Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong
2015-01-01
The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.
Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine
2007-02-01
In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.
Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu
2011-09-01
To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.
Quantitative analysis of periodontal pathogens by ELISA and real-time polymerase chain reaction.
Hamlet, Stephen M
2010-01-01
The development of analytical methods enabling the accurate identification and enumeration of bacterial species colonizing the oral cavity has led to the identification of a small number of bacterial pathogens that are major factors in the etiology of periodontal disease. Further, these methods also underpin more recent epidemiological analyses of the impact of periodontal disease on general health. Given the complex milieu of over 700 species of microorganisms known to exist within the complex biofilms found in the oral cavity, the identification and enumeration of oral periodontopathogens has not been an easy task. In recent years however, some of the intrinsic limitations of the more traditional microbiological analyses previously used have been overcome with the advent of immunological and molecular analytical methods. Of the plethora of methodologies reported in the literature, the enzyme-linked immunosorbent assay (ELISA), which combines the specificity of antibody with the sensitivity of simple enzyme assays and the polymerase chain reaction (PCR), has been widely utilized in both laboratory and clinical applications. Although conventional PCR does not allow quantitation of the target organism, real-time PCR (rtPCR) has the ability to detect amplicons as they accumulate in "real time" allowing subsequent quantitation. These methods enable the accurate quantitation of as few as 10(2) (using rtPCR) to 10(4) (using ELISA) periodontopathogens in dental plaque samples.
Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.
Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z
2017-03-01
The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.
Scherrer, Simone; Frei, Daniel; Wittenbrink, Max Michael
2016-12-01
Progressive atrophic rhinitis (PAR) in pigs is caused by toxigenic Pasteurella multocida. In Switzerland, PAR is monitored by selective culture of nasal swabs and subsequent polymerase chain reaction (PCR) screening of bacterial colonies for the P. multocida toxA gene. A panel of 203 nasal swabs from a recent PAR outbreak were used to evaluate a novel quantitative real-time PCR for toxigenic P. multocida in porcine nasal swabs. In comparison to the conventional PCR with a limit of detection of 100 genome equivalents per PCR reaction, the real-time PCR had a limit of detection of 10 genome equivalents. The real-time PCR detected toxA-positive P. multocida in 101 samples (49.8%), whereas the conventional PCR was less sensitive with 90 toxA-positive samples (44.3%). In comparison to the real-time PCR, 5.4% of the toxA-positive samples revealed unevaluable results by conventional PCR. The approach of culture-coupled toxA PCR for the monitoring of PAR in pigs is substantially improved by a novel quantitative real-time PCR.
Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A
2008-12-01
One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.
Basic quantitative polymerase chain reaction using real-time fluorescence measurements.
Ares, Manuel
2014-10-01
This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.
Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori
2016-08-01
On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.
Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu
2014-04-01
The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.
USDA-ARS?s Scientific Manuscript database
A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...
Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre
2002-01-01
Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.
Zhao, Lihong; Li, Ruiying; Liu, Aihua; Zhao, Shuping
2015-07-01
The objective of this study was to build and apply a duplex real time quantitative reverse transcription-polymerase chain reaction (RT-PCR) for rubella virus. Firstly, a 60-bp-long armored RV RNA was constructed in the laboratory. Secondly, a duplex real time RT-PCR assay was established. Thirdly, the 60-bp-long armored RV RNA was used as an internal positive control (IPC) for the duplex real time RT-PCR. And finally the duplex real time RT-PCR assay was applied to detect RV RNA in clinical specimens. The in-house assay has a high amplification efficiency (0.99), a high analytical sensitivity (200 copies/mL), and a good reproducibility. The diagnostic specificity and sensitivity of the in-house assay were both 100%, due to the monitoring of the armored RV RNA IPC. Therefore, the in-house duplex real time quantitative RT-PCR assay is a specific, sensitive, reproducible and accurate assay for quantitation of RV RNA in clinical specimens. And noncompetitive armored RV RNA IPC can monitor RT-PCR inhibition and prevent false-negative and inaccurate results in the real time detection system. Copyright © 2015 Elsevier B.V. All rights reserved.
Marconcini, Simone; Covani, Ugo; Barone, Antonio; Vittorio, Orazio; Curcio, Michele; Barbuti, Serena; Scatena, Fabrizio; Felli, Lamberto; Nicolini, Claudio
2011-07-01
Periodontitis is a complex multifactorial disease and is typically polygenic in origin. Genes play a fundamental part in each biologic process forming complex networks of interactions. However, only some genes have a high number of interactions with other genes in the network and may, therefore, be considered to play an important role. In a preliminary bioinformatic analysis, five genes that showed a higher number of interactions were identified and termed leader genes. In the present study, we use real-time quantitative polymerase chain reaction (PCR) technology to evaluate the expression levels of leader genes in the leukocytes of 10 patients with refractory chronic periodontitis and compare the expression levels with those of the same genes in 24 healthy patients. Blood was collected from 24 healthy human subjects and 10 patients with refractory chronic periodontitis and placed into heparinized blood collection tubes by personnel trained in phlebotomy using a sterile technique. Blood leukocyte cells were immediately lysed by using a kit for total RNA purification from human whole blood. Complementary DNA (cDNA) synthesis was obtained from total RNA and then real-time quantitative PCR was performed. PCR efficiencies were calculated with a relative standard curve derived from a five cDNA dilution series in triplicate that gave regression coefficients >0.98 and efficiencies >96%. The standard curves were obtained using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and growth factor receptor binding protein 2 (GRB2), casitas B-lineage lymphoma (CBL), nuclear factor-KB1 (NFKB1), and REL-A (gene for transcription factor p65) gene primers and amplified with 1.6, 8, 40, 200, and 1,000 ng/μL total cDNA. Curves obtained for each sample showed a linear relationship between RNA concentrations and the cycle threshold value of real-time quantitative PCR for all genes. Data were expressed as mean ± SE (SEM). The groups were compared to the analysis of variance. A
The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.
Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W
2006-07-01
We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.
Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn
2009-08-01
A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.
Code of Federal Regulations, 2014 CFR
2014-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Code of Federal Regulations, 2013 CFR
2013-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Code of Federal Regulations, 2012 CFR
2012-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov
2014-01-01
A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.
Yang, Jin-Long; Cheng, An-Chun; Wang, Ming-Shu; Pan, Kang-Cheng; Li, Min; Guo, Yu-Fei; Li, Chuan-Feng; Zhu, De-Kang; Chen, Xiao-Yue
2009-01-01
Background Goose parvovirus (GPV) is a Dependovirus associated with latent infection and mortality in geese. Currently, it severely affects geese production worldwide. The objective of this study was to develop a fluorescent quantitative real-time polymerase chain reaction (PCR) (FQ-PCR) assay for fast and accurate quantification of GPV DNA in infected goslings, which can aid in the understanding of the regular distribution pattern and the nosogenesis of GPV in vivo. Results The detection limit of the assay was 2.8 × 101 standard DNA copies, with a sensitivity of 3 logs higher than that of the conventional gel-based PCR assay targeting the same gene. The real-time PCR was reproducible, as shown by satisfactory low intraassay and interassay coefficients of variation. Conclusion The high sensitivity, specificity, simplicity, and reproducibility of the GPV fluorogenic PCR assay, combined with a high throughput, make this method suitable for a broad spectrum of GPV etiology-related applications. PMID:19754946
Code of Federal Regulations, 2010 CFR
2010-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...
Code of Federal Regulations, 2011 CFR
2011-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...
Chase, D.M.; Elliott, D.G.; Pascho, R.J.
2006-01-01
Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.
Olivero, S; Maroc, C; Beillard, E; Gabert, J; Nietfeld, W; Chabannon, C; Tonnelle, C
2000-09-01
The Ikaros gene is an essential regulator in development and haematopoiesis. Dysregulated Ikaros gene expression participates in leukaemic processes, as evidenced in animal models, and by analyses of blast-cell populations from leukaemic patients. We used real-time quantitative polymerase chain reaction (PCR) to evaluate the relative abundance of several Ikaros transcript isoforms in a variety of leukaemic-cell samples. Total RNA was isolated from bone-marrow or blood-cell samples collected at diagnosis in children or adult patients, 18 of whom had acute myeloblastic leukaemia (AML), 61 of whom had acute lymphoblastic leukaemia (ALL) and 11 of whom had chronic myeloid leukaemia (CML). The ratio (Ik1 + Ik2)/(Ik1 + Ik2 + Ik4 + Ik7 + Ik8) ranged from 13.5% to 85% and was lower (P < 0. 05) in samples from patients with m-bcr-abl ALL. An alternative splicing resulting in the deletion of 30 nucleotides at the end of exon 6 was observed in leukaemic samples, and in normal thymus and bone marrow. Our results are consistent with previous reports and suggest that the pattern of expression of the different human Ikaros isoforms are not homogeneous among different subsets of leukaemias.
Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur
2017-05-17
Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.
Torr, Peter; Spiridonov, Sergei E; Heritage, Stuart; Wilson, Michael J
2007-03-01
1. Despite nematodes being the most abundant animals on earth, very few animal ecologists study them, probably because of the difficulties of identifying them to species by morphological methods. 2. A group of nematodes that are important both ecologically and economically is the entomopathogenic nematodes, which play a key role in regulating soil food webs and are sold throughout the world as biological insecticides, yet for which very little is known of their population ecology. 3. A novel detection and quantification method was developed for soil nematodes using real-time polymerase chain reaction (PCR), and the technique was used to estimate numbers of two closely related species of entomopathogenic nematodes, Steinernema kraussei and S. affine in 50 soil samples from 10 sites in Scotland representing two distinct habitats (woodland and grassland). 4. There was a high degree of correlation between our molecular and traditional morphological estimates of population size and our data clearly showed that Steinernema affine occurred only in grassland areas, whereas S. kraussei was found in grassland and woodland samples to a similar degree. 5. Real-time PCR offers a rapid and accurate method of detecting individual nematode species from soil samples without the need for a specialist taxonomist, and has much potential for use in studies of nematode population ecology.
Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy
2015-01-01
Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier
Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei
2018-06-01
The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8 copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4 copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1 copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.
Lund, Vidar; Fonahn, Wenche; Pettersen, Jens Erik; Caugant, Dominique A; Ask, Eirik; Nysaeter, Ase
2014-09-01
Cases of Legionnaires' disease associated with biological treatment plants (BTPs) have been reported in six countries between 1997 and 2010. However, knowledge about the occurrence of Legionella in BTPs is scarce. Hence, we undertook a qualitative and quantitative screening for Legionella in BTPs treating waste water from municipalities and industries in Norway, to assess the transmission potential of Legionella from these installations. Thirty-three plants from different industries were sampled four times within 1 year. By cultivation, 21 (16%) of 130 analyses were positive for Legionella species and 12 (9%) of 130 analyses were positive for Legionella pneumophila. By quantitative real-time polymerase chain reaction (PCR), 433 (99%) of 437 analyses were positive for Legionella species and 218 (46%) of 470 analyses were positive for L. pneumophila. This survey indicates that PCR could be the preferable method for detection of Legionella in samples from BTPs. Sequence types of L. pneumophila associated with outbreaks in Norway were not identified from the BTPs. We showed that a waste water treatment plant with an aeration basin can produce high concentrations of Legionella. Therefore, these plants should be considered as a possible source of community-acquired Legionella infections.
Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F
2015-10-01
We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco
2015-05-27
This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.
High-throughput real-time quantitative reverse transcription PCR.
Bookout, Angie L; Cummins, Carolyn L; Mangelsdorf, David J; Pesola, Jean M; Kramer, Martha F
2006-02-01
Extensive detail on the application of the real-time quantitative polymerase chain reaction (QPCR) for the analysis of gene expression is provided in this unit. The protocols are designed for high-throughput, 384-well-format instruments, such as the Applied Biosystems 7900HT, but may be modified to suit any real-time PCR instrument. QPCR primer and probe design and validation are discussed, and three relative quantitation methods are described: the standard curve method, the efficiency-corrected DeltaCt method, and the comparative cycle time, or DeltaDeltaCt method. In addition, a method is provided for absolute quantification of RNA in unknown samples. RNA standards are subjected to RT-PCR in the same manner as the experimental samples, thus accounting for the reaction efficiencies of both procedures. This protocol describes the production and quantitation of synthetic RNA molecules for real-time and non-real-time RT-PCR applications.
Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus
Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.
2004-01-01
A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703
Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N
2009-01-01
A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.
Barakat, Fareed H; Luthra, Rajyalakshmi; Yin, C Cameron; Barkoh, Bedia A; Hai, Seema; Jamil, Waqar; Bhakta, Yaminiben I; Chen, Su; Medeiros, L Jeffrey; Zuo, Zhuang
2011-08-01
Nucleophosmin 1 (NPM1) is the most commonly mutated gene in acute myeloid leukemia. Detection of NPM1 mutations is useful for stratifying patients for therapy, predicting prognosis, and assessing for minimal residual disease. Several methods have been developed to rapidly detect NPM1 mutations in genomic DNA and/or messenger RNA specimens. To directly compare a quantitative real-time polymerase chain reaction (qPCR) assay with a widely used capillary electrophoresis assay for detecting NPM1 mutations. We adopted and modified a qPCR assay designed to detect the 6 most common NPM1 mutations and performed the assay in parallel with capillary electrophoresis assay in 207 bone marrow aspirate or peripheral blood samples from patients with a range of hematolymphoid neoplasms. The qPCR assay demonstrated a higher analytical sensitivity than the capillary electrophoresis 1/1000 versus 1/40, respectively. The capillary electrophoresis assay generated 10 equivocal results that needed to be repeated, whereas the qPCR assay generated only 1 equivocal result. After test conditions were optimized, the qPCR and capillary electrophoresis methods produced 100% concordant results, 85 positive and 122 negative. Given the higher analytical sensitivity and specificity of the qPCR assay, that assay is less likely to generate equivocal results than the capillary electrophoresis assay. Moreover, the qPCR assay is quantitative, faster, cheaper, less prone to contamination, and well suited for monitoring minimal residual disease.
Wang, Mei-Rong; Qiu, Ning; Lu, Shi-Chun; Xiu, Dian-Rong; Yu, Jian-Guo; Li, Tong; Liu, Xue-En; Zhuang, Hui
2011-05-01
To establish and optimize a sensitive and specific quantitative real-time polymerase chain reaction (PCR) method for detection of hepatitis B virus covalently closed circular DNA (HBV cccDNA) in liver tissue. Specific primers and probes were designed to detect HBV DNA (tDNA) and cccDNA. A series of plasmids (3.44 × 10(0) - 3.44 × 10(9) copies/µl) containing a full double-stranded copies of HBV genome (genotype C) were used to establish the standard curve of real-time PCR. Liver samples of 33 patients with HBV related hepatocellular carcinoma (HCC), 13 Chronic hepatitis B patients (CHB) and 10 non-HBV patients were collected to verify the sensitivity and specificity of the assay. A fraction of extracted DNA was digested with a Plasmid-Safe ATP-dependent Dnase (PSAD) for HBV cccDNA detection and the remaining was used for tDNA and β-globin detection. The amount (copies/cell) of HBV cccDNA and tDNA were measured by a real-time PCR, using β-globin housekeeping gene as a quantitation standard. The standard curves of real-time PCR with a linear range of 3.44 × 10(0) to 3.44 × 10(9) copies/µl were established for detecting HBV cccDNA and tDNA, and both of the lowest detection limits of HBV cccDNA and tDNA were 3.44 × 10(0) copies/µl. The lowest quantitation levels of HBV cccDNA in liver tissues tested in 33 HBV related HCC patients and 13 CHB patients were 0.003 copies/cell and 0.031 copies/cell, respectively. HBV cccDNA and tDNA in liver tissue of 10 non-HBV patient appeared to be negative. The true positive rate was increasing through the digestion of HBV DNA by PSAD, and the analytic specificity of cccDNA detection improved by 7.24 × 10(2) times. Liver tissues of 2 patients were retested 5 times in the PCR for detecting cccDNA and the coefficient of variations on cycle threshold (Ct) were between 0.224% - 0.609%. A highly sensitive and specific quantitative real time PCR method for the detection of HBV cccDNA in liver tissue was established and could be used
Problem-Solving Test: Real-Time Polymerase Chain Reaction
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2009-01-01
Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…
Treff, Nathan R; Scott, Richard T
2013-03-15
Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Trends and advances in food analysis by real-time polymerase chain reaction.
Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin
2016-05-01
Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.
Kaliyaperumal, Subadra; Sankarapandian, Sathasivasubramanian
2016-01-01
The aim of this study was to quantitatively investigate the hypermethylation of p16 gene in buccal cells and saliva of oral submucous fibrosis (OSMF) patients using real-time quantitative methylation-specific polymerase chain reaction (PCR) and to compare the values of two methods. A total of 120 samples were taken from 60 subjects selected for this study, of which 30 were controls and 30 patients were clinically and histopathologically diagnosed with OSMF. In both groups, two sets of samples were collected, one directly from the buccal cells through cytobrush technique and the other through salivary rinse. We analyzed the samples for the presence of p16 hypermethylation using quantitative real-time PCR. In OSMF, the hypermethylation status of p16 in buccal cells was very high (93.3%) and in salivary samples, it was partially methylated (50%). However, no hypermethylation was found in controls suggesting that significant quantity of p16 hypermethylation was present in buccal cells and saliva in OSMF. This study indicates that buccal cell sampling may be a better method for evaluation than the salivary samples. It signifies that hypermethylation of p16 is an important factor to be considered in epigenetic alterations of normal cells to oral precancer, i.e. OSMF.
Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M
1998-11-23
Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.
Peng, Cheng; Wang, Hua; Xu, Xiaoli; Wang, Xiaofu; Chen, Xiaoyun; Wei, Wei; Lai, Yongmin; Liu, Guoquan; Godwin, Ian Douglas; Li, Jieqin; Zhang, Ling; Xu, Junfeng
2018-05-15
Gene editing techniques are becoming powerful tools for modifying target genes in organisms. Although several methods have been developed to detect gene-edited organisms, these techniques are time and labour intensive. Meanwhile, few studies have investigated high-throughput detection and screening strategies for plants modified by gene editing. In this study, we developed a simple, sensitive and high-throughput quantitative real-time (qPCR)-based method. The qPCR-based method exploits two differently labelled probes that are placed within one amplicon at the gene editing target site to simultaneously detect the wild-type and a gene-edited mutant. We showed that the qPCR-based method can accurately distinguish CRISPR/Cas9-induced mutants from the wild-type in several different plant species, such as Oryza sativa, Arabidopsis thaliana, Sorghum bicolor, and Zea mays. Moreover, the method can subsequently determine the mutation type by direct sequencing of the qPCR products of mutations due to gene editing. The qPCR-based method is also sufficiently sensitive to distinguish between heterozygous and homozygous mutations in T 0 transgenic plants. In a 384-well plate format, the method enabled the simultaneous analysis of up to 128 samples in three replicates without handling the post-polymerase chain reaction (PCR) products. Thus, we propose that our method is an ideal choice for screening plants modified by gene editing from many candidates in T 0 transgenic plants, which will be widely used in the area of plant gene editing. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.
Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A
2015-12-01
Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.
Aims: To determine the performance of a rapid, real time polymerase chain reaction (PCR) method for the detection and quantitative analysis Helicobacter pylori at low concentrations in drinking water.
Methods and Results: A rapid DNA extraction and quantitative PCR (QPCR)...
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
Bentley-Hewitt, Kerry L; Hedderley, Duncan I; Monro, John; Martell, Sheridan; Smith, Hannah; Mishra, Suman
2016-05-25
Experimental methods are constantly being improved by new technology. Recently a new technology, NanoString®, has been introduced to the market for the analysis of gene expression. Our experiments used adipose and liver samples collected from a rat feeding trial to explore gene expression changes resulting from a diet of 7.5% seaweed. Both quantitative real-time polymerase chain reaction (qPCR) and NanoString methods were employed to look at expression of genes related to fat and glucose metabolism and this paper compares results from both methods. We conclude that NanoString offers a valuable alternative to qPCR and our data suggest that results are more accurate because of the reduced sample handling and direct quantification of gene copy number without the need for enzymatic amplification. However, we have highlighted a potential challenge for both methods, which needs to be addressed when designing primers or probes. We suggest a literature search for known splice variants of a particular gene to be completed so that primers or probes can be designed that do not span exons which may be affected by alternative gene sequences. Copyright © 2016 Elsevier B.V. All rights reserved.
Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D
2009-12-01
The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.
Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun
2015-09-15
During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus. Copyright © 2015 Elsevier B.V. All rights reserved.
Kutyavin, Igor V.
2013-01-01
Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564
Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R
2007-09-01
To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.
Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.
Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C
2012-09-27
We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.
Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom
2015-01-01
This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449
Pine, Sharon R; Yin, Changhong; Matloub, Yousif H; Sabaawy, Hatem E; Sandoval, Claudio; Levendoglu-Tugal, Oya; Ozkaynak, M Fevzi; Jayabose, Somasundaram
2005-02-01
Accurate detection of central nervous system (CNS) involvement in children with newly diagnosed acute lymphoblastic leukemia (ALL) could have profound prognostic and therapeutic implications. We examined various cerebrospinal fluid (CSF) preservation methods to yield adequate DNA stability for polymerase chain reaction (PCR) analysis and developed a quantitative real-time PCR assay to detect occult CNS leukemia. Sixty CSF specimens were maintained in several storage conditions for varying amounts of time, and we found that preserving CSF in 1:1 serum-free RPMI tissue culture medium offers the best stability of DNA for PCR analysis. Sixty CSF samples (30 at diagnosis and 30 at the end of induction therapy) from 30 children with ALL were tested for CNS leukemic involvement by real-time PCR using patient-specific antigen receptor gene rearrangement primers. Six of thirty patient diagnosis samples were PCR-positive at levels ranging from 0.5 to 66% leukemic blasts in the CSF. Four of these patients had no clinical or cytomorphological evidence of CNS leukemia involvement at that time. All 30 CSF samples drawn at the end of induction therapy were PCR-negative. The data indicate that real-time PCR analysis of CSF is an excellent tool to assess occult CNS leukemia involvement in patients with ALL and can possibly be used to refine CNS status classification.
Pine, Sharon R.; Yin, Changhong; Matloub, Yousif H.; Sabaawy, Hatem E.; Sandoval, Claudio; Levendoglu-Tugal, Oya; Ozkaynak, M. Fevzi; Jayabose, Somasundaram
2005-01-01
Accurate detection of central nervous system (CNS) involvement in children with newly diagnosed acute lymphoblastic leukemia (ALL) could have profound prognostic and therapeutic implications. We examined various cerebrospinal fluid (CSF) preservation methods to yield adequate DNA stability for polymerase chain reaction (PCR) analysis and developed a quantitative real-time PCR assay to detect occult CNS leukemia. Sixty CSF specimens were maintained in several storage conditions for varying amounts of time, and we found that preserving CSF in 1:1 serum-free RPMI tissue culture medium offers the best stability of DNA for PCR analysis. Sixty CSF samples (30 at diagnosis and 30 at the end of induction therapy) from 30 children with ALL were tested for CNS leukemic involvement by real-time PCR using patient-specific antigen receptor gene rearrangement primers. Six of thirty patient diagnosis samples were PCR-positive at levels ranging from 0.5 to 66% leukemic blasts in the CSF. Four of these patients had no clinical or cytomorphological evidence of CNS leukemia involvement at that time. All 30 CSF samples drawn at the end of induction therapy were PCR-negative. The data indicate that real-time PCR analysis of CSF is an excellent tool to assess occult CNS leukemia involvement in patients with ALL and can possibly be used to refine CNS status classification. PMID:15681484
Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays
DOE Office of Scientific and Technical Information (OSTI.GOV)
Frank F. Roberto
2008-08-01
Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means ofmore » rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.« less
Shin, Yun-Kyung; Nam, Ki-Woong; Park, Kwan Ha; Yoon, Jong-Man; Park, Kyung-Il
2014-11-26
The kinetoplastid parasite, Azumiobodo hoyamushi, is the causative agent of soft tunic syndrome (STS) in ascidians and leads to their mass mortality in Korean waters. This study was conducted to quantify A. hoyamushi density during the development of STS in the tunics of ascidians (Halocynthia roretzi) using real-time polymerase chain reaction (qPCR). The infection intensity of A. hoyamushi, as measured by qPCR, varied depending on the part of the tunic analyzed, as well as the stage of STS development. The highest infection intensity was recorded in the tunics of the siphons. The infection intensity of A. hoyamushi in the siphons was only 2.9 cell/tunic (area, 0.25 cm(2)) or 106.0 cell/gram tunic (GT) in the early phase of STS, but this value increased dramatically to 16,066 cells/tunic (0.25 cm(2)) or 617,004 cell/GT at the time of death. The number of A. hoyamushi parasites increased gradually and their distribution spread from the siphons to the other parts of the tunics. qPCR enabled the quantitation of A. hoyamushi and the results revealed that parasite density increased as STS progressed. In addition, our results suggested that the siphons might function as the portal of entry for A. hoyamushi during infection.
Barletta, Francesca; Mercado, Erik; Ruiz, Joaquim; Ecker, Lucie; Lopez, Giovanni; Mispireta, Monica; Gil, Ana I.; Lanata, Claudio F.; Cleary, Thomas G.
2011-01-01
Background. Enteropathogenic Escherichia coli (EPEC) strains are pediatric pathogens commonly isolated from both healthy and sick children with diarrhea in areas of endemicity. The aim of this study was to compare the bacterial load of EPEC isolated from stool samples from children with and without diarrhea to determine whether bacterial load might be a useful tool for further study of this phenomenon. Methods. EPEC was detected by polymerase chain reaction (PCR) of colonies isolated on MacConkey plates from 53 diarrheal and 90 healthy children aged <2 years. DNA was isolated from stool samples by cetyltrimethylammonium bromide extraction. To standardize quantification by quantitative real-time PCR (qRT-PCR), the correlation between fluorescence threshold cycle and copy number of the intimin gene of EPEC E2348/69 was determined. Results. The detection limit of qRT-PCR was 5 bacteria/mg stool. The geometric mean load in diarrhea was 299 bacteria/mg (95% confidence interval [CI], 77–1164 bacteria/mg), compared with 29 bacteria/mg (95% CI, 10–87 bacteria/mg) in control subjects (P = .016). Bacterial load was significantly higher in children with diarrhea than in control subjects among children <12 months of age (178 vs 5 bacteria/mg; P = .006) and among children with EPEC as the sole pathogen (463 vs 24 bacteria/mg; P = .006). Conclusions. EPEC load measured by qRT-PCR is higher in diarrheal than in healthy children. qRT-PCR may be useful to study the relationship between disease and colonization in settings of endemicity. PMID:22028433
Blome, B; Braun, A; Sobarzo, V; Jepsen, S
2008-10-01
It was the aim of the present study to evaluate root canal samples for the presence and numbers of specific species as well as for total bacterial load in teeth with chronic apical periodontitis using quantitative real-time polymerase chain reaction (PCR). Forty adult patients with one radiographically documented periapical lesion were included. Twenty teeth presented with primary infections and 20 with secondary infections, requiring retreatment. After removal of necrotic pulp tissue or root canal filling, a first bacterial sample was obtained. Following chemo-mechanical root canal preparation a second sample was taken and a third sample was obtained after 14 days of intracanal dressing with calcium hydroxide. Analysis by real-time PCR enabled the quantification of total bacterial counts and of nine selected species. Root canals with primary infections harbored significantly more bacteria (by total bacterial count) than teeth with secondary infections (P < 0.05). Mean total bacterial count in the retreatment group was 2.1 x 10(6) and was significantly reduced following root canal preparation (3.6 x 10(4)) and intracanal dressing (1.4 x 10(5)). Corresponding values for primary infections were: 4.6 x 10(7), 3.6 x 10(4), and 6.9 x 10(4). The numbers of the selected bacteria and their detection frequency were also significantly reduced. Root canals with primary infections contained a higher bacterial load. Chemo-mechanical root canal preparation reduced bacterial counts by at least 95%.
[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].
Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A
2015-01-01
Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.
Quantification of Xylella fastidiosa from Citrus Trees by Real-Time Polymerase Chain Reaction Assay.
Oliveira, Antonio C; Vallim, Marcelo A; Semighini, Camile P; Araújo, Welington L; Goldman, Gustavo H; Machado, Marcos A
2002-10-01
ABSTRACT Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease of sweet orange cultivars in Brazil. Polymerase chain reaction (PCR)-based assays constitute the principal diagnostic method for detection of these bacteria. In this work, we established a real-time quantitative PCR (QPCR) assay to quantify X. fastidiosa in naturally and artificially infected citrus. The X. fastidiosa cell number detected in the leaves increased according to the age of the leaf, and bacteria were not detected in the upper midrib section in young leaves, indicating temporal and spatial distribution patterns of bacteria, respectively. In addition, the X. fastidiosa cell number quantified in leaves of 'Pera' orange and 'Murcott' tangor reflected the susceptible and resistant status of these citrus cultivars. None of the 12 endophytic citrus bacteria or the four strains of X. fastidiosa nonpathogenic to citrus that were tested showed an increase in the fluorescence signal during QPCR. In contrast, all 10 CVC-causing strains exhibited an increase in fluorescence signal, thus indicating the specificity of this QPCR assay. Our QPCR provides a powerful tool for studies of different aspects of the Xylella-citrus interactions, and can be incorporated into breeding programs in order to select CVC-resistant plants more quickly.
Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai
2014-10-29
Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.
Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.
2008-01-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880
Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M
2008-09-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.
Choi, Eun-Jung; Lee, Sung-Hoon; Kim, Young-Jae
2009-03-01
Streptococcus mutans and Streptococcus sobrinus are closely associated with the development of early childhood caries (ECC). Recently, quantitative real-time polymerase chain reaction (qRT-PCR) has been used for rapid and accurate quantification of these bacterial species. This study aims to detect quantitatively the levels of S. mutans and S. sobrinus in plaque samples by qRT-PCR, and to assess their association with the prevalence of ECC in Korean preschool children. One hundred and five children (71 months old or younger) were examined and classified into three groups (caries-free, ECC, severe ECC). Dental plaque samples were collected and qRT-PCR was conducted using oligonucleotide primers specific for glucosyltransferase gene (S. mutans-gtfB, S. sobrinus-gtfU) and universal primer. Pearson's correlation test was conducted to evaluate the relationship between the dmfs (decayed, missing, or filled surfaces primary teeth) scores and the microbiological findings. There was a significant difference between the levels of S. mutans and S. sobrinus in the plaque samples of the three groups (P < 0.05). The proportion of S. sobrinus to S. mutans showed strong correlation to the dmfs scores (r = 0.748, P < 0.05). The qRT-PCR results of this study showed that children with ECC had higher level of S. mutans and S. sobrinus in their dental plaque samples. The children with higher ratio of S. sobrinus to S. mutans in their dental plaque showed higher incidence of ECC.
Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M
2011-07-01
Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.
Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.
2012-01-01
The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694
Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J
2016-01-01
Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. © The American Society of Tropical Medicine and Hygiene.
Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y.; Whelen, A. Christian; Calimlim, Precilia S.; Sciulli, Rebecca H.; Honda, Stacey A. A.; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M.; da Silva, Alexandre J.
2016-01-01
Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. PMID:26526920
Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K
2014-01-01
Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.
Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.
2011-01-01
Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.
Peters, Iain R; Helps, Chris R; Calvert, Emma L; Hall, Edward J; Day, Michael J
2005-01-01
To examine the difference in expression of messenger RNA (mRNA) transcripts for polymeric immunoglobulin receptor (plgR), alpha-chain, and J-chain determined by use of quantitative real-time reverse transcription-polymerase chain reaction (QRT-PCR) assays in duodenal biopsy specimens obtained from dogs with and without chronic diarrhea. Biopsy specimens of the proximal portion of the duodenum were obtained endoscopically from 39 dogs evaluated because of chronic diarrhea (12 German Shepherd Dogs and 27 non-German Shepherd Dog breeds); specimens were also obtained from a control group of 7 dogs evaluated because of other gastrointestinal tract diseases and 2 dogs that were euthanatized as a result of nongastrointestinal tract disease. Dogs were anesthetized, and multiple mucosal biopsy specimens were obtained endoscopically at the level of the caudal duodenal flexure by use of biopsy forceps; in 2 control dogs, samples were obtained from the descending duodenum within 5 minutes of euthanasia. One-step QRT-PCR was used to quantify the level of expression of transcripts for the housekeeper gene glyceraldehyde-3-phosphate dehydrogenase, plgR, alpha-chain, and J-chain in duodenal mucosal tissue. There was no significant difference in the level of expression of any transcript among non-German Shepherd Dog breeds without diarrhea (control group), non-German Shepherd Dog breeds with chronic diarrhea, and German Shepherd Dogs with chronic diarrhea. Conclusions and Clinical Relevance-Results indicated that the susceptibility of German Shepherd Dogs to chronic diarrhea is not a result of simple failure of transcription of the key genes that encode molecules involved in mucosal IgA secretion.
USDA-ARS?s Scientific Manuscript database
The present study describes the development of a real time Taqman polymerase chain reaction (PCR) assay using a fluorescent labeled probe for the detection and quantitation of chicken parvovirus (ChPV) in feces. The primers and probes were designed based on the nucleotide sequence of the non struct...
Ansart-Pirenne, H; Martin-Blanc, S; Le Pennec, P-Y; Rouger, P; Cartron, J-P; Tournamille, C
2007-02-01
The Duffy (FY) blood group system is controlled by four major alleles: FY*A and FY*B, the Caucasian common alleles, encoding Fy(a) and Fy(b) antigens; FY*X allele responsible for a poorly expressed Fy(b) antigen, and FY*Fy a silent predominant allele among Black population. Despite the recent development of a real-time fluorescent polymerase chain reaction (PCR) method for FY genotyping FY*X genotyping has not been described by this method. This study focused on the real-time FY*X genotyping development associated with a complete, one-step real-time FY genotyping, based on fluorescence resonance energy transfer (FRET) technology. Seventy-two blood samples from Fy(a+b-) Caucasian blood donors were studied by real-time PCR only. Forty-seven Caucasian and Black individual blood samples, referred to our laboratory, were studied by PCR-RFLP and real-time PCR. For each individual, the result of the genotype was compared to the known phenotype. The FY*X allele frequency calculated in an Fy(a+b-) Caucasian blood donors population was 0.014. With the Caucasian and Black patient samples we found a complete correlation between PCR-RFLP and the real-time PCR method whatever the alleles combination tested. When the known phenotype was not correlated to FY*X genotype, the presence of the Fy(b) antigen was always confirmed by adsorption-elution. The real-time technology method is rapid and accurate for FY genotyping. From now, we are able to detect the FY*X allele in all the alleles combinations studied. Regarding its significant frequency, the detection of the FY*X allele is useful for the correct typing of blood donors and recipients considering the therapeutic use of blood units and the preparation of test red blood cells for antibody screening.
Cimino, Rubén O; Jeun, Rebecca; Juarez, Marisa; Cajal, Pamela S; Vargas, Paola; Echazú, Adriana; Bryan, Patricia E; Nasser, Julio; Krolewiecki, Alejandro; Mejia, Rojelio
2015-07-17
In resource-limited countries, stool microscopy is the diagnostic test of choice for intestinal parasites (soil-transmitted helminths and/or intestinal protozoa). However, sensitivity and specificity is low. Improved diagnosis of intestinal parasites is especially important for accurate measurements of prevalence and intensity of infections in endemic areas. The study was carried out in Orán, Argentina. A total of 99 stool samples from a local surveillance campaign were analyzed by concentration microscopy and McMaster egg counting technique compared to the analysis by multi-parallel quantitative real-time polymerase chain reaction (qPCR). This study compared the performance of qPCR assay and stool microscopy for 8 common intestinal parasites that infect humans including the helminths Ascaris lumbricoides, Ancylostoma duodenale, Necator americanus, Strongyloides stercoralis, Trichuris trichiura, and the protozoa Giardia lamblia, Cryptosporidium parvum/hominis, and Entamoeba histolytica, and investigated the prevalence of polyparasitism in an endemic area. qPCR showed higher detection rates for all parasites as compared to stool microscopy except T. trichiura. Species-specific primers and probes were able to distinguish between A. duodenale (19.1%) and N. americanus (36.4%) infections. There were 48.6% of subjects co-infected with both hookworms, and a significant increase in hookworm DNA for A. duodenale versus N. americanus (119.6 fg/μL: 0.63 fg/μL, P < 0.001) respectively. qPCR outperformed microscopy by the largest margin in G. lamblia infections (63.6% versus 8.1%, P < 0.05). Polyparasitism was detected more often by qPCR compared to microscopy (64.7% versus 24.2%, P < 0.05). Multi-parallel qPCR is a quantitative molecular diagnostic method for common intestinal parasites in an endemic area that has improved diagnostic accuracy compared to stool microscopy. This first time use of multi-parallel qPCR in Argentina has demonstrated the high
Sarris, Andreas H; Jiang, Yunfang; Tsimberidou, Apostolia M; Thomaides, Athanasios; Rassidakis, George Z; Ford, Richard J; Medeiros, L Jeffrey; Cabanillas, Fernando; McLaughlin, Peter
2002-02-01
Fludarabine and rituximab (Rituxan; Genentech, Inc, South San Francisco, CA, and IDEC Pharmaceuticals, San Diego, CA) are active against indolent lymphomas. We have previously shown the safety and efficacy of the combination of FND (fludarabine/mitoxantrone/dexamethasone) in relapsed and subsequently untreated patients with stage IV indolent lymphomas. Currently, we treat patients with stage IV indolent lymphomas who are previously untreated, younger than 60 years, human immunodeficiency virus-negative, and have adequate organ and marrow function with FND and random assignment to concurrent or delayed administration of rituximab. We have developed a quantitative real-time polymerase chain reaction assay for t(14;18). With 1 μg of DNA, this assay detects 0.6 copies in 55% of reactions, as expected for the Poisson distribution. When 1μg of DNA was analyzed in duplicate, cells with the t(14;18) were detected in peripheral blood of 22% of 152 volunteer blood donors. Quantitation showed that numbers of t(14;18) cells were higher than the statistical upper normal limit (mean of all volunteer values plus standard deviations) in 2% of volunteer blood donors. By contrast, 36% of blood or marrow specimens from follicular lymphoma patients were positive, and the number of cells with t(14;18) was higher than the normal upper limit in 26%. The presence of cells with t(14;18) and their numbers are prospectively quantitated in blood and marrow of patients treated with FND plus rituximab to determine their clinical significance both at presentation and during therapy. Semin Oncol 29 (suppl 2):48-55. Copyright © 2002 by W.B. Saunders Company. Copyright © 2002 W.B. Saunders Company. All rights reserved.
Yang, Jie; Lin, Qi; Lin, Juan; Ye, Xiuyun
2016-01-01
With its ability to produce ligninolytic enzymes such as laccases, white-rot basidiomycete Cerrena unicolor, a medicinal mushroom, has great potential in biotechnology. Elucidation of the expression profiles of genes encoding ligninolytic enzymes are important for increasing their production. Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool to study transcriptional regulation of genes of interest. To ensure accuracy and reliability of qPCR analysis of C. unicolor, expression levels of seven candidate reference genes were studied at different growth phases, under various induction conditions, and with a range of carbon/nitrogen ratios and carbon and nitrogen sources. The stability of the genes were analyzed with five statistical approaches, namely geNorm, NormFinder, BestKeeper, the ΔCt method, and RefFinder. Our results indicated that the selection of reference genes varied with sample sets. A combination of four reference genes (Cyt-c, ATP6, TEF1, and β-tubulin) were recommended for normalizing gene expression at different growth phases. GAPDH and Cyt-c were the appropriate reference genes under different induction conditions. ATP6 and TEF1 were most stable in fermentation media with various carbon/nitrogen ratios. In the fermentation media with various carbon or nitrogen sources, 18S rRNA and GAPDH were the references of choice. The present study represents the first validation analysis of reference genes in C. unicolor and serves as a foundation for its qPCR analysis.
USDA-ARS?s Scientific Manuscript database
Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...
Anitharaj, Velmurugan; Stephen, Selvaraj; Pradeep, Jothimani; Pooja, Pratheesh; Preethi, Sridharan
2017-01-01
In the recent past, scrub typhus (ST) has been reported from different parts of India, based on Weil-Felix/enzyme-linked immunosorbent assay (ELISA)/indirect immunofluorescence assay (IFA). Molecular tests are applied only by a few researchers. Evaluation of a new commercial real time polymerase chain reaction (PCR) kit for molecular diagnosis of ST by comparing it with the commonly used IgM ELISA is our aim. ST has been reported all over India including Puducherry and surrounding Tamil Nadu and identified as endemic for ST. This study was designed to correlate antibody detection by IgM ELISA and Orientia tsutsugamushi DNA in real time PCR. ST IgM ELISA (InBios Inc., USA) was carried out for 170 consecutive patients who presented with the symptoms of acute ST during 11 months (November, 2015- September, 2016). All 77 of these patients with IgM ELISA positivity and 49 of 93 IgM ELISA negative patients were subjected to real time PCR (Geno-Sen's ST real time PCR, Himachal Pradesh, India). Statistical analysis for clinical and laboratory results was performed using IBM SPSS Statistics 17 for Windows (SPSS Inc., Chicago, USA). Chi-square test with Yates correction (Fisher's test) was employed for a small number of samples. Among 77 suspected cases of acute ST with IgM ELISA positivity and 49 IgM negative patients, 42 and 7 were positive, respectively, for O. tsutsugamushi 56-kDa type-specific gene in real time PCR kit. Until ST IFA, the gold standard diagnostic test, is properly validated in India, diagnosis of acute ST will depend on both ELISA and quantitative PCR.
Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori
2017-09-01
Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hyeon, Jiyeon; Cho, Soo Youn; Hong, Min Eui; Kang, So Young; Do, Ingu; Im, Young Hyuck; Cho, Eun Yoon
2017-09-01
Accurate testing for estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) is essential for breast cancer treatment. At present, immunohistochemistry (IHC)/florescence in situ hybridization (FISH) are widely accepted as the standard testing methods. To investigate the value of NanoString nCounter®, we performed its comparative analysis with IHC/FISH and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) for the assessment of ER, PR, and HER2. Data on IHC/FISH results for ER, PR, and HER2 in 240 patients from a single tertiary hospital in Korea were collected and compared with NanoString nCounter® and qRT-PCR results at a single institution. Expression levels for each gene using NanoString nCounter® showed good correlation with the corresponding data for protein expression by IHC ( p <0.001) and gene amplification status for HER2 ( p <0.001). Comparisons between gene expression and IHC data showed good overall agreement with a high area under the curve (AUC) for ESR1 /ER (AUC=0.939), PgR /PR (AUC=0.796), and HER2 /HER2 (AUC=0.989) ( p <0.001). The quantification of ER , PgR , and HER2 mRNA expression with NanoString nCounter® may be a viable alternative to conventional IHC/FISH methods.
Jain, Neha; Merwyn, S; Rai, G P; Agarwal, G S
2012-05-01
Real-time polymerase chain reaction (real-time PCR) is a laboratory technique based on PCR. This technique is able to detect sequence-specific PCR products as they accumulate in "real time" during the PCR amplification, and also to quantify the number of substrates present in the initial PCR mixture before amplification begins. In the present study, real-time PCR assay was employed for rapid and real-time detection of Bacillus anthracis spores spiked in 0.1 g of soil and talcum powder ranging from 5 to 10(7) spores. DNA was isolated from spiked soil and talcum powder, using PBS containing 1 % Triton-X-100, followed by heat treatment. The isolated DNA was used as template for real-time PCR and PCR. Real-time PCR amplification was obtained in 60 min under the annealing condition at 60°C by employing primers targeting the pag gene of B. anthracis. In the present study, the detection limit of real-time PCR assay in soil was 10(3) spores and 10(2) spores in talcum powder, respectively, whereas PCR could detect 10(4) spores in soil and 10(3) spores in talcum powder, respectively.
Jung, Woo-Sun; Yang, Il-Hyung; Lim, Won Hee; Baek, Seung-Hak; Kim, Tae-Woo; Ahn, Sug-Joon
2015-12-01
To analyze in vivo mutans streptococci (MS) adhesion to self-ligating ceramic brackets [Clarity-SL (CSL) and Clippy-C (CC)] and the relationships between bacterial adhesion and oral hygiene indices. Four central incisor brackets from the maxilla and mandible were collected from 40 patients (20 patients per each bracket type) at debonding immediately after plaque and gingival indices were measured. Adhesions of Streptococcus mutans, S. sobrinus, and total bacteria were quantitatively determined using real-time polymerase chain reaction after genomic DNA was extracted. Factorial analysis of variance was used to analyze bacterial adhesion to the brackets with respect to the bracket type and jaw position. Correlation coefficients were calculated to determine the relationships of bacterial adhesion to oral hygiene indices. Adhesion of total bacteria and S. mutans to CSL was higher than that to CC (P < 0.001). Adhesion of total bacteria to the mandibular brackets was higher than that to the maxillary ones (P < 0.001), while adhesion of S. mutans to the maxillary brackets were higher than that in the mandibular ones (P < 0.001). In particular, the proportion of S. mutans to total bacteria in CSL was higher than CC (P < 0.05) in the maxillary anterior teeth (P < 0.001). There were no significant differences in adhesion of S. sobrinus between the brackets and jaw positions. Interestingly, no significant relationships were found between bacterial adhesions and oral hygiene indices. Complex bracket configurations may significantly influence bacterial adhesion to orthodontic brackets. Further in vivo study using bracket raw materials will help to define the relationships between bacteria adhesion and enamel demineralization. Because oral hygiene indices were not significantly correlated with adhesions of MS to self-ligating ceramic brackets, careful examinations around the brackets should be needed to prevent enamel demineralization, regardless of oral hygiene status. © The
Identification of four squid species by quantitative real-time polymerase chain reaction.
Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan
2016-02-01
Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. Copyright © 2016 Elsevier Ltd. All rights reserved.
Anitharaj, Velmurugan; Stephen, Selvaraj; Pradeep, Jothimani; Pooja, Pratheesh; Preethi, Sridharan
2017-01-01
Background: In the recent past, scrub typhus (ST) has been reported from different parts of India, based on Weil-Felix/enzyme-linked immunosorbent assay (ELISA)/indirect immunofluorescence assay (IFA). Molecular tests are applied only by a few researchers. Aims: Evaluation of a new commercial real time polymerase chain reaction (PCR) kit for molecular diagnosis of ST by comparing it with the commonly used IgM ELISA is our aim. Settings and Design: ST has been reported all over India including Puducherry and surrounding Tamil Nadu and identified as endemic for ST. This study was designed to correlate antibody detection by IgM ELISA and Orientia tsutsugamushi DNA in real time PCR. Materials and Methods: ST IgM ELISA (InBios Inc., USA) was carried out for 170 consecutive patients who presented with the symptoms of acute ST during 11 months (November, 2015– September, 2016). All 77 of these patients with IgM ELISA positivity and 49 of 93 IgM ELISA negative patients were subjected to real time PCR (Geno-Sen's ST real time PCR, Himachal Pradesh, India). Statistical Analysis: Statistical analysis for clinical and laboratory results was performed using IBM SPSS Statistics 17 for Windows (SPSS Inc., Chicago, USA). Chi-square test with Yates correction (Fisher's test) was employed for a small number of samples. Results and Conclusion: Among 77 suspected cases of acute ST with IgM ELISA positivity and 49 IgM negative patients, 42 and 7 were positive, respectively, for O. tsutsugamushi 56-kDa type-specific gene in real time PCR kit. Until ST IFA, the gold standard diagnostic test, is properly validated in India, diagnosis of acute ST will depend on both ELISA and quantitative PCR. PMID:28878522
Kawamura, Masaki; Kobayashi, Naomi; Inaba, Yutaka; Choe, Hyonmin; Tezuka, Taro; Kubota, So; Saito, Tomoyuki
2017-11-01
A new multiplex real-time polymerase chain reaction (PCR) assay was developed to detect methicillin-resistant Staphylococcus (MRS) and to distinguish between gram-positive and gram-negative bacteria. In this study, we validated the sensitivity and specificity of this assay with periprosthetic joint infections (PJIs) and evaluated the utility of PCR for culture-negative PJI. Forty-five samples from 23 infectious PJI cases and 106 samples from 64 non-infectious control cases were analyzed by real-time PCR using a LightCycler Nano ® system. Twenty-eight clinical samples, comprising bacteria of known species isolated consecutively in the microbiological laboratory of our hospital, were used to determine the spectrum of bacterial species that could be detected using the new multiplex primers and probes. The sensitivity and specificity of the MRS- and universal-PCR assays were 92% and 99%, and 91% and 88%, respectively. Twenty-eight species of clinically isolated bacteria were detected using this method and the concordance rate for the identification of gram-positive or gram-negative organisms was 96%. Eight samples were identified as PCR-positive despite a culture-negative result. This novel multiplex real-time PCR system has acceptable sensitivity and specificity and several advantages; therefore, it has potential use for the diagnosis of PJIs, particularly in culture-negative cases.
Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi
2008-07-23
A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.
Law, Dennis K S; Tsang, Raymond S W
2013-05-01
A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.
Johnson, Stephanie T; Van Tassell, Eric R; Tonnetti, Laura; Cable, Ritchard G; Berardi, Victor P; Leiby, David A
2013-11-01
Babesia microti, an intraerythrocytic parasite, has been implicated in transfusion transmission. B. microti seroprevalence in Connecticut (CT) blood donors is approximately 1%; however, it is not known what percentage of donors is parasitemic and poses a risk for transmitting infection. Therefore, we determined the prevalence of demonstrable B. microti DNA in donors from a highly endemic area of CT and compared observed rates with concurrent immunofluorescence assay (IFA) testing results. Blood samples from consenting donors in southeastern CT were collected from mid-August through early October 2009 and tested by IFA for immunoglobulin G antibodies and real-time polymerase chain reaction (PCR) for B. microti DNA. IFA specificity was determined using blood donor samples collected in northwestern Vermont (VT), an area nonendemic for Babesia. Of 1002 CT donors, 25 (2.5%) were IFA positive and three (0.3%) were real-time PCR positive. Among the three real-time PCR-positive donors, two were also IFA positive, while one was IFA negative and may represent a window period infection. The two IFA- and real-time PCR-positive donors appeared to subsequently clear infection. The other real-time PCR-positive donor did not provide follow-up samples. Of 1015 VT donors tested by IFA, only one (0.1%) was positive, but may have acquired infection during travel to an endemic area. We prospectively identified several real-time PCR-positive blood donors, including an IFA-negative real-time PCR-positive donor, in an area highly endemic for B. microti. These results suggest the need to include nucleic acid testing in planned mitigation strategies for B. microti. © 2013 American Association of Blood Banks.
Yang, Litao; Pan, Aihu; Zhang, Kewei; Guo, Jinchao; Yin, Changsong; Chen, Jianxiu; Huang, Cheng; Zhang, Dabing
2005-08-10
As the genetically modified organisms (GMOs) labeling policies are issued in many countries, qualitative and quantitative polymerase chain reaction (PCR) techniques are increasingly used for the detection of genetically modified (GM) crops in foods. Qualitative PCR and TaqMan real-time quantitative PCR methods to detect and identify three varieties of insect resistant cotton, i.e., Mon531 cotton (Monsanto Co.) and GK19 and SGK321 cottons (Chinese Academy of Agricultural Sciences), which were approved for commercialization in China, were developed in this paper. Primer pairs specific to inserted DNAs, such as Cowpea trypsin inhibitor (CpTI) gene of SGK321 cotton and the specific junction DNA sequences containing partial Cry1A(c) gene and NOS terminator of Mon531, GK19, and SGK321 cotton varieties were designed to conduct the identified PCR assays. In conventional specific identified PCR assays, the limit of detection (LOD) was 0.05% for Mon531, GK19, or SGK321 in 100 ng of cotton genomic DNA for one reaction. Also, the multiplex PCR method for screening the three GM cottons was also established, which could save time and cost in practical detection. Furthermore, a real-time quantitative PCR assay based on TaqMan chemistry for detection of insect resistant gene, Cry1A(c), was developed. This assay also featured the use of a standard plasmid as a reference molecule, which contained both a specific region of the transgene Cry1A(c) and an endogenous stearoyl-acyl carrier protein desaturase (Sad1) gene of the cotton. In quantitative PCR assay, the quantification range was from 0.01 to 100% in 100 ng of the genome DNA template, and in the detection of 1.0, 3.0, and 5.0% levels of three insect resistant cotton lines, respectively, all of the relative standard deviations (RSDs) were less than 8.2% except for the GM cotton samples with 1.0% Mon531 or GK19, which meant that our real-time PCR assays involving the use of reference molecule were reliable and practical for GM
Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A
2014-01-01
Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.
Afanas'ev, M V; Chipanin, E V; Shestakov, V E; Denisov, A V; Fomina, L A; Ostiak, A S; Balakhonov, S V
2013-03-01
The article presents the results of development and practical implementation of system of polymerase chain reaction testing in real-time operation mode to detect agent of plague infield material. In laboratory conditions the system demonstrated good results and hence it was applied in conditions of field laboratory of epidemiologic team during planned epizootologic examination of Gorno-Altaisk hot spot of plague. The sampling consisted of more than 1400 objects. It was demonstrated that high sensitivity and specificity is immanent to proposed system. The adaptation of the system to the real time amplifier "Smart Cycler" (Cephid, USA) having some specific technical characteristics makes it possible to consider the proposed test-system as an effective sensitive and precise instrument for screening studies in the process of regular epizootologic examinations of hot spots of plague.
Brzezinski, Jennifer L
2006-01-01
The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.
Tricarico, Carmela; Pinzani, Pamela; Bianchi, Simonetta; Paglierani, Milena; Distante, Vito; Pazzagli, Mario; Bustin, Stephen A; Orlando, Claudio
2002-10-15
Careful normalization is essential when using quantitative reverse transcription polymerase chain reaction assays to compare mRNA levels between biopsies from different individuals or cells undergoing different treatment. Generally this involves the use of internal controls, such as mRNA specified by a housekeeping gene, ribosomal RNA (rRNA), or accurately quantitated total RNA. The aim of this study was to compare these methods and determine which one can provide the most accurate and biologically relevant quantitative results. Our results show significant variation in the expression levels of 10 commonly used housekeeping genes and 18S rRNA, both between individuals and between biopsies taken from the same patient. Furthermore, in 23 breast cancers samples mRNA and protein levels of a regulated gene, vascular endothelial growth factor (VEGF), correlated only when normalized to total RNA, as did microvessel density. Finally, mRNA levels of VEGF and the most popular housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were significantly correlated in the colon. Our results suggest that the use of internal standards comprising single housekeeping genes or rRNA is inappropriate for studies involving tissue biopsies.
Pitetti, Raymond D; Laus, Stella; Wadowsky, Robert M
2003-08-01
Epstein-Barr virus (EBV) infectious mononucleosis is often diagnosed based on characteristic clinical features and either a positive heterophil antibody test or serology, both of which can be unreliable in young children. Real time quantitative PCR assays that measure EBV DNA load in serum or plasma are highly sensitive in young children, but serum and plasma contain inhibitors of PCR which must be removed by DNA extraction techniques. A real time TaqMan PCR assay was designed and evaluated for simultaneously measuring EBV DNA load and validating the removal of PCR inhibitors from serum samples. A serum sample was available from patients classified serologically as primary EBV infection (n = 28), EBV-seronegative (n = 25) and EBV-seropositive (n = 26). Patients were classified as having EBV infectious mononucleosis if they had specified clinical findings and > or =10% atypical lymphocytes in peripheral blood or had a positive Monospot test result. DNA was purified by a spin column method and tested in PCR reactions with primers for EBV DNA polymerase gene and internal control targets. Amplification of the two PCR products was measured in real time with separate TaqMan DNA probes labeled with various fluorescent reporters. The mean age of study patients was 9 years, 4 months. Twenty-one (75%) of the patients in the primary EBV infection group, one (4%) of the seronegatives and none of the seropositives had detectable EBV DNA. Within the primary infection group, those with detectable virus were more likely than those without detectable virus to have evidence of lymphadenopathy (14 of 16 vs.1 of 5; P = 0.011), higher mean atypical (11.7 vs.0.9%; P = 0.002) and absolute atypical (1.5 vs.0.1 x 109/l; P = 0.004) lymphocyte count, higher mean absolute lymphocyte count (4.7 vs.2.3 x 109/l; P = 0.026) and higher mean aspartate aminotransferase value (119.8 vs.37.3 IU/l; P = 0.036). Ten patients, all in the primary infection group, had EBV infectious mononucleosis, and all
Development of real-time PCR for detection and quantitation of Streptococcus parauberis.
Nguyen, T L; Lim, Y J; Kim, D-H; Austin, B
2016-01-01
Streptococcus parauberis is an increasing threat to aquaculture of olive flounder, Paralichthys olivaceus Temminck & Schlegel, in South Korea. We developed a real-time polymerase chain reaction (PCR) method using the TaqMan probe assay to detect and quantify S. parauberis by targeting the gyrB gene sequences, which are effective for molecular analysis of the genus Streptococcus. Our real-time PCR assay is capable of detecting 10 fg of genomic DNA per reaction. The intra- and interassay coefficient of variation (CV) values ranged from 0.42-1.95%, demonstrating that the assay has good reproducibility. There was not any cross-reactivity to Streptococcus iniae or to other streptococcal/lactococcal fish pathogens, such as S. agalactiae and Lactococcus garvieae, indicating that the assay is highly specific to S. parauberis. The results of the real-time PCR assay corresponded well to those of conventional culture assays for S. parauberis from inoculated tissue homogenates (r = 0.957; P < 0.05). Hence, this sensitive and specific real-time PCR is a valuable tool for diagnostic quantitation of S. parauberis in clinical samples. © 2014 John Wiley & Sons Ltd.
Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun
2014-09-01
The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.
Piller, Nicolas; Decosterd, Isabelle; Suter, Marc R
2013-07-10
The reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a widely used, highly sensitive laboratory technique to rapidly and easily detect, identify and quantify gene expression. Reliable RT-qPCR data necessitates accurate normalization with validated control genes (reference genes) whose expression is constant in all studied conditions. This stability has to be demonstrated.We performed a literature search for studies using quantitative or semi-quantitative PCR in the rat spared nerve injury (SNI) model of neuropathic pain to verify whether any reference genes had previously been validated. We then analyzed the stability over time of 7 commonly used reference genes in the nervous system - specifically in the spinal cord dorsal horn and the dorsal root ganglion (DRG). These were: Actin beta (Actb), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal proteins 18S (18S), L13a (RPL13a) and L29 (RPL29), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and hydroxymethylbilane synthase (HMBS). We compared the candidate genes and established a stability ranking using the geNorm algorithm. Finally, we assessed the number of reference genes necessary for accurate normalization in this neuropathic pain model. We found GAPDH, HMBS, Actb, HPRT1 and 18S cited as reference genes in literature on studies using the SNI model. Only HPRT1 and 18S had been once previously demonstrated as stable in RT-qPCR arrays. All the genes tested in this study, using the geNorm algorithm, presented gene stability values (M-value) acceptable enough for them to qualify as potential reference genes in both DRG and spinal cord. Using the coefficient of variation, 18S failed the 50% cut-off with a value of 61% in the DRG. The two most stable genes in the dorsal horn were RPL29 and RPL13a; in the DRG they were HPRT1 and Actb. Using a 0.15 cut-off for pairwise variations we found that any pair of stable reference gene was sufficient for the normalization process
Qin, Xiao-ying; Li, Guo-xuan; Qin, Ya-zhen; Wang, Yu; Wang, Feng-rong; Liu, Dai-hong; Xu, Lan-ping; Chen, Huan; Han, Wei; Wang, Jing-zhi; Zhang, Xiao-hui; Li, Jin-lan; Li, Ling-di; Liu, Kai-yan; Huang, Xiao-jun
2011-08-01
Analysis of changes in recipient and donor hematopoietic cell origin is extremely useful to monitor the effect of hematopoietic stem cell transplantation (HSCT) and sequential adoptive immunotherapy by donor lymphocyte infusions. We developed a sensitive, reliable and rapid real-time PCR method based on sequence polymorphism systems to quantitatively assess the hematopoietic chimerism after HSCT. A panel of 29 selected sequence polymorphism (SP) markers was screened by real-time PCR in 101 HSCT patients with leukemia and other hematological diseases. The chimerism kinetics of bone marrow samples of 8 HSCT patients in remission and relapse situations were followed longitudinally. Recipient genotype discrimination was possible in 97.0% (98 of 101) with a mean number of 2.5 (1-7) informative markers per recipient/donor pair. Using serial dilutions of plasmids containing specific SP markers, the linear correlation (r) of 0.99, the slope between -3.2 and -3.7 and the sensitivity of 0.1% were proved reproducible. By this method, it was possible to very accurately detect autologous signals in the range from 0.1% to 30%. The accuracy of the method in the very important range of autologous signals below 5% was extraordinarily high (standard deviation <1.85%), which might significantly improve detection accuracy of changes in autologous signals early in the post-transplantation course of follow-up. The main advantage of the real-time PCR method over short tandem repeat PCR chimerism assays is the absence of PCR competition and plateau biases, with demonstrated greater sensitivity and linearity. Finally, we prospectively analyzed bone marrow samples of 8 patients who received allografts and presented the chimerism kinetics of remission and relapse situations that illustrated the sensitivity level and the promising clinical application of this method. This SP-based real-time PCR assay provides a rapid, sensitive, and accurate quantitative assessment of mixed chimerism that can
Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui
2016-05-01
In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.
Bridge, Julia A
2017-01-01
The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.
Sabrina, Rabehi; Mossadak, Hamdi Taha; Bakir, Mamache; Asma, Meghezzi; Khaoula, Boushaba
2018-01-01
Aim: The aim of this study was to detect Brucella spp. DNA in milk samples collected from seronegative cows using the real-time polymerase chain reaction (PCR) assay for diagnosis of brucellosis in seronegative dairy cows to prevent transmission of disease to humans and to reduce economic losses in animal production. Materials and Methods: In this study, 65 milk samples were investigated for the detection of Brucella spp. The detection of the IS711 gene in all samples was done by real-time PCR assay by comparative cycle threshold method. Results: The results show that of the 65 DNA samples tested, 2 (3.08%) were positive for Brucella infection. The mean cyclic threshold values of IS711 real-time PCR test were 37.97 and 40.48, indicating a positive reaction. Conclusion: The results of the present study indicated that the real-time PCR appears to offer several advantages over serological tests. For this reason, the real-time PCR should be validated on representative numbers of Brucella-infected and free samples before being implemented in routine diagnosis in human and animal brucellosis for controlling this disease. PMID:29657430
Oddoux, O; Debourgogne, A; Kantele, A; Kocken, C H; Jokiranta, T S; Vedy, S; Puyhardy, J M; Machouart, M
2011-04-01
Recently, Plasmodium knowlesi has been recognised as the fifth Plasmodium species causing malaria in humans. Hundreds of human cases infected with this originally simian Plasmodium species have been described in Asian countries and increasing numbers are reported in Europe from travellers. The growing impact of tourism and economic development in South and Southeast Asia are expected to subsequently lead to a further increase in cases both among locals and among travellers. P. knowlesi is easily misidentified in microscopy as P. malariae or P. falciparum. We developed new primers for the rapid and specific detection of this species by low-cost real-time polymerase chain reaction (PCR) and added this method to an already existing panel of primers used for the molecular identification of the other four species in one reaction. Reference laboratories should now be able to identify undisputably and rapidly P. knowlesi, as it is a potentially fatal pathogen.
Wang, Yuexia; Yang, Ming; Liu, Shuchun; Chen, Wanyi; Suo, Biao
2015-09-01
Real-time polymerase chain reaction (PCR) allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at -18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA) was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 10 3 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 10 0 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach. Copyright © 2015. Published by Elsevier B.V.
Marois-Créhan, Corinne; Lacouture, Sonia; Jacques, Mario; Fittipaldi, Nahuel; Kobisch, Marylène; Gottschalk, Marcelo
2014-01-01
Two real-time, or quantitative, polymerase chain reaction (qPCR) assays were developed to detect Actinobacillus pleuropneumoniae serovars 1-9-11 (highly related serovars with similar virulence potential) and serovar 2, respectively. The specificity of these assays was verified on a collection of 294 strains, which included all 16 reference A. pleuropneumoniae strains (including serovars 5a and 5b), 263 A. pleuropneumoniae field strains isolated between 1992 and 2009 in different countries, and 15 bacterial strains other than A. pleuropneumoniae. The detection levels of both qPCR tests were evaluated using 10-fold dilutions of chromosomal DNA from reference strains of A. pleuropneumoniae serovars 1 and 2, and the detection limit for both assays was 50 fg per assay. The analytical sensitivities of the qPCR tests were also estimated by using pure cultures and tonsils experimentally spiked with A. pleuropneumoniae. The detection threshold was 2.5 × 10(4) colony forming units (CFU)/ml and 2.9 × 10(5) CFU/0.1 g of tonsil, respectively, for both assays. These specific and sensitive tests can be used for the serotyping of A. pleuropneumoniae in diagnostic laboratories to control porcine pleuropneumonia.
Dreier, Jens; Störmer, Melanie; Kleesiek, Knut
2007-07-01
Bacterial contamination of blood components, particularly of platelet concentrates (PCs), represents the greatest infectious risk in blood transfusion. Although the incidence of platelet bacterial contamination is approximately 1 per 2,000 U, the urgent need for a method for the routine screening of PCs to improve safety for patients had not been considered for a long time. Besides the culturing systems, which will remain the criterion standard, rapid methods for sterility screening will play a more important role in transfusion medicine in the future. In particular, nucleic acid amplification techniques (NATs) are powerful potential tools for bacterial screening assays. The combination of excellent sensitivity and specificity, reduced contamination risk, ease of performance, and speed has made real-time polymerase chain reaction (PCR) technology an appealing alternative to conventional culture-based testing methods. When using real-time PCR for the detection of bacterial contamination, several points have to be considered. The main focus is the choice of the target gene; the assay format; the nucleic acid extraction method, depending on the sample type; and the evaluation of an ideal sampling strategy. However, several factors such as the availability of bacterial-derived nucleic acid amplification reagents, the impracticability, and the cost have limited the use of NATs until now. Attempts to reduce the presence of contaminating nucleic acids from reagents in real-time PCR have been described, but none of these approaches have proven to be very effective or to lower the sensitivity of the assay. Recently, a number of broad-range NAT assays targeting the 16S ribosomal DNA or 23S ribosomal RNA for the detection of bacteria based on real-time technology have been reported. This review will give a short survey of current approaches to and the limitations of the application of real-time PCR for bacterial detection in blood components, with emphasis on the bacterial
Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...
Garg, Pankaj
2017-07-01
Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.
McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y
2014-04-01
A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.
Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn
2013-06-01
A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.
Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh
2016-11-01
Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016
Peeters, M.; Huang, C. L.; Vonk, L. A.; Lu, Z. F.; Bank, R. A.; Doulabi, B. Zandieh
2016-01-01
Objectives Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Materials and Methods Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. Results No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. Conclusion For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised. Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time
de Cremoux, P; Bieche, I; Tran-Perennou, C; Vignaud, S; Boudou, E; Asselain, B; Lidereau, R; Magdelénat, H; Becette, V; Sigal-Zafrani, B; Spyratos, F
2004-09-01
Quantitative reverse transcription-polymerase chain reaction (RT-PCR) used to detect minor changes in specific mRNA concentrations may be associated with poor reproducibility. Stringent quality control is therefore essential at each step of the protocol, including the PCR procedure. We performed inter-laboratory quality control of quantitative PCR between two independent laboratories, using in-house RT-PCR assays on a series of hormone-related target genes in a retrospective consecutive series of 79 breast tumors. Total RNA was reverse transcribed in a single center. Calibration curves were performed for five target genes (estrogen receptor (ER)alpha, ERbeta, progesterone receptor (PR), CYP19 (aromatase) and Ki 67) and for two reference genes (human acidic ribosomal phosphoprotein PO (RPLPO) and TATA box-binding protein (TBP)). Amplification efficiencies of the calibrator were determined for each run and used to calculate mRNA expression. Correlation coefficients were evaluated for each target and each reference gene. A good correlation was observed for all target and reference genes in both centers using their own protocols and kits (P < 0.0001). The correlation coefficients ranged from 0.90 to 0.98 for the various target genes in the two centers. A good correlation was observed between the level of expression of the ERalpha and the PR transcripts (P < 0.001). A weak inverse correlation was observed in both centers between ERalpha and ERbeta levels, but only when TBP was the reference gene. No other correlation was observed with other parameters. Real-time PCR assays allow convenient quantification of target mRNA transcripts and quantification of target-derived nucleic acids in clinical specimens. This study addresses the importance of inter-laboratory quality controls for the use of a panel of real-time PCR assays devoted to clinical samples and protocols and to ensure their appropriate accuracy. This can also facilitate exchanges and multicenter comparison of
Segat, Ludovica; Padovan, Lara; Doc, Darja; Petix, Vincenzo; Morgutti, Marcello; Crovella, Sergio; Ricci, Giuseppe
2012-12-01
We describe a real-time polymerase chain reaction (PCR) protocol based on the fluorescent molecule SYBR Green chemistry, for a low- to medium-throughput analysis of Y-chromosome microdeletions, optimized according to the European guidelines and aimed at making the protocol faster, avoiding post-PCR processing, and simplifying the results interpretation. We screened 156 men from the Assisted Reproduction Unit, Department of Obstetrics and Gynecology, Institute for Maternal and Child Health IRCCS Burlo Garofolo (Trieste, Italy), 150 not presenting Y-chromosome microdeletion, and 6 with microdeletions in different azoospermic factor (AZF) regions. For each sample, the Zinc finger Y-chromosomal protein (ZFY), sex-determining region Y (SRY), sY84, sY86, sY127, sY134, sY254, and sY255 loci were analyzed by performing one reaction for each locus. AZF microdeletions were successfully detected in six individuals, confirming the results obtained with commercial kits. Our real-time PCR protocol proved to be a rapid, safe, and relatively cheap method that was suitable for a low- to medium-throughput diagnosis of Y-chromosome microdeletion, which allows an analysis of approximately 10 samples (with the addition of positive and negative controls) in a 96-well plate format, or approximately 46 samples in a 384-well plate for all markers simultaneously, in less than 2 h without the need of post-PCR manipulation.
Detection of KIT Genotype in Pigs by TaqMan MGB Real-Time Quantitative Polymerase Chain Reaction.
Li, Xiuxiu; Li, Xiaoning; Luo, Rongrong; Wang, Wenwen; Wang, Tao; Tang, Hui
2018-05-01
The dominant white phenotype in domestic pigs is caused by two mutations in the KIT gene: a 450 kb duplication containing the entire KIT gene together with flanking sequences and one splice mutation with a G:A substitution in intron 17. The purpose of this study was to establish a simple, rapid method to determine KIT genotype in pigs. First, to detect KIT copy number variation (CNV), primers for exon 2 of the KIT gene, along with a TaqMan minor groove binder (MGB) probe, were designed. The single-copy gene, estrogen receptor (ESR), was used as an internal control. A real-time fluorescence-based quantitative PCR (FQ-PCR) protocol was developed to accurately detect KIT CNVs. Second, to detect the splice mutation ratio of the G:A substitution in intron 17, a 175 bp region, including the target mutation, was amplified from genomic DNA. Based on the sequence of the resulting amplified fragment, an MGB probe set was designed to detect the ratio of splice mutation to normal using FQ-PCR. A series of parallel amplification curves with the same internal distances were obtained using gradually diluted DNA as templates. The CT values among dilutions were significantly different (p < 0.001) and the coefficients of variation from each dilution were low (from 0.13% to 0.26%). The amplification efficiencies for KIT and ESR were approximately equal, indicating ESR was an appropriate control gene. Furthermore, use of the MGB probe set resulted in detection of the target mutation at a high resolution and stability; standard curves illustrated that the amplification efficiencies of KIT1 (G) and KIT2 (A) were approximately equal (98.8% and 97.2%). In conclusion, a simple, rapid method, with high specificity and stability, for the detection of the KIT genotype in pigs was established using TaqMan MGB probe real-time quantitative PCR.
McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.
2014-01-01
A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178
Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi
2013-01-01
A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.
Liu, Shasha; Xu, Kunhua; Wu, Zhigang; Xie, Xiao; Feng, Junli
2016-09-01
Tunas are economically important fishery worldwide, and are often used for commercial processed production. For effective fishery management and protection of consumers' rights, it is important to develop a molecular method to identify species in canned tuna products rapidly and reliably. Here, we have developed a duplex quantitative real-time PCR (qPCR) for identification of five highly priced tuna species (Thunnus maccoyii, Thunnus obesus, Thunnus albacares, Thunnus alalunga and Katsuwonus pelamis) from processed as well as fresh fish. After amplification and sequencing of seven genetic markers commonly used for species identification, 16S rDNA and control region (CR) of mitochondrial DNA were selected as the reference gene markers for genus Thunnus and tuna species identification, respectively. Subsequently, a 73 bp fragment of 16S rDNA and 85-99 bp fragment of CR were simultaneously amplified from each target species by qPCR. The qPCR efficiency of each reaction was calculated according to the standard curves, and the method was validated by amplification DNA extracted from single or mixed tuna specimen. The developed duplex qPCR system was applied to authenticate species of 14 commercial tuna products successfully, which demonstrated it was really a useful and academic technique to identify highly priced tuna species.
Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-07-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve
2016-01-01
The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus
Doi, Hideyuki; Takahara, Teruhiko; Minamoto, Toshifumi; Matsuhashi, Saeko; Uchii, Kimiko; Yamanaka, Hiroki
2015-05-05
Environmental DNA (eDNA) has been used to investigate species distributions in aquatic ecosystems. Most of these studies use real-time polymerase chain reaction (PCR) to detect eDNA in water; however, PCR amplification is often inhibited by the presence of organic and inorganic matter. In droplet digital PCR (ddPCR), the sample is partitioned into thousands of nanoliter droplets, and PCR inhibition may be reduced by the detection of the end-point of PCR amplification in each droplet, independent of the amplification efficiency. In addition, real-time PCR reagents can affect PCR amplification and consequently alter detection rates. We compared the effectiveness of ddPCR and real-time PCR using two different PCR reagents for the detection of the eDNA from invasive bluegill sunfish, Lepomis macrochirus, in ponds. We found that ddPCR had higher detection rates of bluegill eDNA in pond water than real-time PCR with either of the PCR reagents, especially at low DNA concentrations. Limits of DNA detection, which were tested by spiking the bluegill DNA to DNA extracts from the ponds containing natural inhibitors, found that ddPCR had higher detection rate than real-time PCR. Our results suggest that ddPCR is more resistant to the presence of PCR inhibitors in field samples than real-time PCR. Thus, ddPCR outperforms real-time PCR methods for detecting eDNA to document species distributions in natural habitats, especially in habitats with high concentrations of PCR inhibitors.
Kristof, Jessica; Sakrison, Kellen; Jin, Xiaoping; Nakamaru, Kenji; Schneider, Matthias; Beckman, Robert A; Freeman, Daniel; Spittle, Cindy; Feng, Wenqin
2017-01-01
In preclinical studies, heregulin ( HRG ) expression was shown to be the most relevant predictive biomarker for response to patritumab, a fully human anti-epidermal growth factor receptor 3 monoclonal antibody. In support of a phase 2 study of erlotinib ± patritumab in non-small cell lung cancer (NSCLC), a reverse-transcription quantitative polymerase chain reaction (RT-qPCR) assay for relative quantification of HRG expression from formalin-fixed paraffin-embedded (FFPE) NSCLC tissue samples was developed and validated and described herein. Test specimens included matched FFPE normal lung and NSCLC and frozen NSCLC tissue, and HRG -positive and HRG -negative cell lines. Formalin-fixed paraffin-embedded tissue was examined for functional performance. Heregulin distribution was also analyzed across 200 NSCLC commercial samples. Applied Biosystems TaqMan Gene Expression Assays were run on the Bio-Rad CFX96 real-time PCR platform. Heregulin RT-qPCR assay specificity, PCR efficiency, PCR linearity, and reproducibility were demonstrated. The final assay parameters included the Qiagen FFPE RNA Extraction Kit for RNA extraction from FFPE NSCLC tissue, 50 ng of RNA input, and 3 reference (housekeeping) genes ( HMBS, IPO8 , and EIF2B1 ), which had expression levels similar to HRG expression levels and were stable among FFPE NSCLC samples. Using the validated assay, unimodal HRG distribution was confirmed across 185 evaluable FFPE NSCLC commercial samples. Feasibility of an RT-qPCR assay for the quantification of HRG expression in FFPE NSCLC specimens was demonstrated.
Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M
2014-12-10
A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.
Trombley, Adrienne R.; Wachter, Leslie; Garrison, Jeffrey; Buckley-Beason, Valerie A.; Jahrling, Jordan; Hensley, Lisa E.; Schoepp, Randal J.; Norwood, David A.; Goba, Augustine; Fair, Joseph N.; Kulesh, David A.
2010-01-01
Viral hemorrhagic fever is caused by a diverse group of single-stranded, negative-sense or positive-sense RNA viruses belonging to the families Filoviridae (Ebola and Marburg), Arenaviridae (Lassa, Junin, Machupo, Sabia, and Guanarito), and Bunyaviridae (hantavirus). Disease characteristics in these families mark each with the potential to be used as a biological threat agent. Because other diseases have similar clinical symptoms, specific laboratory diagnostic tests are necessary to provide the differential diagnosis during outbreaks and for instituting acceptable quarantine procedures. We designed 48 TaqMan™-based polymerase chain reaction (PCR) assays for specific and absolute quantitative detection of multiple hemorrhagic fever viruses. Forty-six assays were determined to be virus-specific, and two were designated as pan assays for Marburg virus. The limit of detection for the assays ranged from 10 to 0.001 plaque-forming units (PFU)/PCR. Although these real-time hemorrhagic fever virus assays are qualitative (presence of target), they are also quantitative (measure a single DNA/RNA target sequence in an unknown sample and express the final results as an absolute value (e.g., viral load, PFUs, or copies/mL) on the basis of concentration of standard samples and can be used in viral load, vaccine, and antiviral drug studies. PMID:20439981
USDA-ARS?s Scientific Manuscript database
Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...
Noviyanti, Fia; Hosotani, Yukie; Koseki, Shigenobu; Inatsu, Yasuhiro; Kawasaki, Susumu
2018-04-02
The goals of this study were to monitor the growth kinetics of Salmonella Enteritidis in chicken juice using real-time polymerase chain reaction (PCR) and to evaluate its efficacy by comparing the results with an experimental database. Salmonella Enteritidis was inoculated in chicken juice samples at an initial inoculum of 10 4 CFU/mL with inoculated samples incubated at six different temperatures (10, 15, 20, 25, 30, and 35°C). Sampling was carried out for 36 h to observe the growth of Salmonella Enteritidis. The total DNA was extracted from the samples, and the copy number of the Salmonella invasion gene (invA) was quantified by real-time PCR and converted to Salmonella Enteritidis cell concentration. Growth kinetics data were analyzed by the Baranyi and Roberts model to obtain growth parameters, whereas the Ratkowsky's square-root model was used to describe the effect of the interactions between growth parameters and temperature on the growth of Salmonella Enteritidis. The growth parameters of Salmonella Enteritidis obtained from an experiment conducted at a constant temperature were validated with growth data from chicken juice samples that were incubated under fluctuating temperature conditions between 5°C and 30°C for 30-min periods. A high correlation was observed between maximum growth rate (μ max ) and storage temperature, indicating that the real-time PCR-monitoring method provides a precise estimation of Salmonella Enteritidis growth in food material with a microbial flora. Moreover, the μ max data reflected data from microbial responses viewer database and ComBase. The results of this study suggested that real-time PCR monitoring provides a precise estimation of Salmonella Enteritidis growth in food materials with a background microbial flora.
Lakshmi, I Karthika; Putty, Kalyani; Raut, Satya Samparna; Patil, Sunil R; Rao, P P; Bhagyalakshmi, B; Jyothi, Y Krishna; Susmitha, B; Reddy, Y Vishnuvardhan; Kasulanati, Sowmya; Jyothi, J Shiva; Reddy, Y N
2018-04-01
The present study was designed to standardize real-time polymerase chain reaction (PCR) for detecting the bluetongue virus from blood samples of sheep collected during outbreaks of bluetongue disease in the year 2014 in Andhra Pradesh and Telangana states of India. A 10-fold serial dilution of Plasmid PUC59 with bluetongue virus (BTV) NS3 insert was used to plot the standard curve. BHK-21 and KC cells were used for in vitro propagation of virus BTV-9 at a TCID50/ml of 10 5 ml and RNA was isolated by the Trizol method. Both reverse transcription-PCR and real-time PCR using TaqMan probe were carried out with RNA extracted from virus-spiked culture medium and blood to compare the sensitivity by means of finding out the limit of detection (LoD). The results were verified by inoculating the detected and undetected dilutions onto cell cultures with further cytological (cytopathic effect) and molecular confirmation (by BTV-NS1 group-specific PCR). The standardized technique was then applied to field samples (blood) for detecting BTV. The slope of the standard curve obtained was -3.23, and the efficiency was 103%. The LoD with RT-PCR was 8.269E×10 3 number of copies of plasmid, whereas it was 13 with real-time PCR for plasmid dilutions. Similarly, LoD was determined for virus-spiked culture medium, and blood with both the types of PCR and the values were 10 3 TCID 50/ml and 10 4 TCID 50/ml with RT-PCR and 10° TCID 50/ml and 10 2 TCID 50/ml with real-time PCR, respectively. The standardized technique was applied to blood samples collected from BTV suspected animals; 10 among 20 samples were found positive with Cq values ranging from 27 to 39. The Cq value exhibiting samples were further processed in cell cultures and were confirmed to be BT positive. Likewise, Cq undetected samples on processing in cell cultures turned out to be BTV negative. Real-time PCR was found to be a very sensitive as well as reliable method to detect BTV present in different types of samples
Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo
2011-01-03
In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.
Development of a real-time quantitative PCR assay to enumerate Yersinia pestis in fleas.
Gabitzsch, Elizabeth S; Vera-Tudela, Rommelle; Eisen, Rebecca J; Bearden, Scott W; Gage, Kenneth L; Zeidner, Nordin S
2008-07-01
A real-time quantitative polymerase chain reaction (qPCR) assay was developed for Yersina pestis. The qPCR assay was developed utilizing a conserved region of the Y. pestis ferric iron uptake regulator gene (fur) to design primers and a fluorescent (FAM-labeled) TaqMan probe. The assay was optimized using cultured Y. pestis (UG05-0454) and was confirmed to work with strains from 3 Y. pestis biovars. The optimized assay was capable of detecting a single organism of cultured Y. pestis and as little as 300 bacteria in infected flea triturates. This qPCR assay enables rapid enumeration of Y. pestis bacterium in laboratory-infected fleas when compared with conventional serial dilution plating.
Quantification of Wilms' tumor 1 mRNA by digital polymerase chain reaction.
Koizumi, Yuki; Furuya, Daisuke; Endo, Teruo; Asanuma, Kouichi; Yanagihara, Nozomi; Takahashi, Satoshi
2018-02-01
Wilms' tumor 1 (WT1) is overexpressed in various hematopoietic tumors and widely used as a marker of minimal residual disease. WT1 mRNA has been analyzed using quantitative real-time polymerase chain reaction (real-time PCR). In the present study, we analyzed 40 peripheral blood and bone marrow samples obtained from cases of acute myeloid leukemia, acute lymphoblastic leukemia, and myelodysplastic syndrome at Sapporo Medical University Hospital from April 2012 to January 2015. We performed quantification of WT1 was performed using QuantStudio 3D Digital PCR System (Thermo Fisher Scientific) and compared the results between digital PCR and real-time PCR technology. The correlation between digital PCR and real-time PCR was very strong (R = 0.99), and the detection limits of the two methods were equivalent. Digital PCR was able to accurately detect lower WT levels compared with real-time PCR. Digital PCR technology can thus be utilized to predict WT1/ABL1 expression level accurately and should thus be useful for diagnosis or the evaluation of drug efficiency in patients with leukemia.
Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H
2015-11-01
Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.
Principles and applications of polymerase chain reaction in medical diagnostic fields: a review
Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio
2009-01-01
Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310
USDA-ARS?s Scientific Manuscript database
The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...
Real-Time PCR (qPCR) Primer Design Using Free Online Software
ERIC Educational Resources Information Center
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…
BK virus DNA detection by real-time polymerase chain reaction in clinical specimens.
Marchetti, Simona; Graffeo, Rosalia; Siddu, Alessia; Santangelo, Rosaria; Ciotti, Marco; Picardi, Alessandra; Favalli, Cartesio; Fadda, Giovanni; Cattani, Paola
2007-04-01
The BK polyomavirus (BKV) is widespread in the general population. In transplant recipients, the patients' weakened immune response may encourage reactivation of latent infection, leading to BKV-related diseases. Rapid and quantitative detection might help to delineate viral reactivation patterns and could thus play an important role in their clinical management. In our study we developed an "in-house" quantitative real-time PCR to detect BKV DNA. The effectiveness of this assay was evaluated by a retrospective analysis of 118 plasma specimens from 22 bone marrow transplant (BMT) recipients and 107 samples from immunocompetent subjects. Eight (36.3%) of the 22 bone marrow transplant recipients tested positive for BKV. The viral load varied from specimen to specimen (10 to 10(5) copies/ml). BKV related disease like hemorrhagic cystitis (HC) was diagnosed in three patients. Specimens from the control group all tested negative. Our results showed the high sensitivity of the real-time PCR, allowing accurate and reproducible measuring of the viral load in order to identify patients at risk for BKV-related diseases. With due caution in interpreting threshold values, the real-time PCR could provide a rapid, sensitive and specific tool for detecting BKV and distinguishing latent and active infection.
Spackman, Erica; Suarez, David L
2005-01-01
Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.
Wu, Daxian; Tao, Shuhui; Liu, Shuiping; Zhou, Jiebin; Tan, Deming; Hou, Zhouhua
2017-07-28
To observe the sensitivity of transcription mediated amplification (TMA), and to compare its performance with real-time reverse transcription polymerase chain reaction (real-time RT-PCR) in detecting human immunodeficiency virus RNA (HIV RNA). Methods: TMA system was established with TaqMan probes, specific primers, moloney murine leukemia virus (MMLV) reverse transcriptase, T7 RNA polymerase, and reaction substrates. The sensitivity of TMA was evaluated by amplifying a group of 10-fold diluted HIV RNA standards which were transcribed in vitro. A total of 60 plasma of HIV infected patients were measured by TMA and Cobas Amplicor HIV-1 Monitor test to observe the positive rate. The correlation and concordance of the above two technologies were investigated by linear regression and Bland-Altman analysis. Results: TMA system was established successfully and HIV RNA transcribed standards at concentration of equal or more than 10 copies/mL could be detected by TMA technology. Among 60 samples of plasma from HIV infected patients, 46 were positively detected and 12 were negatively amplified by both TMA and Cobas reagents; 2 samples were positively tested by Cobas reagent but negatively tested by TMA system. The concordance rate of the two methods was 97.1% and the difference of positive detection rate between the two methods was not statistically significant (P>0.05). Linear regression was used for 46 samples which were positively detected by both TMA and Cobas reagents and showed an excellent correlation between the two reagents (r=0.997, P<0.001). Bland-Altma analysis revealed that the mean different value of HIV RNA levels for denary logarithm was 0.02. Forty-four samples were included in 95% of credibility interval of concordance. Conclusion: TMA system has the potential of high sensitivity. TMA and real-time RT-PCR keep an excellent correlation and consistency in detecting HIV RNA.
Reina, J; Weber, I; Riera, E; Busquets, M; Morales, C
2014-05-01
Cytomegalovirus (CMV) is the main virus causing congenital and postnatal infections in the pediatric population. The aim of this study is to evaluate the usefulness of a quantitative real-time PCR in the diagnosis of these infections using urine as a single sample. We studied all the urine samples of newborns (< 7 days) with suspected congenital infection, and urine of patients with suspected postnatal infection (urine negative at birth). Urines were simultaneously studied by cell culture, qualitative PCR (PCRc), and quantitative real-time PCR (PCRq). We analyzed 332 urine samples (270 to rule out congenital infection and 62 postnatal infections). Of the first, 22 were positive in the PCRq, 19 in the PCRc, and 17 in the culture. PCRq had a sensitivity of 100%, on comparing the culture with the rest of the techniques. Using the PCRq as a reference method, culture had a sensitivity of 77.2%, and PCRc 86.3%. In cases of postnatal infection, PCRq detected 16 positive urines, the PCRq 12, and the cell culture 10. The urines showed viral loads ranging from 2,178 to 116,641 copies/ml. The genomic amplification technique PCRq in real time was more sensitive than the other techniques evaluated. This technique should be considered as a reference (gold standard), leaving the cell culture as a second diagnostic level. The low cost and the automation of PCRq would enable the screening for CMV infection in large neonatal and postnatal populations. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.
Wang, Fengjun; Feng, Junli; Ye, Sudan; Li, Xin; Huang, Hannian; Hua, Peng
2018-04-01
Cydia pomonella, Euzophera pyriella Yang, and Grapholitha molesta are destructive pest species of Korla fragrant pears in Xinjiang. They are also quarantine pests of concern in a number of countries. Identification of these small pest larvae by morphological characters is difficult, and misidentifications will influence appropriate quarantine decisions. Here, a 520 bp fragment of mitochondrial cytochrome oxidase subunit I (COI) was first amplified and sequenced from each species, and a diagnostic region was observed. Subsequently, the species-specific primer and probe sets of quantitative real-time PCR (qPCR) were designed, which amplified a 114-116 bp fragment of COI genes. This method was validated by amplification DNA extracted from single, multiple, and mixed pest samples. Results indicated that this method allows rapid discrimination and reliable identification of larvae, pupae, and adult specimens of all three species, which could help the international export trading of Korla fragrant pears and related products.
Rollín, R; Alvarez-Lafuente, R; Marco, F; Jover, J A; Hernández-García, C; Rodríguez-Navas, C; López-Durán, L; Fernández-Gutiérrez, B
2007-04-01
To investigate whether there is a possible viral transmission using mesenchymal stem cells (MSCs) in autologous or allogeneic transplantation in the context of osteoarthritis (OA) patients. The presence of parvovirus B19 (B19), varicella zoster virus (VZV), and human herpesvirus-6 (HHV-6) was studied in MSCs from bone marrow of patients with OA and healthy controls. MSCs were prepared from bone marrow aspirates obtained from 18 patients undergoing joint replacement as a result of OA and from 10 healthy controls. DNA was extracted from primary MSCs' culture established from these cells and quantitative real-time polymerase chain reaction was performed to analyse the prevalence and viral load of B19, VZV and HHV-6. The prevalence of total viral DNA among patients with OA was 16.7% (3/18), with a mean viral load of 29.7 copies/microg of DNA. One out of 18 was positive for B19 (viral load, 61.2 copies/microg of DNA), two for VZV (mean viral load, 14.4 copies/microg of DNA), and none for HHV-6. The prevalence of total viral DNA in the control group was 20% (2/10), with a mean viral load of 13.4 copies/microg of DNA. Both positive results were of B19 parvoviruses. There were no statistically significant differences among patients and controls. This first approach to the viral prevalence in MSCs of bone marrow in OA patients and healthy controls seems to show a very low risk of viral transmission or reactivation in a possible MSCs' transplantation.
Nadin-Davis, Susan; Knowles, Margaret K; Burke, Teresa; Böse, Reinhard; Devenish, John
2015-07-01
A quantitative real-time polymerase chain reaction method (qPCR) was developed and tested for the detection of Taylorella equigenitalis. It was shown to have an analytical sensitivity of 5 colony-forming units (CFU) of T. equigenitalis when applied to the testing of culture swabs that mimicked field samples, and a high analytical specificity in not reacting to 8 other commensal bacterial species associated with horses. As designed, it could also differentiate specifically between T. equigenitalis and T. asinigenitalis. The qPCR was compared to standard culture in a study that included 45 swab samples from 6 horses (1 stallion, 5 mares) naturally infected with T. equigenitalis in Canada, 39 swab samples from 5 naturally infected stallions in Germany, and 311 swab samples from 87 culture negative horses in Canada. When the comparison was conducted on an individual sample swab basis, the qPCR had a statistical sensitivity and specificity of 100% and 96.4%, respectively, and 100% and 99.1% when the comparison was conducted on a sample set basis. A comparison was also made on 203 sample swabs from the 5 German stallions taken over a span of 4 to 9 mo following antibiotic treatment. The qPCR was found to be highly sensitive and at least as good as culture in detecting the presence of T. equigenitalis in post-treatment samples. The work demonstrates that the qPCR assay described here can potentially be used to detect the presence of T. equigenitalis directly from submitted sample swabs taken from infected horses and also for determining T. equigenitalis freedom following treatment.
Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy
2004-01-01
In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement
2005-01-01
Abstract The distribution of the immune complex vaccine virus for infectious bursal disease (IBD) in tissue was examined and the viral loads of the organs were quantitatively compared. One-day-old specific pathogen free (SPF) and maternally immune broiler chickens were injected subcutaneously with the vaccine. Lymphoid and non-lymphoid tissues were collected at various time intervals during the experiment to test for infectious bursal disease virus (IBDV)-RNA by using reverse transcriptase-polymerase chain reaction (RT-PCR). Only the bursa of Fabricius was found to be positive with unusually long viral persistence in the broiler group. The positive bursa samples were further investigated by using real-time PCR coupled with a TaqMan probe. The highest amounts of the virus were detected at its first appearance in the bursa: on day 14 post vaccination (PV) in the SPF chickens and on day 17 and day 21 PV in the maternally immune broiler group. The virus then gradually cleared, most likely due to the parallel appearance of the active immune response indicated by seroconversion. PMID:15971678
Stuart, James Ian; Delport, Johan; Lannigan, Robert; Zahariadis, George
2014-07-01
Disease monitoring of viruses using real-time polymerase chain reaction (PCR) requires knowledge of the precision of the test to determine what constitutes a significant change. Calculation of quantitative PCR confidence limits requires bivariate statistical methods. To develop a simple-to-use graphical user interface to determine the uncertainty of measurement (UOM) of BK virus, cytomegalovirus (CMV) and Epstein-Barr virus (EBV) real-time PCR assays. Thirty positive clinical samples for each of the three viral assays were repeated once. A graphical user interface was developed using a spreadsheet (Excel, Microsoft Corporation, USA) to enable data entry and calculation of the UOM (according to Fieller's theorem) and PCR efficiency. The confidence limits for the BK virus, CMV and EBV tests were ∼0.5 log, 0.5 log to 1.0 log, and 0.5 log to 1.0 log, respectively. The efficiencies of these assays, in the same order were 105%, 119% and 90%. The confidence limits remained stable over the linear range of all three tests. A >5 fold (0.7 log) and a >3-fold (0.5 log) change in viral load were significant for CMV and EBV when the results were ≤1000 copies/mL and >1000 copies/mL, respectively. A >3-fold (0.5 log) change in viral load was significant for BK virus over its entire linear range. PCR efficiency was ideal for BK virus and EBV but not CMV. Standardized international reference materials and shared reporting of UOM among laboratories are required for the development of treatment guidelines for BK virus, CMV and EBV in the context of changes in viral load.
Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio
2017-05-01
Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.
Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio
2017-01-01
BACKGROUND Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. OBJECTIVES The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. METHODS The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. FINDINGS We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses. PMID:28403327
Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung
2012-08-01
Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; p<.001), and appropriate antibiotic usage was an independent predictor for more rapid bacterial clearance (coefficient, -0.995; p<.001). Patients with a slower rate of bacterial clearance experienced higher in-hospital mortality (odds ratio, 2.323; p=.04) Immunosuppression and appropriate antibiotic usage were independent factors affecting the rate of clearance of A. baumannii bacteremia in critical patients. These findings highlight the importance of appropriate antibiotic usage and
Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L
2009-10-01
Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.
Nadin-Davis, Susan; Knowles, Margaret K.; Burke, Teresa; Böse, Reinhard; Devenish, John
2015-01-01
A quantitative real-time polymerase chain reaction method (qPCR) was developed and tested for the detection of Taylorella equigenitalis. It was shown to have an analytical sensitivity of 5 colony-forming units (CFU) of T. equigenitalis when applied to the testing of culture swabs that mimicked field samples, and a high analytical specificity in not reacting to 8 other commensal bacterial species associated with horses. As designed, it could also differentiate specifically between T. equigenitalis and T. asinigenitalis. The qPCR was compared to standard culture in a study that included 45 swab samples from 6 horses (1 stallion, 5 mares) naturally infected with T. equigenitalis in Canada, 39 swab samples from 5 naturally infected stallions in Germany, and 311 swab samples from 87 culture negative horses in Canada. When the comparison was conducted on an individual sample swab basis, the qPCR had a statistical sensitivity and specificity of 100% and 96.4%, respectively, and 100% and 99.1% when the comparison was conducted on a sample set basis. A comparison was also made on 203 sample swabs from the 5 German stallions taken over a span of 4 to 9 mo following antibiotic treatment. The qPCR was found to be highly sensitive and at least as good as culture in detecting the presence of T. equigenitalis in post-treatment samples. The work demonstrates that the qPCR assay described here can potentially be used to detect the presence of T. equigenitalis directly from submitted sample swabs taken from infected horses and also for determining T. equigenitalis freedom following treatment. PMID:26130847
Polymerase chain displacement reaction.
Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang
2013-02-01
Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.
Stuart, James Ian; Delport, Johan; Lannigan, Robert; Zahariadis, George
2014-01-01
BACKGROUND: Disease monitoring of viruses using real-time polymerase chain reaction (PCR) requires knowledge of the precision of the test to determine what constitutes a significant change. Calculation of quantitative PCR confidence limits requires bivariate statistical methods. OBJECTIVE: To develop a simple-to-use graphical user interface to determine the uncertainty of measurement (UOM) of BK virus, cytomegalovirus (CMV) and Epstein-Barr virus (EBV) real-time PCR assays. METHODS: Thirty positive clinical samples for each of the three viral assays were repeated once. A graphical user interface was developed using a spreadsheet (Excel, Microsoft Corporation, USA) to enable data entry and calculation of the UOM (according to Fieller’s theorem) and PCR efficiency. RESULTS: The confidence limits for the BK virus, CMV and EBV tests were ∼0.5 log, 0.5 log to 1.0 log, and 0.5 log to 1.0 log, respectively. The efficiencies of these assays, in the same order were 105%, 119% and 90%. The confidence limits remained stable over the linear range of all three tests. DISCUSSION: A >5 fold (0.7 log) and a >3-fold (0.5 log) change in viral load were significant for CMV and EBV when the results were ≤1000 copies/mL and >1000 copies/mL, respectively. A >3-fold (0.5 log) change in viral load was significant for BK virus over its entire linear range. PCR efficiency was ideal for BK virus and EBV but not CMV. Standardized international reference materials and shared reporting of UOM among laboratories are required for the development of treatment guidelines for BK virus, CMV and EBV in the context of changes in viral load. PMID:25285125
Lee, Jun-Young; Kim, Seok Won; Kim, Dong-Min; Yun, Na Ra; Kim, Choon-Mee; Lee, Sang-Hong
2017-08-01
Vibrio vulnificus is a halophilic gram-negative bacillus isolated in seawater, fish, and shellfish. Infection by V. vulnificus is the most severe food-borne infection reported in the United States of America. Here, we aimed to examine the clinical usefulness of polymerase chain reaction (PCR) using tissue specimens other than blood samples as a diagnostic tool for V. vulnificus infection. A retrospective study was conducted with patients who underwent real-time PCR of toxR in both blood and skin tissues, including serum, bullae, swab, and operation room specimens, between 2006 and 2009. The median V. vulnificus DNA load of 14 patients in real-time PCR analysis of serum at the time of admission was 638.5 copies/mL blood, which was within the interquartile range (IQR: 37-3,225). In contrast, the median value by real-time PCR using the first tissue specimen at the time of admission was 16,650 copies/mL tissue fluid (IQR: 4,419-832,500). This difference was statistically significant ( P = 0.022). DNA copy numbers in tissues were less affected by short-term antibiotic administration than that in blood samples, and antibiotic administration increased the DNA copy number in some patients. We found, for the first time, that DNA copy numbers in tissues of patients infected by V. vulnificus were higher than those in blood samples. Additionally, skin lesions were more useful than blood samples as specimens for PCR analysis in patients administered antibiotics for V. vulnificus infection before admission.
Quantification of HIV-1 DNA using real-time recombinase polymerase amplification.
Crannell, Zachary Austin; Rohrman, Brittany; Richards-Kortum, Rebecca
2014-06-17
Although recombinase polymerase amplification (RPA) has many advantages for the detection of pathogenic nucleic acids in point-of-care applications, RPA has not yet been implemented to quantify sample concentration using a standard curve. Here, we describe a real-time RPA assay with an internal positive control and an algorithm that analyzes real-time fluorescence data to quantify HIV-1 DNA. We show that DNA concentration and the onset of detectable amplification are correlated by an exponential standard curve. In a set of experiments in which the standard curve and algorithm were used to analyze and quantify additional DNA samples, the algorithm predicted an average concentration within 1 order of magnitude of the correct concentration for all HIV-1 DNA concentrations tested. These results suggest that quantitative RPA (qRPA) may serve as a powerful tool for quantifying nucleic acids and may be adapted for use in single-sample point-of-care diagnostic systems.
Romand, Stéphane; Chosson, Muriel; Franck, Jacqueline; Wallon, Martine; Kieffer, François; Kaiser, Karine; Dumon, Henri; Peyron, François; Thulliez, Philippe; Picot, Stéphane
2004-03-01
Our purpose was to evaluate Toxoplasma gondii concentration in amniotic fluid (AF) samples as a prognostic marker of congenital toxoplasmosis. A retrospective study was carried out in 88 consecutive AF samples from 86 pregnant women, which were found positive by prospective polymerase chain reaction (PCR) testing. Parasite AF concentrations were estimated by real-time quantitative PCR and analyzed in relation to the clinical outcome of infected fetuses during pregnancy and at birth, taking into account the gestational age at maternal infection. A significant negative linear regression was observed between gestational age at maternal infection and T gondii DNA loads in AF. After adjusting for time at maternal seroconversion by multivariate analysis, higher parasite concentrations were significantly associated with a severe outcome of congenital infection (odds ratio [OR]=15.38/log (parasites/mL AF) [95% CI=2.45-97.7]). PCR quantification of T gondii in AF can be highly contributive for early prognosis of congenital toxoplasmosis. Maternal infections acquired before 20 weeks with a parasite load greater than 100/mL of AF have the highest risk of severe fetal outcome.
Tien, Wei-Ping; Lim, Gareth; Yeo, Gladys; Chiang, Suzanna Nicole; Chong, Chee-Seng; Ng, Lee-Ching; Hapuarachchi, Hapuarachchige Chanditha
2017-09-19
The monitoring of vectors is one of the key surveillance measures to assess the risk of arbovirus transmission and the success of control strategies in endemic regions. The recent re-emergence of Zika virus (ZIKV) in the tropics, including Singapore, emphasizes the need to develop cost-effective, rapid and accurate assays to monitor the virus spread by mosquitoes. As ZIKV infections largely remain asymptomatic, early detection of ZIKV in the field-caught mosquitoes enables timely implementation of appropriate mosquito control measures. We developed a rapid, sensitive and specific real-time reverse transcription polymerase chain reaction (rRT-PCR) assay for the detection of ZIKV in field-caught mosquitoes. The primers and PCR cycling conditions were optimized to minimize non-specific amplification due to cross-reactivity with the genomic material of Aedes aegypti, Aedes albopictus, Culex quinquefasciatus, Culex tritaeniorhynchus, Culex sitiens and Anopheles sinensis, as well as accompanying microbiota. The performance of the assay was further evaluated with a panel of flaviviruses and alphaviruses as well as in field-caught Ae. aegypti mosquitoes confirmed to be positive for ZIKV. As compared to a probe-based assay, the newly developed assay demonstrated 100% specificity and comparable detection sensitivity for ZIKV in mosquitoes. Being a SYBR Green-based method, the newly-developed assay is cost-effective and easy to adapt, thus is applicable to large-scale vector surveillance activities in endemic countries, including those with limited resources and expertise. The amplicon size (119 bp) also allows sequencing to confirm the virus type. The primers flank relatively conserved regions of ZIKV genome, so that, the assay is able to detect genetically diverse ZIKV strains. Our findings, therefore, testify the potential use of the newly-developed assay in vector surveillance programmes for ZIKV in endemic regions.
Faraji, Reza; Behjati-Ardakani, Mostafa; Moshtaghioun, Seyed Mohammad; Kalantar, Seyed Mehdi; Namayandeh, Seyedeh Mahdieh; Soltani, Mohammadhossien; Emami, Mahmood; Zandi, Hengameh; Firoozabadi, Ali Dehghani; Kazeminasab, Mahmood; Ahmadi, Nastaran; Sarebanhassanabadi, Mohammadtaghi
2018-02-01
Broad-range bacterial rDNA polymerase chain reaction (PCR) followed by sequencing may be identified as the etiology of infective endocarditis (IE) from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery. Copyright © 2017. Published by Elsevier Taiwan.
Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing
2005-11-30
Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.
Vital, Pierangeli G; Van Ha, Nguyen Thi; Tuyet, Le Thi Hong; Widmer, Kenneth W
2017-02-01
Surface water samples in Vietnam were collected from the Saigon River, rural and suburban canals, and urban runoff canals in Ho Chi Minh City, Vietnam, and were processed to enumerate Escherichia coli. Quantification was done through membrane filtration and quantitative real-time polymerase chain reaction (PCR). Mean log colony-forming unit (CFU)/100 ml E. coli counts in the dry season for river/suburban canals and urban canals were log 2.8 and 3.7, respectively, using a membrane filtration method, while using Taqman quantitative real-time PCR they were log 2.4 and 2.8 for river/suburban canals and urban canals, respectively. For the wet season, data determined by the membrane filtration method in river/suburban canals and urban canals samples had mean counts of log 3.7 and 4.1, respectively. While mean log CFU/100 ml counts in the wet season using quantitative PCR were log 3 and 2, respectively. Additionally, the urban canal samples were significantly lower than those determined by conventional culture methods for the wet season. These results show that while quantitative real-time PCR can be used to determine levels of fecal indicator bacteria in surface waters, there are some limitations to its application and it may be impacted by sources of runoff based on surveyed samples.
Valverde, Estefania J; Cano, Irene; Labella, Alejandro; Borrego, Juan J; Castro, Dolores
2016-04-06
Lymphocystis disease (LCD) is the main viral infection reported to affect cultured gilthead seabream (Sparus aurata) in Europe. The existence of subclinical Lymphocystis disease virus (LCDV) infection in this fish species has been recognised by using polymerase chain reaction (PCR)-based methods. Nevertheless, these methods do not provide quantitative results that can be useful in epidemiological and pathological studies. Moreover, carrier fish have been involved in viral transmission, therefore the use of specific and sensitive diagnostic methods to detect LCDV will be relevant for LCD prevention. We have developed a real-time PCR (qPCR) assay to detect and quantify LCDV. The assay was evaluated for viral diagnosis in surveillance studies in gilthead seabream farms, and also to identify viral reservoirs in a hatchery. The prevalence of LCDV infection in the asymptomatic gilthead seabream populations tested varied from 30 to 100 %, including data from one farm without previous records of LCD. Estimated viral load in caudal fin of subclinically infected fish was two to five orders of magnitude lower than in diseased fish. The qPCR assay allowed the detection of carrier fish in broodstock from a farm with a history of clinical LCD in juvenile fish. In addition, the quantitative detection of LCDV was achieved in all samples collected in the hatchery, including fertilized eggs, larvae and fingerlings, and also rotifer cultures and artemia metanauplii and cysts used for larval rearing. The qPCR assay developed in this study has proved to be a rapid, sensitive, and reliable method for LCDV diagnosis, which could be valuable to identify LCDV reservoirs or to study viral replication in gilthead seabream.
Zhao, Xiaowen; Bailey, Mark R; Emery, Warren R; Lambooy, Peter K; Chen, Dayue
2007-06-01
Nanofiltration is commonly introduced into purification processes of biologics produced in mammalian cells to serve as a designated step for removal of potential exogenous viral contaminants and endogenous retrovirus-like particles. The LRV (log reduction value) achieved by nanofiltration is often determined by cell-based infectivity assay, which is time-consuming and labour-intensive. We have explored the possibility of employing QPCR (quantitative PCR) to evaluate LRV achieved by nanofiltration in scaled-down studies using two model viruses, namely xenotropic murine leukemia virus and murine minute virus. We report here the successful development of a QPCR-based method suitable for quantification of virus removal by nanofiltration. The method includes a nuclease treatment step to remove free viral nucleic acids, while viral genome associated with intact virus particles is shielded from the nuclease. In addition, HIV Armored RNA was included as an internal control to ensure the accuracy and reliability of the method. The QPCRbased method described here provides several advantages such as better sensitivity, faster turnaround time, reduced cost and higher throughput over the traditional cell-based infectivity assays.
Oliveira-Cunha, Melissa; Byers, Richard J; Siriwardena, Ajith K
2010-03-01
There is a need to develop methods of early diagnosis for pancreatic cancer. Pancreatic juice is easily collected by endoscopic retrograde cholangiopancreatography and may facilitate diagnosis using molecular markers. The aim of this work was to explore the feasibility of measurement of gene expression in RNA isolated from ductal juice. Intraoperative sampling of pancreatic juice was undertaken in 27 patients undergoing pancreaticoduodenectomy for suspected tumor. Total RNA was extracted and used as template for poly(adenylic acid) (poly[A]) polymerase chain reaction (PCR) to generate a globally amplified complementary DNA pool representative of all expressed messenger RNAs. Real-time PCR was performed for trefoil factor 2 (TFF2), carboxypeptidase B1 (CPB1), and kallikrein-related peptidase 3 (KLK3) in a subset of samples; all samples were normalized for 3 reference genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH], PSMB6, and beta-2-microglobulin [B2M]). The median volume of the pancreatic juice obtained was 1245 microL (range, 50-5000 microL). The RNA integrity number ranged from 1.9 to 10. Reverse transcriptase PCR was positive for pancreas-specific genes (TFF2 and CPB1) and negative for prostatic-specific antigen in all samples. These results demonstrate that RNA analysis of pancreatic juice is feasible using a combination of poly(A) PCR and real-time PCR. In addition, the poly(A) complementary DNA generated can be probed for multiple genes and is indefinitely renewable, thereby representing a molecular block of importance for future research.
Imperiali, C; Alía-Ramos, P; Padró-Miquel, A
2015-08-01
HLA-B*51, a class I human leukocyte antigen (HLA) molecule, is the strongest known genetic risk factor for Behçet disease. However, there are only few articles reporting methods to determine the presence or absence of HLA-B51. For this reason, we designed and developed an easy, fast, and inexpensive real-time high-resolution melting (HRM) assay to detect HLA-B*51. We genotyped 61 samples by our HRM assay and by conventional polymerase chain reaction, and no discrepancies were found between results. Besides, a subgroup of 25 samples was also genotyped in a different laboratory, and another subgroup of 16 samples was obtained from the International Histocompatibility Working Group DNA Bank, and a full concordance of results was observed with those obtained by HRM. Regarding the identifying system evaluated, we obtained 100% of specificity, sensibility, and repeatability, and 0% of false positive and false negative rates. Therefore, this HRM analysis is easily applicable to the rapid detection of HLA-B*51, exhibits a high speed, and requires a very low budget. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario
2010-06-01
Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.
Siala, Mariam; Rihl, Markus; Sellami, Hanen; Znazen, Abir; Sassi, Nadia; Laadhar, Lilia; Gdoura, Radhouane; Belghuith, Imen; Mrabet, Dalila; Baklouti, Sofien; Sellami, Slaheddine; Sibilia, Jean; Fourati, Hela; Hammami, Adnene; Cheour, Ilhem
2018-06-01
Enterobacterial components in the joints of patients are believed to contribute to a perpetuating inflammation leading to a reactive arthritis (ReA), a condition in which microbial agents cannot be recovered from the joint. At present, it is unclear whether nucleic acids from Shigella spp. are playing a pathogenic role in causing not only ReA but also other forms of arthritis. Quantitative real-time polymerase chain reaction assay (qPCR) is the method of choice for the identification of bacteria within the synovium. The aim of our study was to detect the presence of Shigella spp. nucleic acids in the synovial tissue (ST) of Tunisian arthritis patients. We investigated 57 ST samples from rheumatoid arthritis (RA) n = 38, undifferentiated oligoarthritis (UOA) n = 12, and spondyloarthritis (SpA) n = 7 patients; 5 ST samples from healthy individuals were used as controls. Shigella spp. DNA and mRNA transcripts encoding the virulence gene A (VirA) were examined using an optimized qPCR with newly designed primers and probes. Using qPCR, Shigella spp. DNA was found in 37/57 (65%) ST samples (24/38, i.e., 63.2% of RA, 8/12, i.e., 67% of UOA, and 5/7, i.e., 71.4% of SpA patients). Paired DNA and mRNA were extracted from 39 ST samples, whose VirA cDNA was found in 29/39 (74.4%) patients. qPCR did not yield any nucleic acids in the five healthy control ST samples. The qPCR assay was sensitive and showed a good intra- and inter-run reproducibility. These preliminary findings generated by an optimized, highly sensitive PCR assay underline a potential role of past gastrointestinal infections. In Tunisian patients, a bacterial etiology involving Shigella spp. in the manifestation of arthritic disorders including RA might be more common than expected.
Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro
2010-06-01
Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).
Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi
2008-03-01
Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.
2014-01-01
Background Diagnosing adipocytic tumors can be challenging because it is often difficult to morphologically distinguish between benign, intermediate and malignant adipocytic tumors, and other sarcomas that are histologically similar. Recently, a number of tumor-specific chromosome translocations and associated fusion genes have been identified in adipocytic tumors and atypical lipomatous tumors/well-differentiated liposarcomas (ALT/WDL), which have a supernumerary ring and/or giant chromosome marker with amplified sequences of the MDM2 and CDK4 genes. The purpose of this study was to investigate whether quantitative real-time polymerase chain reaction (PCR) could be used to amplify MDM2 and CDK4 from total RNA samples obtained from core-needle biopsy sections for the diagnosis of ALT/WDL. Methods A series of lipoma (n = 124) and ALT/WDL (n = 44) cases were analyzed for cytogenetic analysis and lipoma fusion genes, as well as for MDM2 and CDK4 expression by real-time PCR. Moreover, the expression of MDM2 and CDK4 in whole tissue sections was compared with that in core-needle biopsy sections of the same tumor in order to determine whether real-time PCR could be used to distinguish ALT/WDL from lipoma at the preoperative stage. Results In whole tissue sections, the medians for MDM2 and CDK4 expression in ALT/WDL were higher than those in the lipomas (P < 0.05). Moreover, karyotype subdivisions with rings and/or giant chromosomes had higher MDM2 and CDK4 expression levels compared to karyotypes with 12q13-15 rearrangements, other abnormal karyotypes, and normal karyotypes (P < 0.05). On the other hand, MDM2 and CDK4 expression levels in core-needle biopsy sections were similar to those in whole-tissue sections (MDM2: P = 0.6, CDK4: P = 0.8, Wilcoxon signed-rank test). Conclusion Quantitative real-time PCR of total RNA can be used to evaluate the MDM2 and CDK4 expression levels in core-needle biopsies and may be useful for distinguishing ALT
Farcas, Gabriella A; Soeller, Rainer; Zhong, Kathleen; Zahirieh, Alireza; Kain, Kevin C
2006-03-01
Imported drug-resistant malaria is a growing problem in industrialized countries. Rapid and accurate diagnosis is essential to prevent malaria-associated mortality in returned travelers. However, outside of a limited number of specialized centers, the microscopic diagnosis of malaria is slow, unreliable, and provides little information about drug resistance. Molecular diagnostics have the potential to overcome these limitations. We developed and evaluated a rapid, real-time polymerase chain reaction (PCR) assay to detect Plasmodium falciparum malaria and chloroquine (CQ)-resistance determinants in returned travelers who are febrile. A real-time PCR assay based on detection of the K76T mutation in PfCRT (K76T) of P. falciparum was developed on a LightCycler platform (Roche). The performance characteristics of the real-time assay were compared with those of the nested PCR-restriction fragment-length polymorphism (RFLP) and the sequence analyses of samples obtained from 200 febrile returned travelers, who included 125 infected with P. falciparum (48 of whom were infected CQ-susceptible [K76] and 77 of whom were CQ-resistant [T76] P. falciparum), 22 infected with Plasmodium vivax, 10 infected with Plasmodium ovale, 3 infected with Plasmodium malariae malaria, and 40 infected with other febrile syndromes. All patient samples were coded, and all analyses were performed blindly. The real-time PCR assay detected multiple pfcrt haplotypes associated with CQ resistance in geographically diverse malaria isolates acquired by travelers. Compared with nested-PCR RFLP (the reference standard), the real-time assay was 100% sensitive and 96.2% specific for detection of the P. falciparum K76T mutation. This assay is rapid, sensitive, and specific for the detection and characterization of CQ-resistant P. falciparum malaria in returned travelers. This assay is automated, standardized, and suitable for routine use in clinical diagnostic laboratories.
Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X
2015-03-01
Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).
Meyler, Kenneth L; Meehan, Mary; Bennett, Desiree; Cunney, Robert; Cafferkey, Mary
2012-12-01
Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF. Copyright © 2012 Elsevier Inc. All rights reserved.
Lehman, Susan M; Kim, Won-Sik; Castle, Alan J; Svircev, Antonet M
2008-06-01
Erwinia amylovora and E. pyrifoliae are the causative agents of fire blight and Asian pear blight, respectively. The pathogens are closely related, with overlapping host ranges. Data are unavailable on the current distribution of E. pyrifoliae and on the interaction between the two species when they are present together on the same host. In this study, a duplex real-time polymerase chain reaction (PCR) protocol was developed to monitor the population dynamics of E. amylovora and E. pyrifoliae on the surface of Bartlett pear blossoms. Bacterial cells washed from blossoms were used directly as the PCR template without DNA extraction. Primers and a probe based on the E. amylovora levansucrase gene detected all E. amylovora strains. All E. pyrifoliae strains, including the Japanese Erwinia strains previously described as E. amylovora, were detected with a primer and probe combination based on the E. pyrifoliae hrpW gene. Disease development and severity were not significantly different in blossoms inoculated with individual Erwinia species or with a mixture of the two species. However, E. amylovora grew to greater population sizes than did E. pyrifoliae in both single species inoculations and in mixtures, suggesting that E. amylovora has a greater competitive fitness on Bartlett pear blossoms than E. pyrifoliae.
Allender, Matthew C; Bunick, David; Dzhaman, Elena; Burrus, Lucienne; Maddox, Carol
2015-03-01
Fungal pathogens threatening the conservation of wildlife are becoming increasingly common. Since 2008, free-ranging snakes across North America have been experiencing a marked increase in the prevalence of snake fungal disease associated with Ophidiomyces ophiodiicola. Diagnosis has historically relied on histology, microbiology, and conventional polymerase chain reaction (PCR). More sensitive methods are needed to adequately characterize the epidemiology. The current study describes the development of a real-time PCR (qPCR) assay for detecting a segment of the internal transcribed spacer 1 region between the 18S and 5.8S ribosomal RNA gene. The assay was able to detect as few as 1.05 × 10(1) gene copies per reaction. An additional 4 positive cases were detected when comparing a conventional PCR (n = 3) and the qPCR (n = 7) when used on swab samples from 47 eastern massasauga rattlesnakes. The newly developed assay is a sensitive and specific tool for surveillance and monitoring in the conservation of free-ranging snakes. © 2015 The Author(s).
Daniel, Hubert Darius J; Fletcher, John G; Chandy, George M; Abraham, Priya
2009-01-01
Sensitive nucleic acid testing for the detection and accurate quantitation of hepatitis B virus (HBV) is necessary to reduce transmission through blood and blood products and for monitoring patients on antiviral therapy. The aim of this study is to standardize an "in-house" real-time HBV polymerase chain reaction (PCR) for accurate quantitation and screening of HBV. The "in-house" real-time assay was compared with a commercial assay using 30 chronically infected individuals and 70 blood donors who are negative for hepatitis B surface antigen, hepatitis C virus (HCV) antibody and human immunodeficiency virus (HIV) antibody. Further, 30 HBV-genotyped samples were tested to evaluate the "in-house" assay's capacity to detect genotypes prevalent among individuals attending this tertiary care hospital. The lower limit of detection of this "in-house" HBV real-time PCR was assessed against the WHO international standard and found to be 50 IU/mL. The interassay and intra-assay coefficient of variation (CV) of this "in-house" assay ranged from 1.4% to 9.4% and 0.0% to 2.3%, respectively. Virus loads as estimated with this "in-house" HBV real-time assay correlated well with the commercial artus HBV RG PCR assay ( r = 0.95, P < 0.0001). This assay can be used for the detection and accurate quantitation of HBV viral loads in plasma samples. This assay can be employed for the screening of blood donations and can potentially be adapted to a multiplex format for simultaneous detection of HBV, HIV and HCV to reduce the cost of testing in blood banks.
Li, Yan; Wu, Tao; Qi, Xian; Ge, Yiyue; Guo, Xiling; Wu, Bin; Yu, Huiyan; Zhu, Yefei; Shi, Zhiyang; Wang, Hua; Cui, Lunbiao; Zhou, Minghao
2013-12-01
A novel reassortant influenza A (H7N9) virus emerged recently in China. In this study, a duplex real-time reverse transcription polymerase chain reaction (rRT-PCR) assay was developed for the simultaneous detection of hemagglutinin (HA) and neuraminidase (NA) genes of H7N9 influenza viruses. The sensitivity of the assay was determined to be 10 RNA copies per reaction for both HA and NA genes. No cross-reactivity was observed with other influenza virus subtypes or respiratory tract viruses. One hundred and forty-six clinical and environmental specimens were tested and compared with reference methods and were found to be consistent. The assay is suitable for large-scale screening due to short turnaround times and high specificity, sensitivity, and reproducibility. Copyright © 2013 Elsevier B.V. All rights reserved.
Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A
2017-01-01
Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.
Tan, Thean Yen; Jiang, Boran; Ng, Lily Siew Yong
2017-08-01
Screening for vancomycin-resistant enterococci (VRE) by culture takes days to generate results, while polymerase chain reaction (PCR) testing directly from clinical specimens lacks specificity. The aims of this study were to develop a real-time PCR to detect and identify Enterococcus faecium, Enterococcus faecalis, and vanA and vanB genes, and to evaluate the impact of this PCR on test-reporting times when performing it directly from suspect VRE isolates present on screening chromogenic media. The tetraplex PCR primers were designed to amplify E. faecium, E. faecalis, and vanA and vanB genes, with melt-curve analysis of PCR products. Following analytical and clinical validation of the molecular assay, PCR testing was performed for target colonies present on VRE chromogenic media. PCR results were evaluated against conventional phenotypic identification and susceptibility testing, with the time to result being monitored for both modalities. A total of 519 colonies from clinical specimens were tested concurrently by real-time PCR and phenotypic methods. In all, 223 isolates were identified with phenotypic vancomycin resistance (vanA, n = 108; vanB, n = 105; non-vanA/vanB = 10), with complete agreement between PCR and phenotypic testing for vancomycin-resistant E. faecium and E. faecalis. The majority (88.6%) of PCR results were reported, on average, 24.8 hours earlier than those of phenotypic testing, with 68% reduction in total costs. The use of culture on selective media, followed by direct colony PCR confirmation allows faster and economical VRE screening. Copyright © 2015. Published by Elsevier B.V.
Xu, Tao; Deshmukh, Meenal; Barnes, Virginia Monsul; Trivedi, Harsh M; Du-Thumm, Laurence; Richter, Rose; Cummins, Diane
2005-01-01
This study analyzed, from a combined clinical and molecular biologic perspective, the antibacterial and antiplaque efficacy of Colgate Total dentifrice (CTD). A single-blind crossover study design utilized 11 healthy human subjects. After a one-week washout period, subjects donated dental plaque, received a dental prophylaxis, and subsequently brushed with a test product. Twenty-four hours postbrushing, dental plaque was collected and a clinical plaque score determined. Dental plaque was submitted for Real-time Polymerase Chain Reaction (Real-time PCR) analysis. The same procedure was repeated in accordance with a crossover design for the use of the second test product. Following a one-week washout, a plaque donation, prophylaxis, and brushing with the test product ensued for each subject. Twenty-four hours post-brushing, the subjects returned for a plaque score and plaque donation. Twenty-four hours after brushing, dental plaque coverage increased 17.88% +/- 8.27% with CTD, compared to 30.42% +/- 9.97% with Colgate Cavity Protection (CCP; p = 0.005). Real-time PCR found plaque collected 24 hours after brushing with CTD exhibited, on average, fewer representative periodontal pathogens (Fusobacterium nucleatum, Actinobacillus actinomycetemcomitans, Tannerella forsythensis, and Porphyromonas gingivalis) and fewer early colonizers (Actinomyces naeslundii) than plaque collected before brushing, whereas CCP showed a moderate effect on oral bacteria. The study provides clinical and molecular biological evidence to substantiate the antibacterial and plaque control benefits of Colgate Total, and suggests the value of combining a molecular biological method with clinical research to corroborate clinical benefits.
Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas
2010-01-01
Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158
David-Neto, Elias; Triboni, Ana H K; Paula, Flavio J; Vilas Boas, Lucy S; Machado, Clarisse M; Agena, Fabiana; Latif, Acram Z A; Alencar, Cecília S; Pierrotti, Ligia C; Nahas, William C; Caiaffa-Filho, Helio H; Pannuti, Claudio S
2014-11-27
Cytomegalovirus (CMV) disease occurs in 16% to 20% of low-risk, CMV-positive renal transplant recipients. The cutoffs for quantitative real-time polymerase chain reaction (qPCR) or phosphoprotein (pp65) antigenemia (pp65emia) for starting preemptive therapy have not been well established. We measured qPCR and pp65emia weekly from day 7 to day 120 after transplantation, in anti-CMV immunoglobulin G–positive donor and recipient pairs. Patients and physicians were blinded to the test results. Suspicion of CMV disease led to the order of new tests. In asymptomatic viremic patients, the highest pp65emia and qPCR values were used, whereas we considered the last value before diagnosis in those with CMV disease. We collected a total of 1,481 blood samples from 102 adult patients. Seventeen patients developed CMV disease, 54 presented at least one episode of viremia that cleared spontaneously, and 31 never presented viremia. Five patients developed CMV disease after the end of the study period. The median (95% confidence interval) pp65emia and qPCR values were higher before CMV disease than during asymptomatic viremia (6 [9–82] vs. 3 [1–14] cells/10(6) cells; P<0.001 and 3,080 [1,263–15,605] vs. 258 [258–1,679] copies/mL; P=0.008, respectively). The receiver operating characteristic curve showed that pp65emia 4 cells/10(6) cells or greater showed a sensitivity and specificity to predict CMV disease of 69% and 81%, respectively (area, 0.769; P=0.001), with a positive predictive value of 37% and a negative predictive value of 93%. For qPCR 2,000 copies/mL or higher, the positive predictive value and negative predictive value were 57% and 91%, respectively (receiver operating characteristic area, 0.782; P=0.000). With these cutoffs, both methods are appropriate for detecting CMV disease.
Costa Casagrande, T A; de Oliveira Barros, L M; Fukumasu, H; Cogliati, B; Chaible, L M; Dagli, M L Z; Matera, J M
2015-03-01
This study investigated the correlation between KIT gene expression determined by immunohistochemistry and real-time polymerase chain reaction (RT-PCR) and the rate of tumour recurrence and tumour-related deaths in dogs affected with mast cell tumour (MCT). Kaplan-Meier curves were constructed to compare tumour recurrence and tumour-related death between patients. The log-rank test was used to check for significant differences between curves. KIT-I, KIT-II and KIT-III staining patterns were observed in 9 (11.11%), 50 (61.73%) and 22 (27.16%) tumours, respectively. Tumour recurrence rates and tumour-related deaths were not associated with KIT staining patterns (P = 0278, P > 0.05), KIT (P = 0.289, P > 0.05) or KIT ligand (P = 0.106, P > 0.05) gene expression. Despite the lack of association between KIT staining pattern and patient survival time, the results suggest a correlation between aberrant KIT localization and increased proliferative activity of MCTs. RT-PCR seems to be a sensible method for quantitative detection of KIT gene expression in canine MCT, although expressions levels are not correlated with prognosis. © 2013 Blackwell Publishing Ltd.
The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...
Sun, Bo; Xue, Sheng-Ling; Zhang, Fen; Luo, Zhao-Peng; Wu, Ming-Zhu; Chen, Qing; Tang, Hao-Ru; Lin, Fu-Cheng; Yang, Jun
2015-11-17
Nornicotine production in Nicotiana tabacum is undesirable because it is the precursor of the carcinogen N'-nitrosonornicotine. In some individual burley tobacco plants, a large proportion of the nicotine can be converted to nornicotine, and this process of nicotine conversion is mediated primarily by enzymatic N-demethylation of nicotine which is controlled mainly by CYP82E4. Here we report a novel strategy based on quantitative real-time polymerase chain reaction (qPCR) method, which analyzed the ratio of nicotine conversion through examining the transcript level of CYP82E4 in burley leaves and do not need ethylene induction before detected. The assay was linear in a range from 1 × 10¹ to 1 × 10⁵ copies/mL of serially diluted standards, and also showed high specificity and reproducibility (93%-99%). To assess its applicability, 55 plants of burley cultivar Ky8959 at leaf maturing stage were analyzed, and the results were in accordance with those from gas chromatograph-mass spectrometry (GC-MS) method. Moreover, a linear correlation existed between conversion level and CYP82E4 transcript abundance. Taken together, the quantitative real-time PCR assay is standardized, rapid and reproducible for estimation of nicotine conversion level in vivo, which is expected to shed new light on monitoring of burley tobacco converter.
Denison, Amy M.; Amin, Bijal D.; Nicholson, William L.; Paddock, Christopher D.
2015-01-01
Background Rickettsia rickettsii, Rickettsia parkeri, and Rickettsia akari are the most common causes of spotted fever group rickettsioses indigenous to the United States. Infected patients characteristically present with a maculopapular rash, often accompanied by an inoculation eschar. Skin biopsy specimens are often obtained from these lesions for diagnostic evaluation. However, a species-specific diagnosis is achieved infrequently from pathologic specimens because immunohistochemical stains do not differentiate among the causative agents of spotted fever group rickettsiae, and existing polymerase chain reaction (PCR) assays generally target large gene segments that may be difficult or impossible to obtain from formalin-fixed tissues. Methods This work describes the development and evaluation of a multiplex real-time PCR assay for the detection of these 3 Rickettsia species from formalin-fixed, paraffin-embedded (FFPE) skin biopsy specimens. Results The multiplex PCR assay was specific at discriminating each species from FFPE controls of unrelated bacterial, viral, protozoan, and fungal pathogens that cause skin lesions, as well as other closely related spotted fever group Rickettsia species. Conclusions This multiplex real-time PCR demonstrates greater sensitivity than nested PCR assays in FFPE tissues and provides an effective method to specifically identify cases of Rocky Mountain spotted fever, rickettsialpox, and R. parkeri rickettsiosis by using skin biopsy specimens. PMID:24829214
Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven
2014-01-01
A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.
A polymerase chain reaction strategy for the diagnosis of camelpox.
Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar
2009-03-01
Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.
HSV2 acute retinal necrosis: diagnosis and monitoring with quantitative polymerase chain reaction.
Cottet, L; Kaiser, L; Hirsch, H H; Baglivo, E
2009-06-01
To describe a case of HSV2 acute retinal necrosis (ARN) diagnosed and monitored with quantitative polymerase chain reaction (PCR) in ocular fluids. Case report. Quantitative PCR was performed in the aqueous humor (AH) and vitreous using primers specific for herpes virus. A positive PCR was found for HSV2 in the AH (>100,000,000 viral copies - 8.00 log/ml). After therapy, another anterior chamber tap showed a reduction of the viral load at 4.28 log/ml (19205 copies), confirming the efficacy of the treatment. After six months, PCR on the vitreous still showed the presence of HSV2 viral particles in the eye (3.14 log DNA copies/ml, 1379 copies) although the lesion was healed. This case demonstrates that PCR is useful to detect viral DNA in AH and vitreous and to monitor viral activity and therapeutic response. Viral DNA persists in ocular fluids for months in the presence of a healed infection.
Hong, Yan; Zhao, Xiaosu; Qin, Yazhen; Zhou, Songhai; Chang, Yingjun; Wang, Yu; Zhang, Xiaohui; Xu, Lanping; Huang, Xiaojun
2018-04-28
The E2A-PBX1 rearrangement is common in B cell acute lymphoblastic leukemia (B-ALL). However, whether this fusion gene can be used as a reliable marker for minimal residual disease (MRD) following allogeneic hematopoietic stem cell transplantation (allo-HSCT) remains unknown. In this study, clinical data were collected from 28 consecutive B-ALL patients who received allo-HSCT. Their MRD was evaluated by E2A-PBX1 and leukemia-associated immunophenotype (LAIP). The median follow-up was 374 days (55-2342 days). Of the enrolled patients, seven (25%) patients died of leukemia relapse. A total of nine (32.1%) patients experienced relapse at a median of 164 days (75-559 days) after transplantation. The median expression level in the first positive sample was 0.14% (0.0071-902.4%). The duration from E2A-PBX1-positive results to hematological relapse was 74 days (30-469 days). E2A-PBX1 expression generally became positive prior to flow cytometry. Patients with positive E2A-PBX1 gene expression pre-transplantation were more likely to have positive E2A-PBX1 expression after transplantation. Taken all together, E2A-PBX1 expression determined by real-time quantitative reverse transcriptase polymerase chain reaction (RQ-PCR) could be used to evaluate MRD status after allo-HSCT. Patients with positive E2A-PBX1 expression after transplant will have a poor prognosis.
Jahan, Munira; Lutful Moben, Ahmed; Tabassum, Shahina
2014-01-01
ABSTRACT Background Both real-time-polymerase chain reaction (PCR) and hybrid capture 2 (HC2) assay can detect and quantify hepatitis B virus (HBV) DNA. However, real-time-PCR can detect a wide range of HBV DNA, while HC2 assay could not detect lower levels of viremia. The present study was designed to detect and quantify HBV DNA by real-time-PCR and HC2 assay and compare the quantitative data of these two assays. Materials and methods A cross-sectional study was conducted in between July 2010 and June 2011. A total of 66 serologically diagnosed chronic hepatitis B (CHB) patients were selected for the study. Real-time-PCR and HC2 assay was done to detect HBV DNA. Data were analyzed by statistical Package for the social sciences (SPSS). Results Among 66 serologically diagnosed chronic hepatitis B patients 40 (60.61%) patients had detectable and 26 (39.39%) had undetectable HBV DNA by HC2 assay. Concordant results were obtained for 40 (60.61%) out of these 66 patients by real-time-PCR and HC2 assay with mean viral load of 7.06 ± 1.13 log10 copies/ml and 6.95 ± 1.08 log10 copies/ml, respectively. In the remaining 26 patients, HBV DNA was detectable by real-time-PCR in 20 patients (mean HBV DNA level was 3.67 ± 0.72 log10 copies/ml. However, HBV DNA could not be detectable in six cases by the both assays. The study showed strong correlation (r = 0.915) between real-time-PCR and HC2 assay for the detection and quantification of HBV DNA. Conclusion HC2 assay may be used as an alternative to real-time-PCR for CHB patients. How to cite this article: Majid F, Jahan M, Moben AL, Tabassum S. Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA. Euroasian J Hepato-Gastroenterol 2014;4(1):31-35. PMID:29264316
Majid, Farjana; Jahan, Munira; Lutful Moben, Ahmed; Tabassum, Shahina
2014-01-01
Both real-time-polymerase chain reaction (PCR) and hybrid capture 2 (HC2) assay can detect and quantify hepatitis B virus (HBV) DNA. However, real-time-PCR can detect a wide range of HBV DNA, while HC2 assay could not detect lower levels of viremia. The present study was designed to detect and quantify HBV DNA by real-time-PCR and HC2 assay and compare the quantitative data of these two assays. A cross-sectional study was conducted in between July 2010 and June 2011. A total of 66 serologically diagnosed chronic hepatitis B (CHB) patients were selected for the study. Real-time-PCR and HC2 assay was done to detect HBV DNA. Data were analyzed by statistical Package for the social sciences (SPSS). Among 66 serologically diagnosed chronic hepatitis B patients 40 (60.61%) patients had detectable and 26 (39.39%) had undetectable HBV DNA by HC2 assay. Concordant results were obtained for 40 (60.61%) out of these 66 patients by real-time-PCR and HC2 assay with mean viral load of 7.06 ± 1.13 log 10 copies/ml and 6.95 ± 1.08 log 10 copies/ml, respectively. In the remaining 26 patients, HBV DNA was detectable by real-time-PCR in 20 patients (mean HBV DNA level was 3.67 ± 0.72 log 10 copies/ml. However, HBV DNA could not be detectable in six cases by the both assays. The study showed strong correlation (r = 0.915) between real-time-PCR and HC2 assay for the detection and quantification of HBV DNA. HC2 assay may be used as an alternative to real-time-PCR for CHB patients. How to cite this article: Majid F, Jahan M, Moben AL, Tabassum S. Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA. Euroasian J Hepato-Gastroenterol 2014;4(1):31-35.
Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.
Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava
2018-05-01
Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.
Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.
Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng
2017-04-15
Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.
Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M
2015-10-01
The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.
Efunshile, Michael A.; Ngwu, Bethrand A. F.; Kurtzhals, Jørgen A. L.; Sahar, Sumrin; König, Brigitte; Stensvold, Christen R.
2015-01-01
Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia intestinalis, and Cryptosporidium. Questionnaires were administered for epidemiological data collection. E. histolytica was not detected in any of the samples, whereas Giardia (37.2%), E. dispar (18.6%), and Cryptosporidium (1%) were found. Most of the children sourced their drinking water from community wells (91%), while the majority disposed of feces in the bush (81.9%). Our study is the first to use real-time PCR to evaluate the epidemiology of E. histolytica, Giardia, and Cryptosporidium in Nigeria where previous studies using traditional diagnostic techniques have suggested higher and lower carriage rates of E. histolytica and Giardia, respectively. It is also the first study to accurately identify the prevalence of common potentially diarrheagenic protozoa in asymptomatic carriers in sub-Saharan Africa. PMID:26101274
Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L; Sahar, Sumrin; König, Brigitte; Stensvold, Christen R
2015-08-01
Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia intestinalis, and Cryptosporidium. Questionnaires were administered for epidemiological data collection. E. histolytica was not detected in any of the samples, whereas Giardia (37.2%), E. dispar (18.6%), and Cryptosporidium (1%) were found. Most of the children sourced their drinking water from community wells (91%), while the majority disposed of feces in the bush (81.9%). Our study is the first to use real-time PCR to evaluate the epidemiology of E. histolytica, Giardia, and Cryptosporidium in Nigeria where previous studies using traditional diagnostic techniques have suggested higher and lower carriage rates of E. histolytica and Giardia, respectively. It is also the first study to accurately identify the prevalence of common potentially diarrheagenic protozoa in asymptomatic carriers in sub-Saharan Africa. © The American Society of Tropical Medicine and Hygiene.
Valeriani, Federica; Agodi, Antonella; Casini, Beatrice; Cristina, Maria Luisa; D'Errico, Marcello Mario; Gianfranceschi, Gianluca; Liguori, Giorgio; Liguori, Renato; Mucci, Nicolina; Mura, Ida; Pasquarella, Cesira; Piana, Andrea; Sotgiu, Giovanni; Privitera, Gaetano; Protano, Carmela; Quattrocchi, Annalisa; Ripabelli, Giancarlo; Rossini, Angelo; Spagnolo, Anna Maria; Tamburro, Manuela; Tardivo, Stefano; Veronesi, Licia; Vitali, Matteo; Romano Spica, Vincenzo
2018-02-01
Reprocessing of endoscopes is key to preventing cross-infection after colonoscopy. Culture-based methods are recommended for monitoring, but alternative and rapid approaches are needed to improve surveillance and reduce turnover times. A molecular strategy based on detection of residual traces from gut microbiota was developed and tested using a multicenter survey. A simplified sampling and DNA extraction protocol using nylon-tipped flocked swabs was optimized. A multiplex real-time polymerase chain reaction (PCR) test was developed that targeted 6 bacteria genes that were amplified in 3 mixes. The method was validated by interlaboratory tests involving 5 reference laboratories. Colonoscopy devices (n = 111) were sampled in 10 Italian hospitals. Culture-based microbiology and metagenomic tests were performed to verify PCR data. The sampling method was easily applied in all 10 endoscopy units and the optimized DNA extraction and amplification protocol was successfully performed by all of the involved laboratories. This PCR-based method allowed identification of both contaminated (n = 59) and fully reprocessed endoscopes (n = 52) with high sensibility (98%) and specificity (98%), within 3-4 hours, in contrast to the 24-72 hours needed for a classic microbiology test. Results were confirmed by next-generation sequencing and classic microbiology. A novel approach for monitoring reprocessing of colonoscopy devices was developed and successfully applied in a multicenter survey. The general principle of tracing biological fluids through microflora DNA amplification was successfully applied and may represent a promising approach for hospital hygiene. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.
Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael
2014-01-01
A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible. PMID:24822188
Soejima, Takashi; Xiao, Jin-Zhong; Abe, Fumiaki
2016-06-23
Typically, polymerase chain reaction (PCR) is performed after DNA isolation. Real-time PCR (qPCR), also known as direct qPCR in mammalian cells with weak membranes, is a common technique using crude samples subjected to preliminary boiling to elute DNA. However, applying this methodology to prokaryotic cells, which have solid cell walls, in contrast to mammalian cells which immediately burst in water, can result in poor detection. We successfully achieved PCR elongation with the addition of 1.3 cfu of Cronobacter muytjensii to a newly developed direct qPCR master mix without performing any crude DNA extraction (detection limit of 1.6 × 10(0) cfu/ml for the test sample compared with a detection limit of 1.6 × 10(3) cfu/ml primarily for crude (boiling) or classical DNA isolation). We revealed that the chromosomal DNA retained in prokaryotic cells can function as a PCR template, similarly to the mechanism in in situ PCR. Elucidating this reaction mechanism may contribute to the development of an innovative master mix for direct qPCR to detect genes in a single bacterium with solid cell walls and might lead to numerous novel findings in prokaryotic genomics research.
Provenzano, Maurizio; Mocellin, Simone; Bonginelli, Paola; Nagorsen, Dirk; Kwon, Seog-Woon; Stroncek, David
2003-01-01
The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA) polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs) from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV) and Influenza (Flu), were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR) was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ), Interleukin-2 (IL-2), Interleukin-4 (IL-4), and Interleukin-10 (IL-10). We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization. PMID:14675481
2010-01-01
Background The hepatitis C virus (HCV) genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM), at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP)/COBAS TaqMan (CTM) assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection. PMID:20529244
Quantitative real-time imaging of glutathione
USDA-ARS?s Scientific Manuscript database
Glutathione plays many important roles in biological processes; however, the dynamic changes of glutathione concentrations in living cells remain largely unknown. Here, we report a reversible reaction-based fluorescent probe—designated as RealThiol (RT)—that can quantitatively monitor the real-time ...
Han, Min; Kang, Xing; Liu, Zhengbin; Zhang, Tingting; Li, Yanwei; Chen, Chao; Wang, Huijuan
2017-07-01
HLA-B*57:01 is strongly associated with severe adverse drug reaction induced by the anti-HIV drug abacavir (ABC) and antibiotic flucloxacillin. This study was dedicated to establishing a new method for HLA-B*57:01 genotyping and investigating the HLA-B*57:01 distribution pattern in four Chinese populations. A single-tube duplex real-time polymerase chain reaction (PCR) system was established by combining the amplification refractory mutation system and TaqMan probe. The reliability of this assay was validated by comparing the genotyping results with those by sequence-based typing. With this assay, the distribution of HLA-B*57:01 in 354 blood samples from four ethnic groups, namely, Han, Tibetan, Uighur, and Buyei, was determined. A 100% concordance was observed between the results of real-time PCR and sequence-based typing in 50 Uighur samples. As low as 0.016 ng DNA that carried HLA-B*57:01 could be detected with this assay. HLA-B*57:01 carriers identified in 100 Northern Han Chinese, 104 Buyeis, 100 Tibetans, and 50 Uighurs were 0, 1 (0.96%), 3 (3%), and 6 (12%), respectively. The carrier rate of HLA-B*57:01 in Uighur was significantly higher than those in Northern Han (p = .001) and Buyei (p = .005). The newly established real-time PCR assay provides a rapid and reliable tool for HLA-B*57:01 allele screening before the prescription of ABC and flucloxacillin in clinical practice.
Bohuski, Elizabeth; Lorch, Jeffrey M; Griffin, Kathryn M; Blehert, David S
2015-04-15
Fungal skin infections associated with Ophidiomyces ophiodiicola, a member of the Chrysosporium anamorph of Nannizziopsis vriesii (CANV) complex, have been linked to an increasing number of cases of snake fungal disease (SFD) in captive snakes around the world and in wild snake populations in eastern North America. The emergence of SFD in both captive and wild situations has led to an increased need for tools to better diagnose and study the disease. We developed two TaqMan real-time polymerase chain reaction (PCR) assays to rapidly detect O. ophiodiicola in clinical samples. One assay targets the internal transcribed spacer region (ITS) of the fungal genome while the other targets the more variable intergenic spacer region (IGS). The PCR assays were qualified using skin samples collected from 50 snakes for which O. ophiodiicola had been previously detected by culture, 20 snakes with gross skin lesions suggestive of SFD but which were culture-negative for O. ophiodiicola, and 16 snakes with no clinical signs of infection. Both assays performed equivalently and proved to be more sensitive than traditional culture methods, detecting O. ophiodiicola in 98% of the culture-positive samples and in 40% of the culture-negative snakes that had clinical signs of SFD. In addition, the assays did not cross-react with a panel of 28 fungal species that are closely related to O. ophiodiicola or that commonly occur on the skin of snakes. The assays did, however, indicate that some asymptomatic snakes (~6%) may harbor low levels of the fungus, and that PCR should be paired with histology when a definitive diagnosis is required. These assays represent the first published methods to detect O. ophiodiicola by real-time PCR. The ITS assay has great utility for assisting with SFD diagnoses whereas the IGS assay offers a valuable tool for research-based applications.
Okabe, Tadashi; Sato, Chiyo; Matsumoto, Keisuke; Ozawa, Hitoshi; Sakamoto, Atsuhiro
2009-11-01
Electroconvulsive shock therapy (ECT) has been widely used as an effective and established treatment for refractory depression and schizophrenia. Some reports have shown that ECT is also effective for treating refractory neuropathic pain. In a rat model of neuropathic pain produced by chronic constrictive injury (CCI) of the sciatic nerve, thermal hyperalgesia, and mechanical allodynia were observed from day 2 after surgery. An electroconvulsive shock (ECS) was administered to rodents once daily for 6 days on days 7-12 after CCI operation using a pulse generator. Thermal and mechanical stimulation tests were performed to assess pain thresholds. Real-time polymerase chain reaction was used to measure the gene expression levels for 5HT(1A)R, 5HT(2A)R, neuropeptide Y (NPY), and GABAA(alpha1)R in the brain. After ECS, the latency to withdrawal from thermal stimulation was significantly increased; however, pain withdrawal thresholds in response to mechanical stimulation were not significantly changed. Expression ratios of NPY were significantly greater after ECS. Symptoms of neuropathic pain improved and expression of NPY in the brain was increased in CCI model rats after ECS, suggesting that changes in the expression of NPY in the brain may be related to the mechanism of action of ECT in treating neuropathic pain.
Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette
2014-01-01
Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560
Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas
2002-03-15
The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.
Andosova, L D; Kontorshchikova, K N; Blatova, O L; Kudel'kina, S Iu; Kuznetsova, I A; Belov, A V; Baĭkova, R A
2011-07-01
The polymerase chain reaction technique was applied in "real time" format to evaluate the occurrence rate and infection ratio of various genotypes of human papilloma of high carcinogenic risk in virus-positive women and contact persons. The examination sampling consisted of 738 women aged of 17-50 years. The examination results permitted to establish high percentage of infection of 546 patients (74%) by carcinogenic papilloma viruses. The analysis of detection rate of various genotypes of human papilloma of high carcinogenic risk established that the 56th and 16th types of high carcinogenic risk are revealed more often than others--in 33% and 15.4% correspondingly. In males, first place in occurrence rate is for those types of virus of human papilloma: the 56th n = 10 (33.3%), 16th n = 3 (10%), 45th n = 3 (10%), 51th n = 3 (10%). The rest of genotypes are detected in 3-7% cases.
Zhu, X-B; Gong, Y-H; He, J; Guo, A-L; Zhi, E-L; Yao, J-E; Zhu, B-S; Zhang, A-J; Li, Z
2017-06-01
Azoospermia factor (AZF) genes on the long arm of the human Y chromosome are involved in spermatogenesis, and microdeletions in the AZF region have been recognised to be the second major genetic cause of spermatogenetic failure resulting in male infertility. While screening for these microdeletions can avoid unnecessary medical and surgical treatments, current methods are generally time-consuming. Therefore, we established a new method to detect and analyse microdeletions in the AZF region quickly, safely and efficiently. In total, 1,808 patients with spermatogenetic failure were recruited from three hospitals in southern China, of which 600 patients were randomly selected for screening for Y chromosome microdeletions in AZF regions employing real-time polymerase chain reaction with a TaqMan probe. In our study, of 1,808 infertile patients, 150 (8.3%) were found to bear microdeletions in the Y chromosome using multiplex PCR, while no deletions were found in the controls. Among the AZF deletions detected, two were in AZFa, three in AZFb, 35 in AZFc, three in AZFb+c and two in AZFa+b+c. Our method is fast-it permits the scanning of DNA from a patient in one and a half hours-and reliable, minimising the risk of cross-contamination and false-positive and false-negative results. © 2016 Blackwell Verlag GmbH.
Denison, Amy M; Amin, Bijal D; Nicholson, William L; Paddock, Christopher D
2014-09-01
Rickettsia rickettsii, Rickettsia parkeri, and Rickettsia akari are the most common causes of spotted fever group rickettsioses indigenous to the United States. Infected patients characteristically present with a maculopapular rash, often accompanied by an inoculation eschar. Skin biopsy specimens are often obtained from these lesions for diagnostic evaluation. However, a species-specific diagnosis is achieved infrequently from pathologic specimens because immunohistochemical stains do not differentiate among the causative agents of spotted fever group rickettsiae, and existing polymerase chain reaction (PCR) assays generally target large gene segments that may be difficult or impossible to obtain from formalin-fixed tissues. This work describes the development and evaluation of a multiplex real-time PCR assay for the detection of these 3 Rickettsia species from formalin-fixed, paraffin-embedded (FFPE) skin biopsy specimens. The multiplex PCR assay was specific at discriminating each species from FFPE controls of unrelated bacterial, viral, protozoan, and fungal pathogens that cause skin lesions, as well as other closely related spotted fever group Rickettsia species. This multiplex real-time PCR demonstrates greater sensitivity than nested PCR assays in FFPE tissues and provides an effective method to specifically identify cases of Rocky Mountain spotted fever, rickettsialpox, and R. parkeri rickettsiosis by using skin biopsy specimens. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Fedio, Willis; Blackstone, George M; Kikuta-Oshima, Lynne; Wendakoon, Chitra; McGrath, Timothy H; DePaola, Angelo
2007-01-01
A real-time polymerase chain reaction (qPCR) assay for the detection of the ctxA gene of toxigenic Vibrio cholerae (Vc) was validated against standard culture techniques. The first experimental phase determined optimal enrichment conditions for detection by culture and qPCR of Vc in shrimp, bottled water, milk, and potato salad. The conditions tested included temperature (35 and 42 degrees C), time (6 and 18 h), and effect of shaking (0 and 100 rpm). No definitive trends were found with enrichment temperature or shaking on Vc isolation frequency or detection by qPCR. Generally, Vc was detected by qPCR more frequently than Vc was isolated, but this difference was significant only in the 35 degrees C 6 h enrichment without shaking. In the second phase of experiments, shrimp, bottled water, milk, potato salad, and oysters were inoculated with each of 3 toxigenic Vc strains (Latin American O1 strain, an O139 strain, and an O1 strain from the U.S. Gulf Coast) and enriched under static conditions at 42OC for 6 and 18 h. Overall, detection frequency of ctx by qPCR was 98% (88/90) and 100% (90/90) after 6 and 18 h enrichments, respectively, while Vc isolation frequency was 87% (78/90) and 83% (75/90) after 6 and 18 h, respectively. Toxigenic Vc can be detected by qPCR within an 8 h work day using the 6 h enrichment procedure, assuming an initial level of at least 1-2 colony-forming units/g; however, overnight enrichment may be necessary to detect lower levels. These data indicate that the qPCR assay for ctx is a more reliable, sensitive, and rapid alternative to standard Vc culture methods and is applicable to diverse food products.
Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton
2017-01-01
Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691
Rocha-Silva, Fabiana; Gomes, Luciana I; Gracielle-Melo, Cidiane; Goes, Alfredo M; Caligiorne, Rachel B
2017-01-01
Paracoccidioidomycosis (PCM) is a systemic mycosis caused by dimorphic fungi Paracoccidioides brasiliensis and Paracoccidioides lutzii. It is prevalent in Latin American, mainly in Brazil. Therefore, PCM has fundamental impact on the Brazilian global economy, especially in public health system, since it is affecting economical active population in different country regions. The present study aimed to standardize the Real Time-Polymerase Chain Reaction (rt-PCR) for an efficient and safe PCM diagnosis amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. To standardize a methodology of rt-PCR using species-specific primers and probe designed for annealing in this specific region of the fungi´s genome, amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. Followed by design in silico, experiments were performed in vitro to determine rt-PCR specificity, efficiency and genome detection limit. The primers and probe sequences were deposited in Brazilian Coordination of Technological Innovation and Transfer (CTIT), under patent reference number BR1020160078830. The present study demonstrated the rt-PCR applicability for support on diagnosis of paracoccidioidomycosis, presenting low cost, which makes it affordable for public health services in developing countries as Brazil. It is noteworthy that it is necessary to validate this methodology using clinical samples before to use as a safe method of diagnosis. A review of all patents related to this topic was performed and it was shown that, to date, there are no records of patent on kits for paracoccidioidomycosis´s diagnostic. Indeed, there is still a lot to go to reach this goal. The reaction developed was standardized and patented, opening perspectives to molecular diagnosis development for paracoccidioidomycosis, since rt-PCR can be applied to a broad spectrum of infectious diseases. It would need to be tested in biological
Annaratone, Laura; Volante, Marco; Asioli, Sofia; Rangel, Nelson; Bussolati, Gianni
2013-06-01
The aim of this study was to assess the suitability of using real-time quantitative PCR (RT-qPCR) to characterize neuroendocrine (NE) tumors of the pancreas. For a series of tumors, we evaluated several genes of interest, and the data were matched with the "classical" immunohistochemical (IHC) features. In 21 cases, we extracted RNA from formalin-fixed paraffin-embedded (FFPE) blocks, and in nine cases, we also extracted RNA from fresh-frozen tissue. The RT-qPCR procedure was performed using two sets of customized arrays. The test using the first set, covering 96 genes of interest, was focused on assessing the feasibility of the procedure, and the results were used to select 18 genes indicative of NE differentiation, clinical behavior, and therapeutic responsiveness for use in the second set of arrays. Threshold cycle (Ct) values were used to calculate the fold-changes in gene expression using the 2-∆∆Ct method. Statistical procedures were used to analyze the results, which were matched with the IHC and follow-up data. Material from fresh-frozen samples performed better in terms of the level of amplification, but acceptable and concordant results were also obtained from FFPE samples. In addition, high concordance was observed between the mRNA and protein expression levels of somatostatin receptor type 2A (R = 0.52, p = 0.016). Genes associated with NE differentiation, as well as the gastrin-releasing peptide receptor and O-6-methylguanine-DNA methyltransferase genes, were underexpressed, whereas angiogenesis-associated markers (CDH13 and SLIT2) were overexpressed in tissues with malignant behavior. The RT-qPCR procedure is practical and feasible in economic terms for the characterization of NE tumors of the pancreas and can complement morphological and IHC-based evaluations. Thus, the results of the RT-qPCR procedure might offer an objective basis for therapeutic choices.
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
Guglielmetti, Mariana R; Rosa, Ecinele F; Lourenção, Daniele S; Inoue, Gislene; Gomes, Elaine F; De Micheli, Giorgio; Mendes, Fausto Medeiros; Hirata, Rosário D C; Hirata, Mario H; Pannuti, Claudio M
2014-10-01
The purpose of the present investigation is to compare the presence and number of periodontal pathogens in the subgingival microbiota of smokers versus never-smokers with chronic periodontitis and matched probing depths (PDs) using real-time polymerase chain reaction (RT-PCR). Forty current smokers and 40 never-smokers, matched for age, sex, and mean PD of sampling site, were included in this investigation. A full-mouth periodontal examination was performed, and a pooled subgingival plaque sample was collected from the deepest site in each quadrant of each participant. To confirm smoking status, expired carbon monoxide (CO) concentrations were measured with a CO monitor. The presence and quantification of Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Tannerella forsythia, and Treponema denticola were determined using RT-PCR. Smokers had greater overall mean PD (P = 0.001) and attachment loss (P = 0.006) and fewer bleeding on probing sites (P = 0.001). An association was observed between smoking status and the presence of A. actinomycetemcomitans (P <0.001). The counts of A. actinomycetemcomitans (P <0.001), P. gingivalis (P = 0.042), and T. forsythia (P <0.001) were significantly higher in smokers. Smokers showed significantly greater amounts of P. gingivalis, A. actinomycetemcomitans, and T. forsythia than never-smokers. There was a significant association between smoking and the presence of A. actinomycetemcomitans.
Church, Deirdre L; Ambasta, Anshula; Wilmer, Amanda; Williscroft, Holly; Ritchie, Gordon; Pillai, Dylan R; Champagne, Sylvie; Gregson, Daniel G
2015-01-01
BACKGROUND: Pneumocystis jirovecii (PJ), a pathogenic fungus, causes severe interstitial Pneumocystis pneumonia (PCP) among immunocompromised patients. A laboratory-developed real-time polyermase chain reaction (PCR) assay was validated for PJ detection to improve diagnosis of PCP. METHODS: Forty stored bronchoalveolar lavage (BAL) samples (20 known PJ positive [PJ+] and 20 known PJ negative [PJ−]) were initially tested using the molecular assay. Ninety-two sequentially collected BAL samples were then analyzed using an immunofluorescence assay (IFA) and secondarily tested using the PJ real-time PCR assay. Discrepant results were resolved by retesting BAL samples using another real-time PCR assay with a different target. PJ real-time PCR assay performance was compared with the existing gold standard (ie, IFA) and a modified gold standard, in which a true positive was defined as a sample that tested positive in two of three methods in a patient suspected to have PCP. RESULTS: Ninety of 132 (68%) BAL fluid samples were collected from immunocompromised patients. Thirteen of 92 (14%) BALs collected were PJ+ when tested using IFA. A total of 40 BAL samples were PJ+ in the present study including: all IFA positive samples (n=13); all referred PJ+ BAL samples (n=20); and seven additional BAL samples that were IFA negative, but positive using the modified gold standard. Compared with IFA, the PJ real-time PCR had sensitivity, specificity, and positive and negative predictive values of 100%, 91%, 65% and 100%, respectively. Compared with the modified gold standard, PJ real-time PCR had a sensitivity, specificity, and positive and negative predictive values of 100%. CONCLUSION: PJ real-time PCR improved detection of PJ in immunocompromised patients. PMID:26600815
le Roux, Marie Cecilia; Hoosen, Anwar Ahmed
2017-01-01
This study was done to diagnose Mycoplasma genitalium infection based on bacterial load in urine specimens from symptomatic and asymptomatic men. Urine specimens from 94 men with visible urethral discharge, 206 with burning on micturition and 75 without symptoms presenting to a family practitioner were tested for M. genitalium as well as Neisseria gonorrhoeae, Chlamydia trachomatis, Trichomonas vaginalis by transcription-mediated amplification assays. A quantitative polymerase chain reaction assay was used to determine the bacterial load for all specimens in which M. genitalium was the only organism detected. Among the 375 specimens collected, M. genitalium was detected in 59 (15.7%) men (both symptomatic and asymptomatic) using the transcription-mediated amplification assay, and in 45 (12.0%) of the total population, it was the only pathogen detected. One or more pathogens were detected in 129 (43%) of the symptomatic men, with N. gonorrhoeae in 50 (16.7%); C. trachomatis in 37 (12.3%) and T. vaginalis present in 24 (8.0%) patients. Among the 17 patients where mixed infections were detected, M. genitalium with N. gonorrhoeae was the most common (11/17; 64.7%). Patients with visible urethral discharge had significantly higher M. genitalium concentrations than those with burning on micturition. The median M. genitalium load in symptomatic men was significantly higher than that in asymptomatic men. This study confirms the high prevalence of M. genitalium among men with urethritis in South Africa and demonstrates that there is a strong association with M. genitalium bacterial load and clinical urethritis. As the number of organisms increased, the severity of the symptoms increased, an indication of the role that the organism plays in disease progression.
One step screening of retroviral producer clones by real time quantitative PCR.
Towers, G J; Stockholm, D; Labrousse-Najburg, V; Carlier, F; Danos, O; Pagès, J C
1999-01-01
Recombinant retroviruses are obtained from either stably or transiently transfected retrovirus producer cells. In the case of stably producing lines, a large number of clones must be screened in order to select the one with the highest titre. The multi-step selection of high titre producing clones is time consuming and expensive. We have taken advantage of retroviral endogenous reverse transcription to develop a quantitative PCR assay on crude supernatant from producing clones. We used Taqman PCR technology, which, by using fluorescence measurement at each cycle of amplification, allows PCR product quantification. Fluorescence results from specific degradation of a probe oligonucleotide by the Taq polymerase 3'-5' exonuclease activity. Primers and probe sequences were chosen to anneal to the viral strong stop species, which is the first DNA molecule synthesised during reverse transcription. The protocol consists of a single real time PCR, using as template filtered viral supernatant without any other pre-treatment. We show that the primers and probe described allow quantitation of serially diluted plasmid to as few as 15 plasmid molecules. We then test 200 GFP-expressing retroviral-producing clones either by FACS analysis of infected cells or by using the quantitative PCR. We confirm that the Taqman protocol allows the detection of virus in supernatant and selection of high titre clones. Furthermore, we can determine infectious titre by quantitative PCR on genomic DNA from infected cells, using an additional set of primers and probe to albumin to normalise for the genomic copy number. We demonstrate that real time quantitative PCR can be used as a powerful and reliable single step, high throughput screen for high titre retroviral producer clones.
Rieger, Toni; Kerber, Romy; El Halas, Hussein; Pallasch, Elisa; Duraffour, Sophie; Günther, Stephan; Ölschläger, Stephan
2016-01-01
Background. Diagnosis of Ebola virus (EBOV) disease (EVD) requires laboratory testing. Methods. The RealStar Filovirus Screen reverse transcription–polymerase chain reaction (RT-PCR) kit and the derived RealStar Zaire Ebolavirus RT-PCR kit were validated using in vitro transcripts, supernatant of infected cell cultures, and clinical specimens from patients with EVD. Results. The Filovirus Screen kit detected EBOV, Sudan virus, Taï Forest virus, Bundibugyo virus, Reston virus, and Marburg virus and differentiated between the genera Ebolavirus and Marburgvirus. The amount of filovirus RNA that could be detected with a probability of 95% ranged from 11 to 67 RNA copies/reaction on a LightCycler 480 II. The Zaire Ebolavirus kit is based on the Filovirus Screen kit but was optimized for detection of EBOV. It has an improved signal-to-noise ratio at low EBOV RNA concentrations and is somewhat more sensitive than the Filovirus kit. Both kits show significantly lower analytical sensitivity on a SmartCycler II. Clinical evaluation revealed that the SmartCycler II, compared with other real-time PCR platforms, decreases the clinical sensitivity of the Filovirus Screen kit to diagnose EVD at an early stage. Conclusions. The Filovirus Screen kit detects all human-pathogenic filoviruses with good analytical sensitivity if performed on an appropriate real-time PCR platform. High analytical sensitivity is important for early diagnosis of EVD. PMID:27549586
Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.
Lo, Yat-Tung; Shaw, Pang-Chui
2017-10-25
Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.
Fréalle, E; Rocchi, S; Bacus, M; Bachelet, H; Pasquesoone, L; Tavernier, B; Mathieu, D; Millon, L; Jeanne, M
2018-05-01
Cutaneous mucormycoses, mainly due to Lichtheimia (Absidia), have occurred on several occasions in the Burn Unit of the University Hospital of Lille, France. To investigate the potential vector role of non-sterile bandages used to hold in place sterile gauze used for wound dressing. Mycological analysis by conventional culture, Mucorales real-time polymerase chain reaction (qPCR), and Lichtheimia species-specific qPCR were performed on eight crepe and six elasticized bandages that were sampled on two independent occasions in March 2014 and July 2016. Characteristics of the seven Lichtheimia mucormycoses which occurred in burn patients between November 2013 and July 2016 were also collected to assess the epidemiological relationship between potentially contaminated bandages and clinical infections. One Lichtheimia corymbifera strain was isolated from a crepe bandage by culture, and Lichtheimia spp. qPCR was positive in six out of eight crepe and four out of six elasticized bandages. Using species-specific qPCR, Lichtheimia ramosa, Lichtheimia ornata, and L. corymbifera were identified in six out of ten, five out of ten, and four out of ten bandages, respectively. In patients with mucormycosis, L. ramosa and L. ornata were present in five and two cases, respectively. Our data support the utility of Mucorales qPCR for epidemiological investigations, the potential role of these bandages in cutaneous mucormycoses in burn patients in our centre, and, consequently, the need for sterile bandages for the dressing of extensive wounds. Copyright © 2018 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.
A new ChainMail approach for real-time soft tissue simulation.
Zhang, Jinao; Zhong, Yongmin; Smith, Julian; Gu, Chengfan
2016-07-03
This paper presents a new ChainMail method for real-time soft tissue simulation. This method enables the use of different material properties for chain elements to accommodate various materials. Based on the ChainMail bounding region, a new time-saving scheme is developed to improve computational efficiency for isotropic materials. The proposed method also conserves volume and strain energy. Experimental results demonstrate that the proposed ChainMail method can not only accommodate isotropic, anisotropic and heterogeneous materials but also model incompressibility and relaxation behaviors of soft tissues. Further, the proposed method can achieve real-time computational performance.
Menard, J-P; Mazouni, C; Fenollar, F; Raoult, D; Boubli, L; Bretelle, F
2010-12-01
The purpose of this investigation was to determine the diagnostic accuracy of quantitative real-time polymerase chain reaction (PCR) assay in diagnosing bacterial vaginosis versus the standard methods, the Amsel criteria and the Nugent score. The Amsel criteria, the Nugent score, and results from the molecular tool were obtained independently from vaginal samples of 163 pregnant women who reported abnormal vaginal symptoms before 20 weeks gestation. To determine the performance of the molecular tool, we calculated the kappa value, sensitivity, specificity, and positive and negative predictive values. Either or both of the Amsel criteria (≥3 criteria) and the Nugent score (score ≥7) indicated that 25 women (15%) had bacterial vaginosis, and the remaining 138 women did not. DNA levels of Gardnerella vaginalis or Atopobium vaginae exceeded 10(9) copies/mL or 10(8) copies/mL, respectively, in 34 (21%) of the 163 samples. Complete agreement between both reference methods and high concentrations of G. vaginalis and A. vaginae was found in 94.5% of women (154/163 samples, kappa value = 0.81, 95% confidence interval 0.70-0.81). The nine samples with discordant results were categorized as intermediate flora by the Nugent score. The molecular tool predicted bacterial vaginosis with a sensitivity of 100%, a specificity of 93%, a positive predictive value of 73%, and a negative predictive value of 100%. The quantitative real-time PCR assay shows excellent agreement with the results of both reference methods for the diagnosis of bacterial vaginosis.
Influence of PCR reagents on DNA polymerase extension rates measured on real-time PCR instruments.
Montgomery, Jesse L; Wittwer, Carl T
2014-02-01
Radioactive DNA polymerase activity methods are cumbersome and do not provide initial extension rates. A simple extension rate assay would enable study of basic assumptions about PCR and define the limits of rapid PCR. A continuous assay that monitors DNA polymerase extension using noncovalent DNA dyes on common real-time PCR instruments was developed. Extension rates were measured in nucleotides per second per molecule of polymerase. To initiate the reaction, a nucleotide analog was heat activated at 95 °C for 5 min, the temperature decreased to 75 °C, and fluorescence monitored until substrate exhaustion in 30-90 min. The assay was linear with time for over 40% of the reaction and for polymerase concentrations over a 100-fold range (1-100 pmol/L). Extension rates decreased continuously with increasing monovalent cation concentrations (lithium, sodium, potassium, cesium, and ammonium). Melting-temperature depressors had variable effects. DMSO increased rates up to 33%, whereas glycerol had little effect. Betaine, formamide, and 1,2-propanediol decreased rates with increasing concentrations. Four common noncovalent DNA dyes inhibited polymerase extension. Heat-activated nucleotide analogs were 92% activated after 5 min, and hot start DNA polymerases were 73%-90% activated after 20 min. Simple DNA extension rate assays can be performed on real-time PCR instruments. Activity is decreased by monovalent cations, DNA dyes, and most melting temperature depressors. Rational inclusion of PCR components on the basis of their effects on polymerase extension is likely to be useful in PCR, particularly rapid-cycle or fast PCR.
ERIC Educational Resources Information Center
Valasek, Mark A.; Repa, Joyce J.
2005-01-01
In recent years, real-time polymerase chain reaction (PCR) has emerged as a robust and widely used methodology for biological investigation because it can detect and quantify very small amounts of specific nucleic acid sequences. As a research tool, a major application of this technology is the rapid and accurate assessment of changes in gene…
Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora
2010-01-01
A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454
Szuhai, Károly; Sandhaus, Emily; Kolkman-Uljee, Sandra M.; Lemaître, Marc; Truffert, Jean-Christophe; Dirks, Roeland W.; Tanke, Hans J.; Fleuren, Gert Jan; Schuuring, Ed; Raap, Anton K.
2001-01-01
Human papillomaviruses (HPVs) play an important role in the pathogenesis of cervical cancer. For identification of the large number of different HPV types found in (pre)malignant lesions, a robust methodology is needed that combines general HPV detection with HPV genotyping. We have developed for formaldehyde-fixed samples a strategy that, in a homogenous, real-time fluorescence polymerase chain reaction (PCR)-based assay, accomplishes general HPV detection by SybrGreen reporting of HPV-DNA amplicons, and genotyping of seven prevalent HPV types (HPV-6, -11, -16, -18, -31, -33, -45) by real-time molecular beacon PCR. The false-positive rate of the HPV SybrGreen-PCR was 4%, making it well suited as a prescreening, general HPV detection technology. The type specificity of the seven selected HPV molecular beacons was 100% and double infections were readily identified. The multiplexing capacity of the HPV molecular beacon PCR was analyzed and up to three differently labeled molecular beacons could be used in one PCR reaction without observing cross talk. The inherent quantitation capacities of real-time fluorescence PCR allowed the determination of average HPV copy number per cell. We conclude that the HPV SybrGreen-PCR in combination with the HPV molecular beacon PCR provides a robust, sensitive, and quantitative general HPV detection and genotyping methodology. PMID:11696426
Sanogo, Yibayiri O; Kim, Chang-Hyun; Lampman, Richard; Novak, Robert J
2007-07-01
In North America, West Nile and St. Louis encephalitis viruses have been detected in a wide range of vector species, but the majority of isolations continue to be from pools of mixed mosquitoes in the Culex subgenus Culex. Unfortunately, the morphologic identification of these important disease vectors is often difficult, particularly in regions of sympatry. We developed a sensitive real-time TaqMan polymerase chain reaction assay that allows reliable identification of Culex mosquitoes including Culex pipiens pipiens, Cx. p. quinquefasciatus, Cx. restuans, Cx. salinarius, Cx. nigripalpus, and Cx. tarsalis. Primers and fluorogenic probes specific to each species were designed based on sequences of the acetylcholinesterase gene (Ace2). Both immature and adult mosquitoes were successfully identified as individuals and as mixed species pools. This identification technique provides the basis for a rapid, sensitive, and high-throughput method for expounding the species-specific contribution of vectors to various phases of arbovirus transmission.
Meehan, M; Cafferkey, M; Corcoran, S; Foran, A; Hapnes, N; LeBlanc, D; McGuinness, C; Nusgen, U; O'Sullivan, N; Cunney, R; Drew, R
2015-12-01
Group B streptococcus (GBS) is a leading cause of invasive disease in infants. Accurate and rapid diagnosis is crucial to reduce morbidity and mortality. Real-time polymerase chain reaction (PCR) targeting the dltR gene was utilised for the direct detection of GBS DNA in blood and cerebrospinal fluid (CSF) from infants at an Irish maternity hospital. A retrospective review of laboratory and patient records during the period 2011-2013 was performed in order to evaluate PCR and culture for the diagnosis of invasive GBS disease. A total of 3570 blood and 189 CSF samples from 3510 infants had corresponding culture and PCR results. Culture and PCR exhibited concordance in 3526 GBS-negative samples and 13 (25%) GBS-positive samples (n = 53). Six (11%) and 34 (64%) GBS-positive samples were positive only in culture or PCR, respectively. Culture and PCR identified more GBS-positive infants (n = 47) than PCR (n = 43) or culture (n = 16) alone. Using culture as the reference standard, the sensitivity, specificity, and positive and negative predictive values for PCR on blood samples were 71.4%, 99.2%, 25% and 99.9%, and for CSF samples, they were 60%, 97.8%, 42.9% and 98.9%, respectively. The sensitivity and positive predictive values were improved (blood: 84.6% and 55%; CSF: 77.8% and 100%, respectively) when maternal risk factors and other laboratory test results were considered. The findings in this study recommend the use of direct GBS real-time PCR for the diagnosis of GBS infection in infants with a clinical suspicion of invasive disease and as a complement to culture, but should be interpreted in the light of other laboratory and clinical findings.
Hu, Meizhen; Hu, Wenbin; Xia, Zhiqiang; Zhou, Xincheng; Wang, Wenquan
2016-01-01
Reverse transcription quantitative real-time polymerase chain reaction (real-time PCR, also referred to as quantitative RT-PCR or RT-qPCR) is a highly sensitive and high-throughput method used to study gene expression. Despite the numerous advantages of RT-qPCR, its accuracy is strongly influenced by the stability of internal reference genes used for normalizations. To date, few studies on the identification of reference genes have been performed on cassava (Manihot esculenta Crantz). Therefore, we selected 26 candidate reference genes mainly via the three following channels: reference genes used in previous studies on cassava, the orthologs of the most stable Arabidopsis genes, and the sequences obtained from 32 cassava transcriptome sequence data. Then, we employed ABI 7900 HT and SYBR Green PCR mix to assess the expression of these genes in 21 materials obtained from various cassava samples under different developmental and environmental conditions. The stability of gene expression was analyzed using two statistical algorithms, namely geNorm and NormFinder. geNorm software suggests the combination of cassava4.1_017977 and cassava4.1_006391 as sufficient reference genes for major cassava samples, the union of cassava4.1_014335 and cassava4.1_006884 as best choice for drought stressed samples, and the association of cassava4.1_012496 and cassava4.1_006391 as optimal choice for normally grown samples. NormFinder software recommends cassava4.1_006884 or cassava4.1_006776 as superior reference for qPCR analysis of different materials and organs of drought stressed or normally grown cassava, respectively. Results provide an important resource for cassava reference genes under specific conditions. The limitations of these findings were also discussed. Furthermore, we suggested some strategies that may be used to select candidate reference genes. PMID:27242878
Gouvea, Maria Isabel S; Joao, Esau C; Teixeira, Maria de Lourdes B; Read, Jennifer S; Fracalanzza, Sergio E L; Souza, Claudia T V; Souza, Maria José de; Torres Filho, Helio M; Leite, Cassiana C F; do Brasil, Pedro E A A
2017-05-01
There are limited data regarding Xpert performance to detect Group B Streptococcus (GBS) in HIV-infected pregnant women. We evaluated the accuracy of a rapid real-time polymerase chain reaction (PCR) test in a cohort of HIV-infected women. At 35-37 weeks of pregnancy, a pair of combined rectovaginal swabs were collected for two GBS assays in a cohort of sequentially included HIV-infected women in Rio de Janeiro: (1) culture; and (2) real-time PCR assay [GeneXpert GBS (Cepheid, Sunnyvale, CA)]. Using culture as the reference, sensitivity, specificity, positive and negative-likelihood ratios were estimated. From June 2012 to February 2015, 337 pregnant women met inclusion criteria. One woman was later excluded, due to failure to obtain a result in the index test; 336 were included in the analyses. The GBS colonization rate was 19.04%. Sensitivity and specificity of the GeneXpert GBS assay were 85.94% (95% CI: 75.38-92.42) and 94.85% (95% CI: 91.55-96.91), respectively. Positive and negative predictive values were 79.71% (95% CI: 68.78-87.51) and 96.63% (95% CI: 93.72-98.22), respectively. GeneXpert GBS is an acceptable test for the identification of GBS colonization in HIV-infected pregnant women and represents a reasonable option to detect GBS colonization in settings where culture is not feasible.
Richards-Kortum, Rebecca
2015-01-01
It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to quantify DNA sample concentration using a standard curve. In this manuscript, a detailed protocol for developing and implementing a real-time quantitative recombinase polymerase amplification assay (qRPA assay) is provided. Using HIV-1 DNA quantification as an example, the assembly of real-time RPA reactions, the design of an internal positive control (IPC) sequence, and co-amplification of the IPC and target of interest are all described. Instructions and data processing scripts for the construction of a standard curve using data from multiple experiments are provided, which may be used to predict the concentration of unknown samples or assess the performance of the assay. Finally, an alternative method for collecting real-time fluorescence data with a microscope and a stage heater as a step towards developing a point-of-care qRPA assay is described. The protocol and scripts provided may be used for the development of a qRPA assay for any DNA target of interest. PMID:25867513
Crannell, Zachary A; Rohrman, Brittany; Richards-Kortum, Rebecca
2015-03-30
It was recently demonstrated that recombinase polymerase amplification (RPA), an isothermal amplification platform for pathogen detection, may be used to quantify DNA sample concentration using a standard curve. In this manuscript, a detailed protocol for developing and implementing a real-time quantitative recombinase polymerase amplification assay (qRPA assay) is provided. Using HIV-1 DNA quantification as an example, the assembly of real-time RPA reactions, the design of an internal positive control (IPC) sequence, and co-amplification of the IPC and target of interest are all described. Instructions and data processing scripts for the construction of a standard curve using data from multiple experiments are provided, which may be used to predict the concentration of unknown samples or assess the performance of the assay. Finally, an alternative method for collecting real-time fluorescence data with a microscope and a stage heater as a step towards developing a point-of-care qRPA assay is described. The protocol and scripts provided may be used for the development of a qRPA assay for any DNA target of interest.
Sato, M; Yamazaki, J; Goto-Koshino, Y; Takahashi, M; Fujino, Y; Ohno, K; Tsujimoto, H
2011-01-01
The cytoreductive efficacy of the individual components of multidrug chemotherapy for canine lymphoma is difficult to evaluate after complete remission. To compare the cytoreductive efficacy of vincristine (VCR), cyclophosphamide (CPA), and doxorubicin (DXR) in dogs that received a 6-month modified version of the University of Wisconsin-Madison chemotherapy protocol (UW-25). Twenty-nine dogs with high-grade B-cell multicentric lymphoma. Rearranged immunoglobulin heavy chain gene fragments from lymphoma cells were amplified by polymerase chain reaction (PCR) and sequenced to prepare clone-specific primers and probes for real-time PCR. The number of lymphoma cells in peripheral blood was measured from diagnosis to week 11 of UW-25. The number of lymphoma cells after the 1st administration of VCR, CPA, and DXR in weeks 1-4 was decreased in 29/29 (100%), 15/29 (51.7%), and 26/27 (96.3%) dogs, respectively. The cytoreductive efficacy of CPA was less than that of VCR and DXR. VCR, CPA, and DXR administered in weeks 6-9 were effective in 5/26 (19.2%), 5/20 (25.0%), and 14/19 (73.7%) dogs, respectively, indicating the sustained cytoreductive efficacy of DXR. CPA nonresponders were heavier and exhibited a shorter 1st remission than CPA responders. When using UW-25 for treatment of canine lymphoma, CPA was found to have less cytoreductive efficacy than VCR and DXR. Real-time PCR-based quantification of tumor cells is an objective marker of the efficacy of chemotherapeutic agents. Copyright © 2011 by the American College of Veterinary Internal Medicine.
Calibration-free assays on standard real-time PCR devices
Debski, Pawel R.; Gewartowski, Kamil; Bajer, Seweryn; Garstecki, Piotr
2017-01-01
Quantitative Polymerase Chain Reaction (qPCR) is one of central techniques in molecular biology and important tool in medical diagnostics. While being a golden standard qPCR techniques depend on reference measurements and are susceptible to large errors caused by even small changes of reaction efficiency or conditions that are typically not marked by decreased precision. Digital PCR (dPCR) technologies should alleviate the need for calibration by providing absolute quantitation using binary (yes/no) signals from partitions provided that the basic assumption of amplification a single target molecule into a positive signal is met. Still, the access to digital techniques is limited because they require new instruments. We show an analog-digital method that can be executed on standard (real-time) qPCR devices. It benefits from real-time readout, providing calibration-free assessment. The method combines advantages of qPCR and dPCR and bypasses their drawbacks. The protocols provide for small simplified partitioning that can be fitted within standard well plate format. We demonstrate that with the use of synergistic assay design standard qPCR devices are capable of absolute quantitation when normal qPCR protocols fail to provide accurate estimates. We list practical recipes how to design assays for required parameters, and how to analyze signals to estimate concentration. PMID:28327545
Calibration-free assays on standard real-time PCR devices
NASA Astrophysics Data System (ADS)
Debski, Pawel R.; Gewartowski, Kamil; Bajer, Seweryn; Garstecki, Piotr
2017-03-01
Quantitative Polymerase Chain Reaction (qPCR) is one of central techniques in molecular biology and important tool in medical diagnostics. While being a golden standard qPCR techniques depend on reference measurements and are susceptible to large errors caused by even small changes of reaction efficiency or conditions that are typically not marked by decreased precision. Digital PCR (dPCR) technologies should alleviate the need for calibration by providing absolute quantitation using binary (yes/no) signals from partitions provided that the basic assumption of amplification a single target molecule into a positive signal is met. Still, the access to digital techniques is limited because they require new instruments. We show an analog-digital method that can be executed on standard (real-time) qPCR devices. It benefits from real-time readout, providing calibration-free assessment. The method combines advantages of qPCR and dPCR and bypasses their drawbacks. The protocols provide for small simplified partitioning that can be fitted within standard well plate format. We demonstrate that with the use of synergistic assay design standard qPCR devices are capable of absolute quantitation when normal qPCR protocols fail to provide accurate estimates. We list practical recipes how to design assays for required parameters, and how to analyze signals to estimate concentration.
Samson, Maria Cristina; Gullì, Mariolina; Marmiroli, Nelson
2010-07-01
Methodologies that enable the detection of genetically modified organisms (GMOs) (authorized and non-authorized) in food and feed strongly influence the potential for adequate updating and implementation of legislation together with labeling requirements. Quantitative polymerase chain reaction (qPCR) systems were designed to boost the sensitivity and specificity on the identification of GMOs in highly degraded DNA samples; however, such testing will become economically difficult to cope with due to increasing numbers of approved genetically modified (GM) lines. Multiplexing approaches are therefore in development to provide cost-efficient solution. Construct-specific primers and probe were developed for quantitative analysis of Roundup Ready soybean (RRS) event glyphosate-tolerant soybean (GTS) 40-3-2. The lectin gene (Le1) was used as a reference gene, and its specificity was verified. RRS- and Le1-specific quantitative real-time PCR (qRTPCR) were optimized in a duplex platform that has been validated with respect to limit of detection (LOD) and limit of quantification (LOQ), as well as accuracy. The analysis of model processed food samples showed that the degradation of DNA has no adverse or little effects on the performance of quantification assay. In this study, a duplex qRTPCR using TaqMan minor groove binder-non-fluorescent quencher (MGB-NFQ) chemistry was developed for specific detection and quantification of RRS event GTS 40-3-2 that can be used for practical monitoring in processed food products.
Kwak, Yoonjin; Nam, Soo Kyung; Shin, Eun; Ahn, Sang-Hoon; Lee, Hee Eun; Park, Do Joong; Kim, Woo Ho; Kim, Hyung-Ho; Lee, Hye Seung
2016-05-01
Sentinel lymph node (SLN)-based diagnosis in gastric cancers has shown varied sensitivities and false-negative rates in several studies. Application of the reverse transcription-polymerase chain reaction (RT-PCR) in SLN diagnosis has recently been proposed. A total of 155 SLNs from 65 patients with cT1-2, N0 gastric cancer were examined. The histopathologic results were compared with results obtained by real-time RT-PCR for detecting molecular RNA (mRNA) of cytokeratin (CK)19, carcinoembryonic antigen (CEA), and CK20. The sensitivity and specificity of the multiple marker RT-PCR assay standardized against the results of the postoperative histological examination were 0.778 (95% confidence interval [CI], 0.577-0.914) and 0.781 (95% CI, 0.700-0.850), respectively. In comparison, the sensitivity and specificity of intraoperative diagnosis were 0.819 (95% CI, 0.619-0.937) and 1.000 (95% CI, 0.972-1.000), respectively. The positive predictive value of the multiple-marker RT-PCR assay was 0.355 (95% CI, 0.192-0.546) for predicting non-SLN metastasis, which was lower than that of intraoperative diagnosis (0.813, 95% CI, 0.544-0.960). The real-time RT-PCR assay could detect SLN metastasis in gastric cancer. However, the predictive value of the real-time RT-PCR assay was lower than that of precise histopathologic examination and did not outweigh that of our intraoperative SLN diagnosis. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Chang, Hye-Sook; Mizukami, Keijiro; Yabuki, Akira; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Arai, Toshiro; Yamato, Osamu
2010-09-01
Collie eye anomaly (CEA) is a canine inherited ocular disease that shows a wide variety of manifestations and severity of clinical lesions. Recently, a CEA-associated mutation was reported, and a DNA test that uses conventional polymerase chain reaction (PCR) has now become available. The objective of the current study was to develop a novel rapid genotyping technique by using SYBR Green-based real-time PCR for future large-scale surveys as a key part in the strategy to eradicate CEA by selective breeding. First, a SYBR Green-based real-time PCR assay for genotyping of CEA was developed and evaluated by using purified DNA samples from normal, carrier, and affected Border Collies in which genotypes had previously been determined by conventional PCR. This real-time PCR assay demonstrated appropriate amplifications in all genotypes, and the results were consistent with those of conventional PCR. Second, the availability of Flinders Technology Associates filter paper (FTA card) as DNA templates for the real-time PCR assay was evaluated by using blood and saliva specimens to determine suitability for CEA screening. DNA-containing solution prepared from a disc of blood- or saliva-spotted FTA cards was available directly as templates for the real-time PCR assay when the volume of solution was 2.5% of the PCR mixture. In conclusion, SYBR Green-based real-time PCR combined with FTA cards is a rapid genotyping technique for CEA that can markedly shorten the overall time required for genotyping as well as simplify the sample preparation. Therefore, this newly developed technique suits large-scale screening in breeding populations of Collie-related breeds.
Ammour, Y; Faizuloev, E; Borisova, T; Nikonova, A; Dmitriev, G; Lobodanov, S; Zverev, V
2013-01-01
In this study, a rapid quantitative method using TaqMan-based real-time reverse transcription-polymerase chain reaction (qPCR-RT) has been developed for estimating the titers of measles, mumps and rubella (MMR) viruses in infected cell culture supernatants. The qPCR-RT assay was demonstrated to be a specific, sensitive, efficient and reproducible method. For MMR viral samples obtained during MMR viral propagations in Vero cells at a different multiplicity of infection, titers determined by the qPCR-RT assay have been compared with estimates of infectious virus obtained by a traditional commonly used method for MMR viruses - 50% cell culture infective dose (CCID(50)) assay, in paired samples. Pearson analysis evidenced a significant correlation between both methods for a certain period after viral inoculation. Furthermore, the established qPCR-RT assay was faster and less-laborious. The developed method could be used as an alternative method or a supplementary tool for the routine titer estimation during MMR vaccine production. Copyright © 2012 Elsevier B.V. All rights reserved.
Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao
2016-12-20
Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.
Nixon, Gavin J; Svenstrup, Helle F; Donald, Carol E; Carder, Caroline; Stephenson, Judith M; Morris-Jones, Stephen; Huggett, Jim F; Foy, Carole A
2014-12-01
Molecular diagnostic measurements are currently underpinned by the polymerase chain reaction (PCR). There are also a number of alternative nucleic acid amplification technologies, which unlike PCR, work at a single temperature. These 'isothermal' methods, reportedly offer potential advantages over PCR such as simplicity, speed and resistance to inhibitors and could also be used for quantitative molecular analysis. However there are currently limited mechanisms to evaluate their quantitative performance, which would assist assay development and study comparisons. This study uses a sexually transmitted infection diagnostic model in combination with an adapted metric termed isothermal doubling time (IDT), akin to PCR efficiency, to compare quantitative PCR and quantitative loop-mediated isothermal amplification (qLAMP) assays, and to quantify the impact of matrix interference. The performance metric described here facilitates the comparison of qLAMP assays that could assist assay development and validation activities.
Tan, Martha; Vernes, Jean-Michel; Chan, Joyce; Cuellar, Trinna L; Asundi, Aarati; Nelson, Christopher; Yip, Victor; Shen, Ben; Vandlen, Richard; Siebel, Christian; Meng, Y Gloria
2012-11-15
Short interfering RNA (siRNA) has therapeutic potential. However, efficient delivery is a formidable task. To facilitate delivery of siRNA into cells, we covalently conjugated siRNA to antibodies that bind to cell surface proteins and internalize. Understanding how these antibody-siRNA conjugates function in vivo requires pharmacokinetic analysis. Thus, we developed a simple real-time antigen capture reverse transcription-polymerase chain reaction (RT-PCR) assay to detect intact antibody-siRNA conjugates. Biotinylated antigen bound to streptavidin-coated PCR tubes was used to capture antibody-siRNA conjugate. The captured antibody-siRNA conjugate was then reverse-transcribed in the same tube, avoiding a sample transfer step. This reproducible assay had a wide standard curve range of 0.029 to 480ng/ml and could detect as low as 0.58ng/ml antibody-siRNA conjugates in mouse serum. The presence of unconjugated antibody that could be generated from siRNA degradation in vivo did not affect the assay as long as the total antibody concentration in the antigen capture step did not exceed 480ng/ml. Using this assay, we observed a more rapid decrease in serum antibody-siRNA conjugate concentrations than the total antibody concentrations in mice dosed with antibody-siRNA conjugates, suggesting loss of siRNA from the antibody. This assay is useful for optimizing antibody-siRNA and likely aptamer-siRNA conjugates to improve pharmacokinetics and aid siRNA delivery. Copyright © 2012 Elsevier Inc. All rights reserved.
Wen, Dong-Yue; Lin, Peng; Pang, Yu-Yan; Chen, Gang; He, Yun; Dang, Yi-Wu; Yang, Hong
2018-05-05
BACKGROUND Long non-coding RNAs (lncRNAs) have a role in physiological and pathological processes, including cancer. The aim of this study was to investigate the expression of the long intergenic non-protein coding RNA 665 (LINC00665) gene and the cell cycle in hepatocellular carcinoma (HCC) using database analysis including The Cancer Genome Atlas (TCGA), the Gene Expression Omnibus (GEO), and quantitative real-time polymerase chain reaction (qPCR). MATERIAL AND METHODS Expression levels of LINC00665 were compared between human tissue samples of HCC and adjacent normal liver, clinicopathological correlations were made using TCGA and the GEO, and qPCR was performed to validate the findings. Other public databases were searched for other genes associated with LINC00665 expression, including The Atlas of Noncoding RNAs in Cancer (TANRIC), the Multi Experiment Matrix (MEM), Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) and protein-protein interaction (PPI) networks. RESULTS Overexpression of LINC00665 in patients with HCC was significantly associated with gender, tumor grade, stage, and tumor cell type. Overexpression of LINC00665 in patients with HCC was significantly associated with overall survival (OS) (HR=1.47795%; CI: 1.046-2.086). Bioinformatics analysis identified 469 related genes and further analysis supported a hypothesis that LINC00665 regulates pathways in the cell cycle to facilitate the development and progression of HCC through ten identified core genes: CDK1, BUB1B, BUB1, PLK1, CCNB2, CCNB1, CDC20, ESPL1, MAD2L1, and CCNA2. CONCLUSIONS Overexpression of the lncRNA, LINC00665 may be involved in the regulation of cell cycle pathways in HCC through ten identified hub genes.
Computing Quantitative Characteristics of Finite-State Real-Time Systems
1994-05-04
Current methods for verifying real - time systems are essentially decision procedures that establish whether the system model satisfies a given...specification. We present a general method for computing quantitative information about finite-state real - time systems . We have developed algorithms that...our technique can be extended to a more general representation of real - time systems , namely, timed transition graphs. The algorithms presented in this
Wood, Susanna A; Zaiko, Anastasija; Richter, Ingrid; Inglis, Graeme J; Pochon, Xavier
2017-07-01
The Mediterranean fanworm, Sabella spallanzanii Gmelin 1791, was first detected in the Southern Hemisphere in the 1990s and is now abundant in many parts of southern Australia and in several locations around northern New Zealand. Once established, it can proliferate rapidly, reaching high densities with potential ecological and economic impacts. Early detection of new S. spallanzanii incursions is important to prevent its spread, guide eradication or control efforts and to increase knowledge on the species' dispersal pathways. In this study, we developed a TaqMan probe real-time polymerase chain reaction assay targeting a region of the mitochondrial cytochrome oxidase I gene. The assay was validated in silico and in vitro using DNA from New Zealand and Australian Sabellidae with no cross-reactivity detected. The assay has a linear range of detection over seven orders of magnitude with a limit of detection reached at 12.4 × 10 -4 ng/μL of DNA. We analysed 145 environmental (water, sediment and biofouling) samples and obtained positive detections only from spiked samples and those collected at a port where S. spallanzanii is known to be established. This assay has the potential to enhance current morphological and molecular-based methods, through its ability to rapidly and accurately identify S. spallanzanii in environmental samples.
Aquino-Andrade, Alejandra; Martínez-Leyva, Gabriel; Mérida-Vieyra, Jocelin; Saltigeral, Patricia; Lara, Antonino; Domínguez, Wendy; García de la Puente, Silvestre; De Colsa, Agustín
2017-09-01
To evaluate the usefulness of real-time polymerase chain reaction (RT-PCR) as a diagnostic method for the detection of Bordetella pertussis in hospitalized patients aged <1 year with a clinical diagnosis of whooping cough, as well as to identify the role of household contacts as a source of infection. This was a prospective, multicenter study of infants aged <1 year who were hospitalized with symptoms suggestive of whooping cough. Nasopharyngeal samples were obtained for culture and RT-PCR testing. The clinical and epidemiologic characteristics and outcomes were analyzed. B pertussis detection and symptoms in household contacts of patients diagnosed with pertussis were studied. A total of 286 patients were included; of these, 67.1% had B pertussis and 4.5% had Bordetella spp. Complications occurred in 20% of patients, and the mortality rate was 6.7%. Of 434 contacts studied, 111 were mothers of study infants, representing the most frequently B pertussis-infected group and the main symptomatic contact. The use of RT-PCR permits improved detection and diagnosis of pertussis and a better understanding of the epidemiology of sources of infection. The complications and mortality rate of pertussis continue to be high. Household contacts are confirmed as a frequent source of infection of B pertussis in young children. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Thiele, Elizabeth A; Cama, Vitaliano A; Lakwo, Thomson; Mekasha, Sindeaw; Abanyie, Francisca; Sleshi, Markos; Kebede, Amha; Cantey, Paul T
2016-04-01
Microscopic evaluation of skin biopsies is the monitoring and evaluation (M and E) method currently used by multiple onchocerciasis elimination programs in Africa. However, as repeated mass drug administration suppresses microfilarial loads, the sensitivity and programmatic utility of skin snip microscopy is expected to decrease. Using a pan-filarial real-time polymerase chain reaction with melt curve analysis (qPCR-MCA), we evaluated 1) the use of a single-step molecular assay for detecting and identifying Onchocerca volvulus microfilariae in residual skin snips and 2) the sensitivity of skin snip microscopy relative to qPCR-MCA. Skin snips were collected and examined with routine microscopy in hyperendemic regions of Uganda and Ethiopia (N= 500 each) and "residual" skin snips (tissue remaining after induced microfilarial emergence) were tested with qPCR-MCA. qPCR-MCA detected Onchocerca DNA in 223 residual snips: 139 of 147 microscopy(+) and 84 among microscopy(-) snips, suggesting overall sensitivity of microscopy was 62.3% (139/223) relative to qPCR-MCA (75.6% in Uganda and 28.6% in Ethiopia). These findings demonstrate the insufficient sensitivity of skin snip microscopy for reliable programmatic monitoring. Molecular tools such as qPCR-MCA can augment sensitivity and provide diagnostic confirmation of skin biopsies and will be useful for evaluation or validation of new onchocerciasis M and E tools. © The American Society of Tropical Medicine and Hygiene.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
A Quantitative Approach to the Formal Verification of Real-Time Systems.
1996-09-01
Computer Science A Quantitative Approach to the Formal Verification of Real - Time Systems Sergio Vale Aguiar Campos September 1996 CMU-CS-96-199...ptisiic raieaiSI v Diambimos Lboiamtad _^ A Quantitative Approach to the Formal Verification of Real - Time Systems Sergio Vale Aguiar Campos...implied, of NSF, the Semiconduc- tor Research Corporation, ARPA or the U.S. government. Keywords: real - time systems , formal verification, symbolic
Vongsakulyanon, A; Kitpoka, P; Kunakorn, M; Srikhirin, T
2015-12-01
To develop reliable and convenient methods for Miltenberger (Mi(a) ) blood group typing. To apply real-time polymerase chain reaction (qPCR) melting curve analysis to Mi(a) blood group typing. The Mi(a) blood group is the collective set of glycophorin hybrids in the MNS blood group system. Mi(a+) blood is common among East Asians and is also found in the Thai population. Incompatible Mi(a) blood transfusions pose the risk of life-threatening haemolysis; therefore, Mi(a) blood group typing is necessary in ethnicities where the Mi(a) blood group is prevalent. One hundred and forty-three blood samples from Thai blood donors were used in the study. The samples included 50 Mi(a+) samples and 93 Mi(a-) samples, which were defined by serology. The samples were typed by Mi(a) typing qPCR, and 50 Mi(a+) samples were sequenced to identify the Mi(a) subtypes. Mi(a) subtyping qPCR was performed to define GP.Mur. Both Mi(a) typing and Mi(a) subtyping were tested on a conventional PCR platform. The results of Mi(a) typing qPCR were all concordant with serology. Sequencing of the 50 Mi(a+) samples revealed 47 GP.Mur samples and 3 GP.Hop or Bun samples. Mi(a) subtyping qPCR was the supplementary test used to further define GP.Mur from other Mi(a) subtypes. Both Mi(a) typing and Mi(a) subtyping performed well using a conventional PCR platform. Mi(a) typing qPCR correctly identified Mi(a) blood groups in a Thai population with the feasibility of Mi(a) subtype discrimination, and Mi(a) subtyping qPCR was able to further define GP.Mur from other Mi(a) subtypes. © 2015 British Blood Transfusion Society.
Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T
2017-01-01
Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.
Benden, Christian; Aurora, Paul; Burch, Michael; Cubitt, David; Lloyd, Cathryn; Whitmore, Pauline; Neligan, Sophie L; Elliott, Martin J
2005-12-01
Elevation in Epstein-Barr virus (EBV) load measured in peripheral blood has been proposed as a marker for development of post-transplant lymphoproliferative disease (PTLD), but there are few published data examining this relationship. We report the longitudinal surveillance of EBV for all recipients of heart (HTx), heart-lung (HLTx) and lung (LTx) transplants at our institution. The study population included all patients transplanted between January 2003 and July 2004. EBV load was serially measured in peripheral blood by real-time polymerase chain reaction (PCR). Results were correlated with recipient pre-transplant EBV status and development of PTLD. Forty-four transplant operations were performed, including 33 HTx, 6 HLTx and 5 LTx. Thirty-two (73%) of the patients were EBV seropositive pre-transplant. Nineteen (44%) pediatric recipients developed EB viremia, including 17 HTx, 1 HLTx and 1 LTx. Eleven (58%) of these patients were EBV seropositive pre-transplant. EBV was first detected at a median of 30.5 days (range 2 to 81) post-transplant. The median peak EBV load in that group was 10,099 copies/ml (range 5,935 to 255,466) whole blood. One patient with cystic fibrosis post-LTx developed PTLD localized in the colon. This patient was EBV seronegative pre-transplant; peak EBV load was 14,513 copies/ml. Acute infectious mononucleosis was seen in 1 case. Positive pre-transplant EBV status did not predict post-transplant EB viremia (positive predictive value 0.03). Contrary to earlier reports, our data demonstrate that a high EBV load does not lead to PTLD early post-transplant. These results do not support the practice of pre-emptively reducing immunosuppression in patients with raised EBV load.
Odendaal, Lieza; Fosgate, Geoffrey T; Romito, Marco; Coetzer, Jacobus A W; Clift, Sarah J
2014-01-01
Real-time reverse transcription polymerase chain reaction (real-time RT-PCR), histopathology, and immunohistochemical labeling (IHC) were performed on liver specimens from 380 naturally infected cattle and sheep necropsied during the 2010 Rift Valley fever (RVF) epidemic in South Africa. Sensitivity (Se) and specificity (Sp) of real-time RT-PCR, histopathology, and IHC were estimated in a latent-class model using a Bayesian framework. The Se and Sp of real-time RT-PCR were estimated as 97.4% (95% confidence interval [CI] = 95.2-98.8%) and 71.7% (95% CI = 65-77.9%) respectively. The Se and Sp of histopathology were estimated as 94.6% (95% CI = 91-97.2%) and 92.3% (95% CI = 87.6-95.8%), respectively. The Se and Sp of IHC were estimated as 97.6% (95% CI = 93.9-99.8%) and 99.4% (95% CI = 96.9-100%), respectively. Decreased Sp of real-time RT-PCR was ascribed to cross-contamination of samples. Stratified analysis of the data suggested variations in test accuracy with fetuses and severely autolyzed specimens. The Sp of histopathology in fetuses (83%) was 9.3% lower than the sample population (92.3%). The Se of IHC decreased from 97.6% to 81.5% in the presence of severe autolysis. The diagnostic Se and Sp of histopathology was higher than expected, confirming the value of routine postmortem examinations and histopathology of liver specimens. Aborted fetuses, however, should be screened using a variety of tests in areas endemic for RVF, and results from severely autolyzed specimens should be interpreted with caution. The most feasible testing option for countries lacking suitably equipped laboratories seems to be routine histology in combination with IHC.
Orsi, Carlotta Francesca; Gennari, William; Venturelli, Claudia; La Regina, Annunziata; Pecorari, Monica; Righi, Elena; Machetti, Marco; Blasi, Elisabetta
2012-06-01
This article investigates the performance of 2 commercial real-time polymerase chain reaction (PCR) assays, MycAssay™ Aspergillus (Myc(Asp)Assay) and MycAssay™ Pneumocystis (Myc(PCP)Assay), on the ABI 7300 platform for the detection of Aspergillus (Asp) or Pneumocystis jirovecii (Pj) DNA in bronchoalveolar lavage (BAL) samples from 20 patients. Operationally, patients enrolled were clustered into 3 groups: invasive aspergillosis group (IA, 7 patients), Pj pneumonia group (PCP, 8 patients), and negative control group (5 patients). All the IA patients were Myc(Asp)Assay positive, whereas 12 non-IA patients returned negative PCR results. Furthermore, 7 of 8 PCP patients were Myc(PCP)Assay positive, while 9 non-PCP patients were PCR negative. In conclusion, these data provide an early indication of the effectiveness of both the Myc(Asp)Assay and Myc(PCP)Assay on the ABI 7300 platform for the detection of either Asp or Pj DNA in BAL from patients with deep fungal infections. Copyright © 2012 Elsevier Inc. All rights reserved.
Wang, H; Wang, J; Li, G
2016-06-27
Panax ginseng is one of the most important medicinal plants in the Orient. Owing to its increasing demand in the world market, cultivated ginseng has become the main source of medicinal material. Among the Chinese ginseng cultivars, Damaya commands higher prices and is grown in significant proportions among the local ginseng population. Due to the lack of rapid and accurate authentication methods, Damaya is distributed among different cultivars in the local ginseng population in China. Here, we identified a unique, Damaya-specific single nucleotide polymorphism (SNP) site present in the second intron of mitochondrial cytochrome c oxidase subunit 2 (cox2). Based on this SNP, a Damaya cultivar-specific primer was designed and an allele-specific polymerase chain reaction (PCR) was optimized for the effective molecular authentication of Damaya. We designed a method by combining a simple DNA isolation method with real-time allele-specific PCR using SYBR Green I fluorescent dye, and proved its efficacy in clearly discriminated Damaya cultivar from other Chinese ginseng cultivars according to the allelic discrimination analysis. Hence, this study provides a simple and rapid assay for the differentiation and conservation of Damaya from the local Chinese ginseng population.
Dolan, Liam; Langdale, Jane A.
2015-01-01
Real-time quantitative polymerase chain reaction (qPCR) has become widely used as a method to compare gene transcript levels across different conditions. However, selection of suitable reference genes to normalize qPCR data is required for accurate transcript level analysis. Recently, Marchantia polymorpha has been adopted as a model for the study of liverwort development and land plant evolution. Identification of appropriate reference genes has therefore become a necessity for gene expression studies. In this study, transcript levels of eleven candidate reference genes have been analyzed across a range of biological contexts that encompass abiotic stress, hormone treatment and different developmental stages. The consistency of transcript levels was assessed using both geNorm and NormFinder algorithms, and a consensus ranking of the different candidate genes was then obtained. MpAPT and MpACT showed relatively constant transcript levels across all conditions tested whereas the transcript levels of other candidate genes were clearly influenced by experimental conditions. By analyzing transcript levels of phosphate and nitrate starvation reporter genes, we confirmed that MpAPT and MpACT are suitable reference genes in M. polymorpha and also demonstrated that normalization with an inappropriate gene can lead to erroneous analysis of qPCR data. PMID:25798897
Polymerase chain reaction system
Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.
2004-03-02
A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.
Kim, Ji Yeun; Lee, Jung-Lim
2014-10-01
This study describes the first multiplex real-time polymerase chain reaction assay developed, as a multipurpose assessment, for the simultaneous quantification of total bacteria and three Vibrio spp. (V. parahaemolyticus, V. vulnificus and V. anguillarum) in fish and seawater. The consumption of raw finfish as sushi or sashimi has been increasing the chance of Vibrio outbreaks in consumers. Freshness and quality of fishery products also depend on the total bacterial populations present. The detection sensitivity of the specific targets for the multiplex assay was 1 CFU mL⁻¹ in pure culture and seawater, and 10 CFU g⁻¹ in fish. While total bacterial counts by the multiplex assay were similar to those obtained by cultural methods, the levels of Vibrio detected by the multiplex assay were generally higher than by cultural methods of the same populations. Among the natural samples without Vibrio spp. inoculation, eight out of 10 seawater and three out of 20 fish samples were determined to contain Vibrio spp. Our data demonstrate that this multiplex assay could be useful for the rapid detection and quantification of Vibrio spp. and total bacteria as a multipurpose tool for surveillance of fish and water quality as well as diagnostic method. © 2014 The Authors. Journal of the Science of Food and Agriculture published by JohnWiley & Sons Ltd on behalf of Society of Chemical Industry.
Kim, Ji Yeun; Lee, Jung-Lim
2014-01-01
Background This study describes the first multiplex real-time polymerase chain reaction assay developed, as a multipurpose assessment, for the simultaneous quantification of total bacteria and three Vibrio spp. (V. parahaemolyticus, V. vulnificus and V. anguillarum) in fish and seawater. The consumption of raw finfish as sushi or sashimi has been increasing the chance of Vibrio outbreaks in consumers. Freshness and quality of fishery products also depend on the total bacterial populations present. Results The detection sensitivity of the specific targets for the multiplex assay was 1 CFU mL−1 in pure culture and seawater, and 10 CFU g−1 in fish. While total bacterial counts by the multiplex assay were similar to those obtained by cultural methods, the levels of Vibrio detected by the multiplex assay were generally higher than by cultural methods of the same populations. Among the natural samples without Vibrio spp. inoculation, eight out of 10 seawater and three out of 20 fish samples were determined to contain Vibrio spp. Conclusion Our data demonstrate that this multiplex assay could be useful for the rapid detection and quantification of Vibrio spp. and total bacteria as a multipurpose tool for surveillance of fish and water quality as well as diagnostic method. © 2014 The Authors. Journal of the Science of Food and Agriculture published by JohnWiley & Sons Ltd on behalf of Society of Chemical Industry. PMID:24752974
Residual eDNA detection sensitivity assessed by quantitative real-time PCR in a river ecosystem.
Balasingham, Katherine D; Walter, Ryan P; Heath, Daniel D
2017-05-01
Several studies have demonstrated that environmental DNA (eDNA) can be used to detect the presence of aquatic species, days to weeks after the target species has been removed. However, most studies used eDNA analysis in lentic systems (ponds or lakes), or in controlled laboratory experiments. While eDNA degrades rapidly in all aquatic systems, it also undergoes dilution effects and physical destruction in flowing systems, complicating detection in rivers. However, some eDNA (i.e. residual eDNA) can be retained in aquatic systems, even those subject to high flow regimes. Our goal was to determine residual eDNA detection sensitivity using quantitative real-time polymerase chain reaction (qRT-PCR), in a flowing, uncontrolled river after the eDNA source was removed from the system; we repeated the experiment over 2 years. Residual eDNA had the strongest signal strength at the original source site and was detectable there up to 11.5 h after eDNA source removal. Residual eDNA signal strength decreased as sampling distance downstream from the eDNA source site increased, and was no longer detectable at the source site 48 h after the eDNA source water was exhausted in both experiments. This experiment shows that residual eDNA sampled in surface water can be mapped quantitatively using qRT-PCR, which allows a more accurate spatial identification of the target species location in lotic systems, and relative residual eDNA signal strength may allow the determination of the timing of the presence of target species. © 2016 John Wiley & Sons Ltd.
Mulholland, Catherine; McMenamy, Michael J; Hoffmann, Bernd; Earley, Bernadette; Markey, Bryan; Cassidy, Joseph; Allan, Gordon; Welsh, Michael D; McKillen, John
2017-07-01
Bluetongue virus (BTV) is an infectious, non-contagious viral disease of domestic and wild ruminants that is transmitted by adult females of certain Culicoides species. Since 2006, several serotypes including BTV-1, 2, 4, 6, 8, 9 and 16, have spread from the Mediterranean basin into Northern Europe for the first time. BTV-8 in particular, caused a major epidemic in northern Europe. As a result, it is evident that most European countries are at risk of BTV infection. The objective of this study was to develop and validate a real-time reverse transcriptase-polymerase chain reaction (rRT-PCR) assay based on TaqMan technology for the detection of representative strains of all BTV serotypes. Primers and probes were based on genome segment 10 of the virus, the NS3 gene. The assay was tested for sensitivity, and specificity. The analytical sensitivity of the rRT-PCR assay was 200 copies of RNA per reaction. The assay did not amplify the closely related orbivirus epizootic hemorrhagic disease virus (EHDV) but successfully detected all BTV reference strains including clinical samples from animals experimentally infected with BTV-8. This real time RT-PCR assay offers a sensitive, specific and rapid alternative assay for the pan detection of BTV that could be used as part of a panel of diagnostic assays for the detection of all serotypes of BTV. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Martinez-Serra, Jordi; Robles, Juan; Nicolàs, Antoni; Gutierrez, Antonio; Ros, Teresa; Amat, Juan Carlos; Alemany, Regina; Vögler, Oliver; Abelló, Aina; Noguera, Aina; Besalduch, Joan
2014-01-01
Blood samples are extensively used for the molecular diagnosis of many hematological diseases. The daily practice in a clinical laboratory of molecular diagnosis in hematology involves using a variety of techniques, based on the amplification of nucleic acids. Current methods for polymerase chain reaction (PCR) use purified genomic DNA, mostly isolated from total peripheral blood cells or white blood cells (WBC). In this paper we describe a real-time fluorescence resonance energy transfer-based method for genotyping directly from blood cells. Our strategy is based on an initial isolation of the WBCs, allowing the removal of PCR inhibitors, such as the heme group, present in the erythrocytes. Once the erythrocytes have been lysed, in the LightCycler(®) 2.0 Instrument, we perform a real-time PCR followed by a melting curve analysis for different genes (Factors 2, 5, 12, MTHFR, and HFE). After testing 34 samples comparing the real-time crossing point (CP) values between WBC (5×10(6) WBC/mL) and purified DNA (20 ng/μL), the results for F5 Leiden were as follows: CP mean value for WBC was 29.26±0.566 versus purified DNA 24.79±0.56. Thus, when PCR was performed from WBC (5×10(6) WBC/mL) instead of DNA (20 ng/μL), we observed a delay of about 4 cycles. These small differences in CP values were similar for all genes tested and did not significantly affect the subsequent analysis by melting curves. In both cases the fluorescence values were high enough, allowing a robust genotyping of all these genes without a previous DNA purification/extraction.
Gan, Xiao-Ning; Luo, Jie; Tang, Rui-Xue; Wang, Han-Lin; Zhou, Hong; Qin, Hui; Gan, Ting-Qing; Chen, Gang
2017-05-01
The role and mechanism of miR-452-5p in lung adenocarcinoma remain unclear. In this study, we performed a systematic study to investigate the clinical value of miR-452-5p expression in lung adenocarcinoma. The expression of miR-452-5p in 101 lung adenocarcinoma patients was detected by quantitative real-time polymerase chain reaction. The Cancer Genome Atlas and Gene Expression Omnibus databases were joined to verify the expression level of miR-452-5p in lung adenocarcinoma. Via several online prediction databases and bioinformatics software, pathway and network analyses of miR-452-5p target genes were performed to explore its prospective molecular mechanism. The expression of miR-452-5p in lung adenocarcinoma in house was significantly lower than that in adjacent tissues (p < 0.001). Additionally, the expression level of miR-452-5p was negatively correlated with several clinicopathological parameters including the tumor size (p = 0.014), lymph node metastasis (p = 0.032), and tumor-node-metastasis stage (p = 0.036). Data from The Cancer Genome Atlas also confirmed the low expression of miR-452 in lung adenocarcinoma (p < 0.001). Furthermore, reduced expression of miR-452-5p in lung adenocarcinoma (standard mean deviations = -0.393, 95% confidence interval: -0.774 to -0.011, p = 0.044) was validated by a meta-analysis. Five hub genes targeted by miR-452-5p, including SMAD family member 4, SMAD family member 2, cyclin-dependent kinase inhibitor 1B, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon, and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta, were significantly enriched in the cell-cycle pathway. In conclusion, low expression of miR-452-5p tends to play an essential role in lung adenocarcinoma. Bioinformatics analysis might be beneficial to reveal the potential mechanism of miR-452-5p in lung adenocarcinoma.
Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko
2009-11-01
To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859
Mohamed, Deqa H; AlHetheel, AbdulKarim F; Mohamud, Hanat S; Aldosari, Kamel; Alzamil, Fahad A; Somily, Ali M
2017-04-01
Since discovery of Middle East respiratory syndrome coronavirus (MERS-CoV), a novel betacoronavirus first isolated and characterized in 2012, MERS-CoV real-time reverse transcriptase polymerase chain reaction (rRT-PCR) assays represent one of the most rapidly expanding commercial tests. However, in the absence of extensive evaluations of these assays on positive clinical material of different sources, evaluating their diagnostic effectiveness remains challenging. We describe the diagnostic performance evaluation of 3 common commercial MERS-CoV rRT-PCR assays on a large panel (n = 234) of upper respiratory tract specimens collected during an outbreak episode in Saudi Arabia. Assays were compared to the RealStar® MERS-CoV RT-PCR (Alton Diagnostics, Hamburg, Germany) assay as the gold standard. Results showed i) the TIB MolBiol® LightMix UpE and Orf1a assays (TIB MolBiol, Berlin, Germany) to be the most sensitive, followed by ii) the Anyplex™ Seegene MERS-CoV assay (Seegene, Seoul, Korea), and finally iii) the PrimerDesign™ Genesig® HCoV_2012 assay (PrimerDesign, England, United Kingdom). We also evaluate a modified protocol for the PrimerDesign™ Genesig® HCoV_2012 assay. Copyright © 2017 Elsevier Inc. All rights reserved.
Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...
Hui, Yiang; Manna, Pradip; Ou, Joyce J; Kerley, Spencer; Zhang, Cunxian; Sung, C James; Lawrence, W Dwayne; Quddus, M Ruhul
2015-09-01
High-risk human papillomavirus infection usually is seen at one anatomic site in an individual. Rarely, infection at multiple anatomic sites of the female lower genital tract in the same individual is encountered either simultaneously and/or at a later date. The current study identifies the various subtypes of high-risk human papillomavirus infection in these scenarios and analyzes the potential significance of these findings. High-risk human papillomavirus infection involving 22 anatomic sites from 7 individuals was identified after institutional review board approval. Residual paraffin-embedded tissue samples were retrieved, and all 15 high-risk human papillomavirus were identified and viral load quantified using multiplex real-time polymerase chain reaction-based method. Multiple high-risk human papillomavirus subtypes were identified in 32% of the samples and as many as 5 different subtypes of high-risk human papillomavirus infection in a single anatomic site. In general, each anatomic site has unique combination of viral subtypes, although one individual showed overlapping subtypes in the vagina, cervix, and vulvar samples. Higher viral load and rare subtypes are more frequent in younger patients and in dysplasia compared with carcinoma. Follow-up ranging from 3 to 84 months revealed persistent high-risk human papillomavirus infection in 60% of cases. Copyright © 2015 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Rahmawati, E.; Ibrahim, F.; Imran, D.; Sudarmono, P.
2017-08-01
Focal brain lesion is a neurological complication in HIV, which is marked as a space occupying lesion (SOL) and needs rapid and effective treatment. This lesion is mainly caused by encephalitis toxoplasma and primary central nervous system lymphoma related to the Epstein-Barr virus (EBV) infection, which is difficult to distinguish using CT scan or magnetic resonance imaging (MRI). The gold standard of diagnosing focal brain lesion has been brain biopsy, but this examination is an invasive procedure that causes complications. The objective of this study is to obtain the rapid laboratory diagnosis of Toxoplasma gondii (T. gondii) and EBV infection. In this experimental study, blood and cerebrospinal fluid were obtained from HIV patients who were admitted to the Neurology Department of Cipto Mangunkusumo Hospital. The samples were examined using duplex real-time polymerase chain reaction (PCR) to detect T. gondii and EBV. The first step was the optimization of duplex real-time PCR, including the annealing temperature, primer and probe concentration, elution volume, and template volume. Minimal DNA detection was used to measure minimal T. gondii and EBV. Cross reactions were determined for technical specificity using the bacteria and viruses Staphylococcus aureus, Klebsiella pneumonia, Pseudomonas aeruginosa, Mycobacterium tuberculosis H37Rv, Candida spp, cytomegalovirus, herpes zoster virus, and varicella zoster virus. Duplex real-time PCR was applied optimally to patients. In the optimization of duplex real-time PCR, the annealing temperature of T. gondii and EBV were 58 °C, the concentration of primer forward and reverse for T. gondii and EBV were 0.2 μM, the concentration of probe for T. gondii and EBV were 0.4μM and 0.2 μM, respectively. Minimal DNA detection of T. gondii and EBV were 5.68 copy/ml and 1.31 copy/ml, respectively. There was no cross reaction between another bacteria and virus that were used as the primer and probe for T. gondii and EBV. The
2011-01-01
Abstract The addition of relatively short flap sequence at the 5′-end of one of the polymerase chain reaction (PCR) primers considerably improves performance of real-time assays based on 5′-nuclease activity. This new technology, called Snake, was shown to supersede the conventional methods like TaqMan, Molecular Beacons, and Scorpions in the signal productivity and discrimination of target polymorphic variations as small as single nucleotides. The present article describes a number of reaction conditions and methods that allow further improvement of the assay performance. One of the identified approaches is the use of duplex-destabilizing modifications such as deoxyinosine and deoxyuridine in the design of the Snake primers. This approach was shown to solve the most serious problem associated with the antisense amplicon folding and cleavage. As a result, the method permits the use of relatively long—in this study—14-mer flap sequences. Investigation also revealed that only the 5′-segment of the flap requires the deoxyinosine/deoxyuridine destabilization, whereas the 3′-segment is preferably left unmodified or even stabilized using 2-amino deoxyadenosine d(2-amA) and 5-propynyl deoxyuridine d(5-PrU) modifications. The base-modification technique is especially effective when applied in combination with asymmetric three-step PCR. The most valuable discovery of the present study is the effective application of modified deoxynucleoside 5′-triphosphates d(2-amA)TP and d(5-PrU)TP in Snake PCR. This method made possible the use of very short 6-8-mer 5′-flap sequences in Snake primers. PMID:21050073
Spackman, Erica; Ip, Hon S.; Suarez, D.L.; Slemons, R.D.; Stallknecht, D.E.
2008-01-01
A real-time reverse transcription polymerase chain reaction test for the identification of the H7 subtype in North American Avian influenza viruses (AIVs) was first reported in 2002; however, recent AIV surveillance efforts in wild birds and H7 outbreaks in poultry demonstrated that the 2002 test did not detect all H7 AIVs present in North and South America. Therefore, a new test, the 2008 Pan-American H7 test, was developed by using recently available H7 nucleotide sequences. The analytical specificity of the new assay was characterized with an RNA panel composed of 19 H7 viruses from around the world and RNA from all hemagglutinin subtypes except H16. Specificity for North and South American lineage H7 viruses was observed. Assay limits of detection were determined to be between 103 and 104 gene copies per reaction with in vitro transcribed RNA, and 100.0 and 10 0.8 50% egg infectious doses per reaction. The 2008 Pan-American H7 test also was shown to perform similarly to the 2002 test with specimens from chickens experimentally exposed to A/Chicken/BritishColumbia/314514-2/04 H7N3 highly pathogenic AIV. Furthermore, the 2008 test was able to detect 100% (n = 27) of the H7 AIV isolates recovered from North American wild birds in a 2006-2007 sample set (none of which were detected by the 2002 H7 test).
Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore
2013-01-01
Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations.
REAL TIME PCR ANALYSIS OF INDOOR MOLDS: PRINCIPLES, PROCEDURES AND APPLICATIONS
This presentation will endeavor to present an overview of the real time polymerase chain reaction method developed for indoor mold detection and quantification by the EPA. It will begin with a brief discussion of the PCR technology that provides the basis for this method and how ...
Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi
2005-09-01
1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.
Kutyavin, Igor V.
2010-01-01
The article describes a new technology for real-time polymerase chain reaction (PCR) detection of nucleic acids. Similar to Taqman, this new method, named Snake, utilizes the 5′-nuclease activity of Thermus aquaticus (Taq) DNA polymerase that cleaves dual-labeled Förster resonance energy transfer (FRET) probes and generates a fluorescent signal during PCR. However, the mechanism of the probe cleavage in Snake is different. In this assay, PCR amplicons fold into stem–loop secondary structures. Hybridization of FRET probes to one of these structures leads to the formation of optimal substrates for the 5′-nuclease activity of Taq. The stem–loop structures in the Snake amplicons are introduced by the unique design of one of the PCR primers, which carries a special 5′-flap sequence. It was found that at a certain length of these 5′-flap sequences the folded Snake amplicons have very little, if any, effect on PCR yield but benefit many aspects of the detection process, particularly the signal productivity. Unlike Taqman, the Snake system favors the use of short FRET probes with improved fluorescence background. The head-to-head comparison study of Snake and Taqman revealed that these two technologies have more differences than similarities with respect to their responses to changes in PCR protocol, e.g. the variations in primer concentration, annealing time, PCR asymmetry. The optimal PCR protocol for Snake has been identified. The technology’s real-time performance was compared to a number of conventional assays including Taqman, 3′-MGB-Taqman, Molecular Beacon and Scorpion primers. The test trial showed that Snake supersedes the conventional assays in the signal productivity and detection of sequence variations as small as single nucleotide polymorphisms. Due to the assay’s cost-effectiveness and simplicity of design, the technology is anticipated to quickly replace all known conventional methods currently used for real-time nucleic acid detection
Real-time observation of the initiation of RNA polymerase II transcription.
Fazal, Furqan M; Meng, Cong A; Murakami, Kenji; Kornberg, Roger D; Block, Steven M
2015-09-10
Biochemical and structural studies have shown that the initiation of RNA polymerase II transcription proceeds in the following stages: assembly of the polymerase with general transcription factors and promoter DNA in a 'closed' preinitiation complex (PIC); unwinding of about 15 base pairs of the promoter DNA to form an 'open' complex; scanning downstream to a transcription start site; synthesis of a short transcript, thought to be about 10 nucleotides long; and promoter escape. Here we have assembled a 32-protein, 1.5-megadalton PIC derived from Saccharomyces cerevisiae, and observe subsequent initiation processes in real time with optical tweezers. Contrary to expectation, scanning driven by the transcription factor IIH involved the rapid opening of an extended transcription bubble, averaging 85 base pairs, accompanied by the synthesis of a transcript up to the entire length of the extended bubble, followed by promoter escape. PICs that failed to achieve promoter escape nevertheless formed open complexes and extended bubbles, which collapsed back to closed or open complexes, resulting in repeated futile scanning.
Kwok, Lai-yu; Zhang, Jiachao; Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping
2014-01-01
The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.
Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping
2014-01-01
The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota. PMID:24699404
NASA Astrophysics Data System (ADS)
Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel
2010-12-01
Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.
Gizzi, Aline Baumann da Rocha; Oliveira, Simone Tostes; Leutenegger, Christian M; Estrada, Marko; Kozemjakin, Denise Adamczyk; Stedile, Rafael; Marcondes, Mary; Biondo, Alexander Welker
2014-01-16
Infectious diarrhea can be caused by bacteria, viruses, or protozoan organisms, or a combination of these. The identification of co-infections in dogs is important to determine the prognosis and to plan strategies for their treatment and prophylaxis. Although many pathogens have been individually detected with real-time polymerase chain reaction (PCR), a comprehensive panel of agents that cause diarrhea in privately owned dogs has not yet been established. The objective of this study was to use a real-time PCR diarrhea panel to survey the frequencies of pathogens and co-infections in owned dogs attended in a veterinary hospital with and without diarrhea, as well the frequency in different countries. Feces samples were tested for canine distemper virus, canine coronavirus, canine parvovirus type 2 (CPV-2), Clostridium perfringens alpha toxin (CPA), Cryptosporidium spp., Giardia spp., and Salmonella spp. using molecular techniques. In total, 104 diarrheic and 43 control dogs that were presented consecutively at a major private veterinary hospital were included in the study. Overall, 71/104 (68.3%) dogs with diarrhea were positive for at least one pathogen: a single infection in 39/71 dogs (54.9%) and co-infections in 32/71 dogs (45.1%), including 21/32 dogs (65.6%) with dual, 5/32 (15.6%) with triple, and 6/32 (18.8%) with quadruple infections. In the control group, 13/43 (30.2%) dogs were positive, all with single infections only. The most prevalent pathogens in the diarrheic dogs were CPA (40/104 dogs, 38.5%), CPV-2 (36/104 dogs, 34.6%), and Giardia spp. (14/104 dogs, 13.5%). CPV-2 was the most prevalent pathogen in the dual co-infections, associated with CPA, Cryptosporidium spp., or Giardia spp. No statistical difference (P = 0.8374) was observed in the duration of diarrhea or the number of deaths (P = 0.5722) in the presence or absence of single or co-infections. Diarrheic dogs showed a higher prevalence of pathogen infections than the controls. Whereas the
2014-01-01
Background Infectious diarrhea can be caused by bacteria, viruses, or protozoan organisms, or a combination of these. The identification of co-infections in dogs is important to determine the prognosis and to plan strategies for their treatment and prophylaxis. Although many pathogens have been individually detected with real-time polymerase chain reaction (PCR), a comprehensive panel of agents that cause diarrhea in privately owned dogs has not yet been established. The objective of this study was to use a real-time PCR diarrhea panel to survey the frequencies of pathogens and co-infections in owned dogs attended in a veterinary hospital with and without diarrhea, as well the frequency in different countries. Feces samples were tested for canine distemper virus, canine coronavirus, canine parvovirus type 2 (CPV-2), Clostridium perfringens alpha toxin (CPA), Cryptosporidium spp., Giardia spp., and Salmonella spp. using molecular techniques. Results In total, 104 diarrheic and 43 control dogs that were presented consecutively at a major private veterinary hospital were included in the study. Overall, 71/104 (68.3%) dogs with diarrhea were positive for at least one pathogen: a single infection in 39/71 dogs (54.9%) and co-infections in 32/71 dogs (45.1%), including 21/32 dogs (65.6%) with dual, 5/32 (15.6%) with triple, and 6/32 (18.8%) with quadruple infections. In the control group, 13/43 (30.2%) dogs were positive, all with single infections only. The most prevalent pathogens in the diarrheic dogs were CPA (40/104 dogs, 38.5%), CPV-2 (36/104 dogs, 34.6%), and Giardia spp. (14/104 dogs, 13.5%). CPV-2 was the most prevalent pathogen in the dual co-infections, associated with CPA, Cryptosporidium spp., or Giardia spp. No statistical difference (P = 0.8374) was observed in the duration of diarrhea or the number of deaths (P = 0.5722) in the presence or absence of single or co-infections. Conclusions Diarrheic dogs showed a higher prevalence of pathogen infections than
NASA Astrophysics Data System (ADS)
Rinsoz, Thomas; Duquenne, Philippe; Greff-Mirguet, Guylaine; Oppliger, Anne
Traditional culture-dependent methods to quantify and identify airborne microorganisms are limited by factors such as short-duration sampling times and inability to count non-culturable or non-viable bacteria. Consequently, the quantitative assessment of bioaerosols is often underestimated. Use of the real-time quantitative polymerase chain reaction (Q-PCR) to quantify bacteria in environmental samples presents an alternative method, which should overcome this problem. The aim of this study was to evaluate the performance of a real-time Q-PCR assay as a simple and reliable way to quantify the airborne bacterial load within poultry houses and sewage treatment plants, in comparison with epifluorescence microscopy and culture-dependent methods. The estimates of bacterial load that we obtained from real-time PCR and epifluorescence methods, are comparable, however, our analysis of sewage treatment plants indicate these methods give values 270-290 fold greater than those obtained by the "impaction on nutrient agar" method. The culture-dependent method of air impaction on nutrient agar was also inadequate in poultry houses, as was the impinger-culture method, which gave a bacterial load estimate 32-fold lower than obtained by Q-PCR. Real-time quantitative PCR thus proves to be a reliable, discerning, and simple method that could be used to estimate airborne bacterial load in a broad variety of other environments expected to carry high numbers of airborne bacteria.
Cancino-Faure, Beatriz; Fisa, Roser; Alcover, M. Magdalena; Jimenez-Marco, Teresa; Riera, Cristina
2016-01-01
Molecular techniques based on real-time polymerase chain reaction (qPCR) allow the detection and quantification of DNA but are unable to distinguish between signals from dead or live cells. Because of the lack of simple techniques to differentiate between viable and nonviable cells, the aim of this study was to optimize and evaluate a straightforward test based on propidium monoazide (PMA) dye action combined with a qPCR assay (PMA-qPCR) for the selective quantification of viable/nonviable epimastigotes of Trypanosoma cruzi. PMA has the ability to penetrate the plasma membrane of dead cells and covalently cross-link to the DNA during exposure to bright visible light, thereby inhibiting PCR amplification. Different concentrations of PMA (50–200 μM) and epimastigotes of the Maracay strain of T. cruzi (1 × 105–10 parasites/mL) were assayed; viable and nonviable parasites were tested and quantified by qPCR with a TaqMan probe specific for T. cruzi. In the PMA-qPCR assay optimized at 100 μM PMA, a significant qPCR signal reduction was observed in the nonviable versus viable epimastigotes treated with PMA, with a mean signal reduction of 2.5 logarithm units and a percentage of signal reduction > 98%, in all concentrations of parasites assayed. This signal reduction was also observed when PMA-qPCR was applied to a mixture of live/dead parasites, which allowed the detection of live cells, except when the concentration of live parasites was low (10 parasites/mL). The PMA-qPCR developed allows differentiation between viable and nonviable epimastigotes of T. cruzi and could thus be a potential method of parasite viability assessment and quantification. PMID:27139452
Al-Turab, Mariam; Chehadeh, Wassim; Al-Mulla, Fahd; Al-Nakib, Widad
2012-04-01
Human metapneumovirus (hMPV) is a respiratory pathogen that was discovered in 2001 and is considered a major cause of both upper and lower respiratory tract infections. A sensitive, fast, and high-throughput diagnostic test is needed for the detection of hMPV that may assist in the clinical management as well as in the reduction of inappropriate therapy. Therefore, a comparison assessment was performed in this study between the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction (RT-PCR) Assay and the INFINITI(®) Respiratory Viral Panel Plus Assay (RVP-Plus) for the detection of hMPV infection in patients with respiratory tract infections. A total of 200 respiratory samples were collected from 185 hospitalized patients, during the winter season in Kuwait. Of 185 patients, 10 (5.4%) were positive for hMPV RNA by the in-house RT-PCR assay, while 7 (4%) were positive for hMPV RNA by the real-time RT-PCR assay and 9 (5%) were positive for hMPV RNA by the INFINITI(®) RVP-Plus assay. The high incidence rate (60%) of hMPV infection was in January 2011. The sensitivity of the real-time RT-PCR and INFINITI(®) RVP-Plus assays was 70% and 90%, respectively, with specificity of 100% for both assays. hMPV types A and B could be identified in this study; however, discordant genotyping results were found between the direct sequencing method and the INFINITI(®) RVP-Plus assay in 33% of hMPV-positive patients. Copyright © 2012 Elsevier Inc. All rights reserved.
Real-time dynamics of RNA Polymerase II clustering in live human cells
NASA Astrophysics Data System (ADS)
Cisse, Ibrahim
2014-03-01
Transcription is the first step in the central dogma of molecular biology, when genetic information encoded on DNA is made into messenger RNA. How this fundamental process occurs within living cells (in vivo) is poorly understood,[1] despite extensive biochemical characterizations with isolated biomolecules (in vitro). For high-order organisms, like humans, transcription is reported to be spatially compartmentalized in nuclear foci consisting of clusters of RNA Polymerase II, the enzyme responsible for synthesizing all messenger RNAs. However, little is known of when these foci assemble or their relative stability. We developed an approach based on photo-activation localization microscopy (PALM) combined with a temporal correlation analysis, which we refer to as tcPALM. The tcPALM method enables the real-time characterization of biomolecular spatiotemporal organization, with single-molecule sensitivity, directly in living cells.[2] Using tcPALM, we observed that RNA Polymerase II clusters form transiently, with an average lifetime of 5.1 (+/- 0.4) seconds. Stimuli affecting transcription regulation yielded orders of magnitude changes in the dynamics of the polymerase clusters, implying that clustering is regulated and plays a role in the cells ability to effect rapid response to external signals. Our results suggest that the transient crowding of enzymes may aid in rate-limiting steps of genome regulation.
Rensen, Gabriel; Smith, Wayne; Ruzante, Juliana; Sawyer, Mary; Osburn, Bennie; Cullor, James
2005-01-01
A real-time fluorescent polymerase chain reaction assay for detecting prohibited ruminant materials such as bovine meat and bone meal (BMBM) in cattle feed using primers and FRET probes targeting the ruminant specific mitochondrial cytochrome b gene was developed and evaluated on two different types of cattle feed. Common problems involved with PCR based testing of cattle feed include the presence of high levels of PCR inhibitors and the need for certain pre-sample processing techniques in order to perform DNA extractions. We have developed a pre-sample processing technique for extracting DNA from cattle feed which does not require the feed sample to be ground to a fine powder and utilizes materials that are disposed of between samples, thus, reducing the potential of cross contamination. The DNA extraction method utilizes Whatman FTA card technology, is adaptable to high sample throughput analysis and allows for room temperature storage with established archiving of samples of up to 14 years. The Whatman FTA cards are subsequently treated with RNAse and undergo a Chelex-100 extraction (BioRad, Hercules, CA), thus removing potential PCR inhibitors and eluting the DNA from the FTA card for downstream PCR analysis. The detection limit was evaluated over a period of 30 trials on calf starter mix and heifer starter ration feed samples spiked with known concentrations of BMBM. The PCR detection assay detected 0.05% wt/wt BMBM contamination with 100% sensitivity, 100% specificity, and 100% confidence. Concentrations of 0.005% and 0.001% wt/wt BMBM contamination were also detected in both feed types but with varying levels of confidence.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Review of Detection of Brucella sp. by Polymerase Chain Reaction
Yu, Wei Ling; Nielsen, Klaus
2010-01-01
Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083
Cruz-Rico, Graciela; Avilés-Salas, Alejandro; Segura-González, Manuel; Espinosa-García, Ana María; Ramírez-Tirado, Laura Alejandra; Morales-Oyarvide, Vicente; Rojas-Marín, Carlos; Cardona, Andrés-Felipe; Arrieta, Oscar
2017-12-01
To assess anaplastic lymphoma kinase (ALK) rearrangement detection with immunohistochemistry (IHC) and real-time polymerase chain reaction (RT-qPCR) in comparison with fluorescence in situ hybridization (FISH). Tumor tissue samples from 230 patients with advanced non-small cell lung cancer (NSCLC) were analyzed by FISH to detect ALK rearrangements. Additional IHC tests using 5A4 clone and RT-qPCR (variants 1 to 5) were performed in 63 and 48 patients, respectively. Thirteen percent of FISH tests were not evaluable. From the remaining tests (n=200), 18 (9.0%) were ALK positive (ALK). ALK patients were significantly younger at the time of diagnosis (below 55 y, 14.3% vs. 5.5%, P=0.035), were light smokers (tobacco index <10, 12.6% vs. 4.1%, P=0.049), and presented adenocarcinoma with a mucinous component (30.8 vs. 8.0%, P=0.007). When comparing FISH with IHC using a cutoff of 1+ or 2+, and only 2+ staining intensity, the sensitivity, specificity, negative predictive value, and positive predictive value were as follows: 83.3%, 100.0%, 93.75%, and 100.0%; and 55.6%, 100.0%, 84.9%, and 100.0%, respectively. For RT-qPCR, these results were 55.6, 100, 90.7, and 100.0%, respectively. Our results suggest that RT-qPCR is an inadequate initial test for detecting ALK-positive lung cancer. IHC is highly useful as an initial screening test for ALK rearrangement detection in NSCLC. These results contribute to the medical literature on the establishment of IHC as a standard diagnostic test for ALK rearrangements in NSCLC.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nasarabadi, Shanavaz
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less
Detection of Food Allergens by Taqman Real-Time PCR Methodology.
García, Aina; Madrid, Raquel; García, Teresa; Martín, Rosario; González, Isabel
2017-01-01
Real-time PCR (polymerase chain reaction) has shown to be a very effective technology for the detection of food allergens. The protocol described herein consists on a real-time PCR assay targeting the plant ITS (Internal Transcribed Spacer) region, using species-specific primers and hydrolysis probes (Taqman) dual labeled with a reporter fluorophore at the 5' end (6-carboxyfluorescein, FAM) and a quencher fluorophore at the 3' end (Blackberry, BBQ). The species-specific real-time PCR systems (primers/probe) described in this work allowed the detection of different nuts (peanut, hazelnut, pistachio, almond, cashew, macadamia, walnut and pecan), common allergens present in commercial food products, with a detection limit of 0.1 mg/kg.
Real-time quantitative PCR of Staphylococcus aureus and application in restaurant meals.
Berrada, H; Soriano, J M; Mañes, J; Picó, Y
2006-01-01
Staphylococcus aureus is considered the second most common pathogen to cause outbreaks of food poisoning, exceeded only by Campylobacter. Consumption of foods containing this microorganism is often identified as the cause of illness. In this study, a rapid, reliable, and sensitive real-time quantitative PCR was developed and compared with conventional culture methods. Real-time quantitative PCR was carried out by purifying DNA extracts of S. aureus with a Staphylococcus sample preparation kit and quantifying it in the LightCycler system with hybridization probes. The assay was linear from a range of 10 to 10(6) S. aureus cells (r2 > 0.997). The PCR reaction presented an efficiency of >85%. Accuracy of the PCR-based assay, expressed as percent bias, was around 13%, and the precision, expressed as a percentage of the coefficient of variation, was 7 to 10%. Intraday and interday variability were studied at 10(2) CFU/g and was 12 and 14%, respectively. The proposed method was applied to the analysis of 77 samples of restaurant meals in Valencia (Spain). In 11.6% of samples S. aureus was detected by real-time quantitative PCR, as well as by the conventional microbiological method. An excellent correspondence between real-time quantitative PCR and microbiological numbers (CFU/g) was observed with deviations of < 28%.
Continuous flow real-time PCR device using multi-channel fluorescence excitation and detection.
Hatch, Andrew C; Ray, Tathagata; Lintecum, Kelly; Youngbull, Cody
2014-02-07
High throughput automation is greatly enhanced using techniques that employ conveyor belt strategies with un-interrupted streams of flow. We have developed a 'conveyor belt' analog for high throughput real-time quantitative Polymerase Chain Reaction (qPCR) using droplet emulsion technology. We developed a low power, portable device that employs LED and fiber optic fluorescence excitation in conjunction with a continuous flow thermal cycler to achieve multi-channel fluorescence detection for real-time fluorescence measurements. Continuously streaming fluid plugs or droplets pass through tubing wrapped around a two-temperature zone thermal block with each wrap of tubing fluorescently coupled to a 64-channel multi-anode PMT. This work demonstrates real-time qPCR of 0.1-10 μL droplets or fluid plugs over a range of 7 orders of magnitude concentration from 1 × 10(1) to 1 × 10(7). The real-time qPCR analysis allows dynamic range quantification as high as 1 × 10(7) copies per 10 μL reaction, with PCR efficiencies within the range of 90-110% based on serial dilution assays and a limit of detection of 10 copies per rxn. The combined functionality of continuous flow, low power thermal cycling, high throughput sample processing, and real-time qPCR improves the rates at which biological or environmental samples can be continuously sampled and analyzed.
Doyle, Jacqueline M; McCormick, Cory R; DeWoody, J Andrew
2011-01-01
Many animals, such as crustaceans, insects, and salamanders, package their sperm into spermatophores, and the number of spermatozoa contained in a spermatophore is relevant to studies of sexual selection and sperm competition. We used two molecular methods, real-time quantitative polymerase chain reaction (RT-qPCR) and spectrophotometry, to estimate sperm numbers from spermatophores. First, we designed gene-specific primers that produced a single amplicon in four species of ambystomatid salamanders. A standard curve generated from cloned amplicons revealed a strong positive relationship between template DNA quantity and cycle threshold, suggesting that RT-qPCR could be used to quantify sperm in a given sample. We then extracted DNA from multiple Ambystoma maculatum spermatophores, performed RT-qPCR on each sample, and estimated template copy numbers (i.e. sperm number) using the standard curve. Second, we used spectrophotometry to determine the number of sperm per spermatophore by measuring DNA concentration relative to the genome size. We documented a significant positive relationship between the estimates of sperm number based on RT-qPCR and those based on spectrophotometry. When these molecular estimates were compared to spermatophore cap size, which in principle could predict the number of sperm contained in the spermatophore, we also found a significant positive relationship between sperm number and spermatophore cap size. This linear model allows estimates of sperm number strictly from cap size, an approach which could greatly simplify the estimation of sperm number in future studies. These methods may help explain variation in fertilization success where sperm competition is mediated by sperm quantity. © 2010 Blackwell Publishing Ltd.
Human fecal source identification with real-time quantitative PCR
Waterborne diseases represent a significant public health risk worldwide, and can originate from contact with water contaminated with human fecal material. We describe a real-time quantitative PCR (qPCR) method that targets a Bacteroides dori human-associated genetic marker for...
Jo, Yong Suk; Park, Ju-Hee; Lee, Jung Kyu; Heo, Eun Young; Chung, Hee Soon; Kim, Deog Kyeom
2016-01-01
The prevalence and clinical implications of discordance between Xpert MTB/RIF assays and the AdvanSure TB/NTM real-time polymerase chain reaction (PCR) for bronchial washing specimens have not been studied in pulmonary TB (PTB) patients. The discordant proportion and its clinical impact were evaluated in 320 patients from the bronchoscopy registry whose bronchial washing specimens were tested simultaneously with Xpert MTB/RIF and the TB/NTM PCR assay for three years, and the accuracy of the assays, including the sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV), were studied. The clinical risk factors for discordance and false positivity of assays were also studied. Among 130 patients who were clinically diagnosed with PTB, 64 patients showed positive acid-fast bacilli culture results, 56 patients showed positive results in molecular methods and clinician diagnosed PTB without results of microbiology in 10 patients. The sensitivity, specificity, PPV, and NPV were 80.0%, 98.95%, 98.1%, and 87.9%, respectively, for Xpert MTB/RIF and 81.5%, 92.6%, 88.3%, and 88.0%, respectively, for TB/NTM PCR. The discordant proportion was 16.9% and was higher in culture-negative PTB compared to culture-confirmed PTB (24.3% vs. 9.4%, p = 0.024). However, there were no significant differences in the clinical characteristics, regardless of the discordance. The diagnostic yield increased with an additional assay (7.7% for Xpert MTB/RIF and 9.2% for TB/NTM PCR). False positivity was less common in patients tested with Xpert MTB/RIF (1.05% vs. 7.37%, p = 0.0035). No host-related risk factor for false positivity was identified. The Xpert MTB/RIF and TB/NTM PCR assay in bronchial washing specimens can improve the diagnostic yields for PTB, although there were considerable discordant results without any patient-related risk factors.
Cankar, Katarina; Ravnikar, Maja; Zel, Jana; Gruden, Kristina; Toplak, Natasa
2005-01-01
Labeling of genetically modified organisms (GMOs) is now in place in many countries, including the European Union, in order to guarantee the consumer's choice between GM and non-GM products. Screening of samples is performed by polymerase chain reaction (PCR) amplification of regulatory sequences frequently introduced into genetically modified plants. Primers for the 35S promoter from Cauliflower mosaic virus (CaMV) are those most frequently used. In virus-infected plants or in samples contaminated with plant material carrying the virus, false-positive results can consequently occur. A system for real-time PCR using a TaqMan minor groove binder probe was designed that allows recognition of virus coat protein in the sample, thus allowing differentiation between transgenic and virus-infected samples. We measured the efficiency of PCR amplification, limits of detection and quantification, range of linearity, and repeatability of the assay in order to assess the applicability of the assay for routine analysis. The specificity of the detection system was tested on various virus isolates and plant species. All 8 CaMV isolates were successfully amplified using the designed system. No cross-reactivity was detected with DNA from 3 isolates of the closely related Carnation etched ring virus. Primers do not amplify plant DNA from available genetically modified maize and soybean lines or from different species of Brassicaceae or Solanaceae that are natural hosts for CaMV. We evaluated the assay for different food matrixes by spiking CaMV DNA into DNA from food samples and have successfully amplified CaMV from all samples. The assay was tested on rapeseed samples from routine GMO testing that were positive in the 35S screening assay, and the presence of the virus was confirmed.
Wang, Jianchang; Liu, Libing; Wang, Jinfeng; Sun, Xiaoxia; Yuan, Wanzhe
2017-01-01
Feline herpesvirus 1 (FHV-1), an enveloped dsDNA virus, is one of the major pathogens of feline upper respiratory tract disease (URTD) and ocular disease. Currently, polymerase chain reaction (PCR) remains the gold standard diagnostic tool for FHV-1 infection but is relatively expensive, requires well-equipped laboratories and is not suitable for field tests. Recombinase polymerase amplification (RPA), an isothermal gene amplification technology, has been explored for the molecular diagnosis of infectious diseases. In this study, an exo-RPA assay for FHV-1 detection was developed and validated. Primers targeting specifically the thymidine kinase (TK) gene of FHV-1 were designed. The RPA reaction was performed successfully at 39°C and the results were obtained within 20 min. Using different copy numbers of recombinant plasmid DNA that contains the TK gene as template, we showed the detection limit of exo-RPA was 102 copies DNA/reaction, the same as that of real time PCR. The exo-RPA assay did not cross-detect feline panleukopenia virus, feline calicivirus, bovine herpesvirus-1, pseudorabies virus or chlamydia psittaci, a panel of pathogens important in feline URTD or other viruses in Alphaherpesvirinae, demonstrating high specificity. The assay was validated by testing 120 nasal and ocular conjunctival swabs of cats, and the results were compared with those obtained with real-time PCR. Both assays provided the same testing results in the clinical samples. Compared with real time PCR, the exo-RPA assay uses less-complex equipment that is portable and the reaction is completed much faster. Additionally, commercial RPA reagents in vacuum-sealed pouches can tolerate temperatures up to room temperature for days without loss of activity, suitable for shipment and storage for field tests. Taken together, the exo-RPA assay is a simple, fast and cost-effective alternative to real time PCR, suitable for use in less advanced laboratories and for field detection of FHV-1
Wang, Jianchang; Liu, Libing; Wang, Jinfeng; Sun, Xiaoxia; Yuan, Wanzhe
2017-01-01
Feline herpesvirus 1 (FHV-1), an enveloped dsDNA virus, is one of the major pathogens of feline upper respiratory tract disease (URTD) and ocular disease. Currently, polymerase chain reaction (PCR) remains the gold standard diagnostic tool for FHV-1 infection but is relatively expensive, requires well-equipped laboratories and is not suitable for field tests. Recombinase polymerase amplification (RPA), an isothermal gene amplification technology, has been explored for the molecular diagnosis of infectious diseases. In this study, an exo-RPA assay for FHV-1 detection was developed and validated. Primers targeting specifically the thymidine kinase (TK) gene of FHV-1 were designed. The RPA reaction was performed successfully at 39°C and the results were obtained within 20 min. Using different copy numbers of recombinant plasmid DNA that contains the TK gene as template, we showed the detection limit of exo-RPA was 102 copies DNA/reaction, the same as that of real time PCR. The exo-RPA assay did not cross-detect feline panleukopenia virus, feline calicivirus, bovine herpesvirus-1, pseudorabies virus or chlamydia psittaci, a panel of pathogens important in feline URTD or other viruses in Alphaherpesvirinae, demonstrating high specificity. The assay was validated by testing 120 nasal and ocular conjunctival swabs of cats, and the results were compared with those obtained with real-time PCR. Both assays provided the same testing results in the clinical samples. Compared with real time PCR, the exo-RPA assay uses less-complex equipment that is portable and the reaction is completed much faster. Additionally, commercial RPA reagents in vacuum-sealed pouches can tolerate temperatures up to room temperature for days without loss of activity, suitable for shipment and storage for field tests. Taken together, the exo-RPA assay is a simple, fast and cost-effective alternative to real time PCR, suitable for use in less advanced laboratories and for field detection of FHV-1
Lee, Yuan-Ming; Chen, Yen-Ju; Lee, Cheng-Ming; Kuo, Lou-Hui; Wong, Wing-Wai; Chen, Yi-Ming Arthur
2011-12-01
In the past few years, many new subtypes in hepatitis C virus (HCV) genotype 6 have been identified. The aim of this study was to modify the multiplex real-time polymerase chain reaction (RT-PCR) protocol and use it to determine the HCV subtypes of a group of Taiwanese injection drug users (IDUs). We used 76 serum specimens collected in northern Taiwan in 2008. Multiplex RT-PCR was used for HCV subtyping among those serum samples having anti-HCV antibodies. Twenty cases were randomly selected for comparison with subtyping results from Inno-LiPa II tests and phylogenetic tree analysis using NS5B sequences. Multiplex RT-PCR assays showed that 60.5% (46/76) of IDUs had single HCV infection. Three out of 76 (3.9%) had double HCV infection (1b/6a, 2a/2b and 2b/6a). Besides this, 27.6% (21/76) had no HCV signal. One IDU had subtype 6n and two had subtype 6w infection. Inno-LiPa II tests misclassified all 6n and 6w cases as 1b subtype. Our modified multiplex RT-PCR protocol can be used to support molecular epidemiological studies and laboratory diagnoses of different HCV subtypes including genotype 6. Copyright © 2011. Published by Elsevier B.V.
Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E
2017-08-01
The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.
Bil-Lula, Iwona; Matuszek, Patryk; Pfeiffer, Thomas; Woźniak, Mieczysław
2015-01-01
Infections of Borrelia burgdorferi sensu lato reveal clinical manifestations affecting numerous organs and tissues. The standard diagnostic procedure of these infections is quite simple if a positive history of tick exposure or typical erythema migrans appears. Lack of unequivocal clinical symptoms creates the necessity for further evaluation with laboratory tests. This study discusses the utility of a novel, improved, well-optimized, sensitive and highly specific quantitative real-time PCR assay for the diagnostics of infections caused by Borrelia burgdorferi sensu lato. We designed an improved, specific, highly sensitive real-time quantitative polymerase chain reaction (RQ-PCR) assay for the detection and quantification of all Borrelia burgdorferi genotypes. A wide validation effort was undertaken to ensure confidence in the highly sensitive and specific detection of B. burgdorferi. Due to high sensitivity and great specificity, as low as 1.6×10² copies of Borrelia per mL of whole blood could be detected. As much as 12 (3%) negative ELISA IgM results, 14 (2.8%) negative results of Line blot IgM, 11 (3.1%) and 7 (2.7%) of negative ELISA IgG and Line blot IgG results, respectively, were positive in real-time PCR. The data in this study confirms the high positive predictive value of real-time PCR test in the detection of Borrelia infections.
Money, Deborah; Dobson, Simon; Cole, Lesley; Karacabeyli, Eda; Blondel-Hill, Edith; Milner, Ruth; Thomas, Eva
2008-09-01
To evaluate the sensitivity, specificity, and feasibility of a rapid real-time polymerase chain reaction (PCR) test for group B streptococcus (GBS) completed during labour, compared with the standard culture test performed at 35 to 37 weeks' gestation. Women presenting to the maternity unit for term vaginal delivery had two vaginal/rectal samples collected. One swab was tested using a rapid PCR method (IDI-Strep B, Infectio Diagnostic [IDI] Inc., Sainte-Foy QC ), and the other was cultured after enrichment (intrapartum culture). Comparisons were made between these results and those of a culture-based screen at 35 to 37 weeks' gestation. Of the 190 women enrolled, 85% had results of the standard screen at 35 to 37 weeks available for comparison. The sensitivity and specificity of the standard 35- to 37-week screen were 84.3% (95% confidence interval [CI], 71.4-93.0) and 93.2% (95% CI 86.5-97.2) respectively, whereas the sensitivity and specificity of the rapid PCR were 90.7% (95% CI 79.7-96.9) and 97.6% (95% CI 93.1-99.5), respectively. The median reporting time for the rapid PCR test was 99 minutes (range 50-255). Results were available more than four hours before delivery in 81% of cases. In this Canadian centre, a rapid PCR test done at the time of labour (IDI-Strep B) demonstrated high sensitivity and specificity, comparable to the 35- to 37-week screen. The time to reporting results was acceptably short, allowing for timely administration of intrapartum prophylactic antibiotics.
Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub
2016-01-01
This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.
NASA Astrophysics Data System (ADS)
Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.
1992-04-01
Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.
van Rijn, Piet A; Heutink, René G; Boonstra, Jan; Kramps, Hans A; van Gennip, René G P
2012-05-01
A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic double-stranded RNA, reverse transcription polymerase chain reaction (RT-PCR), and real-time detection and analysis. Reference strains of the 24 recognized BTV serotypes, isolates from different years, and geographic origins were detected. Other orbiviruses such as African horse sickness virus, Epizootic hemorrhagic disease virus, and Equine encephalosis virus were not detected. Experimentally infected animals were PCR positive from 2 days postinoculation, which was earlier than fever, other clinical signs, or seroconversion. The diagnostic sensitivity and specificity were very close to or even 100%. The PCR test played a key role in the detection of BTV serotype 8 in August 2006 in The Netherlands. The outbreak in a completely naive ruminant population allowed for further evaluation of the PCR test with field samples. In 2006, the correlation between enzyme-linked immunosorbent assay and PCR results was estimated to be 95%. In the following years, the PCR test was used for diagnosis of diseased animals, for testing of healthy animals for trade purposes, and for detection of BTV RNA in different species of the insect vector, Culicoides. In the autumn of 2008, BTV serotype 6 unexpectedly emerged in northwest Europe and was also detected with the PCR test developed in the current study. The performance in routine use over 5 years has been recorded and evaluated.
Yang, Chang Geng; Wang, Xian Li; Tian, Juan; Liu, Wei; Wu, Fan; Jiang, Ming; Wen, Hua
2013-09-15
Quantitative real-time reverse-transcriptase polymerase chain reaction (RT-qPCR) has been used frequently to study gene expression related to fish immunology. In such studies, a stable reference gene should be selected to correct the expression of the target gene. In this study, seven candidate reference genes (glyceraldehyde-3-phosphate dehydrogenase (GADPH), ubiquitin-conjugating enzyme (UBCE), 18S ribosomal RNA (18S rRNA), beta-2-microglobulin (B2M), elongation factor 1 alpha (EF1A), tubulin alpha chain-like (TUBA) and beta actin (ACTB)), were selected to analyze their stability and normalization in seven tissues (liver, spleen, kidney, brain, heart, muscle and intestine) of Nile tilapia (Oreochromis niloticus) challenged with Streptococcus agalactiae or Streptococcus iniae, respectively. The results showed that all the candidate reference genes exhibited tissue-dependent transcriptional variations. With PBS injection as a control, UBCE was the most stable and suitable single reference gene in the intestine, liver, brain, kidney, and spleen after S. iniae infection, and in the liver, kidney, and spleen after S. agalactiae infection. EF1A was the most suitable in heart and muscle after S. iniae or S. agalactiae infection. GADPH was the most suitable gene in intestine and brain after S. agalactiae infection. In normal conditions, UBCE and 18S rRNA were the most stably expressed genes across the various tissues. These results showed that for RT-qPCR analysis of tilapia, selecting two or more reference genes may be more suitable for cross-tissue analysis of gene expression. Copyright © 2013 Elsevier B.V. All rights reserved.
Paganin, Maddalena; Fabbri, Giulia; Conter, Valentino; Barisone, Elena; Polato, Katia; Cazzaniga, Giovanni; Giraldi, Eugenia; Fagioli, Franca; Aricò, Maurizio; Valsecchi, Maria Grazia; Basso, Giuseppe
2014-11-01
Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer. Monitoring minimal residual disease (MRD) by using real-time quantitative polymerase chain reaction (RQ-PCR) provides information for patient stratification and individual risk-directed treatment. Cooperative studies have documented that measurement of blast clearance from the bone marrow during and after induction therapy identifies patient populations with different risk of relapse. We explored the possible contribution of measurements of MRD during the course of treatment. We used RQ-PCR to detect MRD in 110 unselected patients treated in Italy in the International Collaborative Treatment Protocol for Children and Adolescents With Acute Lymphoblastic Leukemia (AIEOP-BFM ALL 2000). The trial took place in AIEOP centers during postinduction chemotherapy. Results were categorized as negative, low positive (below the quantitative range [< 5 × 10(-4)]), or high positive (≥ 5 × 10(-4)). Patients with at least one low-positive or high-positive result were assigned to the corresponding subgroup. Patients who tested high positive, low positive, or negative had significantly different cumulative incidences of leukemia relapse: 83.3%, 34.8%, and 8.6%, respectively (P < .001). Two thirds of positive cases were identified within 4 months after induction-consolidation therapy, suggesting that this time frame may be most suitable for cost-effective MRD monitoring, particularly in patients who did not clear their disease at the end of consolidation. These findings provide further insights into the dynamic of MRD and the ongoing effort to define molecular relapse in childhood ALL. © 2014 by American Society of Clinical Oncology.
Specific and quantitative detection of human polyomaviruses BKV, JCV, and SV40 by real time PCR.
McNees, Adrienne L; White, Zoe S; Zanwar, Preeti; Vilchez, Regis A; Butel, Janet S
2005-09-01
The polyomaviruses that infect humans, BK virus (BKV), JC virus (JCV), and simian virus 40 (SV40), typically establish subclinical persistent infections. However, reactivation of these viruses in immunocompromised hosts is associated with renal nephropathy and hemorrhagic cystitis (HC) caused by BKV and with progressive multifocal leukoencephalopathy (PML) caused by JCV. Additionally, SV40 is associated with several types of human cancers including primary brain and bone cancers, mesotheliomas, and non-Hodgkin's lymphoma. Advancements in detection of these viruses may contribute to improved diagnosis and treatment of affected patients. To develop sensitive and specific real time quantitative polymerase chain reaction (RQ-PCR) assays for the detection of T-antigen DNA sequences of the human polyomaviruses BKV, JCV, and SV40 using the ABI Prism 7000 Sequence Detection System. Assays for absolute quantification of the viral T-ag sequences were designed and the sensitivity and specificity were evaluated. A quantitative assay to measure the single copy human RNAse P gene was also developed and evaluated in order to normalize viral gene copy numbers to cell numbers. Quantification of the target genes is sensitive and specific over a 7 log dynamic range. Ten copies each of the viral and cellular genes are reproducibly and accurately detected. The sensitivity of detection of the RQ-PCR assays is increased 10- to 100-fold compared to conventional PCR and agarose gel protocols. The primers and probes used to detect the viral genes are specific for each virus and there is no cross reactivity within the dynamic range of the standard dilutions. The sensitivity of detection for these assays is not reduced in human cellular extracts; however, different DNA extraction protocols may affect quantification. These assays provide a technique for rapid and specific quantification of polyomavirus genomes per cell in human samples.
Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin
2017-08-02
Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.
Goodell, Christa K.; Zhang, Jianqiang; Strait, Erin; Harmon, Karen; Patnayak, Devi; Otterson, Tracy; Culhane, Marie; Christopher-Hennings, Jane; Clement, Travis; Leslie-Steen, Pamela; Hesse, Richard; Anderson, Joe; Skarbek, Kevin; Vincent, Amy; Kitikoon, Pravina; Swenson, Sabrina; Jenkins-Moore, Melinda; McGill, Jodi; Rauh, Rolf; Nelson, William; O’Connell, Catherine; Shah, Rohan; Wang, Chong; Main, Rodger; Zimmerman, Jeffrey J.
2016-01-01
The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 assays based on real-time reverse-transcription polymerase chain reaction (rRT-PCR) and 7 assays based on virus isolation (VI). The OF specimens were inoculated with H1N1 or H3N2 IAV and serially diluted 10-fold (10−1 to 10−8). Eight participating laboratories received 180 randomized OF samples (10 replicates × 8 dilutions × 2 IAV subtypes plus 20 IAV-negative samples) and performed the rRT-PCR and VI procedure(s) of their choice. Analysis of the results with a mixed-effect logistic-regression model identified dilution and assay as variables significant (P < 0.0001) for IAV detection in OF by rRT-PCR or VI. Virus subtype was not significant for IAV detection by either rRT-PCR (P = 0.457) or VI (P = 0.101). For rRT-PCR the cycle threshold (Ct) values increased consistently with dilution but varied widely. Therefore, it was not possible to predict VI success on the basis of Ct values. The success of VI was inversely related to the dilution of the sample; the assay was generally unsuccessful at lower virus concentrations. Successful swine health monitoring and disease surveillance require assays with consistent performance, but significant differences in reproducibility were observed among the assays evaluated. PMID:26733728
Das, Amaresh; Deng, Ming Y; Babiuk, Shawn; McIntosh, Michael T
2017-05-01
Capripoxviruses (CaPVs), consisting of Sheeppox virus (SPV), Goatpox virus (GPV), and Lumpy skin disease virus (LSDV) species, cause economically significant diseases in sheep, goats, and cattle, respectively. Quantitative real-time polymerase chain reaction (qPCR) assays are routinely used for rapid detection of CaPVs in surveillance and outbreak management programs. We further modified and optimized 2 previously published CaPV qPCR assays, referred to as the Balinsky and Bowden assays, by changing commercial PCR reagents used in the tests. The modified assays displayed 100% analytical specificity and showed no apparent changes in analytical sensitivities for detection of CaPVs compared with the original assays. Diagnostic sensitivities, assessed using 50 clinical reference samples from experimentally infected sheep, goats, and cattle, improved from 82% to 92% for the modified Balinsky assay and from 58% to 82% for the modified Bowden assay. The modified qPCR assays were multiplexed for detection of beta-actin as an indicator for potential false-negative results. The multiplex modified qPCR assays exhibited the same diagnostic sensitivities as the singleplex assays suggesting their utility in the detection of CaPVs.
Montesinos, Isabel; Brancart, Françoise; Schepers, Kinda; Jacobs, Frederique; Denis, Olivier; Delforge, Marie-Luce
2015-06-01
A total of 120 bronchoalveolar lavage specimens from HIV and non-HIV immunocompromised patients, positive for Pneumocystis jirovecii by an "in house" real-time polymerase chain reaction (PCR), were evaluated by the Bio-Evolution Pneumocystis real-time PCR, a commercial quantitative assay. Patients were classified in 2 categories based on clinical and radiological findings: definite and unlikely Pneumocystis pneumonia (PCP). For the "in house" PCR, cycle threshold 34 was established as cut-off value to discriminate definite PCP from unlikely PCP with 65% and 85% of sensitivity and specificity, respectively. For the Bio-Evolution quantitative PCR, a cut-off value of 2.8×10(5)copies/mL was defined with 72% and 82% of sensitivity and specificity, respectively. Overlapped zones of results for definite and unlikely PCP were observed. Quantitative PCR is probably a useful tool for PCP diagnosis. However, for optimal management of PCP in non-HIV immunocompromised patients, operational thresholds should be assessed according to underlying diseases and other clinical and radiological parameters. Copyright © 2015 Elsevier Inc. All rights reserved.
Real time markerless motion tracking using linked kinematic chains
Luck, Jason P [Arvada, CO; Small, Daniel E [Albuquerque, NM
2007-08-14
A markerless method is described for tracking the motion of subjects in a three dimensional environment using a model based on linked kinematic chains. The invention is suitable for tracking robotic, animal or human subjects in real-time using a single computer with inexpensive video equipment, and does not require the use of markers or specialized clothing. A simple model of rigid linked segments is constructed of the subject and tracked using three dimensional volumetric data collected by a multiple camera video imaging system. A physics based method is then used to compute forces to align the model with subsequent volumetric data sets in real-time. The method is able to handle occlusion of segments and accommodates joint limits, velocity constraints, and collision constraints and provides for error recovery. The method further provides for elimination of singularities in Jacobian based calculations, which has been problematic in alternative methods.
Chaouachi, Maher; Alaya, Akram; Ali, Imen Ben Haj; Hafsa, Ahmed Ben; Nabi, Nesrine; Bérard, Aurélie; Romaniuk, Marcel; Skhiri, Fethia; Saïd, Khaled
2013-01-01
KEY MESSAGE : Here, we describe a new developed quantitative real-time PCR method for the detection and quantification of a new specific endogenous reference gene used in GMO analysis. The key requirement of this study was the identification of a new reference gene used for the differentiation of the four genomic sections of the sugar beet (Beta vulgaris L.) (Beta, Corrollinae, Nanae and Procumbentes) suitable for quantification of genetically modified sugar beet. A specific qualitative polymerase chain reaction (PCR) assay was designed to detect the sugar beet amplifying a region of the adenylate transporter (ant) gene only from the species of the genomic section I of the genus Beta (cultivated and wild relatives) and showing negative PCR results for 7 species of the 3 other sections, 8 related species and 20 non-sugar beet plants. The sensitivity of the assay was 15 haploid genome copies (HGC). A quantitative real-time polymerase chain reaction (QRT-PCR) assay was also performed, having high linearity (R (2) > 0.994) over sugar beet standard concentrations ranging from 20,000 to 10 HGC of the sugar beet DNA per PCR. The QRT-PCR assay described in this study was specific and more sensitive for sugar beet quantification compared to the validated test previously reported in the European Reference Laboratory. This assay is suitable for GMO quantification in routine analysis from a wide variety of matrices.
A multisite assessment of the quantitative capabilities of the Xpert MTB/RIF assay.
Blakemore, Robert; Nabeta, Pamela; Davidow, Amy L; Vadwai, Viral; Tahirli, Rasim; Munsamy, Vanisha; Nicol, Mark; Jones, Martin; Persing, David H; Hillemann, Doris; Ruesch-Gerdes, Sabine; Leisegang, Felicity; Zamudio, Carlos; Rodrigues, Camilla; Boehme, Catharina C; Perkins, Mark D; Alland, David
2011-11-01
The Xpert MTB/RIF is an automated molecular test for Mycobacterium tuberculosis that estimates bacterial burden by measuring the threshold-cycle (Ct) of its M. tuberculosis-specific real-time polymerase chain reaction. Bacterial burden is an important biomarker for disease severity, infection control risk, and response to therapy. Evaluate bacterial load quantitation by Xpert MTB/RIF compared with conventional quantitative methods. Xpert MTB/RIF results were compared with smear-microscopy, semiquantiative solid culture, and time-to-detection in liquid culture for 741 patients and 2,008 samples tested in a multisite clinical trial. An internal control real-time polymerase chain reaction was evaluated for its ability to identify inaccurate quantitative Xpert MTB/RIF results. Assays with an internal control Ct greater than 34 were likely to be inaccurately quantitated; this represented 15% of M. tuberculosis-positive tests. Excluding these, decreasing M. tuberculosis Ct was associated with increasing smear microscopy grade for smears of concentrated sputum pellets (r(s) = -0.77) and directly from sputum (r(s) =-0.71). A Ct cutoff of approximately 27.7 best predicted smear-positive status. The association between M. tuberculosis Ct and time-to-detection in liquid culture (r(s) = 0.68) and semiquantitative colony counts (r(s) = -0.56) was weaker than smear. Tests of paired same-patient sputum showed that high viscosity sputum samples contained ×32 more M. tuberculosis than nonviscous samples. Comparisons between the grade of the acid-fast bacilli smear and Xpert MTB/RIF quantitative data across study sites enabled us to identify a site outlier in microscopy. Xpert MTB/RIF quantitation offers a new, standardized approach to measuring bacterial burden in the sputum of patients with tuberculosis.
Shipitsyna, E; Zolotoverkhaya, E; Hjelmevoll, S O; Maximova, A; Savicheva, A; Sokolovsky, E; Skogen, V; Domeika, M; Unemo, M
2009-11-01
In Russia, laboratory diagnosis of gonorrhoea has been mainly based on microscopy only and, in some settings, relatively rare suboptimal culturing. In recent years, Russian developed and manufactured nucleic acid amplification tests (NAAT) have been implemented for routine diagnosis of Neisseria gonorrhoeae. However, these NAATs have never been validated to any international well-recognized diagnostic NAAT. This study aims to evaluate the performance characteristics of six Russian NAATs for N. gonorrhoeae diagnostics. In total, 496 symptomatic patients were included. Five polymerase chain reaction (PCR) assays and one real-time nucleic acid sequence based amplification (NASBA) assay, developed by three Russian companies, were evaluated on urogenital samples, i.e. cervical and first voided urine (FVU) samples from females (n = 319), urethral and FVU samples from males (n = 127), and extragenital samples, i.e. rectal and pharyngeal samples, from 50 additional female patients with suspicion of gonorrhoea. As reference method, an international strictly validated real-time porA pseudogene PCR was applied. The prevalence of N. gonorrhoeae was 2.7% and 16% among the patients providing urogenital and extragenital samples, respectively. The Russian NAATs and the reference method displayed high level of concordance (99.4-100%). The sensitivities, specificities, positive predictive values and negative predictive values of the Russian tests in different specimens were 66.7-100%, 100%, 100%, and 99.4-100%, respectively. Russian N. gonorrhoeae diagnostic NAATs comprise relatively good performance characteristics. However, larger studies are crucial and, beneficially, the Russian assays should also be evaluated to other international highly sensitive and specific, and ideally Food and Drug Administration approved, NAATs such as Aptima Combo 2 (Gen-Probe).
Real-time PCR detection chemistry.
Navarro, E; Serrano-Heras, G; Castaño, M J; Solera, J
2015-01-15
Real-time PCR is the method of choice in many laboratories for diagnostic and food applications. This technology merges the polymerase chain reaction chemistry with the use of fluorescent reporter molecules in order to monitor the production of amplification products during each cycle of the PCR reaction. Thus, the combination of excellent sensitivity and specificity, reproducible data, low contamination risk and reduced hand-on time, which make it a post-PCR analysis unnecessary, has made real-time PCR technology an appealing alternative to conventional PCR. The present paper attempts to provide a rigorous overview of fluorescent-based methods for nucleic acid analysis in real-time PCR described in the literature so far. Herein, different real-time PCR chemistries have been classified into two main groups; the first group comprises double-stranded DNA intercalating molecules, such as SYBR Green I and EvaGreen, whereas the second includes fluorophore-labeled oligonucleotides. The latter, in turn, has been divided into three subgroups according to the type of fluorescent molecules used in the PCR reaction: (i) primer-probes (Scorpions, Amplifluor, LUX, Cyclicons, Angler); (ii) probes; hydrolysis (TaqMan, MGB-TaqMan, Snake assay) and hybridization (Hybprobe or FRET, Molecular Beacons, HyBeacon, MGB-Pleiades, MGB-Eclipse, ResonSense, Yin-Yang or displacing); and (iii) analogues of nucleic acids (PNA, LNA, ZNA, non-natural bases: Plexor primer, Tiny-Molecular Beacon). In addition, structures, mechanisms of action, advantages and applications of such real-time PCR probes and analogues are depicted in this review. Copyright © 2014 Elsevier B.V. All rights reserved.
Geng, Yunyun; Wang, Jianchang; Liu, Libing; Lu, Yan; Tan, Ke; Chang, Yan-Zhong
2017-11-06
Canine parvovirus 2, a linear single-stranded DNA virus belonging to the genus Parvovirus within the family Parvoviridae, is a highly contagious pathogen of domestic dogs and several wild canidae species. Early detection of canine parvovirus (CPV-2) is crucial to initiating appropriate outbreak control strategies. Recombinase polymerase amplification (RPA), a novel isothermal gene amplification technique, has been developed for the molecular detection of diverse pathogens. In this study, a real-time RPA assay was developed for the detection of CPV-2 using primers and an exo probe targeting the CPV-2 nucleocapsid protein gene. The real-time RPA assay was performed successfully at 38 °C, and the results were obtained within 4-12 min for 10 5 -10 1 molecules of template DNA. The assay only detected CPV-2, and did not show cross-detection of other viral pathogens, demonstrating a high level of specificity. The analytical sensitivity of the real-time RPA was 10 1 copies/reaction of a standard DNA template, which was 10 times more sensitive than the common RPA method. The clinical sensitivity of the real-time RPA assay matched 100% (n = 91) to the real-time PCR results. The real-time RPA assay is a simple, rapid, reliable and affordable method that can potentially be applied for the detection of CPV-2 in the research laboratory and point-of-care diagnosis.
Cowan, Ashley F; Elkins, Kelly M
2017-12-01
Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.
Sun, Yueying; Lu, Xiaohui; Su, Fengxia; Wang, Limei; Liu, Chenghui; Duan, Xinrui; Li, Zhengping
2015-12-15
Most of practical methods for detection of single nucleotide polymorphism (SNP) need at least two steps: amplification (usually by PCR) and detection of SNP by using the amplification products. Ligase chain reaction (LCR) can integrate the amplification and allele discrimination in one step. However, the detection of LCR products still remains a great challenge for highly sensitive and quantitative SNP detection. Herein, a simple but robust strategy for real-time fluorescence LCR has been developed for highly sensitive and quantitative SNP detection. A pair of LCR probes are firstly labeled with a fluorophore and a quencher, respectively. When the pair of LCR probes are ligated in LCR, the fluorophore will be brought close to the quencher, and thus, the fluorescence will be specifically quenched by fluorescence resonance energy transfer (FRET). The decrease of fluorescence intensity resulted from FRET can be real-time monitored in the LCR process. With the proposed real-time fluorescence LCR assay, 10 aM DNA targets or 100 pg genomic DNA can be accurately determined and as low as 0.1% mutant DNA can be detected in the presence of a large excess of wild-type DNA, indicating the high sensitivity and specificity. The real-time measuring does not require the detection step after LCR and gives a wide dynamic range for detection of DNA targets (from 10 aM to 1 pM). As LCR has been widely used for detection of SNP, DNA methylation, mRNA and microRNA, the real-time fluorescence LCR assay shows great potential for various genetic analysis. Copyright © 2015 Elsevier B.V. All rights reserved.
Kongklieng, Amornmas; Intapan, Pewpan M; Boonmars, Thidarut; Thanchomnang, Tongjit; Janwan, Penchom; Sanpool, Oranuch; Lulitanond, Viraphong; Taweethavonsawat, Piyanan; Chungpivat, Sudchit; Maleewong, Wanchai
2015-03-01
A real-time fluorescence resonance energy transfer polymerase chain reaction (qFRET PCR) coupled with melting curve analysis was developed for detection of Babesia canis vogeli and Hepatozoon canis infections in canine blood samples in a single tube assay. The target of the assay was a region within the 18S ribosomal RNA gene amplified in either species by a single pair of primers. Following amplification from the DNA of infected dog blood, a fluorescence melting curve analysis was done. The 2 species, B. canis vogeli and H. canis, could be detected and differentiated in infected dog blood samples (n = 37) with high sensitivity (100%). The detection limit for B. canis vogeli was 15 copies of a positive control plasmid, and for H. canis, it was 150 copies of a positive control plasmid. The assay could simultaneously distinguish the DNA of both parasites from the DNA of controls. Blood samples from 5 noninfected dogs were negative, indicating high specificity. Several samples can be run at the same time. The assay can reduce misdiagnosis and the time associated with microscopic examination, and is not prone to the carryover contamination associated with the agarose gel electrophoresis step of conventional PCR. In addition, this qFRET PCR method would be useful to accurately determine the range of endemic areas or to discover those areas where the 2 parasites co-circulate. © 2015 The Author(s).
Evaluation of four commercial quantitative real-time PCR kits with inhibited and degraded samples.
Holmes, Amy S; Houston, Rachel; Elwick, Kyleen; Gangitano, David; Hughes-Stamm, Sheree
2018-05-01
DNA quantification is a vital step in forensic DNA analysis to determine the optimal input amount for DNA typing. A quantitative real-time polymerase chain reaction (qPCR) assay that can predict DNA degradation or inhibitors present in the sample prior to DNA amplification could aid forensic laboratories in creating a more streamlined and efficient workflow. This study compares the results from four commercial qPCR kits: (1) Investigator® Quantiplex® Pro Kit, (2) Quantifiler® Trio DNA Quantification Kit, (3) PowerQuant® System, and (4) InnoQuant® HY with high molecular weight DNA, low template samples, degraded samples, and DNA spiked with various inhibitors.The results of this study indicate that all kits were comparable in accurately predicting quantities of high quality DNA down to the sub-picogram level. However, the InnoQuant(R) HY kit showed the highest precision across the DNA concentration range tested in this study. In addition, all kits performed similarly with low concentrations of forensically relevant PCR inhibitors. However, in general, the Investigator® Quantiplex® Pro Kit was the most tolerant kit to inhibitors and provided the most accurate quantification results with higher concentrations of inhibitors (except with salt). PowerQuant® and InnoQuant® HY were the most sensitive to inhibitors, but they did indicate significant levels of PCR inhibition. When quantifying degraded samples, each kit provided different degradation indices (DI), with Investigator® Quantiplex® Pro indicating the largest DI and Quantifiler® Trio indicating the smallest DI. When the qPCR kits were paired with their respective STR kit to genotype highly degraded samples, the Investigator® 24plex QS and GlobalFiler® kits generated more complete profiles when the small target concentrations were used for calculating input amount.
Quantitative analysis of pork and chicken products by droplet digital PCR.
Cai, Yicun; Li, Xiang; Lv, Rong; Yang, Jielin; Li, Jian; He, Yuping; Pan, Liangwen
2014-01-01
In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises.
Estimation of total bacteria by real-time PCR in patients with periodontal disease.
Brajović, Gavrilo; Popović, Branka; Puletić, Miljan; Kostić, Marija; Milasin, Jelena
2016-01-01
Periodontal diseases are associated with the presence of elevated levels of bacteria within the gingival crevice. The aim of this study was to evaluate a total amount of bacteria in subgingival plaque samples in patients with a periodontal disease. A quantitative evaluation of total bacteria amount using quantitative real-time polymerase chain reaction (qRT-PCR) was performed on 20 samples of patients with ulceronecrotic periodontitis and on 10 samples of healthy subjects. The estimation of total bacterial amount was based on gene copy number for 16S rRNA that was determined by comparing to Ct values/gene copy number of the standard curve. A statistically significant difference between average gene copy number of total bacteria in periodontal patients (2.55 x 10⁷) and healthy control (2.37 x 10⁶) was found (p = 0.01). Also, a trend of higher numbers of the gene copy in deeper periodontal lesions (> 7 mm) was confirmed by a positive value of coefficient of correlation (r = 0.073). The quantitative estimation of total bacteria based on gene copy number could be an important additional tool in diagnosing periodontitis.
Yamaguchi, Akira; Oh-ishi, Tsutomu; Arai, Takashi; Sakata, Hideaki; Adachi, Nodoka; Asanuma, Satoshi; Oguma, Eiji; Kimoto, Hirofumi; Matsumoto, Jiro; Fujita, Hidetoshi; Uesato, Tadashi; Fujita, Jutaro; Shirato, Ken; Ohno, Hideki; Kizaki, Takako
2017-01-01
Objective Approximately 8–10% of newborns with asymptomatic congenital cytomegalovirus (cCMV) infection develop sensorineural hearing loss (SNHL). However, the relationship between CMV load, SNHL and central nervous system (CNS) damage in cCMV infection remains unclear. This study aimed to examine the relationship between urinary CMV load, SNHL and CNS damage in newborns with cCMV infection. Study design The study included 23 368 newborns from two maternity hospitals in Saitama Prefecture, Japan. Urine screening for cCMV infection (quantitative real-time PCR) and newborn hearing screening (automated auditory brainstem response (AABR) testing) were conducted within 5 days of birth to examine the incidence of cCMV infection and SNHL, respectively. CNS damage was assessed by MRI of cCMV-infected newborns. Results The incidence of cCMV infection was 60/23 368 (0.257%; 95% CI 0.192% to 0.322%). The geometric mean urinary CMV DNA copy number in newborns with cCMV was 1.79×106 copies/mL (95% CI 7.97×105 to 4.02×106). AABR testing revealed abnormalities in 171 of the 22 229 (0.769%) newborns whose parents approved hearing screening. Of these 171 newborns, 22 had SNHL (12.9%), and 5 of these 22 were infected with cCMV (22.7%). Newborns with both cCMV and SNHL had a higher urinary CMV DNA copy number than newborns with cCMV without SNHL (p=0.036). MRI revealed CNS damage, including white matter abnormalities, in 83.0% of newborns with cCMV. Moreover, newborns with CNS damage had a significantly greater urinary CMV load than newborns without CNS damage (p=0.013). Conclusions We determined the incidence of cCMV infection and urinary CMV DNA copy number in seemingly healthy newborns from two hospitals in Saitama Prefecture. SNHL and CNS damage were associated with urinary CMV DNA copy number. Quantification of urinary CMV load may effectively predict the incidence of late-onset SNHL and neurodevelopmental disorders. PMID:28110288
Law, I L G; Loo, J F C; Kwok, H C; Yeung, H Y; Leung, C C H; Hui, M; Wu, S Y; Chan, H S; Kwan, Y W; Ho, H P; Kong, S K
2018-03-01
With the emergence of multi- and extensive-drug (MDR/XDR) resistant Mycobacterium tuberculosis (M. tb), tuberculosis (TB) persists as one of the world's leading causes of death. Recently, isothermal DNA amplification methods received much attention due to their ease of translation onto portable point-of-care (POC) devices for TB diagnosis. In this study, we aimed to devise a simple yet robust detection method for M. tb. Amongst the numerous up-and-coming isothermal techniques, Recombinase Polymerase Amplification (RPA) was chosen for a real-time detection of TB with or without MDR. In our platform, real-time RPA (RT-RPA) was integrated on a lab-on-a-disc (LOAD) with on-board power to maintain temperature for DNA amplification. Sputa collected from healthy volunteers were spiked with respective target M. tb samples for testing. A limit of detection of 10 2 colony-forming unit per millilitre in 15 min was achieved, making early detection and differentiation of M. tb strains highly feasible in extreme POC settings. Our RT-RPA LOAD platform has also been successfully applied in the differentiation of MDR-TB from H37Ra, an attenuated TB strain. In summary, a quantitative RT-RPA on LOAD assay with a high level of sensitivity was developed as a foundation for further developments in medical bedside and POC diagnostics. Copyright © 2018 Elsevier Inc. All rights reserved.
Dual phase multiplex polymerase chain reaction
Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL
2008-10-07
Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.
Ksouri, H; Eljed, H; Greco, A; Lakhal, A; Torjman, L; Abdelkefi, A; Ben Othmen, T; Ladeb, S; Slim, A; Zouari, B; Abdeladhim, A; Ben Hassen, A
2007-03-01
A pp65 antigenemia assay for polymorphonuclear leukocytes (PMNLs) (CINAkit Rapid Antigenemia), and a qualitative polymerase chain reaction (PCR) test for plasma 'PCR-P qual' (Amplicor cytomegalovirus [CMV] test) were performed for 126 samples (blood and plasma) obtained from 18 bone marrow transplant patients, over a 9-month surveillance period. Among those samples, 92 were assayed with a semi-quantitative PCR test for PMNLs 'PCR-L quant.' The number of samples with a positive CMV test for antigenemia and PCR-P qual assays was 20.63% and 12.7%, respectively, whereas the PCR-L quant assay was positive in 48 of the 92 samples assayed (52.17%). The rates of concordance of the results of PCR-P qual and antigenemia, PCR-P qual and PCR-L quant, antigenemia and PCR-L quant were 92%, 65.2% and 66.8%, respectively. The analysis of the results for the 92 specimens tested by all 3 methods showed a rate of concordance of 63% among all methods. Good agreement (kappa=0.72) was found only between pp65 Ag and PCR-P qual assays. Clinical disease correlates with an antigenemia high viral load. Three patients had CMV disease despite preemptive therapy, and all of them had graft-versus-host-disease (GVHD). PMNLs-based assays are more efficient in monitoring CMV reactivation, but for high-risk patients with GVHD, more sensitive assays (real-time PCR) must be done.
Code of Federal Regulations, 2010 CFR
2010-01-01
... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...
Code of Federal Regulations, 2011 CFR
2011-01-01
... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...
Tan, Qian-Qian; Zhu, Li; Li, Yi; Liu, Wen; Ma, Wei-Hua; Lei, Chao-Liang; Wang, Xiao-Ping
2015-01-01
The cabbage beetle Colaphellus bowringi Baly is a serious insect pest of crucifers and undergoes reproductive diapause in soil. An understanding of the molecular mechanisms of diapause regulation, insecticide resistance, and other physiological processes is helpful for developing new management strategies for this beetle. However, the lack of genomic information and valid reference genes limits knowledge on the molecular bases of these physiological processes in this species. Using Illumina sequencing, we obtained more than 57 million sequence reads derived from C. bowringi, which were assembled into 39,390 unique sequences. A Clusters of Orthologous Groups classification was obtained for 9,048 of these sequences, covering 25 categories, and 16,951 were assigned to 255 Kyoto Encyclopedia of Genes and Genomes pathways. Eleven candidate reference gene sequences from the transcriptome were then identified through reverse transcriptase polymerase chain reaction. Among these candidate genes, EF1α, ACT1, and RPL19 proved to be the most stable reference genes for different reverse transcriptase quantitative polymerase chain reaction experiments in C. bowringi. Conversely, aTUB and GAPDH were the least stable reference genes. The abundant putative C. bowringi transcript sequences reported enrich the genomic resources of this beetle. Importantly, the larger number of gene sequences and valid reference genes provide a valuable platform for future gene expression studies, especially with regard to exploring the molecular mechanisms of different physiological processes in this species.
NASA Astrophysics Data System (ADS)
Yu, Wei; Tian, Xiaolin; He, Xiaoliang; Song, Xiaojun; Xue, Liang; Liu, Cheng; Wang, Shouyu
2016-08-01
Microscopy based on transport of intensity equation provides quantitative phase distributions which opens another perspective for cellular observations. However, it requires multi-focal image capturing while mechanical and electrical scanning limits its real time capacity in sample detections. Here, in order to break through this restriction, real time quantitative phase microscopy based on single-shot transport of the intensity equation method is proposed. A programmed phase mask is designed to realize simultaneous multi-focal image recording without any scanning; thus, phase distributions can be quantitatively retrieved in real time. It is believed the proposed method can be potentially applied in various biological and medical applications, especially for live cell imaging.
Lee, Da-Sheng
2010-01-01
Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design.
Lee, Da-Sheng
2010-01-01
Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design. PMID:22315563
Ghallab, Noha A; Amr, Eman M; Shaker, Olfat G
2015-07-01
The aim of this study is to investigate the protein and gene expression of leptin and visfatin in gingival tissue from patients with chronic periodontitis (CP), patients with CP and type 2 diabetes mellitus (T2DM), and healthy individuals. The study includes 50 individuals: 10 healthy individuals, 20 patients with CP, and 20 patients with CP and T2DM. Plaque index, gingival index, probing depth, and clinical attachment loss were measured, and gingival biopsies were obtained. Leptin and visfatin protein expression in gingival tissues was determined using enzyme-linked immunosorbent assay, and messenger RNA (mRNA) expression was measured via real-time polymerase chain reaction. The highest leptin mRNA and protein expression was observed in the control group and was significantly (P ≤0.05) different from the CP and CP+T2DM groups. Gingival tissues from patients with CP and T2DM had a significant increase in visfatin and a decrease in leptin gene and protein expression (P <0.05) compared with both controls and patients with CP. Expression of leptin and visfatin in the gingival tissues suggests a possible role for these adipokines in the pathogenesis of CP and T2DM.
A real-time polymerase chain reaction assay for the detection of Mycoplasma agalactiae.
Fitzmaurice, J; Sewell, M; King, C M; McDougall, S; McDonald, W L; O'Keefe, J S
2008-10-01
To develop a real-time PCR for the detection of Mycoplasma agalactiae, using PCR primers targeting the ma-mp81 gene. A group of 15 M. agalactiae isolates, 21 other Mycoplasma spp. isolates and 21 other bacterial isolates was used in evaluation of the assay. All M. agalactiae isolates were detected by the assay and none of the non-target isolates was amplified. The analytical detection limit of the assay was 10 fg of purified genomic DNA and 104 cfu/ml milk inoculated with M. agalactiae. When applied to goat-milk samples collected from three herds free of M. agalactiae infection, the assay had a specificity of 100%. The assay would be useful in a diagnostic laboratory, providing specific, sensitive and rapid detection of M. agalactiae.
Wang, Zhenchao; Yu, Lu; Jin, Linhong; Wang, Wenli; Zhao, Qi; Ran, Longlu; Li, Xiangyang; Chen, Zhuo; Guo, Rong; Wei, Yongtian; Yang, Zhongcheng; Liu, Enlong; Hu, Deyu; Song, Baoan
2017-02-22
Diseases caused by southern rice black-streaked dwarf virus (SRBSDV) and rice ragged stunt virus (RRSV) considerably decrease grain yield. Therefore, determining rice cultivars with high resistance to SRBSDV and RRSV is necessary. In this study, rice cultivars with high resistance to SRBSDV and RRSV were evaluated through field trials in Shidian and Mangshi county, Yunnan province, China. SYBR Green I-based quantitative real-time polymerase chain reaction (qRT-PCR) analysis was used to quantitatively detect virus gene expression levels in different rice varieties. The following parameters were applied to evaluate rice resistance: acre yield (A.Y.), incidence of infected plants (I.I.P.), virus load (V.L.), disease index (D.I.), and insect quantity (I.Q.) per 100 clusters. Zhongzheyou1 (Z1) and Liangyou2186 (L2186) were considered the most suitable varieties with integrated higher A.Y., lower I.I.P., V.L., D.I. and I.Q. In order to investigate the mechanism of rice resistance, comparative label-free shotgun liquid chromatography tandem-mass spectrometry (LC-MS/MS) proteomic approaches were applied to comprehensively describe the proteomics of rice varieties' SRBSDV tolerance. Systemic acquired resistance (SAR)-related proteins in Z1 and L2186 may result in the superior resistance of these varieties compared with Fengyouxiangzhan (FYXZ).
Shu, Benshui; Zhang, Jingjing; Cui, Gaofeng; Sun, Ranran; Sethuraman, Veeran; Yi, Xin; Zhong, Guohua
2018-01-01
Azadirachtin is an efficient and broad-spectrum botanical insecticide against more than 150 kinds of agricultural pests with the effects of mortality, antifeedant and growth regulation. Real-time quantitative polymerase chain reaction (RT-qPCR) could be one of the powerful tools to analyze the gene expression level and investigate the mechanism of azadirachtin at transcriptional level, however, the ideal reference genes are needed to normalize the expression profiling of target genes. In this present study, the fragments of eight candidate reference genes were cloned and identified from the pest Spodoptera litura. In addition, the expression stability of these genes in different samples from larvae of control and azadirachtin treatments were evaluated by the computational methods of NormFinder, BestKeeper, Delta CT, geNorm, and RefFinder. According to our results, two of the reference genes should be the optimal number for RT-qPCR analysis. Furthermore, the best reference genes for different samples were showed as followed: EF-1α and EF2 for cuticle, β-Tubulin and RPL7A for fat body, EF2 and Actin for midgut, EF2 and RPL13A for larva and RPL13A and RPL7A for all the samples. Our results established a reliable normalization for RT-qPCR experiments in S. litura and ensure the data more accurate for the mechanism analysis of azadirachtin. PMID:29695976
Shu, Benshui; Zhang, Jingjing; Cui, Gaofeng; Sun, Ranran; Sethuraman, Veeran; Yi, Xin; Zhong, Guohua
2018-01-01
Azadirachtin is an efficient and broad-spectrum botanical insecticide against more than 150 kinds of agricultural pests with the effects of mortality, antifeedant and growth regulation. Real-time quantitative polymerase chain reaction (RT-qPCR) could be one of the powerful tools to analyze the gene expression level and investigate the mechanism of azadirachtin at transcriptional level, however, the ideal reference genes are needed to normalize the expression profiling of target genes. In this present study, the fragments of eight candidate reference genes were cloned and identified from the pest Spodoptera litura . In addition, the expression stability of these genes in different samples from larvae of control and azadirachtin treatments were evaluated by the computational methods of NormFinder, BestKeeper, Delta CT, geNorm, and RefFinder. According to our results, two of the reference genes should be the optimal number for RT-qPCR analysis. Furthermore, the best reference genes for different samples were showed as followed: EF-1α and EF2 for cuticle, β-Tubulin and RPL7A for fat body, EF2 and Actin for midgut, EF2 and RPL13A for larva and RPL13A and RPL7A for all the samples. Our results established a reliable normalization for RT-qPCR experiments in S. litura and ensure the data more accurate for the mechanism analysis of azadirachtin.
Harms, Craig A.; Ottinger, Christopher A.; Blazer, Vicki S.; Densmore, Christine L.; Pieper, L.H.; Kennedy-Stoskopf, S.
2000-01-01
Fish morbidity and mortality events in Chesapeake Bay tributaries have aroused concern over the health of this important aquatic ecosystem. We applied a recently described method for quantifying mRNA of an immunosuppressive cytokine, transforming growth factor-β (TGF-β), by reverse transcription quantitative-competitive polymerase chain reaction to a field study of fish health in the Chesapeake Basin, and compared the results to those of a traditional cellular immunoassay macrophage bactericidal activity. We selected the white perch (Morone americana) as the sentinel fish species because of its abundance at all of the collection sites. White perch were sampled from Chesapeake Bay tributaries in June, August, and October 1998. Splenic mononuclear cell TGF-β mRNA levels increased and anterior kidney macrophage bactericidal activity decreased, particularly in eastern shore tributaries, from June to August and October. The results of the two assays correlated inversely (Kendall's τ b = -0.600; p = 0.0102). The results indicated both temporal and spatial modulation of white perch immune systems in the Chesapeake Basin, and demonstrated the utility of quantitative PCR for TGF-β as a molecular biomarker for field assessment of teleost fish immune status.
Liu, Junlian; Yi, Yong; Chen, Wei; Si, Shaoyan; Yin, Mengmeng; Jin, Hua; Liu, Jianjun; Zhou, Jinlian; Zhang, Jianzhong
2015-01-01
Genital herpes (GH), which is caused mainly by herpes simplex virus (HSV)-2 and HSV-1, remains a worldwide problem. Laboratory confirmation of GH is important, particularly as there are other conditions which present similarly to GH, while atypical presentations of GH also occur. Currently, virus culture is the classical method for diagnosis of GH, but it is time consuming and with low sensitivity. A major advance for diagnosis of GH is to use Real-time polymerase chain reaction (PCR). In this study, to evaluate the significance of the real-time PCR method in diagnosis and typing of genital HSV, the primers and probes targeted at HSV-1 DNA polymerase gene and HSV-2 glycoprotein D gene fraction were designed and applied to amplify DNA from HSV-1 or HSV-2 by employing the real-time PCR technique. Then the PCR reaction system was optimized and evaluated. HSV in swab specimens from patients with genital herpes was detected by real-time PCR. The real-time PCR assay showed good specificity for detection and typing of HSV, with good linear range (5×10(2)~5×10(8) copies/ml, r=0.997), a sensitivity of 5×10(2) copies/ml, and good reproducibility (intra-assay coefficients of variation 2.29% and inter-assay coefficients of variation 4.76%). 186 swab specimens were tested for HSV by real-time PCR, and the positive rate was 23.7% (44/186). Among the 44 positive specimens, 8 (18.2%) were positive for HSV-1 with a viral load of 8.5546×10(6) copies/ml and 36 (81.2%) were positive for HSV-2 with a viral load of 1.9861×10(6) copies/ml. It is concluded that the real-time PCR is a specific, sensitive and rapid method for the detection and typing of HSV, which can be widely used in clinical diagnosis of GH.
Determining Annealing Temperatures for Polymerase Chain Reaction
ERIC Educational Resources Information Center
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
Role of disulfide bridges in archaeal family-B DNA polymerases.
Killelea, Tom; Connolly, Bernard A
2011-06-14
The family-B DNA polymerases obtained from the order Thermococcales, for example, Pyrococcus furiosus (Pfu-Pol) are commonly used in the polymerase chain reaction (PCR) because of their high thermostability and low error rates. Most of these polymerases contain four cysteines, arranged as two disulfide bridges. With Pfu-Pol C429-C443 forms one of the disulfides (DB1) and C507-C510 (DB2) the other. Although the disulfides are well conserved in the enzymes from the hyperthermophilic Thermococcales, they are less prevalent in euryarchaeal polymerases from other orders, and tend to be only found in other hyperthermophiles. Here, we report on the effects of deleting the disulfide bridges by mutating the relevant cysteines to serines. A variety of techniques, including differential scanning calorimetry and differential scanning fluorimetry, have shown that both disulfides make a contribution to thermostability, with DB1 being more important than DB2. However, even when both disulfides are removed, sufficient thermostability remains for normal (identical to the wild type) performance in PCR and quantitative (real-time) PCR. Therefore, polymerases totally lacking cysteine are fully compatible with most PCR-based applications. This observation opens the way to further engineering of polymerases by introduction of a single cysteine followed by appropriate chemical modification. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zhou, Hao; Chen, Shun; Qi, Yulin; Wang, Mingshu; Jia, Renyong; Zhu, Dekang; Liu, Mafeng; Liu, Fei; Chen, Xiaoyue; Cheng, Anchun
2015-10-01
Real time quantitative polymerase chain reaction (RT-qPCR) based on SYBR-Green I binding is a quick, reliable, and easy method for analyzing small amounts of mRNA. Viral pathogens are recognized at the time of infection by pattern recognition receptors; thus, the inflammatory cytokines (IL1β, IL6, and IL18) and antiviral cytokines (IFNα, IFNγ) are secreted by innate immune cells and induced to respond to the pathogens. The objective of this study was to develop an effective and sensitive RT-qPCR assay for the rapid and accurate quantification of goose cytokines: IFNα, IFNγ, IL1β, IL6, and IL18. Subsequently, the established methods were employed to detect the immune response in agonist-stimulated goose spleen cells in vitro. These data indicated that the established RT-qPCR is a reliable method for determining relative gene expression. The results revealed that Imiquimod led to the significant upregulation of goose IFNα (P < 0.01), IFNγ (P < 0.01), IL1β (P < 0.01), IL6 (P < 0.01), and IL18 (P < 0.05). The established methods are important for scientific research and clinical applications, which require rapid and accurate results in a short period of time. The technique can potentially be used in the further research of goose molecular immunology, which will help us understand the interactions between hosts and pathogens. © 2015 Poultry Science Association Inc.
Nhantumbo, Aquino Albino; Cantarelli, Vlademir Vicente; Caireão, Juliana; Munguambe, Alcides Moniz; Comé, Charlotte Elizabeth; Pinto, Gabriela do Carmo; Zimba, Tomás Francisco; Mandomando, Inácio; Semá, Cynthia Baltazar; Dias, Cícero; Moraes, Milton Ozório; Gudo, Eduardo Samo
2015-01-01
In Sub-Saharan Africa, including Mozambique, acute bacterial meningitis (ABM) represents a main cause of childhood mortality. The burden of ABM is seriously underestimated because of the poor performance of culture sampling, the primary method of ABM surveillance in the region. Low quality cerebrospinal fluid (CSF) samples and frequent consumption of antibiotics prior to sample collection lead to a high rate of false-negative results. To our knowledge, this study is the first to determine the frequency of ABM in Mozambique using real-time polymerase chain reaction (qPCR) and to compare results to those of culture sampling. Between March 2013 and March 2014, CSF samples were collected at 3 regional hospitals from patients under 5 years of age, who met World Health Organization case definition criteria for ABM. Macroscopic examination, cytochemical study, culture, and qPCR were performed on all samples. A total of 369 CSF samples were collected from children clinically suspected of ABM. qPCR showed a significantly higher detection rate of ABM-causing pathogens when compared to culture (52.3% [193/369] versus 7.3% [27/369], p = 0.000). The frequency of Streptococcus pneumoniae, Haemophilus influenzae, group B Streptococci, and Neisseria meningitidis were 32.8% (121⁄369), 12.2%, (45⁄369), 3.0% (16⁄369) and 4.3% (11⁄369), respectively, significantly higher compared to that obtained on culture (p < 0.001 for each). Our findings demonstrate that culture is less effective for the diagnosis of ABM than qPCR. The common use of culture rather than qPCR to identify ABM results in serious underestimation of the burden of the disease, and our findings strongly suggest that qPCR should be incorporated into surveillance activities for ABM. In addition, our data showed that S. pneumoniae represents the most common cause of ABM in children under 5 years of age.
Yamaguchi, Akira; Oh-Ishi, Tsutomu; Arai, Takashi; Sakata, Hideaki; Adachi, Nodoka; Asanuma, Satoshi; Oguma, Eiji; Kimoto, Hirofumi; Matsumoto, Jiro; Fujita, Hidetoshi; Uesato, Tadashi; Fujita, Jutaro; Shirato, Ken; Ohno, Hideki; Kizaki, Takako
2017-01-20
Approximately 8-10% of newborns with asymptomatic congenital cytomegalovirus (cCMV) infection develop sensorineural hearing loss (SNHL). However, the relationship between CMV load, SNHL and central nervous system (CNS) damage in cCMV infection remains unclear. This study aimed to examine the relationship between urinary CMV load, SNHL and CNS damage in newborns with cCMV infection. The study included 23 368 newborns from two maternity hospitals in Saitama Prefecture, Japan. Urine screening for cCMV infection (quantitative real-time PCR) and newborn hearing screening (automated auditory brainstem response (AABR) testing) were conducted within 5 days of birth to examine the incidence of cCMV infection and SNHL, respectively. CNS damage was assessed by MRI of cCMV-infected newborns. The incidence of cCMV infection was 60/23 368 (0.257%; 95% CI 0.192% to 0.322%). The geometric mean urinary CMV DNA copy number in newborns with cCMV was 1.79×10 6 copies/mL (95% CI 7.97×10 5 to 4.02×10 6 ). AABR testing revealed abnormalities in 171 of the 22 229 (0.769%) newborns whose parents approved hearing screening. Of these 171 newborns, 22 had SNHL (12.9%), and 5 of these 22 were infected with cCMV (22.7%). Newborns with both cCMV and SNHL had a higher urinary CMV DNA copy number than newborns with cCMV without SNHL (p=0.036). MRI revealed CNS damage, including white matter abnormalities, in 83.0% of newborns with cCMV. Moreover, newborns with CNS damage had a significantly greater urinary CMV load than newborns without CNS damage (p=0.013). We determined the incidence of cCMV infection and urinary CMV DNA copy number in seemingly healthy newborns from two hospitals in Saitama Prefecture. SNHL and CNS damage were associated with urinary CMV DNA copy number. Quantification of urinary CMV load may effectively predict the incidence of late-onset SNHL and neurodevelopmental disorders. Published by the BMJ Publishing Group Limited. For permission to use (where not already
Comparison of Abbott and Da-an real-time PCR for quantitating serum HBV DNA.
Qiu, Ning; Li, Rui; Yu, Jian-Guo; Yang, Wen; Zhang, Wei; An, Yong; Li, Tong; Liu, Xue-En; Zhuang, Hui
2014-09-07
To compare the performance of the Da-an real-time hepatitis B virus (HBV) DNA assay and Abbott RealTime HBV assay. HBV DNA standards as well as a total of 180 clinical serum samples from patients with chronic hepatitis B were measured using the Abbott and Da-an real-time polymerase chain reaction (PCR) assays. Correlation and Bland-Altman plot analysis was used to compare the performance of the Abbott and Da-an assays. The HBV DNA levels were logarithmically transformed for analysis. All statistical analyses were performed using SPSS for Windows version 18.0. The correlation between the two assays was analyzed by Pearson's correlation and linear regression. The Bland-Altman plots were used for the analysis of agreement between the two assays. A P value of < 0.05 was considered statistically significant. The HBV DNA values measured by the Abbott or Da-an assay were significantly correlated with the expected values of HBV DNA standards (r = 0.999, for Abbott; r = 0.987, for Da-an, P < 0.001). A Bland-Altman plot showed good agreement between these two assays in detecting HBV DNA standards. Among the 180 clinical serum samples, 126 were quantifiable by both assays. Fifty-two samples were detectable by the Abbott assay but below the detection limit of the Da-an assay. Moreover, HBV DNA levels measured by the Abbott assay were significantly higher than those of the Da-an assay (6.23 ± 1.76 log IU/mL vs 5.46 ± 1.55 log IU/mL, P < 0.001). A positive correlation was observed between HBV DNA concentrations determined by the two assays in 126 paired samples (r = 0.648, P < 0.001). One hundred and fifteen of 126 (91.3%) specimens tested with both assays were within mean difference ± 1.96 SD of HBV DNA levels. The Da-an assay presented lower sensitivity and a narrower linear range as compared to the Abbott assay, suggesting the need to be improved.
Jiang, Xin; Xue, Yang; Zhou, Hongzhi; Li, Shouhong; Zhang, Zongmin; Hou, Rui; Ding, Yuxiang; Hu, Kaijin
2015-10-01
Reference genes are commonly used as a reliable approach to normalize the results of quantitative polymerase chain reaction (qPCR), and to reduce errors in the relative quantification of gene expression. Suitable reference genes belonging to numerous functional classes have been identified for various types of species and tissue. However, little is currently known regarding the most suitable reference genes for bone, specifically for the sheep mandibular condyle. Sheep are important for the study of human bone diseases, particularly for temporomandibular diseases. The present study aimed to identify a set of reference genes suitable for the normalization of qPCR data from the mandibular condyle of sheep. A total of 12 reference genes belonging to various functional classes were selected, and the expression stability of the reference genes was determined in both the normal and fractured area of the sheep mandibular condyle. RefFinder, which integrates the following currently available computational algorithms: geNorm, NormFinder, BestKeeper, and the comparative ΔCt method, was used to compare and rank the candidate reference genes. The results obtained from the four methods demonstrated a similar trend: RPL19, ACTB, and PGK1 were the most stably expressed reference genes in the sheep mandibular condyle. As determined by RefFinder comprehensive analysis, the results of the present study suggested that RPL19 is the most suitable reference gene for studies associated with the sheep mandibular condyle. In addition, ACTB and PGK1 may be considered suitable alternatives.
Kidd, I M; Clark, D A; Emery, V C
2000-06-01
Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.
NASA Astrophysics Data System (ADS)
Valdes, Pablo A.; Angelo, Joseph; Gioux, Sylvain
2015-03-01
Fluorescence imaging has shown promise as an adjunct to improve the extent of resection in neurosurgery and oncologic surgery. Nevertheless, current fluorescence imaging techniques do not account for the heterogeneous attenuation effects of tissue optical properties. In this work, we present a novel imaging system that performs real time quantitative fluorescence imaging using Single Snapshot Optical Properties (SSOP) imaging. We developed the technique and performed initial phantom studies to validate the quantitative capabilities of the system for intraoperative feasibility. Overall, this work introduces a novel real-time quantitative fluorescence imaging method capable of being used intraoperatively for neurosurgical guidance.
Krøjgaard, Louise H; Krogfelt, Karen A; Albrechtsen, Hans-Jørgen; Uldum, Søren A
2011-11-21
Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool for risk assessment. In water collected from the apartments Legionella spp were detected by qPCR in the concentration range from LOQ to 9.6*105GU/L while L. pneumophila were detected in a range from LOQ to 6.8*105 GU/L. By culturing, the legionellae were detected in the range from below detection limit (> 10 CFU/L) to 1.6*106 CFU/L. In circulating water and in first flush water from shower hoses, culture and qPCR showed the same tendencies. The overall correlation between the bacteria number detected by culture and the two developed qPCR assays (L. spp and L. pneumophila) was relatively poor (r2 = 0.31 for culture and Legionella spp. assay, r2 = 0.20 for culture and L. pneumophila assay). Detection by qPCR was suitable for monitoring changes in the concentration of Legionella but the precise determination of bacteria is difficult. Risk assessment by qPCR only on samples without any background information regarding treatment, timing, etc is dubious. However, the rapid detection by qPCR of high concentrations of Legionella - especially Legionella pneumophila - is valuable as an indicator of risk, although it may be false positive compared to culture results. On the other hand, the detection of a low number of bacteria by qPCR is a strong indication for the absence of risk.
Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli
2014-05-30
Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.
Li, Xiaowei; Zhang, Fusheng; Wang, Dongqin; Li, Zhenyu; Qin, Xuemei; Du, Guanhua
2014-02-01
Carbon tetrachloride (CCl4) is commonly used as a model toxicant to induce chronic and acute liver injuries. In this study, metabolite profiling and gene expression analysis of liver tissues were performed by nuclear magnetic resonance and quantitative real-time polymerase chain reaction to understand the responses of acute liver injury system in rats to CCl4. Acute liver injury was successfully induced by CCl4 as revealed by histopathological results and significant increase in alanine aminotransferase and serum aspartate aminotransferase. We found that CCl4 caused a significant increase in lactate, succinate, citrate, dimethylgycine, choline and taurine. CCl4 also caused a decrease in some of the amino acids such as leucine/isoleucine, glutamine/glutathione and betaine. Gene function analysis revealed that 10 relevant enzyme genes exhibited changes in expressions in the acute liver injury model. In conclusion, the metabolic pathways, including tricarboxylic acid cycle, antioxidant defense systems, fatty acid β-oxidation, glycolysis and choline and mevalonate metabolisms were impaired in CCl4-treated rat livers. These findings provided an overview of the biochemical consequences of CCl4 exposure and comprehensive insights into the metabolic aspects of CCl4-induced hepatotoxicity in rats. These findings may also provide reference of the mechanisms of acute liver injury that could be used to study the changes in functional genes and metabolites. Copyright © 2013 Elsevier B.V. All rights reserved.
Warhurst, Geoffrey; Dunn, Graham; Chadwick, Paul; Blackwood, Bronagh; McAuley, Daniel; Perkins, Gavin D; McMullan, Ronan; Gates, Simon; Bentley, Andrew; Young, Duncan; Carlson, Gordon L; Dark, Paul
2015-05-01
There is growing interest in the potential utility of real-time polymerase chain reaction (PCR) in diagnosing bloodstream infection by detecting pathogen deoxyribonucleic acid (DNA) in blood samples within a few hours. SeptiFast (Roche Diagnostics GmBH, Mannheim, Germany) is a multipathogen probe-based system targeting ribosomal DNA sequences of bacteria and fungi. It detects and identifies the commonest pathogens causing bloodstream infection. As background to this study, we report a systematic review of Phase III diagnostic accuracy studies of SeptiFast, which reveals uncertainty about its likely clinical utility based on widespread evidence of deficiencies in study design and reporting with a high risk of bias. Determine the accuracy of SeptiFast real-time PCR for the detection of health-care-associated bloodstream infection, against standard microbiological culture. Prospective multicentre Phase III clinical diagnostic accuracy study using the standards for the reporting of diagnostic accuracy studies criteria. Critical care departments within NHS hospitals in the north-west of England. Adult patients requiring blood culture (BC) when developing new signs of systemic inflammation. SeptiFast real-time PCR results at species/genus level compared with microbiological culture in association with independent adjudication of infection. Metrics of diagnostic accuracy were derived including sensitivity, specificity, likelihood ratios and predictive values, with their 95% confidence intervals (CIs). Latent class analysis was used to explore the diagnostic performance of culture as a reference standard. Of 1006 new patient episodes of systemic inflammation in 853 patients, 922 (92%) met the inclusion criteria and provided sufficient information for analysis. Index test assay failure occurred on 69 (7%) occasions. Adult patients had been exposed to a median of 8 days (interquartile range 4-16 days) of hospital care, had high levels of organ support activities and recent
Quantitative real-time monitoring of dryer effluent using fiber optic near-infrared spectroscopy.
Harris, S C; Walker, D S
2000-09-01
This paper describes a method for real-time quantitation of the solvents evaporating from a dryer. The vapor stream in the vacuum line of a dryer was monitored in real time using a fiber optic-coupled acousto-optic tunable filter near-infrared (AOTF-NIR) spectrometer. A balance was placed in the dryer, and mass readings were recorded for every scan of the AOTF-NIR. A partial least-squares (PLS) calibration was subsequently built based on change in mass over change in time for solvents typically used in a chemical manufacturing plant. Controlling software for the AOTF-NIR was developed. The software collects spectra, builds the PLS calibration model, and continuously fits subsequently collected spectra to the calibration, allowing the operator to follow the mass loss of solvent from the dryer. The results indicate that solvent loss can be monitored and quantitated in real time using NIR for the optimization of drying times. These time-based mass loss values have also been used to calculate "dynamic" vapor density values for the solvents. The values calculated are in agreement with values determined from the ideal gas law and could prove valuable as tools to measure temperature or pressure indirectly.
Tattiyapong, P; Sirikanchana, K; Surachetpong, W
2018-02-01
Tilapia lake virus (TiLV) is an emerging pathogen associated with high mortalities of wild and farm-raised tilapia in different countries. In this study, a SYBR green-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay targeting segment three of the virus was developed to detect and quantify TiLV in clinical samples and experimentally challenged fish. All 30 field samples with clinical signs and history consistent with TiLV infection were positive for TiLV as detected by the developed RT-qPCR method. The RT-qPCR technique provided 100 and 10,000 times more sensitive for virus detection than those offered by the RT-PCR and virus isolation in cell culture methods, respectively. The detection limit of the RT-qPCR method was as low as two viral copies/μl. Moreover, the RT-qPCR technique could be applied for TiLV detection in various fish tissues including gills, liver, brain, heart, anterior kidney and spleen. Significantly, this study delivered an accurate and reliable method for rapid detection of TiLV viruses that facilitates active surveillance programme and disease containment. © 2017 John Wiley & Sons Ltd.
Johnson, A K; Harms, C A; Levine, J F; Law, J McHugh
2006-01-01
A quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) assay was developed to measure transforming growth factor-beta (TGF-beta) in Atlantic menhaden (Brevoortia tyrannus), an estuarine-dependent species plagued by ulcerative skin lesions in the estuaries along the eastern United States. Atlantic menhaden were acclimated in a closed system for two weeks prior to initiation of the study. The synthetic glucocorticoid, triamcinolone acetonide (10mg/kg body weight) was administered by intracoelomic injection and its effect on the splenic mononuclear cell TGF-beta mRNA transcription, liver-somatic index, spleno-somatic index, hematology, and plasma chemistry were compared to untreated fish at 48 and 96h post-treatment. Triamcinolone-treated Atlantic menhaden showed suppression of TGF-beta mRNA production, neutrophilia, monocytosis, lymphopenia, and an increase in blood glucose concentrations. The health indices used in this study may help us interpret some of the changes observed during the development of ulcerative skin lesions in wild-caught menhaden.
Olioso, Debora; Marzotto, Marta; Bonafini, Clara; Brizzi, Maurizio; Bellavite, Paolo
2016-05-01
Arnica montana is a popular traditional remedy widely used in complementary medicine, also for its wound healing properties. Despite its acknowledged action in clinical settings at various doses, the molecular aspects relating to how A. montana promotes wound healing remain to be elucidated. To fill this gap, we evaluated the whole plant extract, in a wide range of dilutions, in THP-1 human cells, differentiated into mature macrophages and into an alternative IL-4-activated phenotype involved in tissue remodelling and healing. Real-time quantitative Reverse Transcription Polymerase Chain Reaction (PCR) analysis was used to study the changes in the expression of a customized panel of key genes, mainly cytokines, receptors and transcription factors. On macrophages differentiated towards the wound healing phenotype, A. montana affected the expression of several genes. In particular CXC chemokine ligand 1 (CXCL1), coding for an chief chemokine, exhibited the most consistent increase of expression, while also CXC chemokine ligand 2 (CXCL2), Interleukin8 (IL8) and bone morphogenetic protein (BMP2) were slightly up-regulated, suggesting a positive influence of A. montana on neutrophil recruitment and on angiogenesis. MMP1, coding for a metalloproteinase capable of cleaving extracellular matrix substrates, was down-regulated. Most results showed non-linearity of the dose-effect relationship. This exploratory study provides new insights into the cellular and molecular mechanisms of action of A. montana as a promoter of healing, since some of the genes it modifies are key regulators of tissue remodelling, inflammation and chemotaxis. Copyright © 2016 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.
Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao
2011-12-28
For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.
Millon, Laurence; Larosa, Fabrice; Lepiller, Quentin; Legrand, Faezeh; Rocchi, Steffi; Daguindau, Etienne; Scherer, Emeline; Bellanger, Anne-Pauline; Leroy, Joel; Grenouillet, Frederic
2013-05-01
The aim of our study was to assess the detection of circulating DNA from the most common species of Mucorales for early diagnosis of mucormycosis in at-risk patients. We retrospectively evaluated a combination of 3 quantitative polymerase chain reaction (qPCR) assays using hydrolysis probes targeting Mucor/Rhizopus, Lichtheimia (formerly Absidia), and Rhizomucor for circulating Mucorales detection. Serial serum samples from 10 patients diagnosed with proven mucormycosis (2-9 samples per patient) were analyzed. No cross-reactivity was detected in the 3 qPCR assays using 19 reference strains of opportunistic fungi, and the limit of detection ranged from 3.7 to 15 femtograms/10 µL, depending on the species. DNA from Mucorales was detected in the serum of 9 of 10 patients between 68 and 3 days before mucormycosis diagnosis was confirmed by histopathological examination and/or positive culture. All the qPCR results were concordant with culture and/or PCR-based identification of the causing agents in tissue (Lichtheimia species, Rhizomucor species, and Mucor/Rhizopus species in 4, 3, and 2 patients, respectively). Quantitative PCR was negative in only 1 patient with proven disseminated mucormycosis caused by Lichtheimia species. Our study suggests that using specific qPCR targeting several species of Mucorales according to local ecology to screen at-risk patients could be useful in a clinical setting. The cost and efficacy of this strategy should be evaluated. However, given the human and economic cost of mucormycosis and the need for rapid diagnosis to initiate prompt directed antifungal therapy, this strategy could be highly attractive.
Babafemi, Emmanuel O; Cherian, Benny P; Banting, Lee; Mills, Graham A; Ngianga, Kandala
2017-10-25
Rapid and accurate diagnosis of tuberculosis (TB) is key to manage the disease and to control and prevent its transmission. Many established diagnostic methods suffer from low sensitivity or delay of timely results and are inadequate for rapid detection of Mycobacterium tuberculosis (MTB) in pulmonary and extra-pulmonary clinical samples. This study examined whether a real-time polymerase chain reaction (RT-PCR) assay, with a turn-a-round time of 2 h, would prove effective for routine detection of MTB by clinical microbiology laboratories. A systematic literature search was performed for publications in any language on the detection of MTB in pathological samples by RT-PCR assay. The following sources were used MEDLINE via PubMed, EMBASE, BIOSIS Citation Index, Web of Science, SCOPUS, ISI Web of Knowledge and Cochrane Infectious Diseases Group Specialised Register, grey literature, World Health Organization and Centres for Disease Control and Prevention websites. Forty-six studies met set inclusion criteria. Generated pooled summary estimates (95% CIs) were calculated for overall accuracy and bivariate meta-regression model was used for meta-analysis. Summary estimates for pulmonary TB (31 studies) were as follows: sensitivity 0.82 (95% CI 0.81-0.83), specificity 0.99 (95% CI 0.99-0.99), positive likelihood ratio 43.00 (28.23-64.81), negative likelihood ratio 0.16 (0.12-0.20), diagnostic odds ratio 324.26 (95% CI 189.08-556.09) and area under curve 0.99. Summary estimates for extra-pulmonary TB (25 studies) were as follows: sensitivity 0.70 (95% CI 0.67-0.72), specificity 0.99 (95% CI 0.99-0.99), positive likelihood ratio 29.82 (17.86-49.78), negative likelihood ratio 0.33 (0.26-0.42), diagnostic odds ratio 125.20 (95% CI 65.75-238.36) and area under curve 0.96. RT-PCR assay demonstrated a high degree of sensitivity for pulmonary TB and good sensitivity for extra-pulmonary TB. It indicated a high degree of specificity for ruling in TB infection from sampling
Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe
2017-08-15
Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.
Zeng, Shaohua; Liu, Yongliang; Wu, Min; Liu, Xiaomin; Shen, Xiaofei; Liu, Chunzhao; Wang, Ying
2014-01-01
Lycium barbarum and L. ruthenicum are extensively used as traditional Chinese medicinal plants. Next generation sequencing technology provides a powerful tool for analyzing transcriptomic profiles of gene expression in non-model species. Such gene expression can then be confirmed with quantitative real-time polymerase chain reaction (qRT-PCR). Therefore, use of systematically identified suitable reference genes is a prerequisite for obtaining reliable gene expression data. Here, we calculated the expression stability of 18 candidate reference genes across samples from different tissues and grown under salt stress using geNorm and NormFinder procedures. The geNorm-determined rank of reference genes was similar to those defined by NormFinder with some differences. Both procedures confirmed that the single most stable reference gene was ACNTIN1 for L. barbarum fruits, H2B1 for L. barbarum roots, and EF1α for L. ruthenicum fruits. PGK3, H2B2, and PGK3 were identified as the best stable reference genes for salt-treated L. ruthenicum leaves, roots, and stems, respectively. H2B1 and GAPDH1+PGK1 for L. ruthenicum and SAMDC2+H2B1 for L. barbarum were the best single and/or combined reference genes across all samples. Finally, expression of salt-responsive gene NAC, fruit ripening candidate gene LrPG, and anthocyanin genes were investigated to confirm the validity of the selected reference genes. Suitable reference genes identified in this study provide a foundation for accurately assessing gene expression and further better understanding of novel gene function to elucidate molecular mechanisms behind particular biological/physiological processes in Lycium.
Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei
2012-01-01
Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2-ΔΔCt method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR. PMID:22938136
Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei
2012-01-01
Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2(-ΔΔCt) method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR.
Towards real-time quantitative optical imaging for surgery
NASA Astrophysics Data System (ADS)
Gioux, Sylvain
2017-07-01
There is a pressing clinical need to provide image guidance during surgery. Currently, assessment of tissue that needs to be resected or avoided is performed subjectively leading to a large number of failures, patient morbidity and increased healthcare cost. Because near-infrared (NIR) optical imaging is safe, does not require contact, and can provide relatively deep information (several mm), it offers unparalleled capabilities for providing image guidance during surgery. In this work, we introduce a novel concept that enables the quantitative imaging of endogenous molecular information over large fields-of-view. Because this concept can be implemented in real-time, it is amenable to provide video-rate endogenous information during surgery.
Yang, Yang; Wong, Gary; Ye, Baoguo; Li, Shihua; Li, Shanqin; Zheng, Haixia; Wang, Qiang; Liang, Mifang; Gao, George F; Liu, Lei; Liu, Yingxia; Bi, Yuhai
2017-06-01
The Zika virus (ZIKV) is an arbovirus that has spread rapidly worldwide within recent times. There is accumulating evidence that associates ZIKV infections with Guillain-Barré Syndrome (GBS) and microcephaly in humans. The ZIKV is genetically diverse and can be separated into Asian and African lineages. A rapid, sensitive, and specific assay is needed for the detection of ZIKV across various pandemic regions. So far, the available primers and probes do not cover the genetic diversity and geographic distribution of all ZIKV strains. To this end, we have developed a one-step quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay based on conserved sequences in the ZIKV envelope (E) gene. The detection limit of the assay was determined to be five RNA transcript copies and 2.94 × 10 -3 50% tissue culture infectious doses (TCID 50 ) of live ZIKV per reaction. The assay was highly specific and able to detect five different ZIKV strains covering the Asian and African lineages without nonspecific amplification, when tested against other flaviviruses. The assay was also successful in testing for ZIKV in clinical samples. Our assay represents an improvement over the current methods available for the detection ZIKV and would be valuable as a diagnostic tool in various pandemic regions.
NASA Astrophysics Data System (ADS)
Qiu, Reng; Sun, Boguang; Fang, Shasha; Sun, Li; Liu, Xiao
2013-03-01
Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is widely used in studies of gene expression. In most of these studies, housekeeping genes are used as internal references without validation. To identify appropriate reference genes for qRT-PCR in Pacific abalone Haliotis discus hannai, we examined the transcription stability of six housekeeping genes in abalone tissues in the presence and absence of bacterial infection. For this purpose, abalone were infected with the bacterial pathogen Vibrio anguillarum for 12 h and 48 h. The mRNA levels of the housekeeping genes in five tissues (digestive glands, foot muscle, gill, hemocyte, and mantle) were determined by qRT-PCR. The PCR data was subsequently analyzed with the geNorm and NormFinder algorithms. The results show that in the absence of bacterial infection, elongation factor-1-alpha and beta-actin were the most stably expressed genes in all tissues, and thus are suitable as cross-tissue type normalization factors. However, we did not identify any universal reference genes post infection because the most stable genes varied between tissue types. Furthermore, for most tissues, the optimal reference genes identified by both algorithms at 12 h and 48 h post-infection differed. These results indicate that bacterial infection induced significant changes in the expression of abalone housekeeping genes in a manner that is dependent on tissue type and duration of infection. As a result, different normalization factors must be used for different tissues at different infection points.
Alexander, C L; Shankland, G S; Carman, W; Williams, C
2011-05-01
Dermatophytes are the major cause of superficial mycoses in samples submitted to Clinical Mycology, Glasgow. The most prevalent species is Trichophyton rubrum as identified classically by microscopy and culture. Recent advances in polymerase chain reaction (PCR) technology were examined for the feasibility of introducing a T. rubrum real-time PCR assay into a routine diagnostic service. To improve the diagnostic mycology service by the introduction of a real-time PCR test for T. rubrum. The DNA from 4972 nail and skin samples was obtained using the Qiagen QIAsymphony automated extractor. This DNA was subjected to real-time PCR using T. rubrum-specific primers and a probe. During phase 1 of the study, 862 samples were analysed; 446 of 470 specimens that grew T. rubrum were detected by PCR. Out of 4110 samples analysed during phase 2, 753 T. rubrum infections were diagnosed and reported within 72 h. A total of 3357 samples were negative for a fungal infection by PCR and microscopy; these were also reported within 72 h. A vast reduction in the turnaround times can be achieved using this technique as opposed to classical methods. Samples which are PCR negative but microscopy positive are still subjected to culture. Screening samples for their suitability for PCR prior to processing eliminates the application of PCR for T. rubrum on inappropriate samples such those from the scalp or pityriasis versicolor. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.
A PCR primer bank for quantitative gene expression analysis.
Wang, Xiaowei; Seed, Brian
2003-12-15
Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.
Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A
2012-08-15
Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.
Chern, Eunice C; King, Dawn; Haugland, Richard; Pfaller, Stacy
2015-03-01
Mycobacterium avium (MA), Mycobacterium intracellulare (MI), and Mycobacterium avium subsp. paratuberculosis (MAP) are difficult to culture due to their slow growing nature. A quantitative polymerase chain reaction (qPCR) method for the rapid detection of MA, MI, and MAP can be used to provide data supporting drinking water biofilms as potential sources of human exposure. The aim of this study was to characterize two qPCR assays targeting partial 16S rRNA gene sequences of MA and MI and use these assays, along with two previously reported MAP qPCR assays (IS900 and Target 251), to investigate Mycobacterium occurrence in kitchen faucet biofilms. MA and MI qPCR assays demonstrated 100% specificity and sensitivity when evaluated against 18 non-MA complex, 76 MA, and 17 MI isolates. Both assays detected approximately 1,000 cells from a diluted cell stock inoculated on a sampling swab 100% of the time. DNA analysis by qPCR indicated that 35.3, 56.9 and 11.8% of the 51 kitchen faucet biofilm samples collected contained MA, MI, and MAP, respectively. This study introduces novel qPCR assays designed to specifically detect MA and MI in biofilm. Results support the use of qPCR as an alternative to culture for detection and enumeration of MA, MI, and MAP in microbiologically complex samples.
Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.
Chen, Y T; Mercer, G O; Chen, Y
1993-11-01
Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.
Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves
2008-05-15
Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.
Lo, Eugenia; Nguyen, Jennifer; Oo, Winny; Hemming-Schroeder, Elizabeth; Zhou, Guofa; Yang, Zhaoqing; Cui, Liwang; Yan, Guiyun
2016-04-16
Recent emergence of artemisinin-resistant P. falciparum has posed a serious hindrance to the elimination of malaria in the Greater Mekong Subregion. Parasite clearance time, a measure of change in peripheral parasitaemia in a sequence of samples taken after treatment, can be used to reflect the susceptibility of parasites or the efficiency of antimalarials. The association of genetic polymorphisms and artemisinin resistance has been documented. This study aims to examine clearance time of P. falciparum and P. vivax parasitemia as well as putative gene mutations associated with residual or recurred parasitemia in Myanmar. A total of 63 P. falciparum and 130 P. vivax samples collected from two internally-displaced populations and one surrounding village were examined for parasitemia changes. At least four samples were taken from each patient, at the first day of diagnosis up to 3 months following the initial treatment. The amount of parasite gene copy number was estimated using quantitative real-time PCR based on a species-specific region of the 18S rRNA gene. For samples that showed residual or recurred parasitemia after treatment, microsatellites were used to identify the 'post-treatment' parasite genotype and compared such with the 'pre-treatment' genotype. Mutations in genes pfcrt, pfmdr1, pfatp6, pfmrp1 and pfK13 that are potentially associated with ACT resistance were examined to identify if mutation is a factor for residual or persistent parasitemia. Over 30% of the P. falciprium infections showed delayed clearance of parasitemia after 2-3 days of treatment and 9.5% showed recurred parasitemia. Mutations in codon 876 of the pfmrp1 corroborated significance association with slow clearance time. However, no association was observed in the variation in pfmdr1 gene copy number as well as mutations of various codonsinpfatp6, pfcrt, and pfK13 with clearance time. For P. vivax, over 95% of the infections indicated cleared parasitemia at days 2-3 of treatment. Four
2009-01-01
Quantization of gene expression requires that an accurate measurement of a specific transcript is made. In this paper, a quantitative reverse transcription-polymerase chain reaction (RT-PCR) by competition for tilapia growth hormone receptor type I is designed and validated. This experimental procedure was used to determine the abundance of growth hormone receptor type I transcript in different tilapia tissues. The results obtained with this developed competitive RT-PCR were similar to real-time PCR results reported recently. This protocol provides a reliable alternative, but less expensive than real-time PCR to quantify specific genes. PMID:19495916
2010-01-01
Background The existence of circulating tumor cells (CTCs) in peripheral blood as an indicator of tumor recurrence has not been clearly established, particularly for gastric cancer patients. We conducted a retrospective analysis of the relationship between CTCs in peripheral blood at initial diagnosis and clinicopathologic findings in patients with gastric carcinoma. Methods Blood samples were obtained from 123 gastric carcinoma patients at initial diagnosis. mRNA was extracted and amplified for carcinoembryonic antigen (CEA) mRNA detection using real-time RT-PCR. Periodic 3-month follow-up examinations included serum CEA measurements and imaging. Results The minimum threshold for corrected CEA mRNA score [(CEA mRNA/GAPDH mRNA) × 106] was set at 100. Forty-five of 123 patients (36.6%) were positive for CEA mRNA expression. CEA mRNA expression significantly correlated with T stage and postoperative recurrence status (P = 0.001). Recurrent disease was found in 44 of 123 cases (35.8%), and 25 of these (56.8%) were positive for CEA mRNA. Of these patients, CEA mRNA was more sensitive than serum CEA in indicating recurrence. Three-year disease-free survival of patients positive for CEA mRNA was significantly poorer than of patients negative for CEA mRNA (P < 0.001). Only histological grade and CEA mRNA positivity were independent factors for disease-free survival using multivariate analysis. Conclusions CEA mRNA copy number in peripheral blood at initial diagnosis was significantly associated with disease recurrence in gastric adenocarcinoma patients. Real-time RT-PCR detection of CEA mRNA levels at initial diagnosis appears to be a promising predictor for disease recurrence in gastric adenocarcinoma patients. PMID:21040522
Qiu, Miao-Zhen; Li, Zhuang-Hua; Zhou, Zhi-Wei; Li, Yu-Hong; Wang, Zhi-Qiang; Wang, Feng-Hua; Huang, Peng; Aziz, Fahad; Wang, Dao-Yuan; Xu, Rui-Hua
2010-10-31
The existence of circulating tumor cells (CTCs) in peripheral blood as an indicator of tumor recurrence has not been clearly established, particularly for gastric cancer patients. We conducted a retrospective analysis of the relationship between CTCs in peripheral blood at initial diagnosis and clinicopathologic findings in patients with gastric carcinoma. Blood samples were obtained from 123 gastric carcinoma patients at initial diagnosis. mRNA was extracted and amplified for carcinoembryonic antigen (CEA) mRNA detection using real-time RT-PCR. Periodic 3-month follow-up examinations included serum CEA measurements and imaging. The minimum threshold for corrected CEA mRNA score [(CEA mRNA/GAPDH mRNA) × 106] was set at 100. Forty-five of 123 patients (36.6%) were positive for CEA mRNA expression. CEA mRNA expression significantly correlated with T stage and postoperative recurrence status (P = 0.001). Recurrent disease was found in 44 of 123 cases (35.8%), and 25 of these (56.8%) were positive for CEA mRNA. Of these patients, CEA mRNA was more sensitive than serum CEA in indicating recurrence. Three-year disease-free survival of patients positive for CEA mRNA was significantly poorer than of patients negative for CEA mRNA (P < 0.001). Only histological grade and CEA mRNA positivity were independent factors for disease-free survival using multivariate analysis. CEA mRNA copy number in peripheral blood at initial diagnosis was significantly associated with disease recurrence in gastric adenocarcinoma patients. Real-time RT-PCR detection of CEA mRNA levels at initial diagnosis appears to be a promising predictor for disease recurrence in gastric adenocarcinoma patients.
Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P
2012-12-01
Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli
2014-01-01
Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV. PMID:24886818
NASA Technical Reports Server (NTRS)
Parra, Macarena; Jung, Jimmy; Almeida, Eduardo; Boone, Travis; Schonfeld, Julie; Tran, Luan
2016-01-01
The WetLab-2 system was developed by NASA Ames Research Center to offer new capabilities to researchers. The system can lyse cells and extract RNA (Ribonucleic Acid) on-orbit from different sample types ranging from microbial cultures to animal tissues. The purified RNA can then either be stabilized for return to Earth or can be used to conduct on-orbit quantitative Reverse Transcriptase PCR (Polymerase Chain Reaction) (qRT-PCR) analysis without the need for sample return. The qRT-PCR results can be downlinked to the ground a few hours after the completion of the run. The validation flight of the WetLab-2 system launched on SpaceX-8 on April 8, 2016. On orbit operations started on April 15th with system setup and was followed by three quantitative PCR runs using an E. coli genomic DNA template pre-loaded at three different concentrations. These runs were designed to discern if quantitative PCR functions correctly in microgravity and if the data is comparable to that from the ground control runs. The flight data showed no significant differences compared to the ground data though there was more variability in the values, this was likely due to the numerous small bubbles observed. The capability of the system to process samples and purify RNA was then validated using frozen samples prepared on the ground. The flight data for both E. coli and mouse liver clearly shows that RNA was successfully purified by our system. The E. coli qRT-PCR run showed successful singleplex, duplex and triplex capability. Data showed high variability in the resulting Cts (Cycle Thresholds [for the PCR]) likely due to bubble formation and insufficient mixing during the procedure run. The mouse liver qRT-PCR run had successful singleplex and duplex reactions and the variability was slightly better as the mixing operation was improved. The ability to purify and stabilize RNA and to conduct qRT-PCR on-orbit is an important step towards utilizing the ISS as a National Laboratory facility. The
Near Real Time Processing Chain for Suomi NPP Satellite Data
NASA Astrophysics Data System (ADS)
Monsorno, Roberto; Cuozzo, Giovanni; Costa, Armin; Mateescu, Gabriel; Ventura, Bartolomeo; Zebisch, Marc
2014-05-01
Since 2009, the EURAC satellite receiving station, located at Corno del Renon, in a free obstacle site at 2260 m a.s.l., has been acquiring data from Aqua and Terra NASA satellites equipped with Moderate Resolution Imaging Spectroradiometer (MODIS) sensors. The experience gained with this local ground segmenthas given the opportunity of adapting and modifying the processing chain for MODIS data to the Suomi NPP, the natural successor to Terra and Aqua satellites. The processing chain, initially implemented by mean of a proprietary system supplied by Seaspace and Advanced Computer System, was further developed by EURAC's Institute for Applied Remote Sensing engineers. Several algorithms have been developed using MODIS and Visible Infrared Imaging Radiometer Suite (VIIRS) data to produce Snow Cover, Particulate Matter estimation and Meteo maps. These products are implemented on a common processor structure based on the use of configuration files and a generic processor. Data and products have then automatically delivered to the customers such as the Autonomous Province of Bolzano-Civil Protection office. For the processing phase we defined two goals: i) the adaptation and implementation of the products already available for MODIS (and possibly new ones) to VIIRS, that is one of the sensors onboard Suomi NPP; ii) the use of an open source processing chain in order to process NPP data in Near Real Time, exploiting the knowledge we acquired on parallel computing. In order to achieve the second goal, the S-NPP data received and ingested are sent as input to RT-STPS (Real-time Software Telemetry Processing System) software developed by the NASA Direct Readout Laboratory 1 (DRL) that gives as output RDR files (Raw Data Record) for VIIRS, ATMS (Advanced Technology Micorwave Sounder) and CrIS (Cross-track Infrared Sounder)sensors. RDR are then transferred to a server equipped with CSPP2 (Community Satellite Processing Package) software developed by the University of
Blanchard, Philippe; Regnault, Julie; Schurr, Frank; Dubois, Eric; Ribière, Magali
2012-03-01
Chronic bee paralysis virus (CBPV) is responsible for chronic bee paralysis, an infectious and contagious disease in adult honey bees (Apis mellifera L.). A real-time RT-PCR assay to quantitate the CBPV load is now available. To propose this assay as a reference method, it was characterised further in an intra-laboratory study during which the reliability and the repeatability of results and the performance of the assay were confirmed. The qPCR assay alone and the whole quantitation method (from sample RNA extraction to analysis) were both assessed following the ISO/IEC 17025 standard and the recent XP U47-600 standard issued by the French Standards Institute. The performance of the qPCR assay and of the overall CBPV quantitation method were validated over a 6 log range from 10(2) to 10(8) with a detection limit of 50 and 100 CBPV RNA copies, respectively, and the protocol of the real-time RT-qPCR assay for CBPV quantitation was approved by the French Accreditation Committee. Copyright © 2011 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Shrivastava, Sajal; Sohn, Il-Yung; Son, Young-Min; Lee, Won-Il; Lee, Nae-Eung
2015-11-01
Although real-time label-free fluorescent aptasensors based on nanomaterials are increasingly recognized as a useful strategy for the detection of target biomolecules with high fidelity, the lack of an imaging-based quantitative measurement platform limits their implementation with biological samples. Here we introduce an ensemble strategy for a real-time label-free fluorescent graphene (Gr) aptasensor platform. This platform employs aptamer length-dependent tunability, thus enabling the reagentless quantitative detection of biomolecules through computational processing coupled with real-time fluorescence imaging data. We demonstrate that this strategy effectively delivers dose-dependent quantitative readouts of adenosine triphosphate (ATP) concentration on chemical vapor deposited (CVD) Gr and reduced graphene oxide (rGO) surfaces, thereby providing cytotoxicity assessment. Compared with conventional fluorescence spectrometry methods, our highly efficient, universally applicable, and rational approach will facilitate broader implementation of imaging-based biosensing platforms for the quantitative evaluation of a range of target molecules.Although real-time label-free fluorescent aptasensors based on nanomaterials are increasingly recognized as a useful strategy for the detection of target biomolecules with high fidelity, the lack of an imaging-based quantitative measurement platform limits their implementation with biological samples. Here we introduce an ensemble strategy for a real-time label-free fluorescent graphene (Gr) aptasensor platform. This platform employs aptamer length-dependent tunability, thus enabling the reagentless quantitative detection of biomolecules through computational processing coupled with real-time fluorescence imaging data. We demonstrate that this strategy effectively delivers dose-dependent quantitative readouts of adenosine triphosphate (ATP) concentration on chemical vapor deposited (CVD) Gr and reduced graphene oxide (r
Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.
Makeyev, E V; Bamford, D H
2001-05-01
Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.
Richardson, Jason; Molina-Cruz, Alvaro; Salazar, Ma Isabel; Black, William
2006-01-01
Dengue virus-2 (DENV-2) RNA was quantified from the midgut and legs of individual Aedes aegypti at each of 14 days postinfectious blood meal (dpi) in a DENV-2 susceptible strain from Chetumal, Mexico. A SYBR Green I based strand-specific, quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was developed. The lower detection and quantitation limits were 20 and 200 copies per reaction, respectively. Amounts of positive and negative strand viral RNA strands were correlated. Numbers of plaque-forming units (PFU) were correlated with DENV-2 RNA copy number in both C6/36 cell cultures and mosquitoes. PFU were consistently lower than RNA copy number by 2-3 log(10). Midgut levels of DENV-2 RNA peaked 8 dpi and fluctuated erratically between 6 and 9 dpi. Copies of DENV-2 RNA varied significantly among infected mosquitoes at each time point. Quantitative real-time RT-PCR is a convenient and reliable method that provides new insights into virus-vector interactions.
Udomsil, Natteewan; Chen, Shu; Rodtong, Sureelak; Yongsawatdigul, Jirawat
2016-08-01
Real-time quantitative polymerase chain reaction (qPCR) methods were developed for the quantification of Virgibacillus sp. SK37 and Tetragenococcus halophilus MS33, which were added as starter cultures in fish sauce fermentation. The PCR assays were coupled with propidium monoazide (PMA) treatment of samples to selectively quantify viable cells and integrated with exogenous recombinant Escherichia coli cells to control variabilities in analysis procedures. The qPCR methods showed species-specificity for both Virgibacillus halodenitrificans and T. halophilus as evaluated using 6 reference strains and 28 strains of bacteria isolated from fish sauce fermentation. The qPCR efficiencies were 101.1% for V. halodenitrificans and 90.2% for T. halophilus. The quantification limits of the assays were 10(3) CFU/mL and 10(2) CFU/mL in fish sauce samples with linear correlations over 4 Logs for V. halodenitrificans and T. halophilus, respectively. The matrix effect was not observed when evaluated using fish sauce samples fermented for 1-6 months. The developed PMA-qPCR methods were successfully applied to monitor changes of Virgibacillus sp. SK37 and T. halophilus MS33 in a mackerel fish sauce fermentation model where culture-dependent techniques failed to quantify the starter cultures. The results demonstrated the usability of the methods as practical tools for monitoring the starter cultures in fish sauce fermentation. Copyright © 2016 Elsevier Ltd. All rights reserved.
2017-01-01
We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring. PMID:28541661
Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...
Grau, Frederic R; Schroeder, Megan E; Mulhern, Erin L; McIntosh, Michael T; Bounpheng, Mangkey A
2015-03-01
African swine fever (ASF), classical swine fever (CSF), and foot-and-mouth disease (FMD) are highly contagious animal diseases of significant economic importance. Pigs infected with ASF and CSF viruses (ASFV and CSFV) develop clinical signs that may be indistinguishable from other diseases. Likewise, various causes of vesicular disease can mimic clinical signs caused by the FMD virus (FMDV). Early detection is critical to limiting the impact and spread of these disease outbreaks, and the ability to perform herd-level surveillance for all 3 diseases rapidly and cost effectively using a single diagnostic sample and test is highly desirable. This study assessed the feasibility of simultaneous ASFV, CSFV, and FMDV detection by multiplex reverse transcription real-time polymerase chain reaction (mRT-qPCR) in swine oral fluids collected through the use of chewing ropes. Animal groups were experimentally infected independently with each virus, observed for clinical signs, and oral fluids collected and tested throughout the course of infection. All animal groups chewed on the ropes readily before and after onset of clinical signs and before onset of lameness or serious clinical signs. ASFV was detected as early as 3 days postinoculation (dpi), 2-3 days before onset of clinical disease; CSFV was detected at 5 dpi, coincident with onset of clinical disease; and FMDV was detected as early as 1 dpi, 1 day before the onset of clinical disease. Equivalent results were observed in 4 independent studies and demonstrate the feasibility of oral fluids and mRT-qPCR for surveillance of ASF, CSF, and FMD in swine populations. © 2015 The Author(s).
Novel Bioluminescent Quantitative Detection of Nucleic Acid Amplification in Real-Time
Gandelman, Olga A.; Church, Vicki L.; Moore, Cathy A.; Kiddle, Guy; Carne, Christopher A.; Parmar, Surendra; Jalal, Hamid; Tisi, Laurence C.; Murray, James A. H.
2010-01-01
Background The real-time monitoring of polynucleotide amplification is at the core of most molecular assays. This conventionally relies on fluorescent detection of the amplicon produced, requiring complex and costly hardware, often restricting it to specialised laboratories. Principal Findings Here we report the first real-time, closed-tube luminescent reporter system for nucleic acid amplification technologies (NAATs) enabling the progress of amplification to be continuously monitored using simple light measuring equipment. The Bioluminescent Assay in Real-Time (BART) continuously reports through bioluminescent output the exponential increase of inorganic pyrophosphate (PPi) produced during the isothermal amplification of a specific nucleic acid target. BART relies on the coupled conversion of inorganic pyrophosphate (PPi) produced stoichiometrically during nucleic acid synthesis to ATP by the enzyme ATP sulfurylase, and can therefore be coupled to a wide range of isothermal NAATs. During nucleic acid amplification, enzymatic conversion of PPi released during DNA synthesis into ATP is continuously monitored through the bioluminescence generated by thermostable firefly luciferase. The assay shows a unique kinetic signature for nucleic acid amplifications with a readily identifiable light output peak, whose timing is proportional to the concentration of original target nucleic acid. This allows qualitative and quantitative analysis of specific targets, and readily differentiates between negative and positive samples. Since quantitation in BART is based on determination of time-to-peak rather than absolute intensity of light emission, complex or highly sensitive light detectors are not required. Conclusions The combined chemistries of the BART reporter and amplification require only a constant temperature maintained by a heating block and are shown to be robust in the analysis of clinical samples. Since monitoring the BART reaction requires only a simple light
ERIC Educational Resources Information Center
Elkins, Kelly M.; Kadunc, Raelynn E.
2012-01-01
In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…
USDA-ARS?s Scientific Manuscript database
Porcine parvovirus 4 (PPV4) is a DNA virus, and a member of the Parvoviridae family within the Bocavirus genera. It was recently detected in swine, but its epidemiology and pathology remain unclear. A TaqMan-based real-time polymerase chain reaction (qPCR) assay targeting a conserved region of the O...
Polymerase Chain Reaction for Detection of Systemic Plant Pathogens
USDA-ARS?s Scientific Manuscript database
This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...
USDA-ARS?s Scientific Manuscript database
Researchers have proposed the adoption of 3 distinct genetic taxa among bacteria previously classified as Edwardsiella tarda; namely E. tarda, E. piscicida, and a taxon presently termed E. piscicida–like. Individual real-time polymerase chain reaction (qPCR) assays were developed, based on published...
Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.
Igarashi, T; Yamamoto, A; Goto, N
1996-10-01
Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.
Visualisation and quantitative analysis of the rodent malaria liver stage by real time imaging.
Ploemen, Ivo H J; Prudêncio, Miguel; Douradinha, Bruno G; Ramesar, Jai; Fonager, Jannik; van Gemert, Geert-Jan; Luty, Adrian J F; Hermsen, Cornelus C; Sauerwein, Robert W; Baptista, Fernanda G; Mota, Maria M; Waters, Andrew P; Que, Ivo; Lowik, Clemens W G M; Khan, Shahid M; Janse, Chris J; Franke-Fayard, Blandine M D
2009-11-18
The quantitative analysis of Plasmodium development in the liver in laboratory animals in cultured cells is hampered by low parasite infection rates and the complicated methods required to monitor intracellular development. As a consequence, this important phase of the parasite's life cycle has been poorly studied compared to blood stages, for example in screening anti-malarial drugs. Here we report the use of a transgenic P. berghei parasite, PbGFP-Luc(con), expressing the bioluminescent reporter protein luciferase to visualize and quantify parasite development in liver cells both in culture and in live mice using real-time luminescence imaging. The reporter-parasite based quantification in cultured hepatocytes by real-time imaging or using a microplate reader correlates very well with established quantitative RT-PCR methods. For the first time the liver stage of Plasmodium is visualized in whole bodies of live mice and we were able to discriminate as few as 1-5 infected hepatocytes per liver in mice using 2D-imaging and to identify individual infected hepatocytes by 3D-imaging. The analysis of liver infections by whole body imaging shows a good correlation with quantitative RT-PCR analysis of extracted livers. The luminescence-based analysis of the effects of various drugs on in vitro hepatocyte infection shows that this method can effectively be used for in vitro screening of compounds targeting Plasmodium liver stages. Furthermore, by analysing the effect of primaquine and tafenoquine in vivo we demonstrate the applicability of real time imaging to assess parasite drug sensitivity in the liver. The simplicity and speed of quantitative analysis of liver-stage development by real-time imaging compared to the PCR methodologies, as well as the possibility to analyse liver development in live mice without surgery, opens up new possibilities for research on Plasmodium liver infections and for validating the effect of drugs and vaccines on the liver stage of
Visualisation and Quantitative Analysis of the Rodent Malaria Liver Stage by Real Time Imaging
Douradinha, Bruno G.; Ramesar, Jai; Fonager, Jannik; van Gemert, Geert-Jan; Luty, Adrian J. F.; Hermsen, Cornelus C.; Sauerwein, Robert W.; Baptista, Fernanda G.; Mota, Maria M.; Waters, Andrew P.; Que, Ivo; Lowik, Clemens W. G. M.; Khan, Shahid M.; Janse, Chris J.; Franke-Fayard, Blandine M. D.
2009-01-01
The quantitative analysis of Plasmodium development in the liver in laboratory animals in cultured cells is hampered by low parasite infection rates and the complicated methods required to monitor intracellular development. As a consequence, this important phase of the parasite's life cycle has been poorly studied compared to blood stages, for example in screening anti-malarial drugs. Here we report the use of a transgenic P. berghei parasite, PbGFP-Luccon, expressing the bioluminescent reporter protein luciferase to visualize and quantify parasite development in liver cells both in culture and in live mice using real-time luminescence imaging. The reporter-parasite based quantification in cultured hepatocytes by real-time imaging or using a microplate reader correlates very well with established quantitative RT-PCR methods. For the first time the liver stage of Plasmodium is visualized in whole bodies of live mice and we were able to discriminate as few as 1–5 infected hepatocytes per liver in mice using 2D-imaging and to identify individual infected hepatocytes by 3D-imaging. The analysis of liver infections by whole body imaging shows a good correlation with quantitative RT-PCR analysis of extracted livers. The luminescence-based analysis of the effects of various drugs on in vitro hepatocyte infection shows that this method can effectively be used for in vitro screening of compounds targeting Plasmodium liver stages. Furthermore, by analysing the effect of primaquine and tafenoquine in vivo we demonstrate the applicability of real time imaging to assess parasite drug sensitivity in the liver. The simplicity and speed of quantitative analysis of liver-stage development by real-time imaging compared to the PCR methodologies, as well as the possibility to analyse liver development in live mice without surgery, opens up new possibilities for research on Plasmodium liver infections and for validating the effect of drugs and vaccines on the liver stage of
Bowley, Lucas A; Alam, Farhana; Marentette, Julie R; Balshine, Sigal; Wilson, Joanna Y
2010-12-01
A growing concern over endocrine disruption in aquatic species has prompted the development of molecular assays to monitor environmental impacts. This study describes the development of quantitative polymerase chain reaction (qPCR) assays to characterize the expression of two vitellogenin (Vtg) genes in the invasive round goby (Neogobius melanostomus). Fragments from the 18SrRNA (housekeeping gene), Vtg II, and Vtg III genes were cloned and sequenced. The qPCR assays were developed to detect hepatic Vtg expression in goby. The assays detected induction of both Vtg genes in nonreproductive males following a two-week laboratory exposure to 17β-estradiol (≥1 mg/kg i.p. injection). The assays were applied to goby from Hamilton Harbour, Lake Ontario (Canada), including those from sites where feminization and intersex of goby has been documented. Both Vtg genes had significantly higher expression in females compared to males. Male reproductive goby adopt either parental or sneaker tactics; Vtg II expression was higher in sneaker than in parental males but parental and nonreproductive males did not differ from each other. The Vtg III expression was significantly higher in sneaker males followed by parental males and nonreproductive males, respectively. The Vtg II and III expression in nonreproductive males was elevated in the contaminated site with documented intersex. This assay provides an important tool for the use of an invasive species in monitoring endocrine disruption in the Great Lakes region. Copyright © 2010 SETAC.
A. Yang; J. Juzwik
2017-01-01
Oak wilt caused by Ceratocystis fagacearum is a significant disease of Quercus spp. in the eastern United States. Early and accurate detection of the pathogen is particularly important when disease control is planned. Nested and real-time polymerase chain reaction (PCR) methods utilizing fungal DNA extracted from sapwood drill...
Real time blood testing using quantitative phase imaging.
Pham, Hoa V; Bhaduri, Basanta; Tangella, Krishnarao; Best-Popescu, Catherine; Popescu, Gabriel
2013-01-01
We demonstrate a real-time blood testing system that can provide remote diagnosis with minimal human intervention in economically challenged areas. Our instrument combines novel advances in label-free optical imaging with parallel computing. Specifically, we use quantitative phase imaging for extracting red blood cell morphology with nanoscale sensitivity and NVIDIA's CUDA programming language to perform real time cellular-level analysis. While the blood smear is translated through focus, our system is able to segment and analyze all the cells in the one megapixel field of view, at a rate of 40 frames/s. The variety of diagnostic parameters measured from each cell (e.g., surface area, sphericity, and minimum cylindrical diameter) are currently not available with current state of the art clinical instruments. In addition, we show that our instrument correctly recovers the red blood cell volume distribution, as evidenced by the excellent agreement with the cell counter results obtained on normal patients and those with microcytic and macrocytic anemia. The final data outputted by our instrument represent arrays of numbers associated with these morphological parameters and not images. Thus, the memory necessary to store these data is of the order of kilobytes, which allows for their remote transmission via, for example, the cellular network. We envision that such a system will dramatically increase access for blood testing and furthermore, may pave the way to digital hematology.
Shrivastava, Sajal; Sohn, Il-Yung; Son, Young-Min; Lee, Won-Il; Lee, Nae-Eung
2015-12-14
Although real-time label-free fluorescent aptasensors based on nanomaterials are increasingly recognized as a useful strategy for the detection of target biomolecules with high fidelity, the lack of an imaging-based quantitative measurement platform limits their implementation with biological samples. Here we introduce an ensemble strategy for a real-time label-free fluorescent graphene (Gr) aptasensor platform. This platform employs aptamer length-dependent tunability, thus enabling the reagentless quantitative detection of biomolecules through computational processing coupled with real-time fluorescence imaging data. We demonstrate that this strategy effectively delivers dose-dependent quantitative readouts of adenosine triphosphate (ATP) concentration on chemical vapor deposited (CVD) Gr and reduced graphene oxide (rGO) surfaces, thereby providing cytotoxicity assessment. Compared with conventional fluorescence spectrometry methods, our highly efficient, universally applicable, and rational approach will facilitate broader implementation of imaging-based biosensing platforms for the quantitative evaluation of a range of target molecules.
On-Site Molecular Detection of Soil-Borne Phytopathogens Using a Portable Real-Time PCR System
DeShields, Joseph B.; Bomberger, Rachel A.; Woodhall, James W.; Wheeler, David L.; Moroz, Natalia; Johnson, Dennis A.; Tanaka, Kiwamu
2018-01-01
On-site diagnosis of plant diseases can be a useful tool for growers for timely decisions enabling the earlier implementation of disease management strategies that reduce the impact of the disease. Presently in many diagnostic laboratories, the polymerase chain reaction (PCR), particularly real-time PCR, is considered the most sensitive and accurate method for plant pathogen detection. However, laboratory-based PCRs typically require expensive laboratory equipment and skilled personnel. In this study, soil-borne pathogens of potato are used to demonstrate the potential for on-site molecular detection. This was achieved using a rapid and simple protocol comprising of magnetic bead-based nucleic acid extraction, portable real-time PCR (fluorogenic probe-based assay). The portable real-time PCR approach compared favorably with a laboratory-based system, detecting as few as 100 copies of DNA from Spongospora subterranea. The portable real-time PCR method developed here can serve as an alternative to laboratory-based approaches and a useful on-site tool for pathogen diagnosis. PMID:29553557
Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo
2018-06-01
Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.
Goldenberg, S D; Cliff, P R; Smith, S; Milner, M; French, G L
2010-01-01
Current diagnosis of Clostridium difficile infection (CDI) relies upon detection of toxins A/B in stool by enzyme immunoassay [EIA(A/B)]. This strategy is unsatisfactory because it has a low sensitivity resulting in significant false negatives. We investigated the performance of a two-step algorithm for diagnosis of CDI using detection of glutamate dehydrogenase (GDH). GDH-positive samples were tested for C. difficile toxin B gene (tcdB) by polymerase chain reaction (PCR). The performance of the two-step protocol was compared with toxin detection by the Meridian Premier EIA kit in 500 consecutive stool samples from patients with suspected CDI. The reference standard among samples that were positive by either EIA(A/B) or GDH testing was culture cytotoxin neutralisation (culture/CTN). Thirty-six (7%) of 500 samples were identified as true positives by culture/CTN. EIA(A/B) identified 14 of the positive specimens with 22 false negatives and two false positives. The two-step protocol identified 34 of the positive samples with two false positives and two false negatives. EIA(A/B) had a sensitivity of 39%, specificity of 99%, positive predictive value of 88% and negative predictive value of 95%. The two-step algorithm performed better, with corresponding values of 94%, 99%, 94% and 99% respectively. Screening for GDH before confirmation of positives by PCR is cheaper than screening all specimens by PCR and is an effective method for routine use. Current EIA(A/B) tests for CDI are of inadequate sensitivity and should be replaced; however, this may result in apparent changes in CDI rates that would need to be explained in national surveillance statistics. Copyright 2009 The Hospital Infection Society. Published by Elsevier Ltd. All rights reserved.
Real-time quantitative fluorescence measurement of microscale cell culture analog systems
NASA Astrophysics Data System (ADS)
Oh, Taek-il; Kim, Donghyun; Tatosian, Daniel; Sung, Jong Hwan; Shuler, Michael
2007-02-01
A microscale cell culture analog (μCCA) is a cell-based lab-on-a-chip assay that, as an animal surrogate, is applied to pharmacological studies for toxicology tests. A μCCA typically comprises multiple chambers and microfluidics that connect the chambers, which represent animal organs and blood flow to mimic animal metabolism more realistically. A μCCA is expected to provide a tool for high-throughput drug discovery. Previously, a portable fluorescence detection system was investigated for a single μCCA device in real-time. In this study, we present a fluorescence-based imaging system that provides quantitative real-time data of the metabolic interactions in μCCAs with an emphasis on measuring multiple μCCA samples simultaneously for high-throughput screening. The detection system is based on discrete optics components, with a high-power LED and a charge-coupled device (CCD) camera as a light source and a detector, for monitoring cellular status on the chambers of each μCCA sample. Multiple samples are characterized mechanically on a motorized linear stage, which is fully-automated. Each μCCA sample has four chambers, where cell lines MES-SA/DX- 5, and MES-SA (tumor cells of human uterus) have been cultured. All cell-lines have been transfected to express the fusion protein H2B-GFP, which is a human histone protein fused at the amino terminus to EGFP. As a model cytotoxic drug, 10 μM doxorubicin (DOX) was used. Real-time quantitative data of the intensity loss of enhanced green fluorescent protein (EGFP) during cell death of target cells have been collected over several minutes to 40 hours. Design issues and improvements are also discussed.
Quantitative real-time in vivo detection of magnetic nanoparticles by their nonlinear magnetization
NASA Astrophysics Data System (ADS)
Nikitin, M. P.; Torno, M.; Chen, H.; Rosengart, A.; Nikitin, P. I.
2008-04-01
A novel method of highly sensitive quantitative detection of magnetic nanoparticles (MP) in biological tissues and blood system has been realized and tested in real time in vivo experiments. The detection method is based on nonlinear magnetic properties of MP and the related device can record a very small relative variation of nonlinear magnetic susceptibility up to 10-8 at room temperature, providing sensitivity of several nanograms of MP in 0.1ml volume. Real-time quantitative in vivo measurements of dynamics of MP concentration in blood flow have been performed. A catheter that carried the blood flow of a rat passed through the measuring device. After an MP injection, the quantity of MP in the circulating blood was continuously recorded. The method has also been used to evaluate the MP distribution between rat's organs. Its sensitivity was compared with detection of the radioactive MP based on isotope of Fe59. The comparison of magnetic and radioactive signals in the rat's blood and organ samples demonstrated similar sensitivity for both methods. However, the proposed magnetic method is much more convenient as it is safe, less expensive, and provides real-time measurements in vivo. Moreover, the sensitivity of the method can be further improved by optimization of the device geometry.
Zhang, Xiaolian; Yang, Dongmei; Lu, Yu; Lao, Xianjun; Qin, Xue; Li, Shan
2016-01-01
Detecting blood levels of hepatitis B virus (HBV) DNA must be accurate and credible. Shipment and storage conditions of clinical samples affect the quality of nucleic acids and can interfere with HBV DNA analysis. The aim of our study was to compare HBV DNA stability in plasma specimens at 4 degrees C for different storage periods. Blood samples from 30 hepatitis B surface antigen (HBsAg) positive patients were collected in tubes containing EDTA-K2. Each sample was divided into eight aliquots, one of which was measured immediately for the initial viral load. The remaining aliquots were then stored at 4 degrees C and assessed after 1, 2, 3, 7, 14, 21, and 30 days of storage. Quantification of HBV DNA was performed by real-time polymerase chain reaction (RT-PCR), and the difference in HBV DNA concentrations between two different time points was analysed with a paired-samples t-test. HBV DNA was measured in a range of 2.00 - 8.00 IU/mL, with low within-run and between-run coefficients of variation (< 10%). Storing plasma for one month at 4 degrees C revealed no significant decrease in HBV DNA level (p = 0.231), and no trend was evident to indicate continued reduction over a 3-week storage period. Based on the results of this study, storing plasma for up to one month at 4 degrees C does not affect the stability of HBV DNA, regardless of the initial viral load.
Murinda, Shelton E; Ibekwe, A Mark; Zulkaffly, Syaizul; Cruz, Andrew; Park, Stanley; Razak, Nur; Paudzai, Farah Md; Ab Samad, Liana; Baquir, Khairul; Muthaiyah, Kokilah; Santiago, Brenna; Rusli, Amirul; Balkcom, Sean
2014-07-01
Shiga toxin-producing Escherichia coli (STEC) are a major family of foodborne pathogens of public health, zoonotic, and economic significance in the United States and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal of this study was to assess the potential application of RPA in detection of STEC. This study focused on designing and evaluating RPA primers and fluorescent probes for isothermal (39°C) detection of STEC. Compatible sets of candidate primers and probes were designed for detection of Shiga toxin 1 and 2 (Stx1 and 2), respectively. The sets were evaluated for specificity and sensitivity against STEC (n=12) of various stx genotypes (stx1/stx2, stx1, or stx2, respectively), including non-Stx-producing E. coli (n=28) and other genera (n=7). The primers and probes that were designed targeted amplification of the subunit A moiety of stx1 and stx2. The assay detected STEC in real time (within 5-10 min at 39°C) with high sensitivity (93.5% vs. 90%; stx1 vs. stx2), specificity (99.1% vs. 100%; stx1 vs. stx2), and predictive value (97.9% for both stx1 vs. stx2). Limits of detection of ∼ 5-50 colony-forming units/mL were achieved in serially diluted cultures grown in brain heart infusion broth. This study successfully demonstrated for the first time that RPA can be used for isothermal real-time detection of STEC.
Tan, Thean Yen; Zou, Hao; Ong, Danny Chee Tiong; Ker, Khor Jia; Chio, Martin Tze Wei; Teo, Rachael Yu Lin; Koh, Mark Jean Aan
2013-12-01
Herpes simplex virus (HSV) and varicella zoster virus (VZV) are related members of the Herpesviridae family and are well-documented human pathogens causing a spectrum of diseases, from mucocutaneous disease to infections of the central nervous system. This study was carried out to evaluate and validate the performance of a multiplex real-time polymerase chain reaction (PCR) assay in detecting and differentiating HSV1, HSV2, and VZV from clinical samples. Consensus PCR primers for HSV were designed from the UL30 component of the DNA polymerase gene of HSV, with 2 separate hydrolysis probes designed to differentiate HSV1 and HSV2. Separate primers and a probe were also designed against the DNA polymerase gene of VZV. A total of 104 clinical samples were available for testing by real-time PCR, conventional PCR, and viral culture. The sensitivity and specificity of the real-time assay was calculated by comparing the multiplex PCR result with that of a combined standard of virus culture and conventional PCR. The sensitivity of the real-time assay was 100%, with specificity ranging from 98% to 100% depending on the target gene. Both PCR methods detected more positive samples for HSV or VZV, compared with conventional virus culture. This multiplex PCR assay provides accurate and rapid diagnostic capabilities for the diagnosis and differentiation of HSV1, HSV2, and VZV infections, with the presence of an internal control to monitor for inhibition of the PCR reaction.
[Application of recombinase polymerase amplification in the detection of Pseudomonas aeruginosa].
Jin, X J; Gong, Y L; Yang, L; Mo, B H; Peng, Y Z; He, P; Zhao, J N; Li, X L
2018-04-20
Objective: To establish an optimized method of recombinase polymerase amplification (RPA) to rapidly detect Pseudomonas aeruginosa in clinic. Methods: (1) The DNA templates of one standard Pseudomonas aeruginosa strain was extracted and detected by polymerase chain reaction (PCR), real-time fluorescence quantitative PCR and RPA. Time of sample loading, time of amplification, and time of detection of the three methods were recorded. (2) One standard Pseudomonas aeruginosa strain was diluted in 7 concentrations of 1×10(7,) 1×10(6,) 1×10(5,) 1×10(4,) 1×10(3,) 1×10(2,) and 1×10(1) colony forming unit (CFU)/mL after recovery and cultivation. The DNA templates of Pseudomonas aeruginosa and negative control strain Pseudomonas putida were extracted and detected by PCR, real-time fluorescence quantitative PCR, and RPA separately. The sensitivity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (3) The DNA templates of one standard Pseudomonas aeruginosa strain and four negative control strains ( Staphylococcus aureus, Acinetobacter baumanii, Candida albicans, and Pseudomonas putida ) were extracted separately, and then they were detected by PCR, real-time fluorescence quantitative PCR, and RPA. The specificity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (4) The DNA templates of 28 clinical strains of Pseudomonas aeruginosa preserved in glycerin, 1 clinical strain of which was taken by cotton swab, and negative control strain Pseudomonas putida were extracted separately, and then they were detected by RPA. Positive amplification signals of the clinical strains were observed, and the detection rate was calculated. All experiments were repeated for 3 times. Sensitivity results were analyzed by GraphPad Prism 5.01 statistical software. Results: (1) The loading time of RPA, PCR, and real-time fluorescence quantitative PCR for detecting Pseudomonas aeruginosa were all 20 minutes. In PCR, time of amplification was 98 minutes
Ghosh, Prakash; Khan, Md. Anik Ashfaq; Duthie, Malcolm S.; Vallur, Aarthy C.; Picone, Alessandro; Howard, Randall F.; Reed, Steven G.
2017-01-01
Sustained elimination of Visceral Leishmaniasis (VL) requires the reduction and control of parasite reservoirs to minimize the transmission of Leishmania donovani infection. A simple, reproducible and definitive diagnostic procedure is therefore indispensable for the early and accurate detection of parasites in VL, Relapsed VL (RVL) and Post Kala-azar Dermal Leishmaniasis (PKDL) patients, all of whom are potential reservoirs of Leishmania parasites. To overcome the limitations of current diagnostic approaches, a novel quantitative real-time polymerase chain reaction (qPCR) method based on Taqman chemistry was devised for the detection and quantification of L. donovani in blood and skin. The diagnostic efficacy was evaluated using archived peripheral blood buffy coat DNA from 40 VL, 40 PKDL, 10 RVL, 20 cured VL, and 40 cured PKDL along with 10 tuberculosis (TB) cases and 80 healthy endemic controls. Results were compared to those obtained using a Leishmania-specific nested PCR (Ln-PCR). The real time PCR assay was 100% (95% CI, 91.19–100%) sensitive in detecting parasite genomes in VL and RVL samples and 85.0% (95% CI, 70.16–94.29%) sensitive for PKDL samples. In contrast, the sensitivity of Ln-PCR was 77.5% (95% CI, 61.55–89.16%) for VL samples, 100% (95%CI, 69.15–100%) for RVL samples, and 52.5% (95% CI, 36.13–68.49%) for PKDL samples. There was significant discordance between the two methods with the overall sensitivity of the qPCR assay being considerably higher than Ln-PCR. None of the assay detected L. donovani DNA in buffy coats from cured VL cases, and reduced infectious burdens were demonstrated in cured PKDL cases who remained positive in 7.5% (3/40) and 2.5% (1/40) cases by real-time PCR and Ln-PCR, respectively. Both assays were 100% (95% CI, 95.98–100) specific with no positive signals in either endemic healthy control or TB samples. The real time PCR assay we developed offers a molecular tool for accurate detection of circulating L
Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.
Ragheb, Suzan Mohammed; Jimenez, Luis
Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.
Richter, C.A.; Wright-Osment, Maureen K.; Zajicek, J.L.; Honeyfield, D.C.; Tillitt, D.E.
2009-01-01
The thiaminase I enzyme produced by the gram-positive bacterium Paenibacillus thiaminolyticus isolated from the viscera of Lake Michigan alewives Alosa pseudoharengus is currently the only defined source of the thiaminase activity linked to thiamine (vitamin B1) deficiency in early mortality syndrome (EMS) in the larvae of Great Lakes salmonines. Diets of alewife or isolated strains of P. thiaminolyticus mixed in a semipurified diet and fed to lake trout Salvelinus namaycush have been shown to produce EMS in fry. We utilized quantitative polymerase chain reaction (Q-PCR) to aid in studies of the sources of P. thiaminolyticus and thiaminase I. Quantitative PCR assays were established to detect the thiaminase I gene of P. thiaminolyticus, the 16S rRNA gene from most species of bacteria, and the 16S rRNA gene specifically from P. thiaminolyticus and a few closely related taxa. The Q-PCR assays are linear over at least six orders of magnitude and can detect the thiaminase I gene of P. thiaminolyticus from as few as 1,000 P. thiaminolyticus cells/g of sample or the Paenibacillus 16S rRNA gene from as few as 100 P. thiaminolyticus cells/g of sample. The initial results from alewife viscera samples with high thiaminase activity yielded unexpectedly low densities of P. thiaminolyticus cells; Paenibacillus thiaminolyticus was detectable in 2 of 6 alewife viscera tested at densities on the order of 100 cells/g out of 100,000,000 total bacterial cells/g. The low numbers of P. thiaminolyticus detected suggest that alewives contain additional non-P. thiaminolyticus sources of thiaminase activity.
[Real-time PCR kits for the detection of the African Swine Fever virus].
Latyshev, O E; Eliseeva, O V; Grebennikova, T V; Verkhovskiĭ, O A; Tsibezov, V V; Chernykh, O Iu; Dzhailidi, G A; Aliper, T I
2014-01-01
The results obtained using the diagnostic kit based on real-time polymerase chain reaction to detect the DNA of the African Swine Fever in the pathological material, as well as in the culture fluid, are presented. A high sensitivity and specificity for detection of the DNA in the organs and tissues of animals was shown to be useful for detection in the European Union referentiality reagent kits for DNA detection by real time PCR of ASFV. More rapid and effective method of DNA extraction using columns mini spin Quick gDNA(TM) MiniPrep was suggested and compared to the method of DNA isolation on the inorganic sorbent. High correlation of the results of the DNA detection of ASFV by real-time PCR and antigen detection results ASFV by competitive ELISA obtained with the ELISA SEROTEST/INGEZIM COMRAC PPA was demonstrated. The kit can be used in the veterinary services for effective monitoring of ASFV to contain, eliminate and prevent further spread of the disease.
An Alu-based, MGB Eclipse real-time PCR method for quantitation of human DNA in forensic samples.
Nicklas, Janice A; Buel, Eric
2005-09-01
The forensic community needs quick, reliable methods to quantitate human DNA in crime scene samples to replace the laborious and imprecise slot blot method. A real-time PCR based method has the possibility of allowing development of a faster and more quantitative assay. Alu sequences are primate-specific and are found in many copies in the human genome, making these sequences an excellent target or marker for human DNA. This paper describes the development of a real-time Alu sequence-based assay using MGB Eclipse primers and probes. The advantages of this assay are simplicity, speed, less hands-on-time and automated quantitation, as well as a large dynamic range (128 ng/microL to 0.5 pg/microL).
Yin, Hua; Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Zhao, Junfeng; Dong, Jianjun; Yu, Junhong; Chang, Zongming
2016-08-01
Genome shuffling is an efficient and promising approach for the rapid improvement of microbial phenotypes. In this study, genome shuffling was applied to enhance the yield of glutathione produced by Saccharomyces cerevisiae YS86. Six isolates with subtle improvements in glutathione yield were obtained from populations generated by ultraviolet (UV) irradiation and nitrosoguanidine (NTG) mutagenesis. These yeast strains were then subjected to recursive pool-wise protoplast fusion. A strain library that was likely to yield positive colonies was created by fusing the lethal protoplasts obtained from both UV irradiation and heat treatments. After two rounds of genome shuffling, a high-yield recombinant YSF2-19 strain that exhibited 3.2- and 3.3-fold increases in glutathione production in shake flask and fermenter respectively was obtained. Comparative analysis of synthetase gene expression was conducted between the initial and shuffled strains using FQ (fluorescent quantitation) RT-PCR (reverse transcription polymerase chain reaction). Delta CT (threshold cycle) relative quantitation analysis revealed that glutathione synthetase gene (GSH-I) expression at the transcriptional level in the YSF2-19 strain was 9.9-fold greater than in the initial YS86. The shuffled yeast strain has a potential application in brewing, other food, and pharmaceutical industries. Simultaneously, the analysis of improved phenotypes will provide more valuable data for inverse metabolic engineering. Copyright © 2016 Elsevier B.V. All rights reserved.
Staggs, Sarah E.; Beckman, Erin M.; Keely, Scott P.; Mackwan, Reena; Ware, Michael W.; Moyer, Alan P.; Ferretti, James A.; Sayed, Abu; Xiao, Lihua; Villegas, Eric N.
2013-01-01
Quantitative real-time polymerase chain reaction (qPCR) assays to detect Cryptosporidium oocysts in clinical samples are increasingly being used to diagnose human cryptosporidiosis, but a parallel approach for detecting and identifying Cryptosporidium oocyst contamination in surface water sources has yet to be established for current drinking water quality monitoring practices. It has been proposed that Cryptosporidium qPCR-based assays could be used as viable alternatives to current microscopic-based detection methods to quantify levels of oocysts in drinking water sources; however, data on specificity, analytical sensitivity, and the ability to accurately quantify low levels of oocysts are limited. The purpose of this study was to provide a comprehensive evaluation of TaqMan-based qPCR assays, which were developed for either clinical or environmental investigations, for detecting Cryptosporidium oocyst contamination in water. Ten different qPCR assays, six previously published and four developed in this study were analyzed for specificity and analytical sensitivity. Specificity varied between all ten assays, and in one particular assay, which targeted the Cryptosporidium 18S rRNA gene, successfully detected all Cryptosporidium spp. tested, but also cross-amplified T. gondii, fungi, algae, and dinoflagellates. When evaluating the analytical sensitivity of these qPCR assays, results showed that eight of the assays could reliably detect ten flow-sorted oocysts in reagent water or environmental matrix. This study revealed that while a qPCR-based detection assay can be useful for detecting and differentiating different Cryptosporidium species in environmental samples, it cannot accurately measure low levels of oocysts that are typically found in drinking water sources. PMID:23805235
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Jaravata, Carmela V; Smith, Wayne L; Rensen, Gabriel J; Ruzante, Juliana M; Cullor, James S
2006-01-01
A modified forensic DNA extraction and real-time fluorescent polymerase chain reaction assay has been evaluated for the detection of Mycobacterium avium subsp. paratuberculosis (MAP) in bovine fecal samples using primers and fluorescent resonance energy transfer (FRET) probes targeting the IS900 gene sequence of MAP. DNA was successfully extracted from manure samples by utilizing the Whatman FTA card technology, which allows for simple processing and storage of samples at room temperature. The FTA cards were washed and subjected to a Chelex-100 incubation to remove any remaining polymerase chain reaction (PCR) inhibitors and to elute the DNA from the FTA card. This isolated DNA was then subjected to direct real time fluorescent PCR analysis. Detection of MAP DNA from bovine fecal samples spiked with known concentrations of viable MAP cells was obtained. The detection limits of the assay was consistently found to be between 10(2) and 10(4) colony forming units [CFU]/g, with some samples containing as low as 10 CFU/g, yielding positive assay results. This cost-efficient assay allows reporting of results as early as 4 h after fecal collection, which can be particularly useful in highthroughput herd screening.
Ro, Young-Tae; Ticer, Anysha; Carrion, Ricardo; Patterson, Jean L
2017-04-01
Given that Ebola virus causes severe hemorrhagic fever in humans with mortality rates as high as 90%, rapid and accurate detection of this virus is essential both for controlling infection and preventing further transmission. Here, a one-step qRT-PCR assay for rapid and quantitative detection of an Ebola Zaire strain using GP, VP24 or VP40 genes as a target is introduced. Routine assay conditions for hydrolysis probe detection were established from the manufacturer's protocol used in the assays. The analytical specificity and sensitivity of each assay was evaluated using in vitro synthesized viral RNA transcripts. The assays were highly specific for the RNA transcripts, no cross-reactivity being observed among them. The limits of detection of the assays ranged from 10 2 to 10 3 copies per reaction. The assays were also evaluated using viral RNAs extracted from cell culture-propagated viruses (Ebola Zaire, Sudan and Reston strains), confirming that they are gene- and strain-specific. The RT-PCR assays detected viral RNAs in blood samples from virus-infected animal, suggesting that they can be also a useful method for identifying Ebola virus in clinical samples. © 2017 The Societies and John Wiley & Sons Australia, Ltd.
Wen, Shuxiang; Chen, Xiaoling; Xu, Fuzhou; Sun, Huiling
2016-01-01
Real-time quantitative reverse transcription PCR (qRT-PCR) offers a robust method for measurement of gene expression levels. Selection of reliable reference gene(s) for gene expression study is conducive to reduce variations derived from different amounts of RNA and cDNA, the efficiency of the reverse transcriptase or polymerase enzymes. Until now reference genes identified for other members of the family Pasteurellaceae have not been validated for Avibacterium paragallinarum. The aim of this study was to validate nine reference genes of serovars A, B, and C strains of A. paragallinarum in different growth phase by qRT-PCR. Three of the most widely used statistical algorithms, geNorm, NormFinder and ΔCT method were used to evaluate the expression stability of reference genes. Data analyzed by overall rankings showed that in exponential and stationary phase of serovar A, the most stable reference genes were gyrA and atpD respectively; in exponential and stationary phase of serovar B, the most stable reference genes were atpD and recN respectively; in exponential and stationary phase of serovar C, the most stable reference genes were rpoB and recN respectively. This study provides recommendations for stable endogenous control genes for use in further studies involving measurement of gene expression levels.
Bédard, Emilie; Laferrière, Céline; Charron, Dominique; Lalancette, Cindy; Renaud, Christian; Desmarais, Nadia; Déziel, Eric; Prévost, Michèle
2015-11-01
To perform a post-outbreak prospective study of the Pseudomonas aeruginosa contamination at the faucets (water, aerator and drain) by culture and quantitative polymerase chain reaction (qPCR) and to assess environmental factors influencing occurrence A 450-bed pediatric university hospital in Montreal, Canada Water, aerator swab, and drain swab samples were collected from faucets and analyzed by culture and qPCR for the post-outbreak investigation. Water microbial and physicochemical parameters were measured, and a detailed characterization of the sink environmental and design parameters was performed. The outbreak genotyping investigation identified drains and aerators as the source of infection. The implementation of corrective measures was effective, but post-outbreak sampling using qPCR revealed 50% positivity for P. aeruginosa remaining in the water compared with 7% by culture. P. aeruginosa was recovered in the water, the aerator, and the drain in 21% of sinks. Drain alignment vs the faucet and water microbial quality were significant factors associated with water positivity, whereas P. aeruginosa load in the water was an average of 2 log higher for faucets with a positive aerator. P. aeruginosa contamination in various components of sink environments was still detected several years after the resolution of an outbreak in a pediatric university hospital. Although contamination is often not detectable in water samples by culture, P. aeruginosa is present and can recover its culturability under favorable conditions. The importance of having clear maintenance protocols for water systems, including the drainage components, is highlighted.
Real-Time PCR Identification of Six Malassezia Species.
Ilahi, Amin; Hadrich, Inès; Neji, Sourour; Trabelsi, Houaida; Makni, Fattouma; Ayadi, Ali
2017-06-01
Lipophilic yeast Malassezia species is widely found on the skin surface of humans and other animals. This fungus can cause pityriasis versicolor, Malassezia folliculitis, and seborrheic dermatitis. Still now, there is a problem with species identification of Malassezia with conventional methods. We developed a real-time polymerase chain reaction (PCR) assay with multiple hybridization probes for detecting M. globosa, M. furfur, M. restricta, M. sympodialis, M. slooffiae, and M. pachydermatis. The amplification curves and specific melting peaks of the probes hybridized with real-time PCR product were used for species identifications. The assay was further evaluated on 120 samples which were performed by swabbing from 60 domestic animals (23 goats, 10 dogs, 15 cows, 3 cats, 8 rabbits, and 1 donkey) and in 70 human samples (28 patients with pityriasis versicolor, 17 breeders, and 25 control group). Fifteen M. pachydermatis were identified from animals. From human, 61 isolates were identified as M. globosa (28), M. furfur (15), M. restricta (6), M. sympodialis (8), M. slooffiae (2), and M. pachydermatis (2). Eight cases of co-detection from 6 patients and 2 breeders were revealed. Our findings show that the assay was highly effective in identifying Malassezia species. The application of multiplex real-time PCR provides a sensitive and rapid identification system for Malassezia species, which may be applied in further epidemiological surveys from clinical samples.
Gürsel, Derya; Aslan, Aslı; Sönmez, Cemile; Koturoğlu, Güldane; Cöplü, Nilay; Kurugöl, Zafer; Aydemir, Söhret
2012-04-01
Pertussis is a respiratory infection caused by Bordetella pertussis. It attacks all age groups. It has significantly higher mortality and morbidity among newborns and children. Adolescents and adults with symptomatic but unrecognized pertussis are often the source of the infection for pediatric cases. Therefore, it is suggested to perform laboratory diagnostic tests for B.pertussis infection in children and adolescents with prolonged cough of more than two weeks. In this study, it was aimed to identify B.pertussis infection by culture, real-time polymerase chain reaction (Rt-PCR) and serological methods among children with prolonged cough. Nasopharyngeal swab samples were obtained from 51 children (19 female, 32 male; age between 2 months-14 years; median age: 7.0), who attended the outpatient clinic of Ege University Medical Faculty Department of Pediatrics, Izmir, Turkey with prolonged cough (≥ 14 days) during December 2009-August 2010. While pertussis vaccination had been completed in 48 (94%) of the cases, three cases had not been vaccinated. Previous antibiotic treatment was reported for 38 (75%) of the cases. Cultivation was done by using 7% horse blood and charcoal containing Bordetella Agar (Becton Dickinson, Germany) and Rt-PCR targeting IS481 sequence (Roche Applied Science, Germany) was used to detect B.pertussis. In addition, in house ELISA was performed to detect titers of anti-pertussis toxin (anti-PT) IgG and anti-filamentous hemagglutinin (anti-FHA) IgG antibodies in paired sera collected in 2-4 week intervals. Fourfold titer increase of antibodies or anti-PT IgG levels of at least 100 EU/ml in one serum were evaluated as serological confirmation of B.pertussis infection. In our study, B.pertussis was isolated from one nasopharyngeal swab samples culture among the 51 patients, and IS481 Rt-PCR yielded positive results for B.pertussis in 6 (11.8%) samples. Nine (17.6%) patients were diagnosed as B.pertussis infection by serological tests. Totally
NASA Astrophysics Data System (ADS)
Liu, P.
2013-12-01
Quantitative analysis of the risk for reservoir real-time operation is a hard task owing to the difficulty of accurate description of inflow uncertainties. The ensemble-based hydrologic forecasts directly depict the inflows not only the marginal distributions but also their persistence via scenarios. This motivates us to analyze the reservoir real-time operating risk with ensemble-based hydrologic forecasts as inputs. A method is developed by using the forecast horizon point to divide the future time into two stages, the forecast lead-time and the unpredicted time. The risk within the forecast lead-time is computed based on counting the failure number of forecast scenarios, and the risk in the unpredicted time is estimated using reservoir routing with the design floods and the reservoir water levels of forecast horizon point. As a result, a two-stage risk analysis method is set up to quantify the entire flood risks by defining the ratio of the number of scenarios that excessive the critical value to the total number of scenarios. The China's Three Gorges Reservoir (TGR) is selected as a case study, where the parameter and precipitation uncertainties are implemented to produce ensemble-based hydrologic forecasts. The Bayesian inference, Markov Chain Monte Carlo, is used to account for the parameter uncertainty. Two reservoir operation schemes, the real operated and scenario optimization, are evaluated for the flood risks and hydropower profits analysis. With the 2010 flood, it is found that the improvement of the hydrologic forecast accuracy is unnecessary to decrease the reservoir real-time operation risk, and most risks are from the forecast lead-time. It is therefore valuable to decrease the avarice of ensemble-based hydrologic forecasts with less bias for a reservoir operational purpose.
Kobayashi, Naomi; Bauer, Thomas W; Sakai, Hiroshige; Togawa, Daisuke; Lieberman, Isador H; Fujishiro, Takaaki; Procop, Gary W
2006-12-01
We report a case of a culture-negative osteomyelitis in which our newly developed real-time polymerase chain reaction (PCR) could differentiate Staphylococcus aureus from Staphylococcus epidermidis. This is the first report that described the application of this novel assay to an orthopedics clinical sample. This assay may be useful for other clinical culture-negative cases in a combination with a broad-spectrum assay as a rapid microorganism identification method.
Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard
2013-05-30
Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.
Can, Hüseyin; İnceboz, Tonay; Caner, Ayşe; Atalay Şahar, Esra; Karakavuk, Muhammet; Döşkaya, Mert; Çelebi, Fehmi; Değirmenci Döşkaya, Aysu; Gülçe İz, Sultan; Gürüz, Yüksel; Korkmaz, Metin
2016-04-01
Cystic echinococcosis (CE) and alveolar echinococcosis (AE) caused by Echinococcus granulosus and Echinococcus multilocularis, respectively, are important helminthic diseases worldwide as well as in our country. Epidemiological studies conducted in Turkey showed that the prevalence of CE is 291-585/100.000. It has also been showed that the seroprevalence of AE is 3.5%. For the diagnosis of CE and AE, radiological (ultrasonography, computed tomography, magnetic resonance) and serological methods, in addition to clinical findings, are being used. The definitive diagnosis relies on pathological examination When the hydatid cysts are sterile or does not contain protoscolex, problems may occur during pathological discrimination of E.granulosus and E.multilocularis species. In this study, we aimed to develop a novel multiplex real-time polymerase chain reaction (M-RT-PCR) targeting mitochondrial 12S rRNA gene of E.granulosus and E.multilocularis using Echi S (5'-TTTATGAATATTGTGACCCTGAGAT-3') and Echi A (5'-GGTCTTAACTCAACTCATGGAG-3') primers and three different probes; Anchor Ech (5'-GTTTGCCACCTCGATGTTGACTTAG-fluoroscein-3'), Granulosus (5'-LC640-CTAAGGTTTTGGTGTAGTAATTGATATTTT-phosphate-3') and Multilocularis (5'-LC705-CTGTGATCTTGGTGTAGTAGTTGAGATT-phosphate-3') that will enable the diagnosis of CE and AE in same assay. During M-RTR-PCR, plasmids containing E.granulosus (GenBank: AF297617.1) and E.multilocularis (GenBank: NC_000928.2) mitochondrial 12S rRNA regions were used as positive controls. Cysts samples of patients which were pathologically confirmed to be CE (n: 10) and AE (n: 15) and healthy human DNA samples (n: 25) as negative control as well as DNA samples of 12 different parasites (Taenia saginata, Hymenolepis nana, Trichuris trichiura, Fasciola hepatica, Enterobius vermicularis, Toxoplasma gondii, Pneumocystis jirovecii, Trichomonas vaginalis, Cryptosporidium hominis, Strongyloides stercoralis, Plasmodium falciparum, Plasmodium vivax) were used to develop M
Quddus, M Ruhul; Manna, Pradip; Sung, C James; Kerley, Spencer; Steinhoff, Margaret M; Lawrence, W Dwayne
2014-02-01
Human papillomavirus (HPV) 16 and 18 are the types most commonly found in cervical adenosquamous carcinoma. Multiple HPV types have been found in cervical adenocarcinoma but not in the adenosquamous variant. Type-specific detection of high-risk (HR) HPV allows the detection of co-infection by multiple HPV types and assessment of viral load per cell. Our aim was to identify and quantify all HR HPV types in cervical adenosquamous carcinoma and to correlate viral loads with prognosis-related histologic features. All 15 HR HPV types were tested for by multiplex real-time polymerase chain reaction, and standard curves were created for each type. Viral loads were determined retrospectively. Prognosis-related histologic features were correlated with specific HPV types and the viral loads. A total of 80% of the tumors examined expressed HPV. Types 16/18 were detected in 86% of these cases, whereas the remaining 14% of the positive cases were infected by other types. A single type of virus was detected in 67% of cases, 2 in 29%, and 3 in 4%. Poor prognostic features were seen in 84.6% of the tumors infected with HPV 16, 46% of those infected with HPV 18, and 100% of those infected with other types. As expected, HPV 16, HPV 18, or both were the most frequent viral types; HPV 73 was the next most frequent type. Multiple HPV types were detected in 33% of the tumors. Non-HPV 16/18 cases had low viral loads, but all of these had poor prognosis-related histologic features. Two of the three recurrent cases had multiple viral types. © 2014 Elsevier Inc. All rights reserved.
Yang, Yang; Qin, Xiaodong; Zhang, Xiangle; Zhao, Zhixun; Zhang, Wei; Zhu, Xueliang; Cong, Guozheng; Li, Yanmin; Zhang, Zhidong
2017-07-17
Goatpox virus (GTPV) and sheeppox virus (SPPV), which belong to the Capripoxvirus (CaPV), are economically important pathogens of small ruminants. Therefore, a sensitive, specific and rapid diagnostic assay for detection of GTPV and SPPV is necessary to accurately and promptly control these diseases. Recombinase polymerase amplification (RPA) assays combined with a real-time fluorescent detection (real-time RPA assay) and lateral flow dipstick (RPA LFD assay) were developed targeting the CaPV G-protein-coupled chemokine receptor (GPCR) gene, respectively. The sensitivity of both CaPV real-time RPA assay and CaPV RPA LFD assay were 3 × 10 2 copies per reaction within 20 min at 38 °C. Both assays were highly specific for CaPV, with no cross-reactions with peste des petits ruminants virus, foot-and-mouth disease virus and Orf virus. The evaluation of the performance of these two assays with clinical sample (n = 107) showed that the CaPV real-time RPA assay and CaPV RPA LFD assay were able to specially detect SPPV or GTPV present in samples of ovine in liver, lung, kidney, spleen, skin and blood. This study provided a highly time-efficient and simple alternative for rapid detection of GTPV and SPPV.
Single cell digital polymerase chain reaction on self-priming compartmentalization chip.
Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying
2017-01-01
Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.
Single cell digital polymerase chain reaction on self-priming compartmentalization chip
Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying
2017-01-01
Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267
Stubbs, Samuel; Oura, Chris A L; Henstock, Mark; Bowden, Timothy R; King, Donald P; Tuppurainen, Eeva S M
2012-02-01
Capripoxviruses, which are endemic in much of Africa and Asia, are the aetiological agents of economically devastating poxviral diseases in cattle, sheep and goats. The aim of this study was to validate a high-throughput real-time PCR assay for routine diagnostic use in a capripoxvirus reference laboratory. The performance of two previously published real-time PCR methods were compared using commercially available reagents including the amplification kits recommended in the original publication. Furthermore, both manual and robotic extraction methods used to prepare template nucleic acid were evaluated using samples collected from experimentally infected animals. The optimised assay had an analytical sensitivity of at least 63 target DNA copies per reaction, displayed a greater diagnostic sensitivity compared to conventional gel-based PCR, detected capripoxviruses isolated from outbreaks around the world and did not amplify DNA from related viruses in the genera Orthopoxvirus or Parapoxvirus. The high-throughput robotic DNA extraction procedure did not adversely affect the sensitivity of the assay compared to manual preparation of PCR templates. This laboratory-based assay provides a rapid and robust method to detect capripoxviruses following suspicion of disease in endemic or disease-free countries. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.
Real time non invasive imaging of fatty acid uptake in vivo
Henkin, Amy H.; Cohen, Allison S.; Dubikovskaya, Elena A.; Park, Hyo Min; Nikitin, Gennady F.; Auzias, Mathieu G.; Kazantzis, Melissa; Bertozzi, Carolyn R.; Stahl, Andreas
2012-01-01
Detection and quantification of fatty acid fluxes in animal model systems following physiological, pathological, or pharmacological challenges is key to our understanding of complex metabolic networks as these macronutrients also activate transcription factors and modulate signaling cascades including insulin-sensitivity. To enable non-invasive, real-time, spatiotemporal quantitative imaging of fatty acid fluxes in animals, we created a bioactivatable molecular imaging probe based on long-chain fatty acids conjugated to a reporter molecule (luciferin). We show that this probe faithfully recapitulates cellular fatty acid uptake and can be used in animal systems as a valuable tool to localize and quantitate in real-time lipid fluxes such as intestinal fatty acid absorption and brown adipose tissue activation. This imaging approach should further our understanding of basic metabolic processes and pathological alterations in multiple disease models. PMID:22928772
Lee, Ai-Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe
2008-12-15
We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcripts in the population of messenger ribonucleic acid (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify the target signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-naphthyl phosphate. The voltammetric characteristics of substrate and enzymatic product as well as the parameters of SWV analysis were systematically optimized. A detection limit of 1 fM (1 x 10(-19) mol of target transcripts in 100 microL) and a 3-order-wide dynamic range of target concentration were achieved by the electrochemical bDNA assay. Such limit corresponded to approximately 17 fg of the p185 BCR-ABL fusion transcripts. The specificity and sensitivity of assay enabled direct detection of target transcripts in as little as 4.6 ng of mRNA population without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcripts in mRNA population. A mean transcript copy number of 62,900/ng of mRNA was determined, which was at least 50-fold higher than that of real-time quantitative PCR (qPCR). The finding was consistent with the underestimation of targets by qPCR reported earlier. In addition, the unique design based on bDNA technology increases the assay specificity as only the p185 BCR-ABL fusion transcripts will respond to the detection. The approach thus provides a simple, sensitive, accurate, and quantitative tool alternative to the qPCR for early disease diagnosis.
Time-dependent real space RG on the spin-1/2 XXZ chain
NASA Astrophysics Data System (ADS)
Mason, Peter; Zagoskin, Alexandre; Betouras, Joseph
In order to measure the spread of information in a system of interacting fermions with nearest-neighbour couplings and strong bond disorder, one could utilise a dynamical real space renormalisation group (RG) approach on the spin-1/2 XXZ chain. Under such a procedure, a many-body localised state is established as an infinite randomness fixed point and the entropy scales with time as log(log(t)). One interesting further question that results from such a study is the case when the Hamiltonian explicitly depends on time. Here we answer this question by considering a dynamical renormalisation group treatment on the strongly disordered random spin-1/2 XXZ chain where the couplings are time-dependent and chosen to reflect a (slow) evolution of the governing Hamiltonian. Under the condition that the renormalisation process occurs at fixed time, a set of coupled second order, nonlinear PDE's can be written down in terms of the random distributions of the bonds and fields. Solution of these flow equations at the relevant critical fixed points leads us to establish the dynamics of the flow as we sweep through the quantum critical point of the Hamiltonian. We will present these critical flows as well as discussing the issues of duality, entropy and many-body localisation.
Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li
2015-07-01
Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
He, G Z; Tian, W Y; Qian, N; Cheng, A C; Deng, S X
2010-12-01
This research was undertaken to identify and understand the regular distribution pattern for Salmonella Enteritidis (S. enteritidis) in the internal organs of chicken after oral challenge over a 3 wk period. We used a real-time, fluorescence-based quantitative polymerase chain reaction (FQ-PCR) to detect genomic DNA of S. enteritidis in the blood and the internal organs, including heart, liver, spleen, kidney, pancreas, and gallbladder, from chicken after oral challenge at different time points. The results showed that the spleen was positive at 12 h post inoculation (PI), and the blood was at 14 h PI. The organism was detected in the liver and heart at 16 h PI, pancrea was positive at 20 h PI, and the final organ to show a positive results were the kidney and gallbladder at 22 h PI. The copy number of S. enteritidis DNA in each tissue reached a peak at 24 h-36 h PI, with the liver and spleen containing high concentrations of S. enteritidis, whereas the blood, heart, kidney, pancreas, and gallbladder had low concentrations. S. enteritidis populations began to decrease and were not detectable at 3 d PI, but were still present up to 12 d PI in the gallbladder, 2 wk for the liver, and 3 wk for the spleen without causing apparent symptoms. The results showed that the liver and spleen may be the primary sites for S. enteritidis setting itself up as a commensa over a long time after oral challenge. Interestingly, it may be the first time reported that the gallbladder is a site of carriage for S. enteritidis over a 12 d period. This study will help to understand the mechanisms of action of S. enteritidis infection in vivo.
Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cao Hongbin; Banh, Alice; Kwok, Shirley
Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed bymore » p16{sup INK4a} staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using {sup 18}F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.« less
A noninvasive, direct real-time PCR method for sex determination in multiple avian species
Brubaker, Jessica L.; Karouna-Renier, Natalie K.; Chen, Yu; Jenko, Kathryn; Sprague, Daniel T.; Henry, Paula F.P.
2011-01-01
Polymerase chain reaction (PCR)-based methods to determine the sex of birds are well established and have seen few modifications since they were first introduced in the 1990s. Although these methods allowed for sex determination in species that were previously difficult to analyse, they were not conducive to high-throughput analysis because of the laboriousness of DNA extraction and gel electrophoresis. We developed a high-throughput real-time PCR-based method for analysis of sex in birds, which uses noninvasive sample collection and avoids DNA extraction and gel electrophoresis.
Thermally multiplexed polymerase chain reaction.
Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R
2015-07-01
Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.
Tsai, Pei-Chien; Breen, Matthew
2012-09-01
To identify suitable reference genes for normalization of real-time quantitative PCR (RT-qPCR) assay data for common tumors of dogs. Malignant lymph node (n = 8), appendicular osteosarcoma (9), and histiocytic sarcoma (12) samples and control samples of various nonneoplastic canine tissues. Array-based comparative genomic hybridization (aCGH) data were used to guide selection of 9 candidate reference genes. Expression stability of candidate reference genes and 4 commonly used reference genes was determined for tumor samples with RT-qPCR assays and 3 software programs. LOC611555 was the candidate reference gene with the highest expression stability among the 3 tumor types. Of the commonly used reference genes, expression stability of HPRT was high in histiocytic sarcoma samples, and expression stability of Ubi and RPL32 was high in osteosarcoma samples. Some of the candidate reference genes had higher expression stability than did the commonly used reference genes. Data for constitutively expressed genes with high expression stability are required for normalization of RT-qPCR assay results. Without such data, accurate quantification of gene expression in tumor tissue samples is difficult. Results of the present study indicated LOC611555 may be a useful RT-qPCR assay reference gene for multiple tissue types. Some commonly used reference genes may be suitable for normalization of gene expression data for tumors of dogs, such as lymphomas, osteosarcomas, or histiocytic sarcomas.
Lai, Chieh-Hsien; Wu, Sih-Rong; Pang, Jen-Chieh; Ramireddy, Latha; Chiang, Yu-Cheng; Lin, Chien-Ku; Tsen, Hau-Yang
2017-07-01
The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA) real-time quantitative polymerase chain reaction (qPCR) to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4-5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable. Copyright © 2016. Published by Elsevier B.V.
Kiddle, Guy; Hardinge, Patrick; Buttigieg, Neil; Gandelman, Olga; Pereira, Clint; McElgunn, Cathal J; Rizzoli, Manuela; Jackson, Rebecca; Appleton, Nigel; Moore, Cathy; Tisi, Laurence C; Murray, James A H
2012-04-30
There is an increasing need for quantitative technologies suitable for molecular detection in a variety of settings for applications including food traceability and monitoring of genetically modified (GM) crops and their products through the food processing chain. Conventional molecular diagnostics utilising real-time polymerase chain reaction (RT-PCR) and fluorescence-based determination of amplification require temperature cycling and relatively complex optics. In contrast, isothermal amplification coupled to a bioluminescent output produced in real-time (BART) occurs at a constant temperature and only requires a simple light detection and integration device. Loop mediated isothermal amplification (LAMP) shows robustness to sample-derived inhibitors. Here we show the applicability of coupled LAMP and BART reactions (LAMP-BART) for determination of genetically modified (GM) maize target DNA at low levels of contamination (0.1-5.0% GM) using certified reference material, and compare this to RT-PCR. Results show that conventional DNA extraction methods developed for PCR may not be optimal for LAMP-BART quantification. Additionally, we demonstrate that LAMP is more tolerant to plant sample-derived inhibitors, and show this can be exploited to develop rapid extraction techniques suitable for simple field-based qualitative tests for GM status determination. We also assess the effect of total DNA assay load on LAMP-BART quantitation. LAMP-BART is an effective and sensitive technique for GM detection with significant potential for quantification even at low levels of contamination and in samples derived from crops such as maize with a large genome size. The resilience of LAMP-BART to acidic polysaccharides makes it well suited to rapid sample preparation techniques and hence to both high throughput laboratory settings and to portable GM detection applications. The impact of the plant sample matrix and genome loading within a reaction must be controlled to ensure
Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.
De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda
2018-04-01
Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.
Complementary techniques: validation of gene expression data by quantitative real time PCR.
Provenzano, Maurizio; Mocellin, Simone
2007-01-01
Microarray technology can be considered the most powerful tool for screening gene expression profiles of biological samples. After data mining, results need to be validated with highly reliable biotechniques allowing for precise quantitation of transcriptional abundance of identified genes. Quantitative real time PCR (qrt-PCR) technology has recently reached a level of sensitivity, accuracy and practical ease that support its use as a routine bioinstrumentation for gene level measurement. Currently, qrt-PCR is considered by most experts the most appropriate method to confirm or confute microarray-generated data. The knowledge of the biochemical principles underlying qrt-PCR as well as some related technical issues must be beard in mind when using this biotechnology.
Vaïtilingom, M; Pijnenburg, H; Gendre, F; Brignon, P
1999-12-01
A fast and quantitative method was developed to detect transgenic "Maximizer" maize "event 176" (Novartis) and "Roundup Ready" soybean (Monsanto) in food by real-time quantitative PCR. The use of the ABI Prism 7700 sequence detection system allowed the determination of the amplified product accumulation through a fluorogenic probe (TaqMan). Fluorescent dyes were chosen in such a way as to coamplify total and transgenic DNA in the same tube. Using real-time quantitative PCR, 2 pg of transgenic or total DNA per gram of starting sample was detected in 3 h after DNA extraction and the relative amounts of "Maximizer" maize and "Roundup Ready" soybean in some representative food products were quantified.
Identification of Brucella spp. by using the polymerase chain reaction.
Herman, L; De Ridder, H
1992-01-01
The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903
Detection of Listeria monocytogenes by using the polymerase chain reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bessesen, M.T.; Luo, Q.; Blaser, M.J.
1990-09-01
A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.
Sakai, Fuminori; Sonaty, Griffin; Watson, David; Klugman, Keith P; Vidal, Jorge E
2017-09-15
Identification of Streptococcus pneumoniae and its more than 90 serotypes is routinely conducted by culture and Quellung reactions. Quantitative polymerase chain reactions (qPCRs) have been developed for molecular detection, including a pan-pneumococcus lytA assay, and assays targeting 79 serotypes. Reactions require genomic DNA from every target to prepare standards, which can be time consuming. In this study, we have developed a synthetic DNA molecule as a surrogate for genomic DNA and present new single-plex qPCR reactions to increase molecular detection to 94 pneumococcal serotypes. Specificity of these new reactions was confirmed with a limit of detection between 2 and 20 genome equivalents/reaction. A synthetic DNA (NUversa, ∼8.2 kb) was then engineered to contain all available qPCR targets for serotyping and lytA. NUversa was cloned into pUC57-Amp-modified to generate pNUversa (∼10.2 kb). Standards prepared from pNUversa and NUversa were compared against standards made out of genomic DNA. Linearity [NUversa (R2 > 0.982); pNUversa (R2 > 0.991)] and efficiency of qPCR reactions were similar to those utilizing chromosomal DNA (R2 > 0.981). Quantification with plasmid pNUversa was affected, however, whereas quantification with synthetic NUversa was comparable to that of genomic DNA. Therefore, NUversa may be utilized as DNA standard in single-plex assays of the currently known 94 pneumococcal serotypes. © FEMS 2017.
Mitran, Catherine J; Mbonye, Anthony K; Hawkes, Michael; Yanow, Stephanie K
2018-06-04
Malaria rapid diagnostic tests (RDTs) are widely used in clinical and surveillance settings. However, the performance of most RDTs has not been characterized at parasite densities below detection by microscopy. We present findings from Uganda, where RDT results from 491 participants with suspected malaria were correlated with quantitative polymerase chain reaction (qPCR)-defined parasitemia. Compared with qPCR, the sensitivity and specificity of the RDT for Plasmodium falciparum mono-infections were 76% (95% confidence interval [CI]: 68-83%) and 95% (95% CI: 92-97%), respectively. The sensitivity of the RDT at parasite densities between 0.2 and 200 parasites/μL was surprisingly high (87%, 95% CI: 74-94%). The high sensitivity of the RDT is likely because of histidine-rich protein 2 from submicroscopic infections, gametocytes, or sequestered parasites. These findings underscore the importance of evaluating different RDTs in field studies against qPCR reference testing to better define the sensitivity and specificity, particularly at low parasite densities.
Yamamura, Kensuke; Baba, Yoshifumi; Miyake, Keisuke; Nakamura, Kenichi; Shigaki, Hironobu; Mima, Kosuke; Kurashige, Junji; Ishimoto, Takatsugu; Iwatsuki, Masaaki; Sakamoto, Yasuo; Yamashita, Yoichi; Yoshida, Naoya; Watanabe, Masayuki; Baba, Hideo
2017-12-01
The human microbiome Fusobacterium nucleatum , which primarily inhabits the oral cavity, causes periodontal disease and has also been implicated in the development of colorectal cancer. However, whether F. nucleatum is present in other gastroenterological cancer tissues remains to be elucidated. The present study evaluated whether quantitative polymerase chain reaction (qPCR) assays were able to detect F. nucleatum DNA and measure the quantity of F. nucleatum DNA in esophageal, gastric, pancreatic and liver cancer tissues. The accuracy of the qPCR assay was determined from a calibration curve using DNA extracted from cells from the oral cavity. Formalin-fixed paraffin-embedded (FFPE) tumor tissues from 20 patients with gastroenterological [esophageal (squamous cell carcinoma), gastric, colorectal, pancreatic and liver] cancer and 20 matched normal tissues were evaluated for F. nucleatum DNA content. The cycle threshold values in the qPCR assay for F. nucleatum and solute carrier organic anion transporter family member 2A1 (reference sample) decreased linearly with the quantity of input DNA ( r 2 >0.99). The F. nucleatum detection rate in esophageal, gastric and colorectal cancer tissues were 20% (4/20), 10% (2/20) and 45% (9/20), respectively. F. nucleatum was not detected in liver and pancreatic cancer tissues. The qPCR results from the frozen and FFPE tissues were consistent. Notably, F. nucleatum was detected at a higher level in superficial areas compared with the invasive areas. F. nucleatum in esophageal, gastric and colorectal cancer tissues was evaluated by qPCR using FFPE tissues. F. nucleatum may be involved in the development of esophageal, gastric and colorectal cancer.
A real-time quantitative PCR (qPCR) method and a modification of this method incorporating pretreatment of samples with propidium monoazide (PMA) were evaluated for respective analyses of total and presumptively viable Enterococcus and Bacteroidales fecal indicator bacteria. Thes...
Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A
2015-04-01
Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Huang, Su-Hua; Yang, Tsuey-Ching; Tsai, Ming-Hong; Tsai, I.-Shou; Lu, Huang-Chih; Chuang, Pei-Hsin; Wan, Lei; Lin, Ying-Ju; Lai, Chih-Ho; Lin, Cheng-Wen
2008-10-01
Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples.
Choi, Yeonim; Jeon, Bo-Young; Shim, Tae Sun; Jin, Hyunwoo; Cho, Sang-Nae; Lee, Hyeyoung
2014-12-01
Rapid, accurate detection of Mycobacterium tuberculosis is crucial in the diagnosis of tuberculosis (TB), but conventional diagnostic methods have limited sensitivity and specificity or are time consuming. A new highly sensitive nucleic acid amplification test, combined nested and real-time polymerase chain reaction (PCR) in a single tube (one-tube nested real-time PCR), was developed for detecting M. tuberculosis, which takes advantage of two PCR techniques, i.e., nested PCR and real-time PCR. One-tube nested real-time PCR was designed to have two sequential reactions with two sets of primers and dual probes for the insertion sequence (IS) 6110 sequence of M. tuberculosis in a single closed tube. The minimum limits of detection of IS6110 real-time PCR and IS6110 one-tube nested real-time PCR were 100 fg/μL and 1 fg/μL of M. tuberculosis DNA, respectively. AdvanSure TB/non-tuberculous mycobacteria (NTM) real-time PCR, IS6110 real-time PCR, and two-tube nested real-time PCR showed 100% sensitivity and 100% specificity for clinical M. tuberculosis isolates and NTM isolates. In comparison, the sensitivities of AdvanSure TB/NTM real-time PCR, single IS6110 real-time PCR, and one-tube nested real-time PCR were 91% (152/167), 94.6% (158/167), and 100% (167/167) for sputum specimens, respectively. In conclusion, IS6110 one-tube nested real-time PCR is useful for detecting M. tuberculosis due to its high sensitivity and simple manipulation. Copyright © 2014 Elsevier Inc. All rights reserved.
Jeong, Jae-Kyo; Kang, Min-Hee; Gurunathan, Sangiliyandi; Cho, Ssang-Goo; Park, Chankyu; Seo, Han Geuk; Kim, Jin-Hoi
2014-09-25
Real-time quantitative reverse-transcriptase polymerase chain reaction (RT-qPCR) is the most sensitive, and valuable technique for rare mRNA detection. However, the expression profiles of reference genes under different experimental conditions, such as different mouse strains, developmental stage, and culture conditions have been poorly studied. mRNA stability of the actb, gapdh, sdha, ablim, ywhaz, sptbn, h2afz, tgfb1, 18 s and wrnip genes was analyzed. Using the NormFinder program, the most stable genes are as follows: h2afz for the B6D2F-1 and C57BL/6 strains; sptbn for ICR; h2afz for KOSOM and CZB cultures of B6D2F-1 and C57BL/6 strain-derived embryos; wrnip for M16 culture of B6D2F-1 and C57BL/6 strain-derived embryos; ywhaz, tgfb1, 18 s, 18 s, ywhaz, and h2afz for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst embryonic stages cultured in KSOM medium, respectively; h2afz, wrnip, wrnip, h2afz, ywhaz, and ablim for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst stage embryos cultured in CZB medium, respectively; 18 s, h2afz, h2afz, actb, h2afz, and wrnip for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst stage embryos cultured in M16 medium, respectively. These results demonstrated that candidate reference genes for normalization of target gene expression using RT-qPCR should be selected according to mouse strains, developmental stage, and culture conditions.
Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus.
Faye, Martin; Dacheux, Laurent; Weidmann, Manfred; Diop, Sylvie Audrey; Loucoubar, Cheikh; Bourhy, Hervé; Sall, Amadou Alpha; Faye, Ousmane
2017-05-01
Rabies virus (RABV) remains one of the most important global zoonotic pathogens. RABV causes rabies, an acute encephalomyelitis associated with a high rate of mortality in humans and animals and affecting different parts of the world, particularly in Asia and Africa. Confirmation of rabies diagnosis relies on laboratory diagnosis, in which molecular techniques such as detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) are increasingly being used. In this study, two real-time quantitative RT-PCR assays were developed for large-spectrum detection of RABV, with a focus on African isolates. The primer and probe sets were targeted highly conserved regions of the nucleoprotein (N) and polymerase (L) genes. The results indicated the absence of non-specific amplification and cross-reaction with a range of other viruses belonging to the same taxonomic family, i.e. Rhabdoviridae, as well as negative brain tissues from various host species. Analytical sensitivity ranged between 100 to 10 standard RNA copies detected per reaction for N-gene and L-gene assays, respectively. Effective detection and high sensitivity of these assays on African isolates showed that they can be successfully applied in general research and used in diagnostic process and epizootic surveillance in Africa using a double-check strategy. Copyright © 2017 Elsevier B.V. All rights reserved.
Detection of Trypanosoma cruzi by Polymerase Chain Reaction.
Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz
2016-01-01
American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.
Quantification Bias Caused by Plasmid DNA Conformation in Quantitative Real-Time PCR Assay
Lin, Chih-Hui; Chen, Yu-Chieh; Pan, Tzu-Ming
2011-01-01
Quantitative real-time PCR (qPCR) is the gold standard for the quantification of specific nucleic acid sequences. However, a serious concern has been revealed in a recent report: supercoiled plasmid standards cause significant over-estimation in qPCR quantification. In this study, we investigated the effect of plasmid DNA conformation on the quantification of DNA and the efficiency of qPCR. Our results suggest that plasmid DNA conformation has significant impact on the accuracy of absolute quantification by qPCR. DNA standard curves shifted significantly among plasmid standards with different DNA conformations. Moreover, the choice of DNA measurement method and plasmid DNA conformation may also contribute to the measurement error of DNA standard curves. Due to the multiple effects of plasmid DNA conformation on the accuracy of qPCR, efforts should be made to assure the highest consistency of plasmid standards for qPCR. Thus, we suggest that the conformation, preparation, quantification, purification, handling, and storage of standard plasmid DNA should be described and defined in the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) to assure the reproducibility and accuracy of qPCR absolute quantification. PMID:22194997
A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus.
Wang, Jianchang; Wang, Jinfeng; Geng, Yunyun; Yuan, Wanzhe
2017-10-01
A recombinase polymerase amplification (RPA)-based method was developed for rapid and specific detection of African swine fever virus (ASFV), the etiologic agent of African swine fever, a devastating disease of swine. Primers and the exo probe targeting the conserved region of the P72 gene of ASFV were designed and the reaction was run on the Genie III scanner device. Using recombinant plasmid DNA containing the P72 gene as template, we showed that the amplified product could be detected in less than 10 min and that the detection limit was 10 2 copies DNA/reaction [same detection limit as real-time polymerase chain reaction (PCR)]. The RPA assay did not cross-detect CSFV, PCV-2, PRV, PRRSV, or FMDV, common viruses seen in pigs. Tests of recombinant plasmid-spiked serum samples revealed that RPA and real-time PCR had the same diagnostic rate. The RPA assay, which is simple, cost-effective, and fast, is a promising alternative to real-time PCR for ASFV detection.
A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus
Wang, Jianchang; Wang, Jinfeng; Geng, Yunyun; Yuan, Wanzhe
2017-01-01
A recombinase polymerase amplification (RPA)-based method was developed for rapid and specific detection of African swine fever virus (ASFV), the etiologic agent of African swine fever, a devastating disease of swine. Primers and the exo probe targeting the conserved region of the P72 gene of ASFV were designed and the reaction was run on the Genie III scanner device. Using recombinant plasmid DNA containing the P72 gene as template, we showed that the amplified product could be detected in less than 10 min and that the detection limit was 102 copies DNA/reaction [same detection limit as real-time polymerase chain reaction (PCR)]. The RPA assay did not cross-detect CSFV, PCV-2, PRV, PRRSV, or FMDV, common viruses seen in pigs. Tests of recombinant plasmid-spiked serum samples revealed that RPA and real-time PCR had the same diagnostic rate. The RPA assay, which is simple, cost-effective, and fast, is a promising alternative to real-time PCR for ASFV detection. PMID:29081590
Holzhauser, Thomas; Kleiner, Kornelia; Janise, Annabella; Röder, Martin
2014-11-15
A novel method to quantify species or DNA on the basis of a competitive quantitative real-time polymerase chain reaction (cqPCR) was developed. Potentially allergenic peanut in food served as one example. Based on an internal competitive DNA sequence for normalisation of DNA extraction and amplification, the cqPCR was threshold-calibrated against 100mg/kg incurred peanut in milk chocolate. No external standards were necessary. The competitive molecule successfully served as calibrator for quantification, matrix normalisation, and inhibition control. Although designed for verification of a virtual threshold of 100mg/kg, the method allowed quantification of 10-1,000 mg/kg peanut incurred in various food matrices and without further matrix adaption: On the basis of four PCR replicates per sample, mean recovery of 10-1,000 mg/kg peanut in chocolate, vanilla ice cream, cookie dough, cookie, and muesli was 87% (range: 39-147%) in comparison to 199% (range: 114-237%) by three commercial ELISA kits. Copyright © 2014 Elsevier Ltd. All rights reserved.
There is a growing interest in the application of human-associated fecal sourceidentification quantitative real-time PCR (qPCR) technologies for water quality management. The transition from a research tool to a standardized protocol requires a high degree of confidence in data q...
There are numerous quantitative real-time PCR (qPCR) assays available to detect and enumerate fecal pollution in ambient waters. Each assay employs distinct primers and probes that target different rRNA genes and microorganisms leading to potential variations in concentration es...
Diagnosis of aerobic vaginitis by quantitative real-time PCR.
Rumyantseva, T A; Bellen, G; Savochkina, Y A; Guschin, A E; Donders, G G G
2016-07-01
To evaluate a real-time PCR-based technique to quantify bacteria associated with aerobic vaginitis (AV) as a potential test. Vaginal samples from 100 women were tested by wet-mount microscopy, gram stain and quantitative real-time PCR targeting Enterobacteriacea, Staphylococcus spp., Streptococcus spp., Enterococcus spp., Escherichia coli, Streptococcus agalactiae, S. aureus; Lactobacillus spp. AV diagnosis obtained by wet-mount microscopy was used as reference. Some level of AV was diagnosed in 23 (23.7 %) cases. Various concentrations of Enterobacteriacea, Staphylococcus spp., Streptococcus spp. were detected an all patients. Enterococcus spp. were detected in 76 (78.3 %) cases. Summarized concentrations of aerobes were tenfold higher in AV-positive compared to AV-negative cases [7.30lg vs 6.06lg (p = 0.02)]. Concentrations of aerobes in severe, moderate and light AV cases did not vary significantly (p = 0.14). Concentration of lactobacilli was 1000-fold lower in AV-positive cases compared to normal cases (5.3lg vs 8.3lg, p < 0.0001). Streptococcus spp. dominated in the majority of AV-positive cases [19/22 (86.4 %) samples]. The relation of high loads of aerobes to the low numbers of Lactobacilli are a reliable marker for the presence of AV and could substitute microscopy as a test. PCR may be a good standardized substitution for AV diagnosis in settings where well-trained microscopists are lacking.
Sood, Tanushri Jerath; Lagah, Swati Viviyan; Sharma, Ankita; Singla, Suresh Kumar; Mukesh, Manishi; Chauhan, Manmohan Singh; Manik, Radheysham; Palta, Prabhat
2017-10-01
We evaluated the suitability of 10 candidate internal control genes (ICGs), belonging to different functional classes, namely ACTB, EEF1A1, GAPDH, HPRT1, HMBS, RPS15, RPS18, RPS23, SDHA, and UBC for normalizing the real-time quantitative polymerase chain reaction (qPCR) data of blastocyst-stage buffalo embryos produced by hand-made cloning and in vitro fertilization (IVF). Total RNA was isolated from three pools, each of cloned and IVF blastocysts (n = 50/pool) for cDNA synthesis. Two different statistical algorithms geNorm and NormFinder were used for evaluating the stability of these genes. Based on gene stability measure (M value) and pairwise variation (V value), calculated by geNorm analysis, the most stable ICGs were RPS15, HPRT1, and ACTB for cloned blastocysts, HMBS, UBC, and HPRT1 for IVF blastocysts and RPS15, GAPDH, and HPRT1 for both the embryo types analyzed together. RPS18 was the least stable gene for both cloned and IVF blastocysts. Following NormFinder analysis, the order of stability was RPS15 = HPRT1>GAPDH for cloned blastocysts, HMBS = UBC>RPS23 for IVF blastocysts, and HPRT1>GAPDH>RPS15 for cloned and IVF blastocysts together. These results suggest that despite overlapping of the three most stable ICGs between cloned and IVF blastocysts, the panel of ICGs selected for normalization of qPCR data of cloned and IVF blastocyst-stage embryos should be different.
Integrated polymerase chain reaction/electrophoresis instrument
Andresen, Brian D.
2000-01-01
A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
ERIC Educational Resources Information Center
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Real-time PCR assay for the diagnosis of pleural tuberculosis
Cárdenas Bernal, Ana María; Giraldo-Cadavid, Luis Fernando; Prieto Diago, Enrique; Santander, Sandra Paola
2017-01-01
Abstract Introduction: The diagnosis of pleural tuberculosis requires an invasive and time-consuming reference method. Polymerase chain reaction (PCR) is rapid, but validation in pleural tuberculosis is still weak. Objective: To establish the operating characteristics of real-time polymerase chain reaction (RT-PCR) hybridization probes for the diagnosis of pleural tuberculosis. Methods: The validity of the RT-PCR hybridization probes was evaluated compared to a composite reference method by a cross-sectional study at the Hospital Universitario de la Samaritana. 40 adults with lymphocytic pleural effusion were included. Pleural tuberculosis was confirmed (in 9 patients) if the patient had at least one of three tests using the positive reference method: Ziehl-Neelsen or Mycobacterium tuberculosis culture in fluid or pleural tissue, or pleural biopsy with granulomas. Pleural tuberculosis was ruled out (in 31 patients) if all three tests were negative. The operating characteristics of the RT-PCR, using the Mid-P Exact Test, were determined using the OpenEpi 2.3 Software (2009). Results: The RT-PCR hybridization probes showed a sensitivity of 66.7% (95% CI: 33.2%-90.7%) and a specificity of 93.5% (95% CI: 80.3%-98.9%). The PPV was 75.0% (95% CI: 38.8%-95.6%) and a NPV of 90.6% (95% CI: 76.6%-97.6%). Two false positives were found for the test, one with pleural mesothelioma and the other with chronic pleuritis with mesothelial hyperplasia. Conclusions: The RT-PCR hybridization probes had good specificity and acceptable sensitivity, but a negative value cannot rule out pleural tuberculosis. PMID:29021638
Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.
2013-01-01
The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.
The POLIMI forecasting chain for real time flood and drought predictions
NASA Astrophysics Data System (ADS)
Ceppi, Alessandro; Ravazzani, Giovanni; Corbari, Chiara; Mancini, Marco
2016-04-01
Nowadays coupling meteorological and hydrological models is recognized by scientific community as a necessary way to forecast extreme hydrological phenomena, in order to activate useful mitigation measurements and alert systems in advance. The development and implementation of a real-time forecasting chain with a hydro-meteorological operational alert procedure for flood and drought events is presented in this study. Different weather models are used to build the POLIMI operative chain: the probabilistic COSMO-LEPS model with 16 ensembles developed by ARPA-Emilia Romagna, the deterministic Bolam and Moloch models, developed by the Italian ISAC-CNR, and nine further simulations obtained by different runs of the WRF-ARW (3), WRF-NMM (2), ETA2012 (1) and the GFS (3), provided by the private Epson Meteo Center and Terraria companies. All the meteorological runs are then implemented with the rainfall-runoff physically-based distributed FEST-WB model, developed at Politecnico di Milano to obtain a multi-model approach system with hydrological ensemble forecasts in different areas of study over the Italian country. As far as concerning drought predictions, three test-beds are monitored: two in maize fields, one in the Puglia region (South of Italy), and another in the Po Valley area, (northern Italy), and one in a golf course in Milan city. The hydrological model was here calibrated and validated against measurements of latent heat flux and soil moisture acquired by an eddy-covariance station, TDR probes and remote sensing images. Regarding flood forecasts, two test-sites are chosen: the first one is the urban area northern Milan where three catchments (the Seveso, Olona, and Lambro River basins) are used to show how early warning systems are an effective complement to structural measures for flood control in Milan city which flooded frequently in the last 25 years, while the second test-site is the Idro Lake, located between the Lombardy and Trentino region where the
Evaluation of the Abbott RealTime HCV assay for quantitative detection of hepatitis C virus RNA.
Michelin, Birgit D A; Muller, Zsofia; Stelzl, Evelyn; Marth, Egon; Kessler, Harald H
2007-02-01
The Abbott RealTime HCV assay for quantitative detection of HCV RNA has recently been introduced. In this study, the performance of the Abbott RealTime HCV assay was evaluated and compared to the COBAS AmpliPrep/COBAS TaqMan HCV test. Accuracy, linearity, interassay and intra-assay variations were determined, and a total of 243 routine clinical samples were investigated. When accuracy of the new assay was tested, the majority of results were found to be within +/-0.5 log(10) unit of the results obtained by reference laboratories. Determination of linearity resulted in a quasilinear curve up to 1.0 x 10(6)IU/ml. The interassay variation ranged from 15% to 32%, and the intra-assay variation ranged from 5% to 8%. When clinical samples were tested by the Abbott RealTime HCV assay and the results were compared with those obtained by the COBAS AmpliPrep/COBAS TaqMan HCV test, the results for 93% of all samples with positive results by both tests were found to be within +/-1.0 log(10) unit. The viral loads for all patients measured by the Abbott and Roche assays showed a high correlation (R(2)=0.93); quantitative results obtained by the Abbott assay were found to be lower than those obtained by the Roche assay. The Abbott RealTime HCV assay proved to be suitable for use in the routine diagnostic laboratory. The time to results was similar for both of the assays.
Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong
2018-02-01
Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.
Five years' experience of classical swine fever polymerase chain reaction ring trials in France.
Po, F; Le Dimna, M; Le Potier, M F
2011-12-01
Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.
Dalla Valle, L; Toffolo, V; Lamprecht, M; Maltese, C; Bovo, G; Belvedere, P; Colombo, L
2005-10-31
The aim of the present work was to develop two new independent SYBR Green I-based real-time PCR assays for both detection and quantification of betanodavirus, an RNA virus that infects several species of marine teleost fish causing massive mortalities in larvae and juveniles. The assays utilized two pairs of primers targeting highly conserved regions of both the RNA molecules forming the betanodavirus genome: RNA1 encoding the RNA-dependent RNA polymerase (RdRP) and RNA2 encoding the coat protein (CP). The specificity of amplifications was monitored by the melting analysis and agarose gel electrophoresis of the amplified products. The applicability of these assays was confirmed with 21 betanodavirus strains, covering all the four main clades. In addition, a BLAST (NCBI) search with the primer sequences showed no genomic cross-reactivity with other viruses. The new assays were able to quantify concentrations of betanodavirus genes ranging from 10(1) to 10(8) copies per reaction. The intra-assay coefficients of variation (CV) of threshold cycle (Ct) values of the assays were 1.5% and 1.4% for CP and RdRP RNAs, respectively. The inter-assay CVs of Ct values were 2.3% and 2.4% for CP and RdRP RNAs, respectively. Moreover, regression analysis showed a significant correlation (R2>0.97) between genome number, as determined by real-time PCR assays and the corresponding virus titer expressed as TCID50/ml of two different betanodavirus strains propagated in cell culture. The two assays were compared with a previously established one-step RT-PCR assay and with the classical virus isolation test and found to be more sensitive. In conclusion, the developed real-time RT-PCR assays are a reliable, specific and sensitive tool for the quantitative diagnosis of betanodavirus.
NASA Astrophysics Data System (ADS)
Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen S.; Skov, Julia; Sun, Yi; Duong Bang, Dang; Pedersen, Michael E.; Hansen, Mikkel F.; Wolff, Anders
2013-07-01
We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence signal from Rhodamine B. The method was validated with the PCR amplification of mecA gene (162 bp) from methicillin-resistant Staphylococcus aureus bacterium (MRSA), where the time for 30 cycles was reduced from 50 min (without over- and undershooting) to 20 min.
Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase
McInerney, Peter; Adams, Paul; Hadi, Masood Z.
2014-01-01
As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less
NASA Astrophysics Data System (ADS)
Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich
2015-07-01
The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.
Conrad, Cheyenne C; Gilroyed, Brandon H; McAllister, Tim A; Reuter, Tim
2012-10-01
Non-O157 Shiga toxin producing Escherichia coli (STEC) are gaining recognition as human pathogens, but no standardized method exists to identify them. Sequence analysis revealed that STEC can be classified on the base of variable O antigen regions into different O serotypes. Polymerase chain reaction is a powerful technique for thorough screening and complex diagnosis for these pathogens, but requires a positive control to verify qualitative and/or quantitative DNA-fragment amplification. Due to the pathogenic nature of STEC, controls are not readily available and cell culturing of STEC reference strains requires biosafety conditions of level 2 or higher. In order to bypass this limitation, controls of stacked O-type specific DNA-fragments coding for primer recognition sites were designed to screen for nine STEC serotypes frequently associated with human infection. The synthetic controls were amplified by PCR, cloned into a plasmid vector and transferred into bacteria host cells. Plasmids amplified by bacterial expression were purified, serially diluted and tested as standards for real-time PCR using SYBR Green and TaqMan assays. Utility of synthetic DNA controls was demonstrated in conventional and real-time PCR assays and validated with DNA from natural STEC strains. Copyright © 2012 Elsevier B.V. All rights reserved.
Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar
An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less
Ruengsomwong, Supatjaree; Korenori, Yuki; Sakamoto, Naoshige; Wannissorn, Bhusita; Nakayama, Jiro; Nitisinprasert, Sunee
2014-08-01
The fecal microbiotas were investigated in 13 healthy Thai subjects using polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE). Among the 186 DNA bands detected on the polyacrylamide gel, 37 bands were identified as representing 11 species: Bacteroides thetaiotaomicron, Bacteroides ovatus, Bacteroides uniformis, Bacteroides vulgatus, Clostridium colicanis, Eubacterium eligenes, E. rectale, Faecalibacterium prausnitzii, Megamonas funiformis, Prevotella copri, and Roseburia intestinalis, belonging mainly to the groups of Bacteroides, Prevotella, Clostridium, and F. prausnitzii. A dendrogram of the PCR-DGGE divided the subjects; vegetarians and non-vegetarians. The fecal microbiotas were also analyzed using a quantitative real-time PCR focused on Bacteroides, Bifidobacterium, Enterobacteriaceae, Clostrium coccoides-Eubacterium rectale, C. leptum, Lactobacillus, and Prevotella. The nonvegetarian and vegetarian subjects were found to have significant differences in the high abundance of the Bacteroides and Prevotella genera, respectively. No significant differences were found in the counts of Bifidabacterium, Enterobacteriaceae, C. coccoides-E. rectale group, C. leptum group, and Lactobacillus. Therefore, these findings on the microbiota of healthy Thais consuming different diets could provide helpful data for predicting the health of South East Asians with similar diets.
Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan (trademark)) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glab...
A case of Pitt-Hopkins syndrome with absence of hyperventilation.
Inati, Adlette; Abbas, Hussein A; Korjian, Serge; Daaboul, Yazan; Harajeily, Mohamad; Saab, Raya
2013-12-01
Pitt-Hopkins syndrome is characterized by mental retardation, hyperventilation, and dysmorphic features due to TCF4 mutations. We report a case of Pitt-Hopkins syndrome in a 2½-year-old boy presenting with psychomotor retardation, recurrent respiratory tract infections, and dysmorphic features with absence of hyperventilation or other breathing abnormalities. Comparative genomic hybridization and quantitative real-time polymerase chain reaction were used to confirm TCF4 haploinsufficiency. Pitt-Hopkins syndrome is a rare debilitating disease that should be in the differential diagnosis of other neurodevelopmental disorders characterized by mental retardation and hypotonicity despite the absence of hyperapnea and seizures. Quantitative real-time polymerase chain reaction is another method to identify TCF4 and to confirm Pitt-Hopkins syndrome diagnosis.
Pan, Min; Han, Jin; Zhen, Li; Yang, Xin; Li, Ru; Liao, Can; Li, Dong-Zhi
2016-02-01
To assess the clinical value of prenatal diagnosis of fetuses with increased nuchal translucency (NT) using an approach based on quantitative fluorescent polymerase chain reaction (QF-PCR) and chromosomal microarray (CMA). From January 2013 to October 2014, we included 175 pregnancies with fetal NT ≥ 3.5mm at 11-13 weeks' gestation who received chorionic villus sampling. QF-PCR was first used to rapidly detect common aneuploidies. The cases with a normal QF-PCR result were analyzed by CMA. Of the 175 cases, common aneuploidies were detected by QF-PCR in 53 (30.2%) cases (30 cases of trisomy 21, 12 cases of monosomy X, 7 cases of trisomy 18, 3 cases of trisomy 13 and 1 case of 47, XXY). Among the 122 cases with a normal QF-PCR result, microarray detected additional pathogenic copy number variants (CNVs) in 5.7% (7/122) of cases. Four cases would have expected to be detectable by conventional karyotyping because of large deletions/duplications (>10 Mb), leaving three cases (2.5%; 3/118) with pathogenic CNVs only detectable by CMA. It is rational to use a diagnostic strategy in which CMA is preceded by the less expensive, rapid, QF-PCR to detect common aneuploidies. CMA allows detection of a number of pathogenic chromosomal aberrations in fetuses with a high NT. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
In real-time quantitative PCR studies using absolute plasmid DNA standards, a calibration curve is developed to estimate an unknown DNA concentration. However, potential differences in the amplification performance of plasmid DNA compared to genomic DNA standards are often ignore...
Adewale, B; Mafe, M A; Oyerinde, J P O
2005-01-01
Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.
Highly Reproducible Label Free Quantitative Proteomic Analysis of RNA Polymerase Complexes*
Mosley, Amber L.; Sardiu, Mihaela E.; Pattenden, Samantha G.; Workman, Jerry L.; Florens, Laurence; Washburn, Michael P.
2011-01-01
The use of quantitative proteomics methods to study protein complexes has the potential to provide in-depth information on the abundance of different protein components as well as their modification state in various cellular conditions. To interrogate protein complex quantitation using shotgun proteomic methods, we have focused on the analysis of protein complexes using label-free multidimensional protein identification technology and studied the reproducibility of biological replicates. For these studies, we focused on three highly related and essential multi-protein enzymes, RNA polymerase I, II, and III from Saccharomyces cerevisiae. We found that label-free quantitation using spectral counting is highly reproducible at the protein and peptide level when analyzing RNA polymerase I, II, and III. In addition, we show that peptide sampling does not follow a random sampling model, and we show the need for advanced computational models to predict peptide detection probabilities. In order to address these issues, we used the APEX protocol to model the expected peptide detectability based on whole cell lysate acquired using the same multidimensional protein identification technology analysis used for the protein complexes. Neither method was able to predict the peptide sampling levels that we observed using replicate multidimensional protein identification technology analyses. In addition to the analysis of the RNA polymerase complexes, our analysis provides quantitative information about several RNAP associated proteins including the RNAPII elongation factor complexes DSIF and TFIIF. Our data shows that DSIF and TFIIF are the most highly enriched RNAP accessory factors in Rpb3-TAP purifications and demonstrate our ability to measure low level associated protein abundance across biological replicates. In addition, our quantitative data supports a model in which DSIF and TFIIF interact with RNAPII in a dynamic fashion in agreement with previously published reports. PMID
NASA Astrophysics Data System (ADS)
Pérez Urquiza, M.; Acatzi Silva, A. I.
2014-02-01
Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.
Demeke, Tigst; Ratnayaka, Indira; Phan, Anh
2009-01-01
The quality of DNA affects the accuracy and repeatability of quantitative PCR results. Different DNA extraction and purification methods were compared for quantification of Roundup Ready (RR) soybean (event 40-3-2) by real-time PCR. DNA was extracted using cetylmethylammonium bromide (CTAB), DNeasy Plant Mini Kit, and Wizard Magnetic DNA purification system for food. CTAB-extracted DNA was also purified using the Zymo (DNA Clean & Concentrator 25 kit), Qtip 100 (Qiagen Genomic-Tip 100/G), and QIAEX II Gel Extraction Kit. The CTAB extraction method provided the largest amount of DNA, and the Zymo purification kit resulted in the highest percentage of DNA recovery. The Abs260/280 and Abs260/230 ratios were less than the expected values for some of the DNA extraction and purification methods used, indicating the presence of substances that could inhibit PCR reactions. Real-time quantitative PCR results were affected by the DNA extraction and purification methods used. Further purification or dilution of the CTAB DNA was required for successful quantification of RR soybean. Less variability of quantitative PCR results was observed among experiments and replications for DNA extracted and/or purified by CTAB, CTAB+Zymo, CTAB+Qtip 100, and DNeasy methods. Correct and repeatable results for real-time PCR quantification of RR soybean were achieved using CTAB DNA purified with Zymo and Qtip 100 methods.
EPA is currently considering a quantitative polymerase chain reaction (qPCR) method, targeting Enterococcus spp., for beach monitoring. Improvements in the method’s cost-effectiveness may be realized by the use of newer instrumentation such as the Applied Biosystems StepOneTM a...
Zhang, Fang; Wang, Liu; Fan, Kai; Wu, Jian; Ying, Yibin
2014-05-01
An isothermal cross-priming amplification (CPA) assay for Agrobacterium tumefaciens nopaline synthase terminator (T-Nos) was established and investigated in this work. A set of six specific primers, recognizing eight distinct regions on the T-Nos sequence, was designed. The CPA assay was performed at a constant temperature, 63 °C, and detected by real-time fluorescence. The results indicated that real-time fluorescent CPA had high specificity, and the limit of detection was 1.06 × 10(3) copies of rice genomic DNA, which could be detected in 40 min. Comparison of real-time fluorescent CPA and conventional polymerase chain reaction (PCR) was also performed. Results revealed that real-time fluorescent CPA had a comparable sensitivity to conventional real-time PCR and had taken a shorter time. In addition, different contents of genetically modified (GM)-contaminated rice seed powder samples were detected for practical application. The result showed real-time fluorescent CPA could detect 0.5 % GM-contaminated samples at least, and the whole reaction could be finished in 35 min. Real-time fluorescent CPA is sensitive enough to monitor labeling systems and provides an attractive method for the detection of GMO.
The U.S. Environmental Protection Agency (EPA) will be recommending a quantitative polymerase chain reaction (qPCR) method targeting Enterococcus spp. as an option for monitoring recreational beach water quality. A practical consideration for widespread implementation of this or ...
There are numerous quantitative real-time PCR (qPCR) methods available to detect and enumerate human fecal pollution in ambient waters. Each assay employs distinct primers and/or probes and many target different genes and microorganisms leading to potential variations in method ...
Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming
2013-07-01
Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.
Tsaloglou, M-N; Watson, R J; Rushworth, C M; Zhao, Y; Niu, X; Sutton, J M; Morgan, H
2015-01-07
Clostridium difficile is one of the key bacterial pathogens that cause infectious diarrhoea both in the developed and developing world. Isothermal nucleic acid amplification methods are increasingly used for identification of toxinogenic infection by clinical labs. For this purpose, we developed a low-cost microfluidic platform based on the SlipChip concept and implemented real-time isothermal recombinase polymerase amplification (RPA). The on-chip RPA assay targets the Clostridium difficile toxin B gene (tcdB) coding for toxin B, one of the proteins responsible for bacterial toxicity. The device was fabricated in clear acrylic using rapid prototyping methods. It has six replicate 500 nL reaction wells as well as two sets of 500 nL control wells. The reaction can be monitored in real-time using exonuclease fluorescent probes with an initial sample volume of as little as 6.4 μL. We demonstrated a limit of detection of 1000 DNA copies, corresponding to 1 fg, at a time-to-result of <20 minutes. This miniaturised platform for pathogen detection has potential for use in resource-limited environments or at the point-of-care because of its ease of use and low cost, particularly if combined with preserved reagents.
Cryptosporidium spp. and Toxoplasma gondii are important coccidian parasites that have caused waterborne and foodborne disease outbreaks worldwide. Techniques like subtractive hybridization, microarrays, and quantitative reverse transcriptase real-time polymerase chain reaction (...