BN ProSpec), and two different (commercially available and in-house developed) sandwich ELISAs. The results were compared with oligoclonal fLC detected by affinity-mediated immunoblotting after isoelectric focusing. Although the correlations between quantitative methods were good, both proportional and systematic differences were discerned. However, no major differences were observed in the prediction of positive oligoclonal fLC test. Surprisingly, CSF free kappa/free lambda light chain ratios were lower than those in serum in about 75% of samples with negative oligoclonal fLC test. In about a half of patients with multiple sclerosis and clinically isolated syndrome, profoundly increased free kappa/free lambda light chain ratios were found in the CSF. Our results show that using appropriate method-specific cut-offs, different methods of CSF fLC quantitation can be used for the prediction of intrathecal fLC synthesis. The reason for unexpectedly low free kappa/free lambda light chain ratios in normal CSFs remains to be elucidated. Whereas CSF free kappa light chain concentration is increased in most patients with multiple sclerosis and clinically isolated syndrome, CSF free lambda light chain values show large interindividual variability in these patients and should be investigated further for possible immunopathological and prognostic significance.
Kušnierová, Pavlína; Švagera, Zdeněk; Všianský, František; Byrtusová, Monika; Hradílek, Pavel; Kurková, Barbora; Zapletalová, Olga; Bartoš, Vladimír
2016-01-01
Objectives We aimed to compare various methods for free light chain (fLC) quantitation in cerebrospinal fluid (CSF) and serum and to determine whether quantitative CSF measurements could reliably predict intrathecal fLC synthesis. In addition, we wished to determine the relationship between free kappa and free lambda light chain concentrations in CSF and serum in various disease groups. Methods We analysed 166 paired CSF and serum samples by at least one of the following methods: turbidimetry (Freelite™, SPAPLUS), nephelometry (N Latex FLC™, BN ProSpec), and two different (commercially available and in-house developed) sandwich ELISAs. The results were compared with oligoclonal fLC detected by affinity-mediated immunoblotting after isoelectric focusing. Results Although the correlations between quantitative methods were good, both proportional and systematic differences were discerned. However, no major differences were observed in the prediction of positive oligoclonal fLC test. Surprisingly, CSF free kappa/free lambda light chain ratios were lower than those in serum in about 75% of samples with negative oligoclonal fLC test. In about a half of patients with multiple sclerosis and clinically isolated syndrome, profoundly increased free kappa/free lambda light chain ratios were found in the CSF. Conclusions Our results show that using appropriate method-specific cut-offs, different methods of CSF fLC quantitation can be used for the prediction of intrathecal fLC synthesis. The reason for unexpectedly low free kappa/free lambda light chain ratios in normal CSFs remains to be elucidated. Whereas CSF free kappa light chain concentration is increased in most patients with multiple sclerosis and clinically isolated syndrome, CSF free lambda light chain values show large interindividual variability in these patients and should be investigated further for possible immunopathological and prognostic significance. PMID:27846293
Enterococci are frequently monitored in water samples as indicators of fecal pollution. Attention is now shifting from culture based methods for enumerating these organisms to more rapid molecular methods such as QPCR. Accurate quantitative analyses by this method requires highly...
Cnops, Lieselotte; Van den Eede, Peter; Pettitt, James; Heyndrickx, Leo; De Smet, Birgit; Coppens, Sandra; Andries, Ilse; Pattery, Theresa; Van Hove, Luc; Meersseman, Geert; Van Den Herrewegen, Sari; Vergauwe, Nicolas; Thijs, Rein; Jahrling, Peter B; Nauwelaers, David; Ariën, Kevin K
2016-10-15
The 2013-2016 Ebola epidemic in West Africa resulted in accelerated development of rapid diagnostic tests for emergency outbreak preparedness. We describe the development and evaluation of the Idylla™ prototype Ebola virus test, a fully automated sample-to-result molecular diagnostic test for rapid detection of Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV). The Idylla™ prototype Ebola virus test can simultaneously detect EBOV and SUDV in 200 µL of whole blood. The sample is directly added to a disposable cartridge containing all reagents for sample preparation, RNA extraction, and amplification by reverse-transcription polymerase chain reaction analysis. The performance was evaluated with a variety of sample types, including synthetic constructs and whole blood samples from healthy volunteers spiked with viral RNA, inactivated virus, and infectious virus. The 95% limits of detection for EBOV and SUDV were 465 plaque-forming units (PFU)/mL (1010 copies/mL) and 324 PFU/mL (8204 copies/mL), respectively. In silico and in vitro analyses demonstrated 100% correct reactivity for EBOV and SUDV and no cross-reactivity with relevant pathogens. The diagnostic sensitivity was 97.4% (for EBOV) and 91.7% (for SUDV), the specificity was 100%, and the diagnostic accuracy was 95.9%. The Idylla™ prototype Ebola virus test is a fast, safe, easy-to-use, and near-patient test that meets the performance criteria to detect EBOV in patients with suspected Ebola. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Abud, J E; Luque, E H; Ramos, J G; Rodriguez, H A
2017-07-01
GST-tagged proteins are important tools for the production of recombinant proteins. Removal of GST tag from its fusion protein, frequently by harsh chemical treatments or proteolytic methods, is often required. Thus, the monitoring of the proteins in tag-free form requires a significant effort to determine the remnants of GST during purification process. In the present study, we developed both a conventional enzyme-linked immunosorbent assay (ELISA) and an immuno-polymerase chain reaction (IPCR) assay, both specific for detection of recombinant GST (rGST). rGST was expressed in Escherichia coli JM109, using a pGEX4T-3 vector, and several anti-rGST monoclonal antibodies were generated using hybridoma technology. Two of these were rationally selected as capture and detection antibodies, allowing the development of a sandwich ELISA with a limit of detection (LOD) of 0.01 μg/ml. To develop the rGST-IPCR assay, we selected "Universal-IPCR" format, comprising the biotin-avidin binding as the coupling system. In addition, the rGST-IPCR was developed in standard PCR tubes, and the surface adsorption of antibodies on PCR tubes, the optimal neutravidin concentrations, the generation of a reporter DNA and the concentration effect were studied and determined. Under optimized assay conditions, the rGST-IPCR assay provided a 100-fold increase in the LOD as well as an expanded working range, in comparison with rGST-ELISA. The proposed method exhibited great potentiality for application in several fields in which measurement of very low levels of GST is necessary, and might provide a model for other IPCR assays. Copyright © 2017 Elsevier Inc. All rights reserved.
Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao
2011-12-28
For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.
Inhibition of herpes simplex virus DNA polymerase by purine ribonucleoside monophosphates.
Frank, K B; Cheng, Y C
1986-02-05
Purine ribonucleoside monophosphates were found to inhibit chain elongation catalyzed by herpes simplex virus (HSV) DNA polymerase when DNA template-primer concentrations were rate-limiting. Inhibition was fully competitive with DNA template-primer during chain elongation; however, DNA polymerase-associated exonuclease activity was inhibited noncompetitively with respect to DNA. Combinations of 5'-GMP and phosphonoformate were kinetically mutually exclusive in dual inhibitor studies. Pyrimidine nucleoside monophosphates and deoxynucleoside monophosphates were less inhibitory than purine riboside monophosphates. The monophosphates of 9-beta-D-arabinofuranosyladenine, Virazole (1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide), 9-(2-hydroxyethoxymethyl)guanine, and 9-(1,3-dihydroxy-2-propoxymethyl)guanine exerted little or no inhibition. In contrast to HSV DNA polymerase, human DNA polymerase alpha was not inhibited by purine ribonucleoside monophosphates. These studies suggest the possibility of a physiological role of purine ribonucleoside monophosphates as regulators of herpesvirus DNA synthesis and a new approach to developing selective anti-herpesvirus compounds.
Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw
2011-05-01
A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)
Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon
2015-03-07
We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).
2005-01-01
Abstract The distribution of the immune complex vaccine virus for infectious bursal disease (IBD) in tissue was examined and the viral loads of the organs were quantitatively compared. One-day-old specific pathogen free (SPF) and maternally immune broiler chickens were injected subcutaneously with the vaccine. Lymphoid and non-lymphoid tissues were collected at various time intervals during the experiment to test for infectious bursal disease virus (IBDV)-RNA by using reverse transcriptase-polymerase chain reaction (RT-PCR). Only the bursa of Fabricius was found to be positive with unusually long viral persistence in the broiler group. The positive bursa samples were further investigated by using real-time PCR coupled with a TaqMan probe. The highest amounts of the virus were detected at its first appearance in the bursa: on day 14 post vaccination (PV) in the SPF chickens and on day 17 and day 21 PV in the maternally immune broiler group. The virus then gradually cleared, most likely due to the parallel appearance of the active immune response indicated by seroconversion. PMID:15971678
Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication.
Aida, A A; Che Man, Y B; Wong, C M V L; Raha, A R; Son, R
2005-01-01
A method for species identification from pork and lard samples using polymerase chain reaction (PCR) analysis of a conserved region in the mitochondrial (mt) cytochrome b (cyt b) gene has been developed. Genomic DNA of pork and lard were extracted using Qiagen DNeasy(®) Tissue Kits and subjected to PCR amplification targeting the mt cyt b gene. The genomic DNA from lard was found to be of good quality and produced clear PCR products on the amplification of the mt cyt b gene of approximately 360 base pairs. To distinguish between species, the amplified PCR products were cut with restriction enzyme BsaJI resulting in porcine-specific restriction fragment length polymorphisms (RFLP). The cyt b PCR-RFLP species identification assay yielded excellent results for identification of pig species. It is a potentially reliable technique for detection of pig meat and fat from other animals for Halal authentication.
Vanni, Irene; Ugolotti, Elisabetta; Raso, Alessandro; Di Marco, Eddi; Melioli, Giovanni; Biassoni, Roberto
2012-07-01
The clinical applications of in vitro manipulated cultured cells and their precursors are often made use of in therapeutic trials. However, tissue cultures can be easily contaminated by the ubiquitous Mollicutes micro-organisms, which can cause various and severe alterations in cellular function. Thus methods able to detect and trace Mollicutes impurities contaminating cell cultures are required before starting any attempt to grow cells under good manufacturing practice (GMP) conditions. We developed a multiplex quantitative polymerase chain reaction (qPCR) assay specific for the 16S-23S rRNA intergenic spacer regions, for the Tuf and P1 cytoadhesin genes, able to detect contaminant Mollicutes species in a single tube reaction. The system was validated by analyzing different cell lines and the positive samples were confirmed by 16S and P1 cytoadhesin gene dideoxy sequencing. Our multiplex qPCR detection system was able to reach a sensitivity, specificity and robustness comparable with the culture and the indicator cell culture method, as required by the European Pharmacopoeia guidelines. We have developed a multiplex qPCR method, validated following International Conference on Harmonization (ICH) guidelines, as a qualitative limit test for impurities, assessing the validation characteristics of limit of detection and specificity. It also follows the European Pharmacopoeia guidelines and Food and Drug Administration (FDA) requirements.
Brzezinski, Jennifer L
2006-01-01
The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.
Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna
2016-05-01
Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.
Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F
1996-05-01
Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.
Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin
2013-09-15
We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.
Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T
2017-01-01
Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.
USDA-ARS?s Scientific Manuscript database
This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...
Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M
2011-07-01
Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.
Tien, Wei-Ping; Lim, Gareth; Yeo, Gladys; Chiang, Suzanna Nicole; Chong, Chee-Seng; Ng, Lee-Ching; Hapuarachchi, Hapuarachchige Chanditha
2017-09-19
The monitoring of vectors is one of the key surveillance measures to assess the risk of arbovirus transmission and the success of control strategies in endemic regions. The recent re-emergence of Zika virus (ZIKV) in the tropics, including Singapore, emphasizes the need to develop cost-effective, rapid and accurate assays to monitor the virus spread by mosquitoes. As ZIKV infections largely remain asymptomatic, early detection of ZIKV in the field-caught mosquitoes enables timely implementation of appropriate mosquito control measures. We developed a rapid, sensitive and specific real-time reverse transcription polymerase chain reaction (rRT-PCR) assay for the detection of ZIKV in field-caught mosquitoes. The primers and PCR cycling conditions were optimized to minimize non-specific amplification due to cross-reactivity with the genomic material of Aedes aegypti, Aedes albopictus, Culex quinquefasciatus, Culex tritaeniorhynchus, Culex sitiens and Anopheles sinensis, as well as accompanying microbiota. The performance of the assay was further evaluated with a panel of flaviviruses and alphaviruses as well as in field-caught Ae. aegypti mosquitoes confirmed to be positive for ZIKV. As compared to a probe-based assay, the newly developed assay demonstrated 100% specificity and comparable detection sensitivity for ZIKV in mosquitoes. Being a SYBR Green-based method, the newly-developed assay is cost-effective and easy to adapt, thus is applicable to large-scale vector surveillance activities in endemic countries, including those with limited resources and expertise. The amplicon size (119 bp) also allows sequencing to confirm the virus type. The primers flank relatively conserved regions of ZIKV genome, so that, the assay is able to detect genetically diverse ZIKV strains. Our findings, therefore, testify the potential use of the newly-developed assay in vector surveillance programmes for ZIKV in endemic regions.
Detection of the aerolysin gene in Aeromonas hydrophila by the polymerase chain reaction.
Pollard, D R; Johnson, W M; Lior, H; Tyler, S D; Rozee, K R
1990-01-01
Synthetic oligonucleotide primers were used in a polymerase chain reaction (PCR) technique to detect the gene for aerolysin in strains of Aeromonas hydrophila and to screen for identical genes in A. caviae, A. sobria, and A. veronii isolated from patients with diarrheal disease. Primers targeted a 209-bp fragment of the aer gene coding for the beta-hemolysin and detected template DNA only in the PCR using nucleic acid (NA) from hemolytic strains of A. hydrophila which were also cytotoxic to Vero and CHO cells and enterotoxic in suckling-mouse assays. PCR amplification of NA from hemolytic A. sobria or nonhemolytic A. hydrophila and A. caviae strains was consistently negative. Primer specificity was determined in the PCR by using NA extracted from 56 strains of bacteria, including hemolytic Escherichia coli and Listeria monocytogenes as well as several recognized enteric pathogens defined in terms of their toxigenicity. The detection limit for the aerolysin gene by PCR amplification was 1 ng of total NA. The PCR clearly identified aerolysin-producing strains of A. hydrophila and may have application as a species-specific virulence test because other hemolytic Aeromonas species tested were negative. Images PMID:2254423
Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T
2016-06-01
We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.
Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid
2017-01-01
Background: Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor. PMID:29279831
Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid
2017-01-01
Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
An, S F; Fleming, K A
1991-11-01
A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.
Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein
2017-09-01
The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species
Kamaraj R, Dinesh; Bhushan, Kala S; K L, Vandana
2014-01-01
Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load.
Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana
2014-01-01
Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. Materials and Methods: The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. Result: The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. Conclusion: The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load. PMID:24596791
Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A
2000-01-01
Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.
de Cremoux, P; Bieche, I; Tran-Perennou, C; Vignaud, S; Boudou, E; Asselain, B; Lidereau, R; Magdelénat, H; Becette, V; Sigal-Zafrani, B; Spyratos, F
2004-09-01
Quantitative reverse transcription-polymerase chain reaction (RT-PCR) used to detect minor changes in specific mRNA concentrations may be associated with poor reproducibility. Stringent quality control is therefore essential at each step of the protocol, including the PCR procedure. We performed inter-laboratory quality control of quantitative PCR between two independent laboratories, using in-house RT-PCR assays on a series of hormone-related target genes in a retrospective consecutive series of 79 breast tumors. Total RNA was reverse transcribed in a single center. Calibration curves were performed for five target genes (estrogen receptor (ER)alpha, ERbeta, progesterone receptor (PR), CYP19 (aromatase) and Ki 67) and for two reference genes (human acidic ribosomal phosphoprotein PO (RPLPO) and TATA box-binding protein (TBP)). Amplification efficiencies of the calibrator were determined for each run and used to calculate mRNA expression. Correlation coefficients were evaluated for each target and each reference gene. A good correlation was observed for all target and reference genes in both centers using their own protocols and kits (P < 0.0001). The correlation coefficients ranged from 0.90 to 0.98 for the various target genes in the two centers. A good correlation was observed between the level of expression of the ERalpha and the PR transcripts (P < 0.001). A weak inverse correlation was observed in both centers between ERalpha and ERbeta levels, but only when TBP was the reference gene. No other correlation was observed with other parameters. Real-time PCR assays allow convenient quantification of target mRNA transcripts and quantification of target-derived nucleic acids in clinical specimens. This study addresses the importance of inter-laboratory quality controls for the use of a panel of real-time PCR assays devoted to clinical samples and protocols and to ensure their appropriate accuracy. This can also facilitate exchanges and multicenter comparison of
Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada
2009-01-01
A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.
Hase, Ryota; Hirooka, Takuya; Itabashi, Takashi; Endo, Yasunobu; Otsuka, Yoshihito
2018-05-15
A 65-year-old man presented with gradually exacerbating low back pain. Magnetic resonance imaging revealed vertebral osteomyelitis in the Th11-L2 vertebral bodies and discs. The patient showed negative findings on conventional cultures. Direct broad-range polymerase chain reaction (PCR) with sequencing of the biopsied specimen had the highest similarity to the 16S rRNA gene of Helicobacter cinaedi. This case suggests that direct broad-range PCR with sequencing should be considered when conventional cultures cannot identify the causative organism of vertebral osteomyelitis, and that this method may be particularly useful when the pathogen is a fastidious organism, such as H. cinaedi.
Focke, Felix; Haase, Ilka; Fischer, Markus
2011-01-26
Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.
Seol, Jung-Hwan; Cho, Byung-Hoon; Chung, Chong-Pyoung; Bae, Kwang-Shik
2006-02-01
The purpose of this study was to detect the presence of Porphyromonas endodontalis, P. gingivalis, Prevotella intermedia, P. nigrescens, and P. tannerae from clinical samples using multiplex polymerase chain reactions (PCR). Two different multiplex PCR protocols were used (one for the two Porphyromonas species and the other for the three Prevotella species), each one using a primer pair specific for each target species. The results were compared to those of the conventional culture procedures. Microbial samples were taken aseptically from 40 infected root canals and abscesses from patients. Samples were cultured in an anaerobic condition for conventional identification using a Rapid ID 32 A kit. Multiplex PCR was processed using the DNA extracted from each sample. At least one of the five species of black-pigmented bacteria (BPB) were detected in 65% (26 of 40) of the samples using multiplex PCR, and in 15% (6 of 40) using the conventional culture procedures. Multiplex PCR was more rapid, sensitive, specific, and effective in detecting BPB than the conventional culture procedures.
Zietz, B.; Wiese, J.; Brengelmann, F.; Dunkelberg, H.
2001-01-01
Outbreaks of Legionnaire's disease present a public health challenge especially because fatal outcomes still remain frequent. The aim of this study was to describe the abundance and epidemiology of Legionellaceae in the human-made environment. Water was sampled from hot-water taps in private and public buildings across the area of Göttingen, Germany, including distant suburbs. Following isolation, we used polymerase chain reaction in order to generate strain specific banding profiles of legionella isolates. In total, 70 buildings were examined. Of these 18 (26%) had the bacterium in at least one water sample. Legionella pneumophila serogroups 1, 4, 5 and 6 could be identified in the water samples. Most of the buildings were colonized solely by one distinct strain, as proven by PCR. In three cases equal patterns were found in separate buildings. There were two buildings in this study where isolates with different serogroups were found at the same time. PMID:11293675
Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer
2018-01-18
Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples
Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca
2015-01-01
Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713
McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y
2014-04-01
A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.
A polymerase chain reaction-based methodology to detect gene doping.
Carter, Adam; Flueck, Martin
2012-04-01
The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.
Templar, Alexander; Woodhouse, Stefan; Keshavarz-Moore, Eli; Nesbeth, Darren N
2016-08-01
Advances in synthetic genomics are now well underway in yeasts due to the low cost of synthetic DNA. These new capabilities also bring greater need for quantitating the presence, loss and rearrangement of loci within synthetic yeast genomes. Methods for achieving this will ideally; i) be robust to industrial settings, ii) adhere to a global standard and iii) be sufficiently rapid to enable at-line monitoring during cell growth. The methylotrophic yeast Pichia pastoris (P. pastoris) is increasingly used for industrial production of biotherapeutic proteins so we sought to answer the following questions for this particular yeast species. Is time-consuming DNA purification necessary to obtain accurate end-point polymerase chain reaction (e-pPCR) and quantitative PCR (qPCR) data? Can the novel linear regression of efficiency qPCR method (LRE qPCR), which has properties desirable in a synthetic biology standard, match the accuracy of conventional qPCR? Does cell cultivation scale influence PCR performance? To answer these questions we performed e-pPCR and qPCR in the presence and absence of cellular material disrupted by a mild 30s sonication procedure. The e-pPCR limit of detection (LOD) for a genomic target locus was 50pg (4.91×10(3) copies) of purified genomic DNA (gDNA) but the presence of cellular material reduced this sensitivity sixfold to 300pg gDNA (2.95×10(4) copies). LRE qPCR matched the accuracy of a conventional standard curve qPCR method. The presence of material from bioreactor cultivation of up to OD600=80 did not significantly compromise the accuracy of LRE qPCR. We conclude that a simple and rapid cell disruption step is sufficient to render P. pastoris samples of up to OD600=80 amenable to analysis using LRE qPCR which we propose as a synthetic biology standard. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun
2012-06-01
A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments. Copyright © 2012 Elsevier Inc. All rights reserved.
High-throughput real-time quantitative reverse transcription PCR.
Bookout, Angie L; Cummins, Carolyn L; Mangelsdorf, David J; Pesola, Jean M; Kramer, Martha F
2006-02-01
Extensive detail on the application of the real-time quantitative polymerase chain reaction (QPCR) for the analysis of gene expression is provided in this unit. The protocols are designed for high-throughput, 384-well-format instruments, such as the Applied Biosystems 7900HT, but may be modified to suit any real-time PCR instrument. QPCR primer and probe design and validation are discussed, and three relative quantitation methods are described: the standard curve method, the efficiency-corrected DeltaCt method, and the comparative cycle time, or DeltaDeltaCt method. In addition, a method is provided for absolute quantification of RNA in unknown samples. RNA standards are subjected to RT-PCR in the same manner as the experimental samples, thus accounting for the reaction efficiencies of both procedures. This protocol describes the production and quantitation of synthetic RNA molecules for real-time and non-real-time RT-PCR applications.
Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T
2002-03-01
Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.
Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon
2010-09-01
This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights
Yang, Litao; Pan, Aihu; Zhang, Kewei; Guo, Jinchao; Yin, Changsong; Chen, Jianxiu; Huang, Cheng; Zhang, Dabing
2005-08-10
As the genetically modified organisms (GMOs) labeling policies are issued in many countries, qualitative and quantitative polymerase chain reaction (PCR) techniques are increasingly used for the detection of genetically modified (GM) crops in foods. Qualitative PCR and TaqMan real-time quantitative PCR methods to detect and identify three varieties of insect resistant cotton, i.e., Mon531 cotton (Monsanto Co.) and GK19 and SGK321 cottons (Chinese Academy of Agricultural Sciences), which were approved for commercialization in China, were developed in this paper. Primer pairs specific to inserted DNAs, such as Cowpea trypsin inhibitor (CpTI) gene of SGK321 cotton and the specific junction DNA sequences containing partial Cry1A(c) gene and NOS terminator of Mon531, GK19, and SGK321 cotton varieties were designed to conduct the identified PCR assays. In conventional specific identified PCR assays, the limit of detection (LOD) was 0.05% for Mon531, GK19, or SGK321 in 100 ng of cotton genomic DNA for one reaction. Also, the multiplex PCR method for screening the three GM cottons was also established, which could save time and cost in practical detection. Furthermore, a real-time quantitative PCR assay based on TaqMan chemistry for detection of insect resistant gene, Cry1A(c), was developed. This assay also featured the use of a standard plasmid as a reference molecule, which contained both a specific region of the transgene Cry1A(c) and an endogenous stearoyl-acyl carrier protein desaturase (Sad1) gene of the cotton. In quantitative PCR assay, the quantification range was from 0.01 to 100% in 100 ng of the genome DNA template, and in the detection of 1.0, 3.0, and 5.0% levels of three insect resistant cotton lines, respectively, all of the relative standard deviations (RSDs) were less than 8.2% except for the GM cotton samples with 1.0% Mon531 or GK19, which meant that our real-time PCR assays involving the use of reference molecule were reliable and practical for GM
Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum.
Tan, Ching Giap; Ideris, Aini; Omar, Abdul R; Yii, Chen Pei; Kleven, Stanley H
2014-09-02
The present study was based on the reverse transcription polymerase chain reaction (RT-PCR) of the 16S ribosomal nucleic acid (rRNA) of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20-25 h at 37 °C, 22-25 h at 16 °C, and 23-27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h). The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.
Oddoux, O; Debourgogne, A; Kantele, A; Kocken, C H; Jokiranta, T S; Vedy, S; Puyhardy, J M; Machouart, M
2011-04-01
Recently, Plasmodium knowlesi has been recognised as the fifth Plasmodium species causing malaria in humans. Hundreds of human cases infected with this originally simian Plasmodium species have been described in Asian countries and increasing numbers are reported in Europe from travellers. The growing impact of tourism and economic development in South and Southeast Asia are expected to subsequently lead to a further increase in cases both among locals and among travellers. P. knowlesi is easily misidentified in microscopy as P. malariae or P. falciparum. We developed new primers for the rapid and specific detection of this species by low-cost real-time polymerase chain reaction (PCR) and added this method to an already existing panel of primers used for the molecular identification of the other four species in one reaction. Reference laboratories should now be able to identify undisputably and rapidly P. knowlesi, as it is a potentially fatal pathogen.
Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.
Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca
2015-03-01
Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.
McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.
2014-01-01
A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178
USDA-ARS?s Scientific Manuscript database
Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...
Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A
2014-02-01
Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.
Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S
2012-02-01
Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.
Rapid polymerase chain reaction-based screening assay for bacterial biothreat agents.
Yang, Samuel; Rothman, Richard E; Hardick, Justin; Kuroki, Marcos; Hardick, Andrew; Doshi, Vishal; Ramachandran, Padmini; Gaydos, Charlotte A
2008-04-01
To design and evaluate a rapid polymerase chain reaction (PCR)-based assay for detecting Eubacteria and performing early screening for selected Class A biothreat bacterial pathogens. The authors designed a two-step PCR-based algorithm consisting of an initial broad-based universal detection step, followed by specific pathogen identification targeted for identification of the Class A bacterial biothreat agents. A region in the bacterial 16S rRNA gene containing a highly variable sequence flanked by clusters of conserved sequences was chosen as the target for the PCR assay design. A previously described highly conserved region located within the 16S rRNA amplicon was selected as the universal probe (UniProbe, Integrated DNA Technology, Coralville, IA). Pathogen-specific TaqMan probes were designed for Bacillus anthracis, Yersinia pestis, and Francisella tularensis. Performance of the assay was assessed using genomic DNA extracted from the aforementioned biothreat-related organisms (inactivated or surrogate) and other common bacteria. The UniProbe detected the presence of all tested Eubacteria (31/31) with high analytical sensitivity. The biothreat-specific probes accurately identified organisms down to the closely related species and genus level, but were unable to discriminate between very close surrogates, such as Yersinia philomiragia and Bacillus cereus. A simple, two-step PCR-based assay proved capable of both universal bacterial detection and identification of select Class A bacterial biothreat and biothreat-related pathogens. Although this assay requires confirmatory testing for definitive species identification, the method has great potential for use in ED-based settings for rapid diagnosis in cases of suspected Category A bacterial biothreat agents.
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially
Golbang, N; Burnie, J P; Matthews, R C
1999-01-01
AIM: To develop a polymerase chain reaction enzyme immunoassay (PCR-EIA) to measure levels of circulating aspergillus DNA in invasive aspergillosis caused by Aspergillus fumigatus. METHODS: The PCR reaction was based on primers from the 18s rRNA gene. Binding of the product to a streptavidin coated microtitration plate was mediated by a biotinylated capture probe. The product was digoxigenylated during PCR and this was the tag to which antibody was bound in the subsequent EIA. RESULTS: The optical density (OD) endpoint was < 0.1 in 10 sera from neutropenic patients with no evidence of invasive aspergillosis, and in 10 sera from nonneutropenic patients with bacterial pneumonia (group 1). The OD from five of 12 patients with allergic bronchopulmonary aspergillosis (ABPA) (group 2), three with an aspergilloma (group 3), and five with possible invasive aspergillosis (group 4) was > or = 0.1. In 63 sera from 33 cases of proven invasive aspergillosis (group 5) an OD > or = 0.1 was achieved in 48 sera from 30 patients. The maximum OD was 0.510. The level fell in survivors and gradually rose in fatal cases. CONCLUSIONS: This assay validated the concept of diagnosing invasive aspergillosis by measuring levels of circulating fungal DNA in serum. PMID:10562808
Lee, Chi-Tsung; Hsiao, Kuang-Ming; Chen, Jin-Cherng; Su, Cheng-Chuan
2015-11-01
Acute bacterial meningitis causes high morbidity and mortality; the associated clinical symptoms often are insensitive or non-specific; and the pathogenic bacteria are geographically diverse. Clinical diagnosis requires a rapid and accurate methodology. This study aimed to develop a new multiplex polymerase chain reaction (mPCR) assay to detect simultaneously six major bacteria that cause adult bacterial meningitis in Taiwan: Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus pneumoniae, Staphylococcus aureus, Escherichia coli, and Acinetobacter baumannii. Species-specific primers for the six bacteria were developed using reference strains. The specificities of the mPCRs for these bacteria were validated, and the sensitivities were evaluated via serial dilutions. The mPCR assay specifically detected all of the six pathogens, particularly with sensitivities of 12 colony forming units (CFU)/mL, 90 CFU/mL, and 390 CFU/mL for E. coli, S. pneumoniae, and K. pneumoniae, respectively. This mPCR assay is a rapid and specific tool to detect the six major bacterial pathogens that cause acute adult meningitis in Taiwan, particularly sensitive for detecting E. coli, S. pneumoniae, and K. pneumoniae. The assay may facilitate early diagnosis and guidance for antimicrobial therapy for adult patients with this deadly disease in Taiwan. © 2015 APMIS. Published by John Wiley & Sons Ltd.
Dayan, Lior; Sprecher, Hannah; Hananni, Amos; Rosenbaum, Hana; Milloul, Victor; Oren, Ilana
2007-01-01
Vertebral osteomyelitis and disciitis caused by Aspergillus spp is a rare event. Early diagnosis and early antifungal therapy are critical in improving the prognosis for these patients. The diagnosis of invasive fungal infections is, in many cases, not straightforward and requires invasive procedures so that histological examination and culture can be performed. Furthermore, current traditional microbiological tests (ie, cultures and stains) lack the sensitivity for diagnosis of invasive aspergillosis. To present a case of vertebral osteomyelitis caused by Aspergillus spp diagnosed using a novel polymerase chain reaction (PCR) assay. Case report. Aspergillus DNA was detected in DNA extracted from the necrotic bone tissue by using a "panfungal" PCR novel method. Treatment with voriconazole was started based on the diagnosis. Using this novel technique enabled us to diagnose accurately an unusual bone pathogen that requires a unique treatment.
Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton
2003-02-01
A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.
Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael
2016-12-01
This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.
Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li
2015-07-01
Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh
2016-11-01
Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016
Peeters, M.; Huang, C. L.; Vonk, L. A.; Lu, Z. F.; Bank, R. A.; Doulabi, B. Zandieh
2016-01-01
Objectives Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Materials and Methods Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. Results No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. Conclusion For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised. Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real
Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip
2017-01-01
Abstract Background Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. Methods We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Results Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Conclusion Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. PMID:28973672
Five years' experience of classical swine fever polymerase chain reaction ring trials in France.
Po, F; Le Dimna, M; Le Potier, M F
2011-12-01
Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.
Calvo, Charles M; Khan, Mohammed Ali; Mehta, Sonia; Garg, Sunir J; Dunn, James P
2017-04-01
To correlate visual acuity outcomes and clinical features with quantitative PCR DNA copy number in patients with acute retinal necrosis (ARN). Retrospective, consecutive case series. In total, 14 eyes of 13 patients were diagnosed with ARN, based on the American Uveitis Society criteria, and were followed for a mean of 324.5 days (median 250.5 days, SD ± 214 days). Anterior chamber fluid analyzed by quantitative PCR identified viral DNA in 11 of 14 eyes (78.5%). Varicella zoster virus (VZV) was identified in seven eyes (50%) and herpes simplex virus (HSV) in four eyes (28.5%). Mean DNA copy number was 7.9 × 10 6 /mL (median 2.10 × 10 6 /mL, range: 0-5.60 × 10 7 /mL). Eyes with quantitative PCR DNA copy number of ≥5.0 × 10 6 /mL (n = 6 eyes) had worse baseline visual acuity (logMAR 1.48 ± 0.71 vs 0.94 ± 0.76, p = 0.196) and final visual acuity (logMAR 2.10 ± 0.60 vs 0.82 ± 0.81, p = 0.007) compared with patients with a DNA copy number <5.0 × 10 6 /mL (n = 8 eyes). Patients with a DNA copy number of ≥5.0 × 10 6 /mL were more likely to have at least 5 clock hours of retinitis on funduscopic exam (p = 0.03) and developed retinal detachment more frequently (p = 0.08). Quantitative DNA copy number of ≥5.0 × 10 6 /mL is associated with more extensive retinitis, worse visual acuity, and development of retinal detachment in patients with acute retinal necrosis.
Pallen, M J; Hay, A J; Puckey, L H; Efstratiou, A
1994-04-01
To assess the performance of the polymerase chain reaction (PCR) when used to screen rapidly large numbers of corynebacteria for toxin production; and to determine the incidence of false positive PCR results with non-toxigenic Corynebacterium diphtheriae isolates. Eighty seven recent British isolates of corynebacteria were assayed by PCR. All isolates were assayed from both blood and tellurite agar within a five day period. Thirty three non-toxigenic isolates of C diphtheriae from six countries were also tested by PCR and by the Elek immunodiffusion assay. There was complete concordance between the results of PCR and traditional methods on the recent British isolates, with one exception: an Elek positive "C ulcerans" isolate, which was PCR positive from tellurite but not from blood agar. One of the thirty three (3%) non-toxigenic isolates of C diphtheriae was PCR positive. These results suggest that PCR compares favourably with traditional methods for the detection of toxigenic corynebacteria and that it represents a powerful new tool in the diagnosis of an old disease.
Pallen, M J; Hay, A J; Puckey, L H; Efstratiou, A
1994-01-01
AIMS--To assess the performance of the polymerase chain reaction (PCR) when used to screen rapidly large numbers of corynebacteria for toxin production; and to determine the incidence of false positive PCR results with non-toxigenic Corynebacterium diphtheriae isolates. METHODS--Eighty seven recent British isolates of corynebacteria were assayed by PCR. All isolates were assayed from both blood and tellurite agar within a five day period. Thirty three non-toxigenic isolates of C diphtheriae from six countries were also tested by PCR and by the Elek immunodiffusion assay. RESULTS--There was complete concordance between the results of PCR and traditional methods on the recent British isolates, with one exception: an Elek positive "C ulcerans" isolate, which was PCR positive from tellurite but not from blood agar. One of the thirty three (3%) non-toxigenic isolates of C diphtheriae was PCR positive. CONCLUSIONS--These results suggest that PCR compares favourably with traditional methods for the detection of toxigenic corynebacteria and that it represents a powerful new tool in the diagnosis of an old disease. Images PMID:8027375
Detection of hepatitis "C" virus in formalin-fixed liver tissue by nested polymerase chain reaction.
Sallie, R; Rayner, A; Portmann, B; Eddleston, A L; Williams, R
1992-08-01
Interpretation of antibody to hepatitis C virus (HCV) in patients with liver disease is difficult due to false-positive reactivity in some conditions. To evaluate the feasibility of HCV in archival material, HCV was sought in formalin-fixed, paraffin-embedded liver biopsy specimens. Nested polymerase chain reaction was used to detect hepatitis C virus in formalin-fixed, paraffin-embedded liver biopsy specimens after total RNA was extracted from tissue by proteinase K digestion and phenol/chloroform purification. The relative efficiency of amplification of HCV RNA from formalin-fixed material was estimated semiquantitatively by serial dilution of cDNA synthesised from RNA extracted from fresh and formalin-fixed sections from the same liver. Although HCV RNA could be detected in formalin-fixed liver tissue by nested PCR in 5/5 cases in which HCV was detected in serum, amplification was approximately 5-fold less efficient than when HCV was amplified from fresh tissue. Nevertheless, nested PCR of HCV from formalin-fixed liver tissue represents a useful technique in addressing some important questions related to the pathogenesis of liver disease.
Atherton, Richard; Bhavnani, Darlene; Calvopiña, Manuel; Vicuña, Yosselin; Cevallos, William; Eisenberg, Joseph
2013-01-01
The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay) were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh) gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61%) were classified as assemblage B (26 as BIII and 16 as BIV), 22 (32%) as assemblage A (3 as AI and 19 as AII) and five (7%) as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A. PMID:23827993
USDA-ARS?s Scientific Manuscript database
The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...
Prenatal diagnosis using polymerase chain reaction on amniotic fluid for congenital toxoplasmosis.
Romand, S; Wallon, M; Franck, J; Thulliez, P; Peyron, F; Dumon, H
2001-02-01
To evaluate sensitivity, specificity, and predictive values of a prenatal amniotic fluid (AF) polymerase chain reaction (PCR) test for diagnosis of congenital toxoplasmosis. A multicenter prospective study was done on 271 women with proved primary Toxoplasma infection during pregnancy and who had amniocentesis for prenatal diagnosis by PCR. Live-born infants were eligible for analysis only if a serologic follow-up could assess a definitive infection status. Of the 270 evaluable cases, 75 were congenitally infected, 48 of whom had a positive PCR at prenatal diagnosis. Overall sensitivity of PCR on AF was estimated at 64% (95% confidence interval [CI] 53.1%, 74.9%), negative predictive value of 87.8% (95% CI 83.5%, 92.1%), whereas specificity and positive predictive value were 100% (95% CIs 98%, 100% and 92.3%, 100%, respectively). Among cases with congenital toxoplasmosis, there were no significant differences between those with positive or negative PCR with regard to median gestational age at maternal infection, interval between maternal infection and amniocentesis, or duration of treatment before amniocentesis. However, sensitivity of PCR was found to be significantly higher for maternal infections that occurred between 17 and 21 weeks' gestation (P <.02). A negative PCR of AF cannot rule out congenital infection. In this case, continuation of treatment with spiramycin combined with ultrasonographic follow-up and postnatal follow-up are warranted. Our results also suggest presumptive treatment combining pyrimethamine and sulfonamides in case of maternal infection occurring late in pregnancy.
Identification of duck plague virus by polymerase chain reaction
Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.
1999-01-01
A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto
Dusfour, Isabelle; Blondeau, Johanna; Harbach, Ralph E; Vythilingham, Indra; Baimai, Visut; Trung, Ho D; Sochanta, Tho; Bangs, Michael J; Manguin, Sylvie
2007-09-01
Anopheles sundaicus s.l., a major malaria vector taxon, occurs primarily along coastal areas and on islands in Southeast Asia. Our previous studies using cytochrome oxidase I, cytochrome-b, and internal transcribed spacer 2 markers discriminated three allopatric species: An. sundaicus s.s. in northern Borneo, An. epiroticus in Southeast Asia, and An. sundaicus E on Sumatra and Java, Indonesia. Morphological comparisons of three developmental stages did not reveal unique diagnostic characters that could reliably distinguish the three species. Therefore, we developed a multiplex polymerase chain reaction (PCR) assay based on two mitochondrial DNA markers to unambiguously identify them. This PCR was tested on 374 specimens from 24 different geographical populations, expanding our knowledge of the distribution of these species.
Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo
2011-01-03
In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.
Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş
2018-03-15
To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (p<0.0001). The ribotype 027 was the predominant cause of Clostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.
Wen, Dong-Yue; Lin, Peng; Pang, Yu-Yan; Chen, Gang; He, Yun; Dang, Yi-Wu; Yang, Hong
2018-05-05
BACKGROUND Long non-coding RNAs (lncRNAs) have a role in physiological and pathological processes, including cancer. The aim of this study was to investigate the expression of the long intergenic non-protein coding RNA 665 (LINC00665) gene and the cell cycle in hepatocellular carcinoma (HCC) using database analysis including The Cancer Genome Atlas (TCGA), the Gene Expression Omnibus (GEO), and quantitative real-time polymerase chain reaction (qPCR). MATERIAL AND METHODS Expression levels of LINC00665 were compared between human tissue samples of HCC and adjacent normal liver, clinicopathological correlations were made using TCGA and the GEO, and qPCR was performed to validate the findings. Other public databases were searched for other genes associated with LINC00665 expression, including The Atlas of Noncoding RNAs in Cancer (TANRIC), the Multi Experiment Matrix (MEM), Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) and protein-protein interaction (PPI) networks. RESULTS Overexpression of LINC00665 in patients with HCC was significantly associated with gender, tumor grade, stage, and tumor cell type. Overexpression of LINC00665 in patients with HCC was significantly associated with overall survival (OS) (HR=1.47795%; CI: 1.046-2.086). Bioinformatics analysis identified 469 related genes and further analysis supported a hypothesis that LINC00665 regulates pathways in the cell cycle to facilitate the development and progression of HCC through ten identified core genes: CDK1, BUB1B, BUB1, PLK1, CCNB2, CCNB1, CDC20, ESPL1, MAD2L1, and CCNA2. CONCLUSIONS Overexpression of the lncRNA, LINC00665 may be involved in the regulation of cell cycle pathways in HCC through ten identified hub genes.
Liu, Shasha; Xu, Kunhua; Wu, Zhigang; Xie, Xiao; Feng, Junli
2016-09-01
Tunas are economically important fishery worldwide, and are often used for commercial processed production. For effective fishery management and protection of consumers' rights, it is important to develop a molecular method to identify species in canned tuna products rapidly and reliably. Here, we have developed a duplex quantitative real-time PCR (qPCR) for identification of five highly priced tuna species (Thunnus maccoyii, Thunnus obesus, Thunnus albacares, Thunnus alalunga and Katsuwonus pelamis) from processed as well as fresh fish. After amplification and sequencing of seven genetic markers commonly used for species identification, 16S rDNA and control region (CR) of mitochondrial DNA were selected as the reference gene markers for genus Thunnus and tuna species identification, respectively. Subsequently, a 73 bp fragment of 16S rDNA and 85-99 bp fragment of CR were simultaneously amplified from each target species by qPCR. The qPCR efficiency of each reaction was calculated according to the standard curves, and the method was validated by amplification DNA extracted from single or mixed tuna specimen. The developed duplex qPCR system was applied to authenticate species of 14 commercial tuna products successfully, which demonstrated it was really a useful and academic technique to identify highly priced tuna species.
Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.
2004-01-01
We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.
Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H
2013-04-01
Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.
Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun
2014-09-01
The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.
Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao
2016-12-20
Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.
Supply chain risk management of newspaper industry: A quantitative study
NASA Astrophysics Data System (ADS)
Sartika, Viny; Hisjam, Muh.; Sutopo, Wahyudi
2018-02-01
The newspaper industry has several distinctive features that make it stands out from other industries. The strict delivery deadline and zero inventory led to a very short time frame for production and distribution. On the other hand, there is pressure from the newsroom to encourage the start of production as slowly as possible in order to enter the news, while there is pressure from production and distribution to start production as early as possible. Supply chain risk management is needed in determining the best strategy for dealing with possible risks in the newspaper industry. In a case study of a newspaper in Surakarta, quantitative approaches are made to the newspaper supply chain risk management by calculating the expected cost of risk based on the magnitude of the impact and the probability of a risk event. From the calculation results obtained that the five risks with the highest value are newspaper delays to the end customer, broken plate, miss print, down machine, and delayed delivery of newspaper content. Then analyzed appropriate mitigation strategies to cope with such risk events.
Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer
NASA Astrophysics Data System (ADS)
Madadelahi, M.; Kalan, K.; Shamloo, A.
2018-05-01
Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.
Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E
1999-01-01
A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.
Zappelini, Lincohn; Martone-Rocha, Solange; Dropa, Milena; Matté, Maria Helena; Tiba, Monique Ribeiro; Breternitz, Bruna Suellen; Razzolini, Maria Tereza Pepe
2017-02-01
Nontyphoidal Salmonella (NTS) is a relevant pathogen involved in gastroenteritis outbreaks worldwide. In this study, we determined the capacity to combine the most probable number (MPN) and multiplex polymerase chain reaction (PCR) methods to characterize the most important Salmonella serotypes in raw sewage. A total of 499 isolates were recovered from 27 raw sewage samples and screened using two previously described multiplex PCR methods. From those, 123 isolates were selected based on PCR banding pattern-identical or similar to Salmonella Enteritidis and Salmonella Typhimurium-and submitted to conventional serotyping. Results showed that both PCR assays correctly serotyped Salmonella Enteritidis, however, they presented ambiguous results for Salmonella Typhimurium identification. These data highlight that MPN and multiplex PCR can be useful methods to describe microbial quality in raw sewage and suggest two new PCR patterns for Salmonella Enteritidis identification.
Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K
1991-10-01
Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.
Espinoza-Herrera, Shirly J; Gaur, Vineet; Suo, Zucai; Carey, Paul R
2013-07-23
Y-Family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. (13)C- and (15)N-labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg(2+) and Mn(2+), nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of *C modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following a single d*CTP addition. Adding these two bases caused visible damage to the crystal that was possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn(2+) or Mg(2+), the primer extension reaction did not occur; instead, a ternary protein·template·d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features caused by ring modes from the template/primer bases being perturbed and from the DNA backbone appear, as well as features from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary complex than in the binary complex. Using standardized Raman intensities followed as a function of time, the C(*C)TP population in the crystal was maximal at ∼20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred.
2012-01-01
Background In this study, a total of 426 human faecal samples were examined for the presence of Entamoeba histolytica, Entamoeba dispar, Entamoeba moshkovskii infection via a combination of microscopic examination and nested polymerase chain reaction (PCR) targeting 16S ribosomal RNA of Entamoeba species. Methods Faecal sample were collected from 426 participants in five rural villages in Peninsular Malaysia. The faecal samples were processed by direct wet smear and formalin ethyl acetate concentration technique followed by iodine staining and examined via microscopy for the presence of Entamoeba species and other intestinal parasites. Microscopically positive samples for Entamoeba species cysts were further characterized using a Nested Polymerase Chain Reaction (Nested-PCR) targeting 16S-like ribosomal RNA gene. The data entry and analysis was carried out using the SPSS software (Statistical Package for the Social Sciences) program for Windows version 17 (SPSS, Chicago, IL, USA). Results Based on single faecal examination, overall prevalence of Entamoeba infection was 17.6% (75/426). Females (19.1%) were more commonly infected compared to males (15.9%). Comparison by age groups showed that adults (23.9%) had higher infection rates than children (15.3%). The PCR results showed that 52 out of 75 microscopy positive samples successfully generated species-specific amplicons. The infection with E. histolytica (75.0%; 39/52) was the most common, followed by E. dispar (30.8%; 18/52) and E. moshkovskii (5.8%; 3/52). Of these, 33 (63.5%) were shown to contain only E. histolytica, 10 (19.2%) contained E. dispar and 3 (5.8%) contained only E. moshkovskii. Mixed infection with E. histolytica and E. dispar was found in 6 (11.5%) samples. Conclusions The present study essentially emphasized the benefit of molecular techniques in discriminating the pathogenic Entamoeba species from the non-pathogenic for accurate diagnosis and better management of amoebiasis. The presence of E
Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X
2015-03-01
Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).
Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong
2018-02-01
Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.
Standardisation of polymerase chain reaction for the detection of Salmonella typhi in typhoid fever.
Chaudhry, R; Laxmi, B V; Nisar, N; Ray, K; Kumar, D
1997-01-01
To improve the diagnosis of Salmonella typhi infection, a polymerase chain reaction (PCR) assay was developed for the amplification of the dH flagellin gene of S typhi. Primers were designed from dH flagellin gene sequence which will give an amplification product of 486 base pairs. In tests to study the specificity of the assay, no amplification was seen in non-salmonella strains or salmonella strains with flagellar gene other than "d". Sensitivity tests determined that 28 pg of S typhi target DNA or 3 x 10(2) target bacteria could be detected by the PCR assay. Subsequently, the PCR technique was used for detection of S typhi in blood or clot cultures from 84 patients clinically suspected of having typhoid fever, and from 20 healthy control subjects. Twenty five of 84 samples from clinically suspected cases were positive by PCR; four of which were culture negative. No amplification was seen in samples from patients who were culture positive for organisms other than S typhi or from controls. The time taken for each sample for PCR analysis was less than 48 hours compared with three to five days for blood or clot culture. PCR appeared to be a promising diagnostic test for typhoid fever. Images PMID:9215131
Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip
2017-11-27
Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit
2017-01-01
To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.
Pitetti, Raymond D; Laus, Stella; Wadowsky, Robert M
2003-08-01
Epstein-Barr virus (EBV) infectious mononucleosis is often diagnosed based on characteristic clinical features and either a positive heterophil antibody test or serology, both of which can be unreliable in young children. Real time quantitative PCR assays that measure EBV DNA load in serum or plasma are highly sensitive in young children, but serum and plasma contain inhibitors of PCR which must be removed by DNA extraction techniques. A real time TaqMan PCR assay was designed and evaluated for simultaneously measuring EBV DNA load and validating the removal of PCR inhibitors from serum samples. A serum sample was available from patients classified serologically as primary EBV infection (n = 28), EBV-seronegative (n = 25) and EBV-seropositive (n = 26). Patients were classified as having EBV infectious mononucleosis if they had specified clinical findings and > or =10% atypical lymphocytes in peripheral blood or had a positive Monospot test result. DNA was purified by a spin column method and tested in PCR reactions with primers for EBV DNA polymerase gene and internal control targets. Amplification of the two PCR products was measured in real time with separate TaqMan DNA probes labeled with various fluorescent reporters. The mean age of study patients was 9 years, 4 months. Twenty-one (75%) of the patients in the primary EBV infection group, one (4%) of the seronegatives and none of the seropositives had detectable EBV DNA. Within the primary infection group, those with detectable virus were more likely than those without detectable virus to have evidence of lymphadenopathy (14 of 16 vs.1 of 5; P = 0.011), higher mean atypical (11.7 vs.0.9%; P = 0.002) and absolute atypical (1.5 vs.0.1 x 109/l; P = 0.004) lymphocyte count, higher mean absolute lymphocyte count (4.7 vs.2.3 x 109/l; P = 0.026) and higher mean aspartate aminotransferase value (119.8 vs.37.3 IU/l; P = 0.036). Ten patients, all in the primary infection group, had EBV infectious mononucleosis, and all
relA-dependent RNA polymerase activity in Escherichia coli.
Ryals, J; Bremer, H
1982-01-01
Parameters relating to RNA synthesis were measured after a temperature shift from 30 to 42 degrees C, in a relA+ and relA- isogenic pair of Escherichia coli strains containing a temperature-sensitive valyl tRNA synthetase. The following results were obtained: (i) the rRNA chain growth rate increased 2-fold in both strains; (ii) newly synthesized rRNA became unstable in both strains; (iii) the stable RNA gene activity (rRNA and tRNA, measured as stable RNA synthesis rate relative to the total instantaneous rate of RNA synthesis) decreased 1.7-fold in the relA+ strain and increased 1.9-fold in the relA mutant; and (iv) the RNA polymerase activity (measured by the percentage of total RNA polymerase enzyme active in transcription an any instant) decreased from 20 to 3.6% in the relA+ strain and remained unchanged (or increased at most to 22%) in the relA mutant. It is suggested that both rRNA gene activity and the RNA polymerase activity depend on the intracellular concentration of guanosine tetraphosphate, whereas the altered chain elongation rate and stability of rRNA are temperature or amino acid starvation effects, respectively, without involvement of relA function. PMID:6174501
Speicher, David J; Johnson, Newell W
2012-09-11
Human herpesvirus 8 (HHV-8), the aetiological agent of Kaposi's sarcoma (KS), multicentric Castleman's disease (MCD), and primary effusion lymphoma (PEL) is rare in Australia, but endemic in Sub-Saharan Africa, parts of South-east Asia and Oceania. While the treatment of external KS lesions can be monitored by clinical observation, the internal lesions of KS, MCD and PEL require extensive and expensive internal imaging, or autopsy. In patients with MCD and PEL, if HHV-8 viraemia is not reduced quickly, ~50% die within 24 months. HHV-8 qPCR is a valuable tool for monitoring HHV-8 viraemia, but is not available in many parts of the world, including those with high prevalence of KS and HHV-8. A new molecular facility with stringent three-phase workflow was established, adhering to NPAAC and CLSI guidelines. Three fully validated quantitative assays were developed: two for detection and quantification of HHV-8; one for GAPDH, necessary for normalisation of viral loads in tissue and peripheral blood. The HHV-8 ORF73 and ORF26 qPCR assays were 100% specific. All qPCR assays, displayed a broad dynamic range (102 to 1010 copies/μL TE Buffer) with a limit of detection of 4.85x103, 5.61x102, and 2.59x102 copies/μL TE Buffer and a limit of quantification of 4.85x103, 3.01x102, and 1.38x102 copies/μL TE Buffer for HHV-8 ORF73, HHV-8 ORF26, and GAPDH respectively.The assays were tested on a panel of 35 KS biopsies from Queensland. All were HHV-8 qPCR positive with average viral load of 2.96x105 HHV-8 copies/μL DNA extract (range: 4.37x103 to 1.47x106 copies/μL DNA extract): When normalised these equate to an average viral load of 2.44x104 HHV-8 copies/103 cells (range: 2.20x102 to 7.38x105 HHV-8 copies/103 cells). These are the first fully optimised, validated and MIQE compliant HHV-8 qPCR assays established in Australia. They worked well for qualitative detection of HHV-8 in archival tissue, and are well-suited for quantitative detection in whole blood. They are now
Quantitative phylogenetic assessment of microbial communities in diverse environments.
von Mering, C; Hugenholtz, P; Raes, J; Tringe, S G; Doerks, T; Jensen, L J; Ward, N; Bork, P
2007-02-23
The taxonomic composition of environmental communities is an important indicator of their ecology and function. We used a set of protein-coding marker genes, extracted from large-scale environmental shotgun sequencing data, to provide a more direct, quantitative, and accurate picture of community composition than that provided by traditional ribosomal RNA-based approaches depending on the polymerase chain reaction. Mapping marker genes from four diverse environmental data sets onto a reference species phylogeny shows that certain communities evolve faster than others. The method also enables determination of preferred habitats for entire microbial clades and provides evidence that such habitat preferences are often remarkably stable over time.
Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.
2006-01-01
Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430
Gomes, Ciro Martins; Mazin, Suleimy Cristina; dos Santos, Elisa Raphael; Cesetti, Mariana Vicente; Bächtold, Guilherme Albergaria Brízida; Cordeiro, João Henrique de Freitas; Theodoro, Fabrício Claudino Estrela Terra; Damasco, Fabiana dos Santos; Carranza, Sebastián Andrés Vernal; Santos, Adriana de Oliveira; Roselino, Ana Maria; Sampaio, Raimunda Nonata Ribeiro
2015-01-01
The diagnosis of mucocutaneous leishmaniasis (MCL) is hampered by the absence of a gold standard. An accurate diagnosis is essential because of the high toxicity of the medications for the disease. This study aimed to assess the ability of polymerase chain reaction (PCR) to identify MCL and to compare these results with clinical research recently published by the authors. A systematic literature review based on the Preferred Reporting Items for Systematic Reviews and Meta-Analyses: the PRISMA Statement was performed using comprehensive search criteria and communication with the authors. A meta-analysis considering the estimates of the univariate and bivariate models was performed. Specificity near 100% was common among the papers. The primary reason for accuracy differences was sensitivity. The meta-analysis, which was only possible for PCR samples of lesion fragments, revealed a sensitivity of 71% [95% confidence interval (CI) = 0.59; 0.81] and a specificity of 93% (95% CI = 0.83; 0.98) in the bivariate model. The search for measures that could increase the sensitivity of PCR should be encouraged. The quality of the collected material and the optimisation of the amplification of genetic material should be prioritised. PMID:25946238
RECREATIONAL BEACH WATER QUALITY MONITORING WITH QUANTITATIVE POLYMERASE CHAIN
Recreational beaches are an important economic and aesthetic asset to communities, states and the nation as a whole. Considerable resources are expended each year in monitoring the water at these beaches for fecal indicator bacteria as a means of determining if it is safe for pu...
Rapid polymerase chain reaction screening of Helicobacter pylori chromosomal point mutations.
Ge, Z; Taylor, D E
1997-09-01
Microdiversity (within individual genes) in the genomes of different Helicobacter pylori strains has been demonstrated to be more frequent than that seen in other prokaryotes. Point mutations in some genes, such as the vacA and 23S ribosomal RNA genes could result in the alteration of pathogenicity or antibiotic susceptibility of individual H. pylori strains. Development of a simple, rapid, and reliable screening method would be useful in the molecular characterization of genetic variation among different H. pylori strains. The copP gene from H. pylori UA802 was used as a model for developing a mutation screening method. Four point mutations were introduced into the copP gene by in vitro site-directed mutagenesis and were verified by DNA sequencing. The mutated copP gene replaced the wild-type locus by natural transformation and homologous recombination. The site-specific mutants were screened by polymerase chain reaction (PCR) using 3'-end mismatched primers. The origins of the PCR fragments were demonstrated by Southern hybridization with the copP-derived DNA probe. Three of these four mutations were characterized by PCR with the specific primers that contained the 3'-terminal nucleotide complementary only to the mutated nucleotide on both plasmid and chromosomal DNA templates. One mutation was able to be identified with the foregoing primer containing an additional wild-type nucleotide at its 3'-end. Point mutant screening with these specific primers offers 100% sensitivity in the aforementioned conditions. To achieve optimal screening, the concentration of magnesium and the annealing temperature have to be adjusted. The procedure reported in this study is a simple, economical, rapid, and efficient approach in the identification of site-specific mutations on both plasmids and chromosomal DNA. Although the method was developed by using a specified H. pylori gene, it can be extended easily to other genes of interest in H. pylori or other organisms.
Pérez, Lester J.; de Arce, Heidy Díaz
2009-01-01
Aujeszky’s disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided. PMID:24031383
Rampersad, Joanne; Wang, Xiaohui; Gayadeen, Helen; Ramsewak, Samuel; Ammons, David
2007-11-01
To provide a preliminary assessment of in-house polymerase chain reaction (PCR) as an alternative to the more costly commercial test for detection of asymptomatic infection by Chlamydia trachomatis and to provide much needed demographic data on infection indicators within the Trinidad and Tobago public health care system. An inexpensive in-house nested-PCR with an Internal Amplification Control was used to detect C. trachomatis and Neisseria gonorrhoeae in urine samples collected from 273 apparently healthy, pregnant women from March-September 2004 in Trinidad, West Indies. Demographic information on participants was collected and subjected to statistical analyses. C. trachomatis was detected in 57/273 (21%) samples, of which 5 (2%) were also positive for N. gonorrhoeae. Infection correlated well with certain demographic parameters, with the highest incidence of C. trachomatis infection found among pregnant women that were single or of African descent. Given the lack of commercial tests in Trinidad, in-house PCR is an inexpensive alternative that can be used to detect asymptomatic infections of C. trachomatis and to provide demographic information needed for interventions by the public health care system.
USDA-ARS?s Scientific Manuscript database
Quantitative PCR (qPCR) can be used to detect and monitor pathogen colonization, but early attempts to apply the technology to Botrytis cinerea infection of grape berries have identified limitations to current techniques. In this study, four DNA extraction methods, two grinding methods, two grape or...
Anitharaj, Velmurugan; Stephen, Selvaraj; Pradeep, Jothimani; Pooja, Pratheesh; Preethi, Sridharan
2017-01-01
In the recent past, scrub typhus (ST) has been reported from different parts of India, based on Weil-Felix/enzyme-linked immunosorbent assay (ELISA)/indirect immunofluorescence assay (IFA). Molecular tests are applied only by a few researchers. Evaluation of a new commercial real time polymerase chain reaction (PCR) kit for molecular diagnosis of ST by comparing it with the commonly used IgM ELISA is our aim. ST has been reported all over India including Puducherry and surrounding Tamil Nadu and identified as endemic for ST. This study was designed to correlate antibody detection by IgM ELISA and Orientia tsutsugamushi DNA in real time PCR. ST IgM ELISA (InBios Inc., USA) was carried out for 170 consecutive patients who presented with the symptoms of acute ST during 11 months (November, 2015- September, 2016). All 77 of these patients with IgM ELISA positivity and 49 of 93 IgM ELISA negative patients were subjected to real time PCR (Geno-Sen's ST real time PCR, Himachal Pradesh, India). Statistical analysis for clinical and laboratory results was performed using IBM SPSS Statistics 17 for Windows (SPSS Inc., Chicago, USA). Chi-square test with Yates correction (Fisher's test) was employed for a small number of samples. Among 77 suspected cases of acute ST with IgM ELISA positivity and 49 IgM negative patients, 42 and 7 were positive, respectively, for O. tsutsugamushi 56-kDa type-specific gene in real time PCR kit. Until ST IFA, the gold standard diagnostic test, is properly validated in India, diagnosis of acute ST will depend on both ELISA and quantitative PCR.
Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee
2017-10-01
Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.
Okabe, Tadashi; Sato, Chiyo; Matsumoto, Keisuke; Ozawa, Hitoshi; Sakamoto, Atsuhiro
2009-11-01
Electroconvulsive shock therapy (ECT) has been widely used as an effective and established treatment for refractory depression and schizophrenia. Some reports have shown that ECT is also effective for treating refractory neuropathic pain. In a rat model of neuropathic pain produced by chronic constrictive injury (CCI) of the sciatic nerve, thermal hyperalgesia, and mechanical allodynia were observed from day 2 after surgery. An electroconvulsive shock (ECS) was administered to rodents once daily for 6 days on days 7-12 after CCI operation using a pulse generator. Thermal and mechanical stimulation tests were performed to assess pain thresholds. Real-time polymerase chain reaction was used to measure the gene expression levels for 5HT(1A)R, 5HT(2A)R, neuropeptide Y (NPY), and GABAA(alpha1)R in the brain. After ECS, the latency to withdrawal from thermal stimulation was significantly increased; however, pain withdrawal thresholds in response to mechanical stimulation were not significantly changed. Expression ratios of NPY were significantly greater after ECS. Symptoms of neuropathic pain improved and expression of NPY in the brain was increased in CCI model rats after ECS, suggesting that changes in the expression of NPY in the brain may be related to the mechanism of action of ECT in treating neuropathic pain.
Kumar, N S; Kataria, J M; Koti, M; Dhama, K; Toroghi, R
2003-01-01
Polymerase chain reaction (PCR) assay was developed for the detection of Egg drop syndrome 1976 (EDS-76) virus in tissues, namely in the uterus, spleen and buffy coat. It was also used to study the persistence of the virus in tissues of experimentally infected layer birds. The PCR assay could detect as little as 10 fg of purified EDS-76 viral DNA. It also amplified the DNA of Fowl adenovirus serotypes 4 (FAV-4) and 8 (FAV-8). The virus persisted in the uterus up to day 21 post infection (p.i.). Detection of EDS-76 viral DNA in the buffy coat could be useful for studying the occurrence of the respective disease in layer bird flocks.
Bej, A K; McCarty, S C; Atlas, R M
1991-01-01
Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116
Dingemans, A M; Van Ark-Otte, J; Smit, E F; Postmus, P E; Giaccone, G
This report describes the validation of a polymerase chain reaction aided transcript titration assay (PATTY) for tumor samples. The results obtained with the PATTY were compared to those of RNase protection in a set of 7 human lung cancer cell lines and in 23 non-small cell lung cancer samples derived from resected patients. Whereas between PATTY and RNase protection assay a good correlation was observed in the cell lines (r = 0.74, p = 0.057), no correlation was observed within the tumor samples (r = 0.06, p = 0.78). This was also the case when only tumors with a high percentage of tumor cells (> 90%) were selected. Although PATTY is a valuable tool to measure mRNA expression in cell lines, our results caution the use of PATTY in human tumor samples without proper validation. The possible causes of these results are discussed.
Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum
2014-08-01
A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.
Costa Casagrande, T A; de Oliveira Barros, L M; Fukumasu, H; Cogliati, B; Chaible, L M; Dagli, M L Z; Matera, J M
2015-03-01
This study investigated the correlation between KIT gene expression determined by immunohistochemistry and real-time polymerase chain reaction (RT-PCR) and the rate of tumour recurrence and tumour-related deaths in dogs affected with mast cell tumour (MCT). Kaplan-Meier curves were constructed to compare tumour recurrence and tumour-related death between patients. The log-rank test was used to check for significant differences between curves. KIT-I, KIT-II and KIT-III staining patterns were observed in 9 (11.11%), 50 (61.73%) and 22 (27.16%) tumours, respectively. Tumour recurrence rates and tumour-related deaths were not associated with KIT staining patterns (P = 0278, P > 0.05), KIT (P = 0.289, P > 0.05) or KIT ligand (P = 0.106, P > 0.05) gene expression. Despite the lack of association between KIT staining pattern and patient survival time, the results suggest a correlation between aberrant KIT localization and increased proliferative activity of MCTs. RT-PCR seems to be a sensible method for quantitative detection of KIT gene expression in canine MCT, although expressions levels are not correlated with prognosis. © 2013 Blackwell Publishing Ltd.
Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A
2014-01-01
Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.
Andrews, J O; Conway, W; Cho, W -K; Narayanan, A; Spille, J -H; Jayanth, N; Inoue, T; Mullen, S; Thaler, J; Cissé, I I
2018-05-09
We present qSR, an analytical tool for the quantitative analysis of single molecule based super-resolution data. The software is created as an open-source platform integrating multiple algorithms for rigorous spatial and temporal characterizations of protein clusters in super-resolution data of living cells. First, we illustrate qSR using a sample live cell data of RNA Polymerase II (Pol II) as an example of highly dynamic sub-diffractive clusters. Then we utilize qSR to investigate the organization and dynamics of endogenous RNA Polymerase I (Pol I) in live human cells, throughout the cell cycle. Our analysis reveals a previously uncharacterized transient clustering of Pol I. Both stable and transient populations of Pol I clusters co-exist in individual living cells, and their relative fraction vary during cell cycle, in a manner correlating with global gene expression. Thus, qSR serves to facilitate the study of protein organization and dynamics with very high spatial and temporal resolutions directly in live cell.
Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.
Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne
2017-06-01
To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.
Nadal, Anna; Esteve, Teresa; Pla, Maria
2009-01-01
A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary.
Detection of KIT Genotype in Pigs by TaqMan MGB Real-Time Quantitative Polymerase Chain Reaction.
Li, Xiuxiu; Li, Xiaoning; Luo, Rongrong; Wang, Wenwen; Wang, Tao; Tang, Hui
2018-05-01
The dominant white phenotype in domestic pigs is caused by two mutations in the KIT gene: a 450 kb duplication containing the entire KIT gene together with flanking sequences and one splice mutation with a G:A substitution in intron 17. The purpose of this study was to establish a simple, rapid method to determine KIT genotype in pigs. First, to detect KIT copy number variation (CNV), primers for exon 2 of the KIT gene, along with a TaqMan minor groove binder (MGB) probe, were designed. The single-copy gene, estrogen receptor (ESR), was used as an internal control. A real-time fluorescence-based quantitative PCR (FQ-PCR) protocol was developed to accurately detect KIT CNVs. Second, to detect the splice mutation ratio of the G:A substitution in intron 17, a 175 bp region, including the target mutation, was amplified from genomic DNA. Based on the sequence of the resulting amplified fragment, an MGB probe set was designed to detect the ratio of splice mutation to normal using FQ-PCR. A series of parallel amplification curves with the same internal distances were obtained using gradually diluted DNA as templates. The CT values among dilutions were significantly different (p < 0.001) and the coefficients of variation from each dilution were low (from 0.13% to 0.26%). The amplification efficiencies for KIT and ESR were approximately equal, indicating ESR was an appropriate control gene. Furthermore, use of the MGB probe set resulted in detection of the target mutation at a high resolution and stability; standard curves illustrated that the amplification efficiencies of KIT1 (G) and KIT2 (A) were approximately equal (98.8% and 97.2%). In conclusion, a simple, rapid method, with high specificity and stability, for the detection of the KIT genotype in pigs was established using TaqMan MGB probe real-time quantitative PCR.
A novel mechanism of sugar selection utilized by a human X-family DNA polymerase.
Brown, Jessica A; Fiala, Kevin A; Fowler, Jason D; Sherrer, Shanen M; Newmister, Sean A; Duym, Wade W; Suo, Zucai
2010-01-15
During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2'-hydroxyl group and the bulky side chain of an active-site residue. In this study, we demonstrated that human DNA polymerase lambda used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2'-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2'-position. Copyright 2009 Elsevier Ltd. All rights reserved.
Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette
2014-01-01
Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560
Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B
2004-01-01
Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.
Qin, Xiao-ying; Li, Guo-xuan; Qin, Ya-zhen; Wang, Yu; Wang, Feng-rong; Liu, Dai-hong; Xu, Lan-ping; Chen, Huan; Han, Wei; Wang, Jing-zhi; Zhang, Xiao-hui; Li, Jin-lan; Li, Ling-di; Liu, Kai-yan; Huang, Xiao-jun
2011-08-01
Analysis of changes in recipient and donor hematopoietic cell origin is extremely useful to monitor the effect of hematopoietic stem cell transplantation (HSCT) and sequential adoptive immunotherapy by donor lymphocyte infusions. We developed a sensitive, reliable and rapid real-time PCR method based on sequence polymorphism systems to quantitatively assess the hematopoietic chimerism after HSCT. A panel of 29 selected sequence polymorphism (SP) markers was screened by real-time PCR in 101 HSCT patients with leukemia and other hematological diseases. The chimerism kinetics of bone marrow samples of 8 HSCT patients in remission and relapse situations were followed longitudinally. Recipient genotype discrimination was possible in 97.0% (98 of 101) with a mean number of 2.5 (1-7) informative markers per recipient/donor pair. Using serial dilutions of plasmids containing specific SP markers, the linear correlation (r) of 0.99, the slope between -3.2 and -3.7 and the sensitivity of 0.1% were proved reproducible. By this method, it was possible to very accurately detect autologous signals in the range from 0.1% to 30%. The accuracy of the method in the very important range of autologous signals below 5% was extraordinarily high (standard deviation <1.85%), which might significantly improve detection accuracy of changes in autologous signals early in the post-transplantation course of follow-up. The main advantage of the real-time PCR method over short tandem repeat PCR chimerism assays is the absence of PCR competition and plateau biases, with demonstrated greater sensitivity and linearity. Finally, we prospectively analyzed bone marrow samples of 8 patients who received allografts and presented the chimerism kinetics of remission and relapse situations that illustrated the sensitivity level and the promising clinical application of this method. This SP-based real-time PCR assay provides a rapid, sensitive, and accurate quantitative assessment of mixed chimerism that can
Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.
Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon
2011-06-07
Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.
Genome-wide and digital polymerase chain reaction epigenetic assessments of alcohol consumption.
Philibert, Robert; Dogan, Meesha; Noel, Amanda; Miller, Shelly; Krukow, Brianna; Papworth, Emma; Cowley, Joseph; Knudsen, April; Beach, Steven R H; Black, Donald
2018-04-28
The lack of readily employable biomarkers of alcohol consumption is a problem for clinicians and researchers. In 2014, we published a preliminary DNA methylation signature of heavy alcohol consumption that remits as a function of abstinence. Herein, we present new genome-wide methylation findings from a cohort of additional subjects and a meta-analysis of the data. Using DNA from 47 consecutive heavy drinkers admitted for alcohol detoxification in the context of alcohol treatment and 47 abstinent controls, we replicate the 2014 results and show that 21,221 CpG residues are differentially methylated in active heavy drinkers. Meta-analysis of all data from the 448,058 probes common to the two methylation platforms shows a similarly profound signature with confirmation of findings from other groups. Principal components analyses show that genome-wide methylation changes in response to alcohol consumption load on two major factors with one component accounting at least 50% of the total variance in both smokers and nonsmoking alcoholics. Using data from the arrays, we derive a panel of five methylation probes that classifies use status with a receiver operator characteristic area under the curve (AUC) of 0.97. Finally, using droplet digital polymerase chain reaction (PCR), we convert these array-based findings to two marker assays with an AUC of 0.95 and a four marker set AUC of 0.98. We conclude that DNA methylation assessments are capable of quantifying alcohol use status and suggest that readily employable digital PCR approaches for substance consumption may find widespread use in alcohol-related research and patient care. © 2018 Wiley Periodicals, Inc.
Méndez, María C; Domingo, Cristina; Tenorio, Antonio; Pardo, Lissethe C; Rey, Gloria J; Méndez, Jairo A
2013-09-01
Yellow fever is considered a re-emerging disease and is endemic in tropical regions of Africa and South America. At present, there are no standardized or commercialized kits available for yellow fever virus detection. Therefore, diagnosis must be made by time-consuming routine techniques, and sometimes, the virus or its proteins are not detected. Furthermore, co-circulation with other flaviviruses, including dengue virus, increases the difficulty of diagnosis. To develop a specific reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR-based assay to improve the detection and diagnosis of yellow fever virus using both serum and fresh tissue samples. RT-PCR primers were designed to amplify a short fragment of all yellow fever virus genotypes reported. A second set of primers was used in a nested PCR to increase sensitivity. Thirty-three clinical samples were tested with the standardized reaction. The expected amplicon was obtained in 25 out of 33 samples analyzed using this approach, and 2 more samples tested positive after a subsequent nested PCR approach. This improved technique not only ensures the specific detection of a wide range of yellow fever virus genotypes but also may increase the sensitivity of detection by introducing a second round of amplification, allowing a rapid differential diagnosis between dengue and yellow fever infection, which is required for effective surveillance and opportune epidemiologic measures.
Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.
Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin
2010-03-01
Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.
Afanas'ev, M V; Chipanin, E V; Shestakov, V E; Denisov, A V; Fomina, L A; Ostiak, A S; Balakhonov, S V
2013-03-01
The article presents the results of development and practical implementation of system of polymerase chain reaction testing in real-time operation mode to detect agent of plague infield material. In laboratory conditions the system demonstrated good results and hence it was applied in conditions of field laboratory of epidemiologic team during planned epizootologic examination of Gorno-Altaisk hot spot of plague. The sampling consisted of more than 1400 objects. It was demonstrated that high sensitivity and specificity is immanent to proposed system. The adaptation of the system to the real time amplifier "Smart Cycler" (Cephid, USA) having some specific technical characteristics makes it possible to consider the proposed test-system as an effective sensitive and precise instrument for screening studies in the process of regular epizootologic examinations of hot spots of plague.
Gan, Xiao-Ning; Luo, Jie; Tang, Rui-Xue; Wang, Han-Lin; Zhou, Hong; Qin, Hui; Gan, Ting-Qing; Chen, Gang
2017-05-01
The role and mechanism of miR-452-5p in lung adenocarcinoma remain unclear. In this study, we performed a systematic study to investigate the clinical value of miR-452-5p expression in lung adenocarcinoma. The expression of miR-452-5p in 101 lung adenocarcinoma patients was detected by quantitative real-time polymerase chain reaction. The Cancer Genome Atlas and Gene Expression Omnibus databases were joined to verify the expression level of miR-452-5p in lung adenocarcinoma. Via several online prediction databases and bioinformatics software, pathway and network analyses of miR-452-5p target genes were performed to explore its prospective molecular mechanism. The expression of miR-452-5p in lung adenocarcinoma in house was significantly lower than that in adjacent tissues (p < 0.001). Additionally, the expression level of miR-452-5p was negatively correlated with several clinicopathological parameters including the tumor size (p = 0.014), lymph node metastasis (p = 0.032), and tumor-node-metastasis stage (p = 0.036). Data from The Cancer Genome Atlas also confirmed the low expression of miR-452 in lung adenocarcinoma (p < 0.001). Furthermore, reduced expression of miR-452-5p in lung adenocarcinoma (standard mean deviations = -0.393, 95% confidence interval: -0.774 to -0.011, p = 0.044) was validated by a meta-analysis. Five hub genes targeted by miR-452-5p, including SMAD family member 4, SMAD family member 2, cyclin-dependent kinase inhibitor 1B, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon, and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta, were significantly enriched in the cell-cycle pathway. In conclusion, low expression of miR-452-5p tends to play an essential role in lung adenocarcinoma. Bioinformatics analysis might be beneficial to reveal the potential mechanism of miR-452-5p in lung adenocarcinoma.
Stuart, James Ian; Delport, Johan; Lannigan, Robert; Zahariadis, George
2014-07-01
Disease monitoring of viruses using real-time polymerase chain reaction (PCR) requires knowledge of the precision of the test to determine what constitutes a significant change. Calculation of quantitative PCR confidence limits requires bivariate statistical methods. To develop a simple-to-use graphical user interface to determine the uncertainty of measurement (UOM) of BK virus, cytomegalovirus (CMV) and Epstein-Barr virus (EBV) real-time PCR assays. Thirty positive clinical samples for each of the three viral assays were repeated once. A graphical user interface was developed using a spreadsheet (Excel, Microsoft Corporation, USA) to enable data entry and calculation of the UOM (according to Fieller's theorem) and PCR efficiency. The confidence limits for the BK virus, CMV and EBV tests were ∼0.5 log, 0.5 log to 1.0 log, and 0.5 log to 1.0 log, respectively. The efficiencies of these assays, in the same order were 105%, 119% and 90%. The confidence limits remained stable over the linear range of all three tests. A >5 fold (0.7 log) and a >3-fold (0.5 log) change in viral load were significant for CMV and EBV when the results were ≤1000 copies/mL and >1000 copies/mL, respectively. A >3-fold (0.5 log) change in viral load was significant for BK virus over its entire linear range. PCR efficiency was ideal for BK virus and EBV but not CMV. Standardized international reference materials and shared reporting of UOM among laboratories are required for the development of treatment guidelines for BK virus, CMV and EBV in the context of changes in viral load.
Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev
2011-12-01
Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P < 0.0001) than that of SSS in both the MB (85.9% vs. 59.8%) and PB (75.4% vs. 1.8%) subgroups; the difference in sensitivity in the PB subgroup is remarkable. Positivity by PCR and SSS was found in 100% of LL and histoid leprosy, but PCR had significantly greater (P < 0.0001) positivity in BT leprosy and was of definite increased value in indeterminate and TT leprosy. Polymerase chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.
Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol
2010-03-05
The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90%) were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8%) and the lowest in fibroblastic DNA (92.3%, P < or = 0.05). Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P < or = 0.05). The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic cells.
Machado de Oliveira, J C; Siqueira, J F; Alves, G B; Hirata, R; Andrade, A F
2000-12-01
Porphyromonas endodontalis has been isolated from the endodontic infections mainly in symptomatic teeth. This study evaluated the occurrence of P. endodontalis in both symptomatic and asymptomatic endodontic infections using 16S rRNA gene-directed polymerase chain reaction. P. endodontalis was detected in 39.5% of the cases (17 of 43 teeth). It was present in 4 of the 6 cases with acute periradicular abscess (66.7%) and in 13 of the 37 other cases (35.1%). The presence of P. endodontalis was associated with an asymptomatic periradicular lesion in 6 cases (25%) and in 10 teeth with tenderness to percussion (52.6%). P. endodontalis was also found in one asymptomatic case without evidence of periradicular pathosis. Our results indicated that, although P. endodontalis is commonly detected in symptomatic cases, it can be present in asymptomatic root canal infections. Further studies should determine if this bacterial species is really an important endodontopathogen.
Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J
2016-01-01
Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. © The American Society of Tropical Medicine and Hygiene.
Jones, G F; Ward, G E; Murtaugh, M P; Lin, G; Gebhart, C J
1993-01-01
A sensitive assay based on amplification of a 319-bp DNA fragment of the intracellular bacterium of swine proliferative enteritis was developed for the detection of the organism in the feces of swine. A vernacular name, ileal symbiont intracellularis (IS-intracellularis), has recently been published for the intracellular bacterium, which was formerly known as a Campylobacter-like organism (C.J. Gebhart, S.M. Barnes, S. McOrist, G.F. Lin, and G.H.K. Larson, Int. J. Syst. Bacteriol. 43:533-538, 1993). As few as 10(1) IS-intracellularis organisms purified from intestinal mucosa, or 10(3) IS-intracellularis per g of feces, were detected. No amplification product was produced from a polymerase chain reaction performed on DNA extracted from the feces of healthy pigs. A 319-bp DNA fragment specific for IS-intracellularis was produced on amplification of DNA from the feces of pigs with experimental and naturally occurring proliferative enteritis. Images PMID:8253956
Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y.; Whelen, A. Christian; Calimlim, Precilia S.; Sciulli, Rebecca H.; Honda, Stacey A. A.; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M.; da Silva, Alexandre J.
2016-01-01
Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. PMID:26526920
Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori
2017-09-01
Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zur, G; Hallerman, E M; Sharf, R; Kashi, Y
1999-10-01
Alternaria sp. are important fungal contaminants of vegetable, fruit, and grain products, including Alternaria alternata, a contaminant of tomato products. To date, the Howard method, based on microscopic observation of fungal filaments, has been the standard examination for inspection of tomato products. We report development of a polymerase chain reaction (PCR)-based method for detection of Alternaria DNA. PCR primers were designed to anneal to the internal transcribed regions ITS1 and ITS2 of the 5.8S rRNA gene of Alternaria but not to other microbial or tomato DNA. We demonstrate use of the PCR assay to detect Alternaria DNA in experimentally infested and commercially obtained tomato sauce and tomato powder. Use of the PCR method offers a rapid and sensitive assay for the presence of Alternaria DNA in tomato products. The apparent breakdown of DNA in tomato sauce may limit the utility of the assay to freshly prepared products. The assay for tomato powder is not affected by storage time.
Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I
1999-07-01
Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.
Kulkarni, Raghavendra D.; Mishra, Mukti Nath; Mohanraj, Jeevanandam; Chandrasekhar, Arun; Ajantha, G. S.; Kulkani, Sheetal; Bhat, Shama
2018-01-01
BACKGROUND: Nosocomial infections are often caused by multidrug-resistant bacteria and the incidence is increasing. Acinetobacter, a Gram-negative bacillus, is commonly associated with the use of intravascular catheterization and airway intubation. Polymerase chain reaction (PCR) for identification of Acinetobacter baumannii from samples has been standardized that use conventional wet-reagent mix. We have designed and optimized a dry-reagent mix for identification of Acinetobacter species by PCR. The dry-reagent mix can be stored at room temperature, has less chances of contamination, and thus can be used at point-of-care diagnosis. AIM AND OBJECTIVE: The present work was focused on comparing the sensitivity and specificity of dry-reagent PCR mix over conventional wet-reagent PCR mix for identification of Acinetobacter species. MATERIALS AND METHODS: Conventional wet-reagent mix based and dry-reagent mix based PCR were carried out for the DNA isolated from Acinetobacter species. The latter was also applied directly on bacterial growth without prior DNA extraction process. Equal numbers of bacterial isolates other than Acinetobacter species were also subjected to identification by the same protocols for determining the sensitivity and specificity of the test. RESULTS: The Acinetobacter species showed amplification of the target rpoB gene and the band was observed at 397 bp. The dry-reagent PCR mix results matched completely with the conventional wet-reagent PCR mix assay. All the non-Acinetobacter isolates were negative for the PCR. This indicates that the test is highly specific. The dry-reagent mix also contained an enzyme resistant to PCR inhibitors and capable of amplifying DNA directly from cells. CONCLUSION: Performance of dry-reagent PCR mix without the need for DNA extraction and preparation of a PCR mix proved to be more sensitive and reduce the handling error, minimizes the time, manual work, and skilled labor. PMID:29403209
Nixon, Gavin J; Svenstrup, Helle F; Donald, Carol E; Carder, Caroline; Stephenson, Judith M; Morris-Jones, Stephen; Huggett, Jim F; Foy, Carole A
2014-12-01
Molecular diagnostic measurements are currently underpinned by the polymerase chain reaction (PCR). There are also a number of alternative nucleic acid amplification technologies, which unlike PCR, work at a single temperature. These 'isothermal' methods, reportedly offer potential advantages over PCR such as simplicity, speed and resistance to inhibitors and could also be used for quantitative molecular analysis. However there are currently limited mechanisms to evaluate their quantitative performance, which would assist assay development and study comparisons. This study uses a sexually transmitted infection diagnostic model in combination with an adapted metric termed isothermal doubling time (IDT), akin to PCR efficiency, to compare quantitative PCR and quantitative loop-mediated isothermal amplification (qLAMP) assays, and to quantify the impact of matrix interference. The performance metric described here facilitates the comparison of qLAMP assays that could assist assay development and validation activities.
Slavícková, A; Ivánek, R; Cerný, J; Sálková, J; Trnĕný, M
2002-11-22
PCR techniques detecting interchromosomal translocation and clonal immunoglobulin gene rearrangement (IgH) as disease markers in non-Hodgkin's lymphomas (NHL) has been utilised past ten years. However, qualitative PCR detection of persisted minimal residual disease cannot provide clinically useful prognostic information and presently, quantitative approaches are required to predict patient outcome and assess response to the treatment. In some cases, "end-point" quantifying techniques, such as comparative PCR, are applicable and the relative estimation of differences in target quantity may serve in disease monitoring rather than absolute number of target copies. Our method of comparative PCR employs co-amplification of sequences of interest (clonal CDR3, bcl2/Jh) and the segment of Hras 1 gene(ras) as an internal standard. Serial dilutions of stored diagnostic DNAs from blood and bone marrow are examined in the same PCR and, after gel densitometry, the amount of initial target is assessed by comparing exponential products of co-amplification. The comparative PCR assay was utilized in monitoring of NHL patients cured either with conventional therapy, or with high-dose regimens and transplantation with stem cells, or with chimaeric anti-CD20 monoclonal antibody (Rituximab). Results from 50 monitored intervals obtained during several months up to several years were supplemented with clinical statements retrospectively. Some of patients became PCR-negative, reappearance of PCR-positivity was observed as well. The decrease or increase of disease marker corresponded to clinical observations. Results obtained from bone marrow were in agreement with those obtained from blood. End-point quantifying PCR comparative assay may provide an information on the increased risk of relapse and impact of the therapy. The predictive value of these methods depends on the frequency of sample taking and on the sensitivity of the method, which should be monitored in negative cases.
Purcell, Maureen K.; Powers, Rachel L.; Besijn, Bonnie; Hershberger, Paul K.
2017-01-01
We report the development and validation of two quantitative PCR (qPCR) assays to detect Nanophyetus salmincola DNA in water samples and in fish and snail tissues. Analytical and diagnostic validation demonstrated good sensitivity, specificity, and repeatability of both qPCR assays. The N. salmincola DNA copy number in kidney tissue was significantly correlated with metacercaria counts based on microscopy. Extraction methods were optimized for the sensitive qPCR detection of N. salmincola DNA in settled water samples. Artificially spiked samples suggested that the 1-cercaria/L threshold corresponded to an estimated log10 copies per liter ≥ 6.0. Significant correlation of DNA copy number per liter and microscopic counts indicated that the estimated qPCR copy number was a good predictor of the number of waterborne cercariae. However, the detection of real-world samples below the estimated 1-cercaria/L threshold suggests that the assays may also detect other N. salmincola life stages, nonintact cercariae, or free DNA that settles with the debris. In summary, the qPCR assays reported here are suitable for identifying and quantifying all life stages of N. salmincola that occur in fish tissues, snail tissues, and water.
James, Ameh; Macdonald, Joanne
2015-01-01
Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.
Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.
Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal
2014-05-01
Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.
Xia, Minghui; Qi, Qingguo
2013-01-01
We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P < 0.01), there was no positive correlation; similarity (Dice coefficient) was 13.1% to 62.5%. Some bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.
Perez, Edith A; Baehner, Frederick L; Butler, Steven M; Thompson, E Aubrey; Dueck, Amylou C; Jamshidian, Farid; Cherbavaz, Diana; Yoshizawa, Carl; Shak, Steven; Kaufman, Peter A; Davidson, Nancy E; Gralow, Julie; Asmann, Yan W; Ballman, Karla V
2015-10-01
The N9831 trial demonstrated the efficacy of adjuvant trastuzumab for patients with human epidermal growth factor receptor 2 (HER2) locally positive tumors by protein or gene analysis. We used the 21-gene assay to examine the association of quantitative HER2 messenger RNA (mRNA) gene expression and benefit from trastuzumab. N9831 tested the addition of trastuzumab to chemotherapy in stage I-III HER2-positive breast cancer. For two of the arms of the trial, doxorubicin and cyclophosphamide followed by paclitaxel (AC-T) and doxorubicin and cyclophosphamide followed by paclitaxel and trastuzumab concurrent chemotherapy-trastuzumab (AC-TH), recurrence score (RS) and HER2 mRNA expression were determined by the 21-gene assay (Oncotype DX®) (negative <10.7, equivocal 10.7 to <11.5, and positive ≥11.5 log2 expression units). Cox regression was used to assess the association of HER2 expression with trastuzumab benefit in preventing distant recurrence. Median follow-up was 7.4 years. Of 1,940 total patients, 901 had consent and sufficient tissue. HER2 by reverse transcriptase polymerase chain reaction (RT-PCR) was negative in 130 (14 %), equivocal in 85 (9 %), and positive in 686 (76 %) patients. Concordance between HER2 assessments was 95 % for RT-PCR versus central immunohistochemistry (IHC) (>10 % positive cells = positive), 91 % for RT-PCR versus central fluorescence in situ hybridization (FISH) (≥2.0 = positive) and 94 % for central IHC versus central FISH. In the primary analysis, the association of HER2 expression by 21-gene assay with trastuzumab benefit was marginally nonsignificant (nonlinear p = 0.057). In hormone receptor-positive patients (local IHC) the association was significant (p = 0.002). The association was nonlinear with the greatest estimated benefit at lower and higher HER2 expression levels. Concordance among HER2 assessments by central IHC, FISH, and RT-PCR were similar and high. Association of HER2 mRNA expression with
Slow Joining of Newly Replicated DNA Chains in DNA Polymerase I-Deficient Escherichia coli Mutants*
Okazaki, Reiji; Arisawa, Mikio; Sugino, Akio
1971-01-01
In Escherichia coli mutants deficient in DNA polymerase I, newly replicated short DNA is joined at about 10% of the rate in the wild-type strains. It is postulated that DNA polymerase I normally functions in filling gaps between the nascent short segments synthesized by the replication complex. Possible implications of the finding are discussed in relation to other abnormal properties of these mutants. PMID:4943548
Anitharaj, Velmurugan; Stephen, Selvaraj; Pradeep, Jothimani; Pooja, Pratheesh; Preethi, Sridharan
2017-01-01
Background: In the recent past, scrub typhus (ST) has been reported from different parts of India, based on Weil-Felix/enzyme-linked immunosorbent assay (ELISA)/indirect immunofluorescence assay (IFA). Molecular tests are applied only by a few researchers. Aims: Evaluation of a new commercial real time polymerase chain reaction (PCR) kit for molecular diagnosis of ST by comparing it with the commonly used IgM ELISA is our aim. Settings and Design: ST has been reported all over India including Puducherry and surrounding Tamil Nadu and identified as endemic for ST. This study was designed to correlate antibody detection by IgM ELISA and Orientia tsutsugamushi DNA in real time PCR. Materials and Methods: ST IgM ELISA (InBios Inc., USA) was carried out for 170 consecutive patients who presented with the symptoms of acute ST during 11 months (November, 2015– September, 2016). All 77 of these patients with IgM ELISA positivity and 49 of 93 IgM ELISA negative patients were subjected to real time PCR (Geno-Sen's ST real time PCR, Himachal Pradesh, India). Statistical Analysis: Statistical analysis for clinical and laboratory results was performed using IBM SPSS Statistics 17 for Windows (SPSS Inc., Chicago, USA). Chi-square test with Yates correction (Fisher's test) was employed for a small number of samples. Results and Conclusion: Among 77 suspected cases of acute ST with IgM ELISA positivity and 49 IgM negative patients, 42 and 7 were positive, respectively, for O. tsutsugamushi 56-kDa type-specific gene in real time PCR kit. Until ST IFA, the gold standard diagnostic test, is properly validated in India, diagnosis of acute ST will depend on both ELISA and quantitative PCR. PMID:28878522
Nilsson, G; Wang, M; Wejde, J; Kanter, L; Karlén, J; Tani, E; Kreicbergs, A; Larsson, O
1998-01-01
To evaluate the utilization of fine needle aspiration (FNA) biopsy to obtain material for reverse-transcriptase polymerase chain reaction (RT-PCR) in the detection of the t(X;18)(p11.2;q11.2) translocation in synovial sarcomas. We applied RT-PCR to detection of synovial sarcoma fusion gene transcripts on fine needle aspirates. Five clinical samples were first analyzed: one was a tumor previously diagnosed as malignant hemangiopericytoma, one was a poorly defined tumor, and three were suspected synovial sarcomas. FNA material was transferred directly to the RT-PCR reaction tube without RNA extraction. The t(X;18) translocation could be detected on the limited amount of material that FNA provides. In each of the cases studied the representivity of the tumor samples was confirmed microscopically. Our protocol permits analysis directly on representative samples without extraction of RNA. The results imply that RT-PCR offers reliable detection of sarcoma fusion gene transcripts on fine needle aspirates. The procedure, apart from being applicable to outpatients, is rapid and sensitive.
Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M
1993-01-01
A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.
Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi
2017-11-01
Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.
Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur
2015-01-01
The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers
Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R
1998-04-01
Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.
Wihokhoen, Benchawan; Dondorp, Arjen M.; Turner, Paul; Woodrow, Charles J.; Imwong, Mallika
2016-01-01
Molecular approaches offer a means of testing archived samples stored as dried blood spots in settings where standard blood cultures are not possible. Peripheral blood films are one suggested source of material, although the sensitivity of this approach has not been well defined. Thin blood smears and dried blood spots from a severe pediatric malaria study were assessed using specific polymerase chain reaction (PCR) primers to detect non-typhoidal Salmonella (NTS; MisL gene), Streptococcus pneumoniae (lytA), and Plasmodium falciparum (18S rRNA). Of 16 cases of NTS and S. pneumoniae confirmed on blood culture, none were positive by PCR using DNA extracts from blood films or dried blood spots. In contrast, four of 36 dried blood spots and two of 178 plasma samples were PCR positive for S. pneumoniae, despite negative bacterial blood cultures, suggesting false positives. Quantitative assessment revealed that the effective concentration of P. falciparum DNA in blood films was three log orders of magnitude lower than for dried blood spots. The P. falciparum kelch13 gene could not be amplified from blood films. These findings question the value of blood PCR-based approaches for detection of NTS and S. pneumoniae, and show that stored blood films are an inefficient method of studying P. falciparum. PMID:26711525
Fagone, Paolo; Wright, J Fraser; Nathwani, Amit C; Nienhuis, Arthur W; Davidoff, Andrew M; Gray, John T
2012-02-01
Self-complementary AAV (scAAV) vector genomes contain a covalently closed hairpin derived from a mutated inverted terminal repeat that connects the two monomer single-stranded genomes into a head-to-head or tail-to-tail dimer. We found that during quantitative PCR (qPCR) this structure inhibits the amplification of proximal amplicons and causes the systemic underreporting of copy number by as much as 10-fold. We show that cleavage of scAAV vector genomes with restriction endonuclease to liberate amplicons from the covalently closed terminal hairpin restores quantitative amplification, and we implement this procedure in a simple, modified qPCR titration method for scAAV vectors. In addition, we developed and present an AAV genome titration procedure based on gel electrophoresis that requires minimal sample processing and has low interassay variability, and as such is well suited for the rigorous quality control demands of clinical vector production facilities.
Multiplex polymerase chain reaction test for the diagnosis of acute viral hepatitis A.
Heo, Nae-Yun; Lim, Young-Suk; An, Jihyun; Ko, Sun-Young; Oh, Heung-Bum
2012-12-01
The early diagnosis of acute hepatitis A (AHA) is hindered because serum IgM against hepatitis A virus (HAV) can yield false-negative results during the window period. This study evaluated the diagnostic accuracy of a polymerase chain reaction (PCR) kit for HAV RNA for the diagnosis of AHA. Samples were collected from 136 patients with acute severe hepatitis at their admission to Asan Medical Center between June 2010 and July 2010. Samples were analyzed for serum IgM anti-HAV using an immunoassay test and for qualitative HAV RNA using the Magicplex HepaTrio PCR test kit. The diagnostic accuracies of these methods were tested on the basis of clinical and laboratory diagnoses of AHA. The concordance rate and kappa value between IgM anti-HAV and HAV RNA PCR were 88.2% and 0.707, respectively. For the diagnosis of AHA, the sensitivity and specificity of IgM anti-HAV were 90.7% and 100%, respectively, when an "equivocal" result was regarded as positive; and 79.1% and 100%, respectively, when an "equivocal" result was regarded as negative. The sensitivity and specificity of HAV RNA PCR were 81.4% and 100%, respectively. All four patients with negative IgM anti-HAV and positive HAV RNA PCR results and all four patients with equivocal IgM anti-HAV RNA and positive HAV RNA PCR results were eventually diagnosed with AHA. The qualitative HAV RNA PCR test has an equivalent diagnostic accuracy for AHA compared to IgM anti-HAV and may be more sensitive during the window period.
Faron, Gilles; Vancutsem, Ellen; Naessens, Anne; Buyl, Ronald; Gucciardo, Leonardo; Foulon, Walter
2017-01-01
Objective . This study aimed to compare the qualitative and quantitative reproducibility of quantitative PCR (qPCR) for Ureaplasma species (Ureaplasma spp.) throughout pregnancy and according to the genital sampling site. Study Design . Between 5 and 14 weeks of gestation (T1), vaginal, fornix, and two cervical samples were taken. Sampling was repeated during the 2nd (T2) and 3rd (T3) trimester in randomly selected T1 positive and negative women. Qualitative and quantitative reproducibility were evaluated using, respectively, Cohen's kappa ( κ ) and interclass correlation coefficients (ICC) and repeated measures ANOVA on the log-transformed mean number of DNA copies for each sampling site. Results . During T1, 51/127 women were positive for U. parvum and 8 for U. urealyticum (4 patients for both). Sampling was repeated for 44/55 women at T2 and/or T3; 43 (97.7%) remained positive at the three timepoints. κ ranged between 0.83 and 0.95 and the ICC for cervical samples was 0.86. Conclusions . Colonization by Ureaplasma spp. seems to be very constant during pregnancy and vaginal samples have the highest detection rate.
Wang, Fengjun; Feng, Junli; Ye, Sudan; Li, Xin; Huang, Hannian; Hua, Peng
2018-04-01
Cydia pomonella, Euzophera pyriella Yang, and Grapholitha molesta are destructive pest species of Korla fragrant pears in Xinjiang. They are also quarantine pests of concern in a number of countries. Identification of these small pest larvae by morphological characters is difficult, and misidentifications will influence appropriate quarantine decisions. Here, a 520 bp fragment of mitochondrial cytochrome oxidase subunit I (COI) was first amplified and sequenced from each species, and a diagnostic region was observed. Subsequently, the species-specific primer and probe sets of quantitative real-time PCR (qPCR) were designed, which amplified a 114-116 bp fragment of COI genes. This method was validated by amplification DNA extracted from single, multiple, and mixed pest samples. Results indicated that this method allows rapid discrimination and reliable identification of larvae, pupae, and adult specimens of all three species, which could help the international export trading of Korla fragrant pears and related products.
Schuler, Friedrich; Trotter, Martin; Zengerle, Roland; von Stetten, Felix
2016-03-01
Multiplexing in polymerase chain reaction (PCR) is a technique widely used to save cost and sample material and to increase sensitivity compared to distributing a sample to several singleplex reactions. One of the most common methods to detect the different amplification products is the use of fluorogenic probes that emit at different wavelengths (colors). To reduce the number of detection channels, several methods for monochrome multiplexing have been suggested. However, they pose restrictions to the amplifiable target length, the sequence, or the melting temperature. To circumvent these limitations, we suggest a novel approach that uses different fluorophores with the same emission maximum. Discrimination is achieved by their different fluorescence stability during photobleaching. Atto488 (emitting at the same wavelength as 6-carboxyfluorescein, FAM) and Atto467N (emitting at the same wavelength as cyanine 5, Cy5) were found to bleach significantly less than FAM and Cy5; i.e., the final fluorescence of Atto dyes was more than tripled compared to FAM and Cy5. We successfully applied this method by performing a 4-plex PCR targeting antibiotic resistance genes in S. aureus using only 2 color channels. Confidence of discrimination between the targets was >99.9% at high copy initial copy numbers of 100 000 copies. Cases where both targets were present could be discriminated with equal confidence for Cy5 channel and reduced levels of confidence (>68%) for FAM channel. Moreover, a 2-plex digital PCR reaction in 1 color channel was shown. In the future, the degree of multiplexing may be increased by adding fluorogenic probe pairs with other emission wavelengths. The method may also be applied to other probe and assay formats, such as Förster resonance energy transfer (FRET) probes and immunoassays.
Nanobarcoding: detecting nanoparticles in biological samples using in situ polymerase chain reaction
Eustaquio, Trisha; Leary, James F
2012-01-01
Background Determination of the fate of nanoparticles (NPs) in a biological system, or NP biodistribution, is critical in evaluating an NP formulation for nanomedicine. Current methods to determine NP biodistribution are greatly inadequate, due to their limited detection thresholds. Herein, proof of concept of a novel method for improved NP detection based on in situ polymerase chain reaction (ISPCR), coined “nanobarcoding,” is demonstrated. Methods Nanobarcoded superparamagnetic iron oxide nanoparticles (NB-SPIONs) were characterized by dynamic light scattering, zeta potential, and hyperspectral imaging measurements. Cellular uptake of Cy5-labeled NB-SPIONs (Cy5-NB-SPIONs) was imaged by confocal microscopy. The feasibility of the nanobarcoding method was first validated by solution-phase PCR and “pseudo”-ISPCR before implementation in the model in vitro system of HeLa human cervical adenocarcinoma cells, a cell line commonly used for ISPCR-mediated detection of human papilloma virus (HPV). Results Dynamic light-scattering measurements showed that NB conjugation stabilized SPION size in different dispersion media compared to that of its precursor, carboxylated SPIONs (COOH-SPIONs), while the zeta potential became more positive after NB conjugation. Hyperspectral imaging confirmed NB conjugation and showed that the NB completely covered the SPION surface. Solution-phase PCR and pseudo-ISPCR showed that the expected amplicons were exclusively generated from the NB-SPIONs in a dose-dependent manner. Although confocal microscopy revealed minimal cellular uptake of Cy5-NB-SPIONs at 50 nM over 24 hours in individual cells, ISPCR detected definitive NB-SPION signals inside HeLa cells over large sample areas. Conclusion Proof of concept of the nanobarcoding method has been demonstrated in in vitro systems, but the technique needs further development before its widespread use as a standardized assay. PMID:23144562
Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy
2004-01-01
In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement
Souza, M T; Carvalho-Zilse, G A
2014-07-25
In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species.
Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J
2016-12-07
The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray ® Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea. © The American Society of Tropical Medicine and Hygiene.
Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao
2018-05-01
As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.